Khan, Akib Mahmud; Shawon, Jakaria; Halim, Mohammad A
2017-10-01
A major limitation in current molecular docking method is that of failure to account for receptor flexibility. Herein we report multiple receptor conformers based molecular docking as a practical alternative to account for the receptor flexibility. Multiple (forty) conformers of Mycobacterium Enoyl ACP Reductase (InhA) are generated from Molecular Dynamics simulation and twenty crystallographic structures of InhA bound to different inhibitors are obtained from the Protein Data Bank. Fluorine directed modifications are performed to currently available anti-tuberculosis drug ethionamide. The modified drugs are optimized using B3LYP 6-31G (d,p) level of theory. Dipole moment, frontier orbital gap and thermodynamical properties such as electronic energy, enthalpy and Gibbs free energy of these optimized drugs are investigated. These drugs are subsequently docked against the conformers of InhA. Molecular docking against multiple InhA conformations show variation in ligand binding affinity and suggest that Ser94, Gly96, Lys165 and Ile194 amino acids play critical role on strong drug-InhA interaction. Modified drug N1 showed greater binding affinity compared to EN in most conformations. Structure of PDB ID: 2NSD and snapshot conformer at 5.5ns show most favorable binding with N1 compared to other conformers. Fluorine participates in forming fluorine bonds and contributes significantly in increasing binding affinity. Our study reveal that addition of trifluoromethyl group explicitly shows promise in improving thermodynamic properties and in enhancing hydrogen bonding and non-bonded interactions. Molecular dynamics (MD) simulation show that EN and N1 remained in the binding pocket similar to the docked pose of EN-InhA and E1-InhA complexes and also suggested that InhA binds to its inhibitor in inhibitor-induced folding manner. ADMET calculations predict modified drugs to have improved pharmacokinetic properties. Our study concludes that multiple receptor conformers based
Phosphorylation of InhA inhibits mycolic acid biosynthesis and growth of Mycobacterium tuberculosis
Energy Technology Data Exchange (ETDEWEB)
Molle, Virginie; Gulten, Gulcin; Vilchèze, Catherine; Veyron-Churlet, Romain; Zanella-Cléon, Isabelle; Sacchettini, James C.; Jacobs, Jr, William R.; Kremer, Laurent (CNRS-UMR); (Einstein); (TAM)
2011-08-24
The remarkable survival ability of Mycobacterium tuberculosis in infected hosts is related to the presence of cell wall-associated mycolic acids. Despite their importance, the mechanisms that modulate expression of these lipids in response to environmental changes are unknown. Here we demonstrate that the enoyl-ACP reductase activity of InhA, an essential enzyme of the mycolic acid biosynthetic pathway and the primary target of the anti-tubercular drug isoniazid, is controlled via phosphorylation. Thr-266 is the unique kinase phosphoacceptor, both in vitro and in vivo. The physiological relevance of Thr-266 phosphorylation was demonstrated using inhA phosphoablative (T266A) or phosphomimetic (T266D/E) mutants. Enoyl reductase activity was severely impaired in the mimetic mutants in vitro, as a consequence of a reduced binding affinity to NADH. Importantly, introduction of inhA{_}T266D/E failed to complement growth and mycolic acid defects of an inhA-thermosensitive Mycobacterium smegmatis strain, in a similar manner to what is observed following isoniazid treatment. This study suggests that phosphorylation of InhA may represent an unusual mechanism that allows M. tuberculosis to regulate its mycolic acid content, thus offering a new approach to future anti-tuberculosis drug development.
Phosphorylation of InhA inhibits mycolic acid biosynthesis and growth of Mycobacterium tuberculosis.
Molle, Virginie; Gulten, Gulcin; Vilchèze, Catherine; Veyron-Churlet, Romain; Zanella-Cléon, Isabelle; Sacchettini, James C; Jacobs, William R; Kremer, Laurent
2010-12-01
The remarkable survival ability of Mycobacterium tuberculosis in infected hosts is related to the presence of cell wall-associated mycolic acids. Despite their importance, the mechanisms that modulate expression of these lipids in response to environmental changes are unknown. Here we demonstrate that the enoyl-ACP reductase activity of InhA, an essential enzyme of the mycolic acid biosynthetic pathway and the primary target of the anti-tubercular drug isoniazid, is controlled via phosphorylation. Thr-266 is the unique kinase phosphoacceptor, both in vitro and in vivo. The physiological relevance of Thr-266 phosphorylation was demonstrated using inhA phosphoablative (T266A) or phosphomimetic (T266D/E) mutants. Enoyl reductase activity was severely impaired in the mimetic mutants in vitro, as a consequence of a reduced binding affinity to NADH. Importantly, introduction of inhA_T266D/E failed to complement growth and mycolic acid defects of an inhA-thermosensitive Mycobacterium smegmatis strain, in a similar manner to what is observed following isoniazid treatment. This study suggests that phosphorylation of InhA may represent an unusual mechanism that allows M. tuberculosis to regulate its mycolic acid content, thus offering a new approach to future anti-tuberculosis drug development. © 2010 Blackwell Publishing Ltd.
Shaw, Daniel J; Robb, Kirsty; Vetter, Beatrice V; Tong, Madeline; Molle, Virginie; Hunt, Neil T; Hoskisson, Paul A
2017-07-05
Tuberculosis (TB) is a global health problem that affects over 10 million people. There is an urgent need to develop novel antimicrobial therapies to combat TB. To achieve this, a thorough understanding of key validated drug targets is required. The enoyl reductase InhA, responsible for synthesis of essential mycolic acids in the mycobacterial cell wall, is the target for the frontline anti-TB drug isoniazid. To better understand the activity of this protein a series of mutants, targeted to the NADH co-factor binding pocket were created. Residues P193 and W222 comprise a series of hydrophobic residues surrounding the cofactor binding site and mutation of both residues negatively affect InhA function. Construction of an M155A mutant of InhA results in increased affinity for NADH and DD-CoA turnover but with a reduction in V max for DD-CoA, impairing overall activity. This suggests that NADH-binding geometry of InhA likely permits long-range interactions between residues in the NADH-binding pocket to facilitate substrate turnover in the DD-CoA binding region of the protein. Understanding the precise details of substrate binding and turnover in InhA and how this may affect protein-protein interactions may facilitate the development of improved inhibitors enabling the development of novel anti-TB drugs.
Soutter, Holly H; Centrella, Paolo; Clark, Matthew A; Cuozzo, John W; Dumelin, Christoph E; Guie, Marie-Aude; Habeshian, Sevan; Keefe, Anthony D; Kennedy, Kaitlyn M; Sigel, Eric A; Troast, Dawn M; Zhang, Ying; Ferguson, Andrew D; Davies, Gareth; Stead, Eleanor R; Breed, Jason; Madhavapeddi, Prashanti; Read, Jon A
2016-12-06
Millions of individuals are infected with and die from tuberculosis (TB) each year, and multidrug-resistant (MDR) strains of TB are increasingly prevalent. As such, there is an urgent need to identify novel drugs to treat TB infections. Current frontline therapies include the drug isoniazid, which inhibits the essential NADH-dependent enoyl-acyl-carrier protein (ACP) reductase, InhA. To inhibit InhA, isoniazid must be activated by the catalase-peroxidase KatG. Isoniazid resistance is linked primarily to mutations in the katG gene. Discovery of InhA inhibitors that do not require KatG activation is crucial to combat MDR TB. Multiple discovery efforts have been made against InhA in recent years. Until recently, despite achieving high potency against the enzyme, these efforts have been thwarted by lack of cellular activity. We describe here the use of DNA-encoded X-Chem (DEX) screening, combined with selection of appropriate physical properties, to identify multiple classes of InhA inhibitors with cell-based activity. The utilization of DEX screening allowed the interrogation of very large compound libraries (10 11 unique small molecules) against multiple forms of the InhA enzyme in a multiplexed format. Comparison of the enriched library members across various screening conditions allowed the identification of cofactor-specific inhibitors of InhA that do not require activation by KatG, many of which had bactericidal activity in cell-based assays.
Prati, Federica; Zuccotto, Fabio; Fletcher, Daniel; Convery, Maire A; Fernandez-Menendez, Raquel; Bates, Robert; Encinas, Lourdes; Zeng, Jingkun; Chung, Chun-Wa; De Dios Anton, Paco; Mendoza-Losana, Alfonso; Mackenzie, Claire; Green, Simon R; Huggett, Margaret; Barros, David; Wyatt, Paul G; Ray, Peter C
2018-04-06
Our findings reported herein provide support for the benefits of including functional group complexity (FGC) within fragments when screening against protein targets such as Mycobacterium tuberculosis InhA. We show that InhA fragment actives with FGC maintained their binding pose during elaboration. Furthermore, weak fragment hits with functional group handles also allowed for facile fragment elaboration to afford novel and potent InhA inhibitors with good ligand efficiency metrics for optimization. © 2018 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.
Antitubercular drugs for an old target: GSK693 as a promising InhA direct inhibitor
Directory of Open Access Journals (Sweden)
María Martínez-Hoyos
2016-06-01
Full Text Available Despite being one of the first antitubercular agents identified, isoniazid (INH is still the most prescribed drug for prophylaxis and tuberculosis (TB treatment and, together with rifampicin, the pillars of current chemotherapy. A high percentage of isoniazid resistance is linked to mutations in the pro-drug activating enzyme KatG, so the discovery of direct inhibitors (DI of the enoyl-ACP reductase (InhA has been pursued by many groups leading to the identification of different enzyme inhibitors, active against Mycobacterium tuberculosis (Mtb, but with poor physicochemical properties to be considered as preclinical candidates. Here, we present a series of InhA DI active against multidrug (MDR and extensively (XDR drug-resistant clinical isolates as well as in TB murine models when orally dosed that can be a promising foundation for a future treatment.
Directory of Open Access Journals (Sweden)
Devita Kusdianingrum
2014-10-01
Full Text Available ABSTRAK: Sekitar 8-20% isolate M. tuberculosis yang resisten terhadap isoniazid diketahui telah mengalami mutasi pada posisi regio promoter inhA [1]. Untuk memperoleh titik mutasi pada regio promoter, maka amplifikasi fragmen target perlu untuk dilakukan. Tujuan dilakukannya penelitian ini adalah untuk mengamplifikasi regio promoter inhA, mengetahui ada tidaknya mutasi dan jenis mutasi pada isolat 134 MDR-TB. Tahap isolasi DNA dilakukan menggunakan metode Boom yang telah dimodifikasi. Fragmen target diamplifikasi dengan teknik PCR menggunakan sepasang primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ dan reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’. Amplikon disekuensing secara satu arah menggunakan forward primer. Analisis homologi dilakukan menggunakan program online BLASTn, sementara identifikasi mutasi dilakukan menggunakan software MEGA4. Hasil penelitian menunjukkan bahwa analisis homologi isolate 134 terhadap M. tuberculosis H37Rv adalah sebesar 99%. Tahap analisis mutasi menemukan terjadinya perubahan sitosin menjadi timin (CàT pada posisi -15 isolat 134 MDR-TB ABSTRACT: Approximately 8-20% M. tuberculosis isolates that are resistant to isoniazid habe been known to have a mutation in inhA promoter region [1]. To find the mutation in inhA promoter region, it is necessary to carry out the amplification of the target fragment. The purpose of this research were to amplify the inhA promoter region and to find out if there is a mutation and type of mutation at MDR-TB isolate. DNA isolation was done by a modified Boom method. Target fragment was amplified by a pair primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ and reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’ using Polymerase Chain Reaction (PCR technique. Amplicon was sequenced in one forward direction. Homology analysis was conducted by online BLASTn program, while the mutation was identified by MEGA4. The result of this research showed that homology analysis of 134 was homolog
Directory of Open Access Journals (Sweden)
Suffys Philip N
2009-02-01
Full Text Available Abstract Background Mutations associated with resistance to rifampin or streptomycin have been reported for W/Beijing and Latin American Mediterranean (LAM strain families of Mycobacterium tuberculosis. A few studies with limited sample sizes have separately evaluated mutations in katG, ahpC and inhA genes that are associated with isoniazid (INH resistance. Increasing prevalence of INH resistance, especially in high tuberculosis (TB prevalent countries is worsening the burden of TB control programs, since similar transmission rates are noted for INH susceptible and resistant M. tuberculosis strains. Results We, therefore, conducted a comprehensive evaluation of INH resistant M. tuberculosis strains (n = 224 from three South American countries with high burden of drug resistant TB to characterize mutations in katG, ahpC and inhA gene loci and correlate with minimal inhibitory concentrations (MIC levels and spoligotype strain family. Mutations in katG were observed in 181 (80.8% of the isolates of which 178 (98.3% was contributed by the katG S315T mutation. Additional mutations seen included oxyR-ahpC; inhA regulatory region and inhA structural gene. The S315T katG mutation was significantly more likely to be associated with MIC for INH ≥2 μg/mL. The S315T katG mutation was also more frequent in Haarlem family strains than LAM (n = 81 and T strain families. Conclusion Our data suggests that genetic screening for the S315T katG mutation may provide rapid information for anti-TB regimen selection, epidemiological monitoring of INH resistance and, possibly, to track transmission of INH resistant strains.
Encinas, Lourdes; O'Keefe, Heather; Neu, Margarete; Remuiñán, Modesto J; Patel, Amish M; Guardia, Ana; Davie, Christopher P; Pérez-Macías, Natalia; Yang, Hongfang; Convery, Maire A; Messer, Jeff A; Pérez-Herrán, Esther; Centrella, Paolo A; Alvarez-Gómez, Daniel; Clark, Matthew A; Huss, Sophie; O'Donovan, Gary K; Ortega-Muro, Fátima; McDowell, William; Castañeda, Pablo; Arico-Muendel, Christopher C; Pajk, Stane; Rullás, Joaquín; Angulo-Barturen, Iñigo; Alvarez-Ruíz, Emilio; Mendoza-Losana, Alfonso; Ballell Pages, Lluís; Castro-Pichel, Julia; Evindar, Ghotas
2014-02-27
Tuberculosis (TB) is one of the world's oldest and deadliest diseases, killing a person every 20 s. InhA, the enoyl-ACP reductase from Mycobacterium tuberculosis, is the target of the frontline antitubercular drug isoniazid (INH). Compounds that directly target InhA and do not require activation by mycobacterial catalase peroxidase KatG are promising candidates for treating infections caused by INH resistant strains. The application of the encoded library technology (ELT) to the discovery of direct InhA inhibitors yielded compound 7 endowed with good enzymatic potency but with low antitubercular potency. This work reports the hit identification, the selected strategy for potency optimization, the structure-activity relationships of a hundred analogues synthesized, and the results of the in vivo efficacy studies performed with the lead compound 65.
Directory of Open Access Journals (Sweden)
Luk Ketut Budi Maitriani
2015-10-01
Full Text Available ABSTRAK : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb. ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is
Aguda, Adeleke H; Lavallee, Vincent; Cheng, Ping; Bott, Tina M; Meimetis, Labros G; Law, Simon; Nguyen, Nham T; Williams, David E; Kaleta, Jadwiga; Villanueva, Ivan; Davies, Julian; Andersen, Raymond J; Brayer, Gary D; Brömme, Dieter
2016-08-26
Natural products are an important source of novel drug scaffolds. The highly variable and unpredictable timelines associated with isolating novel compounds and elucidating their structures have led to the demise of exploring natural product extract libraries in drug discovery programs. Here we introduce affinity crystallography as a new methodology that significantly shortens the time of the hit to active structure cycle in bioactive natural product discovery research. This affinity crystallography approach is illustrated by using semipure fractions of an actinomycetes culture extract to isolate and identify a cathepsin K inhibitor and to compare the outcome with the traditional assay-guided purification/structural analysis approach. The traditional approach resulted in the identification of the known inhibitor antipain (1) and its new but lower potency dehydration product 2, while the affinity crystallography approach led to the identification of a new high-affinity inhibitor named lichostatinal (3). The structure and potency of lichostatinal (3) was verified by total synthesis and kinetic characterization. To the best of our knowledge, this is the first example of isolating and characterizing a potent enzyme inhibitor from a partially purified crude natural product extract using a protein crystallographic approach.
Shaw, Daniel J.; Robb, Kirsty; Vetter, Beatrice V.; Tong, Madeline; Molle, Virginie; Hunt, Neil T.; Hoskisson, Paul A.
2017-01-01
Tuberculosis (TB) is a global health problem that affects over 10 million people. There is an urgent need to develop novel antimicrobial therapies to combat TB. To achieve this, a thorough understanding of key validated drug targets is required. The enoyl reductase InhA, responsible for synthesis of essential mycolic acids in the mycobacterial cell wall, is the target for the frontline anti-TB drug isoniazid. To better understand the activity of this protein a series of mutants, targeted to t...
Quantifying high-affinity binding of hydrophobic ligands by isothermal titration calorimetry.
Krainer, Georg; Broecker, Jana; Vargas, Carolyn; Fanghänel, Jörg; Keller, Sandro
2012-12-18
A fast and reliable quantification of the binding thermodynamics of hydrophobic high-affinity ligands employing a new calorimetric competition experiment is described. Although isothermal titration calorimetry is the method of choice for a quantitative characterization of intermolecular interactions in solution, a reliable determination of a dissociation constant (K(D)) is typically limited to the range 100 μM > K(D) > 1 nM. Interactions displaying higher or lower K(D) values can be assessed indirectly, provided that a suitable competing ligand is available whose K(D) falls within the directly accessible affinity window. This established displacement assay, however, requires the high-affinity ligand to be soluble at high concentrations in aqueous buffer and, consequently, poses serious problems in the study of protein binding involving small-molecule ligands dissolved in organic solvents--a familiar case in many drug-discovery projects relying on compound libraries. The calorimetric competition assay introduced here overcomes this limitation, thus allowing for a detailed thermodynamic description of high-affinity receptor-ligand interactions involving poorly water-soluble compounds. Based on a single titration of receptor into a dilute mixture of the two competing ligands, this competition assay provides accurate and precise values for the dissociation constants and binding enthalpies of both high- and moderate-affinity ligands. We discuss the theoretical background underlying the approach, demonstrate its practical application to metal ion chelation and high-affinity protein-inhibitor interactions, and explore its potential and limitations with the aid of simulations and statistical analyses.
High affinity hemoglobin and Parkinson's disease.
Graham, Jeffrey; Hobson, Douglas; Ponnampalam, Arjuna
2014-12-01
Parkinson's disease (PD) is a neurodegenerative disorder characterized by the loss of dopaminergic neurons in the substantia nigra (SN) region of the midbrain. Oxidative damage in this region has been shown to play an important role in the pathogenesis of this disease. Human neurons have been discovered to contain hemoglobin, with an increased concentration seen in the neurons of the SN. High affinity hemoglobin is a clinical entity resulting from mutations that create a functional increase in the binding of hemoglobin to oxygen and an inability to efficiently unload it to tissues. This can result in a number of metabolic compensatory changes, including an elevation in circulating hemoglobin and an increase in the molecule 2,3-diphosphoglycerate (2,3-DPG). Population based studies have revealed that patients with PD have elevated hemoglobin as well as 2,3-DPG levels. Based on these observations, we hypothesize that the oxidative damage seen in PD is related to an underlying high affinity hemoglobin subtype. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Johan Nilvebrant
Full Text Available The epidermal growth factor receptor 2, ERBB2, is a well-validated target for cancer diagnostics and therapy. Recent studies suggest that the over-expression of this receptor in various cancers might also be exploited for antibody-based payload delivery, e.g. antibody drug conjugates. In such strategies, the full-length antibody format is probably not required for therapeutic effect and smaller tumor-specific affinity proteins might be an alternative. However, small proteins and peptides generally suffer from fast excretion through the kidneys, and thereby require frequent administration in order to maintain a therapeutic concentration. In an attempt aimed at combining ERBB2-targeting with antibody-like pharmacokinetic properties in a small protein format, we have engineered bispecific ERBB2-binding proteins that are based on a small albumin-binding domain. Phage display selection against ERBB2 was used for identification of a lead candidate, followed by affinity maturation using second-generation libraries. Cell surface display and flow-cytometric sorting allowed stringent selection of top candidates from pools pre-enriched by phage display. Several affinity-matured molecules were shown to bind human ERBB2 with sub-nanomolar affinity while retaining the interaction with human serum albumin. Moreover, parallel selections against ERBB2 in the presence of human serum albumin identified several amino acid substitutions that dramatically modulate the albumin affinity, which could provide a convenient means to control the pharmacokinetics. The new affinity proteins competed for ERBB2-binding with the monoclonal antibody trastuzumab and recognized the native receptor on a human cancer cell line. Hence, high affinity tumor targeting and tunable albumin binding were combined in one small adaptable protein.
High-throughput fragment screening by affinity LC-MS.
Duong-Thi, Minh-Dao; Bergström, Maria; Fex, Tomas; Isaksson, Roland; Ohlson, Sten
2013-02-01
Fragment screening, an emerging approach for hit finding in drug discovery, has recently been proven effective by its first approved drug, vemurafenib, for cancer treatment. Techniques such as nuclear magnetic resonance, surface plasmon resonance, and isothemal titration calorimetry, with their own pros and cons, have been employed for screening fragment libraries. As an alternative approach, screening based on high-performance liquid chromatography separation has been developed. In this work, we present weak affinity LC/MS as a method to screen fragments under high-throughput conditions. Affinity-based capillary columns with immobilized thrombin were used to screen a collection of 590 compounds from a fragment library. The collection was divided into 11 mixtures (each containing 35 to 65 fragments) and screened by MS detection. The primary screening was performed in 3500 fragments per day). Thirty hits were defined, which subsequently entered a secondary screening using an active site-blocked thrombin column for confirmation of specificity. One hit showed selective binding to thrombin with an estimated dissociation constant (K (D)) in the 0.1 mM range. This study shows that affinity LC/MS is characterized by high throughput, ease of operation, and low consumption of target and fragments, and therefore it promises to be a valuable method for fragment screening.
Directory of Open Access Journals (Sweden)
F Dabboussi
2015-01-01
Conclusions: This study showed that the pyrosequencing applied to katG, inhA promoter and ahpC-oxyR intergenic region was able to detect a relatively large proportion of Syrian INH-resistant MTB isolates (80.7% in Syria. This strategy may be inappropriate for Lebanese strains, as the genetic mechanisms of resistance remain unidentified for approximately half of the isolates, so it is quite possible to detect the presence of other mechanisms of resistance.
Proadifen-sensitive high affinity binding of 3H-alaproclate to liver membranes
International Nuclear Information System (INIS)
Ross, S.B.
1987-01-01
3 H-alaproclate, a selective 5 h ydroxytryptamine uptake inhibitor, was found to bind to microsomal membranes from the rat liver with high affinity (K D -=3 nM) and large capacity (B max about 2 nmol/g liver). This binding was stereoselective since S-( - )-alaproclate was 30 times more potent than the R-( + )-enantiomer to displace the 3 H-labelled racemate. Proadifen (SKF 525A), an inhibitor of cytochrome P-450, displaced the 3 H-alaproclate binding with the same, high affinity (K i =3 nM) as alaproclate itself. Repeated treatment with phenobarbital sodium (5x75 mg/kg intraperitoneally) increased the number of alaproclate binding sites 7-8 times without changing the affinity. However, most of the phenobarbital induced 3 H-alaproclate binding was not displaceable by proadifen, showing the presence of at least two different high affinity binding sites. The possible involvement of cytochrome P-450 in the alaproclate binding is discussed. (author)
Structure of Greyhound hemoglobin: origin of high oxygen affinity.
Bhatt, Veer S; Zaldívar-López, Sara; Harris, David R; Couto, C Guillermo; Wang, Peng G; Palmer, Andre F
2011-05-01
This study presents the crystal structure of Greyhound hemoglobin (GrHb) determined to 1.9 Å resolution. GrHb was found to crystallize with an α₁β₁ dimer in the asymmetric unit and belongs to the R2 state. Oxygen-affinity measurements combined with the fact that GrHb crystallizes in the R2 state despite the high-salt conditions used for crystallization strongly indicate that GrHb can serve as a model high-oxygen-affinity hemoglobin (Hb) for higher mammals, especially humans. Structural analysis of GrHb and its comparison with the R2-state of human Hb revealed several regions that can potentially contribute to the high oxygen affinity of GrHb and serve to rationalize the additional stability of the R2-state of GrHb. A previously well studied hydrophobic cluster of bar-headed goose Hb near α119 was also incorporated in the comparison between GrHb and human Hb. Finally, a structural comparison with generic dog Hb and maned wolf Hb was conducted, revealing that in contrast to GrHb these structures belong to the R state of Hb and raising the intriguing possibility of an additional allosteric factor co-purifying with GrHb that can modulate its quaternary structure.
Reconstitution of high-affinity opioid agonist binding in brain membranes
Energy Technology Data Exchange (ETDEWEB)
Remmers, A.E.; Medzihradsky, F. (Univ. of Michigan Medical School, Ann Arbor (United States))
1991-03-15
In synaptosomal membranes from rat brain cortex, the {mu} selective agonist ({sup 3}H)dihydromorphine in the absence of sodium, and the nonselective antagonist ({sup 3}H)naltrexone in the presence of sodium, bound to two populations of opioid receptor sites with K{sub d} values of 0.69 and 8.7 nM for dihydromorphine, and 0.34 and 5.5 nM for naltrexone. The addition of 5 {mu}M guanosine 5{prime}-({gamma}-thio)triphosphate (GTP({gamma}S)) strongly reduced high-affinity agonist but not antagonist binding. Exposure of the membranes to high pH reduced the number of GTP({gamma}-{sup 35}S) binding sites by 90% and low K{sub m}, opioid-sensitive GTPase activity by 95%. In these membranes, high-affinity agonist binding was abolished and modulation of residual binding by GTP({gamma}S) was diminished. Alkali treatment of the glioma cell membranes prior to fusion inhibited most of the low K{sub m} GTPase activity and prevented the reconstitution of agonist binding. The results show that high-affinity opioid agonist binding reflects the ligand-occupied receptor - guanine nucleotide binding protein complex.
Haemoglobin Pierre-Benite--a high affinity variant associated with relative polycythaemia.
Beard, M E; Potter, H C; Spearing, R L; Brennan, S O
2001-12-01
This is the second reported example of Hb Pierre--Benite (beta90 Glu-->Asp). This mutation is associated with increased oxygen affinity and polycythaemia. No instability was found and there was no charge shift detected by cellulose acetate electrophoresis at pH 8.3. The mutation was however, clearly indicated by electrospray ionization mass spectrometry (ESI MS), which showed an abnormal beta chain with a 14 Da decrease in mass. Blood volume studies documented a relative rather than a true polycythaemia and this finding has been reported in at least two other high affinity haemoglobin variants--Hb Heathrow and Hb Rahere. This finding led to delay in diagnosis because high oxygen affinity variants are conventionally considered to cause a true polycythaemia.
High affinity binding of [3H]cocaine to rat liver microsomes
International Nuclear Information System (INIS)
El-Maghrabi, E.A.; Calligaro, D.O.; Eldefrawi, M.E.
1988-01-01
] 3 H]cocaine bound reversible, with high affinity and stereospecificity to rat liver microsomes. Little binding was detected in the lysosomal, mitochondrial and nuclear fractions. The binding kinetics were slow and the kinetically calculated K/sub D/ was 2 nM. Induction of mixed function oxidases by phenobarbital did not produce significant change in [ 3 H]cocaine binding. On the other hand, chronic administration of cocaine reduced [ 3 H]cocaine binding drastically. Neither treatment affected the affinity of the liver binding protein for cocaine. Microsomes from mouse and human livers had less cocaine-binding protein and lower affinity for cocaine than those from rat liver. Binding of [ 3 H]cocaine to rat liver microsomes was insensitive to monovalent cations and > 10 fold less sensitive to biogenic amines than the cocaine receptor in rat striatum. However, the liver protein had higher affinity for cocaine and metabolites except for norcocaine. Amine uptake inhibitors displaced [ 3 H]cocaine binding to liver with a different rank order of potency than their displacement of [ 3 H]cocaine binding to striatum. This high affinity [ 3 H]cocaine binding protein in liver is not likely to be monooxygenase, but may have a role in cocaine-induced hepatotoxicity
Proadifen-sensitive high affinity binding of /sup 3/H-alaproclate to liver membranes
Energy Technology Data Exchange (ETDEWEB)
Ross, S.B.
1987-01-01
/sup 3/H-alaproclate, a selective 5/sub h/ydroxytryptamine uptake inhibitor, was found to bind to microsomal membranes from the rat liver with high affinity (K/sub D/-=3 nM) and large capacity (B/sub max/ about 2 nmol/g liver). This binding was stereoselective since S-( - )-alaproclate was 30 times more potent than the R-( + )-enantiomer to displace the /sup 3/H-labelled racemate. Proadifen (SKF 525A), an inhibitor of cytochrome P-450, displaced the /sup 3/H-alaproclate binding with the same, high affinity (K/sub i/=3 nM) as alaproclate itself. Repeated treatment with phenobarbital sodium (5x75 mg/kg intraperitoneally) increased the number of alaproclate binding sites 7-8 times without changing the affinity. However, most of the phenobarbital induced /sup 3/H-alaproclate binding was not displaceable by proadifen, showing the presence of at least two different high affinity binding sites. The possible involvement of cytochrome P-450 in the alaproclate binding is discussed.
Directory of Open Access Journals (Sweden)
Fabian König
Full Text Available The monoclonal antibody S9.6 is a widely-used tool to purify, analyse and quantify R-loop structures in cells. A previous study using the surface plasmon resonance technology and a single-chain variable fragment (scFv of S9.6 showed high affinity (0.6 nM for DNA-RNA and also a high affinity (2.7 nM for RNA-RNA hybrids. We used the microscale thermophoresis method allowing surface independent interaction studies and electromobility shift assays to evaluate additional RNA-DNA hybrid sequences and to quantify the binding affinities of the S9.6 antibody with respect to distinct sequences and their GC-content. Our results confirm high affinity binding to previously analysed sequences, but reveals that binding affinities are highly sequence specific. Our study presents R-loop sequences that independent of GC-content and in different sequence variations exhibit either no binding, binding affinities in the micromolar range and as well high affinity binding in the nanomolar range. Our study questions the usefulness of the S9.6 antibody in the quantitative analysis of R-loop sequences in vivo.
The role of CH/π interactions in the high affinity binding of streptavidin and biotin.
Ozawa, Motoyasu; Ozawa, Tomonaga; Nishio, Motohiro; Ueda, Kazuyoshi
2017-08-01
The streptavidin-biotin complex has an extraordinarily high affinity (Ka: 10 15 mol -1 ) and contains one of the strongest non-covalent interactions known. This strong interaction is widely used in biological tools, including for affinity tags, detection, and immobilization of proteins. Although hydrogen bond networks and hydrophobic interactions have been proposed to explain this high affinity, the reasons for it remain poorly understood. Inspired by the deceased affinity of biotin observed for point mutations of streptavidin at tryptophan residues, we hypothesized that a CH/π interaction may also contribute to the strong interaction between streptavidin and biotin. CH/π interactions were explored and analyzed at the biotin-binding site and at the interface of the subunits by the fragment molecular orbital method (FMO) and extended applications: PIEDA and FMO4. The results show that CH/π interactions are involved in the high affinity for biotin at the binding site of streptavidin. We further suggest that the involvement of CH/π interactions at the subunit interfaces and an extended CH/π network play more critical roles in determining the high affinity, rather than involvement at the binding site. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Escandon, E.; Chao, M.V.
1990-01-01
In order to study regulation of the nerve growth factor (NGF) receptor during embryogenesis in chick brain, we have used affinity crosslinking of tissues with 125 I-NGF. NGF interacts with high- and low-affinity receptors; high-affinity receptors are required for the majority of NGF's actions. Most measurements of receptor levels do not distinguish between high- and low-affinity forms of the receptor. We have used the lipophilic crosslinking agent HSAB to identify the high-affinity, functional receptor during development of the chicken central nervous system. A peak of expression during Embryonic Days 5-10 was detected in all regions of the chicken central nervous system, but, shortly after birth, only the cerebellar region displays significant levels of NGF receptor protein. The time course of expression confirms the dramatic regulation of the NGF receptor gene during defined embryonic periods. The detection of high-affinity NGF receptors in brain and neural retina provides strong evidence that NGF is involved in essential ontogenetic events in the development of the chicken central nervous system
High affinity calmodulin target sequence in the signalling molecule PI 3-kinase
DEFF Research Database (Denmark)
Fischer, R; Julsgart, J; Berchtold, M W
1998-01-01
M-binding peptide derived from the p110gamma isoform interacts with CaM in a calcium-dependent way. Using gel shift analysis and fluorescence spectrophotometry we discovered that the peptide forms a high affinity complex with CaM. Titration experiments using dansylated CaM gave an affinity constant of 5 n...
Molecular basis of a high affinity murine interleukin-5 receptor.
Devos, R; Plaetinck, G; Van der Heyden, J; Cornelis, S; Vandekerckhove, J; Fiers, W; Tavernier, J
1991-01-01
The mouse interleukin-5 receptor (mIL-5R) consists of two components one of which, the mIL-5R alpha-chain, binds mIL-5 with low affinity. Recently we demonstrated that monoclonal antibodies (Mabs) recognizing the second mIL-5R beta-chain, immunoprecipitate a p130-140 protein doublet which corresponds to the mIL-3R and the mIL-3R-like protein, the latter chain for which so far no ligand has been identified. In this study we show that a high affinity mIL-5R can be reconstituted on COS1 cells by...
Krainer, Georg; Keller, Sandro
2015-04-01
Isothermal titration calorimetry (ITC) is the gold standard for dissecting the thermodynamics of a biomolecular binding process within a single experiment. However, reliable determination of the dissociation constant (KD) from a single titration is typically limited to the range 100 μM>KD>1 nM. Interactions characterized by a lower KD can be assessed indirectly by so-called competition or displacement assays, provided that a suitable competitive ligand is available whose KD falls within the directly accessible window. However, this protocol is limited by the fact that it necessitates at least two titrations to characterize one high-affinity inhibitor, resulting in considerable consumption of both sample material and time. Here, we introduce a fast and efficient ITC displacement assay that allows for the simultaneous characterization of both a high-affinity ligand and a moderate-affinity ligand competing for the same binding site on a receptor within a single experiment. The protocol is based on a titration of the high-affinity ligand into a solution containing the moderate-affinity ligand bound to the receptor present in excess. The resulting biphasic binding isotherm enables accurate and precise determination of KD values and binding enthalpies (ΔH) of both ligands. We discuss the theoretical background underlying the approach, demonstrate its practical application to metal ion chelation, explore its potential and limitations with the aid of simulations and statistical analyses, and elaborate on potential applications to protein-inhibitor interactions. Copyright © 2014 Elsevier Inc. All rights reserved.
Selective induction of high-ouabain-affinity isoform of Na+-K+-ATPase by thyroid hormone
International Nuclear Information System (INIS)
Haber, R.S.; Loeb, J.N.
1988-01-01
The administration of thyroid hormone is known to result in an induction of the Na + -K + -adenosinetriphosphatase (Na + -K + -ATPase) in rat skeletal muscle and other thyroid hormone-responsive tissues. Since the Na + -K + -ATPase in a variety of mammalian tissues has recently been reported to exist in at least two forms distinguishable by differing affinities for the inhibitory cardiac glycoside ouabain. The authors have studied the effects of 3,3',5-triiodo-L-thyronine (T 3 ) treatment on these two forms of the enzyme in rat diaphragm. The inhibition of Na + -K + -ATPase activity in a crude membrane fraction by varying concentrations of ouabain conformed to a biphasic pattern consistent with the presence of two distinct isoforms with inhibition constants (K I s) for ouabain of ∼10 -7 and 10 -4 M, respectively. Measurement of the specific binding of [ 3 H]ouabain to these membranes confirmed the presence of a class of high-affinity ouabain binding sites with a dissociation constant (K d ) of slightly less than 10 -7 M, whose maximal binding capacity was increased by T 3 treatment by 185%. Binding studies in unfractionated homogenates of diaphragm similarly demonstrated the presence of high-affinity sites whose maximal binding capacity was increased by T 3 treatment. Quantitation of both the high- and low-ouabain-affinity forms of the Na + -K + -ATPase by ouabain-dependent phosphorylation from [ 32 P]orthophosphate confirmed that T 3 treatment markedly increased the number of high-affinity sites while having little effect on the number of low-affinity sites. These observations provide, to our knowledge, the first demonstration that these two forms of the Na + -K + -ATPase are subject to selective hormonal induction
Institute of Scientific and Technical Information of China (English)
无
2001-01-01
A new approach for the separation of antithrombin III with high performance affinity chromatography (HPAC) was described. A novel monodisperse,non-porous,cross-linked poly (glycidyl methacrylate) beads (PGMA) were used as the affinity support. With the water-soluble carbodiimide,heparin was linked covalently to amino-PGMA-beads,which was prepared by amination of PGMA. The adsorbent obtained exhibits high binding activity to antithrombin III (ATIII),good resolution and excellent mechanical properties and can be used under high flow rate.
Robotic high-throughput purification of affinity-tagged recombinant proteins.
Wiesler, Simone C; Weinzierl, Robert O J
2015-01-01
Affinity purification of recombinant proteins has become the method of choice to obtain good quantities and qualities of proteins for a variety of downstream biochemical applications. While manual or FPLC-assisted purification techniques are generally time-consuming and labor-intensive, the advent of high-throughput technologies and liquid handling robotics has simplified and accelerated this process significantly. Additionally, without the human factor as a potential source of error, automated purification protocols allow for the generation of large numbers of proteins simultaneously and under directly comparable conditions. The delivered material is ideal for activity comparisons of different variants of the same protein. Here, we present our strategy for the simultaneous purification of up to 24 affinity-tagged proteins for activity measurements in biochemical assays. The protocol described is suitable for the scale typically required in individual research laboratories.
DEFF Research Database (Denmark)
Vorum, H; Pedersen, A O; Honoré, B
1992-01-01
Binding equilibria for decanoate to a defatted, commercially available human serum albumin preparation were investigated by dialysis exchange rate determinations. The binding isotherm could not be fitted by the general binding equation. It was necessary to assume that the preparation was a mixture...... of two albumin components about 40% of the albumin having high affinity and about 60% having low affinity. By affinity chromatography we succeeded in purifying the low-affinity component from the mixture. The high-affinity component, however, could not be isolated. We further analyzed the fatty acid...... and drug binding abilities of the low-affinity component. The fatty acids decanoate, laurate, myristate and palmitate were bound with higher affinity to the mixture than to the low-affinity component. Diazepam was bound with nearly the same affinity to the low-affinity component as to the albumin mixture...
Characteristics of high affinity and low affinity adenosine binding sites in human cerebral cortex
International Nuclear Information System (INIS)
John, D.; Fox, I.V.
1986-01-01
The binding characteristics of human brain cortical membrane fractions were evaluated to test the hypothesis that there are A 1 and A 2 adenosine binding sites. The ligands used were 2-chloro(8- 3 H) adenosine and N 6 -(adenine-2, 8- 3 H) cyclohexayladenosine. Binding of chloroadenosine to human brain cortical membranes was time dependent, reversible and concentration dependent. The kinetic constant determinations from binding studies of the adenosine receptor are presented. Utilizing tritium-cyclohexyladenosine as ligand the authors observed evidence for a high affinity binding site in human brain cortical membranes with a kd of 5 nM
Characterization of high-affinity (/sup 3/H)ouabain binding in the rat central nervous system
Energy Technology Data Exchange (ETDEWEB)
Hauger, R.; Luu, H.M.; Meyer, D.K.; Goodwin, F.K.; Paul, S.M.
1985-06-01
The characteristics of (/sup 3/H)ouabain binding were examined in various areas of rat brain. In the striatum, Scatchard analysis revealed a single class of high-affinity binding sites with an apparent binding affinity (KD) of 10.4 +/- 0.9 nM and an estimated binding capacity (Bmax) of 7.6 +/- 1.9 pmol/mg protein. Similar monophasic Scatchard plots were found in the brainstem, cerebellum, hypothalamus, and frontal cerebral cortex. (/sup 3/H)Ouabain binding to rat brain was sodium- and ATP-dependent and strongly inhibited by potassium. Proscillariden A was the most potent cardiac glycoside tested in inhibiting specific (/sup 3/H)ouabain binding to brain membranes, and the rank order of inhibitory potencies for a series of cardiac glycosides was similar to that previously reported for inhibition of heart Na,K-ATPase. To assess whether the high-affinity binding sites for (/sup 3/H)ouabain were localized to neuronal or nonneuronal membranes, the effect of discrete kainic acid lesions on striatal (/sup 3/H)ouabain binding was examined. Kainic acid lesions of the striatum reduced (/sup 3/H)ouabain binding to striatal homogenates by 79.6 +/- 1.6%. This suggests that the high-affinity (/sup 3/H)ouabain binding sites measured in our experiments are localized to neuronal elements. Thus, the high-affinity binding of (/sup 3/H)ouabain to brain membranes may selectively label a neuronal form or conformation of Na,K-ATPase.
Selective high-affinity polydentate ligands and methods of making such
Energy Technology Data Exchange (ETDEWEB)
Denardo, Sally J.; Denardo, Gerald L.; Balhorn, Rodney L.
2018-02-06
This invention provides novel polydentate selective high affinity ligands (SHALs) that can be used in a variety of applications in a manner analogous to the use of antibodies. SHALs typically comprise a multiplicity of ligands that each bind different region son the target molecule. The ligands are joined directly or through a linker thereby forming a polydentate moiety that typically binds the target molecule with high selectivity and avidity.
High-aluminum-affinity silica is a nanoparticle that seeds secondary aluminosilicate formation.
Directory of Open Access Journals (Sweden)
Ravin Jugdaohsingh
Full Text Available Despite the importance and abundance of aluminosilicates throughout our natural surroundings, their formation at neutral pH is, surprisingly, a matter of considerable debate. From our experiments in dilute aluminum and silica containing solutions (pH ~ 7 we previously identified a silica polymer with an extraordinarily high affinity for aluminium ions (high-aluminum-affinity silica polymer, HSP. Here, further characterization shows that HSP is a colloid of approximately 2.4 nm in diameter with a mean specific surface area of about 1,000 m(2 g(-1 and it competes effectively with transferrin for Al(III binding. Aluminum binding to HSP strongly inhibited its decomposition whilst the reaction rate constant for the formation of the β-silicomolybdic acid complex indicated a diameter between 3.6 and 4.1 nm for these aluminum-containing nanoparticles. Similarly, high resolution microscopic analysis of the air dried aluminum-containing silica colloid solution revealed 3.9 ± 1.3 nm sized crystalline Al-rich silica nanoparticles (ASP with an estimated Al:Si ratio of between 2 and 3 which is close to the range of secondary aluminosilicates such as imogolite. Thus the high-aluminum-affinity silica polymer is a nanoparticle that seeds early aluminosilicate formation through highly competitive binding of Al(III ions. In niche environments, especially in vivo, this may serve as an alternative mechanism to polyhydroxy Al(III species binding monomeric silica to form early phase, non-toxic aluminosilicates.
High-Aluminum-Affinity Silica Is a Nanoparticle That Seeds Secondary Aluminosilicate Formation
Jugdaohsingh, Ravin; Brown, Andy; Dietzel, Martin; Powell, Jonathan J.
2013-01-01
Despite the importance and abundance of aluminosilicates throughout our natural surroundings, their formation at neutral pH is, surprisingly, a matter of considerable debate. From our experiments in dilute aluminum and silica containing solutions (pH ~ 7) we previously identified a silica polymer with an extraordinarily high affinity for aluminium ions (high-aluminum-affinity silica polymer, HSP). Here, further characterization shows that HSP is a colloid of approximately 2.4 nm in diameter with a mean specific surface area of about 1,000 m2 g-1 and it competes effectively with transferrin for Al(III) binding. Aluminum binding to HSP strongly inhibited its decomposition whilst the reaction rate constant for the formation of the β-silicomolybdic acid complex indicated a diameter between 3.6 and 4.1 nm for these aluminum-containing nanoparticles. Similarly, high resolution microscopic analysis of the air dried aluminum-containing silica colloid solution revealed 3.9 ± 1.3 nm sized crystalline Al-rich silica nanoparticles (ASP) with an estimated Al:Si ratio of between 2 and 3 which is close to the range of secondary aluminosilicates such as imogolite. Thus the high-aluminum-affinity silica polymer is a nanoparticle that seeds early aluminosilicate formation through highly competitive binding of Al(III) ions. In niche environments, especially in vivo, this may serve as an alternative mechanism to polyhydroxy Al(III) species binding monomeric silica to form early phase, non-toxic aluminosilicates. PMID:24349573
International Nuclear Information System (INIS)
Poat, J.A.; Cripps, H.E.; Iversen, L.L.
1988-01-01
Forskolin labelled with [ 3 H] bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg 2+ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no further increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins
Wensveen, Felix M; van Gisbergen, Klaas P J M; Eldering, Eric
2012-09-01
Lymphocyte activation via the antigen receptor is associated with radical shifts in metabolism and changes in requirements for nutrients and cytokines. Concomitantly, drastic changes occur in the expression of pro-and anti-apoptotic proteins that alter the sensitivity of lymphocytes to limiting concentrations of key survival factors. Antigen affinity is a primary determinant for the capacity of activated lymphocytes to access these vital resources. The shift in metabolic needs and the variable access to key survival factors is used by the immune system to eliminate activated low-affinity cells and to generate an optimal high-affinity response. In this review, we focus on the control of apoptosis regulators in activated lymphocytes by nutrients, cytokines, and costimulation. We propose that the struggle among individual clones that leads to the formation of high-affinity effector cell populations is in effect an 'invisible' fourth signal required for effective immune responses. © 2012 John Wiley & Sons A/S.
Detection of Waterborne Viruses Using High Affinity Molecularly Imprinted Polymers.
Altintas, Zeynep; Gittens, Micah; Guerreiro, Antonio; Thompson, Katy-Anne; Walker, Jimmy; Piletsky, Sergey; Tothill, Ibtisam E
2015-07-07
Molecularly imprinted polymers (MIPs) are artificial receptor ligands which can recognize and specifically bind to a target molecule. They are more resistant to chemical and biological damage and inactivation than antibodies. Therefore, target specific-MIP nanoparticles are aimed to develop and implemented to biosensors for the detection of biological toxic agents such as viruses, bacteria, and fungi toxins that cause many diseases and death due to the environmental contamination. For the first time, a molecularly imprinted polymer (MIP) targeting the bacteriophage MS2 as the template was investigated using a novel solid-phase synthesis method to obtain the artificial affinity ligand for the detection and removal of waterborne viruses through optical-based sensors. A high affinity between the artificial ligand and the target was found, and a regenerative MIP-based virus detection assay was successfully developed using a new surface plasmon resonance (SPR)-biosensor which provides an alternative technology for the specific detection and removal of waterborne viruses that lead to high disease and death rates all over the world.
Production and Identification of High Affinity Monoclonal Antibodies Against Pesticide Carbofuran
Institute of Scientific and Technical Information of China (English)
无
2007-01-01
To produce high-affinity monoclonal antibodies against pesticide carbofuran, and the develop immunochemical assays for people's health and environmental protection, the hapten 4-[[(2,3-dihydro-2,2-dimethyl-7-benzofuranyloxy) carbonyl]-amino]-butanoic acid (BFNB) of carbofuran was synthesized and Balb/c mice were immunized by the hapten-carrier (BFNB-bovine serum albumin, BFNB-BSA) conjugates. The splenocytes of immunized mice were fused with Sp2/0 cells and the cultural supernatants of hybridoma cells were screened by the indirect enzyme-linked immunoabsorbent assay (ELISA), based on BFNB-ovoalbumin conjugates (BFNB-OVA). Purified monoclonal antibody (McAb) was obtained from fluids of ascites, deposited by octanoic acid and ammonium sulfate. The affinity and the specificity of McAb were characterized by ELISA or indirect competitive ELISA. A hybridoma cell line (5D3) secreting anti-carbofuran McAb had been established. The titer of culture medium and ascites was up to 1:2.048 × 103 and 1:1.024 × 106, respectively, and the subtype of the McAb was IgG1. The affinity constant of the McAb was about 2.54 × 109 L mol-1, with an IC50 value of 1.18 ng mL-1 and a detection limit of 0.01 ng mL-1. Cross-reactivity studies showed that the McAb was quiet specific for carbofuran, as among the four analogous compounds, they were all hardly recognized (4.59 × 10-4% for 2,3-dihydro-2,2-dimethyl-7-benzofuranol and less than 3.0 × 10-4% for others). The prepared McAb had a very high affinity and specificity,and it could be used to develop ELISA for rapid determination of carbofuran.
Yañez, Fernando; Chianella, Iva; Piletsky, Sergey A; Concheiro, Angel; Alvarez-Lorenzo, Carmen
2010-02-05
This work has focused on the rational development of polymers capable of acting as traps of bile salts. Computational modeling was combined with molecular imprinting technology to obtain networks with high affinity for cholate salts in aqueous medium. The screening of a virtual library of 18 monomers, which are commonly used for imprinted networks, identified N-(3-aminopropyl)-methacrylate hydrochloride (APMA.HCl), N,N-diethylamino ethyl methacrylate (DEAEM) and ethyleneglycol methacrylate phosphate (EGMP) as suitable functional monomers with medium-to-high affinity for cholic acid. The polymers were prepared with a fix cholic acid:functional monomer mole ratio of 1:4, but with various cross-linking densities. Compared to polymers prepared without functional monomer, both imprinted and non-imprinted microparticles showed a high capability to remove sodium cholate from aqueous medium. High affinity APMA-based particles even resembled the performance of commercially available cholesterol-lowering granules. The imprinting effect was evident in most of the networks prepared, showing that computational modeling and molecular imprinting can act synergistically to improve the performance of certain polymers. Nevertheless, both the imprinted and non-imprinted networks prepared with the best monomer (APMA.HCl) identified by the modeling demonstrated such high affinity for the template that the imprinting effect was less important. The fitting of adsorption isotherms to the Freundlich model indicated that, in general, imprinting increases the population of high affinity binding sites, except when the affinity of the functional monomer for the target molecule is already very high. The cross-linking density was confirmed as a key parameter that determines the accessibility of the binding points to sodium cholate. Materials prepared with 9% mol APMA and 91% mol cross-linker showed enough affinity to achieve binding levels of up to 0.4 mmol g(-1) (i.e., 170 mg g(-1)) under flow
A rhodium(III) complex for high-affinity DNA base-pair mismatch recognition
Junicke, Henrik; Hart, Jonathan R.; Kisko, Jennifer; Glebov, Oleg; Kirsch, Ilan R.; Barton, Jacqueline K.
2003-01-01
A rhodium(III) complex, rac-[Rh(bpy)2phzi]3+ (bpy, 2,2′-bipyridine; phzi, benzo[a]phenazine-5,6-quinone diimine) has been designed as a sterically demanding intercalator targeted to destabilized mismatched sites in double-helical DNA. The complex is readily synthesized by condensation of the phenazine quinone with the corresponding diammine complex. Upon photoactivation, the complex promotes direct strand scission at single-base mismatch sites within the DNA duplex. As with the parent mismatch-specific reagent, [Rh(bpy)2(chrysi)]3+ [chrysene-5,6-quinone diimine (chrysi)], mismatch selectivity depends on the helix destabilization associated with mispairing. Unlike the parent chrysi complex, the phzi analogue binds and cleaves with high affinity and efficiency. The specific binding constants for CA, CC, and CT mismatches within a 31-mer oligonucleotide duplex are 0.3, 1, and 6 × 107 M−1, respectively; site-specific photocleavage is evident at nanomolar concentrations. Moreover, the specificity, defined as the ratio in binding affinities for mispaired vs. well paired sites, is maintained. The increase in affinity is attributed to greater stability in the mismatched site associated with stacking by the heterocyclic aromatic ligand. The high-affinity complex is also applied in the differential cleavage of DNA obtained from cell lines deficient in mismatch repair vs. those proficient in mismatch repair. Agreement is found between photocleavage by the mismatch-specific probes and deficiency in mismatch repair. This mismatch-specific targeting, therefore, offers a potential strategy for new chemotherapeutic design. PMID:12610209
High blood oxygen affinity in the air-breathing swamp eel Monopterus albus.
Damsgaard, Christian; Findorf, Inge; Helbo, Signe; Kocagoz, Yigit; Buchanan, Rasmus; Huong, Do Thi Thanh; Weber, Roy E; Fago, Angela; Bayley, Mark; Wang, Tobias
2014-12-01
The Asian swamp eel (Monopterus albus, Zuiew 1793) is a facultative air-breathing fish with reduced gills. Previous studies have shown that gas exchange seems to occur across the epithelium of the buccopharyngeal cavity, the esophagus and the integument, resulting in substantial diffusion limitations that must be compensated by adaptations in others steps of the O₂ transport system to secure adequate O₂ delivery to the respiring tissues. We therefore investigated O₂ binding properties of whole blood, stripped hemoglobin (Hb), two major isoHb components and the myoglobin (Mb) from M. albus. Whole blood was sampled using indwelling catheters for blood gas analysis and determination of O₂ equilibrium curves. Hb was purified to assess the effects of endogenous allosteric effectors, and Mb was isolated from heart and skeletal muscle to determine its O₂ binding properties. The blood of M. albus has a high O₂ carrying capacity [hematocrit (Hct) of 42.4±4.5%] and binds O₂ with an unusually high affinity (P₅₀=2.8±0.4mmHg at 27°C and pH7.7), correlating with insensitivity of the Hb to the anionic allosteric effectors that normally decrease Hb-O₂ affinity. In addition, Mb is present at high concentrations in both heart and muscle (5.16±0.99 and 1.08±0.19mg ∙ g wet tissue⁻¹, respectively). We suggest that the high Hct and high blood O₂ affinity serve to overcome the low diffusion capacity in the relatively inefficient respiratory surfaces, while high Hct and Mb concentration aid in increasing the O₂ flux from the blood to the muscles. Copyright © 2014 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Worley, Bradley; Sisco, Nicholas J.; Powers, Robert
2015-01-01
NMR ligand-affinity screens are vital to drug discovery, are routinely used to screen fragment-based libraries, and used to verify chemical leads from high-throughput assays and virtual screens. NMR ligand-affinity screens are also a highly informative first step towards identifying functional epitopes of unknown proteins, as well as elucidating the biochemical functions of protein–ligand interaction at their binding interfaces. While simple one-dimensional 1 H NMR experiments are capable of indicating binding through a change in ligand line shape, they are plagued by broad, ill-defined background signals from protein 1 H resonances. We present an uncomplicated method for subtraction of protein background in high-throughput ligand-based affinity screens, and show that its performance is maximized when phase-scatter correction is applied prior to subtraction
Selective induction of high-ouabain-affinity isoform of Na sup + -K sup + -ATPase by thyroid hormone
Energy Technology Data Exchange (ETDEWEB)
Haber, R.S.; Loeb, J.N. (Columbia Univ., New York, NY (USA))
1988-12-01
The administration of thyroid hormone is known to result in an induction of the Na{sup +}-K{sup +}-adenosinetriphosphatase (Na{sup +}-K{sup +}-ATPase) in rat skeletal muscle and other thyroid hormone-responsive tissues. Since the Na{sup +}-K{sup +}-ATPase in a variety of mammalian tissues has recently been reported to exist in at least two forms distinguishable by differing affinities for the inhibitory cardiac glycoside ouabain. The authors have studied the effects of 3,3{prime},5-triiodo-L-thyronine (T{sub 3}) treatment on these two forms of the enzyme in rat diaphragm. The inhibition of Na{sup +}-K{sup +}-ATPase activity in a crude membrane fraction by varying concentrations of ouabain conformed to a biphasic pattern consistent with the presence of two distinct isoforms with inhibition constants (K{sub I}s) for ouabain of {approximately}10{sup {minus}7} and 10{sup {minus}4} M, respectively. Measurement of the specific binding of ({sup 3}H)ouabain to these membranes confirmed the presence of a class of high-affinity ouabain binding sites with a dissociation constant (K{sub d}) of slightly less than 10{sup {minus}7}M, whose maximal binding capacity was increased by T{sub 3} treatment by 185%. Binding studies in unfractionated homogenates of diaphragm similarly demonstrated the presence of high-affinity sites whose maximal binding capacity was increased by T{sub 3} treatment. Quantitation of both the high- and low-ouabain-affinity forms of the Na{sup +}-K{sup +}-ATPase by ouabain-dependent phosphorylation from ({sup 32}P)orthophosphate confirmed that T{sub 3} treatment markedly increased the number of high-affinity sites while having little effect on the number of low-affinity sites. These observations provide, to our knowledge, the first demonstration that these two forms of the Na{sup +}-K{sup +}-ATPase are subject to selective hormonal induction.
Energy Technology Data Exchange (ETDEWEB)
Wang, Deng-Liang [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China); Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan [State Key Laboratory for Physical Chemistry of Solid Surfaces, Key Laboratory for Chemical Biology of Fujian Province, Key Laboratory of Analytical Chemistry, and Department of Chemical Biology, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen 361005 (China); Yang, Hai-Tao; Wang, Jiang-Jie [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Yao, Pei-Sen [Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China); Pan, Ru-Jun [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Yang, Chaoyong James, E-mail: cyyang@xmu.edu.cn [State Key Laboratory for Physical Chemistry of Solid Surfaces, Key Laboratory for Chemical Biology of Fujian Province, Key Laboratory of Analytical Chemistry, and Department of Chemical Biology, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen 361005 (China); Kang, De-Zhi, E-mail: kdzy99988@163.com [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China)
2014-10-31
Highlights: • This is the first report of DNA aptamer against EGFR in vitro. • Aptamer can bind targets with high affinity and selectivity. • DNA aptamers are more stable, cheap and efficient than RNA aptamers. • Our selected DNA aptamer against EGFR has high affinity with K{sub d} 56 ± 7.3 nM. • Our selected DNA aptamer against EGFR has high selectivity. - Abstract: Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher’s attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with K{sub d} 56 ± 7.3 nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy.
International Nuclear Information System (INIS)
Wang, Deng-Liang; Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan; Yang, Hai-Tao; Wang, Jiang-Jie; Yao, Pei-Sen; Pan, Ru-Jun; Yang, Chaoyong James; Kang, De-Zhi
2014-01-01
Highlights: • This is the first report of DNA aptamer against EGFR in vitro. • Aptamer can bind targets with high affinity and selectivity. • DNA aptamers are more stable, cheap and efficient than RNA aptamers. • Our selected DNA aptamer against EGFR has high affinity with K d 56 ± 7.3 nM. • Our selected DNA aptamer against EGFR has high selectivity. - Abstract: Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher’s attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with K d 56 ± 7.3 nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy
International Nuclear Information System (INIS)
Hutchens, T.W.; Li, C.M.; Zamah, N.M.; Besch, P.K.
1987-01-01
The steroid binding function of soluble (cytosolic) estrogen receptors from calf uteri was evaluated under conditions known to modify the extent of hydrophobic interaction with receptor-associated proteins. Receptor preparations were equilibrated into 6 M urea buffers and control buffers by chromatography through small columns of Sephadex G-25 or by dialysis at 0.6 0 C. Equilibrium dissociation constants (K/sub d/) and binding capacities (n) of experimental and control receptor preparations were determined by 13-point Scatchard analyses using concentrations of 17β-[ 3 H]estradiol from 0.05 to 10 nM. Nonspecific binding was determined at each concentration by parallel incubations with a 200-fold molar excess of the receptor-specific competitor diethylstilbestrol. The control receptor population was consistently found to be a single class of binding sites with a high affinity for estradiol which was unaffected by G-25 chromatography, by dialysis, by dilution, or by the presence of 0.4 M KCl. However, equilibration into 6 M urea induced a discrete (10-fold) reduction in receptor affinity to reveal a second, thermodynamically stable, high-affinity binding state. The presence of 0.4 M KCl did not significantly influence the discrete change in receptor affinity induced by urea. The effects of urea on both receptor affinity and binding capacity were reversible, suggesting a lack of covalent modification. These results demonstrate nonenzymatic means by which not only the binding capacity but also the affinity of receptor for estradiol can be reversibly controlled, suggesting that high concentrations of urea might be more effectively utilized during the physicochemical characterization and purification of steroid receptor proteins
NK1 receptor fused to beta-arrestin displays a single-component, high-affinity molecular phenotype.
Martini, Lene; Hastrup, Hanne; Holst, Birgitte; Fraile-Ramos, Alberto; Marsh, Mark; Schwartz, Thue W
2002-07-01
Arrestins are cytosolic proteins that, upon stimulation of seven transmembrane (7TM) receptors, terminate signaling by binding to the receptor, displacing the G protein and targeting the receptor to clathrin-coated pits. Fusion of beta-arrestin1 to the C-terminal end of the neurokinin NK1 receptor resulted in a chimeric protein that was expressed to some extent on the cell surface but also accumulated in transferrin-labeled recycling endosomes independently of agonist stimulation. As expected, the fusion protein was almost totally silenced with respect to agonist-induced signaling through the normal Gq/G11 and Gs pathways. The NK1-beta-arrestin1 fusion construct bound nonpeptide antagonists with increased affinity but surprisingly also bound two types of agonists, substance P and neurokinin A, with high, normal affinity. In the wild-type NK1 receptor, neurokinin A (NKA) competes for binding against substance P and especially against antagonists with up to 1000-fold lower apparent affinity than determined in functional assays and in homologous binding assays. When the NK1 receptor was closely fused to G proteins, this phenomenon was eliminated among agonists, but the agonists still competed with low affinity against antagonists. In contrast, in the NK1-beta-arrestin1 fusion protein, all ligands bound with similar affinity independent of the choice of radioligand and with Hill coefficients near unity. We conclude that the NK1 receptor in complex with arrestin is in a high-affinity, stable, agonist-binding form probably best suited to structural analysis and that the receptor can display binding properties that are nearly theoretically ideal when it is forced to complex with only a single intracellular protein partner.
The high-affinity peptidoglycan binding domain of Pseudomonas phage endolysin KZ144
Energy Technology Data Exchange (ETDEWEB)
Briers, Yves [Division of Gene Technology, Department of Biosystems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, B-3001 Leuven (Belgium); Schmelcher, Mathias; Loessner, Martin J. [Institute of Food Science and Nutrition, ETH Zuerich, Schmelzbergstrasse 7, CH-8092 Zuerich (Switzerland); Hendrix, Jelle; Engelborghs, Yves [Laboratory of Biomolecular Dynamics, Department of Chemistry, Katholieke Universiteit Leuven, Celestijnenlaan 200G, B-3001 Leuven (Belgium); Volckaert, Guido [Division of Gene Technology, Department of Biosystems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, B-3001 Leuven (Belgium); Lavigne, Rob, E-mail: rob.lavigne@biw.kuleuven.be [Division of Gene Technology, Department of Biosystems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, B-3001 Leuven (Belgium)
2009-05-29
The binding affinity of the N-terminal peptidoglycan binding domain of endolysin KZ144 (PBD{sub KZ}), originating from Pseudomonas aeruginosa bacteriophage {phi}KZ, has been examined using a fusion protein of PBD{sub KZ} and green fluorescent protein (PBD{sub KZ}-GFP). A fluorescence recovery after photobleaching analysis of bound PBD{sub KZ}-GFP molecules showed less than 10% fluorescence recovery in the bleached area within 15 min. Surface plasmon resonance analysis confirmed this apparent high binding affinity revealing an equilibrium affinity constant of 2.95 x 10{sup 7} M{sup -1} for the PBD{sub KZ}-peptidoglycan interaction. This unique domain, which binds to the peptidoglycan of all tested Gram-negative species, was harnessed to improve the specific activity of the peptidoglycan hydrolase domain KMV36C. The chimeric peptidoglycan hydrolase (PBD{sub KZ}-KMV36C) exhibits a threefold higher specific activity than the native catalytic domain (KMV36C). These results demonstrate that the modular assembly of functional domains is a rational approach to improve the specific activity of endolysins from phages infecting Gram-negatives.
International Nuclear Information System (INIS)
Orito, N; Umekage, S; Sakai, E; Tanaka, T; Kikuchi, Y; Sato, K; Kawauchi, S; Tanaka, H
2012-01-01
We have developed a modified SELEX (systematic evolution of ligands by exponential enrichment) method to obtain RNA aptamers with high affinity to C-reactive protein (CRP). CRP is a clinical biomarker present in plasma, the level of which increases in response to infections and noninfectious inflammation. The CRP level is also an important prognostic indicator in patients with several syndromes. At present, CRP content in blood is measured immunochemically using antibodies. To develop a more sensitive method using RNA aptamers, we have attempted to obtain high-affinity RNA aptamers to CRP. We succeeded in obtaining an RNA aptamer with high affinity to CRP using a CRP-immobilized Sepharose column and pre-elution procedure. Pre-elution is a method that removes the weak binding portion from a selected RNA population by washing for a short time with buffer containing CRP. By surface plasmon-resonance (SPR) analysis, the affinity constant of this aptamer for CRP was calculated to be K D = 2.25x10 -9 (M). The secondary structure, contact sites with CRP protein, and application of this aptamer will be described.
Directory of Open Access Journals (Sweden)
Tal Noy-Porat
2016-03-01
Full Text Available Ricin, derived from the castor bean plant Ricinus communis, is one of the most potent and lethal toxins known, against which there is no available antidote. To date, the use of neutralizing antibodies is the most promising post-exposure treatment for ricin intoxication. The aim of this study was to isolate high affinity anti-ricin antibodies that possess potent toxin-neutralization capabilities. Two non-human primates were immunized with either a ricin-holotoxin- or subunit-based vaccine, to ensure the elicitation of diverse high affinity antibodies. By using a comprehensive set of primers, immune scFv phage-displayed libraries were constructed and panned. A panel of 10 antibodies (five directed against the A subunit of ricin and five against the B subunit was isolated and reformatted into a full-length chimeric IgG. All of these antibodies were found to neutralize ricin in vitro, and several conferred full protection to ricin-intoxicated mice when given six hours after exposure. Six antibodies were found to possess exceptionally high affinity toward the toxin, with KD values below pM (koff < 1 × 10−7 s−1 that were well correlated with their ability to neutralize ricin. These antibodies, alone or in combination, could be used for the development of a highly-effective therapeutic preparation for post-exposure treatment of ricin intoxication.
A high affinity monoclonal antibody recognizing the light chain of human coagulating factor VII.
Sarial, Sheila; Asadi, Farzad; Jeddi-Tehrani, Mahmood; Hadavi, Reza; Bayat, Ali Ahmad; Mahmoudian, Jafar; Taghizadeh-Jahed, Masoud; Shokri, Fazel; Rabbani, Hodjattallah
2012-12-01
Factor VII (FVII) is a serine protease-coagulating element responsible for the initiation of an extrinsic pathway of clot formation. Here we generated and characterized a high affinity monoclonal antibody that specifically recognizes human FVII. Recombinant human FVII (rh-FVII) was used for the production of a monoclonal antibody using BALB/c mice. The specificity of the antibody was determined by Western blot using plasma samples from human, mouse, sheep, goat, bovine, rabbit, and rat. Furthermore, the antibody was used to detect transiently expressed rh-FVII in BHK21 cell line using Western blot and sandwich ELISA. A mouse IgG1 (kappa chain) monoclonal antibody clone 1F1-B11 was produced against rh-FVII. The affinity constant (K(aff)) of the antibody was calculated to be 6.4×10(10) M(-1). The antibody could specifically recognize an epitope on the light chain of hFVII, with no reactivity with factor VII from several other animals. In addition, transiently expressed rh-FVII in BHK21 cells was recognized by 1F1-B11. The high affinity as well as the specificity of 1F1-B11 for hFVII will facilitate the affinity purification of hFVII and also production of FVII deficient plasma and minimizes the risk of bovine FVII contamination when fetal bovine serum-supplemented media are used for production and subsequent purification of rh-FVII.
Affine and quasi-affine frames for rational dilations
DEFF Research Database (Denmark)
Bownik, Marcin; Lemvig, Jakob
2011-01-01
In this paper we extend the investigation of quasi-affine systems, which were originally introduced by Ron and Shen [J. Funct. Anal. 148 (1997), 408-447] for integer, expansive dilations, to the class of rational, expansive dilations. We show that an affine system is a frame if, and only if......, the corresponding family of quasi-affine systems are frames with uniform frame bounds. We also prove a similar equivalence result between pairs of dual affine frames and dual quasi-affine frames. Finally, we uncover some fundamental differences between the integer and rational settings by exhibiting an example...
Honey, Denise M.; Best, Annie; Qiu, Huawei
2018-01-01
ABSTRACT Metelimumab (CAT192) is a human IgG4 monoclonal antibody developed as a TGFβ1-specific antagonist. It was tested in clinical trials for the treatment of scleroderma but later terminated due to lack of efficacy. Subsequent characterization of CAT192 indicated that its TGFβ1 binding affinity was reduced by ∼50-fold upon conversion from the parental single-chain variable fragment (scFv) to IgG4. We hypothesized this result was due to decreased conformational flexibility of the IgG that could be altered via engineering. Therefore, we designed insertion mutants in the elbow region and screened for binding and potency. Our results indicated that increasing the elbow region linker length in each chain successfully restored the isoform-specific and high affinity binding of CAT192 to TGFβ1. The crystal structure of the high binding affinity mutant displays large conformational rearrangements of the variable domains compared to the wild-type antigen-binding fragment (Fab) and the low binding affinity mutants. Insertion of two glycines in both the heavy and light chain elbow regions provided sufficient flexibility for the variable domains to extend further apart than the wild-type Fab, and allow the CDR3s to make additional interactions not seen in the wild-type Fab structure. These interactions coupled with the dramatic conformational changes provide a possible explanation of how the scFv and elbow-engineered Fabs bind TGFβ1 with high affinity. This study demonstrates the benefits of re-examining both structure and function when converting scFv to IgG molecules, and highlights the potential of structure-based engineering to produce fully functional antibodies. PMID:29333938
International Nuclear Information System (INIS)
Penefsky, H.S.
1985-01-01
Incubation of [gamma- 32 P]ATP with a molar excess of the membrane-bound form of mitochondrial ATPase (F1) results in binding of the bulk of the radioactive nucleotide in high affinity catalytic sites (Ka = 10(12) M-1). Subsequent initiation of respiration by addition of succinate or NADH is accompanied by a profound decrease in the affinity for ATP. About one-third of the bound radioactive ATP appears to dissociate, that is, the [gamma- 32 P]ATP becomes accessible to hexokinase. The NADH-stimulated dissociation of [gamma- 32 P]ATP is energy-dependent since the stimulation is inhibited by uncouplers of oxidative phosphorylation and is prevented by respiratory chain inhibitors. The rate of the energy-dependent dissociation of ATP that occurs in the presence of NADH, ADP, and Pi is commensurate with the measured initial rate of ATP synthesis in NADH-supported oxidative phosphorylation catalyzed by the same submitochondrial particles. Thus, the rate of dissociation of ATP from the high affinity catalytic site of submitochondrial particles meets the criterion of kinetic competency under the conditions of oxidative phosphorylation. These experiments provide evidence in support of the argument that energy conserved during the oxidation of substrates by the respiratory chain can be utilized to reduce the very tight binding of product ATP in high affinity catalytic sites and to promote dissociation of the nucleotide
Vogensen, Stine B.; Marek, Aleš; Bay, Tina; Wellendorph, Petrine; Kehler, Jan; Bundgaard, Christoffer; Frølund, Bente; Pedersen, Martin H.F.; Clausen, Rasmus P.
2013-01-01
3-Hydroxycyclopent-1-enecarboxylic acid (HOCPCA, 1) is a potent ligand for the high-affinity GHB binding sites in the CNS. An improved synthesis of 1 together with a very efficient synthesis of [3H]-1 is described. The radiosynthesis employs in situ generated lithium trimethoxyborotritide. Screening of 1 against different CNS targets establishes a high selectivity and we demonstrate in vivo brain penetration. In vitro characterization of [3H]-1 binding shows high specificity to the high-affinity GHB binding sites. PMID:24053696
ABEE, T; SIEBERS, A; ALTENDORF, K; KONINGS, WN
1992-01-01
Cells of the purple nonsulfur bacterium Rhodobacter sphaeroides express a high-affinity K+ uptake system when grown in media with low K+ concentrations. A vanadate-sensitive, K+-stimulated and Mg2+-stimulated ATPase was purified from membranes of these cells by solubilization with
Whitehurst, Charles E; Annis, D Allen
2008-07-01
Advances in combinatorial chemistry and genomics have inspired the development of novel affinity selection-based screening techniques that rely on mass spectrometry to identify compounds that preferentially bind to a protein target. Of the many affinity selection-mass spectrometry techniques so far documented, only a few solution-based implementations that separate target-ligand complexes away from unbound ligands persist today as routine high throughput screening platforms. Because affinity selection-mass spectrometry techniques do not rely on radioactive or fluorescent reporters or enzyme activities, they can complement traditional biochemical and cell-based screening assays and enable scientists to screen targets that may not be easily amenable to other methods. In addition, by employing mass spectrometry for ligand detection, these techniques enable high throughput screening of massive library collections of pooled compound mixtures, vastly increasing the chemical space that a target can encounter during screening. Of all drug targets, G protein coupled receptors yield the highest percentage of therapeutically effective drugs. In this manuscript, we present the emerging application of affinity selection-mass spectrometry to the high throughput screening of G protein coupled receptors. We also review how affinity selection-mass spectrometry can be used as an analytical tool to guide receptor purification, and further used after screening to characterize target-ligand binding interactions, enabling the classification of orthosteric and allosteric binders.
Lai, H; Carino, M A
1992-07-01
Acute (20 min) exposure to 100-dB white noise elicits a naltrexone-sensitive decrease in sodium-dependent high-affinity choline uptake in the frontal cortex and hippocampus of the rat. In the present study, the subtypes of opioid receptors involved were investigated by pretreating rats with microinjection of specific opioid-receptor antagonists into the lateral cerebroventricle before noise exposure. We found that the noise-induced decrease in high-affinity choline uptake in the hippocampus was blocked by pretreatment with either mu-, delta-, or kappa-opioid-receptor antagonists, whereas the effect of noise on frontal cortical high-affinity choline uptake was blocked by a mu- and delta- but not by a kappa-antagonist. These data further confirm the role of endogenous opioids in mediating the effects of noise on central cholinergic activity and indicate that different neural mechanisms are involved in the effects of noise on the frontal cortical and hippocampal cholinergic systems.
International Nuclear Information System (INIS)
Krizsan, D.; Varga, E.; Benyhe, S.; Szucs, M.; Borsodi, A.; Hosztafi, S.
1991-01-01
C-6 derivatives-hydrazones, phenylhydrazones, dinitrophenylhydrazones, oximes and semicarbazones - of morphinane-6-ones were synthesized and their binding characteristics were studied on rat brain membranes. The dihydromorphinone and oxymorphone derivatives compete for the ( 3 H)naloxone binding sites with high affinity, while the dihydrocodeinone and oxycodone derivatives are less potent. The affinity of the new compounds is decreased for the delta sites as compared to the parent ligands. The ligands bearing bulky substituents also bind with low affinity to the kappa sites. The modification decreased the Na + -index of compounds indicating their mixed agonist-antagonist character. The dihydromorphinone derivatives are all capable to block irreversibly the high affinity binding site of ( 3 H)naloxone, whereas the dihydrocodeinone derivatives block irreversibly the low affinity site. A possible mechanism for the inhibition is suggested
Qudsia, Sehar; Merugu, Siva B; Mangukiya, Hitesh B; Hema, Negi; Wu, Zhenghua; Li, Dawei
2018-04-30
Antibody display libraries have become a popular technique to screen monoclonal antibodies for therapeutic purposes. An important aspect of display technology is to generate an optimization library by changing antibody affinity to antigen through mutagenesis and screening the high affinity antibody. In this study, we report a novel lentivirus display based optimization library antibody in which Agtuzumab scFv is displayed on cell membrane of HEK-293T cells. To generate an optimization library, hotspot mutagenesis was performed to achieve diverse antibody library. Based on sequence analysis of randomly selected clones, library size was estimated approximately to be 1.6 × 10 6 . Lentivirus display vector was used to display scFv antibody on cell surface and flow cytometery was performed to check the antibody affinity to antigen. Membrane bound scFv antibodies were then converted to secreted antibody through cre/loxP recombination. One of the mutant clones, M8 showed higher affinity to antigen in flow cytometery analysis. Further characterization of cellular and secreted scFv through western blot showed that antibody affinity was increased by three fold after mutagenesis. This study shows successful construction of a novel antibody library and suggests that hotspot mutagenesis could prove a useful and rapid optimization tool to generate similar libraries with various degree of antigen affinity. Copyright © 2018 Elsevier Inc. All rights reserved.
Hemoglobin affinity in Andean rodents
Directory of Open Access Journals (Sweden)
HRVOJ OSTOJIC
2002-01-01
Full Text Available Blood hemoglobin oxygen affinity (P50 was measured in three Andean species and in the laboratory rat (control, all raised near sea level. Chinchilla lanigera (Molina, 1792 has an altitudinal habitat range from low Andean slopes up to 3000 m., while Chinchilla brevicaudata (Waterhouse, 1848 has an altitudinal range from 3000 to 5000 m. The laboratory type guinea pig, wild type guinea pig (Cavia porcellus, (Waterhouse, 1748, and laboratory rat (Rattus norvegicus were also raised at sea level. The Andean species had high hemoglobin oxygen affinities (low P50 compared with the rat. Chinchilla brevicaudata had a higher affinity than Chinchilla lanigera. The wild type guinea pig had a higher affinity than the laboratory type. As has been shown in other species, this is another example of an inverse correlation between the altitude level and the P50 values. This is the first hemoglobin oxygen affinity study in Chinchilla brevicaudata.
High-affinity receptors for bombesin-like peptides in normal guinea pig lung membranes
International Nuclear Information System (INIS)
Lach, E.; Trifilieff, A.; Landry, Y.; Gies, J.P.
1991-01-01
The binding of the radiolabeled bombesin analogue [ 125 I-Tyr 4 ]bombesin to guinea-pig lung membranes was investigated. Binding of [ 125 I-Tyr 4 ]bombesin was specific, saturable, reversible and linearly related to the protein concentration. Scatchard analysis of equilibrium binding data at 25C indicated the presence of a single class of non-interacting binding sites for bombesin (B max = 7.7 fmol/mg protein). The value of the equilibrium dissociation constant (K D = 90 pM) agrees with a high-affinity binding site. Bombesin and structurally related peptides such as [ 125 I-Tyr 4 ]bombesin, neuromedin B and neuromedin C inhibited the binding of [ 125 I-Tyr 4 ]bombesin in an order of potencies as follows: [ 125 I-Tyr 4 ]bombesin > bombesin ≥ neuromedin C much-gt neuromedin B. These results indicate that guinea-pig lung membranes possess a single class of bombesin receptors with a high affinity for bombesin and a lower one for neuromedin B
International Nuclear Information System (INIS)
Hanyu, Naohiro; Nishio, Kosuke; Hatakeyama, Mamoru; Yasuno, Hiroshi; Tanaka, Toshiyuki; Tada, Masaru; Nakagawa, Takashi; Sandhu, Adarsh; Abe, Masanori; Handa, Hiroshi
2009-01-01
For affinity purification of drug target protein we have developed magnetic carriers, narrow in size distribution (184±9 nm), which exhibit minimal non-specific binding of unwanted proteins. The carriers were highly dispersed in aqueous solutions and highly resistant to organic solvents, which enabled immobilization of various hydrophobic chemicals as probes on the carrier surfaces. Utilizing the carriers we have automated the process of separation and purification of the target proteins that had been done by manual operation previously.
A mix-and-read drop-based in vitro two-hybrid method for screening high-affinity peptide binders
Cui, Naiwen; Zhang, Huidan; Schneider, Nils; Tao, Ye; Asahara, Haruichi; Sun, Zhiyi; Cai, Yamei; Koehler, Stephan A.; de Greef, Tom F. A.; Abbaspourrad, Alireza; Weitz, David A.; Chong, Shaorong
2016-01-01
Drop-based microfluidics have recently become a novel tool by providing a stable linkage between phenotype and genotype for high throughput screening. However, use of drop-based microfluidics for screening high-affinity peptide binders has not been demonstrated due to the lack of a sensitive functional assay that can detect single DNA molecules in drops. To address this sensitivity issue, we introduced in vitro two-hybrid system (IVT2H) into microfluidic drops and developed a streamlined mix-and-read drop-IVT2H method to screen a random DNA library. Drop-IVT2H was based on the correlation between the binding affinity of two interacting protein domains and transcriptional activation of a fluorescent reporter. A DNA library encoding potential peptide binders was encapsulated with IVT2H such that single DNA molecules were distributed in individual drops. We validated drop-IVT2H by screening a three-random-residue library derived from a high-affinity MDM2 inhibitor PMI. The current drop-IVT2H platform is ideally suited for affinity screening of small-to-medium-sized libraries (103–106). It can obtain hits within a single day while consuming minimal amounts of reagents. Drop-IVT2H simplifies and accelerates the drop-based microfluidics workflow for screening random DNA libraries, and represents a novel alternative method for protein engineering and in vitro directed protein evolution. PMID:26940078
Synthesis of site-heterologous haptens for high-affinity anti-pyraclostrobin antibody generation.
Mercader, Josep V; Agulló, Consuelo; Abad-Somovilla, Antonio; Abad-Fuentes, Antonio
2011-03-07
The design and synthesis of functional chemical derivatives of small organic molecules is usually a key step for the intricate production of a variety of bioconjugates. In this respect, the derivatization site at which the spacer arm is introduced in immunizing conjugates constitutes a highly critical parameter for the generation of high-affinity and selective antibodies. However, due to the usual complexity of the required synthetic procedures, the appropriate comparison of alternative tethering positions has often been neglected. In the present study, meticulous strategies were followed to prepare synthetic derivatives of pyraclostrobin with the same linkers located at diverse rationally-chosen sites. Activity appraisal of antibodies and bioconjugates was carried out by bidimensional competitive direct and indirect immunoassays, and a superior performance of two of the three synthesized haptens was found. Finally, a detailed analysis of the conformations of the target molecule and the synthesized haptens in aqueous solution was done using computer assisted molecular modeling techniques. This study suggested that the lower titers and affinities of one set of antibodies are most probably due to conformational effects of the spacer arm in the immunizing bioconjugate.
Yoshimi, T; Kawabata, S; Taira, S; Okuno, A; Mikawa, R; Murayama, S; Tanaka, K; Takikawa, O
2015-11-07
A novel screening system, using affinity imaging mass spectrometry (AIMS), has been developed to identify protein aggregates or organ structures in unfixed human tissue. Frozen tissue sections are positioned on small (millimetre-scale) stainless steel chips and incubated with an extensive library of small molecules. Candidate molecules showing specific affinity for the tissue section are identified by imaging mass spectrometry (IMS). As an example application, we screened over a thousand compounds against Alzheimer's disease (AD) brain tissue and identified several compounds with high affinity for AD brain sections containing tau deposits compared to age-matched controls. It should also be possible to use AIMS to isolate chemical compounds with affinity for tissue structures or components that have been extensively modified by events such as oxidation, phosphorylation, acetylation, aggregation, racemization or truncation, for example, due to aging. It may also be applicable to biomarker screening programs.
International Nuclear Information System (INIS)
Fukuda, E.K.
1983-01-01
Molecular electron affinities have historically been difficult quantities to measure accurately. These difficulties arise from differences in structure between the ion and neutral as well as the existence of excited negative ion states. To circumvent these problems, relative electron affinities were determined in this dissertation by studying equilibrium electron transfer reactions using a pulsed ion cyclotron resonance (ICR) spectrometer. Direct measurement of ion and neutral concentrations for reactions of the general type, A - + B = B - + A, allow calculation of the equilibrium constant and, therefore, the free energy change. The free energy difference is related to the difference in electron affinities between A and B. A relative electron affinity scale covering a range of about 45 kcal/mol was constructed with various substituted p-benzoquinones, nitrobenzenes, anhydrides, and benzophenones. To assign absolute electron affinities, various species with accurately known electron affinities are tied to the scale via ion-cyclotron double resonance bracketing techniques. After the relative scale is anchored to these species with well-known electron affinities, the scale is then used as a check on other electron affinity values as well as generating new electron affinity values. Many discrepancies were found between the electron affinities measured using the ICR technique and previous literature determinations
High affinity, ligand specific uptake of complexed copper-67 by brain tissue incubated in vitro
International Nuclear Information System (INIS)
Barnea, A.; Hartter, D.E.
1987-01-01
Copper is an essential metal that is highly concentrated in the brain. The blood, the sole source of tissue Cu, contains 16-20 μM Cu, of which >95% is complexed to proteins and 2 was 10 times greater than that of CuAlbumin or Cu(II). Within the range of 0.2-150μM Cu, multiple uptake sites for CuHis were apparent. Increasing the molar ratio of His:Cu had a differential effect on Cu uptake: enhancing uptake at [Cu] 1 μM. Thus, using a His:Cu ratio of 1000, they observed a high affinity process exhibiting saturating and half saturating values of 5 μM and 1.5 μM Cu, respectively; using a His:Cu ratio of 2, they observed a low affinity process exhibiting saturating and half-saturating values of 100 μM and 40 μM Cu, respectively. Both processes required thermic but not metabolic energy, suggestive of facilitated diffusion. Considering the blood brain barrier for proteins, CuHis appears to be the major substrate for Cu uptake by neuronal tissue. They demonstrate the existence of a ligand specific, high affinity (apparent Km about 1.5 μM Cu) uptake process for CuHis in the brain, operative at the physiological concentration range of CuHis and histidine
Amyloid-beta binds catalase with high affinity and inhibits hydrogen peroxide breakdown.
Milton, N G
1999-01-01
Amyloid-beta (Abeta) specifically bound purified catalase with high affinity and inhibited catalase breakdown of H(2)O(2). The Abeta-induced catalase inhibition involved formation of the inactive catalase Compound II and was reversible. CatalaseAbeta interactions provide rapid functional assays for the cytotoxic domain of Abeta and suggest a mechanism for some of the observed actions of Abeta plus catalase in vitro.
Mobile Technology Affinity in Renal Transplant Recipients.
Reber, S; Scheel, J; Stoessel, L; Schieber, K; Jank, S; Lüker, C; Vitinius, F; Grundmann, F; Eckardt, K-U; Prokosch, H-U; Erim, Y
Medication nonadherence is a common problem in renal transplant recipients (RTRs). Mobile health approaches to improve medication adherence are a current trend, and several medication adherence apps are available. However, it is unknown whether RTRs use these technologies and to what extent. In the present study, the mobile technology affinity of RTRs was analyzed. We hypothesized significant age differences in mobile technology affinity and that mobile technology affinity is associated with better cognitive functioning as well as higher educational level. A total of 109 RTRs (63% male) participated in the cross-sectional study, with an overall mean age of 51.8 ± 14.2 years. The study included the Technology Experience Questionnaire (TEQ) for the assessment of mobile technology affinity, a cognitive test battery, and sociodemographic data. Overall, 57.4% of the patients used a smartphone or tablet and almost 45% used apps. The TEQ sum score was 20.9 in a possible range from 6 (no affinity to technology) to 30 (very high affinity). Younger patients had significantly higher scores in mobile technology affinity. The only significant gender difference was found in having fun with using electronic devices: Men enjoyed technology more than women did. Mobile technology affinity was positively associated with cognitive functioning and educational level. Young adult patients might profit most from mobile health approaches. Furthermore, high educational level and normal cognitive functioning promote mobile technology affinity. This should be kept in mind when designing mobile technology health (mHealth) interventions for RTRs. For beneficial mHealth interventions, further research on potential barriers and desired technologic features is necessary to adapt apps to patients' needs. Copyright © 2017 Elsevier Inc. All rights reserved.
Identification of high-affinity calmodulin-binding proteins in rat liver
International Nuclear Information System (INIS)
Hanley, R.M.; Dedman, J.R.; Shenolikar, S.
1987-01-01
The Ca 2+ -dependent binding of [ 125 I] calmodulin (CaM) to hepatic proteins separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was utilized to identify CaM binding or acceptor proteins or CAPs. Two proteins of apparent molecular weight of 60,000 (CAP-60) and 45,000 (CAP-45) comprised > 80% of the Ca 2+ -dependent CaM binding in rat liver cytosol. CAP-60 and CAP-45 were partially purified by a variety of chromatographic steps, including affinity chromatography on CaM Sepharose. CAP-60 possessed a native molecular size of 400,000, indicating it to be the CaM-binding subunit of a larger oligomeric complex. In contrast, CAP-45 was monomeric as judged by gel filtration. Neither CAP-60 nor CAP-45 possessed chromatographic properties consistent with known CaM-dependent enzymes reported in the literature. Two-dimensional peptide mapping provided convincing evidence that CAP-60 and CAP-45 were unrelated to other well-characterized CAPs, namely Ca 2+ (CaM)-dependent protein kinase II, calcineurin, or the CaM-dependent cyclic nucleotide phosphodiesterase. The relative abundance and high affinity for CaM could suggest that these novel target proteins, CAP-60 and CAP-45, represent a dominant pathway for CaM action in the mammalian liver
Antibody Binding Selectivity: Alternative Sets of Antigen Residues Entail High-Affinity Recognition.
Directory of Open Access Journals (Sweden)
Yves Nominé
Full Text Available Understanding the relationship between protein sequence and molecular recognition selectivity remains a major challenge. The antibody fragment scFv1F4 recognizes with sub nM affinity a decapeptide (sequence 6TAMFQDPQER15 derived from the N-terminal end of human papilloma virus E6 oncoprotein. Using this decapeptide as antigen, we had previously shown that only the wild type amino-acid or conservative replacements were allowed at positions 9 to 12 and 15 of the peptide, indicating a strong binding selectivity. Nevertheless phenylalanine (F was equally well tolerated as the wild type glutamine (Q at position 13, while all other amino acids led to weaker scFv binding. The interfaces of complexes involving either Q or F are expected to diverge, due to the different physico-chemistry of these residues. This would imply that high-affinity binding can be achieved through distinct interfacial geometries. In order to investigate this point, we disrupted the scFv-peptide interface by modifying one or several peptide positions. We then analyzed the effect on binding of amino acid changes at the remaining positions, an altered susceptibility being indicative of an altered role in complex formation. The 23 starting variants analyzed contained replacements whose effects on scFv1F4 binding ranged from minor to drastic. A permutation analysis (effect of replacing each peptide position by all other amino acids except cysteine was carried out on the 23 variants using the PEPperCHIP® Platform technology. A comparison of their permutation patterns with that of the wild type peptide indicated that starting replacements at position 11, 12 or 13 modified the tolerance to amino-acid changes at the other two positions. The interdependence between the three positions was confirmed by SPR (Biacore® technology. Our data demonstrate that binding selectivity does not preclude the existence of alternative high-affinity recognition modes.
International Nuclear Information System (INIS)
Lambeau, G.; Barhanin, J.; Schweitz, H.; Qar, J.; Lazdunski, M.
1989-01-01
Four new monochain phospholipases were purified from the Oxyuranus scutellatus (taipan) venom. Three of them were highly toxic when injected into mice brain. One of these neurotoxic phospholipases, OS2, was iodinated and used in binding experiments to demonstrate the presence of two families of specific binding sites in rat brain synaptic membranes. The affinities were exceptionally high, Kd1 = 1.5 +/- 0.5 pM and Kd2 = 45 +/- 10 pM, and the maximal binding capacities were Bmax 1 = 1 +/- 0.4 and Bmax 2 = 3 +/- 0.5 pmol/mg of protein. Both binding sites were sensitive to proteolysis and demonstrated to be located on proteins of Mr 85,000-88,000 and 36,000-51,000 by cross-linking and photoaffinity labeling techniques. The binding of 125 I-OS2 to synaptic membranes was dependent on Ca2+ ions and enhanced by Zn2+ ions which inhibit phospholipase activity. Competition experiments have shown that, except for beta-bungarotoxin, a number of known toxic snake or bee phospholipases have very high affinities for the newly identified binding sites. A good correlation (r = 0.80) was observed between toxicity and affinity but not between phospholipase activity and affinity
The utility of affine variables and affine coherent states
International Nuclear Information System (INIS)
Klauder, John R
2012-01-01
Affine coherent states are generated by affine kinematical variables much like canonical coherent states are generated by canonical kinematical variables. Although all classical and quantum formalisms normally entail canonical variables, it is shown that affine variables can serve equally well for many classical and quantum studies. This general purpose analysis provides tools to discuss two major applications: (1) the completely successful quantization of a nonrenormalizable scalar quantum field theory by affine techniques, in complete contrast to canonical techniques which only offer triviality; and (2) a formulation of the kinematical portion of quantum gravity that favors affine kinematical variables over canonical kinematical variables, and which generates a framework in which a favorable analysis of the constrained dynamical issues can take place. All this is possible because of the close connection between the affine and the canonical stories, while the few distinctions can be used to advantage when appropriate. This article is part of a special issue of Journal of Physics A: Mathematical and Theoretical devoted to ‘Coherent states: mathematical and physical aspects’. (review)
Selection of imprinted nanoparticles by affinity chromatography.
Guerreiro, António R; Chianella, Iva; Piletska, Elena; Whitcombe, Michael J; Piletsky, Sergey A
2009-04-15
Soluble molecularly imprinted nanoparticles were synthesised via iniferter initiated polymerisation and separated by size via gel permeation chromatography. Subsequent fractionation of these particles by affinity chromatography allowed the separation of high affinity fractions from the mixture of nanoparticles. Fractions selected this way possess affinity similar to that of natural antibodies (K(d) 6.6x10(-8)) M and were also able to discriminate between related functional analogues of the template.
Structural insights into a high affinity nanobody:antigen complex by homology modelling
DEFF Research Database (Denmark)
Skottrup, Peter Durand
2017-01-01
Porphyromonas gingivalis is a major periodontitis-causing pathogens. P. gingivalis secrete a cysteine protease termed RgpB, which is specific for Arg-Xaa bonds in substrates. Recently, a nanobody-based assay was used to demonstrate that RgpB could represent a novel diagnostic target, thereby...... simplifying. P. gingivalis detection. The nanobody, VHH7, had a high binding affinity and was specific for RgpB, when tested towards the highly identical RgpA. In this study a homology model of VHH7 was build. The complementarity determining regions (CDR) comprising the paratope residues responsible for Rgp...
Alternative affinity tools: more attractive than antibodies?
Ruigrok, V.J.B.; Levisson, M.; Eppink, M.H.M.; Smidt, H.; Oost, van der J.
2011-01-01
Antibodies are the most successful affinity tools used today, in both fundamental and applied research (diagnostics, purification and therapeutics). Nonetheless, antibodies do have their limitations, including high production costs and low stability. Alternative affinity tools based on nucleic acids
Trace element affinities in two high-Ge coals from China
Energy Technology Data Exchange (ETDEWEB)
Jing Li; Xinguo Zhuang; Xavier Querol [China University of Geosciences, Wuhan (China). Faculty of Earth Resources
2011-01-15
The Lincang (Yunnan Province, Southwest China) and Wulantuga (Inner Mongolia, Northeast China) coal deposits are known because of the high-Ge content. These coals have also a high concentration of a number of other elements. To determine the mode of occurrence of the enriched elements in both coals, six density fractions from {lt} 1.43 to {gt} 2.8 g/cm{sup 3} were obtained from two representative samples using heavy-liquids. A number of peculiar geochemical patterns characterize these high-Ge coals. Thus, the results of the chemical analysis of these density fractions showed that both coals (very distant and of a different geological age) are highly enriched (compared with the usual worldwide coal concentration ranges) in Ge, As, Sb, W, Be, and Tl. This may be due to similar geochemistry of hydrothermal fluids influencing the Earth Crust in these regions of China. Moreover, Wulantuga coal (Early Cretaceous subbituminous coal) is also enriched in Ca, Mg, and Na, and Lincang coal (Neogene subbituminous coal) in K, Rb, Nb, Mo, Sn, Cs, and U. A group of elements consisting of Ge, W, B, Nb, and Sb mostly occur with an organic affinity in both coals. Additionally, Be, U, and Mo (and partially Mn and Zn) in Lincang, and Na and Mg in Wulantuga occur also with a major organic affinity. Both coals have sulfide-arsenide mineral assemblages (Fe, S, As, Sn, and Pb, and in addition to Tl, Ta, and Cs in the Lincang coal). The occurrence of Al, P, Li, Sc, Ti, V, Cr, and Zr in both coals, and Ba in Lincang, are associated with the mineral assemblage of silico-aluminates and minor heavy minerals. Furthermore, P, Na, Li, Sc, Ti, Ga, Rb, Zr, Cr, Ba, Th, and LREE (La, Ce, Pr, Nd, and Gd) in Lincang are associated with mineral assemblages of phosphates and minor heavy minerals. The two later mineral assemblages are derived from the occurrence of detrital minerals. 34 refs., 7 figs., 3 tabs.
Diribe, C O; Warhurst, D C
1985-09-01
A study of concentration- and substrate-dependence of chloroquine uptake has been carried out on mouse erythrocytes infected with the chloroquine-sensitive NK65 and the chloroquine-resistant RC strains of Plasmodium berghei. The presence of drug binding sites of high and low affinity in such strains of P. berghei was confirmed. High affinity uptake sites in cells parasitized with chloroquine-sensitive and chloroquine-resistant parasites have similar characteristics, but in the sensitive strain the major component of chloroquine-uptake is at high affinity and dependent on the availability of ATP whilst in the resistant strain the major component of uptake is at low affinity and independent of energy. An absolute increase in the quantity of the low affinity site in erythrocytes parasitized with chloroquine-resistant P. berghei was noted, which may be related to an increase in quantity of parasite membrane.
Characterization of a high affinity cocaine binding site in rat brain
International Nuclear Information System (INIS)
Calligaro, D.; Eldefrawi, M.
1986-01-01
Binding of [ 3 H]cocaine to synaptic membranes from whole rat brain was reversible and saturable. Nonlinear regression analysis of binding isotherms indicated two binding affinities: one with k/sub d/ = 16 nM, B/sub max/ = 0.65 pmoles/mg protein and the other with K/sub d/ = 660 nM, B/sub max/ = 5.1 pmoles/mg protein. The high-affinity binding of [ 3 H]cocaine was sensitive to the actions of trypsin and chymotrypsin but not carboxypeptidase, and was eliminated by exposure of the membranes to 95 0 C for 5 min. Specific binding at 2 nM was higher at pH 8.8 than at pH 7.0. Binding of [ 3 H]cocaine (15 nM) was inhibited by increasing concentrations of Na + ions. Several cocaine analogues, neurotransmitter uptake inhibitors and local anesthetics displaced specific [ 3 H]cocaine binding at 2 nM with various potencies. The cocaine analogue (-)-norcocaine was the most potent (IC 50 = 10 nM), while the local anesthetic tetracaine was the least potent in inhibiting [ 3 H]cocaine binding. Several biogenic amine uptake inhibitors, including tricyclic antidepressants and phencyclidine, had IC 50 values below μM concentrations
Report: Affinity Chromatography.
Walters, Rodney R.
1985-01-01
Supports, affinity ligands, immobilization, elution methods, and a number of applications are among the topics considered in this discussion of affinity chromatography. An outline of the basic principles of affinity chromatography is included. (JN)
Hall, Justin; Brault, Amy; Vincent, Fabien; Weng, Shawn; Wang, Hong; Dumlao, Darren; Aulabaugh, Ann; Aivazian, Dikran; Castro, Dana; Chen, Ming; Culp, Jeffrey; Dower, Ken; Gardner, Joseph; Hawrylik, Steven; Golenbock, Douglas; Hepworth, David; Horn, Mark; Jones, Lyn; Jones, Peter; Latz, Eicke; Li, Jing; Lin, Lih-Ling; Lin, Wen; Lin, David; Lovering, Frank; Niljanskul, Nootaree; Nistler, Ryan; Pierce, Betsy; Plotnikova, Olga; Schmitt, Daniel; Shanker, Suman; Smith, James; Snyder, William; Subashi, Timothy; Trujillo, John; Tyminski, Edyta; Wang, Guoxing; Wong, Jimson; Lefker, Bruce; Dakin, Leslie; Leach, Karen
2017-01-01
Cyclic GMP-AMP synthase (cGAS) initiates the innate immune system in response to cytosolic dsDNA. After binding and activation from dsDNA, cGAS uses ATP and GTP to synthesize 2', 3' -cGAMP (cGAMP), a cyclic dinucleotide second messenger with mixed 2'-5' and 3'-5' phosphodiester bonds. Inappropriate stimulation of cGAS has been implicated in autoimmune disease such as systemic lupus erythematosus, thus inhibition of cGAS may be of therapeutic benefit in some diseases; however, the size and polarity of the cGAS active site makes it a challenging target for the development of conventional substrate-competitive inhibitors. We report here the development of a high affinity (KD = 200 nM) inhibitor from a low affinity fragment hit with supporting biochemical and structural data showing these molecules bind to the cGAS active site. We also report a new high throughput cGAS fluorescence polarization (FP)-based assay to enable the rapid identification and optimization of cGAS inhibitors. This FP assay uses Cy5-labelled cGAMP in combination with a novel high affinity monoclonal antibody that specifically recognizes cGAMP with no cross reactivity to cAMP, cGMP, ATP, or GTP. Given its role in the innate immune response, cGAS is a promising therapeutic target for autoinflammatory disease. Our results demonstrate its druggability, provide a high affinity tool compound, and establish a high throughput assay for the identification of next generation cGAS inhibitors.
Rusley, C.; Onstott, T. C.; Lau, M.
2017-12-01
Methane (CH4) is a potent greenhouse gas whose proper budgeting is vital to climate predictions. Recent studies have identified upland Arctic mineral cryosols as consistent CH4 sinks, drawing CH4 from both the atmosphere and underlying anaerobic soil layers. Global atmospheric CH4 uptake is proposed to be mediated by high-affinity methanotrophs based on the detection of the marker gene pmoA (particulate methane monooxygenase beta subunit). However, a lack of pure cultures and scarcity of genomic information have hindered our understanding of their metabolic capabilities and versatility. Together with the missing genetic linkage between its pmoA and 16S ribosomal RNA (rRNA) gene, the factors that control the distribution and magnitude of high-affinity methanotrophy in the Arctic permafrost-affected region have remained elusive. Using 21 metagenomic datasets of surface soils obtained from long-term core incubation experiments,1 this bioinformatics study aimed to reconstruct the draft genome of the Upland Soil Cluster α-proteobacteria (USCα), the high-affinity methanotroph previously detected in the samples,2 and to determine its phylogeny and metabolic requirements. We obtained a genome bin containing the high-affinity form of the USCα-like pmoA gene. The 3.03 Mbp assembly is 91.6% complete with a unique set of single-copy marker genes. The 16S rRNA gene fragment of USCα belongs to the α-proteobacterial family Beijerinckiaceae. Genome annotation indicates possible formaldehyde oxidation via tetrahydromethanopterin-linked C1 transfer pathways, acetate utilization, carbon fixation via the Calvin-Benson-Bassham cycle, and glycogen production. Notably, the key enzymes for formaldehyde assimilation via the serine and ribulose monophosphate pathways are missing. The presence of genes encoding nitrate reductase and hemoglobin suggests adaptation to low O2 under water-logged conditions. Since USCα has versatile carbon metabolisms, it may not be an obligate methanotroph
Energy Technology Data Exchange (ETDEWEB)
Lambeau, G.; Barhanin, J.; Schweitz, H.; Qar, J.; Lazdunski, M. (Centre de Biochimie, Nice (France))
1989-07-05
Four new monochain phospholipases were purified from the Oxyuranus scutellatus (taipan) venom. Three of them were highly toxic when injected into mice brain. One of these neurotoxic phospholipases, OS2, was iodinated and used in binding experiments to demonstrate the presence of two families of specific binding sites in rat brain synaptic membranes. The affinities were exceptionally high, Kd1 = 1.5 +/- 0.5 pM and Kd2 = 45 +/- 10 pM, and the maximal binding capacities were Bmax 1 = 1 +/- 0.4 and Bmax 2 = 3 +/- 0.5 pmol/mg of protein. Both binding sites were sensitive to proteolysis and demonstrated to be located on proteins of Mr 85,000-88,000 and 36,000-51,000 by cross-linking and photoaffinity labeling techniques. The binding of {sup 125}I-OS2 to synaptic membranes was dependent on Ca2+ ions and enhanced by Zn2+ ions which inhibit phospholipase activity. Competition experiments have shown that, except for beta-bungarotoxin, a number of known toxic snake or bee phospholipases have very high affinities for the newly identified binding sites. A good correlation (r = 0.80) was observed between toxicity and affinity but not between phospholipase activity and affinity.
Structural insights into a high affinity nanobody:antigen complex by homology modelling.
Skottrup, Peter Durand
2017-09-01
Porphyromonas gingivalis is a major periodontitis-causing pathogens. P. gingivalis secrete a cysteine protease termed RgpB, which is specific for Arg-Xaa bonds in substrates. Recently, a nanobody-based assay was used to demonstrate that RgpB could represent a novel diagnostic target, thereby simplifying. P. gingivalis detection. The nanobody, VHH7, had a high binding affinity and was specific for RgpB, when tested towards the highly identical RgpA. In this study a homology model of VHH7 was build. The complementarity determining regions (CDR) comprising the paratope residues responsible for RgpB binding were identified and used as input to the docking. Furthermore, residues likely involved in the RgpB epitope was identified based upon RgpB:RgpA alignment and analysis of residue surface accessibility. CDR residues and putitative RgpB epitope residues were used as input to an information-driven flexible docking approach using the HADDOCK server. Analysis of the VHH7:RgpB model demonstrated that the epitope was found in the immunoglobulin-like domain and residue pairs located at the molecular paratope:epitope interface important for complex stability was identified. Collectively, the VHH7 homology model and VHH7:RgpB docking supplies knowledge of the residues involved in the high affinity interaction. This information could prove valuable in the design of an antibody-drug conjugate for specific RgpB targeting. Copyright © 2017 Elsevier Inc. All rights reserved.
Characterization of high affinity [3H]triazolam binding in rat brain
International Nuclear Information System (INIS)
Earle, M.; Concas, A.; Yamamura, H.I.
1986-01-01
The hypnotic Triazolam (TZ), a triazolo (1,4)-benzodiazepine, displays a short physiological half life and has been used for the treatment of insomnia related to anxiety states. Specific binding properties of this recently tritiated TZ were characterized. The authors major objectives were the direct measurement of the temperature dependence and the GABA effect on [ 3 H]TZ binding. Saturation studies showed a shift to lower affinity at 37 0 C (K/sub d/ = 0.25 +/- 0.01 nM at O 0 C; K/sub d/ = 1.46 +/- 0.03 nM at 37 0 C) while the B/sub max/ values remained unchanged (1003 +/- 37 fmoles/mg prot. at 0 0 C and 1001 +/- 43 fmoles/mg prot. at 37 0 C). Inhibition studies showed that [ 3 H]TZ binding displayed no GABA shift at 0 0 C(K/sub i/ 0.37 +/- 0.03 nM/- GABA and K/sub i/ = 0.55 +/- 0.13 nM/+GABA) but a nearly two-fold shift was apparent at 37 0 C (K/sub i/ = 2.92 +/- 0.2 nM/-GABA; K/sub i/ = 1.37 +/- 0.11 mM/+GABA). These results were also confirmed by saturation studies in the presence or absence of GABA showing a shift to higher affinity in the presence of GABA only at 37 0 C. In Ro 15-1788/[ 3 H]TZ competition experiments the presence of GABA did not affect the inhibitory potency of Ro 15-1788 on [ 3 H]TZ binding at both temperatures. In conclusion [ 3 H]TZ binding showed an extremely high affinity for benzodiazepine receptors. In contrast to reported literature, the findings suggest that TZ interacts with benzodiazepine receptors similar to other benzodiazepine agonists
DEFF Research Database (Denmark)
Jørgensen, Thomas R; vanKuyk, Patricia A; Poulsen, Bjarne R
2007-01-01
This is a study of high-affinity glucose uptake in Aspergillus niger and the effect of disruption of a high-affinity monosaccharide-transporter gene, mstA. The substrate saturation constant (K(s)) of a reference strain was about 15 microM in glucose-limited chemostat culture. Disruption of mst......-affinity uptake system of A. niger. The mstA disruptant and a reference strain were cultivated in glucose-limited chemostat cultures at low, intermediate and high dilution rate (D=0.07 h(-1), 0.14 h(-1) and 0.20 h(-1)). Mycelium harvested from steady-state cultures was subjected to glucose uptake assays...
Directory of Open Access Journals (Sweden)
Brian H. Carrick
2016-03-01
Full Text Available Isolation of endogenous proteins from Saccharomyces cerevisiae has been facilitated by inserting encoding polypeptide affinity tags at the C-termini of chromosomal open reading frames (ORFs using homologous recombination of DNA fragments. Tagged protein isolation is limited by a number of factors, including high cost of affinity resins for bulk isolation and low concentration of ligands on the resin surface, leading to low isolation efficiencies and trapping of contaminants. To address this, we have created a recombinant “CelTag” DNA construct from which PCR fragments can be created to easily tag C-termini of S. cerevisiae ORFs using selection for a nat1 marker. The tag has a C-terminal cellulose binding module to be used in the first affinity step. Microgranular cellulose is very inexpensive and has an effectively continuous ligand on its surface, allowing rapid, highly efficient purification with minimal background. Cellulose-bound proteins are released by specific cleavage of an included site for TEV protease, giving nearly pure product. The tag can be lifted from the recombinant DNA construct either with or without a 13x myc epitope tag between the target ORF and the TEV protease site. Binding of CelTag protein fusions to cellulose is stable to high salt, nonionic detergents, and 1 M urea, allowing stringent washing conditions to remove loosely associated components, as needed, before specific elution. It is anticipated that this reagent could allow isolation of protein complexes from large quantities of yeast extract, including soluble, membrane-bound, or nucleic acid-associated assemblies.
Energy Technology Data Exchange (ETDEWEB)
Hall, Justin; Brault, Amy; Vincent, Fabien; Weng, Shawn; Wang, Hong; Dumlao, Darren; Aulabaugh, Ann; Aivazian, Dikran; Castro, Dana; Chen, Ming; Culp, Jeffrey; Dower, Ken; Gardner, Joseph; Hawrylik, Steven; Golenbock, Douglas; Hepworth, David; Horn, Mark; Jones, Lyn; Jones, Peter; Latz, Eicke; Li, Jing; Lin, Lih-Ling; Lin, Wen; Lin, David; Lovering, Frank; Niljanskul, Nootaree; Nistler, Ryan; Pierce, Betsy; Plotnikova, Olga; Schmitt, Daniel; Shanker, Suman; Smith, James; Snyder, William; Subashi, Timothy; Trujillo, John; Tyminski, Edyta; Wang, Guoxing; Wong, Jimson; Lefker, Bruce; Dakin, Leslie; Leach, Karen (UMASS, MED); (Pfizer)
2017-09-21
Cyclic GMP-AMP synthase (cGAS) initiates the innate immune system in response to cytosolic dsDNA. After binding and activation from dsDNA, cGAS uses ATP and GTP to synthesize 2', 3' -cGAMP (cGAMP), a cyclic dinucleotide second messenger with mixed 2'-5' and 3'-5' phosphodiester bonds. Inappropriate stimulation of cGAS has been implicated in autoimmune disease such as systemic lupus erythematosus, thus inhibition of cGAS may be of therapeutic benefit in some diseases; however, the size and polarity of the cGAS active site makes it a challenging target for the development of conventional substrate-competitive inhibitors. We report here the development of a high affinity (KD = 200 nM) inhibitor from a low affinity fragment hit with supporting biochemical and structural data showing these molecules bind to the cGAS active site. We also report a new high throughput cGAS fluorescence polarization (FP)-based assay to enable the rapid identification and optimization of cGAS inhibitors. This FP assay uses Cy5-labelled cGAMP in combination with a novel high affinity monoclonal antibody that specifically recognizes cGAMP with no cross reactivity to cAMP, cGMP, ATP, or GTP. Given its role in the innate immune response, cGAS is a promising therapeutic target for autoinflammatory disease. Our results demonstrate its druggability, provide a high affinity tool compound, and establish a high throughput assay for the identification of next generation cGAS inhibitors.
International Nuclear Information System (INIS)
Miles, L.A.; Plow, E.F.
1986-01-01
An antibody population that reacted with the high-affinity lysine binding site of human plasminogen was elicited by immunizing rabbits with an elastase degradation product containing kringles 1-3 (EDP I). This antibody was immunopurified by affinity chromatography on plasminogen-Sepharose and elution with 0.2 M 6-aminohexanoic acid. The eluted antibodies bound [ 125 I]EDP I, [ 125 I]Glu-plasminogen, and [ 125 I]Lys-plasminogen in radioimmunoassays, and binding of each ligand was at least 99% inhibited by 0.2 M 6-aminohexanoic acid. The concentrations for 50% inhibition of [ 125 I]EDP I binding by tranexamic acid, 6-aminohexanoic acid, and lysine were 2.6, 46, and l730 μM, respectively. Similar values were obtained with plasminogen and suggested that an unoccupied high-affinity lysine binding site was required for antibody recognition. The antiserum reacted exclusively with plasminogen derivatives containing the EDP I region and did not react with those lacking an EDP I region, or with tissue plasminogen activator or prothrombin, which also contains kringles. By immunoblotting analyses, a chymotryptic degradation product of M/sub r/ 20,000 was derived from EDP I that retained reactivity with the antibody. α 2 -Antiplasmin inhibited the binding of radiolabeled EDP I, Glu-plasminogen, or Lys-plasminogen by the antiserum, suggesting that the recognized site is involved in the noncovalent interaction of the inhibitor with plasminogen. The binding of [ 125 I]EDP I to fibrin was also inhibited by the antiserum. The observations provide independent evidence for the role of the high-affinity lysine binding site in the functional interactions of plasminogen with its primary substrate and inhibitor
Qi, Wenjing; Liu, Zhongyuan; Zhang, Wei; Halawa, Mohamed Ibrahim; Xu, Guobao
2016-01-01
Zr(IV) can form phosphate and Zr(IV) (?PO3 2??Zr4+?) complex owing to the high affinity between Zr(IV) with phosphate. Zr(IV) can induce the aggregation of gold nanoparticles (AuNPs), while adenosine triphosphate(ATP) can prevent Zr(IV)-induced aggregation of AuNPs. Herein, a visual and plasmon resonance absorption (PRA)sensor for ATP have been developed using AuNPs based on the high affinity between Zr(IV)with ATP. AuNPs get aggregated in the presence of certain concentrations of Zr(IV). Aft...
14-O-Methylmorphine: A Novel Selective Mu-Opioid Receptor Agonist with High Efficacy and Affinity.
Zádor, Ferenc; Balogh, Mihály; Váradi, András; Zádori, Zoltán S; Király, Kornél; Szűcs, Edina; Varga, Bence; Lázár, Bernadette; Hosztafi, Sándor; Riba, Pál; Benyhe, Sándor; Fürst, Susanna; Al-Khrasani, Mahmoud
2017-11-05
14-O-methyl (14-O-Me) group in morphine-6-O-sulfate (M6SU) or oxymorphone has been reported to be essential for enhanced affinity, potency and antinociceptive effect of these opioids. Herein we report on the pharmacological properties (potency, affinity and efficacy) of the new compound, 14-O-methylmorphine (14-O-MeM) in in vitro. Additionally, we also investigated the antinociceptive effect of the novel compound, as well as its inhibitory action on gastrointestinal transit in in vivo. The potency and efficacy of test compound were measured by [ 35 S]GTPγS binding, isolated mouse vas deferens (MVD) and rat vas deferens (RVD) assays. The affinity of 14-O-MeM for opioid receptors was assessed by radioligand binding and MVD assays. The antinociceptive and gastrointestinal effects of the novel compound were evaluated in the rat tail-flick test and charcoal meal test, respectively. Morphine, DAMGO, Ile 5,6 deltorphin II, deltorphin II and U-69593 were used as reference compounds. 14-O-MeM showed higher efficacy (E max ) and potency (EC 50 ) than morphine in MVD, RVD or [ 35 S]GTPγS binding. In addition, 14-O-MeM compared to morphine showed higher affinity for μ-opioid receptor (MOR). In vivo, in rat tail-flick test 14-O-MeM proved to be stronger antinociceptive agent than morphine after peripheral or central administration. Additionally, both compounds inhibited the gastrointestinal peristalsis. However, when the antinociceptive and antitransit doses for each test compound are compared, 14-O-MeM proved to have slightly more favorable pharmacological profile. Our results affirm that 14-O-MeM, an opioid of high efficacy and affinity for MOR can be considered as a novel analgesic agent of potential clinical value. Copyright © 2017 Elsevier B.V. All rights reserved.
Botulinum neurotoxin B recognizes its protein receptor with high affinity and specificity.
Jin, Rongsheng; Rummel, Andreas; Binz, Thomas; Brunger, Axel T
2006-12-21
Botulinum neurotoxins (BoNTs) are produced by Clostridium botulinum and cause the neuroparalytic syndrome of botulism. With a lethal dose of 1 ng kg(-1), they pose a biological hazard to humans and a serious potential bioweapon threat. BoNTs bind with high specificity at neuromuscular junctions and they impair exocytosis of synaptic vesicles containing acetylcholine through specific proteolysis of SNAREs (soluble N-ethylmaleimide-sensitive fusion protein attachment protein receptors), which constitute part of the synaptic vesicle fusion machinery. The molecular details of the toxin-cell recognition have been elusive. Here we report the structure of a BoNT in complex with its protein receptor: the receptor-binding domain of botulinum neurotoxin serotype B (BoNT/B) bound to the luminal domain of synaptotagmin II, determined at 2.15 A resolution. On binding, a helix is induced in the luminal domain which binds to a saddle-shaped crevice on a distal tip of BoNT/B. This crevice is adjacent to the non-overlapping ganglioside-binding site of BoNT/B. Synaptotagmin II interacts with BoNT/B with nanomolar affinity, at both neutral and acidic endosomal pH. Biochemical and neuronal ex vivo studies of structure-based mutations indicate high specificity and affinity of the interaction, and high selectivity of BoNT/B among synaptotagmin I and II isoforms. Synergistic binding of both synaptotagmin and ganglioside imposes geometric restrictions on the initiation of BoNT/B translocation after endocytosis. Our results provide the basis for the rational development of preventive vaccines or inhibitors against these neurotoxins.
Zorzi, Alessandro; Middendorp, Simon J; Wilbs, Jonas; Deyle, Kaycie; Heinis, Christian
2017-07-17
The rapid renal clearance of peptides in vivo limits this attractive platform for the treatment of a broad range of diseases that require prolonged drug half-lives. An intriguing approach for extending peptide circulation times works through a 'piggy-back' strategy in which peptides bind via a ligand to the long-lived serum protein albumin. In accordance with this strategy, we developed an easily synthesized albumin-binding ligand based on a peptide-fatty acid chimera that has a high affinity for human albumin (K d =39 nM). This ligand prolongs the elimination half-life of cyclic peptides in rats 25-fold to over seven hours. Conjugation to a peptide factor XII inhibitor developed for anti-thrombotic therapy extends the half-life from 13 minutes to over five hours, inhibiting coagulation for eight hours in rabbits. This high-affinity albumin ligand could potentially extend the half-life of peptides in human to several days, substantially broadening the application range of peptides as therapeutics.
Zorzi, Alessandro; Middendorp, Simon J.; Wilbs, Jonas; Deyle, Kaycie; Heinis, Christian
2017-07-01
The rapid renal clearance of peptides in vivo limits this attractive platform for the treatment of a broad range of diseases that require prolonged drug half-lives. An intriguing approach for extending peptide circulation times works through a `piggy-back' strategy in which peptides bind via a ligand to the long-lived serum protein albumin. In accordance with this strategy, we developed an easily synthesized albumin-binding ligand based on a peptide-fatty acid chimera that has a high affinity for human albumin (Kd=39 nM). This ligand prolongs the elimination half-life of cyclic peptides in rats 25-fold to over seven hours. Conjugation to a peptide factor XII inhibitor developed for anti-thrombotic therapy extends the half-life from 13 minutes to over five hours, inhibiting coagulation for eight hours in rabbits. This high-affinity albumin ligand could potentially extend the half-life of peptides in human to several days, substantially broadening the application range of peptides as therapeutics.
Structural implications of hERG K+ channel block by a high-affinity minimally structured blocker
Helliwell, Matthew V.; Zhang, Yihong; El Harchi, Aziza; Du, Chunyun; Hancox, Jules C.; Dempsey, Christopher E.
2018-01-01
Cardiac potassium channels encoded by human ether-à-go-go–related gene (hERG) are major targets for structurally diverse drugs associated with acquired long QT syndrome. This study characterized hERG channel inhibition by a minimally structured high-affinity hERG inhibitor, Cavalli-2, composed of three phenyl groups linked by polymethylene spacers around a central amino group, chosen to probe the spatial arrangement of side chain groups in the high-affinity drug-binding site of the hERG pore. hERG current (IhERG) recorded at physiological temperature from HEK293 cells was inhibited with an IC50 of 35.6 nm with time and voltage dependence characteristic of blockade contingent upon channel gating. Potency of Cavalli-2 action was markedly reduced for attenuated inactivation mutants located near (S620T; 54-fold) and remote from (N588K; 15-fold) the channel pore. The S6 Y652A and F656A mutations decreased inhibitory potency 17- and 75-fold, respectively, whereas T623A and S624A at the base of the selectivity filter also decreased potency (16- and 7-fold, respectively). The S5 helix F557L mutation decreased potency 10-fold, and both F557L and Y652A mutations eliminated voltage dependence of inhibition. Computational docking using the recent cryo-EM structure of an open channel hERG construct could only partially recapitulate experimental data, and the high dependence of Cavalli-2 block on Phe-656 is not readily explainable in that structure. A small clockwise rotation of the inner (S6) helix of the hERG pore from its configuration in the cryo-EM structure may be required to optimize Phe-656 side chain orientations compatible with high-affinity block. PMID:29545312
Hirota's solitons in the affine and the conformal affine Toda models
International Nuclear Information System (INIS)
Aratyn, H.; Constantinidis, C.P.; Ferreira, L.A.; Gomes, J.F.; Zimerman, A.H.
1993-01-01
We use Hirota's method formulated as a recursive scheme to construct a complete set of soliton solutions for the affine Toda field theory based on an arbitrary Lie algebra. Our solutions include a new class of solitons connected with two different types of degeneracies encountered in Hirota's perturbation approach. We also derive an universal mass formula for all Hirota's solutions to the affine Toda model valid for all underlying Lie groups. Embedding of the affine Toda model in the conformal affine Toda model plays a crucial role in this analysis. (orig.)
Improving image segmentation by learning region affinities
Energy Technology Data Exchange (ETDEWEB)
Prasad, Lakshman [Los Alamos National Laboratory; Yang, Xingwei [TEMPLE UNIV.; Latecki, Longin J [TEMPLE UNIV.
2010-11-03
We utilize the context information of other regions in hierarchical image segmentation to learn new regions affinities. It is well known that a single choice of quantization of an image space is highly unlikely to be a common optimal quantization level for all categories. Each level of quantization has its own benefits. Therefore, we utilize the hierarchical information among different quantizations as well as spatial proximity of their regions. The proposed affinity learning takes into account higher order relations among image regions, both local and long range relations, making it robust to instabilities and errors of the original, pairwise region affinities. Once the learnt affinities are obtained, we use a standard image segmentation algorithm to get the final segmentation. Moreover, the learnt affinities can be naturally unutilized in interactive segmentation. Experimental results on Berkeley Segmentation Dataset and MSRC Object Recognition Dataset are comparable and in some aspects better than the state-of-art methods.
The solutions of affine and conformal affine Toda field theory
International Nuclear Information System (INIS)
Papadopoulos, G.; Spence, B.
1994-02-01
We give new formulations of the solutions of the field equations of the affine Toda and conformal affine Toda theories on a cylinder and two-dimensional Minkowski space-time. These solutions are parameterised in terms of initial data and the resulting covariant phase spaces are diffeomorphic to the Hamiltonian ones. We derive the fundamental Poisson brackets of the parameters of the solutions and give the general static solutions for the affine theory. (authors). 10 refs
Influence of self-affine roughness on the friction coefficient of rubber at high sliding velocity
Palasantzas, G
2004-01-01
In this work we investigate the influence of self-affine roughness on the friction coefficient of a rubber body onto a solid surface at high speeds. The roughness is characterized by the rms amplitude w, the correlation length xi, and the roughness exponent H. It is shown that the friction
Different endothelin receptor affinities in dog tissues
International Nuclear Information System (INIS)
Loeffler, B.M.L.; Loehrer, W.
1991-01-01
Endothelin (ET) is a long-lasting potent vasoconstrictor-peptide. Here the authors report different binding affinities of endothelin-1 (ET-1) to ET-receptors of various dog tissues. Crude microsomal fractions were prepared after homogenisation of dog tissues in 50 mM Tris/HCl, 20 mM MnCl2, 1 mM EDTA, pH 7.4 by differential centrifugation. Aliquots of microsomal fractions (70 micrograms of protein) were incubated at 25 degrees C for 180 min in the presence of 20 pM 125I-ET-1 and various concentrations of cold ET-1. Four different ET-1 receptor binding affinities were found: adrenals, cerebrum, liver, heart, skeletal muscle and stomach microsomal membranes contained high affinity binding sites (Kd 50 - 80 pM, Bmax 60 - 250 fmol/mg). In cerebellum and spleen medium affinity ET-1 receptors (Kd 350 pM, Bmax 880 and 1200 fmol/mg respectively) were present. In comparison lung and kidney microsomes contained a low affinity ET-1 receptor (Kd 800 and 880 pM, Bmax 1600 and 350 fmol/mg). Receptors of even lower affinity were present in heart, intestine and liver microsomes with Kd values of 3 - 6 nM
Low affinity uniporter carrier proteins can increase net substrate uptake rate by reducing efflux
Bosdriesz, Evert; Wortel, Meike T.; Haanstra, Jurgen R.; Wagner, Marijke J.; De La Torre Cortés, Pilar; Teusink, Bas
2018-01-01
Many organisms have several similar transporters with different affinities for the same substrate. Typically, high-affinity transporters are expressed when substrate is scarce and low-affinity ones when it is abundant. The benefit of using low instead of high-affinity transporters remains unclear,
Low affinity uniporter carrier proteins can increase net substrate uptake rate by reducing efflux
Bosdriesz, Evert; Wortel, M.T.; Haanstra, Jurgen R.; Wagner, Marijke J.; De La Torre, P.; Teusink, Bas
2018-01-01
Many organisms have several similar transporters with different affinities for the same substrate. Typically, high-affinity transporters are expressed when substrate is scarce and low-affinity ones when it is abundant. The benefit of using low instead of high-affinity transporters remains
Lectin affinity electrophoresis.
Kobayashi, Yuka
2014-01-01
An interaction or a binding event typically changes the electrophoretic properties of a molecule. Affinity electrophoresis methods detect changes in the electrophoretic pattern of molecules (mainly macromolecules) that occur as a result of biospecific interactions or complex formation. Lectin affinity electrophoresis is a very effective method for the detection and analysis of trace amounts of glycobiological substances. It is particularly useful for isolating and separating the glycoisomers of target molecules. Here, we describe a sensitive technique for the detection of glycoproteins separated by agarose gel-lectin affinity electrophoresis that uses antibody-affinity blotting. The technique is tested using α-fetoprotein with lectin (Lens culinaris agglutinin and Phaseolus vulgaris agglutinin)-agarose gels.
High-Affinity Accumulation of Chloroquine by Mouse Erythrocytes Infected with Plasmodium berghei
Fitch, Coy D.; Yunis, Norman G.; Chevli, Rekha; Gonzalez, Yolanda
1974-01-01
Washed erythrocytes infected with chloroquine-susceptible (CS) or with chloroquine-resistant (CR) P. berghei were used in model systems in vitro to study the accumulation of chloroquine with high affinity. The CS model could achieve distribution ratios (chloroquine in cells: chloroquine in medium) of 100 in the absence of substrate. 200—300 in the presence of 10 mM pyruvate or lactate, and over 600 in the presence of 1 mM glucose or glycerol. In comparable studies of the CR model, the distribution ratios were 100 in the absence of substrate and 300 or less in the presence of glucose or glycerol. The presence of lactate stimulated chloroquine accumulation in the CR model, whereas the presence of pyruvate did not. Lactate production from glucose and glycerol was undiminished in the CR model, and ATP concentrations were higher than in the CS model. Cold, iodoacetate, 2,4-dinitrophenol, or decreasing pH inhibited chloroquine accumulation in both models. These findings demonstrate substrate involvement in the accumulation of chloroquine with high affinity. In studies of the CS model, certain compounds competitively inhibited chloroquine accumulation, while others did not. This finding is attributable to a specific receptor that imposes structural constraints on the process of accumulation. For chloroquine analogues, the position and length of the side chain, the terminal nitrogen atom of the side chain, and the nitrogen atom in the quinoline ring are important determinants of binding to this receptor. PMID:4600044
Directory of Open Access Journals (Sweden)
Lourdes Rubio
2018-05-01
Full Text Available Posidonia oceanica (L. Delile is a seagrass, the only group of vascular plants to colonize the marine environment. Seawater is an extreme yet stable environment characterized by high salinity, alkaline pH and low availability of essential nutrients, such as nitrate and phosphate. Classical depletion experiments, membrane potential and cytosolic sodium measurements were used to characterize the high-affinity NO3−, Pi and amino acids uptake mechanisms in this species. Net uptake rates of both NO3− and Pi were reduced by more than 70% in the absence of Na+. Micromolar concentrations of NO3− depolarized mesophyll leaf cells plasma membrane. Depolarizations showed saturation kinetics (Km = 8.7 ± 1 μM NO3−, which were not observed in the absence of Na+. NO3− induced depolarizations at increasing Na+ also showed saturation kinetics (Km = 7.2 ± 2 mM Na+. Cytosolic Na+ measured in P. oceanica leaf cells (17 ± 2 mM Na+ increased by 0.4 ± 0.2 mM Na+ upon the addition of 100 μM NO3−. Na+-dependence was also observed for high-affinity l-ala and l-cys uptake and high-affinity Pi transport. All together, these results strongly suggest that NO3−, amino acids and Pi uptake in P. oceanica leaf cells are mediated by high-affinity Na+-dependent transport systems. This mechanism seems to be a key step in the process of adaptation of seagrasses to the marine environment.
High Affinity IgE-Fc Receptor alpha and gamma Subunit Interactions
International Nuclear Information System (INIS)
Rashid, A.; Housden, J. E. M.; Sabban, S.; Helm, B.
2014-01-01
Objective: To explore the relationships between the subunits (alpha, beta and gamma) of the high affinity IgE receptor (Fc and RI) and its ability to mediate transmembrane signaling. Study Design: Experimental study. Place and Duration of Study: Department of Molecular Biology and Biotechnology, University of Sheffield, UK, from 2008 to 2009. Methodology: The approach employed was to create a chimera (human alpha-gamma-gamma) using the extracellular (EC) domain of the human high affinity IgE receptor. The alpha subunit (huFc and RIalpha) of IgE receptor was spliced onto the rodent gamma TM and cytoplasmic domain (CD). This was transfected into the Rat Basophilic Leukemia cell line in order to assess the possibility of selectively activating cells transfected with this single pass construct for antigen induced mediator release. Results: The RBLs cell lines transfected with the huFc and RIalpha/gamma/gamma cDNA constructs were assessed for the cell surface expression of the huFc and RIalpha subunit and the response to the antigenic stimulus by looking for degranulation and intracellular Ca2+ mobilisation. The results obtained showed the absence of huFc and RIalpha subunit expression on the surface of transfected cells as seen by flowcytometric studies, beta-hexosaminidase assays and intracellular calcium mobilisation studies. Conclusion: In the present study the grounds for non-expression of huFc and RIalpha/gamma/gamma cDNA remains elusive but may be due to the fact that the human-rodent chimeric receptors are assembled differently than the endogenous rodent receptors as seen in study in which COS 7 cells were transfected with human/rat chimeric complexes. (author)
N-Oxide analogs of WAY-100635 : new high affinity 5-HT (1A) receptor antagonists
Oberwinkler - Marchais, Sandrine; Nowicki, B; Pike, VW; Halldin, C; Sandell, J; Chou, YH; Gulyas, B; Brennum, LT; Farde, L; Wikstrom, H V
2005-01-01
WAY-100635 [N-(2-(1-(4-(2-methoxyphenyl)piperazinyl)ethyl))-N-(2-pyridinyl)cyclohexanecarboxamide] 1 and its O-des-methyl derivative DWAY 2 are well-known high affinity 5-HT1A receptor antagonists. which when labeled with carbon-II (beta(+): t(1/2) 20.4min) in the carbonyl group are effective
Directory of Open Access Journals (Sweden)
N.B. Iannucci
2003-03-01
Full Text Available High-performance affinity matrices were obtained by attaching pseudobiospecific ligands to hollow-fibre membranes. The neutral protease contained in FlavourzymeTM was purified to homogeneity with Yellow 4R-HE affinity hollow-fibre membranes. Immobilisation of Red HE-3B allowed purification of a milk-clotting enzyme obtained by solid-state culture of Mucor bacilliformis. Copper immobilisation through iminodiacetic acid allowed fractionation of Biocon Bioconcentrated PlusTM to separate the pectinesterase-containing fraction. The productivity of the developed processes - 1900, 94 and 750 U/ml.min, respectively - was 10- to 15-fold higher than that achieved with the same ligands immobilised on agarose-based soft gels, mainly due to the shortening of the purification processes.
Fenobody: A Ferritin-Displayed Nanobody with High Apparent Affinity and Half-Life Extension.
Fan, Kelong; Jiang, Bing; Guan, Zhe; He, Jiuyang; Yang, Dongling; Xie, Ni; Nie, Guohui; Xie, Can; Yan, Xiyun
2018-04-10
Nanobodies consist of a single domain variable fragment of a camelid heavy-chain antibody. Nanobodies have potential applications in biomedical fields because of their simple production procedures and low cost. Occasionally, nanobody clones of interest exhibit low affinities for their target antigens, which, together with their short half-life limit bioanalytical or therapeutic applications. Here, we developed a novel platform we named fenobody, in which a nanobody developed against H5N1 virus is displayed on the surface of ferritin in the form of a 24mer. We constructed a fenobody by substituting the fifth helix of ferritin with the nanobody. TEM analysis showed that nanobodies were displayed on the surface of ferritin in the form of 6 × 4 bundles, and that these clustered nanobodies are flexible for antigen binding in spatial structure. Comparing fenobodies with conventional nanobodies currently used revealed that the antigen binding apparent affinity of anti-H5N1 fenobody was dramatically increased (∼360-fold). Crucially, their half-life extension in a murine model was 10-fold longer than anti-H5N1 nanobody. In addition, we found that our fenobodies are highly expressed in Escherichia coli, and are both soluble and thermo-stable nanocages that self-assemble as 24-polymers. In conclusion, our results demonstrate that fenobodies have unique advantages over currently available systems for apparent affinity enhancement and half-life extension of nanobodies. Our fenobody system presents a suitable platform for various large-scale biotechnological processes and should greatly facilitate the application of nanobody technology in these areas.
Richard, Gabrielle; Meyers, Ashley J.; McLean, Michael D.; Arbabi-Ghahroudi, Mehdi; MacKenzie, Roger; Hall, J. Christopher
2013-01-01
Small recombinant antibody fragments (e.g. scFvs and VHHs), which are highly tissue permeable, are being investigated for antivenom production as conventional antivenoms consisting of IgG or F(ab’)2 antibody fragments do not effectively neutralize venom toxins located in deep tissues. However, antivenoms composed entirely of small antibody fragments may have poor therapeutic efficacy due to their short serum half-lives. To increase serum persistence and maintain tissue penetration, we prepared low and high molecular mass antivenom antibodies. Four llama VHHs were isolated from an immune VHH-displayed phage library and were shown to have high affinity, in the low nM range, for α-cobratoxin (α–Cbtx), the most lethal component of Naja kaouthia venom. Subsequently, our highest affinity VHH (C2) was fused to a human Fc fragment to create a VHH2-Fc antibody that would offer prolonged serum persistence. After in planta (Nicotiana benthamiana) expression and purification, we show that our VHH2-Fc antibody retained high affinity binding to α–Cbtx. Mouse α–Cbtx challenge studies showed that our highest affinity VHHs (C2 and C20) and the VHH2-Fc antibody effectively neutralized lethality induced by α–Cbtx at an antibody:toxin molar ratio as low as ca. 0.75×:1. Further research towards the development of an antivenom therapeutic involving these anti-α-Cbtx VHHs and VHH2-Fc antibody molecules should involve testing them as a combination, to determine whether they maintain tissue penetration capability and low immunogenicity, and whether they exhibit improved serum persistence and therapeutic efficacy. PMID:23894495
Wei, Wang; Binwu, He
2008-12-01
According to the notion of Lp-affine surface area by Lutwak, in this paper, we introduce the concept of Lp-dual affine surface area. Further, we establish the affine isoperimetric inequality and the Blaschke-Santaló inequality for Lp-dual affine surface area. Besides, the dual Brunn-Minkowski inequality for Lp-dual affine surface area is presented.
Specific recognition of the C-terminal end of A beta 42 by a high affinity monoclonal antibody
DEFF Research Database (Denmark)
Axelsen, Trine Veje; Holm, Arne; Birkelund, Svend
2009-01-01
The neurotoxic peptide A beta(42) is derived from the amyloid precursor protein by proteolytic cleavage and is deposited in the brain of patients suffering from Alzheimer's disease (AD). In this study we generate a high affinity monoclonal antibody that targets the C-terminal end of A beta(42......) with high specificity. By this is meant that the paratope of the antibody must enclose the C-terminal end of A beta(42) including the carboxy-group of amino acid 42, and not just recognize a linear epitope in the C-terminal part of A beta. This has been accomplished by using a unique antigen construct made...... by the Ligand Presenting Assembly technology (LPA technology). This strategy results in dimeric presentation of the free C-terminal end of A beta(42). The generated Mab A beta1.1 is indeed specific for the C-terminal end of A beta(42) to which it binds with high affinity. Mab A beta1.1 recognizes the epitope...
Wang, Deng-Liang; Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan; Yang, Hai-Tao; Wang, Jiang-Jie; Yao, Pei-Sen; Pan, Ru-Jun; Yang, Chaoyong James; Kang, De-Zhi
2014-10-31
Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher's attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with Kd 56±7.3nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy. Copyright © 2014 Elsevier Inc. All rights reserved.
Braun, Michael B; Traenkle, Bjoern; Koch, Philipp A; Emele, Felix; Weiss, Frederik; Poetz, Oliver; Stehle, Thilo; Rothbauer, Ulrich
2016-01-21
Nanobodies are highly valuable tools for numerous bioanalytical and biotechnical applications. Here, we report the characterization of a nanobody that binds a short peptide epitope with extraordinary affinity. Structural analysis reveals an unusual binding mode where the extended peptide becomes part of a β-sheet structure in the nanobody. This interaction relies on sequence-independent backbone interactions augmented by a small number of specificity-determining side chain contacts. Once bound, the peptide is fastened by two nanobody side chains that clamp it in a headlock fashion. Exploiting this unusual binding mode, we generated a novel nanobody-derived capture and detection system. Matrix-coupled nanobody enables the fast and efficient isolation of epitope-tagged proteins from prokaryotic and eukaryotic expression systems. Additionally, the fluorescently labeled nanobody visualizes subcellular structures in different cellular compartments. The high-affinity-binding and modifiable peptide tag of this system renders it a versatile and robust tool to combine biochemical analysis with microscopic studies.
Koch, Katherine S; Moran, Tom; Shier, W Thomas; Leffert, Hyam L
2018-05-01
N-acetyl-2-aminofluorene (AAF) is a procarcinogen used widely in physiological investigations of chemical hepatocarcinogenesis. Its metabolic pathways have been described extensively, yet little is known about its biochemical processing, growth cycle expression, and pharmacological properties inside living hepatocytes-the principal cellular targets of this hepatocarcinogen. In this report, primary monolayer adult rat hepatocyte cultures and high specific-activity [ring G-3 H]-N-acetyl-2-aminofluorene were used to extend previous observations of metabolic activation of AAF by highly differentiated, proliferation-competent hepatocytes in long-term cultures. AAF metabolism proceeded by zero-order kinetics. Hepatocytes processed significant amounts of procarcinogen (≈12 μg AAF/106 cells/day). Five ring-hydroxylated and one deacetylated species of AAF were secreted into the culture media. Extracellular metabolite levels varied during the growth cycle (days 0-13), but their rank quantitative order was time invariant: 5-OH-AAF > 7-OH-AAF > 3-OH-AAF > N-OH-AAF > aminofluorene (AF) > 1-OH-AAF. Lineweaver-Burk analyses revealed two principal classes of metabolism: System I (high-affinity and low-velocity), Km[APPARENT] = 1.64 × 10-7 M and VMAX[APPARENT] = 0.1 nmol/106 cells/day and System II (low-affinity and high-velocity), Km[APPARENT] = 3.25 × 10-5 M and VMAX[APPARENT] = 1000 nmol/106 cells/day. A third system of metabolism of AAF to AF, with Km[APPARENT] and VMAX[APPARENT] constants of 9.6 × 10-5 M and 4.7 nmol/106 cells/day, was also observed. Evidence provided in this report and its companion paper suggests selective roles and intracellular locations for System I- and System II-mediated AAF metabolite formation during hepatocarcinogenesis, although some of the molecules and mechanisms responsible for multi-system processing remain to be fully defined.
International Nuclear Information System (INIS)
Pinto, Vanda; Pinho, Maria Joao; Jose, Pedro A.; Soares-da-Silva, Patricio
2010-01-01
Research highlights: → H 2 O 2 in excess is required for the presence of a low-affinity high-capacity component for the Na + -dependent [ 14 C]-L-alanine uptake in SHR PTE cells only. → It is suggested that Na + binding in renal ASCT2 may be regulated by ROS in SHR PTE cells. -- Abstract: The presence of high and low sodium affinity states for the Na + -dependent [ 14 C]-L-alanine uptake in immortalized renal proximal tubular epithelial (PTE) cells was previously reported (Am. J. Physiol. 293 (2007) R538-R547). This study evaluated the role of H 2 O 2 on the Na + -dependent [ 14 C]-L-alanine uptake of ASCT2 in immortalized renal PTE cells from Wistar Kyoto rat (WKY) and spontaneously hypertensive rat (SHR). Na + dependence of [ 14 C]-L-alanine uptake was investigated replacing NaCl with an equimolar concentration of choline chloride in vehicle- and apocynin-treated cells. Na + removal from the uptake solution abolished transport activity in both WKY and SHR PTE cells. Decreases in H 2 O 2 levels in the extracellular medium significantly reduced Na + -K m and V max values of the low-affinity high-capacity component in SHR PTE cells, with no effect on the high-affinity low-capacity state of the Na + -dependent [ 14 C]-L-alanine uptake. After removal of apocynin from the culture medium, H 2 O 2 levels returned to basal values within 1 to 3 h in both WKY and SHR PTE cells and these were found stable for the next 24 h. Under these experimental conditions, the Na + -K m and V max of the high-affinity low-capacity state were unaffected and the low-affinity high-capacity component remained significantly decreased 1 day but not 4 days after apocynin removal. In conclusion, H 2 O 2 in excess is required for the presence of a low-affinity high-capacity component for the Na + -dependent [ 14 C]-L-alanine uptake in SHR PTE cells only. It is suggested that Na + binding in renal ASCT2 may be regulated by ROS in SHR PTE cells.
DEFF Research Database (Denmark)
Høg, Signe; Wellendorph, Petrine; Nielsen, Birgitte
2008-01-01
Gamma-hydroxybutyrate (GHB) is a metabolite of gamma-aminobutyric acid (GABA) and has been proposed to function as a neurotransmitter or neuromodulator. GHB is used in the treatment of narcolepsy and is a drug of abuse. GHB binds to both GABA(B) receptors and specific high-affinity GHB sites...
DEFF Research Database (Denmark)
Jensen, Bettina Margrethe; Assing, K; Jensen, Lone Hummelshøj
2006-01-01
Immunoglobulin (Ig)E-sensitized persons with positive skin prick test, but no allergy symptoms, are classified as being asymptomatic skin sensitized (AS). The allergic type 1 disease is dependant on IgE binding to the high affinity IgE-receptor (FcepsilonRI) expressed on basophils and mast cells....
Energy Technology Data Exchange (ETDEWEB)
Lázár-Molnár, Eszter; Scandiuzzi, Lisa; Basu, Indranil; Quinn, Thomas; Sylvestre, Eliezer; Palmieri, Edith; Ramagopal, Udupi A.; Nathenson, Stanley G.; Guha, Chandan; Almo, Steven C.
2017-03-01
Programmed Cell Death-1 (PD-1) is an inhibitory immune receptor, which plays critical roles in T cell co-inhibition and exhaustion upon binding to its ligands PD-L1 and PD-L2. We report the crystal structure of the human PD-1 ectodomain and the mapping of the PD-1 binding interface. Mutagenesis studies confirmed the crystallographic interface, and resulted in mutant PD-1 receptors with altered affinity and ligand-specificity. In particular, a high-affinity mutant PD-1 (HA PD-1) exhibited 45 and 30-fold increase in binding to PD-L1 and PD-L2, respectively, due to slower dissociation rates. This mutant (A132L) was used to engineer a soluble chimeric Ig fusion protein for cell-based and in vivo studies. HA PD-1 Ig showed enhanced binding to human dendritic cells, and increased T cell proliferation and cytokine production in a mixed lymphocyte reaction (MLR) assay. Moreover, in an experimental model of murine Lewis lung carcinoma, HA PD-1 Ig treatment synergized with radiation therapy to decrease local and metastatic tumor burden, as well as in the establishment of immunological memory responses. Our studies highlight the value of structural considerations in guiding the design of a high-affinity chimeric PD-1 Ig fusion protein with robust immune modulatory properties, and underscore the power of combination therapies to selectively manipulate the PD-1 pathway for tumor immunotherapy.
Directory of Open Access Journals (Sweden)
Eszter Lázár-Molnár
2017-03-01
Full Text Available Programmed Cell Death-1 (PD-1 is an inhibitory immune receptor, which plays critical roles in T cell co-inhibition and exhaustion upon binding to its ligands PD-L1 and PD-L2. We report the crystal structure of the human PD-1 ectodomain and the mapping of the PD-1 binding interface. Mutagenesis studies confirmed the crystallographic interface, and resulted in mutant PD-1 receptors with altered affinity and ligand-specificity. In particular, a high-affinity mutant PD-1 (HA PD-1 exhibited 45 and 30-fold increase in binding to PD-L1 and PD-L2, respectively, due to slower dissociation rates. This mutant (A132L was used to engineer a soluble chimeric Ig fusion protein for cell-based and in vivo studies. HA PD-1 Ig showed enhanced binding to human dendritic cells, and increased T cell proliferation and cytokine production in a mixed lymphocyte reaction (MLR assay. Moreover, in an experimental model of murine Lewis lung carcinoma, HA PD-1 Ig treatment synergized with radiation therapy to decrease local and metastatic tumor burden, as well as in the establishment of immunological memory responses. Our studies highlight the value of structural considerations in guiding the design of a high-affinity chimeric PD-1 Ig fusion protein with robust immune modulatory properties, and underscore the power of combination therapies to selectively manipulate the PD-1 pathway for tumor immunotherapy.
Lai, Cheng-Tsung; Li, Huei-Jiun; Yu, Weixuan; Shah, Sonam; Bommineni, Gopal R; Perrone, Victoria; Garcia-Diaz, Miguel; Tonge, Peter J; Simmerling, Carlos
2015-08-04
Slow-onset enzyme inhibitors are the subject of considerable interest as an approach to increasing the potency of pharmaceutical compounds by extending the residence time of the inhibitor on the target (the lifetime of the drug-receptor complex). However, rational modulation of residence time presents significant challenges because it requires additional mechanistic insight, such as the nature of the transition state for postbinding isomerization. Our previous work, based on X-ray crystallography, enzyme kinetics, and molecular dynamics simulation, suggested that the slow step in inhibition of the Mycobacterium tuberculosis enoyl-ACP reductase InhA involves a change in the conformation of the substrate binding loop from an open state in the initial enzyme-inhibitor complex to a closed state in the final enzyme-inhibitor complex. Here, we use multidimensional free energy landscapes for loop isomerization to obtain a computational model for the transition state. The results suggest that slow-onset inhibitors crowd key side chains on helices that slide past each other during isomerization, resulting in a steric clash. The landscapes become significantly flatter when residues involved in the steric clash are replaced with alanine. Importantly, this lower barrier can be increased by rational inhibitor redesign to restore the steric clash. Crystallographic studies and enzyme kinetics confirm the predicted effects on loop structure and flexibility, as well as inhibitor residence time. These loss and regain of function studies validate our mechanistic hypothesis for interactions controlling substrate binding loop isomerization, providing a platform for the future design of inhibitors with longer residence times and better in vivo potency. Similar opportunities for slow-onset inhibition via the same mechanism are identified in other pathogens.
DEFF Research Database (Denmark)
Kandra, L.; Abou Hachem, Maher; Gyemant, G.
2006-01-01
Subsite affinity maps of long substrate binding clefts in barley alpha-amylases, obtained using a series of maltooligosaccharides of degree of polymerization of 3-12, revealed unfavorable binding energies at the internal subsites -3 and -5 and at subsites -8 and +3/+4 defining these subsites...... as binding barriers. Barley a-amylase I mutants Y105A and T212Y at subsite -6 and +4 resulted in release or anchoring of bound substrate, thus modifying the affinities of other high-affinity subsites (-2 and +2) and barriers. The double mutant Y105A-T212Y displayed a hybrid subsite affinity profile......, converting barriers to binding areas. These findings highlight the dynamic binding energy distribution and the versatility of long maltooligosaccharide derivatives in mapping extended binding clefts in a-amylases....
DEFF Research Database (Denmark)
Jorgensen, Rasmus; Martini, Lene; Schwartz, Thue W
2005-01-01
To dissect the interaction between beta-arrestin ((beta)arr) and family B G protein-coupled receptors, we constructed fusion proteins between the glucagon-like peptide 1 receptor and (beta)arr2. The fusion constructs had an increase in apparent affinity selectively for glucagon, suggesting...... that (beta)arr2 interaction locks the receptor in a high-affinity conformation, which can be explored by some, but not all, ligands. The fusion constructs adopted a signaling phenotype governed by the tethered (beta)arr2 with an attenuated G protein-mediated cAMP signal and a higher maximal internalization...... of that which has previously been characterized for family A G protein-coupled receptors, suggesting similarities in the effect of (beta)arr interaction between family A and B receptors also at the molecular level....
Directory of Open Access Journals (Sweden)
Gracey Lia E
2010-07-01
Full Text Available Abstract Background The physiological function of eukaryotic DNA occurs in the context of nucleosomal arrays that can expose or obscure defined segments of the genome. Certain DNA sequences are capable of strongly positioning a nucleosome in vitro, suggesting the possibility that favorable intrinsic signals might reproducibly structure chromatin segments. As high-throughput sequencing analyses of nucleosome coverage in vitro and in vivo have become possible, a vigorous debate has arisen over the degree to which intrinsic DNA:nucleosome affinities orchestrate the in vivo positions of nucleosomes, thereby controlling physical accessibility of specific sequences in DNA. Results We describe here the in vivo consequences of placing a synthetic high-affinity nucleosome-positioning signal, the 601 sequence, into a DNA plasmid vector in mice. Strikingly, the 601 sequence was sufficient to position nucleosomes during an early phase after introduction of the DNA into the mice (when the plasmid vector transgene was active. This positioning capability was transient, with a loss of strong positioning at a later time point when the transgenes had become silent. Conclusions These results demonstrate an ability of DNA sequences selected solely for nucleosome affinity to organize chromatin in vivo, and the ability of other mechanisms to overcome these interactions in a dynamic nuclear environment.
High-affinity binding of two molecules of cysteine proteinases to low-molecular-weight kininogen.
Turk, B.; Stoka, V.; Björk, I.; Boudier, C.; Johansson, G.; Dolenc, I.; Colic, A.; Bieth, J. G.; Turk, V.
1995-01-01
Human low-molecular-weight kininogen (LK) was shown by fluorescence titration to bind two molecules of cathepsins L and S and papain with high affinity. By contrast, binding of a second molecule of cathepsin H was much weaker. The 2:1 binding stoichiometry was confirmed by titration monitored by loss of enzyme activity and by sedimentation velocity experiments. The kinetics of binding of cathepsins L and S and papain showed the two proteinase binding sites to have association rate constants kass,1 = 10.7-24.5 x 10(6) M-1 s-1 and kass,2 = 0.83-1.4 x 10(6) M-1 s-1. Comparison of these kinetic constants with previous data for intact LK and its separated domains indicate that the faster-binding site is also the tighter-binding site and is present on domain 3, whereas the slower-binding, lower-affinity site is on domain 2. These results also indicate that there is no appreciable steric hindrance for the binding of proteinases between the two binding sites or from the kininogen light chain. PMID:8528085
Directory of Open Access Journals (Sweden)
Renata De Paris
Full Text Available Protein receptor conformations, obtained from molecular dynamics (MD simulations, have become a promising treatment of its explicit flexibility in molecular docking experiments applied to drug discovery and development. However, incorporating the entire ensemble of MD conformations in docking experiments to screen large candidate compound libraries is currently an unfeasible task. Clustering algorithms have been widely used as a means to reduce such ensembles to a manageable size. Most studies investigate different algorithms using pairwise Root-Mean Square Deviation (RMSD values for all, or part of the MD conformations. Nevertheless, the RMSD only may not be the most appropriate gauge to cluster conformations when the target receptor has a plastic active site, since they are influenced by changes that occur on other parts of the structure. Hence, we have applied two partitioning methods (k-means and k-medoids and four agglomerative hierarchical methods (Complete linkage, Ward's, Unweighted Pair Group Method and Weighted Pair Group Method to analyze and compare the quality of partitions between a data set composed of properties from an enzyme receptor substrate-binding cavity and two data sets created using different RMSD approaches. Ensembles of representative MD conformations were generated by selecting a medoid of each group from all partitions analyzed. We investigated the performance of our new method for evaluating binding conformation of drug candidates to the InhA enzyme, which were performed by cross-docking experiments between a 20 ns MD trajectory and 20 different ligands. Statistical analyses showed that the novel ensemble, which is represented by only 0.48% of the MD conformations, was able to reproduce 75% of all dynamic behaviors within the binding cavity for the docking experiments performed. Moreover, this new approach not only outperforms the other two RMSD-clustering solutions, but it also shows to be a promising strategy to
DEFF Research Database (Denmark)
Buchardt, Kristian
2016-01-01
Affine processes possess the property that expectations of exponential affine transformations are given by a set of Riccati differential equations, which is the main feature of this popular class of processes. In this paper we generalise these results for expectations of more general transformati...
Heegaard, Niels H H
2009-06-01
The journal Electrophoresis has greatly influenced my approaches to biomolecular affinity studies. The methods that I have chosen as my main tools to study interacting biomolecules--native gel and later capillary zone electrophoresis--have been the topic of numerous articles in Electrophoresis. Below, the role of the journal in the development and dissemination of these techniques and applications reviewed. Many exhaustive reviews on affinity electrophoresis and affinity CE have been published in the last few years and are not in any way replaced by the present deliberations that are focused on papers published by the journal.
Detection-Guided Fast Affine Projection Channel Estimator for Speech Applications
Directory of Open Access Journals (Sweden)
Yan Wu Jennifer
2007-04-01
Full Text Available In various adaptive estimation applications, such as acoustic echo cancellation within teleconferencing systems, the input signal is a highly correlated speech. This, in general, leads to extremely slow convergence of the NLMS adaptive FIR estimator. As a result, for such applications, the affine projection algorithm (APA or the low-complexity version, the fast affine projection (FAP algorithm, is commonly employed instead of the NLMS algorithm. In such applications, the signal propagation channel may have a relatively low-dimensional impulse response structure, that is, the number m of active or significant taps within the (discrete-time modelled channel impulse response is much less than the overall tap length n of the channel impulse response. For such cases, we investigate the inclusion of an active-parameter detection-guided concept within the fast affine projection FIR channel estimator. Simulation results indicate that the proposed detection-guided fast affine projection channel estimator has improved convergence speed and has lead to better steady-state performance than the standard fast affine projection channel estimator, especially in the important case of highly correlated speech input signals.
Braun, Michael B.; Traenkle, Bjoern; Koch, Philipp A.; Emele, Felix; Weiss, Frederik; Poetz, Oliver; Stehle, Thilo; Rothbauer, Ulrich
2016-01-01
Nanobodies are highly valuable tools for numerous bioanalytical and biotechnical applications. Here, we report the characterization of a nanobody that binds a short peptide epitope with extraordinary affinity. Structural analysis reveals an unusual binding mode where the extended peptide becomes part of a β-sheet structure in the nanobody. This interaction relies on sequence-independent backbone interactions augmented by a small number of specificity-determining side chain contacts. Once bound, the peptide is fastened by two nanobody side chains that clamp it in a headlock fashion. Exploiting this unusual binding mode, we generated a novel nanobody-derived capture and detection system. Matrix-coupled nanobody enables the fast and efficient isolation of epitope-tagged proteins from prokaryotic and eukaryotic expression systems. Additionally, the fluorescently labeled nanobody visualizes subcellular structures in different cellular compartments. The high-affinity-binding and modifiable peptide tag of this system renders it a versatile and robust tool to combine biochemical analysis with microscopic studies. PMID:26791954
The metric-affine gravitational theory as the gauge theory of the affine group
International Nuclear Information System (INIS)
Lord, E.A.
1978-01-01
The metric-affine gravitational theory is shown to be the gauge theory of the affine group, or equivalently, the gauge theory of the group GL(4,R) of tetrad deformations in a space-time with a locally Minkowskian metric. The identities of the metric-affine theory, and the relationship between them and those of general relativity and Sciama-Kibble theory, are derived. (Auth.)
Zhang, Xu; Shi, Heping; Wu, Jiaxi; Zhang, Xuewu; Sun, Lijun; Chen, Chuo; Chen, Zhijian J.
2013-01-01
The presence of microbial or self DNA in the cytoplasm of mammalian cells is a danger signal detected by the DNA sensor cyclic-GMP-AMP (cGAMP) synthase (cGAS), which catalyzes the production of cGAMP that in turn serves as a second messenger to activate innate immune responses. Here we show that endogenous cGAMP in mammalian cells contains two distinct phosphodiester linkages, one between 2′-OH of GMP and 5′-phosphate of AMP, and the other between 3′-OH of AMP and 5′-phosphate of GMP. This molecule, termed 2′3′-cGAMP, is unique in that it binds to the adaptor protein STING with a much greater affinity than cGAMP molecules containing other combinations of phosphodiester linkages. The crystal structure of STING bound to 2′3′-cGAMP revealed the structural basis of this high-affinity binding and a ligand-induced conformational change in STING that may underlie its activation. PMID:23747010
Zhang, Xu; Shi, Heping; Wu, Jiaxi; Zhang, Xuewu; Sun, Lijun; Chen, Chuo; Chen, Zhijian J
2013-07-25
The presence of microbial or self DNA in the cytoplasm of mammalian cells is a danger signal detected by the DNA sensor cyclic-GMP-AMP (cGAMP) synthase (cGAS), which catalyzes the production of cGAMP that in turn serves as a second messenger to activate innate immune responses. Here we show that endogenous cGAMP in mammalian cells contains two distinct phosphodiester linkages, one between 2'-OH of GMP and 5'-phosphate of AMP, and the other between 3'-OH of AMP and 5'-phosphate of GMP. This molecule, termed 2'3'-cGAMP, is unique in that it binds to the adaptor protein STING with a much greater affinity than cGAMP molecules containing other combinations of phosphodiester linkages. The crystal structure of STING bound to 2'3'-cGAMP revealed the structural basis of this high-affinity binding and a ligand-induced conformational change in STING that may underlie its activation. Copyright © 2013 Elsevier Inc. All rights reserved.
Solution structure of the Grb2 SH2 domain complexed with a high-affinity inhibitor
International Nuclear Information System (INIS)
Ogura, Kenji; Shiga, Takanori; Yokochi, Masashi; Yuzawa, Satoru; Burke, Terrence R.; Inagaki, Fuyuhiko
2008-01-01
The solution structure of the growth factor receptor-bound protein 2 (Grb2) SH2 domain complexed with a high-affinity inhibitor containing a non-phosphorus phosphate mimetic within a macrocyclic platform was determined by nuclear magnetic resonance (NMR) spectroscopy. Unambiguous assignments of the bound inhibitor and intermolecular NOEs between the Grb2 SH2 domain and the inhibitor was accomplished using perdeuterated Grb2 SH2 protein. The well-defined solution structure of the complex was obtained and compared to those by X-ray crystallography. Since the crystal structure of the Grb2 SH2 domain formed a domain-swapped dimer and several inhibitors were bound to a hinge region, there were appreciable differences between the solution and crystal structures. Based on the binding interactions between the inhibitor and the Grb2 SH2 domain in solution, we proposed a design of second-generation inhibitors that could be expected to have higher affinity
Directory of Open Access Journals (Sweden)
Bryan L Roth
Full Text Available In this paper we determined the pharmacological profiles of novel ketamine and phencyclidine analogues currently used as 'designer drugs' and compared them to the parent substances via the resources of the National Institute of Mental Health Psychoactive Drug Screening Program. The ketamine analogues methoxetamine ((RS-2-(ethylamino-2-(3-methoxyphenylcyclohexanone and 3-MeO-PCE (N-ethyl-1-(3-methoxyphenylcyclohexanamine and the 3- and 4-methoxy analogues of phencyclidine, (1-[1-(3-methoxyphenylcyclohexyl]piperidine and 1-[1-(4-methoxyphenylcyclohexyl]piperidine, were all high affinity ligands for the PCP-site on the glutamate NMDA receptor. In addition methoxetamine and PCP and its analogues displayed appreciable affinities for the serotonin transporter, whilst the PCP analogues exhibited high affinities for sigma receptors. Antagonism of the NMDA receptor is thought to be the key pharmacological feature underlying the actions of dissociative anaesthetics. The novel ketamine and PCP analogues had significant affinities for the NMDA receptor in radioligand binding assays, which may explain their psychotomimetic effects in human users. Additional actions on other targets could be important for delineating side-effects.
International Nuclear Information System (INIS)
Hayashida, Kazuhiro; Kitamura, Toshio; Gorman, D.M.; Miyajima, Atsushi; Arai, Kenichi; Yokota, Takashi
1990-01-01
Using the mouse interleukin 3 (IL-3) receptor cDNA as a probe, the authors obtained a monologous cDNA (KH97) from a cDNA library of a human hemopoietic cell line, TF-1. The protein encoded by the KH97 cDNA has 56% amino acid sequence identity with the mouse IL-3 receptor and retains features common to the family of cytokine receptors. Fibroblasts transfected with the KH97 cDNA expressed a protein of 120 kDa but did not bind any human cytokines, including IL-3 and granulocyte - macrophage colony-stimulating factor (GM-CSF). Interestingly, cotransfection of cDNAs for KH97 and the low-affinity human GM-CSF receptor in fibroblasts resulted in formation of a high-affinity receptor for GM-CSF. The dissociation rate of GM-CSF from the reconstituted high-affinity receptor was slower than that from the low-affinity site, whereas the association rate was unchanged. Cross-linking of 125 I-labeled GM-CSF to fibroblasts cotransfected with both cDNAs revealed the same cross-linking patterns as in TF-1 cells - i.e., two major proteins of 80 and 120 kDa which correspond to the low-affinity GM-CSF receptor and the KH97 protein, respectively. These results indicate that the high-affinity GM-CSF receptor is composed of at least two components in a manner analogous to the IL-2 receptor. They therefore propose to designate the low-affinity GM-CSF receptor and the KH97 protein as the α and β subunits of the GM-CSF receptor, respectively
DEFF Research Database (Denmark)
Zhang, Peng; Jørgensen, Trine Nygaard; Løland, Claus Juul
2013-01-01
A novel fluorescent ligand was synthesized as a high-affinity, high specificity probe for visualizing the serotonin transporter (SERT). The rhodamine fluorophore was extended from an aniline substitution on the 5-position of the dihydroisobenzofuran ring of citalopram (2, 1-(3-(dimethylamino......)propyl)-1-(4-fluorophenyl)-1,3-dihydroisobenzofuran-5-carbonitrile), using an ethylamino linker. The resulting rhodamine-labeled ligand 8 inhibited [3H]5-HT uptake in COS-7 cells (Ki = 225 nM) with similar potency to the tropane-based JHC 1-064 (1), but with higher specificity towards the SERT relative...
Novel and high affinity fluorescent ligands for the serotonin transporter based on (s)-citalopram
DEFF Research Database (Denmark)
Kumar, Vivek; Rahbek-Clemmensen, Troels; Billesbølle, Christian B
2014-01-01
Novel rhodamine-labeled ligands, based on (S)-citalopram, were synthesized and evaluated for uptake inhibition at the human serotonin, dopamine, and norepinephrine transporters (hSERT, hDAT, and hNET, respectively) and for binding at SERT, in transiently transfected COS7 cells. Compound 14 demons...... demonstrated high affinity binding and selectivity for SERT (K i = 3 nM). Visualization of SERT, using confocal laser scanning microscopy, validated compound 14 as a novel tool for studying SERT expression and distribution in living cells....
A Generalized Affine Isoperimetric Inequality
Chen, Wenxiong; Howard, Ralph; Lutwak, Erwin; Yang, Deane; Zhang, Gaoyong
2004-01-01
A purely analytic proof is given for an inequality that has as a direct consequence the two most important affine isoperimetric inequalities of plane convex geometry: The Blaschke-Santalo inequality and the affine isoperimetric inequality of affine differential geometry.
Borek, Aleksandra; Sokolowska-Wedzina, Aleksandra; Chodaczek, Grzegorz; Otlewski, Jacek
2018-01-01
Fibroblast growth factor receptors (FGFRs) are promising targets for antibody-based cancer therapies, as their substantial overexpression has been found in various tumor cells. Aberrant activation of FGF receptor 2 (FGFR2) signaling through overexpression of FGFR2 and/or its ligands, mutations, or receptor amplification has been reported in multiple cancer types, including gastric, colorectal, endometrial, ovarian, breast and lung cancer. In this paper, we describe application of the phage display technology to produce a panel of high affinity single chain variable antibody fragments (scFvs) against the extracellular ligand-binding domain of FGFR2 (ECD_FGFR2). The binders were selected from the human single chain variable fragment scFv phage display libraries Tomlinson I + J and showed high specificity and binding affinity towards human FGFR2 with nanomolar KD values. To improve the affinity of the best binder selected, scFvF7, we reformatted it to a bivalent diabody format, or fused it with the Fc region (scFvF7-Fc). The scFvF7-Fc antibody construct presented the highest affinity for FGFR2, with a KD of 0.76 nM, and was selectively internalized into cancer cells overexpressing FGFR2, Snu-16 and NCI-H716. Finally, we prepared a conjugate of scFvF7-Fc with the cytotoxic drug monomethyl-auristatin E (MMAE) and evaluated its cytotoxicity. The conjugate delivered MMAE selectively to FGFR2-positive tumor cells. These results indicate that scFvF7-Fc-vcMMAE is a highly potent molecule for the treatment of cancers with FGFR2 overexpression.
Compound immobilization and drug-affinity chromatography.
Rix, Uwe; Gridling, Manuela; Superti-Furga, Giulio
2012-01-01
Bioactive small molecules act through modulating a yet unpredictable number of targets. It is therefore of critical importance to define the cellular target proteins of a compound as an entry point to understanding its mechanism of action. Often, this can be achieved in a direct fashion by chemical proteomics. As with any affinity chromatography, immobilization of the bait to a solid support is one of the earliest and most crucial steps in the process. Interfering with structural features that are important for identification of a target protein will be detrimental to binding affinity. Also, many molecules are sensitive to heat or to certain chemicals, such as acid or base, and might be destroyed during the process of immobilization, which therefore needs to be not only efficient, but also mild. The subsequent affinity chromatography step needs to preserve molecular and conformational integrity of both bait compound and proteins in order to result in the desired specific enrichment while ensuring a high level of compatibility with downstream analysis by mass spectrometry. Thus, the right choice of detergent, buffer, and protease inhibitors is also essential. This chapter describes a widely applicable procedure for the immobilization of small molecule drugs and for drug-affinity chromatography with subsequent protein identification by mass spectrometry.
Determination of High-affinity Antibody-antigen Binding Kinetics Using Four Biosensor Platforms.
Yang, Danlin; Singh, Ajit; Wu, Helen; Kroe-Barrett, Rachel
2017-04-17
Label-free optical biosensors are powerful tools in drug discovery for the characterization of biomolecular interactions. In this study, we describe the use of four routinely used biosensor platforms in our laboratory to evaluate the binding affinity and kinetics of ten high-affinity monoclonal antibodies (mAbs) against human proprotein convertase subtilisin kexin type 9 (PCSK9). While both Biacore T100 and ProteOn XPR36 are derived from the well-established Surface Plasmon Resonance (SPR) technology, the former has four flow cells connected by serial flow configuration, whereas the latter presents 36 reaction spots in parallel through an improvised 6 x 6 crisscross microfluidic channel configuration. The IBIS MX96 also operates based on the SPR sensor technology, with an additional imaging feature that provides detection in spatial orientation. This detection technique coupled with the Continuous Flow Microspotter (CFM) expands the throughput significantly by enabling multiplex array printing and detection of 96 reaction sports simultaneously. In contrast, the Octet RED384 is based on the BioLayer Interferometry (BLI) optical principle, with fiber-optic probes acting as the biosensor to detect interference pattern changes upon binding interactions at the tip surface. Unlike the SPR-based platforms, the BLI system does not rely on continuous flow fluidics; instead, the sensor tips collect readings while they are immersed in analyte solutions of a 384-well microplate during orbital agitation. Each of these biosensor platforms has its own advantages and disadvantages. To provide a direct comparison of these instruments' ability to provide quality kinetic data, the described protocols illustrate experiments that use the same assay format and the same high-quality reagents to characterize antibody-antigen kinetics that fit the simple 1:1 molecular interaction model.
Wang, Weidong; Leng, Gangsong
2007-11-01
According to the three notions of mixed affine surface area, Lp-affine surface area and Lp-mixed affine surface area proposed by Lutwak, in this article, we give the concept of ith Lp-mixed affine surface area such that the first and second notions of Lutwak are its special cases. Further, some Lutwak's results are extended associated with this concept. Besides, applying this concept, we establish an inequality for the volumes and dual quermassintegrals of a class of star bodies.
Directory of Open Access Journals (Sweden)
Yansheng Li
2016-08-01
Full Text Available With the urgent demand for automatic management of large numbers of high-resolution remote sensing images, content-based high-resolution remote sensing image retrieval (CB-HRRS-IR has attracted much research interest. Accordingly, this paper proposes a novel high-resolution remote sensing image retrieval approach via multiple feature representation and collaborative affinity metric fusion (IRMFRCAMF. In IRMFRCAMF, we design four unsupervised convolutional neural networks with different layers to generate four types of unsupervised features from the fine level to the coarse level. In addition to these four types of unsupervised features, we also implement four traditional feature descriptors, including local binary pattern (LBP, gray level co-occurrence (GLCM, maximal response 8 (MR8, and scale-invariant feature transform (SIFT. In order to fully incorporate the complementary information among multiple features of one image and the mutual information across auxiliary images in the image dataset, this paper advocates collaborative affinity metric fusion to measure the similarity between images. The performance evaluation of high-resolution remote sensing image retrieval is implemented on two public datasets, the UC Merced (UCM dataset and the Wuhan University (WH dataset. Large numbers of experiments show that our proposed IRMFRCAMF can significantly outperform the state-of-the-art approaches.
Quantitative relationship between antibody affinity and antibody avidity
International Nuclear Information System (INIS)
Griswold, W.R.
1987-01-01
The relationship between antibody avidity, measured by the dissociation of the antigen-antibody bond in antigen excess, and antibody affinity was studied. Complexes of radiolabelled antigen and antibody of known affinity were prepared in vitro and allowed to stand for seven days to reach equilibrium. Then nonlabelled antigen in one hundred fold excess was added to dissociate the complexes. After an appropriate incubation the fraction of antigen bound to antibody was measured by the ammonium sulfate precipitation method. The dissociation index was the fraction bound in the experimental sample divided by the fraction bound in the control. The correlation coefficient between the dissociation index and the antibody binding constant was 0.92 for early dissociation and 0.98 for late dissociation. The regression equation relating the binding constant to the dissociation index was K = 6.4(DI) + 6.25, where DI is the late dissociation index and K is the logarithm to the base 10 of the binding constant. There is a high correlation between avidity and affinity of antibody. Antibody affinity can be estimated from avidity data. The stability of antigen-antibody complexes can be predicted from antibody affinity
Novel trends in affinity biosensors: current challenges and perspectives
International Nuclear Information System (INIS)
Arugula, Mary A; Simonian, Aleksandr
2014-01-01
Molecular biorecognition processes facilitate physical and biochemical interactions between molecules in all crucial metabolic pathways. Perhaps the target analyte and the biorecognition element interactions have the most impactful use in biosensing applications. Traditional analytical sensing systems offer excellent biorecognition elements with the ability to detect and determine the presence of analytes. High affinity antibodies and DNA play an important role in the development of affinity biosensors based on electrochemical, optical and mass sensitive approaches. Advancements in this area routinely employ labels, label free, nanoparticles, multifunctional matrices, carbon nanotubes and other methods to meet the requirements of its own application. However, despite increasing affinity ceilings for conventional biosensors, the field draws back in meeting specifically important demands, such as long-term stability, ultrasensitivity, rapid detection, extreme selectivity, strong biological base, calibration, in vivo measurements, regeneration, satisfactory performance and ease of production. Nevertheless, recent efforts through this line have produced novel high-tech nanosensing systems such as ‘aptamers’ and ‘phages’ which exhibit high-throughput sensing. Aptamers and phages are powerful tools that excel over antibodies in sensibility, stability, multi-detection, in vivo measurements and regeneration. Phages are superior in stability, screening for affinity-based target molecules ranging from small to proteins and even cells, and easy production. In this review, we focus mainly on recent developments in affinity-based biosensors such as immunosensors, DNA sensors, emphasizing aptasensors and phage-based biosensors basing on novel electrochemical, optical and mass sensitive detection techniques. We also address enzyme inhibition-based biosensors and the current problems associated with the above sensors and their future perspectives. (topical review)
Directory of Open Access Journals (Sweden)
Xiakun Chu
2014-08-01
Full Text Available Flexibility in biomolecular recognition is essential and critical for many cellular activities. Flexible recognition often leads to moderate affinity but high specificity, in contradiction with the conventional wisdom that high affinity and high specificity are coupled. Furthermore, quantitative understanding of the role of flexibility in biomolecular recognition is still challenging. Here, we meet the challenge by quantifying the intrinsic biomolecular recognition energy landscapes with and without flexibility through the underlying density of states. We quantified the thermodynamic intrinsic specificity by the topography of the intrinsic binding energy landscape and the kinetic specificity by association rate. We found that the thermodynamic and kinetic specificity are strongly correlated. Furthermore, we found that flexibility decreases binding affinity on one hand, but increases binding specificity on the other hand, and the decreasing or increasing proportion of affinity and specificity are strongly correlated with the degree of flexibility. This shows more (less flexibility leads to weaker (stronger coupling between affinity and specificity. Our work provides a theoretical foundation and quantitative explanation of the previous qualitative studies on the relationship among flexibility, affinity and specificity. In addition, we found that the folding energy landscapes are more funneled with binding, indicating that binding helps folding during the recognition. Finally, we demonstrated that the whole binding-folding energy landscapes can be integrated by the rigid binding and isolated folding energy landscapes under weak flexibility. Our results provide a novel way to quantify the affinity and specificity in flexible biomolecular recognition.
High-throughput and multiplexed regeneration buffer scouting for affinity-based interactions
Geuijen, K.P.M.; Schasfoort, R.B.; Wijffels, R.H.; Eppink, M.H.M.
2014-01-01
Affinity-based analyses on biosensors depend partly on regeneration between measurements. Regeneration is performed with a buffer that efficiently breaks all interactions between ligand and analyte while maintaining the active binding site of the ligand. We demonstrated a regeneration buffer
Fujii, Rika; Schlom, Jeffrey; Hodge, James W
2018-05-01
OBJECTIVE Chordoma is a rare bone tumor derived from the notochord and is resistant to conventional therapies such as chemotherapy, radiotherapy, and targeting therapeutics. Expression of epidermal growth factor receptor (EGFR) in a large proportion of chordoma specimens indicates a potential target for therapeutic intervention. In this study the authors investigated the potential role of the anti-EGFR antibody cetuximab in immunotherapy for chordoma. METHODS Since cetuximab is a monoclonal antibody of the IgG1 isotype, it has the potential to mediate antibody-dependent cell-mediated cytotoxicity (ADCC) employing natural killer (NK) cells as effectors. Polymorphisms in the CD16 allele expressed on NK cells have been shown to influence the degree of ADCC of tumor cells, with the high-affinity valine (V)/V allele being responsible for more lysis than the V/phenylalanine (F) or FF allele. Unfortunately, however, only approximately 10% of the population expresses the VV allele on NK cells. An NK cell line, NK-92, has now been engineered to endogenously express IL-2 and the high-affinity CD16 allele. These irradiated high-affinity (ha)NK cells were analyzed for lysis of chordoma cells with and without cetuximab, and the levels of lysis observed in ADCC were compared with those of NK cells from donors expressing the VV, VF, and FF alleles. RESULTS Here the authors demonstrate for the first time 1) that cetuximab in combination with NK cells can mediate ADCC of chordoma cells; 2) the influence of the NK CD16 polymorphism in cetuximab-mediated ADCC for chordoma cell lysis; 3) that engineered haNK cells-that is, cells transduced to express the CD16 V158 FcγRIIIa receptor-bind cetuximab with similar affinity to normal NK cells expressing the high-affinity VV allele; and 4) that irradiated haNK cells induce ADCC with cetuximab in chordoma cells. CONCLUSIONS These studies provide rationale for the use of cetuximab in combination with irradiated haNK cells for therapy for
Bhat, Kamakoti P.; Bétous, Rémy; Cortez, David
2015-01-01
SMARCAL1 catalyzes replication fork remodeling to maintain genome stability. It is recruited to replication forks via an interaction with replication protein A (RPA), the major ssDNA-binding protein in eukaryotic cells. In addition to directing its localization, RPA also activates SMARCAL1 on some fork substrates but inhibits it on others, thereby conferring substrate specificity to SMARCAL1 fork-remodeling reactions. We investigated the mechanism by which RPA regulates SMARCAL1. Our results indicate that although an interaction between SMARCAL1 and RPA is essential for SMARCAL1 activation, the location of the interacting surface on RPA is not. Counterintuitively, high-affinity DNA binding of RPA DNA-binding domain (DBD) A and DBD-B near the fork junction makes it easier for SMARCAL1 to remodel the fork, which requires removing RPA. We also found that RPA DBD-C and DBD-D are not required for SMARCAL1 regulation. Thus, the orientation of the high-affinity RPA DBDs at forks dictates SMARCAL1 substrate specificity. PMID:25552480
Bhat, Kamakoti P; Bétous, Rémy; Cortez, David
2015-02-13
SMARCAL1 catalyzes replication fork remodeling to maintain genome stability. It is recruited to replication forks via an interaction with replication protein A (RPA), the major ssDNA-binding protein in eukaryotic cells. In addition to directing its localization, RPA also activates SMARCAL1 on some fork substrates but inhibits it on others, thereby conferring substrate specificity to SMARCAL1 fork-remodeling reactions. We investigated the mechanism by which RPA regulates SMARCAL1. Our results indicate that although an interaction between SMARCAL1 and RPA is essential for SMARCAL1 activation, the location of the interacting surface on RPA is not. Counterintuitively, high-affinity DNA binding of RPA DNA-binding domain (DBD) A and DBD-B near the fork junction makes it easier for SMARCAL1 to remodel the fork, which requires removing RPA. We also found that RPA DBD-C and DBD-D are not required for SMARCAL1 regulation. Thus, the orientation of the high-affinity RPA DBDs at forks dictates SMARCAL1 substrate specificity. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Erspamer, V; Melchiorri, P; Falconieri-Erspamer, G; Negri, L; Corsi, R; Severini, C; Barra, D; Simmaco, M; Kreil, G
1989-07-01
Deltorphins are endogenous linear heptapeptides, isolated from skin extracts of frogs belonging to the genus Phyllomedusa, that have a higher affinity and selectivity for delta opioid binding sites than any other natural compound known. Two deltorphins with the sequence Tyr-Ala-Phe-Asp(or Glu)-Val-Val-Gly-NH2 have been isolated from skin extracts of Phyllomedusa bicolor. The alanine in position 2 is in the D configuration. These peptides, [D-Ala2]deltorphins I and II, show an even higher affinity for delta receptors than the previously characterized deltorphin, which contains D-methionine as the second amino acid. These peptides show some similarity to another constituent of Phyllomedusa skin, dermorphin, which is highly selective for mu-opioid receptors. These peptides all have the N-terminal sequence Tyr-D-Xaa-Phe, where D-Xaa is either D-alanine or D-methionine. While this structure seems to be capable of activating both mu and delta opioid receptors, differences in the C-terminal regions of these peptides are probably responsible for the observed high receptor selectivity of dermorphin and deltorphin.
DEFF Research Database (Denmark)
Vogensen, Stine B.; Marek, Ales; Bay, Tina
2013-01-01
3-Hydroxycyclopent-1-enecarboxylic acid (HOCPCA, 1) is a potent ligand for the high-affinity GHB binding sites in the CNS. An improved synthesis of 1 together with a very efficient synthesis of [3H]-1 is described. The radiosynthesis employs in situ generated lithium trimethoxyborotritide. Screen...
Phosphopeptide enrichment by immobilized metal affinity chromatography
DEFF Research Database (Denmark)
Thingholm, Tine E.; Larsen, Martin R.
2016-01-01
Immobilized metal affinity chromatography (IMAC) has been the method of choice for phosphopeptide enrichment prior to mass spectrometric analysis for many years and it is still used extensively in many laboratories. Using the affinity of negatively charged phosphate groups towards positively...... charged metal ions such as Fe3+, Ga3+, Al3+, Zr4+, and Ti4+ has made it possible to enrich phosphorylated peptides from peptide samples. However, the selectivity of most of the metal ions is limited, when working with highly complex samples, e.g., whole-cell extracts, resulting in contamination from...
Mapping Affinities in Academic Organizations
Directory of Open Access Journals (Sweden)
Dario Rodighiero
2018-02-01
Full Text Available Scholarly affinities are one of the most fundamental hidden dynamics that drive scientific development. Some affinities are actual, and consequently can be measured through classical academic metrics such as co-authoring. Other affinities are potential, and therefore do not leave visible traces in information systems; for instance, some peers may share interests without actually knowing it. This article illustrates the development of a map of affinities for academic collectives, designed to be relevant to three audiences: the management, the scholars themselves, and the external public. Our case study involves the School of Architecture, Civil and Environmental Engineering of EPFL, hereinafter ENAC. The school consists of around 1,000 scholars, 70 laboratories, and 3 institutes. The actual affinities are modeled using the data available from the information systems reporting publications, teaching, and advising scholars, whereas the potential affinities are addressed through text mining of the publications. The major challenge for designing such a map is to represent the multi-dimensionality and multi-scale nature of the information. The affinities are not limited to the computation of heterogeneous sources of information; they also apply at different scales. The map, thus, shows local affinities inside a given laboratory, as well as global affinities among laboratories. This article presents a graphical grammar to represent affinities. Its effectiveness is illustrated by two actualizations of the design proposal: an interactive online system in which the map can be parameterized, and a large-scale carpet of 250 square meters. In both cases, we discuss how the materiality influences the representation of data, in particular the way key questions could be appropriately addressed considering the three target audiences: the insights gained by the management and their consequences in terms of governance, the understanding of the scholars’ own
International Nuclear Information System (INIS)
Leeb-Lundberg, L.M.F.; Dickinson, K.E.J.; Heald, S.L.
1984-01-01
A description is given of the synthesised and characterization of a novel high affinity radioiodinated α 1 -adrenergic receptor photoaffinity probe, 4-amino-6,7-dimethoxy-2-[4-[5-(4-azido-3-[ 125 I]iodophenyl)pentanoyl]-1-piperazinyl] quinazoline. In the absence of light, this ligand binds with high affinity (K/sub d/ = 130 pm) in a reverisble and saturable manner to sites in rat hepatic plasma membranes. The binding is stereoselective and competitively inhibited by adrenergic agonists and antagonists with an α 1 -adrenergic specificity. Upon photolysis, this ligand incorporates irreversibly into plasma membranes prepared from several mammalian tissues including rat liver, rat, guinea pig, and rabbit spleen, rabbit lung, and rabbit aorta vascular smooth muscle cells, also with typical α 1 -adrenergic specificity. Autoradiograms of such membrane samples subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis reveal a major specifically labeled polypeptide at M/sub 4/ = 78,000-85,000, depending on the tissue used, in addition to some lower molecular weight peptides. Protease inhibitors, in particular EDTA, a metalloprotease inhibitor, dramatically increases the predominance of the M/sub r/ = 78,000-85,000 polypeptide while attenuating the labeling of the lower molecular weight bands. This new high affinity radioiodinated photoaffinity probe should be of great value for the molecular characterization of the α 1 -adrenergic receptor
Decker, T; Schneller, F; Kronschnabl, M; Dechow, T; Lipford, G B; Wagner, H; Peschel, C
2000-05-01
CpG-oligodeoxynucleotides (CpG-ODN) have been shown to induce proliferation, cytokine production, and surface molecule regulation in normal and malignant human B cells. In the present study, we investigated the potential of CpG-ODN to induce functional high-affinity receptors in leukemic and normal B cells and the effects of costimulation with IL-2 on proliferation, cytokine secretion, and surface molecule regulation. Highly purified B cells from B-CLL patients and normal controls were stimulated with CpG-ODN with or without IL-2. Expression of CD25 was determined using FACS, and the presence of high-affinity IL-2 receptors was determined by scatchard analysis. Costimulatory effects of IL-2 and CpG-ODN were investigated using proliferation assays, ELISA (IL-6, TNF-alpha), and FACS analysis (CD80, CD86 expression). Reactivity of autologous and allogeneic T cells toward activated B-CLL cells was determined in mixed lymphocyte reactions and Interferon-gamma Elispot assays. The CpG-ODN DSP30 caused a significantly stronger induction of the IL-2 receptor alpha chain in malignant as compared with normal B cells (p = 0.03). This resulted in the expression of functional high-affinity IL-2 receptors in B-CLL cells, but fewer numbers of receptors with less affinity were expressed in normal B cells. Although addition of IL-2 to CpG-ODN-stimulated cells augmented proliferation in both normal B cells and B-CLL cells, no costimulatory effect on cytokine production or surface molecule expression could be observed in normal B cells. In contrast, TNF-alpha and IL-6 production was increased in B-CLL cells, and the expression of CD80 and CD86 was further enhanced when IL-2 was used as a costimulus. Autologous and allogeneic immune recognition of B-CLL cells stimulated with CpG-ODN and IL-2 was increased compared with B-CLL cells stimulated with CpG-ODN alone. Stimulation of B-CLL cells with CpG-ODN and IL-2 might be an attractive strategy for potential immunotherapies for B
Functional characterization of the high affinity IgG Receptor : making heads and tails of FcγRI
van der Poel, C.E.
2011-01-01
This thesis focuses on human FcγRI, a high affinity receptor for antibodies of the IgG isotype. IgG is the most abundant antibody type in blood and all currently FDA approved therapeutic antibodies are of the IgG isotype. FcγRI, a member of the activating Fcγ receptors, exists as a complex of a
Shiomi, K; Yamaguchi, S; Shimakura, K; Nagashima, Y; Yamamori, K; Matsui, T
1993-12-01
A purification method for tetrodotoxin (TTX), based on affinity chromatography using the TTX-binding high mol. wt substances in the body fluid of shore crab (Hemigrapsus sanguineus) as ligands, was developed. This method was particularly useful for analysis of TTX in biological samples with low concentrations of TTX. The affinity gel prepared was highly specific for TTX, having no ability to bind 4-epi-TTX and anhydro-TTX as well as saxitoxin.
Muro, Silvia; Dziubla, Thomas; Qiu, Weining; Leferovich, John; Cui, Xiumin; Berk, Erik; Muzykantov, Vladimir R
2006-06-01
Targeting of diagnostic and therapeutic agents to endothelial cells (ECs) provides an avenue to improve treatment of many maladies. For example, intercellular adhesion molecule 1 (ICAM-1), a constitutive endothelial cell adhesion molecule up-regulated in many diseases, is a good determinant for endothelial targeting of therapeutic enzymes and polymer nanocarriers (PNCs) conjugated with anti-ICAM (anti-ICAM/PNCs). However, intrinsic and extrinsic factors that control targeting of anti-ICAM/PNCs to ECs (e.g., anti-ICAM affinity and PNC valency and flow) have not been defined. In this study we tested in vitro and in vivo parameters of targeting to ECs of anti-ICAM/PNCs consisting of either prototype polystyrene or biodegradable poly(lactic-coglycolic) acid polymers (approximately 200 nm diameter spheres carrying approximately 200 anti-ICAM molecules). Anti-ICAM/PNCs, but not control IgG/PNCs 1) rapidly (t1/2 approximately 5 min) and specifically bound to tumor necrosis factor-activated ECs in a dose-dependent manner (Bmax approximately 350 PNC/cell) at both static and physiological shear stress conditions and 2) bound to ECs and accumulated in the pulmonary vasculature after i.v. injection in mice. Anti-ICAM/PNCs displayed markedly higher EC affinity versus naked anti-ICAM (Kd approximately 80 pM versus approximately 8 nM) in cell culture and, probably because of this factor, higher value (185.3 +/- 24.2 versus 50.5 +/- 1.5% injected dose/g) and selectivity (lung/blood ratio 81.0 +/- 10.9 versus 2.1 +/- 0.02, in part due to faster blood clearance) of pulmonary targeting. These results 1) show that reformatting monomolecular anti-ICAM into high-affinity multivalent PNCs boosts their vascular immuno-targeting, which withstands physiological hydrodynamics and 2) support potential anti-ICAM/PNCs utility for medical applications.
Fundamentals of affinity cell separations.
Zhang, Ye; Lyons, Veronica; Pappas, Dimitri
2018-03-01
Cell separations using affinity methods continue to be an enabling science for a wide variety of applications. In this review, we discuss the fundamental aspects of affinity separation, including the competing forces for cell capture and elution, cell-surface interactions, and models for cell adhesion. Factors affecting separation performance such as bond affinity, contact area, and temperature are presented. We also discuss and demonstrate the effects of nonspecific binding on separation performance. Metrics for evaluating cell separations are presented, along with methods of comparing separation techniques for cell isolation using affinity capture. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Energy Technology Data Exchange (ETDEWEB)
Ross, S.B. [Astra Arcus AB, Dept. of Neuropharmacology, Soedertaelje (Sweden)
1995-06-01
The characteristics of the binding of {sup 3}H-proadifen to rat liver membranes were studied and compared to those of {sup 3}H-cocaine. It was found that {sup 3}H-proadifen was bound reversibly with high affinity (K{sub D}=1.8{+-}0.5 nM) and large capacity (B{sub max}=2010{+-}340 pmol/g wet tissue) to liver membranes. The corresponding values for the {sup 3}H-cocaine binding were 3.5 nM and 1000 pmol/g wet tissue. The binding of {sup 3}H-proadifen was mainly localised to the microsomal fraction. The number of binding sites was not increased by treatment of rats with phenobarbitone. With 1 {mu}M CdCl{sub 2} in the incubation buffer it was possible to differentiate between two {sup 3}H-cocaine binding sites with K{sub d} values of 1.6 and 7.7 nM and B{sub max} values of 280 and 940 pmol/g wet liver tissue. S-(-)-Alaproclate inhibited the binding of {sup 3}H-proadifen and {sup 3}H-cocaine inhibited the binding of {sup 3}H-proadifen (IC{sub 50}=10 nM) and proadifen that of {sup 3}H-cocaine (IC{sub 50}=1 nM). There was a high correlation coefficient (r{sub r}=0.972; P<0.01; n=12) in the Spearman rank test between the inhibitory potencies of compounds examined in both systems. Beside some potent alaproclate analogues a couple of compounds had moderately high affinity (IC{sub 50}=100-500 nM): chloroquine, phenoxybenzamine, amitriptyline, ajmaline, remoxipride, imipramine and (-)-alaprenolol. CdCl{sub 2}, ZnCl{sub 2} and CuCl{sub 2} inhibited the binding of both ligands with low Hill coefficients, indicating heterogeneous binding sites. The inhibition curve of Cd{sup 2+} on the cocaine binding was biphasic with a high affinity part around 50 nM and a low affinity part at 15{mu}M. The similarity of the characteristics of the binding of these ligands with that of {sup 3}H-alaproclate is discussed. It is suggested that all three compounds bind to the same sites, although additional binding sites seem to exist for proadifen. (au) (9 refs.).
Koch, Katherine S; Moran, Tom; Shier, W Thomas; Leffert, Hyam L
2018-05-01
Long-term cultures of primary adult rat hepatocytes were used to study the effects of N-acetyl-2-aminofluorene (AAF) on hepatocyte proliferation during the growth cycle; on the initiation of hepatocyte DNA synthesis in quiescent cultures; and, on hepatocyte DNA replication following the initiation of DNA synthesis. Scatchard analyses were used to identify the pharmacologic properties of radiolabeled AAF metabolite binding to hepatocyte macromolecules. Two classes of growth cycle-dependent AAF metabolite binding sites-a high-affinity low-capacity site (designated Site I) and a low-affinity high-capacity site (designated Site II)-associated with two spatially distinct classes of macromolecular targets, were revealed. Based upon radiolabeled AAF metabolite binding to purified hepatocyte genomic DNA or to DNA, RNA, proteins, and lipids from isolated nuclei, Site IDAY 4 targets (KD[APPARENT] ≈ 2-4×10-6 M and BMAX[APPARENT] ≈ 6 pmol/106 cells/24 h) were consistent with genomic DNA; and with AAF metabolized by a nuclear cytochrome P450. Based upon radiolabeled AAF binding to total cellular lysates, Site IIDAY 4 targets (KD[APPARENT] ≈ 1.5×10-3 M and BMAX[APPARENT] ≈ 350 pmol/106 cells/24 h) were consistent with cytoplasmic proteins; and with AAF metabolized by cytoplasmic cytochrome P450s. DNA synthesis was not inhibited by concentrations of AAF that saturated DNA binding in the neighborhood of the Site I KD. Instead, hepatocyte DNA synthesis inhibition required higher concentrations of AAF approaching the Site II KD. These observations raise the possibility that carcinogenic DNA adducts derived from AAF metabolites form below concentrations of AAF that inhibit replicative and repair DNA synthesis.
Braun, Michael B.; Traenkle, Bjoern; Koch, Philipp A.; Emele, Felix; Weiss, Frederik; Poetz, Oliver; Stehle, Thilo; Rothbauer, Ulrich
2016-01-01
Nanobodies are highly valuable tools for numerous bioanalytical and biotechnical applications. Here, we report the characterization of a nanobody that binds a short peptide epitope with extraordinary affinity. Structural analysis reveals an unusual binding mode where the extended peptide becomes part of a ?-sheet structure in the nanobody. This interaction relies on sequence-independent backbone interactions augmented by a small number of specificity-determining side chain contacts. Once boun...
Directory of Open Access Journals (Sweden)
Jenny Bostrom
Full Text Available The antigen-binding site of Herceptin, an anti-human Epidermal Growth Factor Receptor 2 (HER2 antibody, was engineered to add a second specificity toward Vascular Endothelial Growth Factor (VEGF to create a high affinity two-in-one antibody bH1. Crystal structures of bH1 in complex with either antigen showed that, in comparison to Herceptin, this antibody exhibited greater conformational variability, also called "structural plasticity". Here, we analyzed the biophysical and thermodynamic properties of the dual specific variants of Herceptin to understand how a single antibody binds two unrelated protein antigens. We showed that while bH1 and the affinity-improved bH1-44, in particular, maintained many properties of Herceptin including binding affinity, kinetics and the use of residues for antigen recognition, they differed in the binding thermodynamics. The interactions of bH1 and its variants with both antigens were characterized by large favorable entropy changes whereas the Herceptin/HER2 interaction involved a large favorable enthalpy change. By dissecting the total entropy change and the energy barrier for dual interaction, we determined that the significant structural plasticity of the bH1 antibodies demanded by the dual specificity did not translate into the expected increase of entropic penalty relative to Herceptin. Clearly, dual antigen recognition of the Herceptin variants involves divergent antibody conformations of nearly equivalent energetic states. Hence, increasing the structural plasticity of an antigen-binding site without increasing the entropic cost may play a role for antibodies to evolve multi-specificity. Our report represents the first comprehensive biophysical analysis of a high affinity dual specific antibody binding two unrelated protein antigens, furthering our understanding of the thermodynamics that drive the vast antigen recognition capacity of the antibody repertoire.
Two distinct affinity binding sites for IL-1 on human cell lines
International Nuclear Information System (INIS)
Bensimon, C.; Wakasugi, N.; Tagaya, Y.; Takakura, K.; Yodoi, J.; Tursz, T.; Wakasugi, H.
1989-01-01
We used two human cell lines, NK-like YT-C3 and an EBV-containing B cell line, 3B6, as models to study the receptor(s) for IL-1. Two distinct types of saturable binding sites were found on both cell lines at 37 degrees C. Between 1 pM and 100 pM of 125I-IL-1-alpha concentration, saturable binding sites were detected on the YT-C3 cells with a K of 4 x 10(-11) M. The K found for the IL-1-alpha binding sites on 3B6 cells was 7.5 x 10(-11) M. An additional binding curve was detected above 100 pM on YT-C3 cells with a K of 7 x 10(-9) M and on 3B6 cells with a K of 5 x 10(-9) M. Scatchard plot analysis revealed 600 sites/cell with high affinity binding and 7000 sites/cell with low affinity for YT-C3 cells and 300 sites/cell with high affinity binding and 6000 sites/cell with low affinity for 3B6 cells. At 37 degrees C, the internalization of 125I-labeled IL-1 occurred via both high and low affinity IL-1R on both YT-C3 and 3B6 cells, whereas the rates of internalization for high affinity binding sites on YT-C3 cells were predominant in comparison to that of low affinity binding sites. In chemical cross-linking studies of 125 I-IL-1-alpha to 3B6 and YT-C3 cells, two protein bands were immunoprecipitated with Mr around 85 to 90 kDa leading to an estimation of the Mr of the IL-1R around 68 to 72 kDa. In similar experiments, the Mr found for the IL-1R expressed on the murine T cell line EL4 was slightly higher (around 80 kDa). Whether these distinct affinity binding sites are shared by a single molecule or by various chains remains to be elucidated
International Nuclear Information System (INIS)
Borgundvaag, B.; George, S.R.
1985-01-01
The diterpinoid forskolin stimulated adenylate cyclase activity (measured by conversion of [ 3 H]-ATP to [ 3 H]-cAMP) in anterior pituitary from male and female rats. Inhibition of stimulated adenylate cyclase activity by potent dopaminergic agonists was demonstrable only in female anterior pituitary. The inhibition of adenylate cyclase activity displayed a typically dopaminergic rank order of agonist potencies and could be completely reversed by a specific dopamine receptor antagonist. The IC 50 values of dopamine agonist inhibition of adenylate cyclase activity correlated with equal molarity with the dissociation constant of the high-affinity dopamine agonist-detected receptor binding site and with the IC 50 values for inhibition of prolactin secretion. These findings support the hypothesis that it is the high-affinity form of the D 2 dopamine receptor in anterior pituitary which is responsible for mediating the dopaminergic function of attenuating adenylate cyclase activity. 12 references, 4 figures, 1 table
Ikeda, Koki; Koga, Tomoaki; Sasaki, Fumiyuki; Ueno, Ayumi; Saeki, Kazuko; Okuno, Toshiaki; Yokomizo, Takehiko
2017-05-13
DYKDDDDK peptide (FLAG) is a useful tool for investigating the function and localization of proteins whose antibodies (Abs) are not available. We recently established a high-affinity monoclonal antibody (mAb) for FLAG (clone 2H8). The 2H8 Ab is highly sensitive for detecting FLAG-tagged proteins by flowcytometry and immunoprecipitation, but it can yield nonspecific signals in immunohistochemistry of mouse tissues because it is of mouse origin. In this study, we reduced nonspecific signals by generating a chimeric 2H8 Ab with Fc fragments derived from human immunoglobulin. We fused a 5' terminal cDNA fragments for the Fab region of 2H8 mAb with 3' terminal cDNA fragments for Fc region of human IgG1. We transfected both chimeric plasmids and purified the resulting human-mouse chimeric 2H8. The chimeric 2H8 Ab successfully detected FLAG-tagged proteins in flowcytometry with anti-human IgG secondary Ab with comparable sensitivity to 2H8 mAb. Importantly, chimeric 2H8 detected specific FLAG peptide signals without nonspecific signals in immunohistochemical analysis with mouse tissues. This human-mouse chimeric high-affinity anti-FLAG Ab will prove useful for future immunohistochemical analysis of mouse tissues. Copyright © 2017 Elsevier Inc. All rights reserved.
A High Affinity Adenosine Kinase from Anopheles gambiae
Cassera, María B.; Ho, Meng-Chiao; Merino, Emilio F.; Burgos, Emmanuel S.; Rinaldo-Matthis, Agnes; Almo, Steven C.; Schramm, Vern L.
2011-01-01
Genome analysis revealed a mosquito orthologue of adenosine kinase in Anopheles gambiae (AgAK; the most important vector for the transmission of Plasmodium falciparum in Africa). P. falciparum are purine auxotrophs and do not express an adenosine kinase but rely on their hosts for purines. AgAK was kinetically characterized and found to have the highest affinity for adenosine (Km 8.1 nM) of any known adenosine kinase. AgAK is specific for adenosine at the nucleoside site but several nucleotide triphosphate phosphoryl donors are tolerated. The AgAK crystal structure with a bound bisubstrate analogue Ap4A (2.0 Å resolution) reveals interactions for adenosine, ATP and the geometry for phosphoryl transfer. The polyphosphate charge is partly neutralized by a bound Mg2+ ion and an ion pair to a catalytic site Arg. The AgAK structure consists of a large catalytic core in a three-layered α/β/α sandwich, and a small cap domain in contact with adenosine. The specificity and tight-binding for adenosine arises from hydrogen bond interactions of Asn14, Leu16, Leu40, Leu133, Leu168, Phe168 and Thr171 and the backbone of Ile39 and Phe168 with the adenine ring as well as through hydrogen bond interactions between Asp18, Gly64 and Asn68 and the ribosyl 2′- and 3′-hydroxyl groups. The structure is more similar to human adenosine kinase (48% identity) than to AK from Toxoplasma gondii (31% identity). With this extraordinary affinity for AgAK, adenosine is efficiently captured and converted to AMP at near the diffusion limit, suggesting an important role of this enzyme to maintain the adenine nucleotide pool. mRNA analysis verifies that AgAK transcripts are produced in the adult insects. PMID:21247194
Affinity chromatography: A versatile technique for antibody purification.
Arora, Sushrut; Saxena, Vikas; Ayyar, B Vijayalakshmi
2017-03-01
Antibodies continue to be extremely utilized entities in myriad applications including basic research, imaging, targeted delivery, chromatography, diagnostics, and therapeutics. At production stage, antibodies are generally present in complex matrices and most of their intended applications necessitate purification. Antibody purification has always been a major bottleneck in downstream processing of antibodies, due to the need of high quality products and associated high costs. Over the years, extensive research has focused on finding better purification methodologies to overcome this holdup. Among a plethora of different techniques, affinity chromatography is one of the most selective, rapid and easy method for antibody purification. This review aims to provide a detailed overview on affinity chromatography and the components involved in purification. An array of support matrices along with various classes of affinity ligands detailing their underlying working principles, together with the advantages and limitations of each system in purifying different types of antibodies, accompanying recent developments and important practical methodological considerations to optimize purification procedure are discussed. Copyright © 2016 Elsevier Inc. All rights reserved.
Affinity purification using recombinant PXR as a tool to characterize environmental ligands.
Dagnino, Sonia; Bellet, Virginie; Grimaldi, Marina; Riu, Anne; Aït-Aïssa, Sélim; Cavaillès, Vincent; Fenet, Hélène; Balaguer, Patrick
2014-02-01
Many environmental endocrine disrupting compounds act as ligands for nuclear receptors. The human pregnane X receptor (hPXR), for instance, is activated by a variety of environmental ligands such as steroids, pharmaceutical drugs, pesticides, alkylphenols, polychlorinated biphenyls and polybromo diethylethers. Some of us have previously reported the occurrence of hPXR ligands in environmental samples but failed to identify them. The aim of this study was to test whether a PXR-affinity column, in which recombinant hPXR was immobilized on solid support, could help the purification of these chemicals. Using PXR ligands of different affinity (10 nM < EC50 < 10 μM), we demonstrated that the PXR-affinity preferentially column captured ligands with medium to high affinities (EC50 < 1 μM). Furthermore, by using the PXR-affinity column to analyze an environmental sample containing ERα, AhR, AR, and PXR activities, we show that (i) half of the PXR activity of the sample was due to compounds with medium to high affinity for PXR and (ii) PXR shared ligands with ERα, AR, and AhR. These findings demonstrate that the newly developed PXR-affinity column coupled to reporter cell lines represents a valuable tool for the characterization of the nature of PXR active compounds and should therefore guide and facilitate their further analysis. Copyright © 2012 Wiley Periodicals, Inc., a Wiley company.
International Nuclear Information System (INIS)
Cadavid, A.C.
1989-01-01
The author constructs a non-Abelian field theory by gauging a Kac-Moody algebra, obtaining an infinite tower of interacting vector fields and associated ghosts, that obey slightly modified Feynman rules. She discusses the spontaneous symmetry breaking of such theory via the Higgs mechanism. If the Higgs particle lies in the Cartan subalgebra of the Kac-Moody algebra, the previously massless vectors acquire a mass spectrum that is linear in the Kac-Moody index and has additional fine structure depending on the associated Lie algebra. She proceeds to show that there is no obstacle in implementing the affine extension of supersymmetric Yang-Mills theories. The result is valid in four, six and ten space-time dimensions. Then the affine extension of supergravity is investigated. She discusses only the loop algebra since the affine extension of the super-Poincare algebra appears inconsistent. The construction of the affine supergravity theory is carried out by the group manifold method and leads to an action describing infinite towers of spin 2 and spin 3/2 fields that interact subject to the symmetries of the loop algebra. The equations of motion satisfy the usual consistency check. Finally, she postulates a theory in which both the vector and scalar fields lie in the loop algebra of SO(3). This theory has an expanded soliton sector, and corresponding to the original 't Hooft-Polyakov solitonic solutions she now finds an infinite family of exact, special solutions of the new equations. She also proposes a perturbation method for obtaining an arbitrary solution of those equations for each level of the affine index
International Nuclear Information System (INIS)
Hou, Feng; Miyakawa, Takuya; Kataoka, Michihiko; Takeshita, Daijiro; Kumashiro, Shoko; Uzura, Atsuko; Urano, Nobuyuki; Nagata, Koji; Shimizu, Sakayu; Tanokura, Masaru
2014-01-01
Highlights: • Crystal structure of AtQR has been determined at 1.72 Å. • NADH binding induces the formation of substrate binding site. • AtQR possesses a conserved hydrophobic wall for stereospecific binding of substrate. • Additional Glu197 residue is critical to the high binding affinity. - Abstract: (R)-3-Quinuclidinol, a useful compound for the synthesis of various pharmaceuticals, can be enantioselectively produced from 3-quinuclidinone by 3-quinuclidinone reductase. Recently, a novel NADH-dependent 3-quinuclidionone reductase (AtQR) was isolated from Agrobacterium tumefaciens, and showed much higher substrate-binding affinity (>100 fold) than the reported 3-quinuclidionone reductase (RrQR) from Rhodotorula rubra. Here, we report the crystal structure of AtQR at 1.72 Å. Three NADH-bound protomers and one NADH-free protomer form a tetrameric structure in an asymmetric unit of crystals. NADH not only acts as a proton donor, but also contributes to the stability of the α7 helix. This helix is a unique and functionally significant part of AtQR and is related to form a deep catalytic cavity. AtQR has all three catalytic residues of the short-chain dehydrogenases/reductases family and the hydrophobic wall for the enantioselective reduction of 3-quinuclidinone as well as RrQR. An additional residue on the α7 helix, Glu197, exists near the active site of AtQR. This acidic residue is considered to form a direct interaction with the amine part of 3-quinuclidinone, which contributes to substrate orientation and enhancement of substrate-binding affinity. Mutational analyses also support that Glu197 is an indispensable residue for the activity
Energy Technology Data Exchange (ETDEWEB)
Hou, Feng; Miyakawa, Takuya [Department of Applied Biological Chemistry, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan); Kataoka, Michihiko [Division of Applied Life Sciences, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 559-8531 (Japan); Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Kitashirakawa-Oiwakecho, Sakyo-ku, Kyoto 606-8502 (Japan); Takeshita, Daijiro [Department of Applied Biological Chemistry, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan); Kumashiro, Shoko [Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Kitashirakawa-Oiwakecho, Sakyo-ku, Kyoto 606-8502 (Japan); Uzura, Atsuko [Research and Development Center, Nagase and Co., Ltd., 2-2-3 Muratani, Nishi-ku, Kobe 651-2241 (Japan); Urano, Nobuyuki [Division of Applied Life Sciences, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 559-8531 (Japan); Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Kitashirakawa-Oiwakecho, Sakyo-ku, Kyoto 606-8502 (Japan); Nagata, Koji [Department of Applied Biological Chemistry, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan); Shimizu, Sakayu [Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Kitashirakawa-Oiwakecho, Sakyo-ku, Kyoto 606-8502 (Japan); Faculty of Bioenvironmental Science, Kyoto Gakuen University, Sogabe-cho, Kameoka 621-8555 (Japan); Tanokura, Masaru, E-mail: amtanok@mail.ecc.u-tokyo.ac.jp [Department of Applied Biological Chemistry, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan)
2014-04-18
Highlights: • Crystal structure of AtQR has been determined at 1.72 Å. • NADH binding induces the formation of substrate binding site. • AtQR possesses a conserved hydrophobic wall for stereospecific binding of substrate. • Additional Glu197 residue is critical to the high binding affinity. - Abstract: (R)-3-Quinuclidinol, a useful compound for the synthesis of various pharmaceuticals, can be enantioselectively produced from 3-quinuclidinone by 3-quinuclidinone reductase. Recently, a novel NADH-dependent 3-quinuclidionone reductase (AtQR) was isolated from Agrobacterium tumefaciens, and showed much higher substrate-binding affinity (>100 fold) than the reported 3-quinuclidionone reductase (RrQR) from Rhodotorula rubra. Here, we report the crystal structure of AtQR at 1.72 Å. Three NADH-bound protomers and one NADH-free protomer form a tetrameric structure in an asymmetric unit of crystals. NADH not only acts as a proton donor, but also contributes to the stability of the α7 helix. This helix is a unique and functionally significant part of AtQR and is related to form a deep catalytic cavity. AtQR has all three catalytic residues of the short-chain dehydrogenases/reductases family and the hydrophobic wall for the enantioselective reduction of 3-quinuclidinone as well as RrQR. An additional residue on the α7 helix, Glu197, exists near the active site of AtQR. This acidic residue is considered to form a direct interaction with the amine part of 3-quinuclidinone, which contributes to substrate orientation and enhancement of substrate-binding affinity. Mutational analyses also support that Glu197 is an indispensable residue for the activity.
Enhanced membrane pore formation through high-affinity targeted antimicrobial peptides.
Directory of Open Access Journals (Sweden)
Christopher J Arnusch
Full Text Available Many cationic antimicrobial peptides (AMPs target the unique lipid composition of the prokaryotic cell membrane. However, the micromolar activities common for these peptides are considered weak in comparison to nisin, which follows a targeted, pore-forming mode of action. Here we show that AMPs can be modified with a high-affinity targeting module, which enables membrane permeabilization at low concentration. Magainin 2 and a truncated peptide analog were conjugated to vancomycin using click chemistry, and could be directed towards specific membrane embedded receptors both in model membrane systems and whole cells. Compared with untargeted vesicles, a gain in permeabilization efficacy of two orders of magnitude was reached with large unilamellar vesicles that included lipid II, the target of vancomycin. The truncated vancomycin-peptide conjugate showed an increased activity against vancomycin resistant Enterococci, whereas the full-length conjugate was more active against a targeted eukaryotic cell model: lipid II containing erythrocytes. This study highlights that AMPs can be made more selective and more potent against biological membranes that contain structures that can be targeted.
Energy Technology Data Exchange (ETDEWEB)
Orcutt, Kelly Davis; Slusarczyk, Adrian L. [Department of Chemical Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Cieslewicz, Maryelise [Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Ruiz-Yi, Benjamin [Department of Chemical Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Bhushan, Kumar R. [Division of Hematology/Oncology, Beth Israel Deaconess Medical Center, Boston, MA 02215 (United States); Frangioni, John V. [Division of Hematology/Oncology, Beth Israel Deaconess Medical Center, Boston, MA 02215 (United States); Department of Radiology, Beth Israel Deaconess Medical Center, Boston, MA 02215 (United States); Wittrup, K. Dane, E-mail: wittrup@mit.ed [Department of Chemical Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States)
2011-02-15
Introduction: In pretargeted radioimmunotherapy (PRIT), a bifunctional antibody is administered and allowed to pre-localize to tumor cells. Subsequently, a chelated radionuclide is administered and captured by cell-bound antibody while unbound hapten clears rapidly from the body. We aim to engineer high-affinity binders to 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA) chelates for use in PRIT applications. Methods: We mathematically modeled antibody and hapten pharmacokinetics to analyze hapten tumor retention as a function of hapten binding affinity. Motivated by model predictions, we used directed evolution and yeast surface display to affinity mature the 2D12.5 antibody to DOTA, reformatted as a single chain variable fragment (scFv). Results: Modeling predicts that for high antigen density and saturating bsAb dose, a hapten-binding affinity of 100 pM is needed for near-maximal hapten retention. We affinity matured 2D12.5 with an initial binding constant of about 10 nM to DOTA-yttrium chelates. Affinity maturation resulted in a 1000-fold affinity improvement to biotinylated DOTA-yttrium, yielding an 8.2{+-}1.9 picomolar binder. The high-affinity scFv binds DOTA complexes of lutetium and gadolinium with similar picomolar affinity and indium chelates with low nanomolar affinity. When engineered into a bispecific antibody construct targeting carcinoembryonic antigen, pretargeted high-affinity scFv results in significantly higher tumor retention of a {sup 111}In-DOTA hapten compared to pretargeted wild-type scFv in a xenograft mouse model. Conclusions: We have engineered a versatile, high-affinity, DOTA-chelate-binding scFv. We anticipate it will prove useful in developing pretargeted imaging and therapy protocols to exploit the potential of a variety of radiometals.
Electron affinities: theoretical
International Nuclear Information System (INIS)
Kaufman, J.J.
1976-01-01
A brief description is given of the conceptual background and formalism of the various ab-initio and semi-ab-initio quantum computational techniques for calculating atomic and molecular electron affinities: Hartree--Fock--Roothaan SCF, configuration interaction (CI), multiconfiguration SCF (MC-SCF), Bethe--Goldstone, superposition of configurations (SOC), ab-initio effective core model potentials, Xα-MS, plus other less common methods. Illustrative and comparative examples of electron affinities calculated by these various methods are presented
Supramolecular Affinity Chromatography for Methylation-Targeted Proteomics.
Garnett, Graham A E; Starke, Melissa J; Shaurya, Alok; Li, Janessa; Hof, Fraser
2016-04-05
Proteome-wide studies of post-translationally methylated species using mass spectrometry are complicated by high sample diversity, competition for ionization among peptides, and mass redundancies. Antibody-based enrichment has powered methylation proteomics until now, but the reliability, pan-specificity, polyclonal nature, and stability of the available pan-specific antibodies are problematic and do not provide a standard, reliable platform for investigators. We have invented an anionic supramolecular host that can form host-guest complexes selectively with methyllysine-containing peptides and used it to create a methylysine-affinity column. The column resolves peptides on the basis of methylation-a feat impossible with a comparable commercial cation-exchange column. A proteolyzed nuclear extract was separated on the methyl-affinity column prior to standard proteomics analysis. This experiment demonstrates that such chemical methyl-affinity columns are capable of enriching and improving the analysis of methyllysine residues from complex protein mixtures. We discuss the importance of this advance in the context of biomolecule-driven enrichment methods.
Kinetics and autoradiography of high affinity uptake of serotonin by primary astrocyte cultures
International Nuclear Information System (INIS)
Katz, D.M.; Kimelberg, H.K.
1985-01-01
Primary astrocyte cultures prepared from the cerebral cortices of neonatal rats showed significant accumulation of serotonin (5-hydroxytryptamine; [ 3 H]-5-HT). At concentrations in the range of 0.01 to 0.7 microM [ 3 H]-5-HT, this uptake was 50 to 85% Na+ dependent and gave a Km of 0.40 +/- 0.11 microM [ 3 H]-5-HT and a Vmax of 6.42 +/- 0.85 (+/- SEM) pmol of [ 3 H]-5-HT/mg of protein/4 min for the Na+-dependent component. In the absence of Na+ the uptake was nonsaturable. Omission of the monoamine oxidase inhibitor pargyline markedly reduced the Na+-dependent component of [ 3 H]-5-HT uptake but had a negligible effect on the Na+-independent component. This suggest significant oxidative deamination of serotonin after it has been taken up by the high affinity system, followed by release of its metabolite. The authors estimated that this system enabled the cells to concentrate [ 3 H]-5-HT up to 44-fold at an external [ 3 H]-5-HT concentration of 10(-7) M. Inhibition of [ 3 H]-5-HT uptake by a number of clinically effective antidepressants was also consistent with a specific high affinity uptake mechanism for 5-HT, the order of effectiveness of inhibition being chlorimipramine greater than fluoxetine greater than imipramine = amitriptyline greater than desmethylimipramine greater than iprindole greater than mianserin. Uptake of [ 3 H]-5-HT was dependent on the presence of Cl- as well as Na+ in the medium, and the effect of omission of both ions was nonadditive. Varying the concentration of K+ in the media from 1 to 50 mM had a limited effect on [ 3 H]-5-HT uptake
Transformations Based on Continuous Piecewise-Affine Velocity Fields
DEFF Research Database (Denmark)
Freifeld, Oren; Hauberg, Søren; Batmanghelich, Kayhan
2017-01-01
We propose novel finite-dimensional spaces of well-behaved transformations. The latter are obtained by (fast and highly-accurate) integration of continuous piecewise-affine velocity fields. The proposed method is simple yet highly expressive, effortlessly handles optional constraints (e.g., volum...
Energy Technology Data Exchange (ETDEWEB)
Metcalf, R.H.; Boegman, R.J.; Quirion, R.; Riopelle, R.J.; Ludwin, S.K.
1987-08-01
A transient 45% increase in cortical high-affinity choline uptake (HACU) was observed after an injection of quinolinic acid (QUIN) into the nucleus basalis magnocellularis (nbM) of the rat. This was followed by a steady decline in choline uptake, which resulted in a 46% decrease by day 7. Specific (/sup 3/H)hemicholinium-3 binding to coronal brain sections showed a similar pattern following injections of QUIN into the nbM. The increase in cortical HACU elicited by QUIN appeared to be dose dependent.
Comparison of high affinity binding of 3H-proadifen and 3H-(-)-cocaine t rat liver membranes
International Nuclear Information System (INIS)
Ross, S.B.
1995-01-01
The characteristics of the binding of 3 H-proadifen to rat liver membranes were studied and compared to those of 3 H-cocaine. It was found that 3 H-proadifen was bound reversibly with high affinity (K D =1.8±0.5 nM) and large capacity (B max =2010±340 pmol/g wet tissue) to liver membranes. The corresponding values for the 3 H-cocaine binding were 3.5 nM and 1000 pmol/g wet tissue. The binding of 3 H-proadifen was mainly localised to the microsomal fraction. The number of binding sites was not increased by treatment of rats with phenobarbitone. With 1 μM CdCl 2 in the incubation buffer it was possible to differentiate between two 3 H-cocaine binding sites with K d values of 1.6 and 7.7 nM and B max values of 280 and 940 pmol/g wet liver tissue. S-(-)-Alaproclate inhibited the binding of 3 H-proadifen and 3 H-cocaine inhibited the binding of 3 H-proadifen (IC 50 =10 nM) and proadifen that of 3 H-cocaine (IC 50 =1 nM). There was a high correlation coefficient (r r =0.972; P 50 =100-500 nM): chloroquine, phenoxybenzamine, amitriptyline, ajmaline, remoxipride, imipramine and (-)-alaprenolol. CdCl 2 , ZnCl 2 and CuCl 2 inhibited the binding of both ligands with low Hill coefficients, indicating heterogeneous binding sites. The inhibition curve of Cd 2+ on the cocaine binding was biphasic with a high affinity part around 50 nM and a low affinity part at 15μM. The similarity of the characteristics of the binding of these ligands with that of 3 H-alaproclate is discussed. It is suggested that all three compounds bind to the same sites, although additional binding sites seem to exist for proadifen. (au) (9 refs.)
International Nuclear Information System (INIS)
Butterworth, R.F.; Lavoie, J.; Giguere, J.F.; Pomier-Layrargues, G.
1988-01-01
The integrity of GABA-A receptors and of central benzodiazepine receptors was evaluated in membrane preparations from prefrontal cortex and caudate nuclei obtained at autopsy from nine cirrhotic patients who died in hepatic coma and an equal number of age-matched control subjects. Histopathological studies revealed Alzheimer Type II astrocytosis in all cases in the cirrhotic group; controls were free from neurological, psychiatric or hepatic diseases. Binding to GABA-A receptors was studied using [ 3 H]muscimol as radioligand. The integrity of central benzodiazepine receptors was evaluated using [ 3 H]flunitrazepam and [ 3 H]Ro15-1788. Data from saturation binding assays was analyzed by Scatchard plot. No modifications of either affinities (Kd) or densities (Bmax) of [ 3 H]muscimol of central benzodiazepine binding sites were observed. These findings do not support recent suggestions that alterations of either high-affinity GABA or benzodiazepine receptors play a significant role in the pathogenesis of hepatic encephalopathy
Affine-Invariant Geometric Constraints-Based High Accuracy Simultaneous Localization and Mapping
Directory of Open Access Journals (Sweden)
Gangchen Hua
2017-01-01
Full Text Available In this study we describe a new appearance-based loop-closure detection method for online incremental simultaneous localization and mapping (SLAM using affine-invariant-based geometric constraints. Unlike other pure bag-of-words-based approaches, our proposed method uses geometric constraints as a supplement to improve accuracy. By establishing an affine-invariant hypothesis, the proposed method excludes incorrect visual words and calculates the dispersion of correctly matched visual words to improve the accuracy of the likelihood calculation. In addition, camera’s intrinsic parameters and distortion coefficients are adequate for this method. 3D measuring is not necessary. We use the mechanism of Long-Term Memory and Working Memory (WM to manage the memory. Only a limited size of the WM is used for loop-closure detection; therefore the proposed method is suitable for large-scale real-time SLAM. We tested our method using the CityCenter and Lip6Indoor datasets. Our proposed method results can effectively correct the typical false-positive localization of previous methods, thus gaining better recall ratios and better precision.
Isolation and characterization of high affinity aptamers against DNA polymerase iota.
Lakhin, Andrei V; Kazakov, Andrei A; Makarova, Alena V; Pavlov, Yuri I; Efremova, Anna S; Shram, Stanislav I; Tarantul, Viacheslav Z; Gening, Leonid V
2012-02-01
Human DNA-polymerase iota (Pol ι) is an extremely error-prone enzyme and the fidelity depends on the sequence context of the template. Using the in vitro systematic evolution of ligands by exponential enrichment (SELEX) procedure, we obtained an oligoribonucleotide with a high affinity to human Pol ι, named aptamer IKL5. We determined its dissociation constant with homogenous preparation of Pol ι and predicted its putative secondary structure. The aptamer IKL5 specifically inhibits DNA-polymerase activity of the purified enzyme Pol ι, but did not inhibit the DNA-polymerase activities of human DNA polymerases beta and kappa. IKL5 suppressed the error-prone DNA-polymerase activity of Pol ι also in cellular extracts of the tumor cell line SKOV-3. The aptamer IKL5 is useful for studies of the biological role of Pol ι and as a potential drug to suppress the increase of the activity of this enzyme in malignant cells.
High-affinity cannabinoid binding site in brain: A possible marijuana receptor
International Nuclear Information System (INIS)
Nye, J.S.
1988-01-01
The mechanism by which delta 9 tetrahydrocannabinol (delta 9 THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5'-Trimethylammonium-delta 8 THC (TMA) is a positively charged analog of delta- 8 THC modified on the 5' carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of [ 3 H]-5'-trimethylammonium-delta- 8 THC ([ 3 H]TMA) to rat neuronal membranes. [ 3 H]TMA binds saturably and reversibly to brain membranes with high affinity to apparently one class of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of [ 3 H]TMA binding activity of approximately 60,000 daltons apparent molecular weight
Benzodiazepines have high-affinity binding sites and induce melanogenesis in B16/C3 melanoma cells.
Matthew, E; Laskin, J D; Zimmerman, E A; Weinstein, I B; Hsu, K C; Engelhardt, D L
1981-01-01
We found that two markers of differentiation, tyrosinase (monophenol, dihydroxyphenylalanine:oxygen oxidoreductase, EC 1.14.18.1) activity and melanin synthesis, are induced by diazepam in B16/C3 mouse melanoma cells. We also demonstrated high-affinity binding sites for [3H]diazepam in these cells by radioreceptor assay, and we visualized binding to the cell surface by fluorescence microscopy with a benzodiazepine analog conjugated to a fluorescein-labeled protein. Our studies also showed tha...
Hage, David S
2017-06-01
The interactions between biochemical and chemical agents in the body are important in many clinical processes. Affinity chromatography and high-performance affinity chromatography (HPAC), in which a column contains an immobilized biologically related binding agent, are 2 methods that can be used to study these interactions. This review presents various approaches that can be used in affinity chromatography and HPAC to characterize the strength or rate of a biological interaction, the number and types of sites that are involved in this process, and the interactions between multiple solutes for the same binding agent. A number of applications for these methods are examined, with an emphasis on recent developments and high-performance affinity methods. These applications include the use of these techniques for fundamental studies of biological interactions, high-throughput screening of drugs, work with modified proteins, tools for personalized medicine, and studies of drug-drug competition for a common binding agent. The wide range of formats and detection methods that can be used with affinity chromatography and HPAC for examining biological interactions makes these tools attractive for various clinical and pharmaceutical applications. Future directions in the development of small-scale columns and the coupling of these methods with other techniques, such as mass spectrometry or other separation methods, should continue to increase the flexibility and ease with which these approaches can be used in work involving clinical or pharmaceutical samples. © 2016 American Association for Clinical Chemistry.
International Nuclear Information System (INIS)
Vignali, D.A.A.; Devey, M.E.; Bickle, Q.D.; Taylor, M.G.
1990-01-01
Sera from rabbits and rats vaccinated with highly irradiated cercariae of Schistosoma mansoni (VRabS, VRatS) were found to be of substantially higher affinity than sera from CBA mice vaccinated four times (4 x CVMS), single sex sera (SSS) or chronic infection sera (CIS). In contrast, immunoprecipitation studies demonstrated that sera from vaccinated LA mice (LVMS) recognized 125 I-labelled schistosomular surface antigens more intensely than sera from vaccinated HA mice (HVMS). However, peritoneal macrophages from HA and LA mice in the presence of HVMS, LVMS or 4 x CVMS, and naive macrophages activated in vitro with interferon-gamma (IFN-γ)/lipopolysaccharide (LPS) mediated comparable levels of schistosomula killing in vitro. The experiments described here provide evidence that the titre of antibody rather than its affinity may be a more critical factor in the development of optimal immunity to S. mansoni. (author)
DEFF Research Database (Denmark)
Hansen, L S; Sparre-Ulrich, A H; Christensen, M.
2016-01-01
functions and pharmacological potential. GIP(1-30)NH2 is a naturally occurring truncation of GIP(1-42). Here we characterize eight N-terminal trrncations of human GIP(1-30)NH2 : GIP(2- to 9-30)NH2 . EXPERIMENTAL APPROACH: COS-7 cells were transiently transfected with the human GIP receptor and assessed...... displayed lower affinities (Ki 2.3-347 nM) with highest affinities of GIP(3-30)NH2 and (5-30)NH2 . Agonism was only observed for GIP(1-30)NH2 with an Emax on 100% of GIP(1-42) and GIP(2-30)NH2 (Emax 20%). GIP(2- to 9-30)NH2 displayed antagonism (IC50 12-450 nM) and right-shifts of the GIP(1-42)-response......, but superior antagonist GIP(3-30)NH2 , that together with GIP(5-30)NH2 were high-affinity competitive antagonist and thus may be suitable tool compounds for basic GIP research and future pharmacological interventions....
International Nuclear Information System (INIS)
Dickinson, K.E.; Heald, S.L.; Jeffs, P.W.; Lefkowitz, R.J.; Caron, M.G.
1985-01-01
Para-(Bromoacetamidyl)benzylcarazolol (pBABC) was synthesized and found to be an extremely potent affinity label for beta-adrenergic receptors. Its interaction with mammalian (rabbit and hamster lung) and nonmammalian (turkey and frog erythrocyte) beta-adrenergic receptors was similar, displaying EC 50 values of 400-900 pM for inhibiting 125 I-cyanopindolol binding to these receptors. pBABC reduced the number of beta-adrenergic receptors in frog erythrocyte membranes, without any change in the affinity of the remaining sites for [ 125 I]iodocyanopindolol. pBABC has been radioiodinated. As assessed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, this affinity probe specifically labeled the beta-adrenergic peptide of a purified preparation of hamster lung, with high efficiency (approximately 40%) and with a pharmacological specificity characteristic of an interaction at the beta 2-adrenergic receptor ligand-binding site. Comparison of the proteolyzed products derived from purified receptor labeled with [ 125 I]pBABC and with the photoaffinity agent [ 125 I]p-azidobenzylcarazolol suggested that covalent labeling of the beta-adrenergic receptor by these probes occurs at similar domains of the beta-adrenergic receptor
APPLICATION OF IMMUNOGLOBULIN-BINDING PROTEINS A, G, L IN THE AFFINITY CHROMATOGRAPHY
Directory of Open Access Journals (Sweden)
О. V. Sviatenko
2014-04-01
Full Text Available Proteins A, G and L are native or recombinant proteins of microbial origin that bind to mammalian immunoglobulins. Preferably recombinant variants of proteins A, G, L are used in biotechnology for affinity sorbents production. Сomparative characteristics of proteins A, G, L and affinity sorbents on the basis of them, advantages and disadvantages of these proteins application as ligands in the affinity chromatography are done. Analysis of proteins A, G, L properties is presented. Binding specificities and affinities of these proteins differ between species and antibody subclass. Protein А has high affinity to human IgG1, IgG2, IgG4, mouse IgG2a, IgG2b, IgG3, goat and sheep IgG2, dog, cat, guinea pig, rabbit IgG. Protein G binds strongly to human, mouse, cow, goat, sheep and rabbit IgG. Protein L has ability of strong binding to immunoglobulin kappa-chains of human, mouse, rat and pig. Expediency of application of affinity chromatography with usage of sorbents on the basis of immobilized proteins A, G, L are shown for isolation and purification of antibodies different classes. Previously mentioned method is used as an alternative to conventional methods of protein purification, such as ion-exchange, hydrophobic interactions, metal affinity chromatography, ethanol precipitation due to simplicity in usage, possibility of one-step purification process, obtaining of proteins high level purity, multiuse at maintenance of proper storage and usage conditions. Affinity sorbents on the basis of immobilized proteins A, G, L are used not only for antibodies purification, but also for extraction of different antibodies fractions from blood serum.
DEFF Research Database (Denmark)
Ma, Lixin; Xu, Hang; Lee, Li Ean
oxide (SIO) nanoparticle as a potent cancer cell selective PA contrast agent, with a high binding affinity and selectivity to the gastrin releasing peptide receptor (GRPR) which is overexpressed in many human cancers including prostate cancer, breast cancer and small cell lung cancer etc.......Photoacoustic (PA) imaging uses a short-pulsed laser to create ultrasound signals for the high resolution acoustic imaging. The development of targeting PA contrast agents offers a unique opportunity to improve the early detection of cancer cells. This work aims to develop a silica coated iron...
International Nuclear Information System (INIS)
Rajasekaran, Maheswari; Brents, Lisa K.; Franks, Lirit N.; Moran, Jeffery H.; Prather, Paul L.
2013-01-01
K2 or Spice is an emerging drug of abuse that contains synthetic cannabinoids, including JWH-018 and JWH-073. Recent reports indicate that monohydroxylated metabolites of JWH-018 and JWH-073 retain high affinity and activity at cannabinoid type-1 receptors (CB 1 Rs), potentially contributing to the enhanced toxicity of K2 compared to marijuana. Since the parent compounds also bind to cannabinoid type-2 receptors (CB 2 Rs), this study investigated the affinity and intrinsic activity of JWH-018, JWH-073 and several monohydroxylated metabolites at human CB 2 Rs (hCB 2 Rs). The affinity of cannabinoids for hCB 2 Rs was determined by competition binding studies employing CHO-hCB 2 membranes. Intrinsic activity of compounds was assessed by G-protein activation and adenylyl cyclase (AC)-inhibition in CHO-hCB 2 cells. JWH-073, JWH-018 and several of their human metabolites exhibit nanomolar affinity and act as potent agonists at hCB 2 Rs. Furthermore, a major omega hydroxyl metabolite of JWH-073 (JWH-073-M5) binds to CB 2 Rs with 10-fold less affinity than the parent molecule, but unexpectedly, is equipotent in regulating AC-activity when compared to the parent molecule. Finally, when compared to CP-55,940 and Δ 9 -tetrahydrocannabinol (Δ 9 -THC), JWH-018, JWH-018-M5 and JWH-073-M5 require significantly less CB 2 R occupancy to produce similar levels of AC-inhibition, indicating that these compounds may more efficiently couple CB 2 Rs to AC than the well characterized cannabinoid agonists examined. These results indicate that JWH-018, JWH-073 and several major human metabolites of these compounds exhibit high affinity and demonstrate distinctive signaling properties at CB 2 Rs. Therefore, future studies examining pharmacological and toxicological properties of synthetic cannabinoids present in K2 products should consider potential actions of these drugs at both CB 1 and CB 2 Rs. - Highlights: • JWH-018 and JWH-073 are synthetic cannabinoids present in abused K2
DEFF Research Database (Denmark)
Klein, A B; Bay, T; Villumsen, I S
2016-01-01
analogue, 3-hydroxycyclopent-1-enecarboxylic acid (HOCPCA) as a tritiated version ((3)H-HOCPCA) to radioactively label the specific GHB high-affinity binding site and gain further insight into the density, distribution and developmental profile of this protein. We show that, in low nanomolar concentrations...... brain development. Due to the high sensitivity of this radioligand, we were able to detect low levels of specific binding already at E15 in mouse brain, which increased progressively until adulthood. Collectively, we show that (3)H-HOCPCA is a highly sensitive radioligand, offering advantages over...
2017 Guralp Affinity Digitizer Evaluation.
Energy Technology Data Exchange (ETDEWEB)
Merchant, Bion J.
2018-03-01
Sandia National Laboratories has tested and evaluated two Guralp Affinity digitizers. The Affinity digitizers are intended to record sensor output for seismic and infrasound monitoring applications. The purpose of this digitizer evaluation is to measure the performance characteristics in such areas as power consumption, input impedance, sensitivity, full scale, self- noise, dynamic range, system noise, response, passband, and timing. The Affinity digitizers are being evaluated for potential use in the International Monitoring System (IMS) of the Comprehensive Nuclear Test-Ban-Treaty Organization (CTBTO).
Synthetic Receptors for the High-Affinity Recognition of O-GlcNAc Derivatives
Rios, Pablo; Carter, Tom S; Mooibroek, Tiddo J; Crump, Matthew P; Lisbjerg, Micke; Pittelkow, Michael; Supekar, Nitin T; Boons, Geert-Jan|info:eu-repo/dai/nl/088245489; Davis, Anthony P
2016-01-01
The combination of a pyrenyl tetraamine with an isophthaloyl spacer has led to two new water-soluble carbohydrate receptors ("synthetic lectins"). Both systems show outstanding affinities for derivatives of N-acetylglucosamine (GlcNAc) in aqueous solution. One receptor binds the methyl glycoside
International Nuclear Information System (INIS)
Sherman, S.J.; Catterall, W.A.
1982-01-01
Specific binding of 3 H-saxitoxin (STX) was used to quantitate the density of voltage-sensitive sodium channels in developing rat skeletal muscle. In adult triceps surae, a single class of sites with a KD . 2.9 nM and a density of 21 fmol/mg wet wt was detected. The density of these high-affinity sites increased from 2.0 fmol/mg wet wt to the adult value in linear fashion during days 2-25 after birth. Denervation of the triceps surae at day 11 or 17 reduced final saxitoxin receptor site density to 10.4 or 9.2 fmol/mg wet wt, respectively, without changing KD. Denervation of the triceps surae at day 5 did not alter the subsequent development of saxitoxin receptor sites during days 5-9 and accelerated the increase of saxitoxin receptor sites during days 9-13. After day 13, saxitoxin receptor development abruptly ceased and the density of saxitoxin receptor sites declined to 11 fmol/wg wet wt. These results show that the regulation of high-affinity saxitoxin receptor site density by innervation is biphasic. During the first phase, which is independent of continuing innervation, the saxitoxin receptor density increases to 47-57% of the adult level. After day 11, the second phase of development, which is dependent on continuing innervation, gives rise to the adult density of saxitoxin receptors
International Nuclear Information System (INIS)
Hu Naihong; Rosso, M.; Zhang Honglian
2006-12-01
We further find the defining structure of a two-parameter quantum affine algebra U r,s (sl n -circumflex) (n > 2) in the sense of Benkart-Witherspoon [BW1] after the work of [BGH1], [HS] and [BH], which turns out to be a Drinfeld double. Of more importance for the 'affine' cases is that we work out the compatible two-parameter version of the Drinfeld realization as a quantum affinization of U r,s (sl n ) and establish the Drinfeld isomorphism Theorem in the two-parameter setting via developing a new remarkable combinatorial approach - quantum 'affine' Lyndon basis with an explicit valid algorithm, based on the Drinfeld realization. (author)
Smith, J R; Subbarao, K; Franc, D T; Haribabu, B; Rosenbaum, J T
2004-01-01
Aim: To investigate the role of arachidonic acid derived chemotactic factor, LTB4, in the development of endotoxin induced uveitis (EIU), using mice deficient in the BLT1 gene which encodes the high affinity LTB4 receptor.
Ramírez, Fidel; Lingg, Thomas; Toscano, Sarah; Lam, Kin Chung; Georgiev, Plamen; Chung, Ho-Ryun; Lajoie, Bryan R; de Wit, Elzo; Zhan, Ye; de Laat, Wouter; Dekker, Job; Manke, Thomas; Akhtar, Asifa
2015-01-01
Dosage compensation mechanisms provide a paradigm to study the contribution of chromosomal conformation toward targeting and spreading of epigenetic regulators over a specific chromosome. By using Hi-C and 4C analyses, we show that high-affinity sites (HAS), landing platforms of the male-specific
IA-2 autoantibody affinity in children at risk for type 1 diabetes.
Krause, Stephanie; Chmiel, Ruth; Bonifacio, Ezio; Scholz, Marlon; Powell, Michael; Furmaniak, Jadwiga; Rees Smith, Bernard; Ziegler, Anette-G; Achenbach, Peter
2012-12-01
Autoantibodies to insulinoma-associated protein 2 (IA-2A) are associated with increased risk for type 1 diabetes. Here we examined IA-2A affinity and epitope specificity to assess heterogeneity in response intensity in relation to pathogenesis and diabetes risk in 50 children who were prospectively followed from birth. At first IA-2A appearance, affinity ranged from 10(7) to 10(11)L/mol and was high (>1.0×10(9)L/mol) in 41 (82%) children. IA-2A affinity was not associated with epitope specificity or HLA class II haplotype. On follow-up, affinity increased or remained high, and IA-2A were commonly against epitopes within the protein tyrosine phosphatase-like IA-2 domain and the homologue protein IA-2β. IA-2A were preceded or accompanied by other islet autoantibodies in 49 (98%) children, of which 34 progressed to diabetes. IA-2A affinity did not stratify diabetes risk. In conclusion, the IA-2A response in children is intense with rapid maturation against immunogenic epitopes and a strong association with diabetes development. Copyright © 2012 Elsevier Inc. All rights reserved.
Rational design of peptide affinity ligands for the purification of therapeutic enzymes.
Trasatti, John P; Woo, James; Ladiwala, Asif; Cramer, Steven; Karande, Pankaj
2018-04-25
Non-mAb biologics represent a growing class of therapeutics under clinical development. Although affinity chromatography is a potentially attractive approach for purification, the development of platform technologies, such as Protein A for mAbs, has been challenging due to the inherent chemical and structural diversity of these molecules. Here, we present our studies on the rapid development of peptide affinity ligands for the purification of biologics using a prototypical enzyme therapeutic in clinical use. Employing a suite of de novo rational and combinatorial design strategies we designed and screened a library of peptides on microarray platforms for their ability to bind to the target with high affinity and selectivity in cell culture fluid. Lead peptides were evaluated on resin in batch conditions and compared with a commercially available resin to evaluate their efficacy. Two lead candidates identified from microarray studies provided high binding capacity to the target while demonstrating high selectivity against culture contaminants and product variants compared to a commercial resin system. These findings provide a proof-of-concept for developing affinity peptide-based bioseparations processes for a target biologic. Peptide affinity ligand design and screening approaches presented in this work can also be easily translated to other biologics of interest. © 2018 American Institute of Chemical Engineers Biotechnol. Prog., 2018. © 2018 American Institute of Chemical Engineers.
Representations of affine Hecke algebras
Xi, Nanhua
1994-01-01
Kazhdan and Lusztig classified the simple modules of an affine Hecke algebra Hq (q E C*) provided that q is not a root of 1 (Invent. Math. 1987). Ginzburg had some very interesting work on affine Hecke algebras. Combining these results simple Hq-modules can be classified provided that the order of q is not too small. These Lecture Notes of N. Xi show that the classification of simple Hq-modules is essentially different from general cases when q is a root of 1 of certain orders. In addition the based rings of affine Weyl groups are shown to be of interest in understanding irreducible representations of affine Hecke algebras. Basic knowledge of abstract algebra is enough to read one third of the book. Some knowledge of K-theory, algebraic group, and Kazhdan-Lusztig cell of Cexeter group is useful for the rest
Inhibition of high affinity choline uptake by N-allyl-3-quinuclidinol
International Nuclear Information System (INIS)
Asermely, K.E.; O'Neill, J.J.
1986-01-01
The peripheral actions of N-allyl-3-quinuclidinol (N-Al-3-OHQ) on high affinity choline uptake (HAChU) on rat phrenic nerve diaphragm are described. Endplate regions (EPA) identified by the Koelle histochemical techniques for acetylcholinesterase, were dissected from adult rat hemidiaphragms and placed in cold Krebs solution (pH-7.35). All measurements of HAChU were at 37 0 C in buffers containing tritium choline (5 μM 0.124 μC/mmole) at intervals of 1, 2, 4, 8, 15 and 30 min. Tissues were washed 3x, digested in 1N NaOH and counted for tritium in Chaikoff's solution. All data are expressed as pmole Ch/g wet weight. Comparison between EPA and non-EPA tissue demonstrate HAChU and slow choline diffusion, respectively. Steady state is observed in 15 min. N-Al-3-OHQ produces 15% inhibition at 5 x 10 -5 M compared with 50% inhibition on brain synaptosomes. At 5 x 10 -4 M N-Al-3-OHQ, 30% inhibition is observed. Attempts to deplete ACh by pre-stimulation with high K + -ion (25 mM) were unsuccessful; tissue 3 H-choline uptake appeared to oscillate over a 30 min period
Inhibition of high affinity choline uptake by N-allyl-3-quinuclidinol
Energy Technology Data Exchange (ETDEWEB)
Asermely, K.E.; O' Neill, J.J.
1986-03-01
The peripheral actions of N-allyl-3-quinuclidinol (N-Al-3-OHQ) on high affinity choline uptake (HAChU) on rat phrenic nerve diaphragm are described. Endplate regions (EPA) identified by the Koelle histochemical techniques for acetylcholinesterase, were dissected from adult rat hemidiaphragms and placed in cold Krebs solution (pH-7.35). All measurements of HAChU were at 37/sup 0/C in buffers containing tritium choline (5 ..mu..M 0.124 ..mu..C/mmole) at intervals of 1, 2, 4, 8, 15 and 30 min. Tissues were washed 3x, digested in 1N NaOH and counted for tritium in Chaikoff's solution. All data are expressed as pmole Ch/g wet weight. Comparison between EPA and non-EPA tissue demonstrate HAChU and slow choline diffusion, respectively. Steady state is observed in 15 min. N-Al-3-OHQ produces 15% inhibition at 5 x 10/sup -5/ M compared with 50% inhibition on brain synaptosomes. At 5 x 10/sup -4/ M N-Al-3-OHQ, 30% inhibition is observed. Attempts to deplete ACh by pre-stimulation with high K/sup +/-ion (25 mM) were unsuccessful; tissue /sup 3/H-choline uptake appeared to oscillate over a 30 min period.
Energy Technology Data Exchange (ETDEWEB)
Vignali, D.A.A.; Devey, M.E.; Bickle, Q.D.; Taylor, M.G. (London School of Hygiene and Tropical Medicine (UK))
1990-02-01
Sera from rabbits and rats vaccinated with highly irradiated cercariae of Schistosoma mansoni (VRabS, VRatS) were found to be of substantially higher affinity than sera from CBA mice vaccinated four times (4 x CVMS), single sex sera (SSS) or chronic infection sera (CIS). In contrast, immunoprecipitation studies demonstrated that sera from vaccinated LA mice (LVMS) recognized {sup 125}I-labelled schistosomular surface antigens more intensely than sera from vaccinated HA mice (HVMS). However, peritoneal macrophages from HA and LA mice in the presence of HVMS, LVMS or 4 x CVMS, and naive macrophages activated in vitro with interferon-gamma (IFN-{gamma})/lipopolysaccharide (LPS) mediated comparable levels of schistosomula killing in vitro. The experiments described here provide evidence that the titre of antibody rather than its affinity may be a more critical factor in the development of optimal immunity to S. mansoni. (author).
DEFF Research Database (Denmark)
Khandelia, Himanshu
2008-01-01
, comparable to the affinities for the binding of small molecule ligands to proteins, was measured for phosphatidic acid (PA, mole fraction of XPA ) 0.2 in phosphatidylcholine vesicles), yielding a molecular partition coefficient of 240 ( 80 × 106. An MD simulation on the siramesine:PA interaction...
Antisymmetric tensor generalizations of affine vector fields.
Houri, Tsuyoshi; Morisawa, Yoshiyuki; Tomoda, Kentaro
2016-02-01
Tensor generalizations of affine vector fields called symmetric and antisymmetric affine tensor fields are discussed as symmetry of spacetimes. We review the properties of the symmetric ones, which have been studied in earlier works, and investigate the properties of the antisymmetric ones, which are the main theme in this paper. It is shown that antisymmetric affine tensor fields are closely related to one-lower-rank antisymmetric tensor fields which are parallelly transported along geodesics. It is also shown that the number of linear independent rank- p antisymmetric affine tensor fields in n -dimensions is bounded by ( n + 1)!/ p !( n - p )!. We also derive the integrability conditions for antisymmetric affine tensor fields. Using the integrability conditions, we discuss the existence of antisymmetric affine tensor fields on various spacetimes.
Ali, Shahin S.; Nugent, Brian; Mullins, Ewen; Doohan, Fiona M.
2013-01-01
Ethanol is the most-widely used biofuel in the world today. Lignocellulosic plant biomass derived from agricultural residue can be converted to ethanol via microbial bioprocessing. Fungi such as Fusarium oxysporum can simultaneously saccharify straw to sugars and ferment sugars to ethanol. But there are many bottlenecks that need to be overcome to increase the efficacy of microbial production of ethanol from straw, not least enhancement of the rate of fermentation of both hexose and pentose sugars. This research tested the hypothesis that the rate of sugar uptake by F. oxysporum would enhance the ethanol yields from lignocellulosic straw and that high affinity glucose transporters can enhance ethanol yields from this substrate. We characterized a novel hexose transporter (Hxt) from this fungus. The F. oxysporum Hxt represents a novel transporter with homology to yeast glucose signaling/transporter proteins Rgt2 and Snf3, but it lacks their C-terminal domain which is necessary for glucose signalling. Its expression level decreased with increasing glucose concentration in the medium and in a glucose uptake study the Km(glucose) was 0.9 mM, which indicated that the protein is a high affinity glucose transporter. Post-translational gene silencing or over expression of the Hxt in F. oxysporum directly affected the glucose and xylose transport capacity and ethanol yielded by F. oxysporum from straw, glucose and xylose. Thus we conclude that this Hxt has the capacity to transport both C5 and C6 sugars and to enhance ethanol yields from lignocellulosic material. This study has confirmed that high affinity glucose transporters are ideal candidates for improving ethanol yields from lignocellulose because their activity and level of expression is high in low glucose concentrations, which is very common during the process of consolidated processing. PMID:23382943
Directory of Open Access Journals (Sweden)
Shahin S Ali
Full Text Available Ethanol is the most-widely used biofuel in the world today. Lignocellulosic plant biomass derived from agricultural residue can be converted to ethanol via microbial bioprocessing. Fungi such as Fusarium oxysporum can simultaneously saccharify straw to sugars and ferment sugars to ethanol. But there are many bottlenecks that need to be overcome to increase the efficacy of microbial production of ethanol from straw, not least enhancement of the rate of fermentation of both hexose and pentose sugars. This research tested the hypothesis that the rate of sugar uptake by F. oxysporum would enhance the ethanol yields from lignocellulosic straw and that high affinity glucose transporters can enhance ethanol yields from this substrate. We characterized a novel hexose transporter (Hxt from this fungus. The F. oxysporum Hxt represents a novel transporter with homology to yeast glucose signaling/transporter proteins Rgt2 and Snf3, but it lacks their C-terminal domain which is necessary for glucose signalling. Its expression level decreased with increasing glucose concentration in the medium and in a glucose uptake study the Km((glucose was 0.9 mM, which indicated that the protein is a high affinity glucose transporter. Post-translational gene silencing or over expression of the Hxt in F. oxysporum directly affected the glucose and xylose transport capacity and ethanol yielded by F. oxysporum from straw, glucose and xylose. Thus we conclude that this Hxt has the capacity to transport both C5 and C6 sugars and to enhance ethanol yields from lignocellulosic material. This study has confirmed that high affinity glucose transporters are ideal candidates for improving ethanol yields from lignocellulose because their activity and level of expression is high in low glucose concentrations, which is very common during the process of consolidated processing.
Manifolds with integrable affine shape operator
Directory of Open Access Journals (Sweden)
Daniel A. Joaquín
2005-05-01
Full Text Available This work establishes the conditions for the existence of vector fields with the property that theirs covariant derivative, with respect to the affine normal connection, be the affine shape operatorS in hypersurfaces. Some results are obtained from this property and, in particular, for some kind of affine decomposable hypersurfaces we explicitely get the actual vector fields.
Idili, Andrea; Plaxco, Kevin W; Vallée-Bélisle, Alexis; Ricci, Francesco
2013-12-23
Naturally occurring chemoreceptors almost invariably employ structure-switching mechanisms, an observation that has inspired the use of biomolecular switches in a wide range of artificial technologies in the areas of diagnostics, imaging, and synthetic biology. In one mechanism for generating such behavior, clamp-based switching, binding occurs via the clamplike embrace of two recognition elements onto a single target molecule. In addition to coupling recognition with a large conformational change, this mechanism offers a second advantage: it improves both affinity and specificity simultaneously. To explore the physics of such switches we have dissected here the thermodynamics of a clamp-switch that recognizes a target DNA sequence through both Watson-Crick base pairing and triplex-forming Hoogsteen interactions. When compared to the equivalent linear DNA probe (which relies solely on Watson-Crick interactions), the extra Hoogsteen interactions in the DNA clamp-switch increase the probe's affinity for its target by ∼0.29 ± 0.02 kcal/mol/base. The Hoogsteen interactions of the clamp-switch likewise provide an additional specificity check that increases the discrimination efficiency toward a single-base mismatch by 1.2 ± 0.2 kcal/mol. This, in turn, leads to a 10-fold improvement in the width of the "specificity window" of this probe relative to that of the equivalent linear probe. Given these attributes, clamp-switches should be of utility not only for sensing applications but also, in the specific field of DNA nanotechnology, for applications calling for a better control over the building of nanostructures and nanomachines.
Constraints on the affinity term for modeling long-term glass dissolution rates
International Nuclear Information System (INIS)
Bourcier, W.L.; Carroll, S.A.; Phillips, B.L.
1993-11-01
Predictions of long-term glass dissolution rates are highly dependent on the form of the affinity term in the rate expression. Analysis of the quantitative effect of saturation state on glass dissolution rate for CSG glass (a simple analog of SRL-165 glass), shows that a simple (1-Q/K) affinity term does not match experimental results. Our data at 100 degree C show that the data is better fit by an affinity term having the form (1 - (Q/K) 1 /σ) where σ = 10
Identification of an adeno-associated virus binding epitope for AVB sepharose affinity resin
Directory of Open Access Journals (Sweden)
Qiang Wang
Full Text Available Recent successes of adeno-associated virus (AAVâbased gene therapy have created a demand for large-scale AAV vector manufacturing and purification techniques for use in clinical trials and beyond. During the development of purification protocols for rh.10, hu.37, AAV8, rh.64R1, AAV3B, and AAV9 vectors, based on a widely used affinity resin, AVB sepharose (GE, we found that, under the same conditions, different serotypes have different affinities to the resin, with AAV3B binding the best and AAV9 the poorest. Further analysis revealed a surface-exposed residue (amino acid number 665 in AAV8 VP1 numbering differs between the high-affinity AAV serotypes (serine in AAV3B, rh.10, and hu.37 and the low-affinity ones (asparagine in AAV8, rh.64R1, and AAV9. The residue locates within a surface-exposed, variable epitope flanked by highly conserved residues. The substitution of the epitope in AAV8, rh.64R1, and AAV9 with the corresponding epitope of AAV3B (SPAKFA resulted in greatly increased affinity to AVB sepharose with no reduction in the vectorsâ in vitro potency. The presence of the newly identified AVB-binding epitope will be useful for affinity resin selection for the purification of novel AAV serotypes. It also suggests the possibility of vector engineering to yield a universal affinity chromatography purification method for multiple AAV serotypes.
Affine LIBOR Models with Multiple Curves
DEFF Research Database (Denmark)
Grbac, Zorana; Papapantoleon, Antonis; Schoenmakers, John
2015-01-01
are specified following the methodology of the affine LIBOR models and are driven by the wide and flexible class of affine processes. The affine property is preserved under forward measures, which allows us to derive Fourier pricing formulas for caps, swaptions, and basis swaptions. A model specification...... with dependent LIBOR rates is developed that allows for an efficient and accurate calibration to a system of caplet prices....
A Novel Fast and Robust Binary Affine Invariant Descriptor for Image Matching
Directory of Open Access Journals (Sweden)
Xiujie Qu
2014-01-01
Full Text Available As the current binary descriptors have disadvantages of high computational complexity, no affine invariance, and the high false matching rate with viewpoint changes, a new binary affine invariant descriptor, called BAND, is proposed. Different from other descriptors, BAND has an irregular pattern, which is based on local affine invariant region surrounding a feature point, and it has five orientations, which are obtained by LBP effectively. Ultimately, a 256 bits binary string is computed by simple random sampling pattern. Experimental results demonstrate that BAND has a good matching result in the conditions of rotating, image zooming, noising, lighting, and small-scale perspective transformation. It has better matching performance compared with current mainstream descriptors, while it costs less time.
Affinity Programs and the Real Estate Brokerage Industry
G Stacy Sirmans; David A. Macpherson
2001-01-01
This study surveys active real estate brokers obtaining information on involvement in affinity programs and referral/relocation networks. Some results regarding affinity involvement are: (a) 13% of respondents reported affinity affilliations, 75% reported no affiliations, and 12% indicated plans to become involved within the next year; (b) about half having affinity affiliations were involved with 2-4 groups; (c) affinity relationships were most often with membership organizations, corporatio...
Energy Technology Data Exchange (ETDEWEB)
Rajasekaran, Maheswari; Brents, Lisa K.; Franks, Lirit N. [Department of Pharmacology and Toxicology, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Moran, Jeffery H. [Department of Pharmacology and Toxicology, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Arkansas Department of Public Health, Public Health Laboratory, Little Rock, AR 72205 (United States); Prather, Paul L., E-mail: pratherpaull@uams.edu [Department of Pharmacology and Toxicology, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States)
2013-06-01
K2 or Spice is an emerging drug of abuse that contains synthetic cannabinoids, including JWH-018 and JWH-073. Recent reports indicate that monohydroxylated metabolites of JWH-018 and JWH-073 retain high affinity and activity at cannabinoid type-1 receptors (CB{sub 1}Rs), potentially contributing to the enhanced toxicity of K2 compared to marijuana. Since the parent compounds also bind to cannabinoid type-2 receptors (CB{sub 2}Rs), this study investigated the affinity and intrinsic activity of JWH-018, JWH-073 and several monohydroxylated metabolites at human CB{sub 2}Rs (hCB{sub 2}Rs). The affinity of cannabinoids for hCB{sub 2}Rs was determined by competition binding studies employing CHO-hCB{sub 2} membranes. Intrinsic activity of compounds was assessed by G-protein activation and adenylyl cyclase (AC)-inhibition in CHO-hCB{sub 2} cells. JWH-073, JWH-018 and several of their human metabolites exhibit nanomolar affinity and act as potent agonists at hCB{sub 2}Rs. Furthermore, a major omega hydroxyl metabolite of JWH-073 (JWH-073-M5) binds to CB{sub 2}Rs with 10-fold less affinity than the parent molecule, but unexpectedly, is equipotent in regulating AC-activity when compared to the parent molecule. Finally, when compared to CP-55,940 and Δ{sup 9}-tetrahydrocannabinol (Δ{sup 9}-THC), JWH-018, JWH-018-M5 and JWH-073-M5 require significantly less CB{sub 2}R occupancy to produce similar levels of AC-inhibition, indicating that these compounds may more efficiently couple CB{sub 2}Rs to AC than the well characterized cannabinoid agonists examined. These results indicate that JWH-018, JWH-073 and several major human metabolites of these compounds exhibit high affinity and demonstrate distinctive signaling properties at CB{sub 2}Rs. Therefore, future studies examining pharmacological and toxicological properties of synthetic cannabinoids present in K2 products should consider potential actions of these drugs at both CB{sub 1} and CB{sub 2}Rs. - Highlights: • JWH-018
International Nuclear Information System (INIS)
Kim, M.H.; Neubig, R.R.
1986-01-01
High affinity α 2 adrenergic agonist binding is thought to occur via a coupling of the α 2 receptor with N/sub i/, the inhibitory guanyl nucleotide binding protein. Human platelet membranes pretreated at pH 11.5 exhibit a selective inactivation of agonist binding and N/sub i/. To further study the mechanism of agonist binding, alkali treated membranes (ATM) were mixed with membranes pretreated with 10 μM phenoxybenzamine to block α 2 receptors (POB-M). The combined membrane pellet was incubated in 50% polyethylene glycol (PEG) to promote membrane-membrane fusion and assayed for binding to the α 2 agonist [ 3 H]UK 14,304 (UK) and the antagonist [ 3 H] yohimbine. PEG treatment resulted in a 2-4 fold enhancement of UK binding whereas yohimbine binding was unchanged. No enhancement of UK binding was observed in the absence of PEG treatment. The reconstitution was dependent on the addition of POB-M. They found that a 1:1 ratio of POB-M:ATM was optimal. Reconstituted binding was inhibited by GppNHp. Fusion of rat C6 glioma cell membranes, which do not contain α 2 receptors, also enhanced agonist binding to ATM. Fusion of C6 membranes from cells treated with pertussis toxin did not enhance [ 3 H] UK binding. These data show that a pertussis toxin sensitive membrane component, possibly N/sub i/, can reconstitute high affinity α 2 agonist binding
Development of 99mTc labelled somatostatin analogues with high affinity for somatostatin receptors
International Nuclear Information System (INIS)
Maina, T.; Nock, B.; Nicolopoulou, A.; Tsipra, C.; Poppe, M.; Chiotellis, E.
2001-01-01
A recent development in oncology involves the use of metabolically stabilized peptide hormone analogues labelled with metallic radionuclides for the diagnosis or therapy of malignant disease. This approach was successfully applied for the first time in the visualization of somatostatin positive tumours and their metastases with 111 In DTPA-octreotide. In an effort to obtain a 99m Tc somatostatin receptor affine radioligand we describe herein the synthesis, radiochemistry and preliminary biological evaluation of two novel 99m Tc labelled somatostatin analogues, N 4 -TOC and N 4 -RC-160. In these compounds a tetraamine bifunctional unit was covalently attached to the N-terminal (D)Phe 1 of the peptide chain using Boc-protection strategies. The peptide conjugates were purified by high performance liquid chromatography (HPLC) and characterized by UV/Vis and ES-MS spectroscopies. As revealed by HPLC, 99m Tc labelling was quantitative under mild conditions, leading to a single 99m Tc species in high specific activities. Affinity of 99m Tc N 4 -TOC for the somatostatin receptor, as determined by in vitro binding assays in rat brain cortex membranes, was found unaffected by the presence of the bulky metal chelate. The binding properties of 99m Tc N 4 -RC-160 could not be determined by this assay due to an extremely high non-specific binding of this radioligand, and will be shortly investigated by other methods. Tissue distribution in healthy mice revealed that 99m Tc N 4 -TOC is clearing mainly through the kidneys and the urinary tract whereas 99m Tc N 4 -RC-160 shows a high accumulation in the liver as a result of its lipophilicity. Analysis of urine samples by HPLC showed that 99m Tc N 4 -TOC is excreted integer from the body of mice, while 99m Tc N 4 -RC-160 is totally transformed to an unidentified hydrophilic metabolite in vivo. The location of this metabolism is currently investigated. In vivo blocking experiments using animals pre-treated with 50 μg octreotide
Durán-Lara, Esteban F; López-Cortés, Xaviera A; Castro, Ricardo I; Avila-Salas, Fabián; González-Nilo, Fernando D; Laurie, V Felipe; Santos, Leonardo S
2015-02-01
Polyvinylpolypyrrolidone (PVPP) is a fining agent, widely used in winemaking and brewing, whose mode of action in removing phenolic compounds has not been fully characterised. The aim of this study was to evaluate the experimental and theoretical binding affinity of PVPP towards six phenolic compounds representing different types of phenolic species. The interaction between PVPP and phenolics was evaluated in model solutions, where hydroxyl groups, hydrophobic bonding and steric hindrance were characterised. The results of the study indicated that PVPP exhibits high affinity for quercetin and catechin, moderate affinity for epicatechin, gallic acid and lower affinity for 4-methylcatechol and caffeic acid. The affinity has a direct correlation with the hydroxylation degree of each compound. The results show that the affinity of PVPP towards phenols is related with frontier orbitals. This work demonstrates a direct correlation between the experimental affinity and the interaction energy calculations obtained through computational chemistry methods. Copyright © 2014 Elsevier Ltd. All rights reserved.
Using Affinity Diagrams to Evaluate Interactive Prototypes
DEFF Research Database (Denmark)
Lucero, Andrés
2015-01-01
our particular use of affinity diagramming in prototype evaluations. We reflect on a decade’s experience using affinity diagramming across a number of projects, both in industry and academia. Our affinity diagramming process in interaction design has been tailored and consists of four stages: creating...
Energy Technology Data Exchange (ETDEWEB)
Bacolod, M.D.
1992-01-01
Rigid microparticulate stationary phases having surface-bound metal chelating functions were developed and evaluated in high performance metal chelate affinity chromatography of proteins. Silica- and polystyrene-divinylbenzene-based metal chelate sorbents were produced in wide pore and in non-porous type of column packings. A major effort has been placed on development of non-porous highly crosslinked polystyrene-divinylbenzene (PSDVB). These PSDVB microparticles were produced by a two-step swelling polymerization, and exhibited excellent mechanical strength over a wide range of flow-rates and composition used in high performance liquid chromatography (HPLC). Simple and reproducible hydrophilic coatings were developed for the surface modification of hydrophobic PSDVB supports. A tetradentate metal chelating ligand, ethylenediamine-N, N[prime]-diacetic acid (EDDA), was covalently bound to the surface of the various supports. Sorbents having iminodiacetic acid (IDA) metal chelating functions were also evaluated. The hydrophilic character and surface coverage of various stationary phases were assessed chromatographically. Studies concerning the effects of eluent pH as well as the nature and concentration of salts on retention and selectivity with different metal chelate stationary phases having various immobilized metal ions were carried out. Elution schemes were developed for rapid separation of proteins in metal chelate affinity chromatography. EDDA stationary phases in metal forms can be viewed as complementary to IDA stationary phases since they afforded different selectivity and retentivity toward proteins. Hydrophilic PSDVB could be functionalized with IDA or EDDA metal chelating ligands or lectins. The non-porous metal chelate stationary phases afforded rapid separation of proteins by the development of multiple gradient systems, which permitted higher column peak capacity, enabling the separation of a greater number of proteins in a single chromatographic run.
Nallapareddy, Sreedhar R; Sillanpää, Jouko; Ganesh, Vannakambadi K; Höök, Magnus; Murray, Barbara E
2007-06-01
Strains of Enterococcus faecium express a cell wall-anchored protein, Acm, which mediates adherence to collagen. Here, we (i) identify the minimal and high-affinity binding subsegments of Acm and (ii) show that anti-Acm immunoglobulin Gs (IgGs) purified against these subsegments reduced E. faecium TX2535 strain collagen adherence up to 73 and 50%, respectively, significantly more than the total IgGs against the full-length Acm A domain (28%) (P Acm adherence with functional subsegment-specific antibodies raises the possibility of their use as therapeutic or prophylactic agents.
The Cutting Edge of Affinity Electrophoresis Technology.
Kinoshita, Eiji; Kinoshita-Kikuta, Emiko; Koike, Tohru
2015-03-18
Affinity electrophoresis is an important technique that is widely used to separate and analyze biomolecules in the fields of biology and medicine. Both quantitative and qualitative information can be gained through affinity electrophoresis. Affinity electrophoresis can be applied through a variety of strategies, such as mobility shift electrophoresis, charge shift electrophoresis or capillary affinity electrophoresis. These strategies are based on changes in the electrophoretic patterns of biological macromolecules that result from interactions or complex-formation processes that induce changes in the size or total charge of the molecules. Nucleic acid fragments can be characterized through their affinity to other molecules, for example transcriptional factor proteins. Hydrophobic membrane proteins can be identified by means of a shift in the mobility induced by a charged detergent. The various strategies have also been used in the estimation of association/disassociation constants. Some of these strategies have similarities to affinity chromatography, in that they use a probe or ligand immobilized on a supported matrix for electrophoresis. Such methods have recently contributed to profiling of major posttranslational modifications of proteins, such as glycosylation or phosphorylation. Here, we describe advances in analytical techniques involving affinity electrophoresis that have appeared during the last five years.
Holdgate, Geoff A; Anderson, Malcolm; Edfeldt, Fredrik; Geschwindner, Stefan
2010-10-01
Affinity-based technologies have become impactful tools to detect, monitor and characterize molecular interactions using recombinant target proteins. This can aid the understanding of biological function by revealing mechanistic details, and even more importantly, enables the identification of new improved ligands that can modulate the biological activity of those targets in a desired fashion. The selection of the appropriate technology is a key step in that process, as each one of the currently available technologies offers a characteristic type of biophysical information about the ligand-binding event. Alongside the indisputable advantages of each of those technologies they naturally display diverse restrictions that are quite frequently related to the target system to be studied but also to the affinity, solubility and molecular size of the ligands. This paper discusses some of the theoretical and experimental aspects of the most common affinity-based methods, what type of information can be gained from each one of those approaches, and what requirements as well as limitations are expected from working with recombinant proteins on those platforms and how those can be optimally addressed.
Single-step affinity purification for fungal proteomics.
Liu, Hui-Lin; Osmani, Aysha H; Ukil, Leena; Son, Sunghun; Markossian, Sarine; Shen, Kuo-Fang; Govindaraghavan, Meera; Varadaraj, Archana; Hashmi, Shahr B; De Souza, Colin P; Osmani, Stephen A
2010-05-01
A single-step protein affinity purification protocol using Aspergillus nidulans is described. Detailed protocols for cell breakage, affinity purification, and depending on the application, methods for protein release from affinity beads are provided. Examples defining the utility of the approaches, which should be widely applicable, are included.
Energy Technology Data Exchange (ETDEWEB)
Mazzone, Amelia; Eisenman, Seth T.; Strege, Peter R. [Enteric NeuroScience Program, Mayo Clinic, Rochester, MN (United States); Yao, Zhen [Laboratory of Molecular Genetics, UCSF, San Francisco, CA (United States); Ordog, Tamas; Gibbons, Simon J. [Enteric NeuroScience Program, Mayo Clinic, Rochester, MN (United States); Farrugia, Gianrico, E-mail: farrugia.gianrico@mayo.edu [Enteric NeuroScience Program, Mayo Clinic, Rochester, MN (United States)
2012-10-19
Highlights: Black-Right-Pointing-Pointer T16A{sub inh}-A01 blocked Ano1 currents in HEK cells expressing Ano1. Black-Right-Pointing-Pointer T16A{sub inh}-A01 reduced proliferation in ICC primary cultures and CFPAC-1 cell line. Black-Right-Pointing-Pointer T16A{sub inh}-A01 reduced proliferation of ICC in intact smooth muscle strips. -- Abstract: Background: Ion channels play important roles in regulation of cellular proliferation. Ano1 (TMEM16A) is a Ca{sup 2+}-activated Cl{sup -} channel expressed in several tumors and cell types. In the muscle layers of the gastrointestinal tract Ano1 is selectively expressed in interstitial cells of Cajal (ICC) and appears to be required for normal gastrointestinal slow wave electrical activity. However, Ano1 is expressed in all classes of ICC, including those that do not generate slow waves suggesting that Ano1 may have other functions. Indeed, a role for Ano1 in regulating proliferation of tumors and ICC has been recently suggested. Recently, a high-throughput screen identified a small molecule, T16A{sub inh}-A01 as a specific inhibitor of Ano1. Aim: To investigate the effect of the T16A{sub inh}-A01 inhibitor on proliferation in ICC and in the Ano1-expressing human pancreatic cancer cell line CFPAC-1. Methods: Inhibition of Ano1 was demonstrated by whole cell voltage clamp recordings of currents in cells transfected with full-length human Ano1. The effect of T16A{sub inh}-A01 on ICC proliferation was examined in situ in organotypic cultures of intact mouse small intestinal smooth muscle strips and in primary cell cultures prepared from these tissues. ICC were identified by Kit immunoreactivity. Proliferating ICC and CFPAC-1 cells were identified by immunoreactivity for the nuclear antigen Ki67 or EdU incorporation, respectively. Results: T16A{sub inh}-A01 inhibited Ca{sup 2+}-activated Cl{sup -} currents by 60% at 10 {mu}M in a voltage-independent fashion. Proliferation of ICC was significantly reduced in primary cultures
The production of high affinity monoclonal antibodies to human growth hormone
International Nuclear Information System (INIS)
Stuart, M.C.; Walichnowski, C.M.; Hussain, S.; Underwood, P.A.; Harman, D.F.; Rathjen, D.A.; Sturmer, S.R. von
1983-01-01
The primary aim of this work was to produce specific monoclonal antibodies to human growth hormone (hGH) for use in a diagnostic RIA of hGH levels in serum. Three different schedules were used for immunization of BALB/c mice and the splenocytes from each mouse were fused with myeloma cells Sp 2/0 Ag 14. Each fusion resulted in the production of hundreds of hybridomas secreting hGH-directed antibodies. Six antibodies have been fully characterized and have been grouped into pairs which recognize 3 different epitopes on the hGH molecule. One pair exhibits no cross reaction with the structurally related placental hormone, human placental lactogen (hPL), a second pair has low cross reaction with hPL (1.6-3%) and a third pair reacts equally well with hGH and hPL indicating binding to a common epitope in the 2 molecules. The highest affinity antibody, 74/6, which has an affinity constant of 4.4x10 10 l/mol and 3% cross-reactivity with hPL, has been used to establish a RIA for serum hGH measurements. Evidence is provided that hGH levels measured in this assay correlate well with those obtained in a conventional rabbit antiserum assay. (Auth.)
A pharmacological profile of the high-affinity GluK5 kainate receptor
DEFF Research Database (Denmark)
Møllerud, Stine; Kastrup, Jette Sandholm Jensen; Pickering, Darryl S
2016-01-01
-hydroxyisoxazol-4-yl)propionate (ATPA), dihydrokainate and (2 S,4 R)−4-methyl-glutamate (SYM2081) have higher affinity at GluK3 compared to GluK5. Since some studies have indicated that GluK5 is associated with various diseases in the central nervous system (e.g. schizophrenia, temporal lobe epilepsy, bipolar...
Directory of Open Access Journals (Sweden)
Rui Hu
2016-10-01
Full Text Available The large nitrate transporter 1/peptide transporter family (NPF has been shown to transport diverse substrates, including nitrate, amino acids, peptides, phytohormones, and glucosinolates. However, the rice (Oryza sativa root-specific expressed member OsNPF7.2 has not been characterized. Here, our data show that OsNPF7.2 is a tonoplast localized low-affinity nitrate transporter, and affects rice growth under high nitrate supply. The expression analysis showed that OsNPF7.2 was mainly expressed in the elongation and maturation zones of roots, especially in the root sclerenchyma, cortex and stele. It was also induced by high concentrations of nitrate. Subcellular localization analysis showed that OsNPF7.2 was localized on the tonoplast of large and small vacuoles. Heterogenous expression in Xenopus laevis oocytes suggested that OsNPF7.2 was a low-affinity nitrate transporter. Knock-down of OsNPF7.2 retarded rice growth under high concentrations of nitrate. Therefore, we deduce that OsNPF7.2 plays a role in intracellular allocation of nitrate in roots, and thus influences rice growth under high nitrate supply.
Plasma-polymerized films providing selective affinity to the polarity of vaporized organic solvents
International Nuclear Information System (INIS)
Akimoto, Takuo; Ikeshita, Yusuke; Terashima, Ryo; Karube, Isao
2009-01-01
Plasma-polymerized films (PPFs) were fabricated as recognition membranes for a vapor-sensing device, and their affinity to vaporized organic solvents was evaluated with surface plasmon resonance. The affinity we intended to create is the selective sorption of the vaporized organic solvents depending on their polarity. For this purpose, acetonitrile, ethylenediamine (EDA), styrene, hexamethyldisiloxane (HMDSO), and hexamethyldisilazane were used to fabricate PPFs. Vaporized methanol, ethanol, and 1-propanol were used as high-polar solvents to be analyzed. Hexane, toluene, and p-xylene were used as low-polar solvents. As a result, the HMDSO-PPF with 97.3 o of contact angle was found to provide affinity to the low-polar solvents. In contrast, the EDA-PPF with 7.1 o of contact angle provided affinity to the high-polar solvents. Observations of the surface morphology of the HMDSO- and EDA-PPFs with a scanning electron microscope revealed that they are composed of nano-scale islands.
Locked nucleic acid (LNA): High affinity targeting of RNA for diagnostics and therapeutics
DEFF Research Database (Denmark)
Kauppinen, S.; Vester, Birte; Wengel, Jesper
2005-01-01
Locked nucleic acid (LNA) is a nucleic acid analogue containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked in an RNA mimicking sugar conformation. This conformational restriction results in unprecedented hybridization affinity towards complementary single stranded RN...
Connections between quantized affine algebras and superalgebras
International Nuclear Information System (INIS)
Zhang, R.B.
1992-08-01
Every affine superalgebra with a symmetrizable Cartan matrix is closely related to an ordinary affine algebra with the same Cartan matrix. It is shown that the quantum supergroup associated with the former is essentially isomorphic to the quantum group associated with the latter in an appropriate class of representations. At the classical level, each integrable irreducible highest weight representation of the affine superalgebra has a corresponding irreducible representation of the affine algebra, which has the same weight space decomposition. (author). 5 refs, 3 tabs
High affinity soluble ILT2 receptor: a potent inhibitor of CD8(+) T cell activation.
Moysey, Ruth K; Li, Yi; Paston, Samantha J; Baston, Emma E; Sami, Malkit S; Cameron, Brian J; Gavarret, Jessie; Todorov, Penio; Vuidepot, Annelise; Dunn, Steven M; Pumphrey, Nicholas J; Adams, Katherine J; Yuan, Fang; Dennis, Rebecca E; Sutton, Deborah H; Johnson, Andy D; Brewer, Joanna E; Ashfield, Rebecca; Lissin, Nikolai M; Jakobsen, Bent K
2010-12-01
Using directed mutagenesis and phage display on a soluble fragment of the human immunoglobulin super-family receptor ILT2 (synonyms: LIR1, MIR7, CD85j), we have selected a range of mutants with binding affinities enhanced by up to 168,000-fold towards the conserved region of major histocompatibility complex (MHC) class I molecules. Produced in a dimeric form, either by chemical cross-linking with bivalent polyethylene glycol (PEG) derivatives or as a genetic fusion with human IgG Fc-fragment, the mutants exhibited a further increase in ligand-binding strength due to the avidity effect, with resident half-times (t(1/2)) on the surface of MHC I-positive cells of many hours. The novel compounds antagonized the interaction of CD8 co-receptor with MHC I in vitro without affecting the peptide-specific binding of T-cell receptors (TCRs). In both cytokine-release assays and cell-killing experiments the engineered receptors inhibited the activation of CD8(+) cytotoxic T lymphocytes (CTLs) in the presence of their target cells, with subnanomolar potency and in a dose-dependent manner. As a selective inhibitor of CD8(+) CTL responses, the engineered high affinity ILT2 receptor presents a new tool for studying the activation mechanism of different subsets of CTLs and could have potential for the development of novel autoimmunity therapies.
Chen, Guilin; Guo, Mingquan
2017-01-01
Topoisomerase I (Topo I) catalyzes topological interconversion of duplex DNA during DNA replication and transcription, and has been deemed as important antineoplastic targets. In this study, the fraction R.d-60 from ethyl acetate extracts of Rhamnus davurica showed higher inhibitory rates against SGC-7901 and HT-29 compared with the R.d-30 fraction in vitro. However, the specific active components of R.d-60 fraction remain elusive. To this end, a method based on bio-affinity ultrafiltration and high performance liquid chromatography/electrospray mass spectrometry (HPLC- ESI-MS/MS) was developed to rapidly screen and identify the Topo I inhibitors in this fraction. The enrichment factors (EFs) were calculated to evaluate the binding affinities between the bioactive constituents and Topo I. As a result, eight ligands were identified and six of which with higher EFs showed more potential antitumor activity. Furthermore, antiproliferative assays in vitro (IC50 values) with two representative candidates (apigenin, quercetin) against SGC-7901, HT-29 and Hep G2 cells were conducted and further validated. Finally, the structure-activity relationships revealed that flavones contain a C2-C3 double bond of C ring exhibited higher bio-affinities to Topo I than those without it. This integrated method combining Topo I ultrafiltration with HPLC-MS/MS proved to be very efficient in rapid screening and identification of potential Topo I inhibitors from the complex extracts of medicinal plants, and could be further explored as a valuable high-throughput screening platform in the early drug discovery stage. PMID:28919906
The Cutting Edge of Affinity Electrophoresis Technology
Kinoshita, Eiji; Kinoshita-Kikuta, Emiko; Koike, Tohru
2015-01-01
Affinity electrophoresis is an important technique that is widely used to separate and analyze biomolecules in the fields of biology and medicine. Both quantitative and qualitative information can be gained through affinity electrophoresis. Affinity electrophoresis can be applied through a variety of strategies, such as mobility shift electrophoresis, charge shift electrophoresis or capillary affinity electrophoresis. These strategies are based on changes in the electrophoretic patterns of biological macromolecules that result from interactions or complex-formation processes that induce changes in the size or total charge of the molecules. Nucleic acid fragments can be characterized through their affinity to other molecules, for example transcriptional factor proteins. Hydrophobic membrane proteins can be identified by means of a shift in the mobility induced by a charged detergent. The various strategies have also been used in the estimation of association/disassociation constants. Some of these strategies have similarities to affinity chromatography, in that they use a probe or ligand immobilized on a supported matrix for electrophoresis. Such methods have recently contributed to profiling of major posttranslational modifications of proteins, such as glycosylation or phosphorylation. Here, we describe advances in analytical techniques involving affinity electrophoresis that have appeared during the last five years. PMID:28248262
Affine Fullerene C60 in a GS-Quasigroup
Directory of Open Access Journals (Sweden)
Vladimir Volenec
2014-01-01
Full Text Available It will be shown that the affine fullerene C60, which is defined as an affine image of buckminsterfullerene C60, can be obtained only by means of the golden section. The concept of the affine fullerene C60 will be constructed in a general GS-quasigroup using the statements about the relationships between affine regular pentagons and affine regular hexagons. The geometrical interpretation of all discovered relations in a general GS-quasigroup will be given in the GS-quasigroup C(1/2(1+5.
DEFF Research Database (Denmark)
Plenge, Per; Wiborg, Ove
2005-01-01
of presumed importance. Binding of S-citalopram, both to the high-affinity-binding site and to the allosteric binding site, was measured in these mutants with the purpose of investigating the connection between the two binding sites. The amino acid substitutions did not introduce large changes in the two...
Affinity Spaces and 21st Century Learning
Gee, James Paul
2017-01-01
This article discusses video games as "attractors" to "affinity spaces." It argues that affinity spaces are key sites today where people teach and learn 21st Century skills. While affinity spaces are proliferating on the Internet as interest-and-passion-driven sites devoted to a common set of endeavors, they are not new, just…
International Nuclear Information System (INIS)
Rougon-Rappuzi, G.; Delaage, M.A.; Conte-Devolx, B.; Millet, Y.
1977-01-01
A highly sensitive and specific radioimmunoassay (RIA) for arginine-vasopressin (AVP) was developped and applied to the measurement of AVP in human plasma. High-affinity antivasopressin antibodies with limited association constant heterogeneity have been induced by immunizing rabbits with Lysine-vasopressine (LVP) coupled to a human immunoglobulin (IgA). Replacing air drying of acetone-petroleum ether extracts by lyophilisation increased significantly the yields of AVP. Equilibrium dialysis was used for separating bound and free antigen, thus reducing the total time required for the assay to 48 hours. Only 1 ml of plasma was required for routine determinations due to a sensitivity threshold better than 0.5 pg/ml. Plasma AVP levels of normal subjects and of patients with inappropriate ADH secretion (SIADH) were determined during different hydratation states and following nicotin of ethanol infusions. (orig.) [de
On the structure of self-affine convex bodies
Energy Technology Data Exchange (ETDEWEB)
Voynov, A S [M. V. Lomonosov Moscow State University, Faculty of Mechanics and Mathematics, Moscow (Russian Federation)
2013-08-31
We study the structure of convex bodies in R{sup d} that can be represented as a union of their affine images with no common interior points. Such bodies are called self-affine. Vallet's conjecture on the structure of self-affine bodies was proved for d = 2 by Richter in 2011. In the present paper we disprove the conjecture for all d≥3 and derive a detailed description of self-affine bodies in R{sup 3}. Also we consider the relation between properties of self-affine bodies and functional equations with a contraction of an argument. Bibliography: 10 titles.
Affinity membranes for hormone removal from aqueous solutions
Urmenyi, A.M.; Poot, Andreas A.; Wessling, Matthias; Mulder, M.H.V.
2005-01-01
A novel affinity membrane was prepared by covalent binding of antibodies (against 17--estradiol) to a micro-porous poly(ethylene vinyl alcohol) (EVAL) membrane, taking benefit from the high surface area of EVAL membranes and the large number of reactive groups available for further surface
ZipA binds to FtsZ with high affinity and enhances the stability of FtsZ protofilaments.
Directory of Open Access Journals (Sweden)
Anuradha Kuchibhatla
Full Text Available A bacterial membrane protein ZipA that tethers FtsZ to the membrane is known to promote FtsZ assembly. In this study, the binding of ZipA to FtsZ was monitored using fluorescence spectroscopy. ZipA was found to bind to FtsZ with high affinities at three different (6.0, 6.8 and 8.0 pHs, albeit the binding affinity decreased with increasing pH. Further, thick bundles of FtsZ protofilaments were observed in the presence of ZipA under the pH conditions used in this study indicating that ZipA can promote FtsZ assembly and stabilize FtsZ polymers under unfavorable conditions. Bis-ANS, a hydrophobic probe, decreased the interaction of FtsZ and ZipA indicating that the interaction between FtsZ and ZipA is hydrophobic in nature. ZipA prevented the dilution induced disassembly of FtsZ polymers suggesting that it stabilizes FtsZ protofilaments. Fluorescein isothiocyanate-labeled ZipA was found to be uniformly distributed along the length of the FtsZ protofilaments indicating that ZipA stabilizes FtsZ protofilaments by cross-linking them.
Pratesi, Alessandro; Ginanneschi, Mauro; Lumini, Marco; Papini, Anna M.; Novellino, Ettore; Brancaccio, Diego; Carotenuto, Alfonso
2017-02-01
In vivo somatostatin receptor scintigraphy is a valuable method for the visualization of human endocrine tumours and their metastases. In fact, peptide ligands of somatostatin receptors (sst’s) conjugated with chelating agents are in clinical use. We have recently developed octreotide dicarba-analogues, which show interesting binding profiles at sst’s. In this context, it was mandatory to explore the possibility that our analogues could maintain their activity also upon conjugation with DOTA. In this paper, we report and discuss the synthesis, binding affinity and conformational preferences of three DOTA-conjugated dicarba-analogues of octreotide. Interestingly, two conjugated analogues exhibited nanomolar affinities on sst2 and sst5 somatostatin receptor subtypes.
Prescher, Horst; Frank, Martin; Gütgemann, Stephan; Kuhfeldt, Elena; Schweizer, Astrid; Nitschke, Lars; Watzl, Carsten; Brossmer, Reinhard
2017-02-09
Natural killer cells are able to directly lyse tumor cells, thereby participating in the immune surveillance against cancer. Unfortunately, many cancer cells use immune evasion strategies to avoid their eradication by the immune system. A prominent escape strategy of malignant cells is to camouflage themselves with Siglec-7 ligands, thereby recruiting the inhibitory receptor Siglec-7 expressed on the NK cell surface which subsequently inhibits NK-cell-mediated lysis. Here we describe the synthesis and evaluation of the first, high-affinity low molecular weight Siglec-7 ligands to interfere with cancer cell immune evasion. The compounds are Sialic acid derivatives and bind with low micromolar K d values to Siglec-7. They display up to a 5000-fold enhanced affinity over the unmodified sialic acid scaffold αMe Neu5Ac, the smallest known natural Siglec-7 ligand. Our results provide a novel immuno-oncology strategy employing natural immunity in the fight against cancers, in particular blocking Siglec-7 with low molecular weight compounds.
Polynomials associated with equilibria of affine Toda-Sutherland systems
International Nuclear Information System (INIS)
Odake, S; Sasaki, R
2004-01-01
An affine Toda-Sutherland system is a quasi-exactly solvable multi-particle dynamics based on an affine simple root system. It is a 'cross' between two well-known integrable multi-particle dynamics, an affine Toda molecule (exponential potential, periodic nearest-neighbour interaction) and a Sutherland system (inverse sine-square interaction). Polynomials describing the equilibrium positions of affine Toda-Sutherland systems are determined for all affine simple root systems
Duals of Affine Grassmann Codes and Their Relatives
DEFF Research Database (Denmark)
Beelen, P.; Ghorpade, S. R.; Hoholdt, T.
2012-01-01
Affine Grassmann codes are a variant of generalized Reed-Muller codes and are closely related to Grassmann codes. These codes were introduced in a recent work by Beelen Here, we consider, more generally, affine Grassmann codes of a given level. We explicitly determine the dual of an affine...... Grassmann code of any level and compute its minimum distance. Further, we ameliorate the results by Beelen concerning the automorphism group of affine Grassmann codes. Finally, we prove that affine Grassmann codes and their duals have the property that they are linear codes generated by their minimum......-weight codewords. This provides a clean analogue of a corresponding result for generalized Reed-Muller codes....
Cartilage Acidic Protein 2 a hyperthermostable, high affinity calcium-binding protein.
Anjos, Liliana; Gomes, Ana S; Melo, Eduardo P; Canário, Adelino V; Power, Deborah M
2013-03-01
Cartilage Acidic Protein 2 (CRTAC2) is a novel protein present from prokaryotes to vertebrates with abundant expression in the teleost fish pituitary gland and an isoform of CRTAC1, a chondrocyte marker in humans. The two proteins are non-integrins containing N-terminal integrin-like Ca(2+)-binding motifs and their structure and function remain to be assigned. Structural studies of recombinant sea bream (sb)CRTAC2 revealed it is composed of 8.8% α-helix, 33.4% β-sheet and 57.8% unordered protein. sbCRTAC2 bound Ca(2+) with high affinity (K(d)=1.46nM) and favourable Gibbs free energy (∆G=-12.4kcal/mol). The stoichiometry for Ca(2+) bound to sbCRTAC2 at saturation indicated six Ca(2+) ligand-binding sites exist per protein molecule. No conformational change in sbCRTAC2 occurred in the presence of Ca(2+). Fluorescence emission revealed that the tertiary structure of the protein is hyperthermostable between 25°C and 95°C and the fully unfolded state is only induced by chemical denaturing (4M GndCl). sbCRTAC has a widespread tissue distribution and is present as high molecular weight aggregates, although strong reducing conditions promote formation of the monomer. sbCRTAC2 promotes epithelial cell outgrowth in vitro suggesting it may share functional homology with mammalian CRTAC1, recently implicated in cell-cell and cell-matrix interactions. Copyright © 2012 Elsevier B.V. All rights reserved.
A Novel Vertex Affinity for Community Detection
Energy Technology Data Exchange (ETDEWEB)
Yoo, Andy [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Sanders, Geoffrey [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Henson, Van [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Vassilevski, Panayot [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)
2015-10-05
We propose a novel vertex affinity measure in this paper. The new vertex affinity quantifies the proximity between two vertices in terms of their clustering strength and is ideal for such graph analytics applications as community detection. We also developed a framework that combines simple graph searches and resistance circuit formulas to compute the vertex affinity efficiently. We study the properties of the new affinity measure empirically in comparison to those of other popular vertex proximity metrics. Our results show that the existing metrics are ill-suited for community detection due to their lack of fundamental properties that are essential for correctly capturing inter- and intra-cluster vertex proximity.
International Nuclear Information System (INIS)
Breillat, Christelle; Thoumine, Olivier; Choquet, Daniel
2007-01-01
In order to better probe SynCAM function in neurons, we produced a fusion protein between the extracellular domain of SynCAM1 and the constant fragment of human IgG (SynCAM-Fc). Whether in soluble form or immobilized on latex microspheres, the chimera bound specifically to the surface of hippocampal neurons and recruited endogenous SynCAM molecules. SynCAM-Fc was also used in combination with Quantum Dots to follow the mobility of transfected SynCAM receptors at the neuronal surface. Both immobile and highly mobile SynCAM were found. Thus, SynCAM-Fc behaves as a high affinity ligand that can be used to study the function of SynCAM at the neuronal membrane
DEFF Research Database (Denmark)
Tosco, Paolo; Ahring, Philip K; Dyhring, Tino
2009-01-01
Complementary 3D-QSAR modeling of binding affinity and functional potency is proposed as a tool to pinpoint the molecular features of the ligands, and the corresponding amino acids in the receptor, responsible for high affinity binding vs those driving agonist behavior and receptor activation. Th...
On affine non-negative matrix factorization
DEFF Research Database (Denmark)
Laurberg, Hans; Hansen, Lars Kai
2007-01-01
We generalize the non-negative matrix factorization (NMF) generative model to incorporate an explicit offset. Multiplicative estimation algorithms are provided for the resulting sparse affine NMF model. We show that the affine model has improved uniqueness properties and leads to more accurate id...
Yildiz, F. Zehra; Babalola, Kathleen; Summers, Michael F.
2012-01-01
Retroviral genome recognition is mediated by interactions between the nucleocapsid (NC) domain of the virally encoded Gag polyprotein and cognate RNA packaging elements that, for most retroviruses, appear to reside primarily within the 5′-untranslated region (5′-UTR) of the genome. Recent studies suggest that a major packaging determinant of Bovine Leukemia Virus (BLV), a member of the human T-cell leukemia virus (HTLV)/BLV family and a non-primate animal model for HTLV-induced leukemogenesis, resides within the gag open reading frame. We have prepared and purified the recombinant BLV NC protein and conducted electrophoretic mobility shift and isothermal titration calorimetry studies with RNA fragments corresponding to these proposed packaging elements. The gag-derived RNAs did not exhibit significant affinity for NC, suggesting an alternate role in packaging. However, an 83-nucleotide fragment of the 5′-UTR that resides just upstream of the gag start codon binds NC stoichiometrically and with high affinity (Kd = 136 ± 21 nM). These nucleotides were predicted to form tandem hairpin structures, and studies with smaller fragments indicate that the NC binding site resides exclusively within the distal hairpin (residues G369- U399, Kd = 67 ± 8 nM at physiological ionic strength). Unlike all other structurally characterized retroviral NC binding RNAs, this fragment is not expected to contain exposed guanosines, suggesting that RNA binding may be mediated by a previously uncharacterized mechanism. PMID:22846919
Peptide Binding to HLA Class I Molecules: Homogenous, High-Throughput Screening, and Affinity Assays
DEFF Research Database (Denmark)
Harndahl, Mikkel; Justesen, Sune Frederik Lamdahl; Lamberth, Kasper
2009-01-01
, better signal-to-background ratios, and a higher capacity. They also describe an efficient approach to screen peptides for binding to HLA molecules. For the occasional user, this will serve as a robust, simple peptide-HLA binding assay. For the more dedicated user, it can easily be performed in a high-throughput...... the luminescent oxygen channeling immunoassay technology (abbreviated LOCI and commercialized as AlphaScreen (TM)). Compared with an enzyme-linked immunosorbent assay-based peptide-HLA class I binding assay, the LOCI assay yields virtually identical affinity measurements, although having a broader dynamic range...... screening mode using standard liquid handling robotics and 384-well plates. We have successfully applied this assay to more than 60 different HLA molecules, leading to more than 2 million measurements. (Journal of Biomolecular Screening 2009: 173-180)...
DEFF Research Database (Denmark)
Domanski, Michal; Molloy, Kelly; Jiang, Hua
2012-01-01
An efficient and reliable procedure for the capture of affinity-tagged proteins and associated complexes from human cell lines is reported. Through multiple optimizations, high yield and low background affinity-purifications are achieved from modest quantities of human cells expressing endogenous...
Sarikhani, Sina; Mirshahi, Manouchehr; Gharaati, Mohammad Reza; Mirshahi, Tooran
2010-11-01
As IgM is the first isotype of antibody which appears in blood after initial exposure to a foreign antigen in the pattern of primary response, detection, and quantification of this molecule in blood seems invaluable. To approach these goals, generation, and characterization of a highly specific mAb (monoclonal antibody) against human IgM were investigated. Human IgM immunoglobulins were used to immunize Balb/c mice. Spleen cells taken from the immunized animals were fused with SP2/O myeloma cells using PEG (polyethylene glycol, MW 1450) as fusogen. The hybridomas were cultured in HAT containing medium and supernatants from the growing hybrids were screened by enzyme-linked immunosorbent assay (ELISA) using plates coated with pure human IgM and the positive wells were then cloned at limiting dilutions. The best clone designated as MAN-1, was injected intraperitoneally to some Pristane-injected mice. Anti-IgM mAb was purified from the animals' ascitic fluid by protein-G sepharose followed by DEAE-cellulose ion exchange chromatography. MAN-1 interacted with human IgM with a very high specificity and affinity. The purity of the sample was tested by SDS-PAGE and the affinity constant was measured (K(a) = 3.5 x 10(9)M(-1). Immunoblotting and competitive ELISA were done and the results showed that the harvested antibody recognizes a conformational epitope on the mu chain of human IgM and there was no cross-reactivity with other subclasses of immunoglobulins. Furthermore, isotyping test was done and the results showed the subclass of the obtained mAb which was IgG(1)kappa.
Baumstummler, A; Lehmann, D; Janjic, N; Ochsner, U A
2014-10-01
Slow off-rate modified aptamer (SOMAmer) reagents were generated to several Staphylococcus aureus cell surface-associated proteins via SELEX with multiple modified DNA libraries using purified recombinant or native proteins. High-affinity binding agents with sub-nanomolar Kd 's were obtained for staphylococcal protein A (SpA), clumping factors (ClfA, ClfB), fibronectin-binding proteins (FnbA, FnbB) and iron-regulated surface determinants (Isd). Further screening revealed several SOMAmers that specifically bound to Staph. aureus cells from all strains that were tested, but not to other staphylococci or other bacteria. SpA and ClfA SOMAmers proved useful for the selective capture and enrichment of Staph. aureus cells, as shown by culture and PCR, leading to improved limits of detection and efficient removal of PCR inhibitors. Detection of Staph. aureus cells was enhanced by several orders of magnitude when the bacterial cell surface was coated with SOMAmers followed by qPCR of the SOMAmers. Furthermore, fluorescence-labelled SpA SOMAmers demonstrated their utility as direct detection agents in flow cytometry. Significance and impact of the study: Monitoring for microbial contamination of food, water, nonsterile products or the environment is typically based on culture, PCR or antibodies. Aptamers that bind with high specificity and affinity to well-conserved cell surface epitopes represent a promising novel type of reagents to detect bacterial cells without the need for culture or cell lysis, including for the capture and enrichment of bacteria present at low cell densities and for the direct detection via qPCR or fluorescent staining. © 2014 Soma Logic, Inc. published by John Wiley & Sons Ltd On behalf of the society for Applied Microbiology.
Hastrup, H; Schwartz, T W
1996-12-16
The three main tachykinins, substance P, neurokinin A (NKA), and neurokinin B, are believed to be selective ligands for respectively the NK-1, NK-2 and NK-3 receptors. However, NKA also has actions which cannot be mediated through its normal NK-2 receptor and the synthetic peptide [pGlu6,Pro9]-Substance P9-11--called septide--is known to have tachykinin-like actions despite its apparent lack of binding to any known tachykinin receptor. In the cloned NK-1 receptor expressed in COS-7 cells NKA and septide as expected were poor competitors for radiolabeled substance P. However, by using radiolabeled NKA and septide directly, it was found that both peptides in homologous binding assays as well as in competition against each other in fact bound to the NK-1 receptor with high affinity: Kd values of 0.51 +/- 0.15 nM (NKA) and 0.55 +/- 0.03 nM (septide). It is concluded that NKA and septide are high-affinity ligands for the NK-1 receptor but that they are poor competitors for substance P, which in contrast competes very well for binding with both NKA and septide.
Contractions of affine spherical varieties
International Nuclear Information System (INIS)
Arzhantsev, I V
1999-01-01
The language of filtrations and contractions is used to describe the class of G-varieties obtainable as the total spaces of the construction of contraction applied to affine spherical varieties, which is well-known in invariant theory. These varieties are local models for arbitrary affine G-varieties of complexity 1 with a one-dimensional categorical quotient. As examples, reductive algebraic semigroups and three-dimensional SL 2 -varieties are considered
International Nuclear Information System (INIS)
Zhang, Xinxin; Zhang, Min; Takano, Tetsuo; Liu, Shenkui
2011-01-01
Highlights: → The AtCCX5 protein coding a putative cation calcium exchanger was characterized. → AtCCX5 expressed in yeast was localized in the plasma membrane and nuclear periphery. → AtCCX5 protein did not show the same transport properties as the CAXs. → AtCCX5 protein involves in mediating high-affinity K + uptake in yeast. → AtCCX5 protein also involves in Na + transport in yeast. -- Abstract: The gene for a putative cation calcium exchanger (CCX) from Arabidopsis thaliana, AtCCX5, was cloned and its function was analyzed in yeast. Green fluorescent protein-tagged AtCCX5 expressed in yeast was localized in the plasma membrane and nuclear periphery. The yeast transformants expressing AtCCX5 were created and their growth in the presence of various cations (K + , Na + , Ca 2+ , Mg 2+ , Fe 2+ , Cu 2+ , Co 2+ , Cd 2+ , Mn 2+ , Ba 2+ , Ni 2+ , Zn 2+ , and Li + ) were analyzed. AtCCX5 expression was found to affect the response to K + and Na + in yeast. The AtCCX5 transformant also showed a little better growth to Zn 2+ . The yeast mutant 9.3 expressing AtCCX5 restored growth of the mutant on medium with low K + (0.5 mM), and also suppressed its Na + sensitivity. Ion uptake experiments showed that AtCCX5 mediated relatively high-affinity K + uptake and was also involved in Na + transport in yeast. Taken together, these findings suggest that the AtCCX5 is a novel transport protein involves in mediating high-affinity K + uptake and Na + transport in yeast.
Wang, Wenwen; Zhang, Hao; Zhang, Zhifeng; Luo, Mengying; Wang, Yuedan; Liu, Qiongzhen; Chen, Yuanli; Li, Mufang; Wang, Dong
2017-02-01
In this study, poly(vinyl alcohol-co-ethylene) (PVA-co-PE) nanofibrous membrane was activated by sodium hydroxide and cyanuric chloride, and then the activated membranes were functionalized by 1,3-propanediamine, hexamethylenediamine and diethylenetriamine to be affinity membranes for bilirubin removal, respectively. The chemical structures and morphologies of membranes were investigated by SEM, FTIR and XPS. And the adsorption ability of different amine-functionalized nanofibrous membranes for bilirubin was characterized. Furthermore, the effects of temperature, initial concentration of bilirubin, NaCl concentration and BSA concentration on the adsorption capacity for bilirubin of diethylenetriamine-functionalized nanofibrous membrane were studied. Results indicated that the adsorption capacity for bilirubin of diethylenetriamine-functionalized nanofibrous membrane could reach 85mg/g membrane when the initial bilirubin concentration was 200mg/L while the adsorption capacity could be increased to 110mg/g membrane if the initial bilirubin concentration was more than 400mg/L. The dynamic adsorption of diethylenetriamine-functionalized nanofibrous membrane showed that the ligands of amine groups on the membrane surface could be used as far as possible by recirculating the plasma with certain flow rates. Therefore, the diethylenetriamine-functionalized PVA-co-PE nanofibrous membrane possessed high adsorption capacity for bilirubin and it can be candidate as affinity membrane for bilirubin removal. Copyright © 2016. Published by Elsevier B.V.
DEFF Research Database (Denmark)
Bach, Anders*; Clausen, Bettina H; Møller, Magda
2012-01-01
Inhibition of the ternary protein complex of the synaptic scaffolding protein postsynaptic density protein-95 (PSD-95), neuronal nitric oxide synthase (nNOS), and the N-methyl-d-aspartate (NMDA) receptor is a potential strategy for treating ischemic brain damage, but high-affinity inhibitors are ...... of Tat-N-dimer (3 nmol/g) to mice subjected to focal cerebral ischemia reduces infarct volume with 40% and restores motor functions. Thus, Tat-N-dimer is a highly efficacious neuroprotective agent with therapeutic potential in stroke....
hPEPT1 Affinity and Translocation of Selected Gln-Sar and Glu-Sar Dipeptide Derivatives
DEFF Research Database (Denmark)
Eriksson, A. H.; Elm, Peter L.; Begtrup, Mikael
2005-01-01
using 14C-labeled Gly-Sar. Translocation was measured as fluorescence ratios induced by the substrates using the fluorescent probe BCECF and an epifluorescence microscope setup. All compounds showed high affinity to hPEPT1, but only the amides l-Gln(N,N-dimethyl)-Sar and l-Gln(N-piperidinyl)-Sar were...... been suggested. However, these are not necessarily predictive of compounds that are actually translocated by hPEPT1. More information on affinity to and translocation via hPEPT1 of side-chain-modified dipeptides may be gained by conducting a study of selected dipeptide derivatives with variety in size...... translocated by hPEPT1. hPEPT1 is very susceptible to modifications of the N-terminal amino acid side chain of dipeptidomimetic substrates, in terms of achieving compounds with high affinity for the transporter. However, as affinity is not predictive of translocation, derivatization in this position must...
Electrochemical affinity biosensors for detection of mycotoxins: A review.
Vidal, Juan C; Bonel, Laura; Ezquerra, Alba; Hernández, Susana; Bertolín, Juan R; Cubel, Carlota; Castillo, Juan R
2013-11-15
This review discusses the current state of electrochemical biosensors in the determination of mycotoxins in foods. Mycotoxins are highly toxic secondary metabolites produced by molds. The acute toxicity of these results in serious human and animal health problems, although it has been only since early 1960s when the first studied aflatoxins were found to be carcinogenic. Mycotoxins affect a broad range of agricultural products, most important cereals and cereal-based foods. A majority of countries, mentioning especially the European Union, have established preventive programs to control contamination and strict laws of the permitted levels in foods. Official methods of analysis of mycotoxins normally requires sophisticated instrumentation, e.g. liquid chromatography with fluorescence or mass detectors, combined with extraction procedures for sample preparation. For about sixteen years, the use of simpler and faster analytical procedures based on affinity biosensors has emerged in scientific literature as a very promising alternative, particularly electrochemical (i.e., amperometric, impedance, potentiometric or conductimetric) affinity biosensors due to their simplicity and sensitivity. Typically, electrochemical biosensors for mycotoxins use specific antibodies or aptamers as affinity ligands, although recombinant antibodies, artificial receptors and molecular imprinted polymers show potential utility. This article deals with recent advances in electrochemical affinity biosensors for mycotoxins and covers complete literature from the first reports about sixteen years ago. Copyright © 2013 Elsevier B.V. All rights reserved.
Paper-based immune-affinity arrays for detection of multiple mycotoxins in cereals.
Li, Li; Chen, Hongpu; Lv, Xiaolan; Wang, Min; Jiang, Xizhi; Jiang, Yifei; Wang, Heye; Zhao, Yongfu; Xia, Liru
2018-03-01
Mycotoxins produced by different species of fungi may coexist in cereals and feedstuffs, and could be highly toxic for humans and animals. For quantification of multiple mycotoxins in cereals, we developed a paper-based mycotoxin immune-affinity array. First, paper-based microzone arrays were fabricated by photolithography. Then, monoclonal mycotoxin antibodies were added in a copolymerization reaction with a cross-linker to form an immune-affinity monolith on the paper-based microzone array. With use of a competitive immune-response format, paper-based mycotoxin immune-affinity arrays were successfully applied to detect mycotoxins in samples. The detection limits for deoxynivalenol, zearalenone, T-2 toxin, and HT-2 toxin were 62.7, 10.8, 0.36, and 0.23 μg·kg -1 , respectively, which meet relevant requirements for these compounds in food. The recovery rates were 81-86% for deoxynivalenol, 89-117% for zearalenone, 79-86% for T-2 toxin, and 78-83% for HT-2 toxin, and showed the paper-based immune-affinity arrays had good reproducibility. In summary, the paper-based mycotoxin immune-affinity array provides a sensitive, rapid, accurate, stable, and convenient platform for detection of multiple mycotoxins in agro-foods. Graphical abstract Paper-based immune-affinity monolithic array. DON deoxynivalenol, HT-2 HT-2 toxin, T-2 T-2 toxin, PEGDA polyethylene glycol diacrylate, ZEN zearalenone.
DEFF Research Database (Denmark)
Guglielmi, Michel; Johannesen, Hl
2004-01-01
, Essex, Hertfordshire, Norfolk and Suffolk. Research found that there was a lack of identity or sense of belonging and nothing anchoring people to the region as a whole. Common affinity is somehow forced to the people of East England and thereby we came to the conclusion that a single landmark...... and potential situations but also virtual events that calls for an undeterminated process of resolution. This process is activated by the user who co-produces the actualisation as an answer to a virtual reality that we defined at the first place. The potential situations or the possible it is a fantomatic real....... The possible is like the real. It is determinated and it only lakes existence. While the possible is already made, the virtual is like a problematic which needs to be resolved and actualized. Our installations are based on high tech interactivity where we use sensors and remote communication to offer a sense...
Pichlo, Magdalena; Bungert-Plümke, Stefanie; Weyand, Ingo; Seifert, Reinhard; Bönigk, Wolfgang; Strünker, Timo; Kashikar, Nachiket Dilip; Goodwin, Normann; Müller, Astrid; Körschen, Heinz G.; Collienne, Ursel; Pelzer, Patric; Van, Qui; Enderlein, Jörg; Klemm, Clementine; Krause, Eberhard; Trötschel, Christian; Poetsch, Ansgar; Kremmer, Elisabeth
2014-01-01
Guanylyl cyclases (GCs), which synthesize the messenger cyclic guanosine 3′,5′-monophosphate, control several sensory functions, such as phototransduction, chemosensation, and thermosensation, in many species from worms to mammals. The GC chemoreceptor in sea urchin sperm can decode chemoattractant concentrations with single-molecule sensitivity. The molecular and cellular underpinnings of such ultrasensitivity are not known for any eukaryotic chemoreceptor. In this paper, we show that an exquisitely high density of 3 × 105 GC chemoreceptors and subnanomolar ligand affinity provide a high ligand-capture efficacy and render sperm perfect absorbers. The GC activity is terminated within 150 ms by dephosphorylation steps of the receptor, which provides a means for precise control of the GC lifetime and which reduces “molecule noise.” Compared with other ultrasensitive sensory systems, the 10-fold signal amplification by the GC receptor is surprisingly low. The hallmarks of this signaling mechanism provide a blueprint for chemical sensing in small compartments, such as olfactory cilia, insect antennae, or even synaptic boutons. PMID:25135936
Wang, Xiaolei
2014-12-12
Background: A quantitative understanding of interactions between transcription factors (TFs) and their DNA binding sites is key to the rational design of gene regulatory networks. Recent advances in high-throughput technologies have enabled high-resolution measurements of protein-DNA binding affinity. Importantly, such experiments revealed the complex nature of TF-DNA interactions, whereby the effects of nucleotide changes on the binding affinity were observed to be context dependent. A systematic method to give high-quality estimates of such complex affinity landscapes is, thus, essential to the control of gene expression and the advance of synthetic biology. Results: Here, we propose a two-round prediction method that is based on support vector regression (SVR) with weighted degree (WD) kernels. In the first round, a WD kernel with shifts and mismatches is used with SVR to detect the importance of subsequences with different lengths at different positions. The subsequences identified as important in the first round are then fed into a second WD kernel to fit the experimentally measured affinities. To our knowledge, this is the first attempt to increase the accuracy of the affinity prediction by applying two rounds of string kernels and by identifying a small number of crucial k-mers. The proposed method was tested by predicting the binding affinity landscape of Gcn4p in Saccharomyces cerevisiae using datasets from HiTS-FLIP. Our method explicitly identified important subsequences and showed significant performance improvements when compared with other state-of-the-art methods. Based on the identified important subsequences, we discovered two surprisingly stable 10-mers and one sensitive 10-mer which were not reported before. Further test on four other TFs in S. cerevisiae demonstrated the generality of our method. Conclusion: We proposed in this paper a two-round method to quantitatively model the DNA binding affinity landscape. Since the ability to modify
Cyr61/CCN1 displays high-affinity binding to the somatomedin B(1-44 domain of vitronectin.
Directory of Open Access Journals (Sweden)
Ivo M B Francischetti
2010-02-01
Full Text Available Cyr61 is a member of the CCN (Cyr61, connective tissue growth, NOV family of extracellular-associated (matricellular proteins that present four distinct functional modules, namely insulin-like growth factor binding protein (IGFBP, von Willebrand factor type C (vWF, thrombospondin type 1 (TSP, and C-terminal growth factor cysteine knot (CT domain. While heparin sulphate proteoglycans reportedly mediate the interaction of Cyr61 with the matrix and cell surface, the role of other extracellular associated proteins has not been revealed.In this report, surface plasmon resonance (SPR experiments and solid-phase binding assays demonstrate that recombinant Cyr61 interacts with immobilized monomeric or multimeric vitronectin (VTNC with K(D in the nanomolar range. Notably, the binding site for Cyr61 was identified as the somatomedin B domain (SMTB(1-44 of VTNC, which mediates its interaction with PAI-1, uPAR, and integrin alphav beta3. Accordingly, PAI-1 outcompetes Cyr61 for binding to immobilized SMTB(1-44, and Cyr61 attenuates uPAR-mediated U937 adhesion to VTNC. In contrast, isothermal titration calorimetry shows that Cyr61 does not display high-affinity binding for SMTB(1-44 in solution. Nevertheless, competitive ELISA revealed that multimeric VTNC, heat-modified monomeric VTNC, or SMTB(1-44 at high concentrations attenuate Cyr61 binding to immobilized VTNC, while monomeric VTNC was ineffective. Therefore, immobilization of VTNC exposes cryptic epitopes that recognize Cyr61 with high affinity, as reported for a number of antibodies, beta-endorphin, and other molecules.The finding that Cyr61 interacts with the SMTB(1-44 domain suggests that VTNC represent a point of anchorage for CCN family members to the matrix. Results are discussed in the context of the role of CCN and VTNC in matrix biology and angiogenesis.
Anderson, Caitlin E; Holstein, Carly A; Strauch, Eva-Maria; Bennett, Steven; Chevalier, Aaron; Nelson, Jorgen; Fu, Elain; Baker, David; Yager, Paul
2017-06-20
Influenza is a ubiquitous and recurring infection that results in approximately 500 000 deaths globally each year. Commercially available rapid diagnostic tests are based upon detection of the influenza nucleoprotein, which are limited in that they are unable to differentiate by species and require an additional viral lysis step. Sample preprocessing can be minimized or eliminated by targeting the intact influenza virus, thereby reducing assay complexity and leveraging the large number of hemagglutinin proteins on the surface of each virus. Here, we report the development of a paper-based influenza assay that targets the hemagglutinin protein; the assay employs a combination of antibodies and novel computationally designed, recombinant affinity proteins as the capture and detection agents. This system leverages the customizability of recombinant protein design to target the conserved receptor-binding pocket of the hemagglutinin protein and to match the trimeric nature of hemagglutinin for improved avidity. Using this assay, we demonstrate the first instance of intact influenza virus detection using a combination of antibody and affinity proteins within a porous network. The recombinant head region binder based assays yield superior analytical sensitivity as compared to the antibody based assay, with lower limits of detection of 3.54 × 10 7 and 1.34 × 10 7 CEID 50 /mL for the mixed and all binder stacks, respectively. Not only does this work describe the development of a novel influenza assay, it also demonstrates the power of recombinant affinity proteins for use in rapid diagnostic assays.
Extreme disorder in an ultrahigh-affinity protein complex
DEFF Research Database (Denmark)
Borgia, Alessandro; Borgia, Madeleine B; Bugge, Katrine
2018-01-01
Molecular communication in biology is mediated by protein interactions. According to the current paradigm, the specificity and affinity required for these interactions are encoded in the precise complementarity of binding interfaces. Even proteins that are disordered under physiological conditions...... with picomolar affinity, but fully retain their structural disorder, long-range flexibility and highly dynamic character. On the basis of closely integrated experiments and molecular simulations, we show that the interaction can be explained by the large opposite net charge of the two proteins, without requiring...... or that contain large unstructured regions commonly interact with well-structured binding sites on other biomolecules. Here we demonstrate the existence of an unexpected interaction mechanism: the two intrinsically disordered human proteins histone H1 and its nuclear chaperone prothymosin-α associate in a complex...
Carbonate-sensitive phytotransferrin controls high-affinity iron uptake in diatoms
McQuaid, Jeffrey B.; Kustka, Adam B.; Oborník, Miroslav; Horák, Aleš; McCrow, John P.; Karas, Bogumil J.; Zheng, Hong; Kindeberg, Theodor; Andersson, Andreas J.; Barbeau, Katherine A.; Allen, Andrew E.
2018-03-01
In vast areas of the ocean, the scarcity of iron controls the growth and productivity of phytoplankton. Although most dissolved iron in the marine environment is complexed with organic molecules, picomolar amounts of labile inorganic iron species (labile iron) are maintained within the euphotic zone and serve as an important source of iron for eukaryotic phytoplankton and particularly for diatoms. Genome-enabled studies of labile iron utilization by diatoms have previously revealed novel iron-responsive transcripts, including the ferric iron-concentrating protein ISIP2A, but the mechanism behind the acquisition of picomolar labile iron remains unknown. Here we show that ISIP2A is a phytotransferrin that independently and convergently evolved carbonate ion-coordinated ferric iron binding. Deletion of ISIP2A disrupts high-affinity iron uptake in the diatom Phaeodactylum tricornutum, and uptake is restored by complementation with human transferrin. ISIP2A is internalized by endocytosis, and manipulation of the seawater carbonic acid system reveals a second-order dependence on the concentrations of labile iron and carbonate ions. In P. tricornutum, the synergistic interaction of labile iron and carbonate ions occurs at environmentally relevant concentrations, revealing that carbonate availability co-limits iron uptake. Phytotransferrin sequences have a broad taxonomic distribution and are abundant in marine environmental genomic datasets, suggesting that acidification-driven declines in the concentration of seawater carbonate ions will have a negative effect on this globally important eukaryotic iron acquisition mechanism.
Directory of Open Access Journals (Sweden)
Kailai Cai
Full Text Available Inhibin is an important marker of Sertoli cell (SC activity in animals with impaired spermatogenesis. However, the precise relationship between inhibin and SC activity is unknown. To investigate this relationship, we partially silenced both the transcription and translation of the gene for the α-subunit of inhibin, Inha, using recombinant pshRNA vectors developed with RNAi-Ready pSIREN-RetroQ-ZsGreen Vector (Clontech Laboratories, Mountain View, Calif. We found that Inha silencing suppresses the cell-cycle regulators Cyclin D1 and Cyclin E and up-regulates the cell-cycle inhibitor P21 (as detected by Western blot analysis, thereby increasing the number of SCs in the G1 phase of the cell cycle and decreasing the amount in the S-phase of the cell cycle (as detected by flow cytometry. Inha silencing also suppressed Pdgfa, Igf1, and Kitl mRNA levels and up-regulated Tgfbrs, Inhba, Inhbb, Cyp11a1, Dhh, and Tjp1 mRNA levels (as indicated by real-time polymerase chain reaction [PCR] analysis. These findings indicate that Inha has the potential to influence the availability of the ligand inhibin and its antagonist activin in the SC in an autocrine manner and inhibit the progression of SC from G1 to S. It may also participate in the development of the blood-testis barrier, Leydig cells, and spermatogenesis through its effect on Dhh, Tjp1, Kitl, and Pdgfa. Real-time PCR and Western blot analyses of Inha, Inhba, and Inhbb mRNA and Inha levels over time show that Inha plays an important role in the formation of round spermatid during the first wave of spermatogenesis in mice.
Global affine differential geometry of hypersurfaces
Li, An-Min; Zhao, Guosong; Hu, Zejun
2015-01-01
This book draws a colorful and widespread picture of global affine hypersurface theory up to the most recent state. Moreover, the recent development revealed that affine differential geometry- as differential geometry in general- has an exciting intersection area with other fields of interest, like partial differential equations, global analysis, convex geometry and Riemann surfaces.
Heparin-binding peptide as a novel affinity tag for purification of recombinant proteins.
Morris, Jacqueline; Jayanthi, Srinivas; Langston, Rebekah; Daily, Anna; Kight, Alicia; McNabb, David S; Henry, Ralph; Kumar, Thallapuranam Krishnaswamy Suresh
2016-10-01
Purification of recombinant proteins constitutes a significant part of the downstream processing in biopharmaceutical industries. Major costs involved in the production of bio-therapeutics mainly depend on the number of purification steps used during the downstream process. Affinity chromatography is a widely used method for the purification of recombinant proteins expressed in different expression host platforms. Recombinant protein purification is achieved by fusing appropriate affinity tags to either N- or C- terminus of the target recombinant proteins. Currently available protein/peptide affinity tags have proved quite useful in the purification of recombinant proteins. However, these affinity tags suffer from specific limitations in their use under different conditions of purification. In this study, we have designed a novel 34-amino acid heparin-binding affinity tag (HB-tag) for the purification of recombinant proteins expressed in Escherichia coli (E. coli) cells. HB-tag fused recombinant proteins were overexpressed in E. coli in high yields. A one-step heparin-Sepharose-based affinity chromatography protocol was developed to purify HB-fused recombinant proteins to homogeneity using a simple sodium chloride step gradient elution. The HB-tag has also been shown to facilitate the purification of target recombinant proteins from their 8 M urea denatured state(s). The HB-tag has been demonstrated to be successfully released from the fusion protein by an appropriate protease treatment to obtain the recombinant target protein(s) in high yields. Results of the two-dimensional NMR spectroscopy experiments indicate that the purified recombinant target protein(s) exist in the native conformation. Polyclonal antibodies raised against the HB-peptide sequence, exhibited high binding specificity and sensitivity to the HB-fused recombinant proteins (∼10 ng) in different crude cell extracts obtained from diverse expression hosts. In our opinion, the HB-tag provides a
Energy Technology Data Exchange (ETDEWEB)
Jung, K. H.; Kim, D. H.; Paik, J. Y.; Koh, B. H.; Bae, J. S.; Choe, Y. S.; Lee, K. H.; Kim, B. T. [Samsung Medical Center, Seoul (Korea, Republic of)
2005-07-01
Some of the obstacles for the clinical application of whole nerve growth factor (NGF) may be overcome by utilizing small molecule mimetics. We thus investigated the in vivo pharmacokinetics and biodistribution of a small cyclic peptide derived from NGF-[C(92-96)] with high receptor binding affinity. I-125 C(92-96) was labeled with the Bolton-Hunter method, and binding to TrkA/IgG chimeric protein was confirmed on a polyacrylamide gel after cross-linking. Pharmacokinetic analysis was performed in normal ICR mice intravenously injected with 0.5 MBq I-125 C(92-96) containing varying doses of C(92-96). Biodistribution studies were done at 6 h after injection. Cross-linkage analysis confirmed binding of I-125 C(92-96) to the high affinity NGF receptor, TrkA. Intravenously injected I-125 C(92-96) was cleared from the blood in a biexponential manner with an early T1/2{alpha} of 5.2 min and late T1/2{beta} of 121.3 min. Log blood-concentration decreased over time with a k-slope of 0.0025, clearance of 11.8{+-}0.5 ml/min, T1/2 of 4.1{+-}0.4 hr, and volume of distribution of 69.7{+-}4.6 ml. The pattern of elimination from the blood remained essentially unchanged regardless of the dose of added C(92-96), with dose-proportionate increases in AUCs and peak concentrations consistent with linear pharmacokinetics. Biodistribution studies demonstrated high kidney activity suggesting renal excretion of I-125 C(92-96). There were moderate levels of accumulation in the spleen, lungs and liver, followed by the myocardium and skeletal muscle, whereas brain uptake was low (< 0.2 %ID/gm). Intravenously administered C(92-96) follows linear pharmacokinetics, and is cleared from the circulation at a rate comparable to whole NGF despite its substantially smaller size. Although intravenous C(92-96) does not adequately reach brain tissue, clinically relevant doses can achieve major organ accumulation levels that may be sufficient to elicit biologic responses through NGF receptors.
International Nuclear Information System (INIS)
Jung, K. H.; Kim, D. H.; Paik, J. Y.; Koh, B. H.; Bae, J. S.; Choe, Y. S.; Lee, K. H.; Kim, B. T.
2005-01-01
Some of the obstacles for the clinical application of whole nerve growth factor (NGF) may be overcome by utilizing small molecule mimetics. We thus investigated the in vivo pharmacokinetics and biodistribution of a small cyclic peptide derived from NGF-[C(92-96)] with high receptor binding affinity. I-125 C(92-96) was labeled with the Bolton-Hunter method, and binding to TrkA/IgG chimeric protein was confirmed on a polyacrylamide gel after cross-linking. Pharmacokinetic analysis was performed in normal ICR mice intravenously injected with 0.5 MBq I-125 C(92-96) containing varying doses of C(92-96). Biodistribution studies were done at 6 h after injection. Cross-linkage analysis confirmed binding of I-125 C(92-96) to the high affinity NGF receptor, TrkA. Intravenously injected I-125 C(92-96) was cleared from the blood in a biexponential manner with an early T1/2α of 5.2 min and late T1/2β of 121.3 min. Log blood-concentration decreased over time with a k-slope of 0.0025, clearance of 11.8±0.5 ml/min, T1/2 of 4.1±0.4 hr, and volume of distribution of 69.7±4.6 ml. The pattern of elimination from the blood remained essentially unchanged regardless of the dose of added C(92-96), with dose-proportionate increases in AUCs and peak concentrations consistent with linear pharmacokinetics. Biodistribution studies demonstrated high kidney activity suggesting renal excretion of I-125 C(92-96). There were moderate levels of accumulation in the spleen, lungs and liver, followed by the myocardium and skeletal muscle, whereas brain uptake was low (< 0.2 %ID/gm). Intravenously administered C(92-96) follows linear pharmacokinetics, and is cleared from the circulation at a rate comparable to whole NGF despite its substantially smaller size. Although intravenous C(92-96) does not adequately reach brain tissue, clinically relevant doses can achieve major organ accumulation levels that may be sufficient to elicit biologic responses through NGF receptors
Li, Baiyan
2011-12-23
Open and friendly: The smallest member of the rht-type metal-organic frameworks (MOFs, see picture) constructed by a hexacarboxylate ligand with a nitrogen-rich imino triazine backbone shows a significantly enhanced gas binding affinity relative to all other isoreticular rht-type MOFs. The high adsorption capacity and remarkable selectivity of CO 2 are attributed to the high density of open metal and Lewis basic sites in the framework. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Fawaz, Maria V; Brooks, Allen F; Rodnick, Melissa E; Carpenter, Garrett M; Shao, Xia; Desmond, Timothy J; Sherman, Phillip; Quesada, Carole A; Hockley, Brian G; Kilbourn, Michael R; Albin, Roger L; Frey, Kirk A; Scott, Peter J H
2014-08-20
Abnormally aggregated tau is the hallmark pathology of tauopathy neurodegenerative disorders and is a target for development of both diagnostic tools and therapeutic strategies across the tauopathy disease spectrum. Development of carbon-11- or fluorine-18-labeled radiotracers with appropriate affinity and specificity for tau would allow noninvasive quantification of tau burden using positron emission tomography (PET) imaging. We have synthesized [(18)F]lansoprazole, [(11)C]N-methyl lansoprazole, and [(18)F]N-methyl lansoprazole and identified them as high affinity radiotracers for tau with low to subnanomolar binding affinities. Herein, we report radiosyntheses and extensive preclinical evaluation with the aim of selecting a lead radiotracer for translation into human PET imaging trials. We demonstrate that [(18)F]N-methyl lansoprazole, on account of the favorable half-life of fluorine-18 and its rapid brain entry in nonhuman primates, favorable kinetics, low white matter binding, and selectivity for binding to tau over amyloid, is the lead compound for progression into clinical trials.
Vinayek, R; Patto, R J; Menozzi, D; Gregory, J; Mrozinski, J E; Jensen, R T; Gardner, J D
1993-03-10
Based on the effects of monensin on binding of 125I-CCK-8 and its lack of effect on CCK-8-stimulated amylase secretion we previously proposed that pancreatic acinar cells possess three classes of CCK receptors: high-affinity receptors, low-affinity receptors and very low-affinity receptors [1]. In the present study we treated pancreatic acini with carbachol to induce a complete loss of high-affinity CCK receptors and then examined the action of CCK-8 on inositol trisphosphate IP3(1,4,5), cytosolic calcium and amylase secretion in an effort to confirm and extend our previous hypothesis. We found that first incubating pancreatic acini with 10 mM carbachol decreased binding of 125I-CCK-8 measured during a second incubation by causing a complete loss of high-affinity CCK receptors with no change in the low-affinity CCK receptors. Carbachol treatment of acini, however, did not alter the action of CCK-8 on IP3(1,4,5), cytosolic calcium or amylase secretion or the action of CCK-JMV-180 on amylase secretion or on the supramaximal inhibition of amylase secretion caused by CCK-8. The present findings support our previous hypothesis that pancreatic acinar cells possess three classes of CCK receptors and suggest that high-affinity CCK receptors do not mediate the action of CCK-8 on enzyme secretion, that low-affinity CCK receptors may mediate the action of CCK on cytosolic calcium that does not involve IP3(1,4,5) and produce the upstroke of the dose-response curve for CCK-8-stimulated amylase secretion and that very low-affinity CCK receptors mediate the actions of CCK on IP3(1,4,5) and cytosolic calcium and produce the downstroke of the dose-response curve for CCK-8-stimulated amylase secretion. Moreover, CCK-JMV-180 is a full agonist for stimulating amylase secretion by acting at low-affinity CCK receptors and is an antagonist at very low-affinity CCK receptors.
New unitary affine-Virasoro constructions
International Nuclear Information System (INIS)
Halpern, M.B.; Kiritsis, E.; Obers, N.A.; Poratti, M.; Yamron, J.P.
1990-01-01
This paper reports on a quasi-systematic investigation of the Virasoro master equation. The space of all affine-Virasoro constructions is organized by K-conjugation into affine-Virasoro nests, and an estimate of the dimension of the space shows that most solutions await discovery. With consistent ansatze for the master equation, large classes of new unitary nests are constructed, including quadratic deformation nests with continuous conformal weights, and unitary irrational central charge nests, which may dominate unitary rational central charge on compact g
Development of an aptamer-based affinity purification method for vascular endothelial growth factor
Directory of Open Access Journals (Sweden)
Maren Lönne
2015-12-01
Full Text Available Since aptamers bind their targets with high affinity and specificity, they are promising alternative ligands in protein affinity purification. As aptamers are chemically synthesized oligonucleotides, they can be easily produced in large quantities regarding GMP conditions allowing their application in protein production for therapeutic purposes. Several advantages of aptamers compared to antibodies are described in general within this paper. Here, an aptamer directed against the human Vascular Endothelial Growth Factor (VEGF was used as affinity ligand for establishing a purification platform for VEGF in small scale. The aptamer was covalently immobilized on magnetic beads in a controlled orientation resulting in a functional active affinity matrix. Target binding was optimized by introduction of spacer molecules and variation of aptamer density. Further, salt-induced target elution was demonstrated as well as VEGF purification from a complex protein mixture proving the specificity of protein-aptamer binding.
Hage, David S.; Anguizola, Jeanethe A.; Bi, Cong; Li, Rong; Matsuda, Ryan; Papastavros, Efthimia; Pfaunmiller, Erika; Vargas, John; Zheng, Xiwei
2012-01-01
Affinity chromatography is a separation technique that has become increasingly important in work with biological samples and pharmaceutical agents. This method is based on the use of a biologically-related agent as a stationary phase to selectively retain analytes or to study biological interactions. This review discusses the basic principles behind affinity chromatography and examines recent developments that have occurred in the use of this method for biomedical and pharmaceutical analysis. Techniques based on traditional affinity supports are discussed, but an emphasis is placed on methods in which affinity columns are used as part of HPLC systems or in combination with other analytical methods. General formats for affinity chromatography that are considered include step elution schemes, weak affinity chromatography, affinity extraction and affinity depletion. Specific separation techniques that are examined include lectin affinity chromatography, boronate affinity chromatography, immunoaffinity chromatography, and immobilized metal ion affinity chromatography. Approaches for the study of biological interactions by affinity chromatography are also presented, such as the measurement of equilibrium constants, rate constants, or competition and displacement effects. In addition, related developments in the use of immobilized enzyme reactors, molecularly imprinted polymers, dye ligands and aptamers are briefly considered. PMID:22305083
Stewart, Rachel C.; Bansal, Prashant N.; Entezari, Vahid; Lusic, Hrvoje; Nazarian, Rosalynn M.; Snyder, Brian D.; Grinstaff, Mark W.
2013-01-01
The high affinity of a cationic iodinated contrast agent for cartilage provides better tissue visualization, easier segmentation, higher contrast-to-noise ratios, and longer usable imaging windows and requires a lower dose of injected contrast agent compared with an anionic contrast agent.
Ahamed, Muneer; van Veghel, Daisy; Ullmer, Christoph; Van Laere, Koen; Verbruggen, Alfons; Bormans, Guy M
2016-01-01
The type 2 cannabinoid receptor (CB2) is a member of the endocannabinoid system and is known for its important role in (neuro)inflammation. A PET-imaging agent that allows in vivo visualization of CB2 expression may thus allow quantification of neuroinflammation. In this paper, we report the synthesis, radiosynthesis, biodistribution and in vitro evaluation of a carbon-11 ([ 11 C]MA2) and a fluorine-18 ([ 18 F]MA3) labeled analog of a highly potent N -arylamide oxadiazole CB2 agonist (EC 50 = 0.015 nM). MA2 and MA3 behaved as potent CB2 agonist (EC 50 : 3 nM and 0.1 nM, respectively) and their in vitro binding affinity for h CB2 was found to be 87 nM and 0.8 nM, respectively. Also MA3 (substituted with a fluoro ethyl group) was found to have higher binding affinity and EC 50 values when compared to the originally reported trifluoromethyl analog 12 . [ 11 C]MA2 and [ 18 F]MA3 were successfully synthesized with good radiochemical yield, high radiochemical purity and high specific activity. In mice, both tracers were efficiently cleared from blood and all major organs by the hepatobiliary pathway and importantly these compounds showed high brain uptake. In conclusion, [ 11 C]MA2 and [ 18 F]MA3 are shown to be high potent CB2 agonists with good brain uptake, these favorable characteristics makes them potential PET probes for in vivo imaging of brain CB2 receptors. However, in view of its higher affinity and selectivity, further detailed evaluation of MA3 as a PET tracer for CB2 is warranted.
Schrager, D.F.
2006-01-01
We propose a new model for stochastic mortality. The model is based on the literature on affine term structure models. It satisfies three important requirements for application in practice: analytical tractibility, clear interpretation of the factors and compatibility with financial option pricing
International Nuclear Information System (INIS)
Ong, Hooi Tin; Loo, Joachim S. C.; Boey, Freddy Y. C.; Russell, Stephen J.; Ma Jan; Peng, Kah-Whye
2008-01-01
Hydroxyapatite is biocompatible and used in various biomedical applications. Here, we generated hydroxyapatite nanoparticles (HNPs) of various sizes (40-200 nm) and demonstrated that they can be stably loaded with drugs or radioisotopes by exploiting the high-affinity HA-(poly)phosphonate interaction. Clinically available phosphonates, clodronate, and Tc-99m-methylene-diphosphonate (Tc-99m-MDP), were efficiently loaded onto HNPs within 15 min. Biodistribution of radiolabeled HNP-MDP-Tc99m in mice was monitored non-invasively using microSPECT-CT. Imaging and dosimetry studies indicated that the HNPs, regardless of size, were quickly taken up by Kupffer cells in the liver after systemic administration into mice. Clodronate loaded onto HNPs remained biologically active and were able to result in selective depletion of Kupffer cells. This method of drug or isotope loading on HA is fast and easy as it eliminates the need for additional surface modifications of the nanoparticles
Rank Two Affine Manifolds in Genus 3
Aulicino, David; Nguyen, Duc-Manh
2016-01-01
We complete the classification of rank two affine manifolds in the moduli space of translation surfaces in genus three. Combined with a recent result of Mirzakhani and Wright, this completes the classification of higher rank affine manifolds in genus three.
Maximum-Entropy Models of Sequenced Immune Repertoires Predict Antigen-Antibody Affinity.
Directory of Open Access Journals (Sweden)
Lorenzo Asti
2016-04-01
Full Text Available The immune system has developed a number of distinct complex mechanisms to shape and control the antibody repertoire. One of these mechanisms, the affinity maturation process, works in an evolutionary-like fashion: after binding to a foreign molecule, the antibody-producing B-cells exhibit a high-frequency mutation rate in the genome region that codes for the antibody active site. Eventually, cells that produce antibodies with higher affinity for their cognate antigen are selected and clonally expanded. Here, we propose a new statistical approach based on maximum entropy modeling in which a scoring function related to the binding affinity of antibodies against a specific antigen is inferred from a sample of sequences of the immune repertoire of an individual. We use our inference strategy to infer a statistical model on a data set obtained by sequencing a fairly large portion of the immune repertoire of an HIV-1 infected patient. The Pearson correlation coefficient between our scoring function and the IC50 neutralization titer measured on 30 different antibodies of known sequence is as high as 0.77 (p-value 10-6, outperforming other sequence- and structure-based models.
Hu, Meng-Xin; Li, Xiang; Li, Ji-Nian; Huang, Jing-Jing; Ren, Ge-Rui
2018-02-23
Polymer brushes modified surfaces have been widely used for protein immobilization and isolation. Modification of membranes with polymer brushes increases the surface concentration of affinity ligands used for protein binding. Albumin is one of the transporting proteins and shows a high affinity to bile acids. In this work, the modified membranes with cholic acid-containing polymer brushes can be facilely prepared by the immobilization of cholic acid on the poly(2-hydroxyethyl methacrylate) grafted microporous polypropylene membranes (MPPMs) for affinity adsorption of albumin. ATR/FT-IR and X-ray photoelectron spectroscopy were used to characterize the chemical composition of the modified membranes. Water contact angle measurements were used to analyze the hydrophilic/hydrophobic properties of the membrane surface. The modified MPPMs show a high affinity to albumin and have little non-specific adsorption of hemoglobin. The dynamic binding capacity of albumin in the continous-flow system increases with the cycle number and feed rate as the binding degree of cholic acid is moderate. The highest binding capacity of affinity membranes is about 52.49 g/m 2 membrane, which is about 24 times more than the monolayer binding capacity. These results reveal proteins could be captured in multilayers by the polymer brushes containing affinity ligands similar to the polymer brushes containing ion-exchange groups, which open up the potential of the polymer brushes containing affinity ligands in protein or another components separation. And the cholic acid containing polymer brushes modified membranes has the promising potential for albumin separation and purification rapidly from serum or fermented solution in medical diagnosis and bioseparation. Copyright © 2018 Elsevier B.V. All rights reserved.
High-affinity hemoglobin and blood oxygen saturation in diving emperor penguins.
Meir, Jessica U; Ponganis, Paul J
2009-10-01
The emperor penguin (Aptenodytes forsteri) thrives in the Antarctic underwater environment, diving to depths greater than 500 m and for durations longer than 23 min. To examine mechanisms underlying the exceptional diving ability of this species and further describe blood oxygen (O2) transport and depletion while diving, we characterized the O2-hemoglobin (Hb) dissociation curve of the emperor penguin in whole blood. This allowed us to (1) investigate the biochemical adaptation of Hb in this species, and (2) address blood O2 depletion during diving, by applying the dissociation curve to previously collected partial pressure of O2 (PO2) profiles to estimate in vivo Hb saturation (SO2) changes during dives. This investigation revealed enhanced Hb-O2 affinity (P50=28 mmHg, pH 7.5) in the emperor penguin, similar to high-altitude birds and other penguin species. This allows for increased O2 at low blood PO2 levels during diving and more complete depletion of the respiratory O2 store. SO2 profiles during diving demonstrated that arterial SO2 levels are maintained near 100% throughout much of the dive, not decreasing significantly until the final ascent phase. End-of-dive venous SO2 values were widely distributed and optimization of the venous blood O2 store resulted from arterialization and near complete depletion of venous blood O2 during longer dives. The estimated contribution of the blood O2 store to diving metabolic rate was low and highly variable. This pattern is due, in part, to the influx of O2 from the lungs into the blood during diving, and variable rates of tissue O2 uptake.
Food and value motivation: Linking consumer affinities to different types of food products.
de Boer, Joop; Schösler, Hanna
2016-08-01
This study uses the consumer affinity concept to examine the multiple motives that may shape consumers' relationships with food. The concept was applied in a study on four broad product types in the Netherlands, which cover a wide range of the market and may each appeal to consumers with different affinities towards foods. These product types may be denoted as 'conventional', 'efficient', 'gourmet' and 'pure'. A comparative analysis, based on Higgins' Regulatory Focus Theory, was performed to examine whether food-related value motivations could explain different consumer affinities for these product types. The affinities of consumers were measured by means of a non-verbal, visual presentation of four samples of food products in a nationwide survey (n = 742) among consumers who were all involved in food purchasing and/or cooking. The affinities found could be predicted fairly well from a number of self-descriptions relating to food and eating, which expressed different combinations of type of value motivation and involvement with food. The analysis demonstrated the contrasting role of high and low involvement as well as the potential complementarity of promotion- and prevention-focused value motivation. It is suggested that knowledge of the relationships between product types, consumer affinities and value motivation can help improve the effectiveness of interventions that seek to promote healthy and sustainable diets in developed countries. Copyright © 2016 Elsevier Ltd. All rights reserved.
Dynamics of Open Systems with Affine Maps
International Nuclear Information System (INIS)
Zhang Da-Jian; Liu Chong-Long; Tong Dian-Min
2015-01-01
Many quantum systems of interest are initially correlated with their environments and the reduced dynamics of open systems are an interesting while challenging topic. Affine maps, as an extension of completely positive maps, are a useful tool to describe the reduced dynamics of open systems with initial correlations. However, it is unclear what kind of initial state shares an affine map. In this study, we give a sufficient condition of initial states, in which the reduced dynamics can always be described by an affine map. Our result shows that if the initial states of the combined system constitute a convex set, and if the correspondence between the initial states of the open system and those of the combined system, defined by taking the partial trace, is a bijection, then the reduced dynamics of the open system can be described by an affine map. (paper)
USING MICROSCALE THERMOPHORESIS TO EASILY MEASURE BINDING AFFINITY
Directory of Open Access Journals (Sweden)
Dennis Breitsprecher*
2018-03-01
Full Text Available While it’s very common for biologists and chemists to test whether or not two molecules interact with each other, it’s much more useful to gather information on the nature of that interaction. How strong is it? How long will it last? What does that mean for its biological function? One way to answer these questions is to study affinity. Binding affinity is defined as the strength of the binding interaction between a single biomolecule to its binding partner, or ligand, and it can be quantifiably measured, providing information on whether or not molecules are interacting, as well as assigning a value to the affinity. When measuring binding affinity, there are several parameters to look at, but the dissociation constant (Kd, which defines the likelihood that an interaction between two molecules will break, is a very common measurement. The smaller the dissociation constant, the more tightly bound the ligand is, and the higher the affinity is between the two molecules.
Single-Step Affinity Purification for Fungal Proteomics ▿ †
Liu, Hui-Lin; Osmani, Aysha H.; Ukil, Leena; Son, Sunghun; Markossian, Sarine; Shen, Kuo-Fang; Govindaraghavan, Meera; Varadaraj, Archana; Hashmi, Shahr B.; De Souza, Colin P.; Osmani, Stephen A.
2010-01-01
A single-step protein affinity purification protocol using Aspergillus nidulans is described. Detailed protocols for cell breakage, affinity purification, and depending on the application, methods for protein release from affinity beads are provided. Examples defining the utility of the approaches, which should be widely applicable, are included.
Blood O2 affinity of a large polar elasmobranch, the Greenland shark Somniosus microcephalus
DEFF Research Database (Denmark)
Herbert, N.A.; Skov, Peter Vilhelm; Tirsgaard, B.
2017-01-01
The Greenland shark (Somniosus microcephalus. Bloch & Schneider 1801) is a polar elasmobranch that is hypothesised to possess a unique metabolic physiology due to its extreme large size, the cold waters it inhabits and its slow swimming lifestyle. Our results therefore provide the first insight...... into the metabolic physiology of this unique shark, with a focus on blood O2 affinity. An evaluation of blood O2 affinity at 2 °C using tonometry revealed a P50 of 11.7 mmHg at a PCO2 of 2.25 mmHg and a Bohr effect (binding sensitivity of blood to pH, ϕ = Δlog P50/ΔpH) of −0.26. A comparative evaluation of blood O2...... affinity across elasmobranch fishes suggests that S. microcephalus has a high blood O2 affinity (i.e., low P50) and a small Bohr effect but these are common traits in sluggish elasmobranch fishes, with little evidence for any relationship of blood O2 affinity to the low metabolic rates, low environmental...
The Structure of Affine Buildings
Weiss, Richard M
2009-01-01
In The Structure of Affine Buildings, Richard Weiss gives a detailed presentation of the complete proof of the classification of Bruhat-Tits buildings first completed by Jacques Tits in 1986. The book includes numerous results about automorphisms, completions, and residues of these buildings. It also includes tables correlating the results in the locally finite case with the results of Tits's classification of absolutely simple algebraic groups defined over a local field. A companion to Weiss's The Structure of Spherical Buildings, The Structure of Affine Buildings is organized around the clas
The dynamics of metric-affine gravity
International Nuclear Information System (INIS)
Vitagliano, Vincenzo; Sotiriou, Thomas P.; Liberati, Stefano
2011-01-01
Highlights: → The role and the dynamics of the connection in metric-affine theories is explored. → The most general second order action does not lead to a dynamical connection. → Including higher order invariants excites new degrees of freedom in the connection. → f(R) actions are also discussed and shown to be a non- representative class. - Abstract: Metric-affine theories of gravity provide an interesting alternative to general relativity: in such an approach, the metric and the affine (not necessarily symmetric) connection are independent quantities. Furthermore, the action should include covariant derivatives of the matter fields, with the covariant derivative naturally defined using the independent connection. As a result, in metric-affine theories a direct coupling involving matter and connection is also present. The role and the dynamics of the connection in such theories is explored. We employ power counting in order to construct the action and search for the minimal requirements it should satisfy for the connection to be dynamical. We find that for the most general action containing lower order invariants of the curvature and the torsion the independent connection does not carry any dynamics. It actually reduces to the role of an auxiliary field and can be completely eliminated algebraically in favour of the metric and the matter field, introducing extra interactions with respect to general relativity. However, we also show that including higher order terms in the action radically changes this picture and excites new degrees of freedom in the connection, making it (or parts of it) dynamical. Constructing actions that constitute exceptions to this rule requires significant fine tuned and/or extra a priori constraints on the connection. We also consider f(R) actions as a particular example in order to show that they constitute a distinct class of metric-affine theories with special properties, and as such they cannot be used as representative toy
International Nuclear Information System (INIS)
Leff, S.E.; Creese, I.
1985-01-01
The interactions of dopaminergic agonists and antagonists with 3 H-agonist labeled D3 dopaminergic binding sites of rat striatum have been characterized by radioligand-binding techniques. When the binding of [ 3 H]dopamine and [ 3 H]apomorphine to D2 dopamine receptors is blocked by the inclusion of D2 selective concentrations of unlabeled spiroperidol or domperidone, these ligands appear to label selectively the previously termed D3 binding site. Antagonist/[ 3 H]dopamine competition curves are of uniformly steep slope (nH . 1.0), suggesting the presence of a single D3 binding site. The relative potencies of antagonists to inhibit D3 specific [ 3 H]dopamine binding are significantly correlated with their potencies to block D1 dopamine receptors as measured by the inhibition of both dopamine-stimulated adenylate cyclase and [ 3 H]flupentixol-binding activities. The affinities of agonists to inhibit D3 specific [ 3 H]dopamine binding are also correlated with estimates of these agonists affinities for the high affinity binding component of agonist/[ 3 H]flupentixol competition curves. Both D3 specific [ 3 H] dopamine binding and the high affinity agonist-binding component of dopamine/[ 3 H]flupentixol competition curves show a similar sensitivity to guanine nucleotides. Taken together, these data strongly suggest that the D3 binding site is related to a high affinity agonist-binding state of the D1 dopamine receptor
Spectral affinity in protein networks.
Voevodski, Konstantin; Teng, Shang-Hua; Xia, Yu
2009-11-29
Protein-protein interaction (PPI) networks enable us to better understand the functional organization of the proteome. We can learn a lot about a particular protein by querying its neighborhood in a PPI network to find proteins with similar function. A spectral approach that considers random walks between nodes of interest is particularly useful in evaluating closeness in PPI networks. Spectral measures of closeness are more robust to noise in the data and are more precise than simpler methods based on edge density and shortest path length. We develop a novel affinity measure for pairs of proteins in PPI networks, which uses personalized PageRank, a random walk based method used in context-sensitive search on the Web. Our measure of closeness, which we call PageRank Affinity, is proportional to the number of times the smaller-degree protein is visited in a random walk that restarts at the larger-degree protein. PageRank considers paths of all lengths in a network, therefore PageRank Affinity is a precise measure that is robust to noise in the data. PageRank Affinity is also provably related to cluster co-membership, making it a meaningful measure. In our experiments on protein networks we find that our measure is better at predicting co-complex membership and finding functionally related proteins than other commonly used measures of closeness. Moreover, our experiments indicate that PageRank Affinity is very resilient to noise in the network. In addition, based on our method we build a tool that quickly finds nodes closest to a queried protein in any protein network, and easily scales to much larger biological networks. We define a meaningful way to assess the closeness of two proteins in a PPI network, and show that our closeness measure is more biologically significant than other commonly used methods. We also develop a tool, accessible at http://xialab.bu.edu/resources/pnns, that allows the user to quickly find nodes closest to a queried vertex in any protein
Janecka, Jan E.; Nielsen, Simone S. E.; Andersen, Sidsel D.; Hoffmann, Federico G.; Weber, Roy E.; Anderson, Trevor; Storz, Jay F.; Fago, Angela
2015-01-01
ABSTRACT Genetically based modifications of hemoglobin (Hb) function that increase blood–O2 affinity are hallmarks of hypoxia adaptation in vertebrates. Among mammals, felid Hbs are unusual in that they have low intrinsic O2 affinities and reduced sensitivities to the allosteric cofactor 2,3-diphosphoglycerate (DPG). This combination of features compromises the acclimatization capacity of blood–O2 affinity and has led to the hypothesis that felids have a restricted physiological niche breadth relative to other mammals. In seeming defiance of this conjecture, the snow leopard (Panthera uncia) has an extraordinarily broad elevational distribution and occurs at elevations above 6000 m in the Himalayas. Here, we characterized structural and functional variation of big cat Hbs and investigated molecular mechanisms of Hb adaptation and allosteric regulation that may contribute to the extreme hypoxia tolerance of the snow leopard. Experiments revealed that purified Hbs from snow leopard and African lion exhibited equally low O2 affinities and DPG sensitivities. Both properties are primarily attributable to a single amino acid substitution, β2His→Phe, which occurred in the common ancestor of Felidae. Given the low O2 affinity and reduced regulatory capacity of feline Hbs, the extreme hypoxia tolerance of snow leopards must be attributable to compensatory modifications of other steps in the O2-transport pathway. PMID:26246610
2014-01-01
Abnormally aggregated tau is the hallmark pathology of tauopathy neurodegenerative disorders and is a target for development of both diagnostic tools and therapeutic strategies across the tauopathy disease spectrum. Development of carbon-11- or fluorine-18-labeled radiotracers with appropriate affinity and specificity for tau would allow noninvasive quantification of tau burden using positron emission tomography (PET) imaging. We have synthesized [18F]lansoprazole, [11C]N-methyl lansoprazole, and [18F]N-methyl lansoprazole and identified them as high affinity radiotracers for tau with low to subnanomolar binding affinities. Herein, we report radiosyntheses and extensive preclinical evaluation with the aim of selecting a lead radiotracer for translation into human PET imaging trials. We demonstrate that [18F]N-methyl lansoprazole, on account of the favorable half-life of fluorine-18 and its rapid brain entry in nonhuman primates, favorable kinetics, low white matter binding, and selectivity for binding to tau over amyloid, is the lead compound for progression into clinical trials. PMID:24896980
Multiprocessor Real-Time Scheduling with Hierarchical Processor Affinities
Bonifaci , Vincenzo; Brandenburg , Björn; D'Angelo , Gianlorenzo; Marchetti-Spaccamela , Alberto
2016-01-01
International audience; Many multiprocessor real-time operating systems offer the possibility to restrict the migrations of any task to a specified subset of processors by setting affinity masks. A notion of " strong arbitrary processor affinity scheduling " (strong APA scheduling) has been proposed; this notion avoids schedulability losses due to overly simple implementations of processor affinities. Due to potential overheads, strong APA has not been implemented so far in a real-time operat...
Roelofs, Anke J; Stewart, Charlotte A; Sun, Shuting; Błażewska, Katarzyna M; Kashemirov, Boris A; McKenna, Charles E; Russell, R Graham G; Rogers, Michael J; Lundy, Mark W; Ebetino, Frank H; Coxon, Fraser P
2012-04-01
Bisphosphonates are widely used antiresorptive drugs that bind to calcium. It has become evident that these drugs have differing affinities for bone mineral; however, it is unclear whether such differences affect their distribution on mineral surfaces. In this study, fluorescent conjugates of risedronate, and its lower-affinity analogues deoxy-risedronate and 3-PEHPC, were used to compare the localization of compounds with differing mineral affinities in vivo. Binding to dentine in vitro confirmed differences in mineral binding between compounds, which was influenced predominantly by the characteristics of the parent compound but also by the choice of fluorescent tag. In growing rats, all compounds preferentially bound to forming endocortical as opposed to resorbing periosteal surfaces in cortical bone, 1 day after administration. At resorbing surfaces, lower-affinity compounds showed preferential binding to resorption lacunae, whereas the highest-affinity compound showed more uniform labeling. At forming surfaces, penetration into the mineralizing osteoid was found to inversely correlate with mineral affinity. These differences in distribution at resorbing and forming surfaces were not observed at quiescent surfaces. Lower-affinity compounds also showed a relatively higher degree of labeling of osteocyte lacunar walls and labeled lacunae deeper within cortical bone, indicating increased penetration of the osteocyte canalicular network. Similar differences in mineralizing surface and osteocyte network penetration between high- and low-affinity compounds were evident 7 days after administration, with fluorescent conjugates at forming surfaces buried under a new layer of bone. Fluorescent compounds were incorporated into these areas of newly formed bone, indicating that "recycling" had occurred, albeit at very low levels. Taken together, these findings indicate that the bone mineral affinity of bisphosphonates is likely to influence their distribution within the
Specific, high affinity receptors for insulin-like growth factor II in the rat kidney glomerulus
International Nuclear Information System (INIS)
Haskell, J.F.; Pillion, D.J.; Meezan, E.
1988-01-01
Rat renal glomeruli were isolated by a technique involving kidney perfusion with a solution containing magnetic iron oxide particles, followed by homogenization, sieving, and concentration over a strong magnet. Isolated glomeruli were treated with 1% Triton X-100 to solubilize plasma membrane components, while insoluble basement membrane components were removed by centrifugation. [ 125 I]Insulin-like growth factor II (IGF-II) binding to this preparation was competitively inhibited by increasing amounts of unlabeled IGF-II, with 50% inhibition at an IGF-II concentration of 1 ng/ml. [ 125 I]IGF-II was covalently cross-linked with disuccinimidyl suberate to its receptor in rat renal glomeruli and a specific high mol wt (255,000) band could be identified on autoradiograms of dodecyl sulfate-polyacrylamide gels. [ 125 I]IGF-II binding and cross-linking to this band was inhibited by a polyclonal antibody against the type II IGF receptor. These results demonstrate for the first time that the isolated rat renal glomerulus contains a high affinity receptor for IGF-II
Simulated electron affinity tuning in metal-insulator-metal (MIM) diodes
Mistry, Kissan; Yavuz, Mustafa; Musselman, Kevin P.
2017-05-01
Metal-insulator-metal diodes for rectification applications must exhibit high asymmetry, nonlinearity, and responsivity. Traditional methods of improving these figures of merit have consisted of increasing insulator thickness, adding multiple insulator layers, and utilizing a variety of metal contact combinations. However, these methods have come with the price of increasing the diode resistance and ultimately limiting the operating frequency to well below the terahertz regime. In this work, an Airy Function Transfer Matrix simulation method was used to observe the effect of tuning the electron affinity of the insulator as a technique to decrease the diode resistance. It was shown that a small increase in electron affinity can result in a resistance decrease in upwards of five orders of magnitude, corresponding to an increase in operating frequency on the same order. Electron affinity tuning has a minimal effect on the diode figures of merit, where asymmetry improves or remains unaffected and slight decreases in nonlinearity and responsivity are likely to be greatly outweighed by the improved operating frequency of the diode.
Directory of Open Access Journals (Sweden)
Muneer Ahamed
2016-09-01
Full Text Available Abstract The type 2 cannabinoid receptor (CB2 is a member of the endocannabinoid system and is known for its important role in (neuroinflammation. A PET-imaging agent that allows in vivo visualization of CB2 expression may thus allow quantification of neuroinflammation. In this paper, we report the synthesis, radiosynthesis, biodistribution and in vitro evaluation of a carbon-11 ([11C]MA2 and a fluorine-18 ([18F]MA3 labeled analogue of a highly potent N-arylamide oxadiazole CB2 agonist (EC50 = 0.015 nM. MA2 and MA3 behaved as potent CB2 agonist (EC50: 3 nM and 0.1 nM, respectively and their in vitro binding affinity for hCB2 was found to be 87 nM and 0.8 nM, respectively. Also MA3 (substituted with a fluoro ethyl group was found to have higher binding affinity and EC50 values when compared to the originally reported trifluoromethyl analogue 12. [11C]MA2 and [18F]MA3 were successfully synthesized with good radiochemical yield, high radiochemical purity and high specific activity. In mice, both tracers were efficiently cleared from blood and all major organs by the hepatobiliary pathway and importantly these compounds showed high brain uptake. In conclusion, [11C]MA2 and [18F]MA3 are shown to be high potent CB2 agonists with good brain uptake, these favorable characteristics makes them potential PET probes for in vivo imaging of brain CB2 receptors. However in view of its higher affinity and selectivity, further detailed evaluation of MA3 as a PET tracer for CB2 is warranted.
Affine fractal functions as bases of continuous funtions | Navascues ...
African Journals Online (AJOL)
The objective of the present paper is the study of affine transformations of the plane, which provide self-affine curves as attractors. The properties of these curves depend decisively of the coefficients of the system of affinities involved. The corresponding functions are continuous on a compact interval. If the scale factors are ...
Antibody Affinity Maturation in Fishes—Our Current Understanding
Directory of Open Access Journals (Sweden)
Brad G. Magor
2015-07-01
Full Text Available It has long been believed that fish lack antibody affinity maturation, in part because they were thought to lack germinal centers. Recent research done on sharks and bony fishes indicates that these early vertebrates are able to affinity mature their antibodies. This article reviews the functionality of the fish homologue of the immunoglobulin (Ig mutator enzyme activation-induced cytidine deaminase (AID. We also consider the protein and molecular evidence for Ig somatic hypermutation and antibody affinity maturation. In the context of recent evidence for a putative proto-germinal center in fishes we propose some possible reasons that observed affinity maturation in fishes often seems lacking and propose future work that might shed further light on this process in fishes.
High-Affinity Interaction of the K-Ras4B Hypervariable Region with the Ras Active Site
Chavan, Tanmay S.; Jang, Hyunbum; Khavrutskii, Lyuba; Abraham, Sherwin J.; Banerjee, Avik; Freed, Benjamin C.; Johannessen, Liv; Tarasov, Sergey G.; Gaponenko, Vadim; Nussinov, Ruth; Tarasova, Nadya I.
2015-01-01
Ras proteins are small GTPases that act as signal transducers between cell surface receptors and several intracellular signaling cascades. They contain highly homologous catalytic domains and flexible C-terminal hypervariable regions (HVRs) that differ across Ras isoforms. KRAS is among the most frequently mutated oncogenes in human tumors. Surprisingly, we found that the C-terminal HVR of K-Ras4B, thought to minimally impact the catalytic domain, directly interacts with the active site of the protein. The interaction is almost 100-fold tighter with the GDP-bound than the GTP-bound protein. HVR binding interferes with Ras-Raf interaction, modulates binding to phospholipids, and slightly slows down nucleotide exchange. The data indicate that contrary to previously suggested models of K-Ras4B signaling, HVR plays essential roles in regulation of signaling. High affinity binding of short peptide analogs of HVR to K-Ras active site suggests that targeting this surface with inhibitory synthetic molecules for the therapy of KRAS-dependent tumors is feasible. PMID:26682817
Energy Technology Data Exchange (ETDEWEB)
Inoguchi, Noriko; Mizuno, Nobuhiro; Baba, Seiki; Kumasaka, Takashi; Natarajan, Chandrasekhar; Storz, Jay F.; Moriyama, Hideaki; Permyakov, Eugene A.
2017-03-31
Deer mice (Peromyscus maniculatus) that are native to high altitudes in the Rocky Mountains have evolved hemoglobins with an increased oxygen-binding affinity relative to those of lowland conspecifics. To elucidate the molecular mechanisms responsible for the evolved increase in hemoglobin-oxygen affinity, the crystal structure of the highland hemoglobin variant was solved and compared with the previously reported structure for the lowland variant. Highland hemoglobin yielded at least two crystal types, in which the longest axes were 507 and 230 Å. Using the smaller unit cell crystal, the structure was solved at 2.2 Å resolution. The asymmetric unit contained two tetrameric hemoglobin molecules. The analyses revealed that αPro50 in the highland hemoglobin variant promoted a stable interaction between αHis45 and heme that was not seen in the αHis50 lowland variant. The αPro50 mutation also altered the nature of atomic contacts at the α1β2/α2β1 intersubunit interfaces. These results demonstrate how affinity-altering changes in intersubunit interactions can be produced by mutations at structurally remote sites.
DEFF Research Database (Denmark)
Wang, M.; Tang, Sheila Tuyet; Lund, Ole
2009-01-01
Interferon-gamma secreting T lymphocytes against pox virus-derived synthetic 9-mer peptides were tested by enzyme-linked immunospot in peripheral blood of individuals vaccinated with vaccinia virus more than 30 years ago. The peptides were characterized biochemically as high-affinity human leucoc...
Qi, Wenjing; Liu, Zhongyuan; Zhang, Wei; Halawa, Mohamed Ibrahim; Xu, Guobao
2016-10-12
Zr(IV) can form phosphate and Zr(IV) (-PO₃ 2- -Zr 4+ -) complex owing to the high affinity between Zr(IV) with phosphate. Zr(IV) can induce the aggregation of gold nanoparticles (AuNPs), while adenosine triphosphate(ATP) can prevent Zr(IV)-induced aggregation of AuNPs. Herein, a visual and plasmon resonance absorption (PRA)sensor for ATP have been developed using AuNPs based on the high affinity between Zr(IV)with ATP. AuNPs get aggregated in the presence of certain concentrations of Zr(IV). After the addition of ATP, ATP reacts with Zr(IV) and prevents AuNPs from aggregation, enabling the detection of ATP. Because of the fast interaction of ATP with Zr(IV), ATP can be detected with a detection limit of 0.5 μM within 2 min by the naked eye. Moreover, ATP can be detected by the PRA technique with higher sensitivity. The A 520nm / A 650nm values in PRA spectra increase linearly with the concentrations of ATP from 0.1 μM to 15 μM (r = 0.9945) with a detection limit of 28 nM. The proposed visual and PRA sensor exhibit good selectivity against adenosine, adenosine monophosphate, guanosine triphosphate, cytidine triphosphate and uridine triphosphate. The recoveries for the analysis of ATP in synthetic samples range from 95.3% to 102.0%. Therefore, the proposed novel sensor for ATP is promising for real-time or on-site detection of ATP.
Energy Technology Data Exchange (ETDEWEB)
John, Christy S; Gulden, Mary E; Vilner, Bertold J; Bowen, Wayne D
1996-08-01
N-[2-(4-iodophenyl)ethyl]-N-methyl-2-(1-piperidinyl)ethylamine, IPEMP, and the corresponding bromo derivative, BrPEMP, have been synthesized and characterized. Both BrPEMP and IPEMP were evaluated for sigma-1 and sigma-2 subtype receptor affinities and found to possess very high affinities for both receptor subtypes. The precursor for radioiodination n-tributylstannylphenylethylpiperidinylethylamine was prepared from its bromo derivative by palladium-catalyzed stannylation reaction. Radioiodinated 4-[{sup 125}I]PEMP was readily prepared in high yields and high specific activity by oxidative iododestannylation reaction using chloramine-T as oxidizing agent. Sites labeled by 4-[{sup 125}I]PEMP in guinea pig brain membranes showed high affinity for BD1008, haloperidol, and (+)-pentazocine (Ki = 5.06 {+-} 0.40, 32.6 {+-} 2.75, and 48.1 {+-} 8.60 nM, respectively), which is consistent with sigma receptor pharmacology. Competition binding studies of 4-[{sup 125}I]PEMP in melanoma (A375) and MCF-7 breast cancer cells showed a high affinity, dose-dependent inhibition of binding with known sigma ligand N-[2-(3,4-dichlorophenyl)ethyl]-N-methyl-2-(1-pyrrolidinyl) ethylamine, BD1008 (Ki = 5, 11 nM, respectively), supporting the labeling of sigma sites in these cells. Haloperidol, however showed a weaker (Ki 100-200 nM) affinity for the sites labeled by 4-[{sup 125}I]PEMP in these cells. Biodistribution studies of 4-[{sup 125}I]PEMP in rats showed a fast clearance of this radiopharmaceutical from blood, liver, lung, and other organs. A co-injection of 4-IPEMP with 4-[{sup 125}I]PEMP resulted in 37%, 69%, and 35% decrease in activity in liver, kidney, and brain (organs possessing sigma receptors), respectively at 1-h postinjection. These results suggest that 4-[{sup 125}I]PEMP is a promising radiopharmaceutical for pursuing further studies in animal models with tumors.
Lorkin, P A; Stephens, A D; Beard, M E; Wrigley, P F; Adams, L; Lehmann, H
1975-01-01
A new haemoglobin with increased oxygen affinity, beta82 (EF6) lysine leads to threonine (Hb Rahere), was found during the investigation of a patient who was found to have a raised haemoglobin concentration after a routine blood count. The substitution affects one of the 2, 3-diphosphoglycerate binding sites, resulting in an increased affinity for oxygen, but both the haem-haem interaction and the alkaline Bohr effect are normal in the haemolysate. This variant had the same mobility as haemoglobin A on electrophoresis at alkaline pH but was detected by measuring the whole blood oxygen affinity; it could be separated from haemoglobin A, however, by electrophoresis in agar at acid pH. The raised haemoglobin concentration was mainly due to a reduction in plasma volume (a relative polycythaemia) and was associated with a persistently raised white blood count. This case emphasises the need to measure the oxygen affinity of haemoglobin in all patients with absolute or relative polycythaemia when some obvious cause is not evident. PMID:124
Thermokinetic model of borosilicate glass dissolution: contextual affinity
International Nuclear Information System (INIS)
Advocat, T.; Vernaz, E.; Crovisier, J.L.; Fritz, B.
1989-01-01
Short and long-term geochemical interactions of R7T7 nuclear glass with water at 100 0 C were simulated with the DISSOL thermokinetic computer code. Both the dissolved glass quantity and the resulting water composition, saturation states and mineral quantities produced were calculated as a function of time. The rate equation used in the simulation was first proposed by Aagaard and Helgeson. It simulates a gradually diminishing dissolution rate as the reaction affinity diminishes. The best agreement with 1-year experimental data was obtained with a reaction affinity calculated from silica activity (Grambow's hypothesis) rather than taking into account the activity of all the glass components as proposed by Jantzen and Plodinec. The concept of residual affinity was introduced by Grambow to express the fact that the glass dissolution rate does not cease. We prefer to replace the term residual affinity by contextual affinity, which expresses the influence on the dissolution rate of three factors: the solution chemistry, the metastability of SiO 2 (m), and the possible precipitation of certain aluminosilicates such as zeolites. 19 refs
Affinity Strings: Enterprise Data for Resource Recommendations
Directory of Open Access Journals (Sweden)
Shane Nackerud
2008-12-01
Full Text Available The University of Minnesota Libraries have created a MyLibrary portal, with databases and e-journals targeted to users, based on their affiliations. The University's enterprise authentication system provides an "affinity string", now used to personalize the MyLibrary portal. This affinity string automates discovery of a user's relationship to the University--describing a user's academic department and degree program or position at the University. Affinity strings also provide the Libraries with an anonymized view of resource usage, allowing data collection that respects users' privacy and lays the groundwork for automated recommendation of relevant resources based on the practices and habits of their peers.
Affine coherent states and Toeplitz operators
Hutníková, Mária; Hutník, Ondrej
2012-06-01
We study a parameterized family of Toeplitz operators in the context of affine coherent states based on the Calderón reproducing formula (= resolution of unity on L_2( {R})) and the specific admissible wavelets (= affine coherent states in L_2( {R})) related to Laguerre functions. Symbols of such Calderón-Toeplitz operators as individual coordinates of the affine group (= upper half-plane with the hyperbolic geometry) are considered. In this case, a certain class of pseudo-differential operators, their properties and their operator algebras are investigated. As a result of this study, the Fredholm symbol algebras of the Calderón-Toeplitz operator algebras for these particular cases of symbols are described. This article is part of a special issue of Journal of Physics A: Mathematical and Theoretical devoted to ‘Coherent states: mathematical and physical aspects’.
International Nuclear Information System (INIS)
Rothman, R.B.; Reid, A.; Mahboubi, A.; Kim, C.H.; De Costa, B.R.; Jacobson, A.E.; Rice, K.C.
1991-01-01
Equilibrium binding studies with the sigma receptor ligand [ 3 H]1,3-di(2-tolyl)guanidine ([ 3 H]DTG) demonstrated two high affinity binding sites in membranes prepared from guinea pig brain. The apparent Kd values of DTG for sites 1 and 2 were 11.9 and 37.6 nM, respectively. The corresponding Bmax values were 1045 and 1423 fmol/mg of protein. Site 1 had high affinity for (+)-pentazocine, haloperidol, (R)-(+)-PPP, carbepentane, and other sigma ligands, suggesting a similarity with the dextromethorphan/sigma 1 binding site described by Musacchio et al. [Life Sci. 45:1721-1732 (1989)]. Site 2 had high affinity for DTG and haloperidol (Ki = 36.1 nM) and low affinity for most other sigma ligands. Kinetic experiments demonstrated that [ 3 H]DTG dissociated in a biphasic manner from both site 1 and site 2. DTG and haloperidol increased the dissociation rate of [ 3 H]DTG from site 1 and site 2, demonstrating the presence of pseudoallosteric interactions. Inorganic calcium channel blockers such as Cd2+ selectively increased the dissociation rate of [ 3 H]DTG from site 2, suggesting an association of this binding site with calcium channels
Zhao, Lan; Zhang, Jingfei; Huang, Yongdong; Li, Qiang; Zhang, Rongyue; Zhu, Kai; Suo, Jia; Su, Zhiguo; Zhang, Zhigang; Ma, Guanghui
2016-03-01
Novel high-capacity Ni(2+) immobilized metal ion affinity chromatographic media were prepared through the dextran-grafting process. Dextran was grafted to an allyl-activated agarose-based matrix followed by functionalization for the immobilized metal ion affinity chromatographic media. With elaborate regulation of the allylation degree, dextran was completely or partly grafted to agarose microspheres, namely, completely dextran-grafted agarose microspheres and partly dextran-grafted ones, respectively. Confocal laser scanning microscope results demonstrated that a good adjustment of dextran-grafting degree was achieved, and dextran was distributed uniformly in whole completely dextran-grafted microspheres, while just distributed around the outside of the partly dextran-grafted ones. Flow hydrodynamic properties were improved greatly after the dextran-grafting process, and the flow velocity increased by about 30% compared with that of a commercial chromatographic medium (Ni Sepharose FF). A significant improvement of protein binding performance was also achieved by the dextran-grafting process, and partly dextran-grafted Ni(2+) chelating medium had a maximum binding capacity for His-tagged lactate dehydrogenase about 2.5 times higher than that of Ni Sepharose FF. The results indicated that this novel chromatographic medium is promising for applications in high-efficiency and large-scale protein purification. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Affinity between information retrieval system and search topic
International Nuclear Information System (INIS)
Ebinuma, Yukio
1979-01-01
Ten search profiles are tested on the INIS system at the Japan Atomic Energy Research Institute. The results are plotted on recall-precision chart ranging from 100% recall to 100% precision. The curves are not purely systems-dependent nor search-dependent, and are determined substantially by the ''affinity'' between the system and the search topic. The curves are named ''Affinity curves of search topics with information retrieval systems'', and hence retrieval affinity factors are derived. They are obtained not only for individual search topics but also for averages in the system. By such a quantitative examination, the difference of affinity among search topics in a given system, that of the same search topic among various systems, and that of systems to the same group of search topics can be compared reasonably. (author)
Myoglobin oxygen affinity in aquatic and terrestrial birds and mammals.
Wright, Traver J; Davis, Randall W
2015-07-01
Myoglobin (Mb) is an oxygen binding protein found in vertebrate skeletal muscle, where it facilitates intracellular transport and storage of oxygen. This protein has evolved to suit unique physiological needs in the muscle of diving vertebrates that express Mb at much greater concentrations than their terrestrial counterparts. In this study, we characterized Mb oxygen affinity (P50) from 25 species of aquatic and terrestrial birds and mammals. Among diving species, we tested for correlations between Mb P50 and routine dive duration. Across all species examined, Mb P50 ranged from 2.40 to 4.85 mmHg. The mean P50 of Mb from terrestrial ungulates was 3.72±0.15 mmHg (range 3.70-3.74 mmHg). The P50 of cetaceans was similar to terrestrial ungulates ranging from 3.54 to 3.82 mmHg, with the exception of the melon-headed whale, which had a significantly higher P50 of 4.85 mmHg. Among pinnipeds, the P50 ranged from 3.23 to 3.81 mmHg and showed a trend for higher oxygen affinity in species with longer dive durations. Among diving birds, the P50 ranged from 2.40 to 3.36 mmHg and also showed a trend of higher affinities in species with longer dive durations. In pinnipeds and birds, low Mb P50 was associated with species whose muscles are metabolically active under hypoxic conditions associated with aerobic dives. Given the broad range of potential globin oxygen affinities, Mb P50 from diverse vertebrate species appears constrained within a relatively narrow range. High Mb oxygen affinity within this range may be adaptive for some vertebrates that make prolonged dives. © 2015. Published by The Company of Biologists Ltd.
Affine group formulation of the Standard Model coupled to gravity
Energy Technology Data Exchange (ETDEWEB)
Chou, Ching-Yi, E-mail: l2897107@mail.ncku.edu.tw [Department of Physics, National Cheng Kung University, Taiwan (China); Ita, Eyo, E-mail: ita@usna.edu [Department of Physics, US Naval Academy, Annapolis, MD (United States); Soo, Chopin, E-mail: cpsoo@mail.ncku.edu.tw [Department of Physics, National Cheng Kung University, Taiwan (China)
2014-04-15
In this work we apply the affine group formalism for four dimensional gravity of Lorentzian signature, which is based on Klauder’s affine algebraic program, to the formulation of the Hamiltonian constraint of the interaction of matter and all forces, including gravity with non-vanishing cosmological constant Λ, as an affine Lie algebra. We use the hermitian action of fermions coupled to gravitation and Yang–Mills theory to find the density weight one fermionic super-Hamiltonian constraint. This term, combined with the Yang–Mills and Higgs energy densities, are composed with York’s integrated time functional. The result, when combined with the imaginary part of the Chern–Simons functional Q, forms the affine commutation relation with the volume element V(x). Affine algebraic quantization of gravitation and matter on equal footing implies a fundamental uncertainty relation which is predicated upon a non-vanishing cosmological constant. -- Highlights: •Wheeler–DeWitt equation (WDW) quantized as affine algebra, realizing Klauder’s program. •WDW formulated for interaction of matter and all forces, including gravity, as affine algebra. •WDW features Hermitian generators in spite of fermionic content: Standard Model addressed. •Constructed a family of physical states for the full, coupled theory via affine coherent states. •Fundamental uncertainty relation, predicated on non-vanishing cosmological constant.
International Nuclear Information System (INIS)
Garayoa, Elisa Garcia-; Allemann-Tannahill, Lesley; Blaeuenstein, Peter; Willmann, Martine; Carrel-Remy, Nathalie; Tourwe, Dirk; Iterbeke, Koen; Conrath, Peter; Schubiger, P. August
2001-01-01
The potential utility of neurotensin (NT) in cancer diagnosis and therapy is limited by its rapid degradation. New stabilized analogues were synthesized, labeled with [ 99m Tc] and screened in vitro and in vivo. High affinity and rapid internalization were obtained in binding assays. Despite their longer human plasma half-lives, a rapid degradation was observed with low concentrations as used in biodistribution tests. The tumor uptake rates were rather low but tumor/blood ratios increased according to the stability raise
Energy Technology Data Exchange (ETDEWEB)
Garayoa, Elisa Garcia-; Allemann-Tannahill, Lesley; Blaeuenstein, Peter; Willmann, Martine; Carrel-Remy, Nathalie; Tourwe, Dirk; Iterbeke, Koen; Conrath, Peter; Schubiger, P. August E-mail: schubiger@psi.ch
2001-01-01
The potential utility of neurotensin (NT) in cancer diagnosis and therapy is limited by its rapid degradation. New stabilized analogues were synthesized, labeled with [{sup 99m}Tc] and screened in vitro and in vivo. High affinity and rapid internalization were obtained in binding assays. Despite their longer human plasma half-lives, a rapid degradation was observed with low concentrations as used in biodistribution tests. The tumor uptake rates were rather low but tumor/blood ratios increased according to the stability raise.
Dai, Hanjun
2017-07-26
Motivation: An accurate characterization of transcription factor (TF)-DNA affinity landscape is crucial to a quantitative understanding of the molecular mechanisms underpinning endogenous gene regulation. While recent advances in biotechnology have brought the opportunity for building binding affinity prediction methods, the accurate characterization of TF-DNA binding affinity landscape still remains a challenging problem. Results: Here we propose a novel sequence embedding approach for modeling the transcription factor binding affinity landscape. Our method represents DNA binding sequences as a hidden Markov model (HMM) which captures both position specific information and long-range dependency in the sequence. A cornerstone of our method is a novel message passing-like embedding algorithm, called Sequence2Vec, which maps these HMMs into a common nonlinear feature space and uses these embedded features to build a predictive model. Our method is a novel combination of the strength of probabilistic graphical models, feature space embedding and deep learning. We conducted comprehensive experiments on over 90 large-scale TF-DNA data sets which were measured by different high-throughput experimental technologies. Sequence2Vec outperforms alternative machine learning methods as well as the state-of-the-art binding affinity prediction methods.
Li, Qianjin; Liu, Zhen
2015-01-01
Boronate affinity monolithic columns have been developed into an important means for the selective recognition and capture of cis-diol-containing biomolecules, such as glycoproteins, nucleosides and saccharides. The ligands of boronic acids are playing an important role in boronate affinity monolithic columns. Although several boronate affinity monoliths with high affinity toward cis-diol-containing biomolecules have been reported, only few publications are focused on their detailed procedures for preparation and characterization. This chapter describes in detail the preparation and characterization of a boronate affinity monolithic column applying 2,4-difluoro-3-formyl-phenylboronic acid (DFFPBA) as a ligand. The DFFPBA-functionalized monolithic column not only exhibited an ultrahigh boronate affinity toward cis-diol-containing biomolecules, but also showed great potential for the selective enrichment of cis-diol-containing biomolecules in real samples.
Single-cell measurement of red blood cell oxygen affinity.
Di Caprio, Giuseppe; Stokes, Chris; Higgins, John M; Schonbrun, Ethan
2015-08-11
Oxygen is transported throughout the body by hemoglobin (Hb) in red blood cells (RBCs). Although the oxygen affinity of blood is well-understood and routinely assessed in patients by pulse oximetry, variability at the single-cell level has not been previously measured. In contrast, single-cell measurements of RBC volume and Hb concentration are taken millions of times per day by clinical hematology analyzers, and they are important factors in determining the health of the hematologic system. To better understand the variability and determinants of oxygen affinity on a cellular level, we have developed a system that quantifies the oxygen saturation, cell volume, and Hb concentration for individual RBCs in high throughput. We find that the variability in single-cell saturation peaks at an oxygen partial pressure of 2.9%, which corresponds to the maximum slope of the oxygen-Hb dissociation curve. In addition, single-cell oxygen affinity is positively correlated with Hb concentration but independent of osmolarity, which suggests variation in the Hb to 2,3-diphosphoglycerate (2-3 DPG) ratio on a cellular level. By quantifying the functional behavior of a cellular population, our system adds a dimension to blood cell analysis and other measurements of single-cell variability.
Simple and Efficient Purification of Recombinant Proteins Using the Heparin-Binding Affinity Tag.
Jayanthi, Srinivas; Gundampati, Ravi Kumar; Kumar, Thallapuranam Krishnaswamy Suresh
2017-11-01
Heparin, a member of the glycosaminoglycan family, is known to interact with more than 400 different types of proteins. For the past few decades, significant progress has been made to understand the molecular details involved in heparin-protein interactions. Based on the structural knowledge available from the FGF1-heparin interaction studies, we have designed a novel heparin-binding peptide (HBP) affinity tag that can be used for the simple, efficient, and cost-effective purification of recombinant proteins of interest. HBP-tagged fusion proteins can be purified by heparin Sepharose affinity chromatography using a simple sodium chloride gradient to elute the bound fusion protein. In addition, owing to the high density of positive charges on the HBP tag, recombinant target proteins are preferably expressed in their soluble forms. The purification of HBP-fusion proteins can also be achieved in the presence of chemical denaturants, including urea. Additionally, polyclonal antibodies raised against the affinity tag can be used to detect HBP-fused target proteins with high sensitivity. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
Nazarov, Anton
2012-11-01
In this paper we present Affine.m-a program for computations in representation theory of finite-dimensional and affine Lie algebras and describe implemented algorithms. The algorithms are based on the properties of weights and Weyl symmetry. Computation of weight multiplicities in irreducible and Verma modules, branching of representations and tensor product decomposition are the most important problems for us. These problems have numerous applications in physics and we provide some examples of these applications. The program is implemented in the popular computer algebra system Mathematica and works with finite-dimensional and affine Lie algebras. Catalogue identifier: AENA_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AENB_v1_0.html Program obtainable from: CPC Program Library, Queen’s University, Belfast, UK Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 24 844 No. of bytes in distributed program, including test data, etc.: 1 045 908 Distribution format: tar.gz Programming language: Mathematica. Computer: i386-i686, x86_64. Operating system: Linux, Windows, Mac OS, Solaris. RAM: 5-500 Mb Classification: 4.2, 5. Nature of problem: Representation theory of finite-dimensional Lie algebras has many applications in different branches of physics, including elementary particle physics, molecular physics, nuclear physics. Representations of affine Lie algebras appear in string theories and two-dimensional conformal field theory used for the description of critical phenomena in two-dimensional systems. Also Lie symmetries play a major role in a study of quantum integrable systems. Solution method: We work with weights and roots of finite-dimensional and affine Lie algebras and use Weyl symmetry extensively. Central problems which are the computations of weight multiplicities, branching and fusion coefficients are solved using one general recurrent
Extreme disorder in an ultrahigh-affinity protein complex
Borgia, Alessandro; Borgia, Madeleine B.; Bugge, Katrine; Kissling, Vera M.; Heidarsson, Pétur O.; Fernandes, Catarina B.; Sottini, Andrea; Soranno, Andrea; Buholzer, Karin J.; Nettels, Daniel; Kragelund, Birthe B.; Best, Robert B.; Schuler, Benjamin
2018-03-01
Molecular communication in biology is mediated by protein interactions. According to the current paradigm, the specificity and affinity required for these interactions are encoded in the precise complementarity of binding interfaces. Even proteins that are disordered under physiological conditions or that contain large unstructured regions commonly interact with well-structured binding sites on other biomolecules. Here we demonstrate the existence of an unexpected interaction mechanism: the two intrinsically disordered human proteins histone H1 and its nuclear chaperone prothymosin-α associate in a complex with picomolar affinity, but fully retain their structural disorder, long-range flexibility and highly dynamic character. On the basis of closely integrated experiments and molecular simulations, we show that the interaction can be explained by the large opposite net charge of the two proteins, without requiring defined binding sites or interactions between specific individual residues. Proteome-wide sequence analysis suggests that this interaction mechanism may be abundant in eukaryotes.
Spectral affinity in protein networks
Directory of Open Access Journals (Sweden)
Teng Shang-Hua
2009-11-01
Full Text Available Abstract Background Protein-protein interaction (PPI networks enable us to better understand the functional organization of the proteome. We can learn a lot about a particular protein by querying its neighborhood in a PPI network to find proteins with similar function. A spectral approach that considers random walks between nodes of interest is particularly useful in evaluating closeness in PPI networks. Spectral measures of closeness are more robust to noise in the data and are more precise than simpler methods based on edge density and shortest path length. Results We develop a novel affinity measure for pairs of proteins in PPI networks, which uses personalized PageRank, a random walk based method used in context-sensitive search on the Web. Our measure of closeness, which we call PageRank Affinity, is proportional to the number of times the smaller-degree protein is visited in a random walk that restarts at the larger-degree protein. PageRank considers paths of all lengths in a network, therefore PageRank Affinity is a precise measure that is robust to noise in the data. PageRank Affinity is also provably related to cluster co-membership, making it a meaningful measure. In our experiments on protein networks we find that our measure is better at predicting co-complex membership and finding functionally related proteins than other commonly used measures of closeness. Moreover, our experiments indicate that PageRank Affinity is very resilient to noise in the network. In addition, based on our method we build a tool that quickly finds nodes closest to a queried protein in any protein network, and easily scales to much larger biological networks. Conclusion We define a meaningful way to assess the closeness of two proteins in a PPI network, and show that our closeness measure is more biologically significant than other commonly used methods. We also develop a tool, accessible at http://xialab.bu.edu/resources/pnns, that allows the user to
Imaduwage, Kasun P; Go, Eden P; Zhu, Zhikai; Desaire, Heather
2016-11-01
A major challenge in drug discovery is the identification of high affinity lead compounds that bind a particular target protein; these leads are typically identified by high throughput screens. Mass spectrometry has become a detection method of choice in drug screening assays because the target and the ligand need not be modified. Label-free assays are advantageous because they can be developed more rapidly than assays requiring labels, and they eliminate the risk of the label interfering with the binding event. However, in commonly used MS-based screening methods, detection of false positives is a major challenge. Here, we describe a detection strategy designed to eliminate false positives. In this approach, the protein and the ligands are incubated together, and the non-binders are separated for detection. Hits (protein binders) are not detectable by MS after incubation with the protein, but readily identifiable by MS when the target protein is not present in the incubation media. The assay was demonstrated using three different proteins and hundreds of non-inhibitors; no false positive hits were identified in any experiment. The assay can be tuned to select for ligands of a particular binding affinity by varying the quantity of protein used and the immobilization method. As examples, the method selectively detected inhibitors that have K i values of 0.2 μM, 50 pM, and 700 pM. These findings demonstrate that the approach described here compares favorably with traditional MS-based screening methods. Graphical Abstract ᅟ.
Thermokinetic model of borosilicate glass dissolution: Contextual affinity
International Nuclear Information System (INIS)
Advocat, T.; Vernaz, E.; Crovisier, J.L.; Fritz, B.
1990-01-01
Short and long-term geochemical interactions of R7T7 nuclear glass with water at 100C were simulated with the DISSOL thermokinetic computer code. Both the dissolved glass quantity and the resulting water composition, saturation states and mineral quantities produced were calculated as a function of time. The rate equation used in the simulation was first proposed by Aagaard and Hegelson: v = k + · S · a( H + ) -n · (1 - e -(A/RT) ). It simulates a gradually diminishing dissolution rate as the reaction affinity diminishes. The best agreement with 1-year experimental data was obtained with a reaction affinity calculated from silica activity (Grambow's hypothesis) rather than taking into account the activity of all the glass components as proposed by Jantzen and Plodinec. The concept of residual affinity was introduced by Grambow to express the fact that the glass dissolution rate does not cease. The authors prefer to replace the term residual affinity by contextual affinity, which expresses the influence on the dissolution rate of three factors: the solution chemistry, the metastability of SiO 2 (m), and the possible precipitation of certain aluminosilicates such as zeolites
Directory of Open Access Journals (Sweden)
Lykke Pedersen
2014-01-01
Full Text Available Antisense oligonucleotides complementary to RNA targets promise generality and ease of drug design. The first systemically administered antisense drug was recently approved for treatment and others are in clinical development. Chemical modifications that increase the hybridization affinity of oligonucleotides are reasoned to confer higher potency, i.e., modified oligonucleotides can be dosed at lower concentrations to achieve the same effect. Surprisingly, shorter and less affine oligonucleotides sometimes display increased potency. To explain this apparent contradiction, increased uptake or decreased propensity to form structures have been suggested as possible mechanisms. Here, we provide an alternative explanation that invokes only the kinetics behind oligonucleotide-mediated cleavage of RNA targets. A model based on the law of mass action predicts, and experiments support, the existence of an optimal binding affinity. Exaggerated affinity, and not length per se, is detrimental to potency. This finding clarifies how to optimally apply high-affinity modifications in the discovery of potent antisense oligonucleotide drugs.
DEFF Research Database (Denmark)
Damgaard, Maria; Al-Khawaja, Anas; Nittegaard-Nielsen, Mia
2017-01-01
-affinity binding and is furthermore reported as an allosteric modulator selective for the α1β2δ GABAARs. Therefore, structural determinants for selectivity at the two targets were investigated. 39 structural diverse monastrol analogues were synthesized by employing the Biginelli cyclocondensation and examined......-affinity binding. However, three analogues of monastrol (11, 12 and 24) enhanced the maximal binding of [(3)H]NCS-382 to a higher maximal level than seen for monastrol itself. Selected compounds were further characterized as modulators at α1β2δ, α1β2γ2s and α1β2 GABAARs. Most of these modulators were shown to have...... δ-specific GABA-potentiating effects. The dual effect shown for monastrol to modulate the GHB high-affinity binding and α1β2δ GABAAR activity was also shown for the compounds 11, 18 and 24. Compound 29 displayed minimal modulatory effect on GABAARs and therefore appears to be a GHB high...
Miller, J. A.; Richter, J. A.
1985-01-01
The effects of several anticonvulsant drugs on sodium-dependent high affinity choline uptake (HACU) in mouse hippocampal synaptosomes was investigated. HACU was measured in vitro after in vivo administration of the drug to mice. HACU was inhibited by drugs which have in common the ability to facilitate gamma-aminobutyric acid (GABA) transmission, pentobarbitone, phenobarbitone, barbitone, diazepam, chloridiazepoxide, and valproic acid. Dose-response relationships were determined for these drugs and the drugs' potencies at inhibiting HACU correlated well with their anticonvulsant potencies. Clonazepam, ethosuximide, carbamazepine, and barbituric acid had no effect on HACU in the doses used while phenytoin and trimethadione stimulated HACU. These results suggest that certain anticonvulsants may elicit a part of their anticonvulsant activity by modulating cholinergic neurones. This effect may be mediated through a GABA mechanism. PMID:3978310
Energy Technology Data Exchange (ETDEWEB)
Rothman, R.B.; Reid, A.; Mahboubi, A.; Kim, C.H.; De Costa, B.R.; Jacobson, A.E.; Rice, K.C. (National Institute of Mental Health, Bethesda, MD (USA))
1991-02-01
Equilibrium binding studies with the sigma receptor ligand ({sup 3}H)1,3-di(2-tolyl)guanidine (({sup 3}H)DTG) demonstrated two high affinity binding sites in membranes prepared from guinea pig brain. The apparent Kd values of DTG for sites 1 and 2 were 11.9 and 37.6 nM, respectively. The corresponding Bmax values were 1045 and 1423 fmol/mg of protein. Site 1 had high affinity for (+)-pentazocine, haloperidol, (R)-(+)-PPP, carbepentane, and other sigma ligands, suggesting a similarity with the dextromethorphan/sigma 1 binding site described by Musacchio et al. (Life Sci. 45:1721-1732 (1989)). Site 2 had high affinity for DTG and haloperidol (Ki = 36.1 nM) and low affinity for most other sigma ligands. Kinetic experiments demonstrated that ({sup 3}H)DTG dissociated in a biphasic manner from both site 1 and site 2. DTG and haloperidol increased the dissociation rate of ({sup 3}H)DTG from site 1 and site 2, demonstrating the presence of pseudoallosteric interactions. Inorganic calcium channel blockers such as Cd2+ selectively increased the dissociation rate of ({sup 3}H)DTG from site 2, suggesting an association of this binding site with calcium channels.
Bainomugisa, Arnold; Lavu, Evelyn; Hiashiri, Stenard; Majumdar, Suman; Honjepari, Alice; Moke, Rendi; Dakulala, Paison; Hill-Cawthorne, Grant A.; Pandey, Sushil; Marais, Ben J.; Coulter, Chris; Coin, Lachlan
2018-01-01
An outbreak of multi-drug resistant (MDR) tuberculosis (TB) has been reported on Daru Island, Papua New Guinea. Mycobacterium tuberculosis strains driving this outbreak and the temporal accrual of drug resistance mutations have not been described. Whole genome sequencing of 100 of 165 clinical isolates referred from Daru General Hospital to the Supranational reference laboratory, Brisbane, during 2012–2015 revealed that 95 belonged to a single modern Beijing sub-lineage strain. Molecular dating suggested acquisition of streptomycin and isoniazid resistance in the 1960s, with potentially enhanced virulence mediated by an mycP1 mutation. The Beijing sub-lineage strain demonstrated a high degree of co-resistance between isoniazid and ethionamide (80/95; 84.2 %) attributed to an inhA promoter mutation combined with inhA and ndh coding mutations. Multi-drug resistance, observed in 78/95 samples, emerged with the acquisition of a typical rpoB mutation together with a compensatory rpoC mutation in the 1980s. There was independent acquisition of fluoroquinolone and aminoglycoside resistance, and evidence of local transmission of extensively drug resistant (XDR) strains from 2009. These findings underline the importance of whole genome sequencing in informing an effective public health response to MDR/XDR TB. PMID:29310751
Calculation of protein-ligand binding affinities.
Gilson, Michael K; Zhou, Huan-Xiang
2007-01-01
Accurate methods of computing the affinity of a small molecule with a protein are needed to speed the discovery of new medications and biological probes. This paper reviews physics-based models of binding, beginning with a summary of the changes in potential energy, solvation energy, and configurational entropy that influence affinity, and a theoretical overview to frame the discussion of specific computational approaches. Important advances are reported in modeling protein-ligand energetics, such as the incorporation of electronic polarization and the use of quantum mechanical methods. Recent calculations suggest that changes in configurational entropy strongly oppose binding and must be included if accurate affinities are to be obtained. The linear interaction energy (LIE) and molecular mechanics Poisson-Boltzmann surface area (MM-PBSA) methods are analyzed, as are free energy pathway methods, which show promise and may be ready for more extensive testing. Ultimately, major improvements in modeling accuracy will likely require advances on multiple fronts, as well as continued validation against experiment.
Directory of Open Access Journals (Sweden)
Wenjing Qi
2016-10-01
Full Text Available Zr(IV can form phosphate and Zr(IV (–PO32−–Zr4+– complex owing to the high affinity between Zr(IV with phosphate. Zr(IV can induce the aggregation of gold nanoparticles (AuNPs, while adenosine triphosphate(ATP can prevent Zr(IV-induced aggregation of AuNPs. Herein, a visual and plasmon resonance absorption (PRAsensor for ATP have been developed using AuNPs based on the high affinity between Zr(IVwith ATP. AuNPs get aggregated in the presence of certain concentrations of Zr(IV. After the addition of ATP, ATP reacts with Zr(IV and prevents AuNPs from aggregation, enabling the detection of ATP. Because of the fast interaction of ATP with Zr(IV, ATP can be detected with a detection limit of 0.5 μM within 2 min by the naked eye. Moreover, ATP can be detected by the PRA technique with higher sensitivity. The A520nm/A650nm values in PRA spectra increase linearly with the concentrations of ATP from 0.1 μM to 15 μM (r = 0.9945 with a detection limit of 28 nM. The proposed visual and PRA sensor exhibit good selectivity against adenosine, adenosine monophosphate, guanosine triphosphate, cytidine triphosphate and uridine triphosphate. The recoveries for the analysis of ATP in synthetic samples range from 95.3% to 102.0%. Therefore, the proposed novel sensor for ATP is promising for real-time or on-site detection of ATP.
Schellenberg, Matthew J; Petrovich, Robert M; Malone, Christine C; Williams, R Scott
2018-03-25
Recombinant protein expression systems that produce high yields of pure proteins and multi-protein complexes are essential to meet the needs of biologists, biochemists, and structural biologists using X-ray crystallography and cryo-electron microscopy. An ideal expression system for recombinant human proteins is cultured human cells where the correct translation and chaperone machinery are present. However, compared to bacterial expression systems, human cell cultures present several technical challenges to their use as an expression system. We developed a method that utilizes a YFP fusion-tag to generate recombinant proteins using suspension-cultured HEK293F cells. YFP is a dual-function tag that enables direct visualization and fluorescence-based selection of high expressing clones for and rapid purification using a high-stringency, high-affinity anti-GFP/YFP nanobody support. We demonstrate the utility of this system by expressing two large human proteins, TOP2α (340 KDa dimer) and a TOP2β catalytic core (260 KDa dimer). This robustly and reproducibly yields >10 mg/L liter of cell culture using transient expression or 2.5 mg/L using stable expression. Published 2018. This article is a US Government work and is in the public domain in the USA.
ASIFT: An Algorithm for Fully Affine Invariant Comparison
Directory of Open Access Journals (Sweden)
Guoshen Yu
2011-02-01
Full Text Available If a physical object has a smooth or piecewise smooth boundary, its images obtained by cameras in varying positions undergo smooth apparent deformations. These deformations are locally well approximated by affine transforms of the image plane. In consequence the solid object recognition problem has often been led back to the computation of affine invariant image local features. The similarity invariance (invariance to translation, rotation, and zoom is dealt with rigorously by the SIFT method The method illustrated and demonstrated in this work, Affine-SIFT (ASIFT, simulates a set of sample views of the initial images, obtainable by varying the two camera axis orientation parameters, namely the latitude and the longitude angles, which are not treated by the SIFT method. Then it applies the SIFT method itself to all images thus generated. Thus, ASIFT covers effectively all six parameters of the affine transform.
Directory of Open Access Journals (Sweden)
Guy Caljon
Full Text Available Analysis of the tsetse fly salivary gland EST database revealed the presence of a highly enriched cluster of putative endonuclease genes, including tsal1 and tsal2. Tsal proteins are the major components of tsetse fly (G. morsitans morsitans saliva where they are present as monomers as well as high molecular weight complexes with other saliva proteins. We demonstrate that the recombinant tsetse salivary gland proteins 1&2 (Tsal1&2 display DNA/RNA non-specific, high affinity nucleic acid binding with K(D values in the low nanomolar range and a non-exclusive preference for duplex. These Tsal proteins exert only a residual nuclease activity with a preference for dsDNA in a broad pH range. Knockdown of Tsal expression by in vivo RNA interference in the tsetse fly revealed a partially impaired blood digestion phenotype as evidenced by higher gut nucleic acid, hematin and protein contents.
Applications of Affine and Weyl geometry
García-Río, Eduardo; Nikcevic, Stana
2013-01-01
Pseudo-Riemannian geometry is, to a large extent, the study of the Levi-Civita connection, which is the unique torsion-free connection compatible with the metric structure. There are, however, other affine connections which arise in different contexts, such as conformal geometry, contact structures, Weyl structures, and almost Hermitian geometry. In this book, we reverse this point of view and instead associate an auxiliary pseudo-Riemannian structure of neutral signature to certain affine connections and use this correspondence to study both geometries. We examine Walker structures, Riemannia
Khdhiri, Mondher; Hesse, Laura; Popa, Maria Elena; Quiza, Liliana; Lalonde, Isabelle; Meredith, Laura K.; Röckmann, Thomas; Constant, Philippe
2015-01-01
Soil-atmosphere exchange of H2 is controlled by gas diffusion and the microbial production and oxidation activities in soil. Among these parameters, the H2 oxidation activity catalyzed by soil microorganisms harboring high affinity hydrogenase is the most difficult variable to parameterize because
Theoretical determination of proton affinity differences in zeolites
Kramer, G.J.; Santen, van R.A.
1993-01-01
An important factor in zeolite catalysis is the proton affinity, i.e., the energy required to remove a proton from the zeolite lattice. Differences in proton affinity are expected to influence the catalytic activity of acid sites, making the catalytically active sites inhomogeneous (within one
Pseudo-affinity chromatography of rumen microbial cellulase on ...
African Journals Online (AJOL)
Pseudo-affinity chromatography of rumen microbial cellulase on Sepharose- Cibacron Blue F3GA. ... African Journal of Biotechnology ... Pseudo affinity adsorption of bioproducts on Sepharose-cibacron blue F3-GA was subjected to rumen microbial enzyme evaluation through batch binding and column chromatography of ...
Volatility Components, Affine Restrictions and Non-Normal Innovations
DEFF Research Database (Denmark)
Christoffersen, Peter; Jacobs, Kris; Dorian, Christian
Recent work by Engle and Lee (1999) shows that allowing for long-run and short-run components greatly enhances a GARCH model's ability fit daily equity return dynamics. Using the risk-neutralization in Duan (1995), we assess the option valuation performance of the Engle-Lee model and compare...... models to four conditionally non-normal versions. As in Hsieh and Ritchken (2005), we find that non-affine models dominate affine models both in terms of fitting return and in terms of option valuation. For the affine models we find strong evidence in favor of the component structure for both returns...
Realization of Robertson-Walker spacetimes as affine hypersurfaces
International Nuclear Information System (INIS)
Chen Bangyen
2007-01-01
Due to the growing interest in embeddings of spacetimes in higher dimensional spaces, we consider a special type of embedding. We prove that Robertson-Walker spacetimes can be embedded as centroaffine hypersurfaces and graph hypersurfaces in some affine spaces in such a way that the induced relative metrics are exactly the Lorentzian metrics on the Robertson-Walker spacetimes. Such realizations allow us to view Robertson-Walker spacetimes and their submanifolds as affine submanifolds in a natural way. Consequently, our realizations make it possible to apply the tools of affine differential geometry to study Robertson-Walker spacetimes and their submanifolds
Overcoming HERG affinity in the discovery of the CCR5 antagonist maraviroc.
Price, David A; Armour, Duncan; de Groot, Marcel; Leishman, Derek; Napier, Carolyn; Perros, Manos; Stammen, Blanda L; Wood, Anthony
2006-09-01
The discovery of maraviroc 17 is described with particular reference to the generation of high selectivity over affinity for the HERG potassium channel. This was achieved through the use of a high throughput binding assay for the HERG channel that is known to show an excellent correlation with functional effects.
Mulder, R. Joshua; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias
2010-01-01
We have computed the methyl cation affinities in the gas phase of archetypal anionic and neutral bases across the periodic table using ZORA-relativistic density functional theory (DFT) at BP86/QZ4P//BP86/TZ2P. The main purpose of this work is to provide the methyl cation affinities (and
Blakeley, D; Sykes, D A; Ensor, P; Bertran, E; Aston, P J; Charlton, S J
2015-11-01
Plasma protein binding (PPB) influences the free fraction of drug available to bind to its target and is therefore an important consideration in drug discovery. While traditional methods for assessing PPB (e.g. rapid equilibrium dialysis) are suitable for comparing compounds with relatively weak PPB, they are not able to accurately discriminate between highly bound compounds (typically >99.5%). The aim of the present work was to use mathematical modelling to explore the potential utility of receptor binding and cellular functional assays to estimate the affinity of compounds for plasma proteins. Plasma proteins are routinely added to in vitro assays, so a secondary goal was to investigate the effect of plasma proteins on observed ligand-receptor interactions. Using the principle of conservation of mass and the law of mass action, a cubic equation was derived describing the ligand-receptor complex [LR] in the presence of plasma protein at equilibrium. The model demonstrates the profound influence of PPB on in vitro assays and identifies the utility of Schild analysis, which is usually applied to determine receptor-antagonist affinities, for calculating affinity at plasma proteins (termed KP ). We have also extended this analysis to functional effects using operational modelling and demonstrate that these approaches can also be applied to cell-based assay systems. These mathematical models can potentially be used in conjunction with experimental data to estimate drug-plasma protein affinities in the earliest phases of drug discovery programmes. © 2015 The British Pharmacological Society.
Ye, Qun
2013-03-15
Several diazatetracene diimides with high electron affinity (up to 4.66 eV!) were prepared and well characterized. The LUMO energy level of these electron-deficient molecules was found to be closely related to their material stability. Compound 7 with ultrahigh electron affinity suffered from reduction and hydrolysis in the presence of silica gel or water. The stable compounds 3 and 6 showed n-channel FET behavior with an average electron mobility of 0.002 and 0.005 cm2 V-1 s-1, respectively, using a solution processing method. © 2013 American Chemical Society.
Mathematical analysis of frontal affinity chromatography in particle and membrane configurations.
Tejeda-Mansir, A; Montesinos, R M; Guzmán, R
2001-10-30
The scaleup and optimization of large-scale affinity-chromatographic operations in the recovery, separation and purification of biochemical components is of major industrial importance. The development of mathematical models to describe affinity-chromatographic processes, and the use of these models in computer programs to predict column performance is an engineering approach that can help to attain these bioprocess engineering tasks successfully. Most affinity-chromatographic separations are operated in the frontal mode, using fixed-bed columns. Purely diffusive and perfusion particles and membrane-based affinity chromatography are among the main commercially available technologies for these separations. For a particular application, a basic understanding of the main similarities and differences between particle and membrane frontal affinity chromatography and how these characteristics are reflected in the transport models is of fundamental relevance. This review presents the basic theoretical considerations used in the development of particle and membrane affinity chromatography models that can be applied in the design and operation of large-scale affinity separations in fixed-bed columns. A transport model for column affinity chromatography that considers column dispersion, particle internal convection, external film resistance, finite kinetic rate, plus macropore and micropore resistances is analyzed as a framework for exploring further the mathematical analysis. Such models provide a general realistic description of almost all practical systems. Specific mathematical models that take into account geometric considerations and transport effects have been developed for both particle and membrane affinity chromatography systems. Some of the most common simplified models, based on linear driving-force (LDF) and equilibrium assumptions, are emphasized. Analytical solutions of the corresponding simplified dimensionless affinity models are presented. Particular
Generalized Warburg impedance on realistic self-affine fractals ...
Indian Academy of Sciences (India)
2016-08-26
Aug 26, 2016 ... We analyse the problem of impedance for a diffusion controlled charge transfer process across an irregular interface. These interfacial irregularities are characterized as two class of random fractals: (i) a statistically isotropic self-affine fractals and (ii) a statistically corrugated self-affine fractals.
Piecewise affine control for fast unmanned ground vehicles
Benine Neto , André; Grand , Christophe
2012-01-01
International audience; Unmanned ground vehicles (UGV) may experience skidding when moving at high speeds, and therefore have its safety jeopardized. For this reason the nonlinear dynamics of lateral tire forces must be taken into account into the design of steering controllers for autonomous vehicles. This paper presents the design of a state feedback piecewise affine controller applied to an UGV to coordinate the steering and torque distribution inputs in order to reduce vehicle skidding on...
Weak affinity chromatography for evaluation of stereoisomers in early drug discovery.
Duong-Thi, Minh-Dao; Bergström, Maria; Fex, Tomas; Svensson, Susanne; Ohlson, Sten; Isaksson, Roland
2013-07-01
In early drug discovery (e.g., in fragment screening), recognition of stereoisomeric structures is valuable and guides medicinal chemists to focus only on useful configurations. In this work, we concurrently screened mixtures of stereoisomers and estimated their affinities to a protein target (thrombin) using weak affinity chromatography-mass spectrometry (WAC-MS). Affinity determinations by WAC showed that minor changes in stereoisomeric configuration could have a major impact on affinity. The ability of WAC-MS to provide instant information about stereoselectivity and binding affinities directly from analyte mixtures is a great advantage in fragment library screening and drug lead development.
International Nuclear Information System (INIS)
Shyu, Conrad; Cavileer, Timothy D.; Nagler, James J.; Ytreberg, F. Marty
2011-01-01
Environmental estrogens have been the subject of intense research due to their documented detrimental effects on the health of fish and wildlife and their potential to negatively impact humans. A complete understanding of how these compounds affect health is complicated because environmental estrogens are a structurally heterogeneous group of compounds. In this work, computational molecular dynamics simulations were utilized to predict the binding affinity of different compounds using rainbow trout (Oncorhynchus mykiss) estrogen receptors (ERs) as a model. Specifically, this study presents a comparison of the binding affinity of the natural ligand estradiol-17β to the four rainbow trout ER isoforms with that of three known environmental estrogens 17α-ethinylestradiol, bisphenol A, and raloxifene. Two additional compounds, atrazine and testosterone, that are known to be very weak or non-binders to ERs were tested. The binding affinity of these compounds to the human ERα subtype is also included for comparison. The results of this study suggest that, when compared to estradiol-17β, bisphenol A binds less strongly to all four receptors, 17α-ethinylestradiol binds more strongly, and raloxifene has a high affinity for the α subtype only. The results also show that atrazine and testosterone are weak or non-binders to the ERs. All of the results are in excellent qualitative agreement with the known in vivo estrogenicity of these compounds in the rainbow trout and other fishes. Computational estimation of binding affinities could be a valuable tool for predicting the impact of environmental estrogens in fish and other animals.
Low-complexity piecewise-affine virtual sensors: theory and design
Rubagotti, Matteo; Poggi, Tomaso; Oliveri, Alberto; Pascucci, Carlo Alberto; Bemporad, Alberto; Storace, Marco
2014-03-01
This paper is focused on the theoretical development and the hardware implementation of low-complexity piecewise-affine direct virtual sensors for the estimation of unmeasured variables of interest of nonlinear systems. The direct virtual sensor is designed directly from measured inputs and outputs of the system and does not require a dynamical model. The proposed approach allows one to design estimators which mitigate the effect of the so-called 'curse of dimensionality' of simplicial piecewise-affine functions, and can be therefore applied to relatively high-order systems, enjoying convergence and optimality properties. An automatic toolchain is also presented to generate the VHDL code describing the digital circuit implementing the virtual sensor, starting from the set of measured input and output data. The proposed methodology is applied to generate an FPGA implementation of the virtual sensor for the estimation of vehicle lateral velocity, using a hardware-in-the-loop setting.
Optimizing scoring function of protein-nucleic acid interactions with both affinity and specificity.
Directory of Open Access Journals (Sweden)
Zhiqiang Yan
Full Text Available Protein-nucleic acid (protein-DNA and protein-RNA recognition is fundamental to the regulation of gene expression. Determination of the structures of the protein-nucleic acid recognition and insight into their interactions at molecular level are vital to understanding the regulation function. Recently, quantitative computational approach has been becoming an alternative of experimental technique for predicting the structures and interactions of biomolecular recognition. However, the progress of protein-nucleic acid structure prediction, especially protein-RNA, is far behind that of the protein-ligand and protein-protein structure predictions due to the lack of reliable and accurate scoring function for quantifying the protein-nucleic acid interactions. In this work, we developed an accurate scoring function (named as SPA-PN, SPecificity and Affinity of the Protein-Nucleic acid interactions for protein-nucleic acid interactions by incorporating both the specificity and affinity into the optimization strategy. Specificity and affinity are two requirements of highly efficient and specific biomolecular recognition. Previous quantitative descriptions of the biomolecular interactions considered the affinity, but often ignored the specificity owing to the challenge of specificity quantification. We applied our concept of intrinsic specificity to connect the conventional specificity, which circumvents the challenge of specificity quantification. In addition to the affinity optimization, we incorporated the quantified intrinsic specificity into the optimization strategy of SPA-PN. The testing results and comparisons with other scoring functions validated that SPA-PN performs well on both the prediction of binding affinity and identification of native conformation. In terms of its performance, SPA-PN can be widely used to predict the protein-nucleic acid structures and quantify their interactions.
Generalized Warburg impedance on realistic self-affine fractals
Indian Academy of Sciences (India)
We analyse the problem of impedance for a diffusion controlled charge transfer process across an irregular interface. These interfacial irregularities are characterized as two class of random fractals: (i) a statistically isotropic self-affine fractals and (ii) a statistically corrugated self-affine fractals. The information about the ...
Energy Technology Data Exchange (ETDEWEB)
Xiong, Sicheng; Zhou, Yaofeng; Huang, Xiaolin [State Key Laboratory of Food Science and Technology, Nanchang University, Nanchang 330047 (China); Yu, Ruijin [College of Science, Northwest A& F University, Yangling, Shaanxi 712100 (China); Lai, Weihua [State Key Laboratory of Food Science and Technology, Nanchang University, Nanchang 330047 (China); Xiong, Yonghua, E-mail: yhxiongchen@163.com [State Key Laboratory of Food Science and Technology, Nanchang University, Nanchang 330047 (China)
2017-06-15
Herein, for the first time we report a novel direct competitive fluorescence-linked immunosorbent assay (dcFLISA) for the ultrasensitive detection of ochratoxin A (OTA) by introducing a large size polymer beads loaded with quantum dots (QBs) as carrier of competing antigen for decreasing binding affinity to antibody and enhancing the fluorescent signal intensity. When using 255 nm QBs as carrier of competing antigen, the equilibrium dissociation constant of QB based competing antigen to antibodies can be tuned to 100 times higher than that of the horseradish peroxidase (HRP) based competing antigen by controlling labeled amounts of antigen on the surface of QBs. Various parameters that influenced the sensitivity of dcFLISA were investigated and optimized. Under optimum detection parameters, the dynamic linear range of developed dcFLISA for detecting OTA was established at 0.05 pg/mL to 1.56 pg/mL with a half maximal inhibitory concentration at 0.14 ± 0.04 pg/mL (n = 5), which is three orders of magnitude lower than that of conventional HRP-based dcELISA (0.24 ng/mL). The developed FLISA is also highly accurate, reliable, and shows no cross reaction to other mycotoxins. In summary, the proposed method offers a straightforward approach to improve the sensitivity of direct competitive immunoassay for trace small chemical molecule detection in food quality control, environmental monitoring, and clinical diagnosis. - Highlights: • Highly luminescent QBs were used as a carrier of competing antigen for ultrasensitive detection of OTA. • It is the first time to use a large size QBs as a carrier for tuning affinity of competing antigen to antibodies. • IC{sub 50} value of QB-based dcFLISA is three orders of magnitude lower than that of HRP-based dcELISA.
International Nuclear Information System (INIS)
Xiong, Sicheng; Zhou, Yaofeng; Huang, Xiaolin; Yu, Ruijin; Lai, Weihua; Xiong, Yonghua
2017-01-01
Herein, for the first time we report a novel direct competitive fluorescence-linked immunosorbent assay (dcFLISA) for the ultrasensitive detection of ochratoxin A (OTA) by introducing a large size polymer beads loaded with quantum dots (QBs) as carrier of competing antigen for decreasing binding affinity to antibody and enhancing the fluorescent signal intensity. When using 255 nm QBs as carrier of competing antigen, the equilibrium dissociation constant of QB based competing antigen to antibodies can be tuned to 100 times higher than that of the horseradish peroxidase (HRP) based competing antigen by controlling labeled amounts of antigen on the surface of QBs. Various parameters that influenced the sensitivity of dcFLISA were investigated and optimized. Under optimum detection parameters, the dynamic linear range of developed dcFLISA for detecting OTA was established at 0.05 pg/mL to 1.56 pg/mL with a half maximal inhibitory concentration at 0.14 ± 0.04 pg/mL (n = 5), which is three orders of magnitude lower than that of conventional HRP-based dcELISA (0.24 ng/mL). The developed FLISA is also highly accurate, reliable, and shows no cross reaction to other mycotoxins. In summary, the proposed method offers a straightforward approach to improve the sensitivity of direct competitive immunoassay for trace small chemical molecule detection in food quality control, environmental monitoring, and clinical diagnosis. - Highlights: • Highly luminescent QBs were used as a carrier of competing antigen for ultrasensitive detection of OTA. • It is the first time to use a large size QBs as a carrier for tuning affinity of competing antigen to antibodies. • IC_5_0 value of QB-based dcFLISA is three orders of magnitude lower than that of HRP-based dcELISA.
Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.
2011-01-01
Pairings on elliptic curves are being used in an increasing number of cryptographic applications on many different devices and platforms, but few performance numbers for cryptographic pairings have been reported on embedded and mobile devices. In this paper we give performance numbers for affine and
International Nuclear Information System (INIS)
Alexandratos, Spiro D.
2007-01-01
Polymer-supported reagents are comprised of crosslinked polymer networks that have been modified with ligands capable of selective metal ion complexation. Applications of these polymers are in environmental remediation, ion chromatography, sensor technology, and hydrometallurgy. Bifunctional polymers with diphosphonate/sulfonate ligands have a high selectivity for actinide ions. The distribution coefficient for the uranyl ion from 1 M nitric acid is 70,000, compared to 900 for the monophosphonate/sulfonate polymer and 200 for the sulfonic acid ion-exchange resin. A bifunctional trihexyl/triethylammonium polymer has a high affinity and selectivity for pertechnetate and perchlorate anions from groundwater. In one example, its distribution coefficient for perchlorate ions in the presence of competing anions is 3,300,000, compared to 203,180 for a commercially available anion-exchange resin. Polystyrene modified with N-methyl-D-glucamine ligands is capable of selectively complexing arsenate from groundwater. It complexes 99% of the arsenate present in a solution of 100 mg/L arsenate with 560 mg/L sulfate ions. Its selectivity is retained even in the presence of 400 mg/L phosphate. There is no affinity for arsenate above pH 9, allowing for the polymer to be regenerated with moderate alkali solution. In studies aimed at developing a Hg(II)-selective resin, simple amine resins were found to have a high Hg(II) affinity and that affinity is dependent upon the solution pH and the counterion
Chen, Guilin; Huang, Bill X; Guo, Mingquan
2018-05-21
Medicinal plants have played an important role in maintaining human health for thousands of years. However, the interactions between the active components in medicinal plants and some certain biological targets during a disease are still unclear in most cases. To conduct the high-throughput screening for small active molecules that can interact with biological targets, which is of great theoretical significance and practical value. The ultrafiltration mass spectrometry (UF-LC/MS) is a powerful bio-analytical method by combining affinity ultrafiltration and liquid chromatography-mass spectrometry (LC/MS), which could rapidly screen and identify small active molecules that bind to biological targets of interest at the same time. Compared with other analytical methods, affinity UF-LC/MS has the characteristics of fast, sensitive and high throughput, and is especially suitable for the complicated extracts of medicinal plants. In this review, the basic principle, characteristics and some most recent challenges in UF-LC/MS have been demonstrated. Meanwhile, the progress and applications of affinity UF-LC/MS in the discovery of the active components from natural medicinal plants and the interactions between small molecules and biological target proteins are also briefly summarised. In addition, the future directions for UF-LC/MS are also prospected. Affinity UF-LC/MS is a powerful tool in studies on the interactions between small active molecules and biological protein targets, especially in the high-throughput screening of active components from the natural medicinal plants. Copyright © 2018 John Wiley & Sons, Ltd.
Nguyen, Hai T; Guiard, Bruno P; Bacq, Alexandre; David, Denis J; David, Indira; Quesseveur, Gaël; Gautron, Sophie; Sanchez, Connie; Gardier, Alain M
2013-01-01
BACKGROUND AND PURPOSE Escitalopram, the S(+)-enantiomer of citalopram is the most selective 5-HT reuptake inhibitor approved. Although all 5-HT selective reuptake inhibitors (SSRIs) increase extracellular levels of 5-HT ([5-HT]ext). some also enhance, to a lesser extent, extracellular levels of noradrenaline ([NA]ext). However, the mechanisms by which SSRIs activate noradrenergic transmission in the brain remain to be determined. EXPERIMENTAL APPROACH This study examined the effects of escitalopram, on both [5-HT]ext and [NA]ext in the frontal cortex (FCx) of freely moving wild-type (WT) and mutant mice lacking the 5-HT transporter (SERT−/−) by using intracerebral microdialysis. We explored the possibilities that escitalopram enhances [NA]ext, either by a direct mechanism involving the inhibition of the low- or high-affinity noradrenaline transporters, or by an indirect mechanism promoted by [5-HT]ext elevation. The forced swim test (FST) was used to investigate whether enhancing cortical [5-HT]ext and/or [NA]ext affected the antidepressant-like activity of escitalopram. KEY RESULTS In WT mice, a single systemic administration of escitalopram produced a significant increase in cortical [5-HT]ext and [NA]ext. As expected, escitalopram failed to increase cortical [5-HT]ext in SERT−/− mice, whereas its neurochemical effects on [NA]ext persisted in these mutants. In WT mice subjected to the FST, escitalopram increased swimming parameters without affecting climbing behaviour. Finally, escitalopram, at relevant concentrations, failed to inhibit cortical noradrenaline and 5-HT uptake mediated by low-affinity monoamine transporters. CONCLUSIONS AND IMPLICATIONS These experiments suggest that escitalopram enhances, although moderately, cortical [NA]extin vivo by a direct mechanism involving the inhibition of the high-affinity noradrenaline transporter (NET). PMID:22233336
Traceless affinity labeling of endogenous proteins for functional analysis in living cells.
Hayashi, Takahiro; Hamachi, Itaru
2012-09-18
affinity labeling method and allows for real-time monitoring of protein activity. With the high target specificity and biocompatibility of this technique, we have achieved individual labeling and imaging of endogenously expressed proteins in samples of high biological complexity. We also highlight applications in which our current approach enabled the monitoring of important biological events, such as ligand binding, in living cells. These novel chemical labeling techniques are expected to provide a molecular toolbox for studying a wide variety of proteins and beyond in living cells.
Shetty, Dinesh; Khedkar, Jayshree K; Park, Kyeng Min; Kim, Kimoon
2015-12-07
The design of synthetic, monovalent host-guest molecular recognition pairs is still challenging and of particular interest to inquire into the limits of the affinity that can be achieved with designed systems. In this regard, cucurbit[7]uril (CB[7]), an important member of the host family cucurbit[n]uril (CB[n], n = 5-8, 10, 14), has attracted much attention because of its ability to form ultra-stable complexes with multiple guests. The strong hydrophobic effect between the host cavity and guests, ion-dipole and dipole-dipole interactions of guests with CB portals helps in cooperative and multiple noncovalent interactions that are essential for realizing such strong complexations. These highly selective, strong yet dynamic interactions can be exploited in many applications including affinity chromatography, biomolecule immobilization, protein isolation, biological catalysis, and sensor technologies. In this review, we summarize the progress in the development of high affinity guests for CB[7], factors affecting the stability of complexes, theoretical insights, and the utility of these high affinity pairs in different challenging applications.
ZrFsy1, a high-affinity fructose/H+ symporter from fructophilic yeast Zygosaccharomyces rouxii.
Directory of Open Access Journals (Sweden)
Maria José Leandro
Full Text Available Zygosaccharomyces rouxii is a fructophilic yeast than can grow at very high sugar concentrations. We have identified an ORF encoding a putative fructose/H(+ symporter in the Z. rouxii CBS 732 genome database. Heterologous expression of this ORF in a S. cerevisiae strain lacking its own hexose transporters (hxt-null and subsequent kinetic characterization of its sugar transport activity showed it is a high-affinity low-capacity fructose/H(+ symporter, with Km 0.45 ± 0.07 mM and Vmax 0.57 ± 0.02 mmol h(-1 (gdw(-1. We named it ZrFsy1. This protein also weakly transports xylitol and sorbose, but not glucose or other hexoses. The expression of ZrFSY1 in Z. rouxii is higher when the cells are cultivated at extremely low fructose concentrations (<0.2% and on non-fermentable carbon sources such as mannitol and xylitol, where the cells have a prolonged lag phase, longer duplication times and change their microscopic morphology. A clear phenotype was determined for the first time for the deletion of a fructose/H(+ symporter in the genome where it occurs naturally. The effect of the deletion of ZrFSY1 in Z. rouxii cells is only evident when the cells are cultivated at very low fructose concentrations, when the ZrFsy1 fructose symporter is the main active fructose transporter system.
ODE/IM correspondence and modified affine Toda field equations
Energy Technology Data Exchange (ETDEWEB)
Ito, Katsushi; Locke, Christopher
2014-08-15
We study the two-dimensional affine Toda field equations for affine Lie algebra g{sup ^} modified by a conformal transformation and the associated linear equations. In the conformal limit, the associated linear problem reduces to a (pseudo-)differential equation. For classical affine Lie algebra g{sup ^}, we obtain a (pseudo-)differential equation corresponding to the Bethe equations for the Langlands dual of the Lie algebra g, which were found by Dorey et al. in study of the ODE/IM correspondence.
Wang, Juan; Shi, Yali; Cai, Yaqi
2018-04-06
In the present study, a highly selective fluorous affinity-based dispersive liquid-liquid microextraction (DLLME) technique was developed for the extraction and analysis of per- and polyfluoroalkyl substances (PFASs) followed by high performance liquid chromatography tandem-mass spectrometry. Perfluoro-tert-butanol with multiple C-F bonds was chosen as the extraction solvent, which was injected into the aqueous samples with a dispersive solvent (acetonitrile) in a 120:800 (μL, v/v) mixture for PFASs enrichment. The fluorous affinity-based extraction mechanism was confirmed by the significantly higher extraction recoveries for PFASs containing multiple fluorine atoms than those for compounds with fewer or no fluorine atoms. The extraction recoveries of medium and long-chain PFASs (CF 2 > 5) exceeded 70%, except perfluoroheptanoic acid, while those of short-chain PFASs were lower than 50%, implying that the proposed DLLME may not be suitable for their extraction due to weak fluorous affinity. This highly fluoroselective DLLME technique can greatly decrease the matrix effect that occurs in mass spectrometry detection when applied to the analysis of urine samples. Under the optimum conditions, the relative recoveries of PFASs with CF 2 > 5 ranged from 80.6-121.4% for tap water, river water and urine samples spiked with concentrations of 10, 50 and 100 ng/L. The method limits of quantification for PFASs in water and urine samples were in the range of 0.6-8.7 ng/L. Furthermore, comparable concentrations of PFASs were obtained via DLLME and solid-phase extraction, confirming that the developed DLLME technique is a promising method for the extraction of PFASs in real samples. Copyright © 2018 Elsevier B.V. All rights reserved.
In vitro evolution and affinity-maturation with Coliphage qβ display.
Directory of Open Access Journals (Sweden)
Claudia Skamel
Full Text Available The Escherichia coli bacteriophage, Qβ (Coliphage Qβ, offers a favorable alternative to M13 for in vitro evolution of displayed peptides and proteins due to high mutagenesis rates in Qβ RNA replication that better simulate the affinity maturation processes of the immune response. We describe a benchtop in vitro evolution system using Qβ display of the VP1 G-H loop peptide of foot-and-mouth disease virus (FMDV. DNA encoding the G-H loop was fused to the A1 minor coat protein of Qβ resulting in a replication-competent hybrid phage that efficiently displayed the FMDV peptide. The surface-localized FMDV VP1 G-H loop cross-reacted with the anti-FMDV monoclonal antibody (mAb SD6 and was found to decorate the corners of the Qβ icosahedral shell by electron microscopy. Evolution of Qβ-displayed peptides, starting from fully degenerate coding sequences corresponding to the immunodominant region of VP1, allowed rapid in vitro affinity maturation to SD6 mAb. Qβ selected under evolutionary pressure revealed a non-canonical, but essential epitope for mAb SD6 recognition consisting of an Arg-Gly tandem pair. Finally, the selected hybrid phages induced polyclonal antibodies in guinea pigs with good affinity to both FMDV and hybrid Qβ-G-H loop, validating the requirement of the tandem pair epitope. Qβ-display emerges as a novel framework for rapid in vitro evolution with affinity-maturation to molecular targets.
Characterization of self-affinity in the global regime
Neimark, Alexander V.
1994-11-01
Methods for characterization of self-affine surfaces and measurements of their roughness exponents H are developed. It is shown that for smoothed surfaces, which underwent particular coarse graining or averaging of the small-scale fluctuations, the excess surface area Sex and the mean square root radius of curvature ac are related by two distinct asymptotic power laws if ac is well below or well above a certain crossover scale acr. In the local regime of self-affinity, when acSex~(ac/acr)-(1-H). In the global regime of self-affinity, when ac>>acr, Sex~(ac/acr)-2(1-H)/(2-H). The former scaling relationship is consistent with the well known definition of local fractal dimensions dloc=dtop+1-H. The latter scaling relationship offers alternatives for characterization of self-affinity over large scales by means of excess dimensions defined as dex=dtop+2(1-H)/(2-H) and can be used for determination of roughness exponents from the measurements provided in the global regime. The thermodynamic method of fractal analysis, proposed earlier for self-similar surfaces (A.V. Neimark, Pis'ma Zh. Eksp. Teor. Fiz. 51, 535 (1990) [JETP Lett. 51, 607 (1990)]; Physica A 191, 258 (1992)), is extended for self-affine surfaces for determination of fractal dimensions and roughness exponents from adsorption and capillary experimental data.
Zeilinger, Markus; Pichler, Florian; Nics, Lukas; Wadsak, Wolfgang; Spreitzer, Helmut; Hacker, Marcus; Mitterhauser, Markus
2017-12-01
Resolving the kinetic mechanisms of biomolecular interactions have become increasingly important in early-phase drug development. Since traditional in vitro methods belong to dose-dependent assessments, binding kinetics is usually overlooked. The present study aimed at the establishment of two novel experimental approaches for the assessment of binding affinity of both, radiolabelled and non-labelled compounds targeting the A 3 R, based on high-resolution real-time data acquisition of radioligand-receptor binding kinetics. A novel time-resolved competition assay was developed and applied to determine the K i of eight different A 3 R antagonists, using CHO-K1 cells stably expressing the hA 3 R. In addition, a new kinetic real-time cell-binding approach was established to quantify the rate constants k on and k off , as well as the dedicated K d of the A 3 R agonist [ 125 I]-AB-MECA. Furthermore, lipophilicity measurements were conducted to control influences due to physicochemical properties of the used compounds. Two novel real-time cell-binding approaches were successfully developed and established. Both experimental procedures were found to visualize the kinetic binding characteristics with high spatial and temporal resolution, resulting in reliable affinity values, which are in good agreement with values previously reported with traditional methods. Taking into account the lipophilicity of the A 3 R antagonists, no influences on the experimental performance and the resulting affinity were investigated. Both kinetic binding approaches comprise tracer administration and subsequent binding to living cells, expressing the dedicated target protein. Therefore, the experiments resemble better the true in vivo physiological conditions and provide important markers of cellular feedback and biological response.
Mulder, R Joshua; Guerra, Célia Fonseca; Bickelhaupt, F Matthias
2010-07-22
We have computed the methyl cation affinities in the gas phase of archetypal anionic and neutral bases across the periodic table using ZORA-relativistic density functional theory (DFT) at BP86/QZ4P//BP86/TZ2P. The main purpose of this work is to provide the methyl cation affinities (and corresponding entropies) at 298 K of all anionic (XH(n-1)(-)) and neutral bases (XH(n)) constituted by maingroup-element hydrides of groups 14-17 and the noble gases (i.e., group 18) along the periods 2-6. The cation affinity of the bases decreases from H(+) to CH(3)(+). To understand this trend, we have carried out quantitative bond energy decomposition analyses (EDA). Quantitative correlations are established between the MCA and PA values.
Yetim, Aylin; Yetim, Çağcıl; Baş, Firdevs; Erol, Oğuz Bülent; Çığ, Gülnaz; Uçar, Ahmet; Darendeliler, Feyza
2016-09-01
Polycystic ovary syndrome (PCOS) is a common endocrine problem in adolescents with an increasing prevalence of 30%. Pursuing new biomarkers with high specificity and sensitivity in the diagnosis of PCOS in adolescents is currently an active area of research. We aimed to investigate the diagnostic value of anti-Müllerian hormone (AMH), insulin-like peptide-3 (INSL3), inhibin-A (INH-A), and inhibin-B (INH-B) in adolescents with PCOS and also to determine the association, if any, between these hormones and clinical/laboratory findings related with hyperandrogenism. The study group comprised 53 adolescent girls aged between 14.5 and 20 years who were admitted to our outpatient clinic with symptoms of hirsutism and/or irregular menses and diagnosed as having PCOS in accordance with the Rotterdam criteria. Twenty-six healthy peers, eumenorrheic for at least two years and body mass index-matched, constituted the controls. Fasting blood samples for hormones [luteinizing hormone (LH), follicle-stimulating hormone (FSH), dehydroepiandrosterone-sulfate (DHEAS), androstenedione (D4-A), total/free testosterone (T/fT), sex hormone binding globulin (SHBG), AMH, INSL3, INH-A, INH-B] were drawn after an overnight fast. In the PCOS group, 83% of the subjects were oligomenorrheic/amenorrheic and 87% had hirsutism. The LH, LH/FSH ratio, total T, fT, free androgen-index (FAI), DHEAS levels were significantly higher (p=0.005, p=0.042, p=0.047, pPCOS patients as compared to the controls. Although the INSL-3 and INH-B levels showed no difference between the groups (p>0.05), AMH and INH-A levels were found to be significantly higher in the PCOS group compared to the controls (pPCOS. When AMH and INH-A were used in combination, the sensitivity (96.2%) increased. INSL3 and INH-B were not found to have diagnostic value in adolescents with PCOS. On the other hand, it was shown that INH-A could be used as a new diagnostic biomarker in addition to AMH.
DAYA ANTIBAKTERI EKSTRAK ETANOL DAUN SENGGANI (Melastoma affine D. Don
Directory of Open Access Journals (Sweden)
Ika Trisharyanti Dian Kusumowati
2014-08-01
Full Text Available Melastoma affine D. Don had some activities such as anthelmintic, antibacteria, antiinfiammation, antifungal, and antitumor. The aims of this research was determine antibacteria activity of ethanolic extract of Melastoma affine D. Don. The antimicrobial activity was tested by solid dilution method to get Minimum Inhibition Concentration (MIC. The compounds in Melastoma affine D. Don was analyzed by tube test method and Thin Layer Chromatography (TLC with chloroform : methanol : formic acid (8,5:1,5:0,5 as mobile phase and silica gel GF254 as stationary phase. The result showed ethanolic extract of Melastoma affine D. Don contains alkaloid, polyphenol, fiavonoid, saponin, and essential oil. The MIC of Senggani against Staphylococcus aureus was 2% and 3% against Escherichia coli and the extract could not inhibit Staphylococcus aureus and Escherichia coli multiresistant until concentration 7% extract ethanol. Keywords: Melastoma affine D. Don, Staphylococcus aureus, Escherichia coli
Computation of piecewise affine terminal cost functions for model predictive control
Brunner, F.D.; Lazar, M.; Allgöwer, F.; Fränzle, Martin; Lygeros, John
2014-01-01
This paper proposes a method for the construction of piecewise affine terminal cost functions for model predictive control (MPC). The terminal cost function is constructed on a predefined partition by solving a linear program for a given piecewise affine system, a stabilizing piecewise affine
Algimantas P. Valaitis; Jeremy L. Jenkins; Mi Kyong Lee; Donald H. Dean; Karen J. Garner
2001-01-01
BTR-270, a gypsy moth (Lymantria dispar) brush border membrane molecule that binds Bacillus thuringiensis (Bt) Cry1A toxins with high affinity, was purified by preparative gel electrophoresis. Rabbit antibodies specific for the Bt toxin-binding molecule were raised. Attempts to label BTR-270 by protein-directed techniques were...
A novel affinity purification method to isolate peptide specific antibodies
DEFF Research Database (Denmark)
Karlsen, Alan E; Lernmark, A; Kofod, Hans
1990-01-01
Site-specific, high affinity polyclonal antisera are effectively and successfully produced by immunizing rabbits with synthetic peptides. The use of these antisera in subsequent immune analysis is often limited because of non-specific binding. We describe a new and simple method to effectively...... affinity-purify anti-peptide antibodies. To test our system, rabbits were immunized with model peptides representing sequences of the putative rabbit growth hormone receptor and several HLA-DQ beta-chain molecules. Polystyrene plastic beads were coated with peptides. Immune serum was incubated...... with the beads and after a wash step the bound antibodies were eluted in 1 M acetic acid. The eluted material was composed predominantly of intact immunoglobulin as evidenced by the presence of heavy and light chain bands in SDS-PAGE. The eluted antibodies were peptide specific in ELISA and bound only to intact...
DEFF Research Database (Denmark)
Sabbatini, Paola; Wellendorph, Petrine; Høg, Signe
2010-01-01
γ-Hydroxybutyric acid (GHB) is a psychotropic compound endogenous to the brain. Despite its potential physiological significance, the complete molecular mechanisms of action remain unexplained. To facilitate the isolation and identification of the high-affinity GHB binding site, we herein report ...
Banroques, Josette; Doère, Monique; Dreyfus, Marc; Linder, Patrick; Tanner, N Kyle
2010-03-05
Motif III in the putative helicases of superfamily 2 is highly conserved in both its sequence and its structural context. It typically consists of the sequence alcohol-alanine-alcohol (S/T-A-S/T). Historically, it was thought to link ATPase activity with a "helicase" strand displacement activity that disrupts RNA or DNA duplexes. DEAD-box proteins constitute the largest family of superfamily 2; they are RNA-dependent ATPases and ATP-dependent RNA binding proteins that, in some cases, are able to disrupt short RNA duplexes. We made mutations of motif III (S-A-T) in the yeast DEAD-box protein Ded1 and analyzed in vivo phenotypes and in vitro properties. Moreover, we made a tertiary model of Ded1 based on the solved structure of Vasa. We used Ded1 because it has relatively high ATPase and RNA binding activities; it is able to displace moderately stable duplexes at a large excess of substrate. We find that the alanine and the threonine in the second and third positions of motif III are more important than the serine, but that mutations of all three residues have strong phenotypes. We purified the wild-type and various mutants expressed in Escherichia coli. We found that motif III mutations affect the RNA-dependent hydrolysis of ATP (k(cat)), but not the affinity for ATP (K(m)). Moreover, mutations alter and reduce the affinity for single-stranded RNA and subsequently reduce the ability to disrupt duplexes. We obtained intragenic suppressors of the S-A-C mutant that compensate for the mutation by enhancing the affinity for ATP and RNA. We conclude that motif III and the binding energy of gamma-PO(4) of ATP are used to coordinate motifs I, II, and VI and the two RecA-like domains to create a high-affinity single-stranded RNA binding site. It also may help activate the beta,gamma-phosphoanhydride bond of ATP. (c) 2009 Elsevier Ltd. All rights reserved.
On Affine Fusion and the Phase Model
Directory of Open Access Journals (Sweden)
Mark A. Walton
2012-11-01
Full Text Available A brief review is given of the integrable realization of affine fusion discovered recently by Korff and Stroppel. They showed that the affine fusion of the su(n Wess-Zumino-Novikov-Witten (WZNW conformal field theories appears in a simple integrable system known as the phase model. The Yang-Baxter equation leads to the construction of commuting operators as Schur polynomials, with noncommuting hopping operators as arguments. The algebraic Bethe ansatz diagonalizes them, revealing a connection to the modular S matrix and fusion of the su(n WZNW model. The noncommutative Schur polynomials play roles similar to those of the primary field operators in the corresponding WZNW model. In particular, their 3-point functions are the su(n fusion multiplicities. We show here how the new phase model realization of affine fusion makes obvious the existence of threshold levels, and how it accommodates higher-genus fusion.
Capillary electrophoresis-based assessment of nanobody affinity and purity
Haselberg, Rob; Oliveira, Sabrina; van der Meel, Roy; Somsen, Govert W; de Jong, Gerhardus J
2014-01-01
Drug purity and affinity are essential attributes during development and production of therapeutic proteins. In this work, capillary electrophoresis (CE) was used to determine both the affinity and composition of the biotechnologically produced "nanobody" EGa1, the binding fragment of a
Specificity and affinity quantification of protein-protein interactions.
Yan, Zhiqiang; Guo, Liyong; Hu, Liang; Wang, Jin
2013-05-01
Most biological processes are mediated by the protein-protein interactions. Determination of the protein-protein structures and insight into their interactions are vital to understand the mechanisms of protein functions. Currently, compared with the isolated protein structures, only a small fraction of protein-protein structures are experimentally solved. Therefore, the computational docking methods play an increasing role in predicting the structures and interactions of protein-protein complexes. The scoring function of protein-protein interactions is the key responsible for the accuracy of the computational docking. Previous scoring functions were mostly developed by optimizing the binding affinity which determines the stability of the protein-protein complex, but they are often lack of the consideration of specificity which determines the discrimination of native protein-protein complex against competitive ones. We developed a scoring function (named as SPA-PP, specificity and affinity of the protein-protein interactions) by incorporating both the specificity and affinity into the optimization strategy. The testing results and comparisons with other scoring functions show that SPA-PP performs remarkably on both predictions of binding pose and binding affinity. Thus, SPA-PP is a promising quantification of protein-protein interactions, which can be implemented into the protein docking tools and applied for the predictions of protein-protein structure and affinity. The algorithm is implemented in C language, and the code can be downloaded from http://dl.dropbox.com/u/1865642/Optimization.cpp.
Fraisier, V; Gojon, A; Tillard, P; Daniel-Vedele, F
2000-08-01
The NpNRT2.1 gene encodes a putative inducible component of the high-affinity nitrate (NO3-) uptake system in Nicotiana plumbaginifolia. Here we report functional and physiological analyses of transgenic plants expressing the NpNRT2.1 coding sequence fused to the CaMV 35S or rolD promoters. Irrespective of the level of NO3- supplied, NO3- contents were found to be remarkably similar in wild-type and transgenic plants. Under specific conditions (growth on 10 mM NO3-), the steady-state NpNRT2. 1 mRNA level resulting from the deregulated transgene expression was accompanied by an increase in 15NO3- influx measured in the low concentration range. This demonstrates for the first time that the NRT2.1 sequence codes a limiting element of the inducible high-affinity transport system. Both 15NO3- influx and mRNA levels decreased in the wild type after exposure to ammonium, in agreement with previous results from many species. Surprisingly, however, influx was also markedly decreased in transgenic plants, despite stable levels of transgene expression in independent transformants after ammonium addition. We conclude that the conditions associated with the supply of a reduced nitrogen source such as ammonium, or with the generation of a further downstream metabolite, probably exert a repressive effect on NO3- influx at both transcriptional and post-transcriptional levels.
Exploring Girls' Science Affinities Through an Informal Science Education Program
Todd, Brandy; Zvoch, Keith
2017-10-01
This study examines science interests, efficacy, attitudes, and identity—referred to as affinities, in the context of an informal science outreach program for girls. A mixed methods design was used to explore girls' science affinities before, during, and after participation in a cohort-based summer science camp. Multivariate analysis of survey data revealed that girls' science affinities varied as a function of the joint relationship between family background and number of years in the program, with girls from more affluent families predicted to increase affinities over time and girls from lower income families to experience initial gains in affinities that diminish over time. Qualitative examination of girls' perspectives on gender and science efficacy, attitudes toward science, and elements of science identities revealed a complex interplay of gendered stereotypes of science and girls' personal desires to prove themselves knowledgeable and competent scientists. Implications for the best practice in fostering science engagement and identities in middle school-aged girls are discussed.
Dekker, Frank J; de Mol, Nico J; Fischer, Marcel J E; Liskamp, Rob M J; Dekker, Frank
2003-01-01
The construction of rigid spacers composed of amino propynyl benzoic acid building blocks is described. These spacers were used to link two phosphopeptide ligand sites towards obtaining divalent ligands with a high affinity for Syk tandem SH2 domains, which are important in signal transduction. The
Affinity-tuning leukocyte integrin for development of safe therapeutics
Park, Spencer
Much attention has been given to the molecular and cellular pathways linking inflammation with cancer and the local tumor environment to identify new target molecules that could lead to improved diagnosis and treatment. Among the many molecular players involved in the complex response, central to the induction of inflammation is intercellular adhesion molecule (ICAM)-1, which is of particular interest for its highly sensitive and localized expression in response to inflammatory signals. ICAM-1, which has been implicated to play a critical role in tumor progression in various types of cancer, has also been linked to cancer metastases, where ICAM-1 facilitates the spread of metastatic cancer cells to secondary sites. This unique expression profile of ICAM-1 throughout solid tumor microenvironment makes ICAM-1 an intriguing molecular target, which holds great potential as an important diagnostic and therapeutic tool. Herein, we have engineered the ligand binding domain, or the inserted (I) domain of a leukocyte integrin, to exhibit a wide range of monovalent affinities to the natural ligand, ICAM-1. Using the resulting I domain variants, we have created drug and gene delivery nanoparticles, as well as targeted immunotherapeutics that have the ability to bind and migrate to inflammatory sites prevalent in tumors and the associated microenvironment. Through the delivery of diagnostic agents, chemotherapeutics, and immunotherapeutics, the following chapters demonstrate that the affinity enhancements achieved by directed evolution bring the affinity of I domains into the range optimal for numerous applications.
Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.; Abdalla, M.; Lange, T.
2013-01-01
We report on relative performance numbers for affine and projective pairings on a dual-core Cortex A9 ARM processor. Using a fast inversion in the base field and doing inversion in extension fields by using the norm map to reduce to inversions in smaller fields, we find a very low ratio of
Affine planes, ternary rings, and examples of non-Desarguesian planes
Ivanov, Nikolai V.
2016-01-01
The paper is devoted to a detailed self-contained exposition of a part of the theory of affine planes leading to a construction of affine (or, equivalently, projective) planes not satisfying the Desarques axiom. It is intended to complement the introductory expositions of the theory of affine and projective planes. A novelty of our exposition is a new notation for the ternary operation in a ternary ring, much more suggestive than the standard one.
Fermionic construction of vertex operators for twisted affine algebras
International Nuclear Information System (INIS)
Frappat, L.; Sorba, P.; Sciarrino, A.
1988-03-01
We construct vertex operator representations of the twisted affine algebras in terms of fermionic (or parafermionic in some cases) elementary fields. The folding method applied to the extended Dynkin diagrams of the affine algebras allows us to determine explicitly these fermionic fields as vertex operators
International Nuclear Information System (INIS)
Hofmann, C.; Vanderbruggen, H.; Hoefte, H.; Van Rie, J.; Jansens, S.; Van Mellaert, H.
1988-01-01
Binding studies were performed with two 125 I-labeled Bacillus thuringiensis δ-endotoxins on brush border membrane vesicles prepared from the larval midgut of the tobacco hornworm Manduca sexta or the cabbage butterfly Pieris brassicae. One δ-endotoxin, Bt2-protoxin, is a 130-kDa recombinant crystalline protein from B. thuringiensis subsp. berliner. It kills larvae of both insect species. The active Bt2-toxin is a 60-kDa proteolytic fragment of the Bt2-protoxin. It binds saturably and with high affinity to brush border membrane vesicles from the midgut of both species. The other δ-endotoxin, Bt4412-protoxin, is a 136-kDa crystalline protein from B. thuringiensis subsp. thuringiensis, which is highly toxic for P. brassicae, but not for M. sexta larvae. Bt4412-toxin, obtained after proteolytic activation of Bt4412-protoxin, shows high-affinity saturable binding to P. brassicae vesicles but not to M. sexta vesicles. The correlation between toxicity and specific binding is further strengthened by competition studies. Other B. thuringiensis δ-endotoxins active against M. sexta compete for binding of 125 I-labeled Bt2-toxin to M. sexta vesicles, whereas toxins active against dipteran or coleopteran larvae do not compete. Bt2-toxin and Bt4412-toxin bind to different sites on P. brassicae vesicles
Excited state electron affinity calculations for aluminum
Hussein, Adnan Yousif
2017-08-01
Excited states of negative aluminum ion are reviewed, and calculations of electron affinities of the states (3s^23p^2)^1D and (3s3p^3){^5}{S}° relative to the (3s^23p)^2P° and (3s3p^2)^4P respectively of the neutral aluminum atom are reported in the framework of nonrelativistic configuration interaction (CI) method. A priori selected CI (SCI) with truncation energy error (Bunge in J Chem Phys 125:014107, 2006) and CI by parts (Bunge and Carbó-Dorca in J Chem Phys 125:014108, 2006) are used to approximate the valence nonrelativistic energy. Systematic studies of convergence of electron affinity with respect to the CI excitation level are reported. The calculated value of the electron affinity for ^1D state is 78.675(3) meV. Detailed Calculations on the ^5S°c state reveals that is 1216.8166(3) meV below the ^4P state.
k-Schur functions and affine Schubert calculus
Lam, Thomas; Morse, Jennifer; Schilling, Anne; Shimozono, Mark; Zabrocki, Mike
2014-01-01
This book gives an introduction to the very active field of combinatorics of affine Schubert calculus, explains the current state of the art, and states the current open problems. Affine Schubert calculus lies at the crossroads of combinatorics, geometry, and representation theory. Its modern development is motivated by two seemingly unrelated directions. One is the introduction of k-Schur functions in the study of Macdonald polynomial positivity, a mostly combinatorial branch of symmetric function theory. The other direction is the study of the Schubert bases of the (co)homology of the affine Grassmannian, an algebro-topological formulation of a problem in enumerative geometry. This is the first introductory text on this subject. It contains many examples in Sage, a free open source general purpose mathematical software system, to entice the reader to investigate the open problems. This book is written for advanced undergraduate and graduate students, as well as researchers, who want to become familiar with ...
Directory of Open Access Journals (Sweden)
Nur Hasiba Kamaruddin
2017-10-01
Full Text Available The study of binding affinity is essential in surface plasmon resonance (SPR sensing because it allows researchers to quantify the affinity between the analyte and immobilised ligands of an SPR sensor. In this study, we demonstrate the derivation of the binding affinity constant, K, for Pb2+ and Hg2+ ions according to their SPR response using a gold/silver/gold/chitosan–graphene oxide (Au/Ag/Au/CS–GO sensor for the concentration range of 0.1–5 ppm. The higher affinity of Pb2+ to binding with the CS–GO sensor explains the outstanding sensitivity of 2.05 °ppm−1 against 1.66 °ppm−1 of Hg2+. The maximum signal-to-noise ratio (SNR upon detection of Pb2+ is 1.53, and exceeds the suggested logical criterion of an SNR. The Au/Ag/Au/CS–GO SPR sensor also exhibits excellent repeatability in Pb2+ due to the strong bond between its functional groups and this cation. The adsorption data of Pb2+ and Hg2+ on the CS–GO sensor fits well with the Langmuir isotherm model where the affinity constant, K, of Pb2+ and Hg2+ ions is computed. The affinity of Pb2+ ions to the Au/Ag/Au/CS–GO sensor is significantly higher than that of Hg2+ based on the value of K, 7 × 105 M−1 and 4 × 105 M−1, respectively. The higher shift in SPR angles due to Pb2+ and Hg2+ compared to Cr3+, Cu2+ and Zn2+ ions also reveals the greater affinity of the CS–GO SPR sensor to them, thus supporting the rationale for obtaining K for these two heavy metals. This study provides a better understanding on the sensing performance of such sensors in detecting heavy metal ions.
Kutlu, Munir Gunes; Holliday, Erica; Gould, Thomas J
2016-02-01
Previously, studies from our lab have shown that while acute nicotine administered prior to training and testing enhances contextual fear conditioning, acute nicotine injections prior to extinction sessions impair extinction of contextual fear. Although there is also strong evidence showing that the acute nicotine's enhancing effects on contextual fear conditioning require high-affinity α4β2 nicotinic acetylcholine receptors (nAChRs), it is unknown which nAChR subtypes are involved in the acute nicotine-induced impairment of contextual fear extinction. In this study, we investigated the effects of acute nicotine administration on contextual fear extinction in knock-out (KO) mice lacking α4, β2 or α7 subtypes of nAChRs and their wild-type (WT) littermates. Both KO and WT mice were first trained and tested for contextual fear conditioning and received a daily contextual extinction session for 4 days. Subjects received intraperitoneal injections of nicotine (0.18 mg/kg) or saline 2-4 min prior to each extinction session. Our results showed that the mice that lack α4 and β2 subtypes of nAChRs showed normal contextual fear extinction but not the acute nicotine-induced impairment while the mice that lack the α7 subtype showed both normal contextual extinction and nicotine-induced impairment of contextual extinction. In addition, control experiments showed that acute nicotine-induced impairment of contextual fear extinction persisted when nicotine administration was ceased and repeated acute nicotine administrations alone did not induce freezing behavior in the absence of context-shock learning. These results clearly demonstrate that high-affinity α4β2 nAChRs are necessary for the effects of acute nicotine on contextual fear extinction. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Person Alexandra M
2011-11-01
Full Text Available Abstract Background Along with high affinity binding of epibatidine (Kd1≈10 pM to α4β2 nicotinic acetylcholine receptor (nAChR, low affinity binding of epibatidine (Kd2≈1-10 nM to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after
2011-01-01
Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of
International Nuclear Information System (INIS)
Murphy, G.L.
1975-01-01
The general topic of geometric unified field theories is discussed in the first section. Some reasons are given for pursuing such theories, and some criticisms are considered. The second section develops the fundamental equations of a purely affine theory which is invariant under projective transformations of the affine connection. This theory is a generalization of that of Schrodinger. Possible identifications for the space-time metric are considered in Sec. III. Sections IV and V deal with the limits of pure gravitation and electrodynamics. In the symmetric limit, Einstein's vacuum equations with cosmological term are recovered. The theory also contains a generalized electrodynamic set of equations which is very similar to the Born-Infeld set. In the weak-field approximation, a finite mass must be attributed to the photon. The problem of motion for charges is discussed here, and it is argued that criticisms of unified field theories because of a supposed inability to produce the Lorentz force law are probably not justified. Three more speculative sections deal with possible explanations of nuclear forces, the spin-torsion relation, and particle structure
2015-01-01
Molecules able to bind the antigen-binding sites of antibodies are of interest in medicine and immunology. Since most antibodies are bivalent, higher affinity recognition can be achieved through avidity effects in which a construct containing two or more copies of the ligand engages both arms of the immunoglobulin simultaneously. This can be achieved routinely by immobilizing antibody ligands at high density on solid surfaces, such as ELISA plates, but there is surprisingly little literature on scaffolds that routinely support bivalent binding of antibody ligands in solution, particularly for the important case of human IgG antibodies. Here we show that the simple strategy of linking two antigens with a polyethylene glycol (PEG) spacer long enough to span the two arms of an antibody results in higher affinity binding in some, but not all, cases. However, we found that the creation of multimeric constructs in which several antibody ligands are displayed on a dextran polymer reliably provides much higher affinity binding than is observed with the monomer in all cases tested. Since these dextran conjugates are simple to construct, they provide a general and convenient strategy to transform modest affinity antibody ligands into high affinity probes. An additional advantage is that the antibody ligands occupy only a small number of the reactive sites on the dextran, so that molecular cargo can be attached easily, creating molecules capable of delivering this cargo to cells displaying antigen-specific receptors. PMID:25073654
PRINCIPLES OF AFFINITY-BASED BIOSENSORS
Despite the amount of resources that have been invested by national and international academic, government, and commercial sectors to develop affinity-based biosensor products, little obvious success has been realized through commercialization of these devices for specific applic...
Polynomial Primal-Dual Cone Affine Scaling for Semidefinite Programming
A.B. Berkelaar (Arjan); J.F. Sturm; S. Zhang (Shuzhong)
1996-01-01
textabstractIn this paper we generalize the primal--dual cone affine scaling algorithm of Sturm and Zhang to semidefinite programming. We show in this paper that the underlying ideas of the cone affine scaling algorithm can be naturely applied to semidefinite programming, resulting in a new
Control and estimation of piecewise affine systems
Xu, Jun
2014-01-01
As a powerful tool to study nonlinear systems and hybrid systems, piecewise affine (PWA) systems have been widely applied to mechanical systems. Control and Estimation of Piecewise Affine Systems presents several research findings relating to the control and estimation of PWA systems in one unified view. Chapters in this title discuss stability results of PWA systems, using piecewise quadratic Lyapunov functions and piecewise homogeneous polynomial Lyapunov functions. Explicit necessary and sufficient conditions for the controllability and reachability of a class of PWA systems are
Paraschiv, Gabriela; Vincke, Cécile; Czaplewska, Paulina; Manea, Marilena; Muyldermans, Serge; Przybylski, Michael
2013-01-01
ß-Amyloid (Aß) immunotherapy has become a promising strategy for reducing the level of Aß in brain. New immunological approaches have been recently proposed for rapid, early diagnosis, and molecular treatment of neurodegenerative diseases related to Alzheimer's Disease (AD). The combination of proteolytic epitope excision and extraction and mass spectrometry using digestion with various proteases has been shown to be an efficient tool for the identification and molecular characterization of antigenic determinants. Here, we report the identification of the Aβ epitope recognized by the variable domain of single chain llama anti-Aβ-antibodies, termed Aβ-nanobodies, that have been discovered in the blood of camelids and found to be promising candidates for immunotherapy of AD. The epitope recognized by two Aβ-specific nanobodies was identified by proteolytic epitope extraction- and excision-mass spectrometry using a series of proteases (trypsin, chymotrypsin, GluC-protease, and LysC-protease). Matrix-assisted laser desorption ionization--mass spectrometric analysis of the affinity--elution fraction provided the epitope, Aβ(17-28), in the mid- to carboxy-terminal domain of Aβ, which has been shown to exert an Aß-fibril inhibiting effect. Affinity studies of the synthetic epitope confirmed that the Aβ(17-28) peptide is the minimal fragment that binds to the nanobodies. The interactions between the nanobodies and full length Aβ(1-40) or Aβ-peptides containing or lacking the epitope sequence were further characterized by enzyme linked immunosorbent assay and bioaffinity analysis. Determinations of binding affinities between the Aβ-nanobodies and Aβ(1-40) and the Aβ(17-28) epitope provided K(D) values of approximately 150 and 700 nmol, respectively. Thus, the knowledge of the epitope may be highly useful for future studies of Aβ-aggregation (oligomerization and fibril formation) and for designing new aggregation inhibitors. Copyright © 2012 John Wiley
Non-contact adhesion to self-affine surfaces: A theoretical model
Energy Technology Data Exchange (ETDEWEB)
Makeev, Maxim A., E-mail: makeev@umich.edu
2013-11-22
Strength of adhesion between materials is known to be strongly influenced by interface irregularities. In this work, I devise a perturbative approach to describe the effect of self-affine roughness on non-contact adhesive interactions. The hierarchy of the obtained analytical solutions is the following. First, analytical formulae are deduced to describe roughness corrections to the van der Waals interaction energies between a hemi-space adherend, bounded by a self-affine surface, and a point-like adherent. Second, the problem of two hemi-spaces, one of which has a planar surface, and the other is bounded by a self-affine surface, is solved analytically. In the latter case, a numerical analysis is performed to delineate the behavior of the roughness corrections as a function of the parameters, characterizing self-affine fractal surface roughness. The problem of two hemi-spaces, both bounded by self-affine fractal surfaces, is also addressed in this work. The model's predictions are compared with previously reported theoretical results and available experimental data.
de Boer, A.H.; Van der Molen, G.W.; Prins, H.B.A.; Korthout, H.A.A.J.; van der Hoeven, P.C.J.
1994-01-01
The fusicoccin-binding protein was solubilised from purified oat root plasma membranes. The solubilised protein retained full binding activity, provided that protease inhibitors were included. Sodium fluoride reduced the high-affinity [H-3]fusicoccin binding to almost zero in a
Self-affine roughness influence on redox reaction charge admittance
Palasantzas, G
2005-01-01
In this work we investigate the influence of self-affine electrode roughness on the admittance of redox reactions during facile charge transfer kinetics. The self-affine roughness is characterized by the rms roughness amplitude w, the correlation length xi and the roughness exponent H (0
Affine Toda equations and solutions in the homogeneous grading
Czech Academy of Sciences Publication Activity Database
Zuevsky, Alexander
2018-01-01
Roč. 542, April 1 (2018), s. 149-161 ISSN 0024-3795 Institutional support: RVO:67985840 Keywords : affine Lie gebras * affine Toda modes * solitons Subject RIV: BA - General Mathematics OBOR OECD: Pure mathematics Impact factor: 0.973, year: 2016 https://www.sciencedirect.com/science/article/pii/S0024379517302100
Binding affinities of anti-acetylcholine receptor autoantibodies in myasthenia gravis
Energy Technology Data Exchange (ETDEWEB)
Bray, J.J.; Drachman, D.B.
1982-01-01
Antibodies directed against acetylcholine (ACh) receptors are present in the sera of nearly 90% of patients with myasthenia gravis (MG), and are involved in the pathogenesis of this autoimmune disease. However, the antibody titers measured by the standard radioimmunoassay correspond poorly with the clinical severity of the disease. To determine whether this disparity could be accounted for by differences in the binding affinities of anti-ACh receptor antibodies in different patients, we have measured the binding affinities of these autoantibodies in 15 sera from MG patients. The affinity constants (K/sub o/), as determined by Scatchard analysis, were all in the range of 10/sup 10/ M/sup -1/, comparable to the highest values reported in immunized animals. The affinity constants were truly representative of the population of autoantibodies detected by the radioimmunoassay, as shown by the remarkable linearity of the Scatchard plots (r/sup 2/>0.90) and the close correlation between the antibody titers determined by extrapolation of the Scatchard plots and by saturation analysis (r = 0.99; p < 0.001). There was only a 6-fold variation in affinity constants measured in this series of patients despite widely differing antibody titers and severity of the disease. Factors other than the titer and affinity of anti-ACh receptor antibodies may correlate better with the clinical manifestations of MG.
Sequence-specific DNA binding by MYC/MAX to low-affinity non-E-box motifs.
Directory of Open Access Journals (Sweden)
Michael Allevato
Full Text Available The MYC oncoprotein regulates transcription of a large fraction of the genome as an obligatory heterodimer with the transcription factor MAX. The MYC:MAX heterodimer and MAX:MAX homodimer (hereafter MYC/MAX bind Enhancer box (E-box DNA elements (CANNTG and have the greatest affinity for the canonical MYC E-box (CME CACGTG. However, MYC:MAX also recognizes E-box variants and was reported to bind DNA in a "non-specific" fashion in vitro and in vivo. Here, in order to identify potential additional non-canonical binding sites for MYC/MAX, we employed high throughput in vitro protein-binding microarrays, along with electrophoretic mobility-shift assays and bioinformatic analyses of MYC-bound genomic loci in vivo. We identified all hexameric motifs preferentially bound by MYC/MAX in vitro, which include the low-affinity non-E-box sequence AACGTT, and found that the vast majority (87% of MYC-bound genomic sites in a human B cell line contain at least one of the top 21 motifs bound by MYC:MAX in vitro. We further show that high MYC/MAX concentrations are needed for specific binding to the low-affinity sequence AACGTT in vitro and that elevated MYC levels in vivo more markedly increase the occupancy of AACGTT sites relative to CME sites, especially at distal intergenic and intragenic loci. Hence, MYC binds diverse DNA motifs with a broad range of affinities in a sequence-specific and dose-dependent manner, suggesting that MYC overexpression has more selective effects on the tumor transcriptome than previously thought.
Single-Domain Antibodies As Versatile Affinity Reagents for Analytical and Diagnostic Applications
Directory of Open Access Journals (Sweden)
Gualberto Gonzalez-Sapienza
2017-08-01
Full Text Available With just three CDRs in their variable domains, the antigen-binding site of camelid heavy-chain-only antibodies (HcAbs has a more limited structural diversity than that of conventional antibodies. Even so, this does not seem to limit their specificity and high affinity as HcAbs against a broad range of structurally diverse antigens have been reported. The recombinant form of their variable domain [nanobody (Nb] has outstanding properties that make Nbs, not just an alternative option to conventional antibodies, but in many cases, these properties allow them to reach analytical or diagnostic performances that cannot be accomplished with conventional antibodies. These attributes include comprehensive representation of the immune specificity in display libraries, easy adaptation to high-throughput screening, exceptional stability, minimal size, and versatility as affinity building block. Here, we critically reviewed each of these properties and highlight their relevance with regard to recent developments in different fields of immunosensing applications.
Directory of Open Access Journals (Sweden)
Béatrice Marquèze-Pouey
Full Text Available Signaling mediated by the epidermal growth factor (EGF is crucial in tissue development, homeostasis and tumorigenesis. EGF is mitogenic at picomolar concentrations and is known to bind its receptor on high affinity binding sites depending of the oligomerization state of the receptor (monomer or dimer. In spite of these observations, the cellular response induced by EGF has been mainly characterized for nanomolar concentrations of the growth factor, and a clear definition of the cellular response to circulating (picomolar concentrations is still lacking. We investigated Ca2+ signaling, an early event in EGF responses, in response to picomolar doses in COS-7 cells where the monomer/dimer equilibrium is unaltered by the synthesis of exogenous EGFR. Using the fluo5F Ca2+ indicator, we found that picomolar concentrations of EGF induced in 50% of the cells a robust oscillatory Ca2+ signal quantitatively similar to the Ca2+ signal induced by nanomolar concentrations. However, responses to nanomolar and picomolar concentrations differed in their underlying mechanisms as the picomolar EGF response involved essentially plasma membrane Ca2+ channels that are not activated by internal Ca2+ store depletion, while the nanomolar EGF response involved internal Ca2+ release. Moreover, while the picomolar EGF response was modulated by charybdotoxin-sensitive K+ channels, the nanomolar response was insensitive to the blockade of these ion channels.
Marquèze-Pouey, Béatrice; Mailfert, Sébastien; Rouger, Vincent; Goaillard, Jean-Marc; Marguet, Didier
2014-01-01
Signaling mediated by the epidermal growth factor (EGF) is crucial in tissue development, homeostasis and tumorigenesis. EGF is mitogenic at picomolar concentrations and is known to bind its receptor on high affinity binding sites depending of the oligomerization state of the receptor (monomer or dimer). In spite of these observations, the cellular response induced by EGF has been mainly characterized for nanomolar concentrations of the growth factor, and a clear definition of the cellular response to circulating (picomolar) concentrations is still lacking. We investigated Ca2+ signaling, an early event in EGF responses, in response to picomolar doses in COS-7 cells where the monomer/dimer equilibrium is unaltered by the synthesis of exogenous EGFR. Using the fluo5F Ca2+ indicator, we found that picomolar concentrations of EGF induced in 50% of the cells a robust oscillatory Ca2+ signal quantitatively similar to the Ca2+ signal induced by nanomolar concentrations. However, responses to nanomolar and picomolar concentrations differed in their underlying mechanisms as the picomolar EGF response involved essentially plasma membrane Ca2+ channels that are not activated by internal Ca2+ store depletion, while the nanomolar EGF response involved internal Ca2+ release. Moreover, while the picomolar EGF response was modulated by charybdotoxin-sensitive K+ channels, the nanomolar response was insensitive to the blockade of these ion channels.
International Nuclear Information System (INIS)
Sakakibara, H.; Shima, K.; Takamatsu, J.; Said, S.I.
1990-01-01
VIP binds to specific receptors on lymphocytes and mononuclear cells and exhibits antiinflammatory properties. Eosinophils (Eos) contribute to inflammatory reactions but the regulation of Eos function is incompletely understood. The authors examined the binding of monoradioiodinated VIP, [Tyr( 125 I) 10 ] VIP ( 125 I-VIP), to Eos in guinea pigs. The interaction of 125 i-VIP with Eos was rapid, reversible, saturable and linearly dependent on the number of cells. At equilibrium the binding was competitively inhibited by native peptide or by the related peptide helodermin. Scatchard analysis suggested the presence of a single class of VIP binding sites with a low affinity and a high capacity. In the presence of isobutyl-methylxanthine, VIP, PHI or helodermin did not stimulate cyclic AMP accumulation in intact Eos, while PGE 2 or 1-isoproterenol did. VIP also did not inhibit superoxide anion generation from Eos stimulated by phorbol myristate acetate. The authors conclude that: (1) VIP binds to low-affinity, specific sites on guinea pig peritoneal eosinophils; (2) this binding is not coupled to stimulation of adenylate cyclase; and (3) the possible function of these binding sites is at present unknown
An improved affine projection algorithm for active noise cancellation
Zhang, Congyan; Wang, Mingjiang; Han, Yufei; Sun, Yunzhuo
2017-08-01
Affine projection algorithm is a signal reuse algorithm, and it has a good convergence rate compared to other traditional adaptive filtering algorithm. There are two factors that affect the performance of the algorithm, which are step factor and the projection length. In the paper, we propose a new variable step size affine projection algorithm (VSS-APA). It dynamically changes the step size according to certain rules, so that it can get smaller steady-state error and faster convergence speed. Simulation results can prove that its performance is superior to the traditional affine projection algorithm and in the active noise control (ANC) applications, the new algorithm can get very good results.
Satake diagrams of affine Kac-Moody algebras
Energy Technology Data Exchange (ETDEWEB)
Tripathy, L K [S B R Government Womens' College, Berhampur, Orissa 760 001 (India); Pati, K C [Department of Physics, Khallikote College, Berhampur, Orissa 760 001 (India)
2006-02-10
Satake diagrams of affine Kac-Moody algebras (untwisted and twisted) are obtained from their Dynkin diagrams. These diagrams give a classification of restricted root systems associated with these algebras. In the case of simple Lie algebras, these root systems and Satake diagrams correspond to symmetric spaces which have recently found many physical applications in quantum integrable systems, quantum transport problems, random matrix theories etc. We hope these types of root systems may have similar applications in theoretical physics in future and may correspond to symmetric spaces analogue of affine Kac-Moody algebras if they exist.
International Nuclear Information System (INIS)
Shi Bingzhi; Narayanan, Tanjore K.; Yang, Z.-Y.; Christian, Bradley T.; Mukherjee, Jogeshwar
1999-01-01
We have developed radiotracers based on agonists that may potentially allow the in vivo assessment of the high affinity (HA) state of the dopamine D-2 receptors. The population of HA state, which is likely the functional state of the receptor, may be altered in certain diseases. We carried out radiosyntheses and evaluated the binding affinities, lipophilicity, and in vitro autoradiographic binding characteristics of three dopamine D-2 receptor agonists: (±)-2-(N,N-dipropyl)amino-5-hydroxytetralin (5-OH-DPAT), (±)-2-(N-phenethyl-N-propyl)amino-5-hydroxytetralin (PPHT), and (±)-2-(N-cyclohexylethyl-N-propyl)amino-5-hydroxytetralin (ZYY-339). In 3 H-spiperone assays using rat striata, ZYY-339 exhibited subnanomolar affinity for D-2 receptor sites ( IC 50 =0.010 nM), PPHT was somewhat weaker ( IC 50 =0.65 nM), and 5-OH-DPAT exhibited the weakest affinity ( IC 50 =2.5 nM) of the three compounds. Radiosynthesis of these derivatives, 2-(N-propyl-N-1'- 11 C-propyl)amino-5-hydroxytetralin ( 11 C-5-OH-DPAT), 2-(N-phenethyl-N-1'- 11 C-propyl)amino-5-hydroxytetralin ( 11 C-PPHT), and 2-(N-cyclohexylethyl-N-1'- 11 C-propyl)amino-5-hydroxytetralin ( 11 C-ZYY-339) was achieved by first synthesizing 11 C-1-propionyl chloride and subsequent coupling with the appropriate secondary amine precursor to form the respective amide, which was then reduced to provide the desired tertiary amine products. The final products were obtained by reverse-phase high performance liquid chromatography (HPLC) purification in radiochemical yields of 5-10% after 60-75 min from the end of 11 CO 2 trapping and with specific activities in the range of 250-1,000 Ci/mmol. In vitro autoradiographs in rat brain slices with 11 C-5-OH-DPAT, 11 C-PPHT, and 11 C-ZYY-339 revealed selective binding of the three radiotracers to the dopamine D-2 receptors in the striata
Design of a peptidic turn with high affinity for HgII
DEFF Research Database (Denmark)
Pires, Sara; Habjanic, Jelena; Sezer, Murat
2012-01-01
A four amino acid peptide containing the ß-turn template dPro-Pro in the middle and two cysteines (Cys) in the terminal positions (CdPPC) has been synthesized and its mercury(II) coordination properties studied using different spectroscopic methods. The UV-vis, CD, (199m)Hg PAC, and Raman...... spectroscopic studies indicate the binding of Hg(II) to the two Cys, forming the dithiolatemercury(II) complex Hg(CdPPC). Electrospray ionization mass spectrometry corroborates the 1:1 complex formation. A log K = 40.0 was determined for the formation constant of the Hg(CdPPC) complex using competition...... potentiometric studies. Replacement of the dPro-Pro motif by a Pro-Pro unit generated a peptide (CPPC) capable of forming a similar species [Hg(CPPC)] but showing a lower affinity for Hg(II) (at least 3-3.5 orders of magnitude lower). The introduction of the dPro-Pro motif is crucial to induce the folding...
International Nuclear Information System (INIS)
Haberly, L.B.; Hansen, D.J.; Feig, S.L.; Presto, S.
1987-01-01
GABAergic neurons have been identified in the piriform cortex of the opossum at light and electron microscopic levels by immunocytochemical localization of GABA and the GABA-synthesizing enzyme glutamic acid decarboxylase and by autoradiographic visualization of high-affinity 3 H-GABA uptake. Four major neuron populations have been distinguished on the basis of soma size, shape, and segregation at specific depths and locations: large horizontal cells in layer Ia of the anterior piriform cortex, small globular cells with thin dendrites concentrated in layers Ib and II of the posterior piriform cortex, and multipolar and fusiform cells concentrated in the deep part of layer III in anterior and posterior parts of the piriform cortex and the subjacent endopiriform nucleus. All four populations were well visualized with both antisera, but the large layer Ia horizontal cells displayed only very light 3 H-GABA uptake, thus suggesting a lack of local axon collaterals or lack of high-affinity GABA uptake sites. The large, ultrastructurally distinctive somata of layer Ia horizontal cells receive a very small number of symmetrical synapses; the thin, axonlike dendrites of small globular cells are exclusively postsynaptic and receive large numbers of both symmetrical and asymmetrical synapses, in contrast to somata which receive a small number of both types; and the deep multipolar and fusiform cells receive a highly variable number of symmetrical and asymmetrical synapses on somata and proximal dendrites. Labeled puncta of axon terminal dimensions were found in large numbers in the neuropil surrounding pyramidal cell somata in layer II and in the endopiriform nucleus. Moderately large numbers of labeled puncta were found in layer I at the depth of pyramidal cell apical dendrites with greater numbers in layer Ia at the depth of distal apical segments than in layer Ib
ODE/IM correspondence and Bethe ansatz for affine Toda field equations
Directory of Open Access Journals (Sweden)
Katsushi Ito
2015-07-01
Full Text Available We study the linear problem associated with modified affine Toda field equation for the Langlands dual gˆ∨, where gˆ is an untwisted affine Lie algebra. The connection coefficients for the asymptotic solutions of the linear problem are found to correspond to the Q-functions for g-type quantum integrable models. The ψ-system for the solutions associated with the fundamental representations of g leads to Bethe ansatz equations associated with the affine Lie algebra gˆ. We also study the A2r(2 affine Toda field equation in massless limit in detail and find its Bethe ansatz equations as well as T–Q relations.
DEFF Research Database (Denmark)
Graversen, Jonas Heilskov; Jacobsen, C; Sigurskjold, B W
2000-01-01
-type lectin-like domain of tetranectin, involving Lys-148, Glu-150, and Asp-165, which mediates calcium-sensitive binding to plasminogen kringle 4. Here, we investigate the effect of conservative substitutions of these and a neighboring amino acid residue. Substitution of Thr-149 in tetranectin...... with a tyrosine residue considerably increases the affinity for plasminogen kringle 4, and, in addition, confers affinity for plasminogen kringle 2. As shown by isothermal titration calorimetry analysis, this new interaction is stronger than the binding of wild-type tetranectin to plasminogen kringle 4...
Integrable deformations of affine Toda theories and duality
International Nuclear Information System (INIS)
Fateev, V.A.
1996-01-01
We introduce and study five series of one-parameter families of two-dimensional integrable quantum field theories. These theories have a Lagrangian description in terms of the massive Thirring model coupled with non-simply laced affine Toda theories. Perturbative calculations, analysis of the factorized scattering theory and the Bethe ansatz technique are used to show that these field theories possess the dual representation available for the perturbative analysis in the strong coupling limit. The dual theory can be formulated as the non-linear sigma model with Witten's Euclidean black hole metric (complex sinh-Gordon theory) coupled with non-simply laced affine Toda theories. Lie algebras associated with these ''dual'' Toda theories belong to the dual series of affine algebras but have a smaller rank. The exact relation between coupling constants in the dual theories is conjectured. (orig.)
Sioud, Mouldy; Westby, Phuong; Vasovic, Vlada; Fløisand, Yngvar; Peng, Qian
2018-04-16
mAbs have emerged as a promising strategy for the treatment of cancer. However, in several malignancies, no effective antitumor mAbs are yet available. Identifying therapeutic mAbs that recognize common tumor antigens could render the treatment widely applicable. Here, a human single-chain variable fragment (scFv) antibody library was sequentially affinity selected against a panel of human cancer cell lines and an antibody fragment (named MS5) that bound to solid and blood cancer cells was identified. The MS5 scFv was fused to the human IgG1 Fc domain to generate an antibody (MS5-Fc fusion) that induced antibody-dependent cellular cytotoxicity and phagocytosis of cancer cells by macrophages. In addition, the MS5-Fc antibody bound to primary leukemia cells and induced antibody-dependent cellular cytotoxicity. In the majority of analyzed cancer cells, the MS5-Fc antibody induced cell surface redistribution of the receptor complexes, but not internalization, thus maximizing the accessibility of the IgG1 Fc domain to immune effector cells. In vitro stability studies showed that the MS5-Fc antibody was stable after 6 d of incubation in human serum, retaining ∼60% of its initial intact form. After intravenous injections, the antibody localized into tumor tissues and inhibited the growth of 3 different human tumor xenografts (breast, lymphoma, and leukemia). These antitumor effects were associated with tumor infiltration by macrophages and NK cells. In the Ramos B-cell lymphoma xenograft model, the MS5-Fc antibody exhibited a comparable antitumor effect as rituximab, a chimeric anti-CD20 IgG1 mAb. These results indicate that human antibodies with pan-cancer abilities can be generated from phage display libraries, and that the engineered MS5-Fc antibody could be an attractive agent for further clinical investigation.-Sioud, M., Westby, P., Vasovic, V., Fløisand, Y., Peng, Q. Development of a new high-affinity human antibody with antitumor activity against solid and
2D Affine and Projective Shape Analysis.
Bryner, Darshan; Klassen, Eric; Huiling Le; Srivastava, Anuj
2014-05-01
Current techniques for shape analysis tend to seek invariance to similarity transformations (rotation, translation, and scale), but certain imaging situations require invariance to larger groups, such as affine or projective groups. Here we present a general Riemannian framework for shape analysis of planar objects where metrics and related quantities are invariant to affine and projective groups. Highlighting two possibilities for representing object boundaries-ordered points (or landmarks) and parameterized curves-we study different combinations of these representations (points and curves) and transformations (affine and projective). Specifically, we provide solutions to three out of four situations and develop algorithms for computing geodesics and intrinsic sample statistics, leading up to Gaussian-type statistical models, and classifying test shapes using such models learned from training data. In the case of parameterized curves, we also achieve the desired goal of invariance to re-parameterizations. The geodesics are constructed by particularizing the path-straightening algorithm to geometries of current manifolds and are used, in turn, to compute shape statistics and Gaussian-type shape models. We demonstrate these ideas using a number of examples from shape and activity recognition.
Local uncontrollability for affine control systems with jumps
Treanţă, Savin
2017-09-01
This paper investigates affine control systems with jumps for which the ideal If(g1, …, gm) generated by the drift vector field f in the Lie algebra L(f, g1, …, gm) can be imbedded as a kernel of a linear first-order partial differential equation. It will lead us to uncontrollable affine control systems with jumps for which the corresponding reachable sets are included in explicitly described differentiable manifolds.
Lee, Shir-Ying; Goh, Jia-Hui; Tan, Karen M L; Liu, Te-Chih
2017-05-01
Hb Helsinki [HBB: c.248A>T; β82(EF6)Lys→Met] is a high oxygen affinity hemoglobin (Hb) causing polycythemia, whereas Hb H (β4) disease causes mild to severe chronic hemolytic anemia. The clinical characteristics, gel electrophoresis, capillary electrophoresis (CE) and molecular genotyping of a case of Hb Helsinki coinherited with Hb H disease in an ethnic Malay is described, illustrating the interaction between the β-globin variant and coinheritance of three α gene deletions. The proband was asymptomatic, exhibited microcytosis and a normal with Hb value.
J.F. Sturm; J. Zhang (Shuzhong)
1996-01-01
textabstractIn this paper we introduce a primal-dual affine scaling method. The method uses a search-direction obtained by minimizing the duality gap over a linearly transformed conic section. This direction neither coincides with known primal-dual affine scaling directions (Jansen et al., 1993;
Directory of Open Access Journals (Sweden)
Darwish Ibrahim A
2012-10-01
Full Text Available Abstract Background For therapeutic monitoring and pharmacokinetic studies of lenalidomide (LND, the potent drug for treatment of multiple myeloma (MM, a specific antibody was required for the development of a sensitive immunoassay system for the accurate determination of LND in plasma. Results In this study, a hapten of LND (N-glutaryl-LND was synthesized by introducing the glutaryl moiety, as a spacer, into the primary aromatic amine site of the LND molecular structure. The structure of the hapten (G-LND was confirmed by mass, 1H-NMR, and 13C spectrometric techniques. G-LND was coupled to each of bovine serum albumin (BSA and keyhole limpet hemocyanin (KLH proteins by ethyl-3-(3-dimethylaminopropyl carbodiimide as a coupling reagent. LND-KLH conjugate was used as an immunogen. Four female 2-3 months old New Zealand white rabbits were immunized with an emulsion of LND-KLH with Freund`s adjuvant. The immune response of the rabbits was monitored by direct enzyme-linked immunosorbent assay (ELISA using LND-BSA immobilized onto microwell plates as a solid phase. The rabbit that showed the highest antibody titer and affinity to LND was scarified and its sera were collected. The IgG fraction was isolated and purified by affinity chromatography on protein A column. The specificity of the purified antibody for LND was evaluated by indirect competitive ELISA using dexamethasone as a competitor as it is used with LND in a combination therapy. Conclusions The high affinity of the antibody (IC50 = 10 ng/mL will be useful in the development of an immunoassay system for the determination of plasma LND concentrations. Current research is going to optimize the assay conditions and validate the procedures for the routine application in clinical laboratories.
Darwish, Ibrahim A; Alzoman, Nourh Z; Abuhejail, Reem M; El-Samani, Tilal E
2012-10-26
For therapeutic monitoring and pharmacokinetic studies of lenalidomide (LND), the potent drug for treatment of multiple myeloma (MM), a specific antibody was required for the development of a sensitive immunoassay system for the accurate determination of LND in plasma. In this study, a hapten of LND (N-glutaryl-LND) was synthesized by introducing the glutaryl moiety, as a spacer, into the primary aromatic amine site of the LND molecular structure. The structure of the hapten (G-LND) was confirmed by mass, 1H-NMR, and 13C spectrometric techniques. G-LND was coupled to each of bovine serum albumin (BSA) and keyhole limpet hemocyanin (KLH) proteins by ethyl-3-(3-dimethylaminopropyl) carbodiimide as a coupling reagent. LND-KLH conjugate was used as an immunogen. Four female 2-3 months old New Zealand white rabbits were immunized with an emulsion of LND-KLH with Freund`s adjuvant. The immune response of the rabbits was monitored by direct enzyme-linked immunosorbent assay (ELISA) using LND-BSA immobilized onto microwell plates as a solid phase. The rabbit that showed the highest antibody titer and affinity to LND was scarified and its sera were collected. The IgG fraction was isolated and purified by affinity chromatography on protein A column. The specificity of the purified antibody for LND was evaluated by indirect competitive ELISA using dexamethasone as a competitor as it is used with LND in a combination therapy. The high affinity of the antibody (IC50 = 10 ng/mL) will be useful in the development of an immunoassay system for the determination of plasma LND concentrations. Current research is going to optimize the assay conditions and validate the procedures for the routine application in clinical laboratories.
The topological entropy of iterated piecewise affine maps is uncomputable
Directory of Open Access Journals (Sweden)
Pascal Koiran
2001-12-01
Full Text Available We show that it is impossible to compute (or even to approximate the topological entropy of a continuous piecewise affine function in dimension four. The same result holds for saturated linear functions in unbounded dimension. We ask whether the topological entropy of a piecewise affine function is always a computable real number, and conversely whether every non-negative computable real number can be obtained as the topological entropy of a piecewise affine function. It seems that these two questions are also open for cellular automata.
A high affinity Ca2(+)-ATPase on the surface membrane of Leishmania donovani promastigote
International Nuclear Information System (INIS)
Ghosh, J.; Ray, M.; Sarkar, S.; Bhaduri, A.
1990-01-01
A Ca2(+)-dependent ATP-hydrolytic activity was detected in the crude membrane ghost of the promastigote or vector form of the protozoal parasite Leishmania donovani, the pathogen responsible for kala azar. The Ca2(+)-ATPase was purified to apparent homogeneity after solubilization with deoxycholate. The enzyme consists of two subunits of Mr = 51,000 and 57,000 and has an apparent molecular weight of 215,000 +/- 12,000. The enzyme activity is exclusively dependent on Ca2+, and the pure enzyme can hydrolyze 1.6 mumol of ATP/min/mg of protein. The apparent Km for Ca2+ is 35 nM, which is further reduced to 12 nM in the presence of heterologous calmodulin. The enzyme is sensitive to vanadate, but is insensitive to oligomycin and ouabain. The enzyme is strongly associated with the plasma membrane and has its catalytic site oriented toward the cytoplasmic face. The enzyme spans across the plasma membrane as surface labeling with radioiodine shows considerable radioactivity in the completely purified enzyme. The localization and orientation of this high affinity, calmodulin-sensitive Ca2(+)-ATPase suggest some role of this enzyme in Ca2+ movement in the life cycle of this protozoal parasite
A high affinity Ca2(+)-ATPase on the surface membrane of Leishmania donovani promastigote
Energy Technology Data Exchange (ETDEWEB)
Ghosh, J.; Ray, M.; Sarkar, S.; Bhaduri, A. (Indian Institute of Chemical Biology, Calcutta (India))
1990-07-05
A Ca2(+)-dependent ATP-hydrolytic activity was detected in the crude membrane ghost of the promastigote or vector form of the protozoal parasite Leishmania donovani, the pathogen responsible for kala azar. The Ca2(+)-ATPase was purified to apparent homogeneity after solubilization with deoxycholate. The enzyme consists of two subunits of Mr = 51,000 and 57,000 and has an apparent molecular weight of 215,000 +/- 12,000. The enzyme activity is exclusively dependent on Ca2+, and the pure enzyme can hydrolyze 1.6 mumol of ATP/min/mg of protein. The apparent Km for Ca2+ is 35 nM, which is further reduced to 12 nM in the presence of heterologous calmodulin. The enzyme is sensitive to vanadate, but is insensitive to oligomycin and ouabain. The enzyme is strongly associated with the plasma membrane and has its catalytic site oriented toward the cytoplasmic face. The enzyme spans across the plasma membrane as surface labeling with radioiodine shows considerable radioactivity in the completely purified enzyme. The localization and orientation of this high affinity, calmodulin-sensitive Ca2(+)-ATPase suggest some role of this enzyme in Ca2+ movement in the life cycle of this protozoal parasite.
2018-01-01
Background Visceral hypersensitivity is a common feature of irritable bowel syndrome. Cholinergic system involves in the development of visceral hypersensitivity, and high-affinity choline transporter (CHT1) is of crucial importance in choline uptake system. However, involvement of CHT1 in visceral hypersensitivity remains unknown. The research aimed to study the CHT1 expression in dorsal root ganglions (DRGs) and the role of CHT1 in visceral hypersensitivity. Methods Repetitive water avoidance stress (WAS) was used to induce visceral hypersensitivity in rats. Colorectal distension (CRD) was determined, and the abdominal withdrawal reflex (AWR) and threshold intensity data were recorded to measure the visceral sensitivity. After intraperitoneal injection of hemicholinium-3 (HC-3), the specific inhibitor of CHT1, CRD data were also recorded. The CHT1 expression of DRGs was investigated by Western blotting, immunohistochemistry, and quantitative RT-PCR. Acetylcholine levels in the DRGs were detected by the assay kit. Results Repetitive WAS increased the AWR score of CRD at high distension pressure and decreased the mean threshold of rats. The CHT1 expression and acetylcholine concentration of DRG were significantly increased in WAS rats. After the administration of HC-3, the AWR score in WAS group was significantly increased at higher distension pressure while the threshold intensity was significantly reduced compared to the normal saline group. Acetylcholine concentration was significantly lower than the normal saline rats. Conclusion Our research firstly reports that CHT1 is overexpressed in noninflammatory visceral hypersensitivity, and blockage of CHT1 can enhance the visceral hypersensitivity. CHT1 may play an inhibitory role in visceral hypersensitivity. PMID:29849603
DEFF Research Database (Denmark)
Skjødt, Mette Louise
Yeast surface display is an effective tool for antibody affinity maturation because yeast can be used as an all-in-one workhorse to assemble, display and screen diversified antibody libraries. By employing the natural ability of yeast Saccharomyces cerevisiae to efficiently recombine multiple DNA...... laboratory conditions. A particular emphasis was put on using molecular techniques in conjunction with microenvironmental measurements (O2, pH, irradiance), a combination that is rarely found but provides a much more detailed understanding of “cause and effect” in complex natural systems...
Affinity biosensors: techniques and protocols
National Research Council Canada - National Science Library
Rogers, Kim R; Mulchandani, Ashok
1998-01-01
..., and government to begin or expand their biosensors research. This volume, Methods in Biotechnology vol. 7: Affinity Biosensors: Techniques and Protocols, describes a variety of classical and emerging transduction technologies that have been interfaced to bioaffinity elements (e.g., antibodies and receptors). Some of the reas...
The affine quantum gravity programme
Klauder, J R
2002-01-01
The central principle of affine quantum gravity is securing and maintaining the strict positivity of the matrix left brace g-hat sub a sub b (x)right brace composed of the spatial components of the local metric operator. On spectral grounds, canonical commutation relations are incompatible with this principle, and they must be replaced by noncanonical, affine commutation relations. Due to the partial second-class nature of the quantum gravitational constraints, it is advantageous to use the recently developed projection operator method, which treats all quantum constraints on an equal footing. Using this method, enforcement of regularized versions of the gravitational operator constraints is formulated quite naturally by means of a novel and relatively well-defined functional integral involving only the same set of variables that appears in the usual classical formulation. It is anticipated that skills and insight to study this formulation can be developed by studying special, reduced-variable models that sti...
Affinity resins as new tools for identifying target proteins of ascorbic acid.
Iwaoka, Yuji; Nishino, Kohei; Ishikawa, Takahiro; Ito, Hideyuki; Sawa, Yoshihiro; Tai, Akihiro
2018-02-12
l-Ascorbic acid (AA) has diverse physiological functions, but little is known about the functional mechanisms of AA. In this study, we synthesized two types of affinity resin on which AA is immobilized in a stable form to identify new AA-targeted proteins, which can provide important clues for elucidating unknown functional mechanisms of AA. To our knowledge, an affinity resin on which AA as a ligand is immobilized has not been prepared, because AA is very unstable and rapidly degraded in an aqueous solution. By using the affinity resins, cytochrome c (cyt c) was identified as an AA-targeted protein, and we showed that oxidized cyt c exhibits specific affinity for AA. These results suggest that two kinds of AA-affinity resin can be powerful tools to identify new target proteins of AA.
Mizuno, Daisuke; Head, David; Ikebe, Emi; Nakamasu, Akiko; Kinoshita, Suguru; Peijuan, Zhang; Ando, Shoji
2013-03-01
Forces are generated heterogeneously in living cells and transmitted through cytoskeletal networks that respond highly non-linearly. Here, we carry out high-bandwidth passive microrheology on vimentin networks reconstituted in vitro, and observe the nonlinear mechanical response due to forces propagating from a local source applied by an optical tweezer. Since the applied force is constant, the gel becomes equilibrated and the fluctuation-dissipation theorem can be employed to deduce the viscoelasticity of the local environment from the thermal fluctuations of colloidal probes. Our experiments unequivocally demonstrate the anisotropic stiffening of the cytoskeletal network behind the applied force, with greater stiffening in the parallel direction. Quantitative agreement with an affine continuum model is obtained, but only for the response at certain frequency ~ 10-1000 Hz which separates the high-frequency power law and low-frequency elastic behavior of the network. We argue that the failure of the model at lower frequencies is due to the presence of non-affinity, and observe that zero-frequency changes in particle separation can be fitted when an independently-measured, empirical nonaffinity factor is applied.
Online identification of continuous bimodal and trimodal piecewise affine systems
Le, Q.T.; van den Boom, A.J.J.; Baldi, S.; Rantzer, Anders; Bagterp Jørgensen, John; Stoustrup, Jakob
2016-01-01
This paper investigates the identification of continuous piecewise affine systems in state space form with jointly unknown partition and subsystem matrices. The partition of the system is generated by the so-called centers. By representing continuous piecewise affine systems in the max-form and
Directory of Open Access Journals (Sweden)
Greg Hussack
2017-10-01
Full Text Available ABTAG is a camelid single-domain antibody (sdAb that binds to bovine serum albumin (BSA with low picomolar affinity. In surface plasmon resonance (SPR analyses using BSA surfaces, bound ABTAG can be completely dissociated from the BSA surfaces at low pH, over multiple cycles, without any reduction in the capacity of the BSA surfaces to bind ABTAG. A moderate throughput, SPR-based, antibody screening assay exploiting the unique features of ABTAG is described. Anti-carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6 sdAbs were isolated from a phage-displayed sdAb library derived from the heavy chain antibody repertoire of a llama immunized with CEACAM6. Following one or two rounds of panning, enriched clones were expressed as ABTAG fusions in microtiter plate cultures. The sdAb-ABTAG fusions from culture supernatants were captured on BSA surfaces and CEACAM6 antigen was then bound to the captured molecules. The SPR screening method gives a read-out of relative expression levels of the fusion proteins and kinetic and affinity constants for CEACAM6 binding by the captured molecules. The library was also panned and screened by conventional methods and positive clones were subcloned and expressed for SPR analysis. Compared to conventional panning and screening, the SPR-based ABTAG method yielded a considerably higher diversity of binders, some with affinities that were three orders of magnitude higher affinity than those identified by conventional panning.
Early signs of pathological cognitive aging in mice lacking high-affinity nicotinic receptors.
Directory of Open Access Journals (Sweden)
Eleni eKonsolaki
2016-04-01
Full Text Available In order to address pathological cognitive decline effectively, it is critical to adopt early preventive measures in individuals considered at risk. It is therefore essential to develop approaches that identify such individuals before the onset of irreversible dementia. Α deficient cholinergic system has been consistently implicated as one of the main factors associated with a heightened vulnerability to the aging process. In the present study we used mice lacking high affinity nicotinic receptors (β2-/-, which have been proposed as an animal model of accelerated/premature cognitive aging. Our aim was to identify behavioural signs that could serve as indicators or predictors of impending cognitive decline. We used test batteries in order to assess cognitive functions and additional tasks to investigate spontaneous behaviours, such as species-specific activities and exploration/locomotion in a novel environment. Our data confirm and extend the hypothesis that β2-/- animals exhibit age-related cognitive impairments, manifested in both spatial learning and recognition memory tasks. In addition, we reveal deficits in spontaneous behaviour and habituation processes earlier in life. To our knowledge, this is the first study to perform an extensive behavioural examination of an animal model of premature cognitive aging, and our results suggest that β2-nAChR dependent cognitive deterioration progressively evolves from initial subtle behavioural changes to global dementia due to the combined effect of the neuropathology and aging.
Wang, Xiaolei; Kuwahara, Hiroyuki; Gao, Xin
2014-01-01
high-quality estimates of such complex affinity landscapes is, thus, essential to the control of gene expression and the advance of synthetic biology. Results: Here, we propose a two-round prediction method that is based on support vector regression
The Mobile Phone Affinity Scale: Enhancement and Refinement
Rosen, Rochelle K
2016-01-01
Background Existing instruments that assess individuals’ relationships with mobile phones tend to focus on negative constructs such as addiction or dependence, and appear to assume that high mobile phone use reflects pathology. Mobile phones can be beneficial for health behavior change, disease management, work productivity, and social connections, so there is a need for an instrument that provides a more balanced assessment of the various aspects of individuals’ relationships with mobile phones. Objective The purpose of this research was to develop, revise, and validate the Mobile Phone Affinity Scale, a multi-scale instrument designed to assess key factors associated with mobile phone use. Methods Participants (N=1058, mean age 33) were recruited from Amazon Mechanical Turk between March and April of 2016 to complete a survey that assessed participants’ mobile phone attitudes and use, anxious and depressive symptoms, and resilience. Results Confirmatory factor analysis supported a 6-factor model. The final measure consisted of 24 items, with 4 items on each of 6 factors: Connectedness, Productivity, Empowerment, Anxious Attachment, Addiction, and Continuous Use. The subscales demonstrated strong internal consistency (Cronbach alpha range=0.76-0.88, mean 0.83), and high item factor loadings (range=0.57-0.87, mean 0.75). Tests for validity further demonstrated support for the individual subscales. Conclusions Mobile phone affinity may have an important impact in the development and effectiveness of mobile health interventions, and continued research is needed to assess its predictive ability in health behavior change interventions delivered via mobile phones. PMID:27979792
Directory of Open Access Journals (Sweden)
Ramon Wahl
2010-02-01
Full Text Available Plant pathogenic fungi cause massive yield losses and affect both quality and safety of food and feed produced from infected plants. The main objective of plant pathogenic fungi is to get access to the organic carbon sources of their carbon-autotrophic hosts. However, the chemical nature of the carbon source(s and the mode of uptake are largely unknown. Here, we present a novel, plasma membrane-localized sucrose transporter (Srt1 from the corn smut fungus Ustilago maydis and its characterization as a fungal virulence factor. Srt1 has an unusually high substrate affinity, is absolutely sucrose specific, and allows the direct utilization of sucrose at the plant/fungal interface without extracellular hydrolysis and, thus, without the production of extracellular monosaccharides known to elicit plant immune responses. srt1 is expressed exclusively during infection, and its deletion strongly reduces fungal virulence. This emphasizes the central role of this protein both for efficient carbon supply and for avoidance of apoplastic signals potentially recognized by the host.
Affinity of Iresine herbstii and Brugmansia arborea extracts on different cerebral receptors.
Nencini, Cristina; Cavallo, Federica; Bruni, Giancarlo; Capasso, Anna; De Feo, Vincenzo; De Martino, Laura; Giorgi, Giorgio; Micheli, Lucia
2006-05-24
Iresine herbstii Hook. (Amaranthaceae) and Brugmansia arborea (L.) Lagerheim (Solanaceae) are used in the northern Peruvian Andes for magic-therapeutical purposes. The traditional healers use Iresine herbstii with the ritual aim to expel bad spirits from the body. Furthermore, Iresine herbstii was used in association with other plants, such as Trichocereus pachanoi Britt. et Rose, for divination, to diagnose diseases, and to take possession of another identity. Also, species of Brugmansia have been reported to be used during ritual practices for magical and curative purposes. Given the above evidence, the aim of the present study is to evaluate if the central effects of Iresine herbstii and Brugmansia arborea could be associated with interaction with SNC receptors. Two Iresine herbstii extracts (methanolic and aqueous) and one Brugmansia arborea aqueous extract were tested for in vitro affinity on 5-HT(1A), 5-HT(2A), 5-HT(2C), D1, D2, alpha(1), and alpha(2) receptors by radioligand binding assays. The biological materials for binding assay (cerebral cortex) were taken from male Sprague-Dawley rats. The extracts affinity for receptors is definite as inhibition percentage of radioligand/receptor binding and measured as the radioactivity of remaining complex radioligand/receptor. The data obtained for Iresine extracts have shown a low affinity for the 5-HT(1A) receptor and no affinity for 5-HT(2A) receptor. Otherwise the methanolic extract showed affinity for 5-HT(2C) receptor (IC(50): 34.78 microg/ml) and for D1 receptor (IC(50): 19.63 microg/ml), instead the Iresine aqueous extract displayed a lower affinity for D1 (48.3% at the maximum concentration tested) and a higher value of affinity for D2 receptors (IC(50): 32.08 microg/ml). The Brugmansia aqueous extract displayed affinity for D1 receptors (IC(50): 17.68 microg/ml), D2 receptors (IC(50): 15.95 microg/ml) and weak affinity for the serotoninergic receptors. None of the three extracts showed relevant affinity
Agonist-induced affinity alterations of a central nervous system. cap alpha. -bungarotoxin receptor
Energy Technology Data Exchange (ETDEWEB)
Lukas, R.J.; Bennett, E.L.
1979-01-01
The ability of cholinergic agonists to block the specific interaction of ..cap alpha..-bungarotoxin (..cap alpha..-Bgt) with membrane-bound sites derived from rat brain is enhanced when membranes are preincubated with agonist. Thus, pretreatment of ..cap alpha..-Bgt receptors with agonist (but not antagonist) causes transformation of sites to a high-affinity form toward agonist. This change in receptor state occurs with a half-time on the order of minutes, and is fully reversible on dilution of agonist. The results are consistent with the identity of ..cap alpha..-Bgt binding sites as true central nicotinic acetylcholine receptors. Furthermore, this agonist-induced alteration in receptor state may represent an in vitro correlate of physiological desensitization. As determined from the effects of agonist on toxin binding isotherms, and on the rate of toxin binding to specific sites, agonist inhibition of toxin binding to the high-affinity state is non-competitive. This result suggests that there may exist discrete toxin-binding and agonist-binding sites on central toxin receptors.
Directory of Open Access Journals (Sweden)
Wulf-Dieter Christian Krenz
2013-10-01
Full Text Available Neuromodulators alter network output and have the potential to destabilize a circuit. The mechanisms maintaining stability in the face of neuromodulation are not well described. Using the pyloric network in the crustacean stomatogastric nervous system, we show that dopamine (DA does not simply alter circuit output, but activates a closed loop in which DA-induced alterations in circuit output consequently drive a change in an ionic conductance to preserve a conductance ratio and its activity correlate. DA acted at low affinity type 1 receptors (D1Rs to induce an immediate modulatory decrease in the transient potassium current (IA of a pyloric neuron. This, in turn, advanced the activity phase of that component neuron, which disrupted its network function and thereby destabilized the circuit. DA simultaneously acted at high affinity D1Rs on the same neuron to confer activity-dependence upon the hyperpolarization activated current (Ih such that the DA-induced changes in activity subsequently reduced Ih. This DA-enabled, activity-dependent, intrinsic plasticity exactly compensated for the modulatory decrease in IA to restore the IA:Ih ratio and neuronal activity phase, thereby closing an open loop created by the modulator. Activation of closed loops to preserve conductance ratios may represent a fundamental operating principle neuromodulatory systems use to ensure stability in their target networks.
Biochemical method for fast affinity diagnosis in grape-vine transplantation
International Nuclear Information System (INIS)
Lilov, D.
1977-01-01
Long term experiments have proved the affinity of cv. Mavroud in transplantations on various root stocks. Best affinity was observed in the combination cv. Mavroud X Riparia tomanteau, followed, in a descending order, by the combinations Mavroud X Mavroud (autotransplantation), Mavroud X Berlandieri X Riparia Kobber SBB and Mavroud X Riparia 33 EM. In view to establish indices for predicting the transplantation affinity a great number of physiological-biochemical and morphological-anatomical studies were carried out. The results obtained showed that a most clearly expressed positive, statistically significant correlation exists between the amount of 15 N transported from the root stock to the scions, shoots and leaves. As a result, a biochemical method for fast affinity diagnosis in grape-vine transplantation has been developed. The reliability of the method has been checked up also with other cultivars. Up to the present no such method was known in grape-vine science and practice. (author)
Methods for quantifying T cell receptor binding affinities and thermodynamics
Piepenbrink, Kurt H.; Gloor, Brian E.; Armstrong, Kathryn M.; Baker, Brian M.
2013-01-01
αβ T cell receptors (TCRs) recognize peptide antigens bound and presented by class I or class II major histocompatibility complex (MHC) proteins. Recognition of a peptide/MHC complex is required for initiation and propagation of a cellular immune response, as well as the development and maintenance of the T cell repertoire. Here we discuss methods to quantify the affinities and thermodynamics of interactions between soluble ectodomains of TCRs and their peptide/MHC ligands, focusing on titration calorimetry, surface plasmon resonance, and fluorescence anisotropy. As TCRs typically bind ligand with weak-to-moderate affinities, we focus the discussion on means to enhance the accuracy and precision of low affinity measurements. In addition to further elucidating the biology of the T cell mediated immune response, more reliable low affinity measurements will aid with more probing studies with mutants or altered peptides that can help illuminate the physical underpinnings of how TCRs achieve their remarkable recognition properties. PMID:21609868
Targeting Anti-Cancer Active Compounds: Affinity-Based Chromatographic Assays
de Moraes, Marcela Cristina; Cardoso, Carmen Lucia; Seidl, Claudia; Moaddel, Ruin; Cass, Quezia Bezerra
2016-01-01
Affinity-based chromatography assays encompass the use of solid supports containing immobilized biological targets to monitor binding events in the isolation , identification and/or characterization of bioactive compounds. This powerful bioanalytical technique allows the screening of potential binders through fast analyses that can be directly performed using isolated substances or complex matrices. An overview of the recent researches in frontal and zonal affinity-based chromatography screen...
Quantum image encryption based on generalized affine transform and logistic map
Liang, Hao-Ran; Tao, Xiang-Yang; Zhou, Nan-Run
2016-07-01
Quantum circuits of the generalized affine transform are devised based on the novel enhanced quantum representation of digital images. A novel quantum image encryption algorithm combining the generalized affine transform with logistic map is suggested. The gray-level information of the quantum image is encrypted by the XOR operation with a key generator controlled by the logistic map, while the position information of the quantum image is encoded by the generalized affine transform. The encryption keys include the independent control parameters used in the generalized affine transform and the logistic map. Thus, the key space is large enough to frustrate the possible brute-force attack. Numerical simulations and analyses indicate that the proposed algorithm is realizable, robust and has a better performance than its classical counterpart in terms of computational complexity.
Enhancing Community Detection By Affinity-based Edge Weighting Scheme
Energy Technology Data Exchange (ETDEWEB)
Yoo, Andy [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Sanders, Geoffrey [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Henson, Van [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Vassilevski, Panayot [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)
2015-10-05
Community detection refers to an important graph analytics problem of finding a set of densely-connected subgraphs in a graph and has gained a great deal of interest recently. The performance of current community detection algorithms is limited by an inherent constraint of unweighted graphs that offer very little information on their internal community structures. In this paper, we propose a new scheme to address this issue that weights the edges in a given graph based on recently proposed vertex affinity. The vertex affinity quantifies the proximity between two vertices in terms of their clustering strength, and therefore, it is ideal for graph analytics applications such as community detection. We also demonstrate that the affinity-based edge weighting scheme can improve the performance of community detection algorithms significantly.
Directory of Open Access Journals (Sweden)
Wei Shi
2014-12-01
Full Text Available Clonal population expansion of T cells during an immune response is dependent on the affinity of the T cell receptor (TCR for its antigen [1]. However, there is little understanding of how this process is controlled transcriptionally. We found that the transcription factor IRF4 was induced in a manner dependent on TCR-affinity and was critical for the clonal expansion and maintenance of effector function of antigen-specific CD8+ T cells. We performed a genome-wide expression profiling experiment using RNA sequencing technology (RNA-seq to interrogate global expression changes when IRF4 was deleted in CD8+ T cells activated with either a low or high affinity peptide ligand. This allowed us not only to determine IRF4-dependent transcriptional changes but also to identify transcripts dependent on TCR-affinity [2]. Here we describe in detail the analyses of the RNA-seq data, including quality control, read mapping, quantification, normalization and assessment of differential gene expression. The RNA-seq data can be accessed from Gene Expression Omnibus database (accession number GSE49929.
Molecular basis for the wide range of affinity found in Csr/Rsm protein-RNA recognition.
Duss, Olivier; Michel, Erich; Diarra dit Konté, Nana; Schubert, Mario; Allain, Frédéric H-T
2014-04-01
The carbon storage regulator/regulator of secondary metabolism (Csr/Rsm) type of small non-coding RNAs (sRNAs) is widespread throughout bacteria and acts by sequestering the global translation repressor protein CsrA/RsmE from the ribosome binding site of a subset of mRNAs. Although we have previously described the molecular basis of a high affinity RNA target bound to RsmE, it remains unknown how other lower affinity targets are recognized by the same protein. Here, we have determined the nuclear magnetic resonance solution structures of five separate GGA binding motifs of the sRNA RsmZ of Pseudomonas fluorescens in complex with RsmE. The structures explain how the variation of sequence and structural context of the GGA binding motifs modulate the binding affinity for RsmE by five orders of magnitude (∼10 nM to ∼3 mM, Kd). Furthermore, we see that conformational adaptation of protein side-chains and RNA enable recognition of different RNA sequences by the same protein contributing to binding affinity without conferring specificity. Overall, our findings illustrate how the variability in the Csr/Rsm protein-RNA recognition allows a fine-tuning of the competition between mRNAs and sRNAs for the CsrA/RsmE protein.
Non-affine fields in solid-solid transformations: the structure and stability of a product droplet.
Paul, Arya; Sengupta, Surajit; Rao, Madan
2014-01-08
We describe the microstructure, morphology, and dynamics of growth of a droplet of martensite nucleating in a parent austenite during a solid-solid transformation, using a Landau theory written in terms of both conventional affine elastic deformations and non-affine deformations. Non-affineness, φ, serves as a source of strain incompatibility and screens long-ranged elastic interactions. It is produced wherever the local stress exceeds a threshold and anneals diffusively thereafter. Using a variational calculation, we find three types of stable solution (labeled I, II, and III) for the structure of the product droplet, depending on the stress threshold and the scaled mobilities of φ parallel and perpendicular to the parent-product interface. The profile of the non-affine field φ is different in these three solutions: I is characterized by a vanishingly small φ, II admits large values of φ localized in regions of high stress within the parent-product interface, and III is a structure in which φ completely wets the parent-product interface. The width l and size W of the twins follow the relation l is proportional to √W in solution I; this relation does not hold for II or III. We obtain a dynamical phase diagram featuring these solutions, and argue that they represent specific solid-state microstructures.
Immobilizing affinity proteins to nitrocellulose: a toolbox for paper-based assay developers.
Holstein, Carly A; Chevalier, Aaron; Bennett, Steven; Anderson, Caitlin E; Keniston, Karen; Olsen, Cathryn; Li, Bing; Bales, Brian; Moore, David R; Fu, Elain; Baker, David; Yager, Paul
2016-02-01
To enable enhanced paper-based diagnostics with improved detection capabilities, new methods are needed to immobilize affinity reagents to porous substrates, especially for capture molecules other than IgG. To this end, we have developed and characterized three novel methods for immobilizing protein-based affinity reagents to nitrocellulose membranes. We have demonstrated these methods using recombinant affinity proteins for the influenza surface protein hemagglutinin, leveraging the customizability of these recombinant "flu binders" for the design of features for immobilization. The three approaches shown are: (1) covalent attachment of thiolated affinity protein to an epoxide-functionalized nitrocellulose membrane, (2) attachment of biotinylated affinity protein through a nitrocellulose-binding streptavidin anchor protein, and (3) fusion of affinity protein to a novel nitrocellulose-binding anchor protein for direct coupling and immobilization. We also characterized the use of direct adsorption for the flu binders, as a point of comparison and motivation for these novel methods. Finally, we demonstrated that these novel methods can provide improved performance to an influenza hemagglutinin assay, compared to a traditional antibody-based capture system. Taken together, this work advances the toolkit available for the development of next-generation paper-based diagnostics.
Directory of Open Access Journals (Sweden)
Chen Zhao
2018-01-01
Full Text Available Background. Visceral hypersensitivity is a common feature of irritable bowel syndrome. Cholinergic system involves in the development of visceral hypersensitivity, and high-affinity choline transporter (CHT1 is of crucial importance in choline uptake system. However, involvement of CHT1 in visceral hypersensitivity remains unknown. The research aimed to study the CHT1 expression in dorsal root ganglions (DRGs and the role of CHT1 in visceral hypersensitivity. Methods. Repetitive water avoidance stress (WAS was used to induce visceral hypersensitivity in rats. Colorectal distension (CRD was determined, and the abdominal withdrawal reflex (AWR and threshold intensity data were recorded to measure the visceral sensitivity. After intraperitoneal injection of hemicholinium-3 (HC-3, the specific inhibitor of CHT1, CRD data were also recorded. The CHT1 expression of DRGs was investigated by Western blotting, immunohistochemistry, and quantitative RT-PCR. Acetylcholine levels in the DRGs were detected by the assay kit. Results. Repetitive WAS increased the AWR score of CRD at high distension pressure and decreased the mean threshold of rats. The CHT1 expression and acetylcholine concentration of DRG were significantly increased in WAS rats. After the administration of HC-3, the AWR score in WAS group was significantly increased at higher distension pressure while the threshold intensity was significantly reduced compared to the normal saline group. Acetylcholine concentration was significantly lower than the normal saline rats. Conclusion. Our research firstly reports that CHT1 is overexpressed in noninflammatory visceral hypersensitivity, and blockage of CHT1 can enhance the visceral hypersensitivity. CHT1 may play an inhibitory role in visceral hypersensitivity.
Directory of Open Access Journals (Sweden)
Tanusree Sengupta
Full Text Available Protein Z (PZ is an anticoagulant that binds with high affinity to Protein Z-dependent protease inhibitor (ZPI and accelerates the rate of ZPI-mediated inhibition of factor Xa (fXa by more than 1000-fold in the presence of Ca2+ and phospholipids. PZ promotion of the ZPI-fXa interaction results from the anchoring of the Gla domain of PZ onto phospholipid surfaces and positioning the bound ZPI in close proximity to the Gla-anchored fXa, forming a ternary complex of PZ/ZPI/fXa. Although interaction of PZ with phospholipid membrane appears to be absolutely crucial for its cofactor activity, little is known about the binding of different phospholipids to PZ. The present study was conceived to understand the interaction of different phospholipids with PZ. Experiments with both soluble lipids and model membranes revealed that PZ binds to phosphatidylserine (PS and phosphatidylethanolamine (PE with equal affinity (Kd~48 μM; further, PS and PE bound to PZ synergistically. Equilibrium dialysis experiments revealed two lipid-binding sites for both PS and PE. PZ binds with weaker affinity to other phospholipids, e.g., phosphatidic acid, phosphatidylglycerol, phosphatidylcholine and binding of these lipids is not synergistic with respect to PS. Both PS and PE -containing membranes supported the formation of a fXa-PZ complex. PZ protection of fXa from antithrombin inhibition were also shown to be comparable in presence of both PS: PC and PE: PC membranes. These findings are particularly important and intriguing since they suggest a special affinity of PZ, in vivo, towards activated platelets, the primary membrane involved in blood coagulation process.
Affinity of antibody secreted by a single cell
International Nuclear Information System (INIS)
Doran, D.M.
1978-01-01
It was the intention of this research to measure the affinity of antibody secreted by a single cell, and to describe the spectrum of affinities displayed in response to antigenic stimulation. The single cell secreting specific antibody was isolated by means of the hemolytic plaque assay. The amount of antibody secreted by the cell was to be measured through the use of a solid phase radioimmunoassay. The affinity of the antibody would be estimated by comparing the diameter of the plaque, and the amount of antibody secreted, with a mathematical theory of the formation of a plaque in agar. As a test system, a solid phase radioimmunoassay was developed for human serum albumin using antibody coupled to Sephadex. A sensitivity of 1 nanogram was attained with this assay. A solid phase radioimmunoassay for mouse immunoglobulin M was developed, using antibody coupled to Sepharose. The sensitivity attained with this assay was only on the order of 10 micrograms. The mouse immunoglobulin M radioimmunoassay was not sensitive enough to measure the amount of antibody secreted by a single cell. From a theoretical equation, the relationship between antibody affinity, plaque diameter and antibody secretion rate was calculated for the experimental conditions used in this research. By assuming a constant antibody secretion rate, an effective binding constant for the antibody was estimated from the average plaque diameters. This effective binding constant was observed to increase during the immune response
DEFF Research Database (Denmark)
Engholm-Keller, Kasper; Larsen, Martin R
2011-01-01
biomolecules due to its unique ion and ligand exchange properties and high stability towards pH and temperature. Recently, titanium dioxide chromatography was introduced in proteomics as a highly specific method for enriching phosphorylated peptides - a method, which has been widely adapted by the field...... matrices for further characterization is affinity chromatography, which relies on the specific interaction between an analyte in solution and a solid adsorbent. Titanium dioxide-based affinity chromatography has proven to be a versatile tool in enrichment of various compounds such as phosphorylated....... The development of TiO(2)-based chromatographic strategies for separation of various biomolecules from its introduction for small molecules more than 20years ago until recent proteomics applications today will be reviewed here....
Effect of 2,3-diphosphoglycerate on oxygen affinity of blood in sickle cell anemia
Charache, Samuel; Grisolia, Santiago; Fiedler, Adam J.; Hellegers, Andre E.
1970-01-01
Blood of patients with sickle cell anemia (SS) exhibits decreased affinity for oxygen, although the oxygen affinity of hemoglobin S is the same as that of hemoglobin A. SS red cells contain more 2,3-diphosphoglycerate (DPG) than normal erythrocytes. The oxygen affinity of hemolyzed red cells is decreased by added DPG, and hemolysates prepared from SS red cells do not differ from normal hemolysates in this regard. Reduction of oxygen affinity to the levels found in intact SS red cells required DPG concentrations in excess of those found in most SS patients. The same was true of oxygen affinity of patients with pyruvate kinase deficiency. Other organic phosphates, as well as inorganic ions, are known to alter the oxygen affinity of dilute solutions of hemoglobin. These substances, the state of aggregation of hemoglobin molecules, and cytoarchitectural factors probably play roles in determining oxygen affinity of both normal and SS red cells. PMID:5443181
Relationship of nonreturn rates of dairy bulls to binding affinity of heparin to sperm
International Nuclear Information System (INIS)
Marks, J.L.; Ax, R.L.
1985-01-01
The binding of the glycosaminoglycan [ 3 H] heparin to bull spermatozoa was compared with nonreturn rates of dairy bulls. Semen samples from five bulls above and five below an average 71% nonreturn rate were used. Samples consisted of first and second ejaculates on a single day collected 1 d/wk for up to 5 consecutive wk. Saturation binding assays using [ 3 H] heparin were performed to quantitate the binding characteristics of each sample. Scatchard plot analyses indicated a significant difference in the binding affinity for [ 3 H] heparin between bulls of high and low fertility. Dissociation constants were 69.0 and 119.3 pmol for bulls of high and low fertility, respectively. In contrast, the number of binding sites for [ 3 H] heparin did not differ significantly among bulls. Differences in binding affinity of [ 3 H] heparin to bull sperm might be used to predict relative fertility of dairy bulls
On the Lp affine isoperimetric inequalities
Indian Academy of Sciences (India)
surface area measure on convex bodies. We also establish the reverse version of -Petty projection inequality and an affine isoperimetric inequality of − p K . Author Affiliations. Wuyang Yu1 Gangsong Leng2. Institute of Management Decision ...
Fc-Binding Ligands of Immunoglobulin G: An Overview of High Affinity Proteins and Peptides
Directory of Open Access Journals (Sweden)
Weonu Choe
2016-12-01
Full Text Available The rapidly increasing application of antibodies has inspired the development of several novel methods to isolate and target antibodies using smart biomaterials that mimic the binding of Fc-receptors to antibodies. The Fc-binding domain of antibodies is the primary binding site for e.g., effector proteins and secondary antibodies, whereas antigens bind to the Fab region. Protein A, G, and L, surface proteins expressed by pathogenic bacteria, are well known to bind immunoglobulin and have been widely exploited in antibody purification strategies. Several difficulties are encountered when bacterial proteins are used in antibody research and application. One of the major obstacles hampering the use of bacterial proteins is sample contamination with trace amounts of these proteins, which can invoke an immune response in the host. Many research groups actively develop synthetic ligands that are able to selectively and strongly bind to antibodies. Among the reported ligands, peptides that bind to the Fc-domain of antibodies are attractive tools in antibody research. Besides their use as high affinity ligands in antibody purification chromatography, Fc-binding peptides are applied e.g., to localize antibodies on nanomaterials and to increase the half-life of proteins in serum. In this review, recent developments of Fc-binding peptides are presented and their binding characteristics and diverse applications are discussed.
Humic Acid Confers HIGH-AFFINITY K+ TRANSPORTER 1-Mediated Salinity Stress Tolerance in Arabidopsis.
Khaleda, Laila; Park, Hee Jin; Yun, Dae-Jin; Jeon, Jong-Rok; Kim, Min Gab; Cha, Joon-Yung; Kim, Woe-Yeon
2017-12-31
Excessive salt disrupts intracellular ion homeostasis and inhibits plant growth, which poses a serious threat to global food security. Plants have adapted various strategies to survive in unfavorable saline soil conditions. Here, we show that humic acid (HA) is a good soil amendment that can be used to help overcome salinity stress because it markedly reduces the adverse effects of salinity on Arabidopsis thaliana seedlings. To identify the molecular mechanisms of HA-induced salt stress tolerance in Arabidopsis, we examined possible roles of a sodium influx transporter HIGH-AFFINITY K+ TRANSPORTER 1 (HKT1). Salt-induced root growth inhibition in HKT1 overexpressor transgenic plants (HKT1-OX) was rescued by application of HA, but not in wild-type and other plants. Moreover, salt-induced degradation of HKT1 protein was blocked by HA treatment. In addition, the application of HA to HKT1-OX seedlings led to increased distribution of Na+ in roots up to the elongation zone and caused the reabsorption of Na+ by xylem and parenchyma cells. Both the influx of the secondary messenger calcium and its cytosolic release appear to function in the destabilization of HKT1 protein under salt stress. Taken together, these results suggest that HA could be applied to the field to enhance plant growth and salt stress tolerance via post-transcriptional control of the HKT1 transporter gene under saline conditions.
The affinity purification and characterization of ATP synthase complexes from mitochondria.
Runswick, Michael J; Bason, John V; Montgomery, Martin G; Robinson, Graham C; Fearnley, Ian M; Walker, John E
2013-02-13
The mitochondrial F₁-ATPase inhibitor protein, IF₁, inhibits the hydrolytic, but not the synthetic activity of the F-ATP synthase, and requires the hydrolysis of ATP to form the inhibited complex. In this complex, the α-helical inhibitory region of the bound IF₁ occupies a deep cleft in one of the three catalytic interfaces of the enzyme. Its N-terminal region penetrates into the central aqueous cavity of the enzyme and interacts with the γ-subunit in the enzyme's rotor. The intricacy of forming this complex and the binding mode of the inhibitor endow IF₁ with high specificity. This property has been exploited in the development of a highly selective affinity procedure for purifying the intact F-ATP synthase complex from mitochondria in a single chromatographic step by using inhibitor proteins with a C-terminal affinity tag. The inhibited complex was recovered with residues 1-60 of bovine IF₁ with a C-terminal green fluorescent protein followed by a His-tag, and the active enzyme with the same inhibitor with a C-terminal glutathione-S-transferase domain. The wide applicability of the procedure has been demonstrated by purifying the enzyme complex from bovine, ovine, porcine and yeast mitochondria. The subunit compositions of these complexes have been characterized. The catalytic properties of the bovine enzyme have been studied in detail. Its hydrolytic activity is sensitive to inhibition by oligomycin, and the enzyme is capable of synthesizing ATP in vesicles in which the proton-motive force is generated from light by bacteriorhodopsin. The coupled enzyme has been compared by limited trypsinolysis with uncoupled enzyme prepared by affinity chromatography. In the uncoupled enzyme, subunits of the enzyme's stator are degraded more rapidly than in the coupled enzyme, indicating that uncoupling involves significant structural changes in the stator region.
Highly Efficient Estimators of Multivariate Location with High Breakdown Point
Lopuhaa, H.P.
1991-01-01
We propose an affine equivariant estimator of multivariate location that combines a high breakdown point and a bounded influence function with high asymptotic efficiency. This proposal is basically a location $M$-estimator based on the observations obtained after scaling with an affine equivariant
Differential affinity of mammalian histone H1 somatic subtypes for DNA and chromatin
Directory of Open Access Journals (Sweden)
Mora Xavier
2007-05-01
Full Text Available Abstract Background Histone H1 is involved in the formation and maintenance of chromatin higher order structure. H1 has multiple isoforms; the subtypes differ in timing of expression, extent of phosphorylation and turnover rate. In vertebrates, the amino acid substitution rates differ among subtypes by almost one order of magnitude, suggesting that each subtype might have acquired a unique function. We have devised a competitive assay to estimate the relative binding affinities of histone H1 mammalian somatic subtypes H1a-e and H1° for long chromatin fragments (30–35 nucleosomes in physiological salt (0.14 M NaCl at constant stoichiometry. Results The H1 complement of native chromatin was perturbed by adding an additional amount of one of the subtypes. A certain amount of SAR (scaffold-associated region DNA was present in the mixture to avoid precipitation of chromatin by excess H1. SAR DNA also provided a set of reference relative affinities, which were needed to estimate the relative affinities of the subtypes for chromatin from the distribution of the subtypes between the SAR and the chromatin. The amounts of chromatin, SAR and additional H1 were adjusted so as to keep the stoichiometry of perturbed chromatin similar to that of native chromatin. H1 molecules freely exchanged between the chromatin and SAR binding sites. In conditions of free exchange, H1a was the subtype of lowest affinity, H1b and H1c had intermediate affinities and H1d, H1e and H1° the highest affinities. Subtype affinities for chromatin differed by up to 19-fold. The relative affinities of the subtypes for chromatin were equivalent to those estimated for a SAR DNA fragment and a pUC19 fragment of similar length. Avian H5 had an affinity ~12-fold higher than H1e for both DNA and chromatin. Conclusion H1 subtypes freely exchange in vitro between chromatin binding sites in physiological salt (0.14 M NaCl. The large differences in relative affinity of the H1 subtypes for
Affinity-based screening of combinatorial libraries using automated, serial-column chromatography
Energy Technology Data Exchange (ETDEWEB)
Evans, D.M.; Williams, K.P.; McGuinness, B. [PerSeptive Biosystems, Framingham, MA (United States)] [and others
1996-04-01
The authors have developed an automated serial chromatographic technique for screening a library of compounds based upon their relative affinity for a target molecule. A {open_quotes}target{close_quotes} column containing the immobilized target molecule is set in tandem with a reversed-phase column. A combinatorial peptide library is injected onto the target column. The target-bound peptides are eluted from the first column and transferred automatically to the reversed-phase column. The target-specific peptide peaks from the reversed-phase column are identified and sequenced. Using a monoclonal antibody (3E-7) against {beta}-endorphin as a target, we selected a single peptide with sequence YGGFL from approximately 5800 peptides present in a combinatorial library. We demonstrated the applicability of the technology towards selection of peptides with predetermined affinity for bacterial lipopolysaccharide (LPS, endotoxin). We expect that this technology will have broad applications for high throughput screening of chemical libraries or natural product extracts. 21 refs., 4 figs.
Protein Cofactors Are Essential for High-Affinity DNA Binding by the Nuclear Factor κB RelA Subunit.
Mulero, Maria Carmen; Shahabi, Shandy; Ko, Myung Soo; Schiffer, Jamie M; Huang, De-Bin; Wang, Vivien Ya-Fan; Amaro, Rommie E; Huxford, Tom; Ghosh, Gourisankar
2018-05-22
Transcription activator proteins typically contain two functional domains: a DNA binding domain (DBD) that binds to DNA with sequence specificity and an activation domain (AD) whose established function is to recruit RNA polymerase. In this report, we show that purified recombinant nuclear factor κB (NF-κB) RelA dimers bind specific κB DNA sites with an affinity significantly lower than that of the same dimers from nuclear extracts of activated cells, suggesting that additional nuclear cofactors might facilitate DNA binding by the RelA dimers. Additionally, recombinant RelA binds DNA with relatively low affinity at a physiological salt concentration in vitro. The addition of p53 or RPS3 (ribosomal protein S3) increases RelA:DNA binding affinity 2- to >50-fold depending on the protein and ionic conditions. These cofactor proteins do not form stable ternary complexes, suggesting that they stabilize the RelA:DNA complex through dynamic interactions. Surprisingly, the RelA-DBD alone fails to bind DNA under the same solution conditions even in the presence of cofactors, suggesting an important role of the RelA-AD in DNA binding. Reduced RelA:DNA binding at a physiological ionic strength suggests that multiple cofactors might be acting simultaneously to mitigate the electrolyte effect and stabilize the RelA:DNA complex in vivo. Overall, our observations suggest that the RelA-AD and multiple cofactor proteins function cooperatively to prime the RelA-DBD and stabilize the RelA:DNA complex in cells. Our study provides a mechanism for nuclear cofactor proteins in NF-κB-dependent gene regulation.
Maximum-Entropy Models of Sequenced Immune Repertoires Predict Antigen-Antibody Affinity
DEFF Research Database (Denmark)
Asti, Lorenzo; Uguzzoni, Guido; Marcatili, Paolo
2016-01-01
The immune system has developed a number of distinct complex mechanisms to shape and control the antibody repertoire. One of these mechanisms, the affinity maturation process, works in an evolutionary-like fashion: after binding to a foreign molecule, the antibody-producing B-cells exhibit a high...... of an HIV-1 infected patient. The Pearson correlation coefficient between our scoring function and the IC50 neutralization titer measured on 30 different antibodies of known sequence is as high as 0.77 (p-value 10-6), outperforming other sequence- and structure-based models....
Affinity functions for modeling glass dissolution rates
Energy Technology Data Exchange (ETDEWEB)
Bourcier, W.L. [Lawrence Livermore National Lab., CA (United States)
1997-07-01
Glass dissolution rates decrease dramatically as glass approach ''saturation'' with respect to the leachate solution. Most repository sites are chosen where water fluxes are minimal, and therefore the waste glass is most likely to dissolve under conditions close to ''saturation''. The key term in the rate expression used to predict glass dissolution rates close to ''saturation'' is the affinity term, which accounts for saturation effects on dissolution rates. Interpretations of recent experimental data on the dissolution behaviour of silicate glasses and silicate minerals indicate the following: 1) simple affinity control does not explain the observed dissolution rate for silicate minerals or glasses; 2) dissolution rates can be significantly modified by dissolved cations even under conditions far from saturation where the affinity term is near unity; 3) the effects of dissolved species such as Al and Si on the dissolution rate vary with pH, temperature, and saturation state; and 4) as temperature is increased, the effect of both pH and temperature on glass and mineral dissolution rates decrease, which strongly suggests a switch in rate control from surface reaction-based to diffusion control. Borosilicate glass dissolution models need to be upgraded to account for these recent experimental observations. (A.C.)
DEFF Research Database (Denmark)
Jensen, Claus H; Hansen, Hanne D; Bay, Tina
2017-01-01
understanding of this population of binding sites. With its high specific affinity and monocarboxylate transporter (MCT1) mediated transport across the blood-brain barrier in pharmacological doses, 3-hydroxycyclopent-1-enecarboxylic acid (HOCPCA) seems like a suitable PET radiotracer candidate. Here, we report...... autoradiography on sections of pig brain was performed using [(3)H]HOCPCA. In vivo evaluation of [(11)C]HOCPCA showed no brain uptake, possibly due to a limited uptake of HOCPCA by the MCT1 transporter at tracer doses of [(11)C]HOCPCA....
On $L_p$ Affine Surface Area and Curvature Measures
Zhao, Yiming
2015-01-01
The relationship between $L_p$ affine surface area and curvature measures is investigated. As a result, a new representation of the existing notion of $L_p$ affine surface area depending only on curvature measures is derived. Direct proofs of the equivalence between this new representation and those previously known are provided. The proofs show that the new representation is, in a sense, "polar" to that of Lutwak's and "dual" to that of Sch\\"utt & Werner's.
International Nuclear Information System (INIS)
Di Paolo, T.; Falardeau, P.
1987-01-01
The authors have investigated dopamine (DA) receptor agonist high- and low-affinity states in female rate estradiol-induced prolactin (PRL)-secreting pituitary tumors and intact pituitary tissue. Estradiol treatment increased the anterior pituitary weight 9-fold and plasma prolactin levels 74-fold and these measures are correlated (R = 0.745, n = 73, p 3 H]-spiperone binding to the DA receptor by apomorphine was compared in normal and adenomatous pituitary tissue. The inhibition constants (Ki) and the proportions of the two apomorphine sites are unchanged in tumors compared to intact pituitary tissue. Guanosine 5'-[β-γ-imino]triphosphate (Gpp(NH)p) causes complete conversion of the high into low affinity dopaminergic agonist site in normal pituitary and in tumors. These results suggest that rats with primary estradiol-induced pituitary tumors have normal and functional DA receptors. 9 references, 2 tables
[An examination of the determinants of social withdrawal and affinity for social withdrawal].
Watanabe, Asami; Matsui, Yutaka; Takatsuka, Yusuke
2010-12-01
This study examined the determinants of social withdrawal using data from a survey by the Tokyo Metropolitan Government Office for Youth Affairs and Public Safety (2008). In addition, this study identified young people who showed an affinity for social withdrawal although they were not in a state of withdrawal, and examined the determinants of an affinity for social withdrawal. The results of stepwise discriminant analysis showed that factors such as social phobia, depression, violence, and emotional bonds with family differentiated between the general youth group and the social withdrawal group and the "affinity group". Social phobia, violence, and refusal to be interfered in self-decision making differentiated between the social withdrawal group and the "affinity group". This study shows that an "affinity group" should be cared as well as an actual withdrawal group.
Li, Min; Zhu, Min; Zhang, Cunzheng; Liu, Xianjin; Wan, Yakun
2014-01-01
Nanobodies are the smallest natural fragments with useful properties such as high affinity, distinct paratope and high stability, which make them an ideal tool for detecting target antigens. In this study, we generated and characterized nanobodies against the Cry1Ac toxin and applied them in a biotin-streptavidin based double antibodies (nanobodies) sandwich-ELISA (DAS-ELISA) assay. After immunizing a camel with soluble Cry1Ac toxin, a phage displayed library was constructed to generate Nbs against the Cry1Ac toxin. Through successive rounds of affinity bio-panning, four nanobodies with greatest diversity in CDR3 sequences were obtained. After affinity determination and conjugating to HRP, two nanobodies with high affinity which can recognize different epitopes of the same antigen (Cry1Ac) were selected as capture antibody (Nb61) and detection antibody (Nb44). The capture antibody (Nb61) was biotinylated in vivo for directional immobilization on wells coated with streptavidin matrix. Both results of specificity analysis and thermal stability determination add support for reliability of the following DAS-ELISA with a minimum detection limit of 0.005 μg·mL−1 and a working range 0.010–1.0 μg·mL−1. The linear curve displayed an acceptable correlation coefficient of 0.9976. These results indicated promising applications of nanobodies for detection of Cry1Ac toxin with biotin-streptavidin based DAS-ELISA system. PMID:25474492
Directory of Open Access Journals (Sweden)
Min Li
2014-12-01
Full Text Available Nanobodies are the smallest natural fragments with useful properties such as high affinity, distinct paratope and high stability, which make them an ideal tool for detecting target antigens. In this study, we generated and characterized nanobodies against the Cry1Ac toxin and applied them in a biotin-streptavidin based double antibodies (nanobodies sandwich-ELISA (DAS-ELISA assay. After immunizing a camel with soluble Cry1Ac toxin, a phage displayed library was constructed to generate Nbs against the Cry1Ac toxin. Through successive rounds of affinity bio-panning, four nanobodies with greatest diversity in CDR3 sequences were obtained. After affinity determination and conjugating to HRP, two nanobodies with high affinity which can recognize different epitopes of the same antigen (Cry1Ac were selected as capture antibody (Nb61 and detection antibody (Nb44. The capture antibody (Nb61 was biotinylated in vivo for directional immobilization on wells coated with streptavidin matrix. Both results of specificity analysis and thermal stability determination add support for reliability of the following DAS-ELISA with a minimum detection limit of 0.005 μg·mL−1 and a working range 0.010–1.0 μg·mL−1. The linear curve displayed an acceptable correlation coefficient of 0.9976. These results indicated promising applications of nanobodies for detection of Cry1Ac toxin with biotin-streptavidin based DAS-ELISA system.
99mTc(CO)3-DTMA bombesin conjugates having high affinity for the GRP receptor
International Nuclear Information System (INIS)
Lane, Stephanie R.; Veerendra, Bhadrasetty; Rold, Tammy L.; Sieckman, Gary L.; Hoffman, Timothy J.; Jurisson, Silvia S.; Smith, Charles J.
2008-01-01
Introduction: Targeted diagnosis of specific human cancer types continues to be of significant interest in nuclear medicine. 99m Tc is ideally suited as a diagnostic radiometal for in vivo tumor targeting due to its ideal physical characteristics and diverse labeling chemistries in numerous oxidation states. Methods: In this study, we report a synthetic approach toward design of a new tridentate amine ligand for the organometallic aqua-ion [ 99m Tc(H 2 O) 3 (CO) 3 ] + . The new chelating ligand framework, 2-(N,N'-Bis(tert-butoxycarbonyl)diethylenetriamine) acetic acid (DTMA), was synthesized from a diethylenetriamine precursor and fully characterized by mass spectrometry and nuclear magnetic resonance spectroscopy ( 1 H and 13 C). DTMA was conjugated to H 2 N-(X)-BBN(7-14)NH 2 , where X=an amino acid or aliphatic pharmacokinetic modifier and BBN=bombesin peptide, by means of solid phase peptide synthesis. DTMA-(X)-BBN(7-14)NH 2 conjugates were purified by reversed-phase high-performance chromatography and characterized by electrospray-ionization mass spectrometry. Results: The new conjugates were radiolabeled with [ 99m Tc(H 2 O) 3 (CO) 3 ] + produced via Isolink radiolabeling kits to produce [ 99m Tc(CO) 3 -DTMA-(X)-BBN(7-14)NH 2 ]. Radiolabeled conjugates were purified by reversed-phase high-performance chromatography. Effective receptor binding behavior was evaluated in vitro and in vivo. Conclusions: [ 99m Tc(CO) 3 -DTMA-(X)-BBN(7-14)NH 2 ] conjugates displayed very high affinity for the gastrin releasing peptide receptor in vitro and in vivo. Therefore, these conjugates hold some propensity to be investigated as molecular imaging agents that specifically target human cancers uniquely expressing the gastrin releasing peptide receptor subtypes
DEFF Research Database (Denmark)
Pedersen, M. K.; Sørensen, Nanna Skall; Heegaard, Peter M. H.
2006-01-01
-based assay systems and in deciding whether a vaccine-induced antibody response will be protective. With ovalbumin as a carrier protein and a peptide (7.2NY) representing a 19 ammo acid sequence from the E. coli-derived Verotoxin 2e as a model hapten we investigated whether it was possible to influence...... ten dines at two-weeks intervals with low doses of the eight conjugates, Blood samples collected between each immunisation were analysed by ELISA for specific antibody titres and relative affinities. With both types of conjugations, the anti-peptide antibody titres increased in response to increasing...... for terminal conjugation. Thus, it appears that the molar ratio of a peptide and its carrier may affect the resulting antibody affinities, and that a conjugation ratio between a terminally Conjugated peptide and its carrier approaching one will result in relatively high antibody affinities. Furthermore...
Brorsen, Kurt R; Yang, Yang; Hammes-Schiffer, Sharon
2017-08-03
Nuclear quantum effects such as zero point energy play a critical role in computational chemistry and often are included as energetic corrections following geometry optimizations. The nuclear-electronic orbital (NEO) multicomponent density functional theory (DFT) method treats select nuclei, typically protons, quantum mechanically on the same level as the electrons. Electron-proton correlation is highly significant, and inadequate treatments lead to highly overlocalized nuclear densities. A recently developed electron-proton correlation functional, epc17, has been shown to provide accurate nuclear densities for molecular systems. Herein, the NEO-DFT/epc17 method is used to compute the proton affinities for a set of molecules and to examine the role of nuclear quantum effects on the equilibrium geometry of FHF - . The agreement of the computed results with experimental and benchmark values demonstrates the promise of this approach for including nuclear quantum effects in calculations of proton affinities, pK a 's, optimized geometries, and reaction paths.
Affinity of 169Yb, 67Ga and 111In for malignant tumor, (1)
International Nuclear Information System (INIS)
Ando, Itsuko
1975-01-01
The tumor affinity of 169 Yb-citrate, 67 Ga-citrate and 111 In-citrate was examined by using Yoshida sarcoma-bearing rats, and the affinity of these compounds for inflammation was also tested using rats with inflammation induced by croton oil injection. In this investigation there was no great difference in uptake by the tumor tissue of these compounds, but a great difference was observed in the retention value of the blood and uptake rate in the bone. 169 Yb-citrate was cleared rapidly from the blood and was taken mostly into the bone. So the retention values in the soft tissues became very small. On the other hand, 111 In-citrate was slowly and only slightly taken into the bone from the blood, so the retention values in the soft tissue remained relatively high. 67 Ga-citrate showed the intermediate value between the bone uptake rate of 169 Yb-citrate and that of 111 In-citrate. In the following experiments, 169 Yb-citrate and 67 Ga-citrate were compared in four strains: Yoshida sarcoma, Walker carcinosarcoma 256, Sarcoma 180, and Ehrlich tumor. The uptake rate of 169 Yb in tumor tissue was much larger than that of 67 Ga in Ehrlich tumor-bearing mice, but the value of 169 Yb was slightly smaller than those of 67 Ga in Yoshida sarcoma-bearing rats, Walker carcinosarcoma 256-bearing rats and Sarcoma 180-bearing mice. Tumor to organ ratios of 169 Yb, which were most important for tumor scanning, were much larger than those of 67 Ga in all four strains except tumor to bone ratios of 169 Yb. From the above-described facts, it was shown that 169 Yb-citrate had a stronger tumor affinity than 67 Ga-citrate and that the tumor affinity of 169 Yb-citrate was similar in these four strains of tumor bearing animals. These three compounds had a relatively strong affinity with the inflammatory tissue. (auth.)
Directory of Open Access Journals (Sweden)
Lixin Ma
2007-05-01
Full Text Available Gastrin-releasing peptide (GRP receptors are overexpressed on several types of human cancer cells, including breast, prostate, small cell lung, and pancreatic cancers. Bombesin (BBN, a 14–amino acid peptide that is an analogue of human GRP, binds to GRP receptors with very high affinity and specificity. The aim of this study was to develop a new fluorescent probe based on BBN having high tumor uptake and optimal pharmacokinetics for specific targeting and optical imaging of human breast cancer tissue. In this study, solid-phase peptide synthesis was used to produce H2N-glycylglycylglycine-BBN[7–14]NH2 peptide with the following general sequence: H2N-G-G-G-Q-W-A-V-G-H-L-M-(NH2. This conjugate was purified by reversed-phase high-performance liquid chromatography and characterized by electrospray-ionization mass spectra. The fluorescent probe Alexa Fluor 680-G-G-G-BBN[7–14]NH2 conjugate was prepared by reaction of Alexa Fluor 680 succinimidyl ester to H2N-G-G-G-BBN[7–14]NH2 in dimethylformamide (DMF. In vitro competitive binding assays, using 125I-Tyr4-BBN as the radiolabeling gold standard, demonstrated an inhibitory concentration 50% value of 7.7 ± 1.4 nM in human T-47D breast cancer cells. Confocal fluorescence microscopy images of Alexa Fluor 680-G-G-G-BBN[7–14]NH2 in human T-47D breast cancer cells indicated specific uptake, internalization, and receptor blocking of the fluorescent bioprobe in vitro. In vivo investigations in SCID mice bearing xenografted T-47D breast cancer lesions demonstrated the ability of this new conjugate to specifically target tumor tissue with high selectivity and affinity.
Rikta, S. Y.; Tareq, Shafi M.; Uddin, M. Khabir
2018-03-01
Solid waste production is rapidly increasing in Bangladesh and landfill leachate is the consequence of the decomposition of this waste. These leachates contain heavy metals and significant amount of dissolved organic matter (DOM). DOM is known to have considerable role in heavy metals speciation. Hence, it is important to characterize DOM/leachate and evaluate toxic metals binding affinity of DOM. The objectives of this study were to characterize the DOM in landfill leachate through physico-chemical and optical analyses and to investigate the toxic metals (Ni2+, Pb2+ and Hg2+) binding affinity of three different ages (fresh sample L-1, young sample L-2 and mature sample L-3) DOM samples. Results suggested that leachate is a potential pollutant which contained very high organic pollutant load. Conditional stability constant (Log K) and percentages of fluorophores that correspond to metal binding (% f) values indicated that young DOM sample (L-2) had the highest binding affinity to all the three metals ions. In general, DOM samples showed the following order affinity to the metal ions; Ni2+ binding affinity: L-2 > L-3 > L-1, Pb2+ binding affinity: L-2 > L-3 > L-1 and Hg2+ binding affinity: L-2 > L-1 > L-3.
Ogata, Makoto; Kameshima, Yumiko; Hattori, Takeshi; Michishita, Kousuke; Suzuki, Tomohiro; Kawagishi, Hirokazu; Totani, Kazuhide; Hiratake, Jun; Usui, Taichi
2010-12-10
Selective adsorption and separation of β-glucosidase, endo-acting endo-β-(1→4)-glucanase I (EG I), and exo-acting cellobiohydrolase I (CBH I) were achieved by affinity chromatography with β-lactosylamidine as ligand. A crude cellulase preparation from Hypocrea jecorina served as the source of enzyme. When crude cellulase was applied to the lactosylamidine-based affinity column, β-glucosidase appeared in the unbound fraction. By contrast, EG I and CBH I were retained on the column and then separated from each other by appropriately adjusting the elution conditions. The relative affinities of the enzymes, based on their column elution conditions, were strongly dependent on the ligand. The highly purified EG I and CBH I, obtained by affinity chromatography, were further purified by Mono P and DEAE chromatography, respectively. EG I and CBH I cleave only at the phenolic bond in p-nitrophenyl glycosides with lactose and N-acetyllactosamine (LacNAc). By contrast, both scissile bonds in p-nitrophenyl glycosides with cellobiose were subject to hydrolysis although with important differences in their kinetic parameters. Copyright © 2010 Elsevier Ltd. All rights reserved.
DFT study on the effect of exocyclic substituents on the proton affinity of 1-methylimidazole
International Nuclear Information System (INIS)
Liu, Haining; Bara, Jason E.; Turner, C. Heath
2013-01-01
Highlights: • DFT calculations are used to predict the proton affinity of 1-methylimidazoles. • The electron-withdrawing groups dominate the predicted proton affinity. • The effects of multiple substituents on the proton affinity can be accurately predicted. • Large compound libraries can be screened for imidazoles with tailored reactivity. - Abstract: A deeper understanding of the acid/base properties of imidazole derivatives will aid the development of solvents, polymer membranes and other materials that can be used for CO 2 capture and acid gas removal. In this study, we employ density functional theory calculations to investigate the effect of various electron-donating and electron-withdrawing groups on the proton affinity of 1-methylimidazole. We find that electron-donating groups are able to increase the proton affinity relative to 1-methylimidazole, i.e., making the molecule more basic. In contrast, electron-withdrawing groups cause a decrease of the proton affinity. When multiple substituents are present, their effects on the proton affinity were found to be additive. This finding offers a quick approach for predicting and targeting the proton affinities of this series of molecules, and we show the strong correlation between the calculated proton affinities and experimental pK a values
International Nuclear Information System (INIS)
Wolnik, Barbara; Dembowski, Marcin; Bołt, Witold; Baetens, Jan M; De Baets, Bernard
2017-01-01
The focus of this paper is on the density classification problem in the context of affine continuous cellular automata. Although such cellular automata cannot solve this problem in the classical sense, most density-conserving affine continuous cellular automata with a unit neighborhood radius are valid solutions of a slightly relaxed version of this problem. This result follows from a detailed study of the dynamics of the density-conserving affine continuous cellular automata that we introduce. (paper)
A soluble, high-affinity, interleukin-4-binding protein is present in the biological fluids of mice
International Nuclear Information System (INIS)
Fernandez-Botran, R.; Vitetta, E.S.
1990-01-01
Cytokines such as interleukin 4 (IL-4) play a key role in the regulation of immune responses, but little is known about how their multiple activities are regulated in vivo. In this report, we demonstrate that an IL-4-binding protein (IL-4BP) is constitutively present in the biological fluids of mice (serum, ascites fluid, and urine). Binding of 125 I-labeled IL-4 to the IL-4BP is specific and saturable and can be inhibited by an excess of unlabeled IL-4 but not IL-2. The IL-4BP binds IL-4 with an affinity similar to that reported for the cellular IL-4 with an affinity similar to that reported for the cellular IL-4 receptor (K d ∼7 x 10 -11 M) and has a molecular mass of 30-40 kDa and pI values of 3.6-4.8. IL-4BP-containing biological fluids or purified IL-4BP competitively inhibit the binding of 125 I-labeled IL-4 to mouse T or B cells and inhibit the biological activity of IL-4 but not IL-2. The serum levels of IL-4BP in severe combined immunodeficiency (SCID) mice are lower than those of normal mice. The above findings suggest that IL-4BP plays an important immunoregulatory role in vivo
Learning a peptide-protein binding affinity predictor with kernel ridge regression
2013-01-01
Background The cellular function of a vast majority of proteins is performed through physical interactions with other biomolecules, which, most of the time, are other proteins. Peptides represent templates of choice for mimicking a secondary structure in order to modulate protein-protein interaction. They are thus an interesting class of therapeutics since they also display strong activity, high selectivity, low toxicity and few drug-drug interactions. Furthermore, predicting peptides that would bind to a specific MHC alleles would be of tremendous benefit to improve vaccine based therapy and possibly generate antibodies with greater affinity. Modern computational methods have the potential to accelerate and lower the cost of drug and vaccine discovery by selecting potential compounds for testing in silico prior to biological validation. Results We propose a specialized string kernel for small bio-molecules, peptides and pseudo-sequences of binding interfaces. The kernel incorporates physico-chemical properties of amino acids and elegantly generalizes eight kernels, comprised of the Oligo, the Weighted Degree, the Blended Spectrum, and the Radial Basis Function. We provide a low complexity dynamic programming algorithm for the exact computation of the kernel and a linear time algorithm for it’s approximation. Combined with kernel ridge regression and SupCK, a novel binding pocket kernel, the proposed kernel yields biologically relevant and good prediction accuracy on the PepX database. For the first time, a machine learning predictor is capable of predicting the binding affinity of any peptide to any protein with reasonable accuracy. The method was also applied to both single-target and pan-specific Major Histocompatibility Complex class II benchmark datasets and three Quantitative Structure Affinity Model benchmark datasets. Conclusion On all benchmarks, our method significantly (p-value ≤ 0.057) outperforms the current state-of-the-art methods at predicting