
Sample records for high affinity inha

  1. Discovery of cofactor-specific, bactericidal Mycobacterium tuberculosis InhA inhibitors using DNA-encoded library technology. (United States)

    Soutter, Holly H; Centrella, Paolo; Clark, Matthew A; Cuozzo, John W; Dumelin, Christoph E; Guie, Marie-Aude; Habeshian, Sevan; Keefe, Anthony D; Kennedy, Kaitlyn M; Sigel, Eric A; Troast, Dawn M; Zhang, Ying; Ferguson, Andrew D; Davies, Gareth; Stead, Eleanor R; Breed, Jason; Madhavapeddi, Prashanti; Read, Jon A


    Millions of individuals are infected with and die from tuberculosis (TB) each year, and multidrug-resistant (MDR) strains of TB are increasingly prevalent. As such, there is an urgent need to identify novel drugs to treat TB infections. Current frontline therapies include the drug isoniazid, which inhibits the essential NADH-dependent enoyl-acyl-carrier protein (ACP) reductase, InhA. To inhibit InhA, isoniazid must be activated by the catalase-peroxidase KatG. Isoniazid resistance is linked primarily to mutations in the katG gene. Discovery of InhA inhibitors that do not require KatG activation is crucial to combat MDR TB. Multiple discovery efforts have been made against InhA in recent years. Until recently, despite achieving high potency against the enzyme, these efforts have been thwarted by lack of cellular activity. We describe here the use of DNA-encoded X-Chem (DEX) screening, combined with selection of appropriate physical properties, to identify multiple classes of InhA inhibitors with cell-based activity. The utilization of DEX screening allowed the interrogation of very large compound libraries (10 11 unique small molecules) against multiple forms of the InhA enzyme in a multiplexed format. Comparison of the enriched library members across various screening conditions allowed the identification of cofactor-specific inhibitors of InhA that do not require activation by KatG, many of which had bactericidal activity in cell-based assays.

  2. Phosphorylation of InhA inhibits mycolic acid biosynthesis and growth of Mycobacterium tuberculosis

    Energy Technology Data Exchange (ETDEWEB)

    Molle, Virginie; Gulten, Gulcin; Vilchèze, Catherine; Veyron-Churlet, Romain; Zanella-Cléon, Isabelle; Sacchettini, James C.; Jacobs, Jr, William R.; Kremer, Laurent (CNRS-UMR); (Einstein); (TAM)


    The remarkable survival ability of Mycobacterium tuberculosis in infected hosts is related to the presence of cell wall-associated mycolic acids. Despite their importance, the mechanisms that modulate expression of these lipids in response to environmental changes are unknown. Here we demonstrate that the enoyl-ACP reductase activity of InhA, an essential enzyme of the mycolic acid biosynthetic pathway and the primary target of the anti-tubercular drug isoniazid, is controlled via phosphorylation. Thr-266 is the unique kinase phosphoacceptor, both in vitro and in vivo. The physiological relevance of Thr-266 phosphorylation was demonstrated using inhA phosphoablative (T266A) or phosphomimetic (T266D/E) mutants. Enoyl reductase activity was severely impaired in the mimetic mutants in vitro, as a consequence of a reduced binding affinity to NADH. Importantly, introduction of inhA{_}T266D/E failed to complement growth and mycolic acid defects of an inhA-thermosensitive Mycobacterium smegmatis strain, in a similar manner to what is observed following isoniazid treatment. This study suggests that phosphorylation of InhA may represent an unusual mechanism that allows M. tuberculosis to regulate its mycolic acid content, thus offering a new approach to future anti-tuberculosis drug development.

  3. Phosphorylation of InhA inhibits mycolic acid biosynthesis and growth of Mycobacterium tuberculosis. (United States)

    Molle, Virginie; Gulten, Gulcin; Vilchèze, Catherine; Veyron-Churlet, Romain; Zanella-Cléon, Isabelle; Sacchettini, James C; Jacobs, William R; Kremer, Laurent


    The remarkable survival ability of Mycobacterium tuberculosis in infected hosts is related to the presence of cell wall-associated mycolic acids. Despite their importance, the mechanisms that modulate expression of these lipids in response to environmental changes are unknown. Here we demonstrate that the enoyl-ACP reductase activity of InhA, an essential enzyme of the mycolic acid biosynthetic pathway and the primary target of the anti-tubercular drug isoniazid, is controlled via phosphorylation. Thr-266 is the unique kinase phosphoacceptor, both in vitro and in vivo. The physiological relevance of Thr-266 phosphorylation was demonstrated using inhA phosphoablative (T266A) or phosphomimetic (T266D/E) mutants. Enoyl reductase activity was severely impaired in the mimetic mutants in vitro, as a consequence of a reduced binding affinity to NADH. Importantly, introduction of inhA_T266D/E failed to complement growth and mycolic acid defects of an inhA-thermosensitive Mycobacterium smegmatis strain, in a similar manner to what is observed following isoniazid treatment. This study suggests that phosphorylation of InhA may represent an unusual mechanism that allows M. tuberculosis to regulate its mycolic acid content, thus offering a new approach to future anti-tuberculosis drug development. © 2010 Blackwell Publishing Ltd.

  4. High affinity hemoglobin and Parkinson's disease. (United States)

    Graham, Jeffrey; Hobson, Douglas; Ponnampalam, Arjuna


    Parkinson's disease (PD) is a neurodegenerative disorder characterized by the loss of dopaminergic neurons in the substantia nigra (SN) region of the midbrain. Oxidative damage in this region has been shown to play an important role in the pathogenesis of this disease. Human neurons have been discovered to contain hemoglobin, with an increased concentration seen in the neurons of the SN. High affinity hemoglobin is a clinical entity resulting from mutations that create a functional increase in the binding of hemoglobin to oxygen and an inability to efficiently unload it to tissues. This can result in a number of metabolic compensatory changes, including an elevation in circulating hemoglobin and an increase in the molecule 2,3-diphosphoglycerate (2,3-DPG). Population based studies have revealed that patients with PD have elevated hemoglobin as well as 2,3-DPG levels. Based on these observations, we hypothesize that the oxidative damage seen in PD is related to an underlying high affinity hemoglobin subtype. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Multiple receptor conformers based molecular docking study of fluorine enhanced ethionamide with mycobacterium enoyl ACP reductase (InhA). (United States)

    Khan, Akib Mahmud; Shawon, Jakaria; Halim, Mohammad A


    A major limitation in current molecular docking method is that of failure to account for receptor flexibility. Herein we report multiple receptor conformers based molecular docking as a practical alternative to account for the receptor flexibility. Multiple (forty) conformers of Mycobacterium Enoyl ACP Reductase (InhA) are generated from Molecular Dynamics simulation and twenty crystallographic structures of InhA bound to different inhibitors are obtained from the Protein Data Bank. Fluorine directed modifications are performed to currently available anti-tuberculosis drug ethionamide. The modified drugs are optimized using B3LYP 6-31G (d,p) level of theory. Dipole moment, frontier orbital gap and thermodynamical properties such as electronic energy, enthalpy and Gibbs free energy of these optimized drugs are investigated. These drugs are subsequently docked against the conformers of InhA. Molecular docking against multiple InhA conformations show variation in ligand binding affinity and suggest that Ser94, Gly96, Lys165 and Ile194 amino acids play critical role on strong drug-InhA interaction. Modified drug N1 showed greater binding affinity compared to EN in most conformations. Structure of PDB ID: 2NSD and snapshot conformer at 5.5ns show most favorable binding with N1 compared to other conformers. Fluorine participates in forming fluorine bonds and contributes significantly in increasing binding affinity. Our study reveal that addition of trifluoromethyl group explicitly shows promise in improving thermodynamic properties and in enhancing hydrogen bonding and non-bonded interactions. Molecular dynamics (MD) simulation show that EN and N1 remained in the binding pocket similar to the docked pose of EN-InhA and E1-InhA complexes and also suggested that InhA binds to its inhibitor in inhibitor-induced folding manner. ADMET calculations predict modified drugs to have improved pharmacokinetic properties. Our study concludes that multiple receptor conformers based

  6. Disruption of key NADH-binding pocket residues of the Mycobacterium tuberculosis InhA affects DD-CoA binding ability. (United States)

    Shaw, Daniel J; Robb, Kirsty; Vetter, Beatrice V; Tong, Madeline; Molle, Virginie; Hunt, Neil T; Hoskisson, Paul A


    Tuberculosis (TB) is a global health problem that affects over 10 million people. There is an urgent need to develop novel antimicrobial therapies to combat TB. To achieve this, a thorough understanding of key validated drug targets is required. The enoyl reductase InhA, responsible for synthesis of essential mycolic acids in the mycobacterial cell wall, is the target for the frontline anti-TB drug isoniazid. To better understand the activity of this protein a series of mutants, targeted to the NADH co-factor binding pocket were created. Residues P193 and W222 comprise a series of hydrophobic residues surrounding the cofactor binding site and mutation of both residues negatively affect InhA function. Construction of an M155A mutant of InhA results in increased affinity for NADH and DD-CoA turnover but with a reduction in V max for DD-CoA, impairing overall activity. This suggests that NADH-binding geometry of InhA likely permits long-range interactions between residues in the NADH-binding pocket to facilitate substrate turnover in the DD-CoA binding region of the protein. Understanding the precise details of substrate binding and turnover in InhA and how this may affect protein-protein interactions may facilitate the development of improved inhibitors enabling the development of novel anti-TB drugs.

  7. Antitubercular drugs for an old target: GSK693 as a promising InhA direct inhibitor

    Directory of Open Access Journals (Sweden)

    María Martínez-Hoyos


    Full Text Available Despite being one of the first antitubercular agents identified, isoniazid (INH is still the most prescribed drug for prophylaxis and tuberculosis (TB treatment and, together with rifampicin, the pillars of current chemotherapy. A high percentage of isoniazid resistance is linked to mutations in the pro-drug activating enzyme KatG, so the discovery of direct inhibitors (DI of the enoyl-ACP reductase (InhA has been pursued by many groups leading to the identification of different enzyme inhibitors, active against Mycobacterium tuberculosis (Mtb, but with poor physicochemical properties to be considered as preclinical candidates. Here, we present a series of InhA DI active against multidrug (MDR and extensively (XDR drug-resistant clinical isolates as well as in TB murine models when orally dosed that can be a promising foundation for a future treatment.

  8. Engineering of bispecific affinity proteins with high affinity for ERBB2 and adaptable binding to albumin.

    Directory of Open Access Journals (Sweden)

    Johan Nilvebrant

    Full Text Available The epidermal growth factor receptor 2, ERBB2, is a well-validated target for cancer diagnostics and therapy. Recent studies suggest that the over-expression of this receptor in various cancers might also be exploited for antibody-based payload delivery, e.g. antibody drug conjugates. In such strategies, the full-length antibody format is probably not required for therapeutic effect and smaller tumor-specific affinity proteins might be an alternative. However, small proteins and peptides generally suffer from fast excretion through the kidneys, and thereby require frequent administration in order to maintain a therapeutic concentration. In an attempt aimed at combining ERBB2-targeting with antibody-like pharmacokinetic properties in a small protein format, we have engineered bispecific ERBB2-binding proteins that are based on a small albumin-binding domain. Phage display selection against ERBB2 was used for identification of a lead candidate, followed by affinity maturation using second-generation libraries. Cell surface display and flow-cytometric sorting allowed stringent selection of top candidates from pools pre-enriched by phage display. Several affinity-matured molecules were shown to bind human ERBB2 with sub-nanomolar affinity while retaining the interaction with human serum albumin. Moreover, parallel selections against ERBB2 in the presence of human serum albumin identified several amino acid substitutions that dramatically modulate the albumin affinity, which could provide a convenient means to control the pharmacokinetics. The new affinity proteins competed for ERBB2-binding with the monoclonal antibody trastuzumab and recognized the native receptor on a human cancer cell line. Hence, high affinity tumor targeting and tunable albumin binding were combined in one small adaptable protein.

  9. Affinity Crystallography: A New Approach to Extracting High-Affinity Enzyme Inhibitors from Natural Extracts. (United States)

    Aguda, Adeleke H; Lavallee, Vincent; Cheng, Ping; Bott, Tina M; Meimetis, Labros G; Law, Simon; Nguyen, Nham T; Williams, David E; Kaleta, Jadwiga; Villanueva, Ivan; Davies, Julian; Andersen, Raymond J; Brayer, Gary D; Brömme, Dieter


    Natural products are an important source of novel drug scaffolds. The highly variable and unpredictable timelines associated with isolating novel compounds and elucidating their structures have led to the demise of exploring natural product extract libraries in drug discovery programs. Here we introduce affinity crystallography as a new methodology that significantly shortens the time of the hit to active structure cycle in bioactive natural product discovery research. This affinity crystallography approach is illustrated by using semipure fractions of an actinomycetes culture extract to isolate and identify a cathepsin K inhibitor and to compare the outcome with the traditional assay-guided purification/structural analysis approach. The traditional approach resulted in the identification of the known inhibitor antipain (1) and its new but lower potency dehydration product 2, while the affinity crystallography approach led to the identification of a new high-affinity inhibitor named lichostatinal (3). The structure and potency of lichostatinal (3) was verified by total synthesis and kinetic characterization. To the best of our knowledge, this is the first example of isolating and characterizing a potent enzyme inhibitor from a partially purified crude natural product extract using a protein crystallographic approach.

  10. Characteristics of high affinity and low affinity adenosine binding sites in human cerebral cortex

    International Nuclear Information System (INIS)

    John, D.; Fox, I.V.


    The binding characteristics of human brain cortical membrane fractions were evaluated to test the hypothesis that there are A 1 and A 2 adenosine binding sites. The ligands used were 2-chloro(8- 3 H) adenosine and N 6 -(adenine-2, 8- 3 H) cyclohexayladenosine. Binding of chloroadenosine to human brain cortical membranes was time dependent, reversible and concentration dependent. The kinetic constant determinations from binding studies of the adenosine receptor are presented. Utilizing tritium-cyclohexyladenosine as ligand the authors observed evidence for a high affinity binding site in human brain cortical membranes with a kd of 5 nM

  11. Molecular basis of a high affinity murine interleukin-5 receptor.


    Devos, R; Plaetinck, G; Van der Heyden, J; Cornelis, S; Vandekerckhove, J; Fiers, W; Tavernier, J


    The mouse interleukin-5 receptor (mIL-5R) consists of two components one of which, the mIL-5R alpha-chain, binds mIL-5 with low affinity. Recently we demonstrated that monoclonal antibodies (Mabs) recognizing the second mIL-5R beta-chain, immunoprecipitate a p130-140 protein doublet which corresponds to the mIL-3R and the mIL-3R-like protein, the latter chain for which so far no ligand has been identified. In this study we show that a high affinity mIL-5R can be reconstituted on COS1 cells by...

  12. Structure of Greyhound hemoglobin: origin of high oxygen affinity. (United States)

    Bhatt, Veer S; Zaldívar-López, Sara; Harris, David R; Couto, C Guillermo; Wang, Peng G; Palmer, Andre F


    This study presents the crystal structure of Greyhound hemoglobin (GrHb) determined to 1.9 Å resolution. GrHb was found to crystallize with an α₁β₁ dimer in the asymmetric unit and belongs to the R2 state. Oxygen-affinity measurements combined with the fact that GrHb crystallizes in the R2 state despite the high-salt conditions used for crystallization strongly indicate that GrHb can serve as a model high-oxygen-affinity hemoglobin (Hb) for higher mammals, especially humans. Structural analysis of GrHb and its comparison with the R2-state of human Hb revealed several regions that can potentially contribute to the high oxygen affinity of GrHb and serve to rationalize the additional stability of the R2-state of GrHb. A previously well studied hydrophobic cluster of bar-headed goose Hb near α119 was also incorporated in the comparison between GrHb and human Hb. Finally, a structural comparison with generic dog Hb and maned wolf Hb was conducted, revealing that in contrast to GrHb these structures belong to the R state of Hb and raising the intriguing possibility of an additional allosteric factor co-purifying with GrHb that can modulate its quaternary structure.

  13. High-throughput fragment screening by affinity LC-MS. (United States)

    Duong-Thi, Minh-Dao; Bergström, Maria; Fex, Tomas; Isaksson, Roland; Ohlson, Sten


    Fragment screening, an emerging approach for hit finding in drug discovery, has recently been proven effective by its first approved drug, vemurafenib, for cancer treatment. Techniques such as nuclear magnetic resonance, surface plasmon resonance, and isothemal titration calorimetry, with their own pros and cons, have been employed for screening fragment libraries. As an alternative approach, screening based on high-performance liquid chromatography separation has been developed. In this work, we present weak affinity LC/MS as a method to screen fragments under high-throughput conditions. Affinity-based capillary columns with immobilized thrombin were used to screen a collection of 590 compounds from a fragment library. The collection was divided into 11 mixtures (each containing 35 to 65 fragments) and screened by MS detection. The primary screening was performed in 3500 fragments per day). Thirty hits were defined, which subsequently entered a secondary screening using an active site-blocked thrombin column for confirmation of specificity. One hit showed selective binding to thrombin with an estimated dissociation constant (K (D)) in the 0.1 mM range. This study shows that affinity LC/MS is characterized by high throughput, ease of operation, and low consumption of target and fragments, and therefore it promises to be a valuable method for fragment screening.

  14. Screening of a Novel Fragment Library with Functional Complexity against Mycobacterium tuberculosis InhA. (United States)

    Prati, Federica; Zuccotto, Fabio; Fletcher, Daniel; Convery, Maire A; Fernandez-Menendez, Raquel; Bates, Robert; Encinas, Lourdes; Zeng, Jingkun; Chung, Chun-Wa; De Dios Anton, Paco; Mendoza-Losana, Alfonso; Mackenzie, Claire; Green, Simon R; Huggett, Margaret; Barros, David; Wyatt, Paul G; Ray, Peter C


    Our findings reported herein provide support for the benefits of including functional group complexity (FGC) within fragments when screening against protein targets such as Mycobacterium tuberculosis InhA. We show that InhA fragment actives with FGC maintained their binding pose during elaboration. Furthermore, weak fragment hits with functional group handles also allowed for facile fragment elaboration to afford novel and potent InhA inhibitors with good ligand efficiency metrics for optimization. © 2018 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  15. Detection of Waterborne Viruses Using High Affinity Molecularly Imprinted Polymers. (United States)

    Altintas, Zeynep; Gittens, Micah; Guerreiro, Antonio; Thompson, Katy-Anne; Walker, Jimmy; Piletsky, Sergey; Tothill, Ibtisam E


    Molecularly imprinted polymers (MIPs) are artificial receptor ligands which can recognize and specifically bind to a target molecule. They are more resistant to chemical and biological damage and inactivation than antibodies. Therefore, target specific-MIP nanoparticles are aimed to develop and implemented to biosensors for the detection of biological toxic agents such as viruses, bacteria, and fungi toxins that cause many diseases and death due to the environmental contamination. For the first time, a molecularly imprinted polymer (MIP) targeting the bacteriophage MS2 as the template was investigated using a novel solid-phase synthesis method to obtain the artificial affinity ligand for the detection and removal of waterborne viruses through optical-based sensors. A high affinity between the artificial ligand and the target was found, and a regenerative MIP-based virus detection assay was successfully developed using a new surface plasmon resonance (SPR)-biosensor which provides an alternative technology for the specific detection and removal of waterborne viruses that lead to high disease and death rates all over the world.

  16. High affinity calmodulin target sequence in the signalling molecule PI 3-kinase

    DEFF Research Database (Denmark)

    Fischer, R; Julsgart, J; Berchtold, M W


    M-binding peptide derived from the p110gamma isoform interacts with CaM in a calcium-dependent way. Using gel shift analysis and fluorescence spectrophotometry we discovered that the peptide forms a high affinity complex with CaM. Titration experiments using dansylated CaM gave an affinity constant of 5 n...

  17. A High Affinity Adenosine Kinase from Anopheles gambiae (United States)

    Cassera, María B.; Ho, Meng-Chiao; Merino, Emilio F.; Burgos, Emmanuel S.; Rinaldo-Matthis, Agnes; Almo, Steven C.; Schramm, Vern L.


    Genome analysis revealed a mosquito orthologue of adenosine kinase in Anopheles gambiae (AgAK; the most important vector for the transmission of Plasmodium falciparum in Africa). P. falciparum are purine auxotrophs and do not express an adenosine kinase but rely on their hosts for purines. AgAK was kinetically characterized and found to have the highest affinity for adenosine (Km 8.1 nM) of any known adenosine kinase. AgAK is specific for adenosine at the nucleoside site but several nucleotide triphosphate phosphoryl donors are tolerated. The AgAK crystal structure with a bound bisubstrate analogue Ap4A (2.0 Å resolution) reveals interactions for adenosine, ATP and the geometry for phosphoryl transfer. The polyphosphate charge is partly neutralized by a bound Mg2+ ion and an ion pair to a catalytic site Arg. The AgAK structure consists of a large catalytic core in a three-layered α/β/α sandwich, and a small cap domain in contact with adenosine. The specificity and tight-binding for adenosine arises from hydrogen bond interactions of Asn14, Leu16, Leu40, Leu133, Leu168, Phe168 and Thr171 and the backbone of Ile39 and Phe168 with the adenine ring as well as through hydrogen bond interactions between Asp18, Gly64 and Asn68 and the ribosyl 2′- and 3′-hydroxyl groups. The structure is more similar to human adenosine kinase (48% identity) than to AK from Toxoplasma gondii (31% identity). With this extraordinary affinity for AgAK, adenosine is efficiently captured and converted to AMP at near the diffusion limit, suggesting an important role of this enzyme to maintain the adenine nucleotide pool. mRNA analysis verifies that AgAK transcripts are produced in the adult insects. PMID:21247194

  18. The fourth dimension in immunological space: how the struggle for nutrients selects high-affinity lymphocytes. (United States)

    Wensveen, Felix M; van Gisbergen, Klaas P J M; Eldering, Eric


    Lymphocyte activation via the antigen receptor is associated with radical shifts in metabolism and changes in requirements for nutrients and cytokines. Concomitantly, drastic changes occur in the expression of pro-and anti-apoptotic proteins that alter the sensitivity of lymphocytes to limiting concentrations of key survival factors. Antigen affinity is a primary determinant for the capacity of activated lymphocytes to access these vital resources. The shift in metabolic needs and the variable access to key survival factors is used by the immune system to eliminate activated low-affinity cells and to generate an optimal high-affinity response. In this review, we focus on the control of apoptosis regulators in activated lymphocytes by nutrients, cytokines, and costimulation. We propose that the struggle among individual clones that leads to the formation of high-affinity effector cell populations is in effect an 'invisible' fourth signal required for effective immune responses. © 2012 John Wiley & Sons A/S.

  19. The role of CH/π interactions in the high affinity binding of streptavidin and biotin. (United States)

    Ozawa, Motoyasu; Ozawa, Tomonaga; Nishio, Motohiro; Ueda, Kazuyoshi


    The streptavidin-biotin complex has an extraordinarily high affinity (Ka: 10 15 mol -1 ) and contains one of the strongest non-covalent interactions known. This strong interaction is widely used in biological tools, including for affinity tags, detection, and immobilization of proteins. Although hydrogen bond networks and hydrophobic interactions have been proposed to explain this high affinity, the reasons for it remain poorly understood. Inspired by the deceased affinity of biotin observed for point mutations of streptavidin at tryptophan residues, we hypothesized that a CH/π interaction may also contribute to the strong interaction between streptavidin and biotin. CH/π interactions were explored and analyzed at the biotin-binding site and at the interface of the subunits by the fragment molecular orbital method (FMO) and extended applications: PIEDA and FMO4. The results show that CH/π interactions are involved in the high affinity for biotin at the binding site of streptavidin. We further suggest that the involvement of CH/π interactions at the subunit interfaces and an extended CH/π network play more critical roles in determining the high affinity, rather than involvement at the binding site. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. High Performance Affinity Chromatography of Antithrombin III Based on Monodisperse Poly (glycidyl methacrylate) Beads

    Institute of Scientific and Technical Information of China (English)


    A new approach for the separation of antithrombin III with high performance affinity chromatography (HPAC) was described. A novel monodisperse,non-porous,cross-linked poly (glycidyl methacrylate) beads (PGMA) were used as the affinity support. With the water-soluble carbodiimide,heparin was linked covalently to amino-PGMA-beads,which was prepared by amination of PGMA. The adsorbent obtained exhibits high binding activity to antithrombin III (ATIII),good resolution and excellent mechanical properties and can be used under high flow rate.

  1. Single-experiment displacement assay for quantifying high-affinity binding by isothermal titration calorimetry. (United States)

    Krainer, Georg; Keller, Sandro


    Isothermal titration calorimetry (ITC) is the gold standard for dissecting the thermodynamics of a biomolecular binding process within a single experiment. However, reliable determination of the dissociation constant (KD) from a single titration is typically limited to the range 100 μM>KD>1 nM. Interactions characterized by a lower KD can be assessed indirectly by so-called competition or displacement assays, provided that a suitable competitive ligand is available whose KD falls within the directly accessible window. However, this protocol is limited by the fact that it necessitates at least two titrations to characterize one high-affinity inhibitor, resulting in considerable consumption of both sample material and time. Here, we introduce a fast and efficient ITC displacement assay that allows for the simultaneous characterization of both a high-affinity ligand and a moderate-affinity ligand competing for the same binding site on a receptor within a single experiment. The protocol is based on a titration of the high-affinity ligand into a solution containing the moderate-affinity ligand bound to the receptor present in excess. The resulting biphasic binding isotherm enables accurate and precise determination of KD values and binding enthalpies (ΔH) of both ligands. We discuss the theoretical background underlying the approach, demonstrate its practical application to metal ion chelation, explore its potential and limitations with the aid of simulations and statistical analyses, and elaborate on potential applications to protein-inhibitor interactions. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Quantifying high-affinity binding of hydrophobic ligands by isothermal titration calorimetry. (United States)

    Krainer, Georg; Broecker, Jana; Vargas, Carolyn; Fanghänel, Jörg; Keller, Sandro


    A fast and reliable quantification of the binding thermodynamics of hydrophobic high-affinity ligands employing a new calorimetric competition experiment is described. Although isothermal titration calorimetry is the method of choice for a quantitative characterization of intermolecular interactions in solution, a reliable determination of a dissociation constant (K(D)) is typically limited to the range 100 μM > K(D) > 1 nM. Interactions displaying higher or lower K(D) values can be assessed indirectly, provided that a suitable competing ligand is available whose K(D) falls within the directly accessible affinity window. This established displacement assay, however, requires the high-affinity ligand to be soluble at high concentrations in aqueous buffer and, consequently, poses serious problems in the study of protein binding involving small-molecule ligands dissolved in organic solvents--a familiar case in many drug-discovery projects relying on compound libraries. The calorimetric competition assay introduced here overcomes this limitation, thus allowing for a detailed thermodynamic description of high-affinity receptor-ligand interactions involving poorly water-soluble compounds. Based on a single titration of receptor into a dilute mixture of the two competing ligands, this competition assay provides accurate and precise values for the dissociation constants and binding enthalpies of both high- and moderate-affinity ligands. We discuss the theoretical background underlying the approach, demonstrate its practical application to metal ion chelation and high-affinity protein-inhibitor interactions, and explore its potential and limitations with the aid of simulations and statistical analyses.

  3. High affinity binding of [3H]cocaine to rat liver microsomes

    International Nuclear Information System (INIS)

    El-Maghrabi, E.A.; Calligaro, D.O.; Eldefrawi, M.E.


    ] 3 H]cocaine bound reversible, with high affinity and stereospecificity to rat liver microsomes. Little binding was detected in the lysosomal, mitochondrial and nuclear fractions. The binding kinetics were slow and the kinetically calculated K/sub D/ was 2 nM. Induction of mixed function oxidases by phenobarbital did not produce significant change in [ 3 H]cocaine binding. On the other hand, chronic administration of cocaine reduced [ 3 H]cocaine binding drastically. Neither treatment affected the affinity of the liver binding protein for cocaine. Microsomes from mouse and human livers had less cocaine-binding protein and lower affinity for cocaine than those from rat liver. Binding of [ 3 H]cocaine to rat liver microsomes was insensitive to monovalent cations and > 10 fold less sensitive to biogenic amines than the cocaine receptor in rat striatum. However, the liver protein had higher affinity for cocaine and metabolites except for norcocaine. Amine uptake inhibitors displaced [ 3 H]cocaine binding to liver with a different rank order of potency than their displacement of [ 3 H]cocaine binding to striatum. This high affinity [ 3 H]cocaine binding protein in liver is not likely to be monooxygenase, but may have a role in cocaine-induced hepatotoxicity

  4. Haemoglobin Pierre-Benite--a high affinity variant associated with relative polycythaemia. (United States)

    Beard, M E; Potter, H C; Spearing, R L; Brennan, S O


    This is the second reported example of Hb Pierre--Benite (beta90 Glu-->Asp). This mutation is associated with increased oxygen affinity and polycythaemia. No instability was found and there was no charge shift detected by cellulose acetate electrophoresis at pH 8.3. The mutation was however, clearly indicated by electrospray ionization mass spectrometry (ESI MS), which showed an abnormal beta chain with a 14 Da decrease in mass. Blood volume studies documented a relative rather than a true polycythaemia and this finding has been reported in at least two other high affinity haemoglobin variants--Hb Heathrow and Hb Rahere. This finding led to delay in diagnosis because high oxygen affinity variants are conventionally considered to cause a true polycythaemia.

  5. Selective induction of high-ouabain-affinity isoform of Na+-K+-ATPase by thyroid hormone

    International Nuclear Information System (INIS)

    Haber, R.S.; Loeb, J.N.


    The administration of thyroid hormone is known to result in an induction of the Na + -K + -adenosinetriphosphatase (Na + -K + -ATPase) in rat skeletal muscle and other thyroid hormone-responsive tissues. Since the Na + -K + -ATPase in a variety of mammalian tissues has recently been reported to exist in at least two forms distinguishable by differing affinities for the inhibitory cardiac glycoside ouabain. The authors have studied the effects of 3,3',5-triiodo-L-thyronine (T 3 ) treatment on these two forms of the enzyme in rat diaphragm. The inhibition of Na + -K + -ATPase activity in a crude membrane fraction by varying concentrations of ouabain conformed to a biphasic pattern consistent with the presence of two distinct isoforms with inhibition constants (K I s) for ouabain of ∼10 -7 and 10 -4 M, respectively. Measurement of the specific binding of [ 3 H]ouabain to these membranes confirmed the presence of a class of high-affinity ouabain binding sites with a dissociation constant (K d ) of slightly less than 10 -7 M, whose maximal binding capacity was increased by T 3 treatment by 185%. Binding studies in unfractionated homogenates of diaphragm similarly demonstrated the presence of high-affinity sites whose maximal binding capacity was increased by T 3 treatment. Quantitation of both the high- and low-ouabain-affinity forms of the Na + -K + -ATPase by ouabain-dependent phosphorylation from [ 32 P]orthophosphate confirmed that T 3 treatment markedly increased the number of high-affinity sites while having little effect on the number of low-affinity sites. These observations provide, to our knowledge, the first demonstration that these two forms of the Na + -K + -ATPase are subject to selective hormonal induction

  6. Correlations of mutations in katG, oxyR-ahpC and inhA genes and in vitro susceptibility in Mycobacterium tuberculosis clinical strains segregated by spoligotype families from tuberculosis prevalent countries in South America

    Directory of Open Access Journals (Sweden)

    Suffys Philip N


    Full Text Available Abstract Background Mutations associated with resistance to rifampin or streptomycin have been reported for W/Beijing and Latin American Mediterranean (LAM strain families of Mycobacterium tuberculosis. A few studies with limited sample sizes have separately evaluated mutations in katG, ahpC and inhA genes that are associated with isoniazid (INH resistance. Increasing prevalence of INH resistance, especially in high tuberculosis (TB prevalent countries is worsening the burden of TB control programs, since similar transmission rates are noted for INH susceptible and resistant M. tuberculosis strains. Results We, therefore, conducted a comprehensive evaluation of INH resistant M. tuberculosis strains (n = 224 from three South American countries with high burden of drug resistant TB to characterize mutations in katG, ahpC and inhA gene loci and correlate with minimal inhibitory concentrations (MIC levels and spoligotype strain family. Mutations in katG were observed in 181 (80.8% of the isolates of which 178 (98.3% was contributed by the katG S315T mutation. Additional mutations seen included oxyR-ahpC; inhA regulatory region and inhA structural gene. The S315T katG mutation was significantly more likely to be associated with MIC for INH ≥2 μg/mL. The S315T katG mutation was also more frequent in Haarlem family strains than LAM (n = 81 and T strain families. Conclusion Our data suggests that genetic screening for the S315T katG mutation may provide rapid information for anti-TB regimen selection, epidemiological monitoring of INH resistance and, possibly, to track transmission of INH resistant strains.

  7. N-Oxide analogs of WAY-100635 : new high affinity 5-HT (1A) receptor antagonists

    NARCIS (Netherlands)

    Oberwinkler - Marchais, Sandrine; Nowicki, B; Pike, VW; Halldin, C; Sandell, J; Chou, YH; Gulyas, B; Brennum, LT; Farde, L; Wikstrom, H V


    WAY-100635 [N-(2-(1-(4-(2-methoxyphenyl)piperazinyl)ethyl))-N-(2-pyridinyl)cyclohexanecarboxamide] 1 and its O-des-methyl derivative DWAY 2 are well-known high affinity 5-HT1A receptor antagonists. which when labeled with carbon-II (beta(+): t(1/2) 20.4min) in the carbonyl group are effective


    NARCIS (Netherlands)



    Cells of the purple nonsulfur bacterium Rhodobacter sphaeroides express a high-affinity K+ uptake system when grown in media with low K+ concentrations. A vanadate-sensitive, K+-stimulated and Mg2+-stimulated ATPase was purified from membranes of these cells by solubilization with

  9. Influence of self-affine roughness on the friction coefficient of rubber at high sliding velocity

    NARCIS (Netherlands)

    Palasantzas, G


    In this work we investigate the influence of self-affine roughness on the friction coefficient of a rubber body onto a solid surface at high speeds. The roughness is characterized by the rms amplitude w, the correlation length xi, and the roughness exponent H. It is shown that the friction

  10. Proadifen-sensitive high affinity binding of 3H-alaproclate to liver membranes

    International Nuclear Information System (INIS)

    Ross, S.B.


    3 H-alaproclate, a selective 5 h ydroxytryptamine uptake inhibitor, was found to bind to microsomal membranes from the rat liver with high affinity (K D -=3 nM) and large capacity (B max about 2 nmol/g liver). This binding was stereoselective since S-( - )-alaproclate was 30 times more potent than the R-( + )-enantiomer to displace the 3 H-labelled racemate. Proadifen (SKF 525A), an inhibitor of cytochrome P-450, displaced the 3 H-alaproclate binding with the same, high affinity (K i =3 nM) as alaproclate itself. Repeated treatment with phenobarbital sodium (5x75 mg/kg intraperitoneally) increased the number of alaproclate binding sites 7-8 times without changing the affinity. However, most of the phenobarbital induced 3 H-alaproclate binding was not displaceable by proadifen, showing the presence of at least two different high affinity binding sites. The possible involvement of cytochrome P-450 in the alaproclate binding is discussed. (author)

  11. Proadifen-sensitive high affinity binding of /sup 3/H-alaproclate to liver membranes

    Energy Technology Data Exchange (ETDEWEB)

    Ross, S.B.


    /sup 3/H-alaproclate, a selective 5/sub h/ydroxytryptamine uptake inhibitor, was found to bind to microsomal membranes from the rat liver with high affinity (K/sub D/-=3 nM) and large capacity (B/sub max/ about 2 nmol/g liver). This binding was stereoselective since S-( - )-alaproclate was 30 times more potent than the R-( + )-enantiomer to displace the /sup 3/H-labelled racemate. Proadifen (SKF 525A), an inhibitor of cytochrome P-450, displaced the /sup 3/H-alaproclate binding with the same, high affinity (K/sub i/=3 nM) as alaproclate itself. Repeated treatment with phenobarbital sodium (5x75 mg/kg intraperitoneally) increased the number of alaproclate binding sites 7-8 times without changing the affinity. However, most of the phenobarbital induced /sup 3/H-alaproclate binding was not displaceable by proadifen, showing the presence of at least two different high affinity binding sites. The possible involvement of cytochrome P-450 in the alaproclate binding is discussed.

  12. A high affinity monoclonal antibody recognizing the light chain of human coagulating factor VII. (United States)

    Sarial, Sheila; Asadi, Farzad; Jeddi-Tehrani, Mahmood; Hadavi, Reza; Bayat, Ali Ahmad; Mahmoudian, Jafar; Taghizadeh-Jahed, Masoud; Shokri, Fazel; Rabbani, Hodjattallah


    Factor VII (FVII) is a serine protease-coagulating element responsible for the initiation of an extrinsic pathway of clot formation. Here we generated and characterized a high affinity monoclonal antibody that specifically recognizes human FVII. Recombinant human FVII (rh-FVII) was used for the production of a monoclonal antibody using BALB/c mice. The specificity of the antibody was determined by Western blot using plasma samples from human, mouse, sheep, goat, bovine, rabbit, and rat. Furthermore, the antibody was used to detect transiently expressed rh-FVII in BHK21 cell line using Western blot and sandwich ELISA. A mouse IgG1 (kappa chain) monoclonal antibody clone 1F1-B11 was produced against rh-FVII. The affinity constant (K(aff)) of the antibody was calculated to be 6.4×10(10) M(-1). The antibody could specifically recognize an epitope on the light chain of hFVII, with no reactivity with factor VII from several other animals. In addition, transiently expressed rh-FVII in BHK21 cells was recognized by 1F1-B11. The high affinity as well as the specificity of 1F1-B11 for hFVII will facilitate the affinity purification of hFVII and also production of FVII deficient plasma and minimizes the risk of bovine FVII contamination when fetal bovine serum-supplemented media are used for production and subsequent purification of rh-FVII.

  13. Selective high-affinity polydentate ligands and methods of making such

    Energy Technology Data Exchange (ETDEWEB)

    Denardo, Sally J.; Denardo, Gerald L.; Balhorn, Rodney L.


    This invention provides novel polydentate selective high affinity ligands (SHALs) that can be used in a variety of applications in a manner analogous to the use of antibodies. SHALs typically comprise a multiplicity of ligands that each bind different region son the target molecule. The ligands are joined directly or through a linker thereby forming a polydentate moiety that typically binds the target molecule with high selectivity and avidity.

  14. Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity

    International Nuclear Information System (INIS)

    Wang, Deng-Liang; Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan; Yang, Hai-Tao; Wang, Jiang-Jie; Yao, Pei-Sen; Pan, Ru-Jun; Yang, Chaoyong James; Kang, De-Zhi


    Highlights: • This is the first report of DNA aptamer against EGFR in vitro. • Aptamer can bind targets with high affinity and selectivity. • DNA aptamers are more stable, cheap and efficient than RNA aptamers. • Our selected DNA aptamer against EGFR has high affinity with K d 56 ± 7.3 nM. • Our selected DNA aptamer against EGFR has high selectivity. - Abstract: Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher’s attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with K d 56 ± 7.3 nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy

  15. Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Deng-Liang [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China); Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan [State Key Laboratory for Physical Chemistry of Solid Surfaces, Key Laboratory for Chemical Biology of Fujian Province, Key Laboratory of Analytical Chemistry, and Department of Chemical Biology, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen 361005 (China); Yang, Hai-Tao; Wang, Jiang-Jie [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Yao, Pei-Sen [Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China); Pan, Ru-Jun [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Yang, Chaoyong James, E-mail: [State Key Laboratory for Physical Chemistry of Solid Surfaces, Key Laboratory for Chemical Biology of Fujian Province, Key Laboratory of Analytical Chemistry, and Department of Chemical Biology, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen 361005 (China); Kang, De-Zhi, E-mail: [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China)


    Highlights: • This is the first report of DNA aptamer against EGFR in vitro. • Aptamer can bind targets with high affinity and selectivity. • DNA aptamers are more stable, cheap and efficient than RNA aptamers. • Our selected DNA aptamer against EGFR has high affinity with K{sub d} 56 ± 7.3 nM. • Our selected DNA aptamer against EGFR has high selectivity. - Abstract: Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher’s attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with K{sub d} 56 ± 7.3 nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy.

  16. Reconstitution of high-affinity opioid agonist binding in brain membranes

    Energy Technology Data Exchange (ETDEWEB)

    Remmers, A.E.; Medzihradsky, F. (Univ. of Michigan Medical School, Ann Arbor (United States))


    In synaptosomal membranes from rat brain cortex, the {mu} selective agonist ({sup 3}H)dihydromorphine in the absence of sodium, and the nonselective antagonist ({sup 3}H)naltrexone in the presence of sodium, bound to two populations of opioid receptor sites with K{sub d} values of 0.69 and 8.7 nM for dihydromorphine, and 0.34 and 5.5 nM for naltrexone. The addition of 5 {mu}M guanosine 5{prime}-({gamma}-thio)triphosphate (GTP({gamma}S)) strongly reduced high-affinity agonist but not antagonist binding. Exposure of the membranes to high pH reduced the number of GTP({gamma}-{sup 35}S) binding sites by 90% and low K{sub m}, opioid-sensitive GTPase activity by 95%. In these membranes, high-affinity agonist binding was abolished and modulation of residual binding by GTP({gamma}S) was diminished. Alkali treatment of the glioma cell membranes prior to fusion inhibited most of the low K{sub m} GTPase activity and prevented the reconstitution of agonist binding. The results show that high-affinity opioid agonist binding reflects the ligand-occupied receptor - guanine nucleotide binding protein complex.

  17. Isolation of Anti-Ricin Protective Antibodies Exhibiting High Affinity from Immunized Non-Human Primates

    Directory of Open Access Journals (Sweden)

    Tal Noy-Porat


    Full Text Available Ricin, derived from the castor bean plant Ricinus communis, is one of the most potent and lethal toxins known, against which there is no available antidote. To date, the use of neutralizing antibodies is the most promising post-exposure treatment for ricin intoxication. The aim of this study was to isolate high affinity anti-ricin antibodies that possess potent toxin-neutralization capabilities. Two non-human primates were immunized with either a ricin-holotoxin- or subunit-based vaccine, to ensure the elicitation of diverse high affinity antibodies. By using a comprehensive set of primers, immune scFv phage-displayed libraries were constructed and panned. A panel of 10 antibodies (five directed against the A subunit of ricin and five against the B subunit was isolated and reformatted into a full-length chimeric IgG. All of these antibodies were found to neutralize ricin in vitro, and several conferred full protection to ricin-intoxicated mice when given six hours after exposure. Six antibodies were found to possess exceptionally high affinity toward the toxin, with KD values below pM (koff < 1 × 10−7 s−1 that were well correlated with their ability to neutralize ricin. These antibodies, alone or in combination, could be used for the development of a highly-effective therapeutic preparation for post-exposure treatment of ricin intoxication.

  18. Amyloid-beta binds catalase with high affinity and inhibits hydrogen peroxide breakdown.


    Milton, N G


    Amyloid-beta (Abeta) specifically bound purified catalase with high affinity and inhibited catalase breakdown of H(2)O(2). The Abeta-induced catalase inhibition involved formation of the inactive catalase Compound II and was reversible. CatalaseAbeta interactions provide rapid functional assays for the cytotoxic domain of Abeta and suggest a mechanism for some of the observed actions of Abeta plus catalase in vitro.

  19. High affinity, ligand specific uptake of complexed copper-67 by brain tissue incubated in vitro

    International Nuclear Information System (INIS)

    Barnea, A.; Hartter, D.E.


    Copper is an essential metal that is highly concentrated in the brain. The blood, the sole source of tissue Cu, contains 16-20 μM Cu, of which >95% is complexed to proteins and 2 was 10 times greater than that of CuAlbumin or Cu(II). Within the range of 0.2-150μM Cu, multiple uptake sites for CuHis were apparent. Increasing the molar ratio of His:Cu had a differential effect on Cu uptake: enhancing uptake at [Cu] 1 μM. Thus, using a His:Cu ratio of 1000, they observed a high affinity process exhibiting saturating and half saturating values of 5 μM and 1.5 μM Cu, respectively; using a His:Cu ratio of 2, they observed a low affinity process exhibiting saturating and half-saturating values of 100 μM and 40 μM Cu, respectively. Both processes required thermic but not metabolic energy, suggestive of facilitated diffusion. Considering the blood brain barrier for proteins, CuHis appears to be the major substrate for Cu uptake by neuronal tissue. They demonstrate the existence of a ligand specific, high affinity (apparent Km about 1.5 μM Cu) uptake process for CuHis in the brain, operative at the physiological concentration range of CuHis and histidine

  20. Robotic high-throughput purification of affinity-tagged recombinant proteins. (United States)

    Wiesler, Simone C; Weinzierl, Robert O J


    Affinity purification of recombinant proteins has become the method of choice to obtain good quantities and qualities of proteins for a variety of downstream biochemical applications. While manual or FPLC-assisted purification techniques are generally time-consuming and labor-intensive, the advent of high-throughput technologies and liquid handling robotics has simplified and accelerated this process significantly. Additionally, without the human factor as a potential source of error, automated purification protocols allow for the generation of large numbers of proteins simultaneously and under directly comparable conditions. The delivered material is ideal for activity comparisons of different variants of the same protein. Here, we present our strategy for the simultaneous purification of up to 24 affinity-tagged proteins for activity measurements in biochemical assays. The protocol described is suitable for the scale typically required in individual research laboratories.

  1. Solution structure of the Grb2 SH2 domain complexed with a high-affinity inhibitor

    International Nuclear Information System (INIS)

    Ogura, Kenji; Shiga, Takanori; Yokochi, Masashi; Yuzawa, Satoru; Burke, Terrence R.; Inagaki, Fuyuhiko


    The solution structure of the growth factor receptor-bound protein 2 (Grb2) SH2 domain complexed with a high-affinity inhibitor containing a non-phosphorus phosphate mimetic within a macrocyclic platform was determined by nuclear magnetic resonance (NMR) spectroscopy. Unambiguous assignments of the bound inhibitor and intermolecular NOEs between the Grb2 SH2 domain and the inhibitor was accomplished using perdeuterated Grb2 SH2 protein. The well-defined solution structure of the complex was obtained and compared to those by X-ray crystallography. Since the crystal structure of the Grb2 SH2 domain formed a domain-swapped dimer and several inhibitors were bound to a hinge region, there were appreciable differences between the solution and crystal structures. Based on the binding interactions between the inhibitor and the Grb2 SH2 domain in solution, we proposed a design of second-generation inhibitors that could be expected to have higher affinity

  2. Production and Identification of High Affinity Monoclonal Antibodies Against Pesticide Carbofuran

    Institute of Scientific and Technical Information of China (English)


    To produce high-affinity monoclonal antibodies against pesticide carbofuran, and the develop immunochemical assays for people's health and environmental protection, the hapten 4-[[(2,3-dihydro-2,2-dimethyl-7-benzofuranyloxy) carbonyl]-amino]-butanoic acid (BFNB) of carbofuran was synthesized and Balb/c mice were immunized by the hapten-carrier (BFNB-bovine serum albumin, BFNB-BSA) conjugates. The splenocytes of immunized mice were fused with Sp2/0 cells and the cultural supernatants of hybridoma cells were screened by the indirect enzyme-linked immunoabsorbent assay (ELISA), based on BFNB-ovoalbumin conjugates (BFNB-OVA). Purified monoclonal antibody (McAb) was obtained from fluids of ascites, deposited by octanoic acid and ammonium sulfate. The affinity and the specificity of McAb were characterized by ELISA or indirect competitive ELISA. A hybridoma cell line (5D3) secreting anti-carbofuran McAb had been established. The titer of culture medium and ascites was up to 1:2.048 × 103 and 1:1.024 × 106, respectively, and the subtype of the McAb was IgG1. The affinity constant of the McAb was about 2.54 × 109 L mol-1, with an IC50 value of 1.18 ng mL-1 and a detection limit of 0.01 ng mL-1. Cross-reactivity studies showed that the McAb was quiet specific for carbofuran, as among the four analogous compounds, they were all hardly recognized (4.59 × 10-4% for 2,3-dihydro-2,2-dimethyl-7-benzofuranol and less than 3.0 × 10-4% for others). The prepared McAb had a very high affinity and specificity,and it could be used to develop ELISA for rapid determination of carbofuran.

  3. A rhodium(III) complex for high-affinity DNA base-pair mismatch recognition (United States)

    Junicke, Henrik; Hart, Jonathan R.; Kisko, Jennifer; Glebov, Oleg; Kirsch, Ilan R.; Barton, Jacqueline K.


    A rhodium(III) complex, rac-[Rh(bpy)2phzi]3+ (bpy, 2,2′-bipyridine; phzi, benzo[a]phenazine-5,6-quinone diimine) has been designed as a sterically demanding intercalator targeted to destabilized mismatched sites in double-helical DNA. The complex is readily synthesized by condensation of the phenazine quinone with the corresponding diammine complex. Upon photoactivation, the complex promotes direct strand scission at single-base mismatch sites within the DNA duplex. As with the parent mismatch-specific reagent, [Rh(bpy)2(chrysi)]3+ [chrysene-5,6-quinone diimine (chrysi)], mismatch selectivity depends on the helix destabilization associated with mispairing. Unlike the parent chrysi complex, the phzi analogue binds and cleaves with high affinity and efficiency. The specific binding constants for CA, CC, and CT mismatches within a 31-mer oligonucleotide duplex are 0.3, 1, and 6 × 107 M−1, respectively; site-specific photocleavage is evident at nanomolar concentrations. Moreover, the specificity, defined as the ratio in binding affinities for mispaired vs. well paired sites, is maintained. The increase in affinity is attributed to greater stability in the mismatched site associated with stacking by the heterocyclic aromatic ligand. The high-affinity complex is also applied in the differential cleavage of DNA obtained from cell lines deficient in mismatch repair vs. those proficient in mismatch repair. Agreement is found between photocleavage by the mismatch-specific probes and deficiency in mismatch repair. This mismatch-specific targeting, therefore, offers a potential strategy for new chemotherapeutic design. PMID:12610209

  4. The high-affinity peptidoglycan binding domain of Pseudomonas phage endolysin KZ144

    Energy Technology Data Exchange (ETDEWEB)

    Briers, Yves [Division of Gene Technology, Department of Biosystems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, B-3001 Leuven (Belgium); Schmelcher, Mathias; Loessner, Martin J. [Institute of Food Science and Nutrition, ETH Zuerich, Schmelzbergstrasse 7, CH-8092 Zuerich (Switzerland); Hendrix, Jelle; Engelborghs, Yves [Laboratory of Biomolecular Dynamics, Department of Chemistry, Katholieke Universiteit Leuven, Celestijnenlaan 200G, B-3001 Leuven (Belgium); Volckaert, Guido [Division of Gene Technology, Department of Biosystems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, B-3001 Leuven (Belgium); Lavigne, Rob, E-mail: [Division of Gene Technology, Department of Biosystems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, B-3001 Leuven (Belgium)


    The binding affinity of the N-terminal peptidoglycan binding domain of endolysin KZ144 (PBD{sub KZ}), originating from Pseudomonas aeruginosa bacteriophage {phi}KZ, has been examined using a fusion protein of PBD{sub KZ} and green fluorescent protein (PBD{sub KZ}-GFP). A fluorescence recovery after photobleaching analysis of bound PBD{sub KZ}-GFP molecules showed less than 10% fluorescence recovery in the bleached area within 15 min. Surface plasmon resonance analysis confirmed this apparent high binding affinity revealing an equilibrium affinity constant of 2.95 x 10{sup 7} M{sup -1} for the PBD{sub KZ}-peptidoglycan interaction. This unique domain, which binds to the peptidoglycan of all tested Gram-negative species, was harnessed to improve the specific activity of the peptidoglycan hydrolase domain KMV36C. The chimeric peptidoglycan hydrolase (PBD{sub KZ}-KMV36C) exhibits a threefold higher specific activity than the native catalytic domain (KMV36C). These results demonstrate that the modular assembly of functional domains is a rational approach to improve the specific activity of endolysins from phages infecting Gram-negatives.

  5. High blood oxygen affinity in the air-breathing swamp eel Monopterus albus. (United States)

    Damsgaard, Christian; Findorf, Inge; Helbo, Signe; Kocagoz, Yigit; Buchanan, Rasmus; Huong, Do Thi Thanh; Weber, Roy E; Fago, Angela; Bayley, Mark; Wang, Tobias


    The Asian swamp eel (Monopterus albus, Zuiew 1793) is a facultative air-breathing fish with reduced gills. Previous studies have shown that gas exchange seems to occur across the epithelium of the buccopharyngeal cavity, the esophagus and the integument, resulting in substantial diffusion limitations that must be compensated by adaptations in others steps of the O₂ transport system to secure adequate O₂ delivery to the respiring tissues. We therefore investigated O₂ binding properties of whole blood, stripped hemoglobin (Hb), two major isoHb components and the myoglobin (Mb) from M. albus. Whole blood was sampled using indwelling catheters for blood gas analysis and determination of O₂ equilibrium curves. Hb was purified to assess the effects of endogenous allosteric effectors, and Mb was isolated from heart and skeletal muscle to determine its O₂ binding properties. The blood of M. albus has a high O₂ carrying capacity [hematocrit (Hct) of 42.4±4.5%] and binds O₂ with an unusually high affinity (P₅₀=2.8±0.4mmHg at 27°C and pH7.7), correlating with insensitivity of the Hb to the anionic allosteric effectors that normally decrease Hb-O₂ affinity. In addition, Mb is present at high concentrations in both heart and muscle (5.16±0.99 and 1.08±0.19mg ∙ g wet tissue⁻¹, respectively). We suggest that the high Hct and high blood O₂ affinity serve to overcome the low diffusion capacity in the relatively inefficient respiratory surfaces, while high Hct and Mb concentration aid in increasing the O₂ flux from the blood to the muscles. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Structural insights into a high affinity nanobody:antigen complex by homology modelling

    DEFF Research Database (Denmark)

    Skottrup, Peter Durand


    Porphyromonas gingivalis is a major periodontitis-causing pathogens. P. gingivalis secrete a cysteine protease termed RgpB, which is specific for Arg-Xaa bonds in substrates. Recently, a nanobody-based assay was used to demonstrate that RgpB could represent a novel diagnostic target, thereby...... simplifying. P. gingivalis detection. The nanobody, VHH7, had a high binding affinity and was specific for RgpB, when tested towards the highly identical RgpA. In this study a homology model of VHH7 was build. The complementarity determining regions (CDR) comprising the paratope residues responsible for Rgp...

  7. High-aluminum-affinity silica is a nanoparticle that seeds secondary aluminosilicate formation.

    Directory of Open Access Journals (Sweden)

    Ravin Jugdaohsingh

    Full Text Available Despite the importance and abundance of aluminosilicates throughout our natural surroundings, their formation at neutral pH is, surprisingly, a matter of considerable debate. From our experiments in dilute aluminum and silica containing solutions (pH ~ 7 we previously identified a silica polymer with an extraordinarily high affinity for aluminium ions (high-aluminum-affinity silica polymer, HSP. Here, further characterization shows that HSP is a colloid of approximately 2.4 nm in diameter with a mean specific surface area of about 1,000 m(2 g(-1 and it competes effectively with transferrin for Al(III binding. Aluminum binding to HSP strongly inhibited its decomposition whilst the reaction rate constant for the formation of the β-silicomolybdic acid complex indicated a diameter between 3.6 and 4.1 nm for these aluminum-containing nanoparticles. Similarly, high resolution microscopic analysis of the air dried aluminum-containing silica colloid solution revealed 3.9 ± 1.3 nm sized crystalline Al-rich silica nanoparticles (ASP with an estimated Al:Si ratio of between 2 and 3 which is close to the range of secondary aluminosilicates such as imogolite. Thus the high-aluminum-affinity silica polymer is a nanoparticle that seeds early aluminosilicate formation through highly competitive binding of Al(III ions. In niche environments, especially in vivo, this may serve as an alternative mechanism to polyhydroxy Al(III species binding monomeric silica to form early phase, non-toxic aluminosilicates.

  8. High-Aluminum-Affinity Silica Is a Nanoparticle That Seeds Secondary Aluminosilicate Formation (United States)

    Jugdaohsingh, Ravin; Brown, Andy; Dietzel, Martin; Powell, Jonathan J.


    Despite the importance and abundance of aluminosilicates throughout our natural surroundings, their formation at neutral pH is, surprisingly, a matter of considerable debate. From our experiments in dilute aluminum and silica containing solutions (pH ~ 7) we previously identified a silica polymer with an extraordinarily high affinity for aluminium ions (high-aluminum-affinity silica polymer, HSP). Here, further characterization shows that HSP is a colloid of approximately 2.4 nm in diameter with a mean specific surface area of about 1,000 m2 g-1 and it competes effectively with transferrin for Al(III) binding. Aluminum binding to HSP strongly inhibited its decomposition whilst the reaction rate constant for the formation of the β-silicomolybdic acid complex indicated a diameter between 3.6 and 4.1 nm for these aluminum-containing nanoparticles. Similarly, high resolution microscopic analysis of the air dried aluminum-containing silica colloid solution revealed 3.9 ± 1.3 nm sized crystalline Al-rich silica nanoparticles (ASP) with an estimated Al:Si ratio of between 2 and 3 which is close to the range of secondary aluminosilicates such as imogolite. Thus the high-aluminum-affinity silica polymer is a nanoparticle that seeds early aluminosilicate formation through highly competitive binding of Al(III) ions. In niche environments, especially in vivo, this may serve as an alternative mechanism to polyhydroxy Al(III) species binding monomeric silica to form early phase, non-toxic aluminosilicates. PMID:24349573

  9. The monoclonal S9.6 antibody exhibits highly variable binding affinities towards different R-loop sequences.

    Directory of Open Access Journals (Sweden)

    Fabian König

    Full Text Available The monoclonal antibody S9.6 is a widely-used tool to purify, analyse and quantify R-loop structures in cells. A previous study using the surface plasmon resonance technology and a single-chain variable fragment (scFv of S9.6 showed high affinity (0.6 nM for DNA-RNA and also a high affinity (2.7 nM for RNA-RNA hybrids. We used the microscale thermophoresis method allowing surface independent interaction studies and electromobility shift assays to evaluate additional RNA-DNA hybrid sequences and to quantify the binding affinities of the S9.6 antibody with respect to distinct sequences and their GC-content. Our results confirm high affinity binding to previously analysed sequences, but reveals that binding affinities are highly sequence specific. Our study presents R-loop sequences that independent of GC-content and in different sequence variations exhibit either no binding, binding affinities in the micromolar range and as well high affinity binding in the nanomolar range. Our study questions the usefulness of the S9.6 antibody in the quantitative analysis of R-loop sequences in vivo.

  10. High-throughput bioscreening system utilizing high-performance affinity magnetic carriers exhibiting minimal non-specific protein binding

    International Nuclear Information System (INIS)

    Hanyu, Naohiro; Nishio, Kosuke; Hatakeyama, Mamoru; Yasuno, Hiroshi; Tanaka, Toshiyuki; Tada, Masaru; Nakagawa, Takashi; Sandhu, Adarsh; Abe, Masanori; Handa, Hiroshi


    For affinity purification of drug target protein we have developed magnetic carriers, narrow in size distribution (184±9 nm), which exhibit minimal non-specific binding of unwanted proteins. The carriers were highly dispersed in aqueous solutions and highly resistant to organic solvents, which enabled immobilization of various hydrophobic chemicals as probes on the carrier surfaces. Utilizing the carriers we have automated the process of separation and purification of the target proteins that had been done by manual operation previously.

  11. A Novel Recombinant DNA System for High Efficiency Affinity Purification of Proteins in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Brian H. Carrick


    Full Text Available Isolation of endogenous proteins from Saccharomyces cerevisiae has been facilitated by inserting encoding polypeptide affinity tags at the C-termini of chromosomal open reading frames (ORFs using homologous recombination of DNA fragments. Tagged protein isolation is limited by a number of factors, including high cost of affinity resins for bulk isolation and low concentration of ligands on the resin surface, leading to low isolation efficiencies and trapping of contaminants. To address this, we have created a recombinant “CelTag” DNA construct from which PCR fragments can be created to easily tag C-termini of S. cerevisiae ORFs using selection for a nat1 marker. The tag has a C-terminal cellulose binding module to be used in the first affinity step. Microgranular cellulose is very inexpensive and has an effectively continuous ligand on its surface, allowing rapid, highly efficient purification with minimal background. Cellulose-bound proteins are released by specific cleavage of an included site for TEV protease, giving nearly pure product. The tag can be lifted from the recombinant DNA construct either with or without a 13x myc epitope tag between the target ORF and the TEV protease site. Binding of CelTag protein fusions to cellulose is stable to high salt, nonionic detergents, and 1 M urea, allowing stringent washing conditions to remove loosely associated components, as needed, before specific elution. It is anticipated that this reagent could allow isolation of protein complexes from large quantities of yeast extract, including soluble, membrane-bound, or nucleic acid-associated assemblies.

  12. Effect of quinolinic acid in the nucleus basalis magnocellularis on cortical high-affinity choline uptake

    Energy Technology Data Exchange (ETDEWEB)

    Metcalf, R.H.; Boegman, R.J.; Quirion, R.; Riopelle, R.J.; Ludwin, S.K.


    A transient 45% increase in cortical high-affinity choline uptake (HACU) was observed after an injection of quinolinic acid (QUIN) into the nucleus basalis magnocellularis (nbM) of the rat. This was followed by a steady decline in choline uptake, which resulted in a 46% decrease by day 7. Specific (/sup 3/H)hemicholinium-3 binding to coronal brain sections showed a similar pattern following injections of QUIN into the nbM. The increase in cortical HACU elicited by QUIN appeared to be dose dependent.

  13. Novel and high affinity fluorescent ligands for the serotonin transporter based on (s)-citalopram

    DEFF Research Database (Denmark)

    Kumar, Vivek; Rahbek-Clemmensen, Troels; Billesbølle, Christian B


    Novel rhodamine-labeled ligands, based on (S)-citalopram, were synthesized and evaluated for uptake inhibition at the human serotonin, dopamine, and norepinephrine transporters (hSERT, hDAT, and hNET, respectively) and for binding at SERT, in transiently transfected COS7 cells. Compound 14 demons...... demonstrated high affinity binding and selectivity for SERT (K i = 3 nM). Visualization of SERT, using confocal laser scanning microscopy, validated compound 14 as a novel tool for studying SERT expression and distribution in living cells....

  14. Antibody Binding Selectivity: Alternative Sets of Antigen Residues Entail High-Affinity Recognition.

    Directory of Open Access Journals (Sweden)

    Yves Nominé

    Full Text Available Understanding the relationship between protein sequence and molecular recognition selectivity remains a major challenge. The antibody fragment scFv1F4 recognizes with sub nM affinity a decapeptide (sequence 6TAMFQDPQER15 derived from the N-terminal end of human papilloma virus E6 oncoprotein. Using this decapeptide as antigen, we had previously shown that only the wild type amino-acid or conservative replacements were allowed at positions 9 to 12 and 15 of the peptide, indicating a strong binding selectivity. Nevertheless phenylalanine (F was equally well tolerated as the wild type glutamine (Q at position 13, while all other amino acids led to weaker scFv binding. The interfaces of complexes involving either Q or F are expected to diverge, due to the different physico-chemistry of these residues. This would imply that high-affinity binding can be achieved through distinct interfacial geometries. In order to investigate this point, we disrupted the scFv-peptide interface by modifying one or several peptide positions. We then analyzed the effect on binding of amino acid changes at the remaining positions, an altered susceptibility being indicative of an altered role in complex formation. The 23 starting variants analyzed contained replacements whose effects on scFv1F4 binding ranged from minor to drastic. A permutation analysis (effect of replacing each peptide position by all other amino acids except cysteine was carried out on the 23 variants using the PEPperCHIP® Platform technology. A comparison of their permutation patterns with that of the wild type peptide indicated that starting replacements at position 11, 12 or 13 modified the tolerance to amino-acid changes at the other two positions. The interdependence between the three positions was confirmed by SPR (Biacore® technology. Our data demonstrate that binding selectivity does not preclude the existence of alternative high-affinity recognition modes.

  15. Structural insights into a high affinity nanobody:antigen complex by homology modelling. (United States)

    Skottrup, Peter Durand


    Porphyromonas gingivalis is a major periodontitis-causing pathogens. P. gingivalis secrete a cysteine protease termed RgpB, which is specific for Arg-Xaa bonds in substrates. Recently, a nanobody-based assay was used to demonstrate that RgpB could represent a novel diagnostic target, thereby simplifying. P. gingivalis detection. The nanobody, VHH7, had a high binding affinity and was specific for RgpB, when tested towards the highly identical RgpA. In this study a homology model of VHH7 was build. The complementarity determining regions (CDR) comprising the paratope residues responsible for RgpB binding were identified and used as input to the docking. Furthermore, residues likely involved in the RgpB epitope was identified based upon RgpB:RgpA alignment and analysis of residue surface accessibility. CDR residues and putitative RgpB epitope residues were used as input to an information-driven flexible docking approach using the HADDOCK server. Analysis of the VHH7:RgpB model demonstrated that the epitope was found in the immunoglobulin-like domain and residue pairs located at the molecular paratope:epitope interface important for complex stability was identified. Collectively, the VHH7 homology model and VHH7:RgpB docking supplies knowledge of the residues involved in the high affinity interaction. This information could prove valuable in the design of an antibody-drug conjugate for specific RgpB targeting. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity. (United States)

    Wang, Deng-Liang; Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan; Yang, Hai-Tao; Wang, Jiang-Jie; Yao, Pei-Sen; Pan, Ru-Jun; Yang, Chaoyong James; Kang, De-Zhi


    Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher's attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with Kd 56±7.3nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Fenobody: A Ferritin-Displayed Nanobody with High Apparent Affinity and Half-Life Extension. (United States)

    Fan, Kelong; Jiang, Bing; Guan, Zhe; He, Jiuyang; Yang, Dongling; Xie, Ni; Nie, Guohui; Xie, Can; Yan, Xiyun


    Nanobodies consist of a single domain variable fragment of a camelid heavy-chain antibody. Nanobodies have potential applications in biomedical fields because of their simple production procedures and low cost. Occasionally, nanobody clones of interest exhibit low affinities for their target antigens, which, together with their short half-life limit bioanalytical or therapeutic applications. Here, we developed a novel platform we named fenobody, in which a nanobody developed against H5N1 virus is displayed on the surface of ferritin in the form of a 24mer. We constructed a fenobody by substituting the fifth helix of ferritin with the nanobody. TEM analysis showed that nanobodies were displayed on the surface of ferritin in the form of 6 × 4 bundles, and that these clustered nanobodies are flexible for antigen binding in spatial structure. Comparing fenobodies with conventional nanobodies currently used revealed that the antigen binding apparent affinity of anti-H5N1 fenobody was dramatically increased (∼360-fold). Crucially, their half-life extension in a murine model was 10-fold longer than anti-H5N1 nanobody. In addition, we found that our fenobodies are highly expressed in Escherichia coli, and are both soluble and thermo-stable nanocages that self-assemble as 24-polymers. In conclusion, our results demonstrate that fenobodies have unique advantages over currently available systems for apparent affinity enhancement and half-life extension of nanobodies. Our fenobody system presents a suitable platform for various large-scale biotechnological processes and should greatly facilitate the application of nanobody technology in these areas.

  18. Endothelial targeting of high-affinity multivalent polymer nanocarriers directed to intercellular adhesion molecule 1. (United States)

    Muro, Silvia; Dziubla, Thomas; Qiu, Weining; Leferovich, John; Cui, Xiumin; Berk, Erik; Muzykantov, Vladimir R


    Targeting of diagnostic and therapeutic agents to endothelial cells (ECs) provides an avenue to improve treatment of many maladies. For example, intercellular adhesion molecule 1 (ICAM-1), a constitutive endothelial cell adhesion molecule up-regulated in many diseases, is a good determinant for endothelial targeting of therapeutic enzymes and polymer nanocarriers (PNCs) conjugated with anti-ICAM (anti-ICAM/PNCs). However, intrinsic and extrinsic factors that control targeting of anti-ICAM/PNCs to ECs (e.g., anti-ICAM affinity and PNC valency and flow) have not been defined. In this study we tested in vitro and in vivo parameters of targeting to ECs of anti-ICAM/PNCs consisting of either prototype polystyrene or biodegradable poly(lactic-coglycolic) acid polymers (approximately 200 nm diameter spheres carrying approximately 200 anti-ICAM molecules). Anti-ICAM/PNCs, but not control IgG/PNCs 1) rapidly (t1/2 approximately 5 min) and specifically bound to tumor necrosis factor-activated ECs in a dose-dependent manner (Bmax approximately 350 PNC/cell) at both static and physiological shear stress conditions and 2) bound to ECs and accumulated in the pulmonary vasculature after i.v. injection in mice. Anti-ICAM/PNCs displayed markedly higher EC affinity versus naked anti-ICAM (Kd approximately 80 pM versus approximately 8 nM) in cell culture and, probably because of this factor, higher value (185.3 +/- 24.2 versus 50.5 +/- 1.5% injected dose/g) and selectivity (lung/blood ratio 81.0 +/- 10.9 versus 2.1 +/- 0.02, in part due to faster blood clearance) of pulmonary targeting. These results 1) show that reformatting monomolecular anti-ICAM into high-affinity multivalent PNCs boosts their vascular immuno-targeting, which withstands physiological hydrodynamics and 2) support potential anti-ICAM/PNCs utility for medical applications.

  19. Characterization of high affinity [3H]triazolam binding in rat brain

    International Nuclear Information System (INIS)

    Earle, M.; Concas, A.; Yamamura, H.I.


    The hypnotic Triazolam (TZ), a triazolo (1,4)-benzodiazepine, displays a short physiological half life and has been used for the treatment of insomnia related to anxiety states. Specific binding properties of this recently tritiated TZ were characterized. The authors major objectives were the direct measurement of the temperature dependence and the GABA effect on [ 3 H]TZ binding. Saturation studies showed a shift to lower affinity at 37 0 C (K/sub d/ = 0.25 +/- 0.01 nM at O 0 C; K/sub d/ = 1.46 +/- 0.03 nM at 37 0 C) while the B/sub max/ values remained unchanged (1003 +/- 37 fmoles/mg prot. at 0 0 C and 1001 +/- 43 fmoles/mg prot. at 37 0 C). Inhibition studies showed that [ 3 H]TZ binding displayed no GABA shift at 0 0 C(K/sub i/ 0.37 +/- 0.03 nM/- GABA and K/sub i/ = 0.55 +/- 0.13 nM/+GABA) but a nearly two-fold shift was apparent at 37 0 C (K/sub i/ = 2.92 +/- 0.2 nM/-GABA; K/sub i/ = 1.37 +/- 0.11 mM/+GABA). These results were also confirmed by saturation studies in the presence or absence of GABA showing a shift to higher affinity in the presence of GABA only at 37 0 C. In Ro 15-1788/[ 3 H]TZ competition experiments the presence of GABA did not affect the inhibitory potency of Ro 15-1788 on [ 3 H]TZ binding at both temperatures. In conclusion [ 3 H]TZ binding showed an extremely high affinity for benzodiazepine receptors. In contrast to reported literature, the findings suggest that TZ interacts with benzodiazepine receptors similar to other benzodiazepine agonists

  20. Acylated heptapeptide binds albumin with high affinity and application as tag furnishes long-acting peptides. (United States)

    Zorzi, Alessandro; Middendorp, Simon J; Wilbs, Jonas; Deyle, Kaycie; Heinis, Christian


    The rapid renal clearance of peptides in vivo limits this attractive platform for the treatment of a broad range of diseases that require prolonged drug half-lives. An intriguing approach for extending peptide circulation times works through a 'piggy-back' strategy in which peptides bind via a ligand to the long-lived serum protein albumin. In accordance with this strategy, we developed an easily synthesized albumin-binding ligand based on a peptide-fatty acid chimera that has a high affinity for human albumin (K d =39 nM). This ligand prolongs the elimination half-life of cyclic peptides in rats 25-fold to over seven hours. Conjugation to a peptide factor XII inhibitor developed for anti-thrombotic therapy extends the half-life from 13 minutes to over five hours, inhibiting coagulation for eight hours in rabbits. This high-affinity albumin ligand could potentially extend the half-life of peptides in human to several days, substantially broadening the application range of peptides as therapeutics.

  1. High-Affinity Accumulation of Chloroquine by Mouse Erythrocytes Infected with Plasmodium berghei (United States)

    Fitch, Coy D.; Yunis, Norman G.; Chevli, Rekha; Gonzalez, Yolanda


    Washed erythrocytes infected with chloroquine-susceptible (CS) or with chloroquine-resistant (CR) P. berghei were used in model systems in vitro to study the accumulation of chloroquine with high affinity. The CS model could achieve distribution ratios (chloroquine in cells: chloroquine in medium) of 100 in the absence of substrate. 200—300 in the presence of 10 mM pyruvate or lactate, and over 600 in the presence of 1 mM glucose or glycerol. In comparable studies of the CR model, the distribution ratios were 100 in the absence of substrate and 300 or less in the presence of glucose or glycerol. The presence of lactate stimulated chloroquine accumulation in the CR model, whereas the presence of pyruvate did not. Lactate production from glucose and glycerol was undiminished in the CR model, and ATP concentrations were higher than in the CS model. Cold, iodoacetate, 2,4-dinitrophenol, or decreasing pH inhibited chloroquine accumulation in both models. These findings demonstrate substrate involvement in the accumulation of chloroquine with high affinity. In studies of the CS model, certain compounds competitively inhibited chloroquine accumulation, while others did not. This finding is attributable to a specific receptor that imposes structural constraints on the process of accumulation. For chloroquine analogues, the position and length of the side chain, the terminal nitrogen atom of the side chain, and the nitrogen atom in the quinoline ring are important determinants of binding to this receptor. PMID:4600044

  2. High-affinity receptors for bombesin-like peptides in normal guinea pig lung membranes

    International Nuclear Information System (INIS)

    Lach, E.; Trifilieff, A.; Landry, Y.; Gies, J.P.


    The binding of the radiolabeled bombesin analogue [ 125 I-Tyr 4 ]bombesin to guinea-pig lung membranes was investigated. Binding of [ 125 I-Tyr 4 ]bombesin was specific, saturable, reversible and linearly related to the protein concentration. Scatchard analysis of equilibrium binding data at 25C indicated the presence of a single class of non-interacting binding sites for bombesin (B max = 7.7 fmol/mg protein). The value of the equilibrium dissociation constant (K D = 90 pM) agrees with a high-affinity binding site. Bombesin and structurally related peptides such as [ 125 I-Tyr 4 ]bombesin, neuromedin B and neuromedin C inhibited the binding of [ 125 I-Tyr 4 ]bombesin in an order of potencies as follows: [ 125 I-Tyr 4 ]bombesin > bombesin ≥ neuromedin C much-gt neuromedin B. These results indicate that guinea-pig lung membranes possess a single class of bombesin receptors with a high affinity for bombesin and a lower one for neuromedin B

  3. Synthesis of site-heterologous haptens for high-affinity anti-pyraclostrobin antibody generation. (United States)

    Mercader, Josep V; Agulló, Consuelo; Abad-Somovilla, Antonio; Abad-Fuentes, Antonio


    The design and synthesis of functional chemical derivatives of small organic molecules is usually a key step for the intricate production of a variety of bioconjugates. In this respect, the derivatization site at which the spacer arm is introduced in immunizing conjugates constitutes a highly critical parameter for the generation of high-affinity and selective antibodies. However, due to the usual complexity of the required synthetic procedures, the appropriate comparison of alternative tethering positions has often been neglected. In the present study, meticulous strategies were followed to prepare synthetic derivatives of pyraclostrobin with the same linkers located at diverse rationally-chosen sites. Activity appraisal of antibodies and bioconjugates was carried out by bidimensional competitive direct and indirect immunoassays, and a superior performance of two of the three synthesized haptens was found. Finally, a detailed analysis of the conformations of the target molecule and the synthesized haptens in aqueous solution was done using computer assisted molecular modeling techniques. This study suggested that the lower titers and affinities of one set of antibodies are most probably due to conformational effects of the spacer arm in the immunizing bioconjugate.

  4. Reconstitution of high affinity α2 adrenergic agonist binding by fusion with a pertussis toxin substrate

    International Nuclear Information System (INIS)

    Kim, M.H.; Neubig, R.R.


    High affinity α 2 adrenergic agonist binding is thought to occur via a coupling of the α 2 receptor with N/sub i/, the inhibitory guanyl nucleotide binding protein. Human platelet membranes pretreated at pH 11.5 exhibit a selective inactivation of agonist binding and N/sub i/. To further study the mechanism of agonist binding, alkali treated membranes (ATM) were mixed with membranes pretreated with 10 μM phenoxybenzamine to block α 2 receptors (POB-M). The combined membrane pellet was incubated in 50% polyethylene glycol (PEG) to promote membrane-membrane fusion and assayed for binding to the α 2 agonist [ 3 H]UK 14,304 (UK) and the antagonist [ 3 H] yohimbine. PEG treatment resulted in a 2-4 fold enhancement of UK binding whereas yohimbine binding was unchanged. No enhancement of UK binding was observed in the absence of PEG treatment. The reconstitution was dependent on the addition of POB-M. They found that a 1:1 ratio of POB-M:ATM was optimal. Reconstituted binding was inhibited by GppNHp. Fusion of rat C6 glioma cell membranes, which do not contain α 2 receptors, also enhanced agonist binding to ATM. Fusion of C6 membranes from cells treated with pertussis toxin did not enhance [ 3 H] UK binding. These data show that a pertussis toxin sensitive membrane component, possibly N/sub i/, can reconstitute high affinity α 2 agonist binding

  5. Acylated heptapeptide binds albumin with high affinity and application as tag furnishes long-acting peptides (United States)

    Zorzi, Alessandro; Middendorp, Simon J.; Wilbs, Jonas; Deyle, Kaycie; Heinis, Christian


    The rapid renal clearance of peptides in vivo limits this attractive platform for the treatment of a broad range of diseases that require prolonged drug half-lives. An intriguing approach for extending peptide circulation times works through a `piggy-back' strategy in which peptides bind via a ligand to the long-lived serum protein albumin. In accordance with this strategy, we developed an easily synthesized albumin-binding ligand based on a peptide-fatty acid chimera that has a high affinity for human albumin (Kd=39 nM). This ligand prolongs the elimination half-life of cyclic peptides in rats 25-fold to over seven hours. Conjugation to a peptide factor XII inhibitor developed for anti-thrombotic therapy extends the half-life from 13 minutes to over five hours, inhibiting coagulation for eight hours in rabbits. This high-affinity albumin ligand could potentially extend the half-life of peptides in human to several days, substantially broadening the application range of peptides as therapeutics.

  6. Identification of high- and low-affinity NGF receptors during development of the chicken central nervous system

    International Nuclear Information System (INIS)

    Escandon, E.; Chao, M.V.


    In order to study regulation of the nerve growth factor (NGF) receptor during embryogenesis in chick brain, we have used affinity crosslinking of tissues with 125 I-NGF. NGF interacts with high- and low-affinity receptors; high-affinity receptors are required for the majority of NGF's actions. Most measurements of receptor levels do not distinguish between high- and low-affinity forms of the receptor. We have used the lipophilic crosslinking agent HSAB to identify the high-affinity, functional receptor during development of the chicken central nervous system. A peak of expression during Embryonic Days 5-10 was detected in all regions of the chicken central nervous system, but, shortly after birth, only the cerebellar region displays significant levels of NGF receptor protein. The time course of expression confirms the dramatic regulation of the NGF receptor gene during defined embryonic periods. The detection of high-affinity NGF receptors in brain and neural retina provides strong evidence that NGF is involved in essential ontogenetic events in the development of the chicken central nervous system

  7. Characterization of a high affinity cocaine binding site in rat brain

    International Nuclear Information System (INIS)

    Calligaro, D.; Eldefrawi, M.


    Binding of [ 3 H]cocaine to synaptic membranes from whole rat brain was reversible and saturable. Nonlinear regression analysis of binding isotherms indicated two binding affinities: one with k/sub d/ = 16 nM, B/sub max/ = 0.65 pmoles/mg protein and the other with K/sub d/ = 660 nM, B/sub max/ = 5.1 pmoles/mg protein. The high-affinity binding of [ 3 H]cocaine was sensitive to the actions of trypsin and chymotrypsin but not carboxypeptidase, and was eliminated by exposure of the membranes to 95 0 C for 5 min. Specific binding at 2 nM was higher at pH 8.8 than at pH 7.0. Binding of [ 3 H]cocaine (15 nM) was inhibited by increasing concentrations of Na + ions. Several cocaine analogues, neurotransmitter uptake inhibitors and local anesthetics displaced specific [ 3 H]cocaine binding at 2 nM with various potencies. The cocaine analogue (-)-norcocaine was the most potent (IC 50 = 10 nM), while the local anesthetic tetracaine was the least potent in inhibiting [ 3 H]cocaine binding. Several biogenic amine uptake inhibitors, including tricyclic antidepressants and phencyclidine, had IC 50 values below μM concentrations

  8. High-affinity binding of two molecules of cysteine proteinases to low-molecular-weight kininogen. (United States)

    Turk, B.; Stoka, V.; Björk, I.; Boudier, C.; Johansson, G.; Dolenc, I.; Colic, A.; Bieth, J. G.; Turk, V.


    Human low-molecular-weight kininogen (LK) was shown by fluorescence titration to bind two molecules of cathepsins L and S and papain with high affinity. By contrast, binding of a second molecule of cathepsin H was much weaker. The 2:1 binding stoichiometry was confirmed by titration monitored by loss of enzyme activity and by sedimentation velocity experiments. The kinetics of binding of cathepsins L and S and papain showed the two proteinase binding sites to have association rate constants kass,1 = 10.7-24.5 x 10(6) M-1 s-1 and kass,2 = 0.83-1.4 x 10(6) M-1 s-1. Comparison of these kinetic constants with previous data for intact LK and its separated domains indicate that the faster-binding site is also the tighter-binding site and is present on domain 3, whereas the slower-binding, lower-affinity site is on domain 2. These results also indicate that there is no appreciable steric hindrance for the binding of proteinases between the two binding sites or from the kininogen light chain. PMID:8528085

  9. Cyclic GMP-AMP Containing Mixed Phosphodiester Linkages Is An Endogenous High Affinity Ligand for STING (United States)

    Zhang, Xu; Shi, Heping; Wu, Jiaxi; Zhang, Xuewu; Sun, Lijun; Chen, Chuo; Chen, Zhijian J.


    The presence of microbial or self DNA in the cytoplasm of mammalian cells is a danger signal detected by the DNA sensor cyclic-GMP-AMP (cGAMP) synthase (cGAS), which catalyzes the production of cGAMP that in turn serves as a second messenger to activate innate immune responses. Here we show that endogenous cGAMP in mammalian cells contains two distinct phosphodiester linkages, one between 2′-OH of GMP and 5′-phosphate of AMP, and the other between 3′-OH of AMP and 5′-phosphate of GMP. This molecule, termed 2′3′-cGAMP, is unique in that it binds to the adaptor protein STING with a much greater affinity than cGAMP molecules containing other combinations of phosphodiester linkages. The crystal structure of STING bound to 2′3′-cGAMP revealed the structural basis of this high-affinity binding and a ligand-induced conformational change in STING that may underlie its activation. PMID:23747010

  10. Identification of a High Affinity Nucleocapsid Protein Binding Element from The Bovine Leukemia Virus Genome (United States)

    Yildiz, F. Zehra; Babalola, Kathleen; Summers, Michael F.


    Retroviral genome recognition is mediated by interactions between the nucleocapsid (NC) domain of the virally encoded Gag polyprotein and cognate RNA packaging elements that, for most retroviruses, appear to reside primarily within the 5′-untranslated region (5′-UTR) of the genome. Recent studies suggest that a major packaging determinant of Bovine Leukemia Virus (BLV), a member of the human T-cell leukemia virus (HTLV)/BLV family and a non-primate animal model for HTLV-induced leukemogenesis, resides within the gag open reading frame. We have prepared and purified the recombinant BLV NC protein and conducted electrophoretic mobility shift and isothermal titration calorimetry studies with RNA fragments corresponding to these proposed packaging elements. The gag-derived RNAs did not exhibit significant affinity for NC, suggesting an alternate role in packaging. However, an 83-nucleotide fragment of the 5′-UTR that resides just upstream of the gag start codon binds NC stoichiometrically and with high affinity (Kd = 136 ± 21 nM). These nucleotides were predicted to form tandem hairpin structures, and studies with smaller fragments indicate that the NC binding site resides exclusively within the distal hairpin (residues G369- U399, Kd = 67 ± 8 nM at physiological ionic strength). Unlike all other structurally characterized retroviral NC binding RNAs, this fragment is not expected to contain exposed guanosines, suggesting that RNA binding may be mediated by a previously uncharacterized mechanism. PMID:22846919

  11. Identification of high-affinity calmodulin-binding proteins in rat liver

    International Nuclear Information System (INIS)

    Hanley, R.M.; Dedman, J.R.; Shenolikar, S.


    The Ca 2+ -dependent binding of [ 125 I] calmodulin (CaM) to hepatic proteins separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was utilized to identify CaM binding or acceptor proteins or CAPs. Two proteins of apparent molecular weight of 60,000 (CAP-60) and 45,000 (CAP-45) comprised > 80% of the Ca 2+ -dependent CaM binding in rat liver cytosol. CAP-60 and CAP-45 were partially purified by a variety of chromatographic steps, including affinity chromatography on CaM Sepharose. CAP-60 possessed a native molecular size of 400,000, indicating it to be the CaM-binding subunit of a larger oligomeric complex. In contrast, CAP-45 was monomeric as judged by gel filtration. Neither CAP-60 nor CAP-45 possessed chromatographic properties consistent with known CaM-dependent enzymes reported in the literature. Two-dimensional peptide mapping provided convincing evidence that CAP-60 and CAP-45 were unrelated to other well-characterized CAPs, namely Ca 2+ (CaM)-dependent protein kinase II, calcineurin, or the CaM-dependent cyclic nucleotide phosphodiesterase. The relative abundance and high affinity for CaM could suggest that these novel target proteins, CAP-60 and CAP-45, represent a dominant pathway for CaM action in the mammalian liver

  12. High affinity soluble ILT2 receptor: a potent inhibitor of CD8(+) T cell activation. (United States)

    Moysey, Ruth K; Li, Yi; Paston, Samantha J; Baston, Emma E; Sami, Malkit S; Cameron, Brian J; Gavarret, Jessie; Todorov, Penio; Vuidepot, Annelise; Dunn, Steven M; Pumphrey, Nicholas J; Adams, Katherine J; Yuan, Fang; Dennis, Rebecca E; Sutton, Deborah H; Johnson, Andy D; Brewer, Joanna E; Ashfield, Rebecca; Lissin, Nikolai M; Jakobsen, Bent K


    Using directed mutagenesis and phage display on a soluble fragment of the human immunoglobulin super-family receptor ILT2 (synonyms: LIR1, MIR7, CD85j), we have selected a range of mutants with binding affinities enhanced by up to 168,000-fold towards the conserved region of major histocompatibility complex (MHC) class I molecules. Produced in a dimeric form, either by chemical cross-linking with bivalent polyethylene glycol (PEG) derivatives or as a genetic fusion with human IgG Fc-fragment, the mutants exhibited a further increase in ligand-binding strength due to the avidity effect, with resident half-times (t(1/2)) on the surface of MHC I-positive cells of many hours. The novel compounds antagonized the interaction of CD8 co-receptor with MHC I in vitro without affecting the peptide-specific binding of T-cell receptors (TCRs). In both cytokine-release assays and cell-killing experiments the engineered receptors inhibited the activation of CD8(+) cytotoxic T lymphocytes (CTLs) in the presence of their target cells, with subnanomolar potency and in a dose-dependent manner. As a selective inhibitor of CD8(+) CTL responses, the engineered high affinity ILT2 receptor presents a new tool for studying the activation mechanism of different subsets of CTLs and could have potential for the development of novel autoimmunity therapies.

  13. New immunogenic form for vasopressin: production of high-affinity antiserum and RIA for plasmatic AVP

    International Nuclear Information System (INIS)

    Rougon-Rappuzi, G.; Delaage, M.A.; Conte-Devolx, B.; Millet, Y.


    A highly sensitive and specific radioimmunoassay (RIA) for arginine-vasopressin (AVP) was developped and applied to the measurement of AVP in human plasma. High-affinity antivasopressin antibodies with limited association constant heterogeneity have been induced by immunizing rabbits with Lysine-vasopressine (LVP) coupled to a human immunoglobulin (IgA). Replacing air drying of acetone-petroleum ether extracts by lyophilisation increased significantly the yields of AVP. Equilibrium dialysis was used for separating bound and free antigen, thus reducing the total time required for the assay to 48 hours. Only 1 ml of plasma was required for routine determinations due to a sensitivity threshold better than 0.5 pg/ml. Plasma AVP levels of normal subjects and of patients with inappropriate ADH secretion (SIADH) were determined during different hydratation states and following nicotin of ethanol infusions. (orig.) [de

  14. Thermodynamic basis for engineering high-affinity, high-specificity binding-induced DNA clamp nanoswitches. (United States)

    Idili, Andrea; Plaxco, Kevin W; Vallée-Bélisle, Alexis; Ricci, Francesco


    Naturally occurring chemoreceptors almost invariably employ structure-switching mechanisms, an observation that has inspired the use of biomolecular switches in a wide range of artificial technologies in the areas of diagnostics, imaging, and synthetic biology. In one mechanism for generating such behavior, clamp-based switching, binding occurs via the clamplike embrace of two recognition elements onto a single target molecule. In addition to coupling recognition with a large conformational change, this mechanism offers a second advantage: it improves both affinity and specificity simultaneously. To explore the physics of such switches we have dissected here the thermodynamics of a clamp-switch that recognizes a target DNA sequence through both Watson-Crick base pairing and triplex-forming Hoogsteen interactions. When compared to the equivalent linear DNA probe (which relies solely on Watson-Crick interactions), the extra Hoogsteen interactions in the DNA clamp-switch increase the probe's affinity for its target by ∼0.29 ± 0.02 kcal/mol/base. The Hoogsteen interactions of the clamp-switch likewise provide an additional specificity check that increases the discrimination efficiency toward a single-base mismatch by 1.2 ± 0.2 kcal/mol. This, in turn, leads to a 10-fold improvement in the width of the "specificity window" of this probe relative to that of the equivalent linear probe. Given these attributes, clamp-switches should be of utility not only for sensing applications but also, in the specific field of DNA nanotechnology, for applications calling for a better control over the building of nanostructures and nanomachines.

  15. Affinity imaging mass spectrometry (AIMS): high-throughput screening for specific small molecule interactions with frozen tissue sections. (United States)

    Yoshimi, T; Kawabata, S; Taira, S; Okuno, A; Mikawa, R; Murayama, S; Tanaka, K; Takikawa, O


    A novel screening system, using affinity imaging mass spectrometry (AIMS), has been developed to identify protein aggregates or organ structures in unfixed human tissue. Frozen tissue sections are positioned on small (millimetre-scale) stainless steel chips and incubated with an extensive library of small molecules. Candidate molecules showing specific affinity for the tissue section are identified by imaging mass spectrometry (IMS). As an example application, we screened over a thousand compounds against Alzheimer's disease (AD) brain tissue and identified several compounds with high affinity for AD brain sections containing tau deposits compared to age-matched controls. It should also be possible to use AIMS to isolate chemical compounds with affinity for tissue structures or components that have been extensively modified by events such as oxidation, phosphorylation, acetylation, aggregation, racemization or truncation, for example, due to aging. It may also be applicable to biomarker screening programs.

  16. Botulinum neurotoxin B recognizes its protein receptor with high affinity and specificity. (United States)

    Jin, Rongsheng; Rummel, Andreas; Binz, Thomas; Brunger, Axel T


    Botulinum neurotoxins (BoNTs) are produced by Clostridium botulinum and cause the neuroparalytic syndrome of botulism. With a lethal dose of 1 ng kg(-1), they pose a biological hazard to humans and a serious potential bioweapon threat. BoNTs bind with high specificity at neuromuscular junctions and they impair exocytosis of synaptic vesicles containing acetylcholine through specific proteolysis of SNAREs (soluble N-ethylmaleimide-sensitive fusion protein attachment protein receptors), which constitute part of the synaptic vesicle fusion machinery. The molecular details of the toxin-cell recognition have been elusive. Here we report the structure of a BoNT in complex with its protein receptor: the receptor-binding domain of botulinum neurotoxin serotype B (BoNT/B) bound to the luminal domain of synaptotagmin II, determined at 2.15 A resolution. On binding, a helix is induced in the luminal domain which binds to a saddle-shaped crevice on a distal tip of BoNT/B. This crevice is adjacent to the non-overlapping ganglioside-binding site of BoNT/B. Synaptotagmin II interacts with BoNT/B with nanomolar affinity, at both neutral and acidic endosomal pH. Biochemical and neuronal ex vivo studies of structure-based mutations indicate high specificity and affinity of the interaction, and high selectivity of BoNT/B among synaptotagmin I and II isoforms. Synergistic binding of both synaptotagmin and ganglioside imposes geometric restrictions on the initiation of BoNT/B translocation after endocytosis. Our results provide the basis for the rational development of preventive vaccines or inhibitors against these neurotoxins.

  17. Peptide Binding to HLA Class I Molecules: Homogenous, High-Throughput Screening, and Affinity Assays

    DEFF Research Database (Denmark)

    Harndahl, Mikkel; Justesen, Sune Frederik Lamdahl; Lamberth, Kasper


    , better signal-to-background ratios, and a higher capacity. They also describe an efficient approach to screen peptides for binding to HLA molecules. For the occasional user, this will serve as a robust, simple peptide-HLA binding assay. For the more dedicated user, it can easily be performed in a high-throughput...... the luminescent oxygen channeling immunoassay technology (abbreviated LOCI and commercialized as AlphaScreen (TM)). Compared with an enzyme-linked immunosorbent assay-based peptide-HLA class I binding assay, the LOCI assay yields virtually identical affinity measurements, although having a broader dynamic range...... screening mode using standard liquid handling robotics and 384-well plates. We have successfully applied this assay to more than 60 different HLA molecules, leading to more than 2 million measurements. (Journal of Biomolecular Screening 2009: 173-180)...

  18. Isolation and characterization of high affinity aptamers against DNA polymerase iota. (United States)

    Lakhin, Andrei V; Kazakov, Andrei A; Makarova, Alena V; Pavlov, Yuri I; Efremova, Anna S; Shram, Stanislav I; Tarantul, Viacheslav Z; Gening, Leonid V


    Human DNA-polymerase iota (Pol ι) is an extremely error-prone enzyme and the fidelity depends on the sequence context of the template. Using the in vitro systematic evolution of ligands by exponential enrichment (SELEX) procedure, we obtained an oligoribonucleotide with a high affinity to human Pol ι, named aptamer IKL5. We determined its dissociation constant with homogenous preparation of Pol ι and predicted its putative secondary structure. The aptamer IKL5 specifically inhibits DNA-polymerase activity of the purified enzyme Pol ι, but did not inhibit the DNA-polymerase activities of human DNA polymerases beta and kappa. IKL5 suppressed the error-prone DNA-polymerase activity of Pol ι also in cellular extracts of the tumor cell line SKOV-3. The aptamer IKL5 is useful for studies of the biological role of Pol ι and as a potential drug to suppress the increase of the activity of this enzyme in malignant cells.

  19. Effects of anticonvulsants in vivo on high affinity choline uptake in vitro in mouse hippocampal synaptosomes. (United States)

    Miller, J. A.; Richter, J. A.


    The effects of several anticonvulsant drugs on sodium-dependent high affinity choline uptake (HACU) in mouse hippocampal synaptosomes was investigated. HACU was measured in vitro after in vivo administration of the drug to mice. HACU was inhibited by drugs which have in common the ability to facilitate gamma-aminobutyric acid (GABA) transmission, pentobarbitone, phenobarbitone, barbitone, diazepam, chloridiazepoxide, and valproic acid. Dose-response relationships were determined for these drugs and the drugs' potencies at inhibiting HACU correlated well with their anticonvulsant potencies. Clonazepam, ethosuximide, carbamazepine, and barbituric acid had no effect on HACU in the doses used while phenytoin and trimethadione stimulated HACU. These results suggest that certain anticonvulsants may elicit a part of their anticonvulsant activity by modulating cholinergic neurones. This effect may be mediated through a GABA mechanism. PMID:3978310

  20. Exploiting the high-affinity phosphonate-hydroxyapatite nanoparticle interaction for delivery of radiation and drugs

    International Nuclear Information System (INIS)

    Ong, Hooi Tin; Loo, Joachim S. C.; Boey, Freddy Y. C.; Russell, Stephen J.; Ma Jan; Peng, Kah-Whye


    Hydroxyapatite is biocompatible and used in various biomedical applications. Here, we generated hydroxyapatite nanoparticles (HNPs) of various sizes (40-200 nm) and demonstrated that they can be stably loaded with drugs or radioisotopes by exploiting the high-affinity HA-(poly)phosphonate interaction. Clinically available phosphonates, clodronate, and Tc-99m-methylene-diphosphonate (Tc-99m-MDP), were efficiently loaded onto HNPs within 15 min. Biodistribution of radiolabeled HNP-MDP-Tc99m in mice was monitored non-invasively using microSPECT-CT. Imaging and dosimetry studies indicated that the HNPs, regardless of size, were quickly taken up by Kupffer cells in the liver after systemic administration into mice. Clodronate loaded onto HNPs remained biologically active and were able to result in selective depletion of Kupffer cells. This method of drug or isotope loading on HA is fast and easy as it eliminates the need for additional surface modifications of the nanoparticles

  1. High Affinity IgE-Fc Receptor alpha and gamma Subunit Interactions

    International Nuclear Information System (INIS)

    Rashid, A.; Housden, J. E. M.; Sabban, S.; Helm, B.


    Objective: To explore the relationships between the subunits (alpha, beta and gamma) of the high affinity IgE receptor (Fc and RI) and its ability to mediate transmembrane signaling. Study Design: Experimental study. Place and Duration of Study: Department of Molecular Biology and Biotechnology, University of Sheffield, UK, from 2008 to 2009. Methodology: The approach employed was to create a chimera (human alpha-gamma-gamma) using the extracellular (EC) domain of the human high affinity IgE receptor. The alpha subunit (huFc and RIalpha) of IgE receptor was spliced onto the rodent gamma TM and cytoplasmic domain (CD). This was transfected into the Rat Basophilic Leukemia cell line in order to assess the possibility of selectively activating cells transfected with this single pass construct for antigen induced mediator release. Results: The RBLs cell lines transfected with the huFc and RIalpha/gamma/gamma cDNA constructs were assessed for the cell surface expression of the huFc and RIalpha subunit and the response to the antigenic stimulus by looking for degranulation and intracellular Ca2+ mobilisation. The results obtained showed the absence of huFc and RIalpha subunit expression on the surface of transfected cells as seen by flowcytometric studies, beta-hexosaminidase assays and intracellular calcium mobilisation studies. Conclusion: In the present study the grounds for non-expression of huFc and RIalpha/gamma/gamma cDNA remains elusive but may be due to the fact that the human-rodent chimeric receptors are assembled differently than the endogenous rodent receptors as seen in study in which COS 7 cells were transfected with human/rat chimeric complexes. (author)

  2. Kinetics and autoradiography of high affinity uptake of serotonin by primary astrocyte cultures

    International Nuclear Information System (INIS)

    Katz, D.M.; Kimelberg, H.K.


    Primary astrocyte cultures prepared from the cerebral cortices of neonatal rats showed significant accumulation of serotonin (5-hydroxytryptamine; [ 3 H]-5-HT). At concentrations in the range of 0.01 to 0.7 microM [ 3 H]-5-HT, this uptake was 50 to 85% Na+ dependent and gave a Km of 0.40 +/- 0.11 microM [ 3 H]-5-HT and a Vmax of 6.42 +/- 0.85 (+/- SEM) pmol of [ 3 H]-5-HT/mg of protein/4 min for the Na+-dependent component. In the absence of Na+ the uptake was nonsaturable. Omission of the monoamine oxidase inhibitor pargyline markedly reduced the Na+-dependent component of [ 3 H]-5-HT uptake but had a negligible effect on the Na+-independent component. This suggest significant oxidative deamination of serotonin after it has been taken up by the high affinity system, followed by release of its metabolite. The authors estimated that this system enabled the cells to concentrate [ 3 H]-5-HT up to 44-fold at an external [ 3 H]-5-HT concentration of 10(-7) M. Inhibition of [ 3 H]-5-HT uptake by a number of clinically effective antidepressants was also consistent with a specific high affinity uptake mechanism for 5-HT, the order of effectiveness of inhibition being chlorimipramine greater than fluoxetine greater than imipramine = amitriptyline greater than desmethylimipramine greater than iprindole greater than mianserin. Uptake of [ 3 H]-5-HT was dependent on the presence of Cl- as well as Na+ in the medium, and the effect of omission of both ions was nonadditive. Varying the concentration of K+ in the media from 1 to 50 mM had a limited effect on [ 3 H]-5-HT uptake

  3. Determination of High-affinity Antibody-antigen Binding Kinetics Using Four Biosensor Platforms. (United States)

    Yang, Danlin; Singh, Ajit; Wu, Helen; Kroe-Barrett, Rachel


    Label-free optical biosensors are powerful tools in drug discovery for the characterization of biomolecular interactions. In this study, we describe the use of four routinely used biosensor platforms in our laboratory to evaluate the binding affinity and kinetics of ten high-affinity monoclonal antibodies (mAbs) against human proprotein convertase subtilisin kexin type 9 (PCSK9). While both Biacore T100 and ProteOn XPR36 are derived from the well-established Surface Plasmon Resonance (SPR) technology, the former has four flow cells connected by serial flow configuration, whereas the latter presents 36 reaction spots in parallel through an improvised 6 x 6 crisscross microfluidic channel configuration. The IBIS MX96 also operates based on the SPR sensor technology, with an additional imaging feature that provides detection in spatial orientation. This detection technique coupled with the Continuous Flow Microspotter (CFM) expands the throughput significantly by enabling multiplex array printing and detection of 96 reaction sports simultaneously. In contrast, the Octet RED384 is based on the BioLayer Interferometry (BLI) optical principle, with fiber-optic probes acting as the biosensor to detect interference pattern changes upon binding interactions at the tip surface. Unlike the SPR-based platforms, the BLI system does not rely on continuous flow fluidics; instead, the sensor tips collect readings while they are immersed in analyte solutions of a 384-well microplate during orbital agitation. Each of these biosensor platforms has its own advantages and disadvantages. To provide a direct comparison of these instruments' ability to provide quality kinetic data, the described protocols illustrate experiments that use the same assay format and the same high-quality reagents to characterize antibody-antigen kinetics that fit the simple 1:1 molecular interaction model.

  4. New Synthesis and Tritium Labeling of a Selective Ligand for Studying High-affinity γ-Hydroxybutyrate (GHB) Binding Sites (United States)

    Vogensen, Stine B.; Marek, Aleš; Bay, Tina; Wellendorph, Petrine; Kehler, Jan; Bundgaard, Christoffer; Frølund, Bente; Pedersen, Martin H.F.; Clausen, Rasmus P.


    3-Hydroxycyclopent-1-enecarboxylic acid (HOCPCA, 1) is a potent ligand for the high-affinity GHB binding sites in the CNS. An improved synthesis of 1 together with a very efficient synthesis of [3H]-1 is described. The radiosynthesis employs in situ generated lithium trimethoxyborotritide. Screening of 1 against different CNS targets establishes a high selectivity and we demonstrate in vivo brain penetration. In vitro characterization of [3H]-1 binding shows high specificity to the high-affinity GHB binding sites. PMID:24053696

  5. A novel lentiviral scFv display library for rapid optimization and selection of high affinity antibodies. (United States)

    Qudsia, Sehar; Merugu, Siva B; Mangukiya, Hitesh B; Hema, Negi; Wu, Zhenghua; Li, Dawei


    Antibody display libraries have become a popular technique to screen monoclonal antibodies for therapeutic purposes. An important aspect of display technology is to generate an optimization library by changing antibody affinity to antigen through mutagenesis and screening the high affinity antibody. In this study, we report a novel lentivirus display based optimization library antibody in which Agtuzumab scFv is displayed on cell membrane of HEK-293T cells. To generate an optimization library, hotspot mutagenesis was performed to achieve diverse antibody library. Based on sequence analysis of randomly selected clones, library size was estimated approximately to be 1.6 × 10 6 . Lentivirus display vector was used to display scFv antibody on cell surface and flow cytometery was performed to check the antibody affinity to antigen. Membrane bound scFv antibodies were then converted to secreted antibody through cre/loxP recombination. One of the mutant clones, M8 showed higher affinity to antigen in flow cytometery analysis. Further characterization of cellular and secreted scFv through western blot showed that antibody affinity was increased by three fold after mutagenesis. This study shows successful construction of a novel antibody library and suggests that hotspot mutagenesis could prove a useful and rapid optimization tool to generate similar libraries with various degree of antigen affinity. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. Statistical removal of background signals from high-throughput 1H NMR line-broadening ligand-affinity screens

    International Nuclear Information System (INIS)

    Worley, Bradley; Sisco, Nicholas J.; Powers, Robert


    NMR ligand-affinity screens are vital to drug discovery, are routinely used to screen fragment-based libraries, and used to verify chemical leads from high-throughput assays and virtual screens. NMR ligand-affinity screens are also a highly informative first step towards identifying functional epitopes of unknown proteins, as well as elucidating the biochemical functions of protein–ligand interaction at their binding interfaces. While simple one-dimensional 1 H NMR experiments are capable of indicating binding through a change in ligand line shape, they are plagued by broad, ill-defined background signals from protein 1 H resonances. We present an uncomplicated method for subtraction of protein background in high-throughput ligand-based affinity screens, and show that its performance is maximized when phase-scatter correction is applied prior to subtraction

  7. Opioid receptor subtypes mediating the noise-induced decreases in high-affinity choline uptake in the rat brain. (United States)

    Lai, H; Carino, M A


    Acute (20 min) exposure to 100-dB white noise elicits a naltrexone-sensitive decrease in sodium-dependent high-affinity choline uptake in the frontal cortex and hippocampus of the rat. In the present study, the subtypes of opioid receptors involved were investigated by pretreating rats with microinjection of specific opioid-receptor antagonists into the lateral cerebroventricle before noise exposure. We found that the noise-induced decrease in high-affinity choline uptake in the hippocampus was blocked by pretreatment with either mu-, delta-, or kappa-opioid-receptor antagonists, whereas the effect of noise on frontal cortical high-affinity choline uptake was blocked by a mu- and delta- but not by a kappa-antagonist. These data further confirm the role of endogenous opioids in mediating the effects of noise on central cholinergic activity and indicate that different neural mechanisms are involved in the effects of noise on the frontal cortical and hippocampal cholinergic systems.


    Directory of Open Access Journals (Sweden)

    Devita Kusdianingrum


    Full Text Available ABSTRAK: Sekitar 8-20% isolate M. tuberculosis yang resisten terhadap isoniazid diketahui telah mengalami mutasi pada posisi regio promoter inhA [1]. Untuk memperoleh titik mutasi pada regio promoter, maka amplifikasi fragmen target perlu untuk dilakukan. Tujuan dilakukannya penelitian ini adalah untuk mengamplifikasi regio promoter inhA, mengetahui ada tidaknya mutasi dan jenis mutasi pada isolat 134 MDR-TB. Tahap isolasi DNA dilakukan menggunakan metode Boom yang telah dimodifikasi. Fragmen target diamplifikasi dengan teknik PCR menggunakan sepasang primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ dan reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’. Amplikon disekuensing secara satu arah menggunakan forward primer. Analisis homologi dilakukan menggunakan program online BLASTn, sementara identifikasi mutasi dilakukan menggunakan software MEGA4. Hasil penelitian menunjukkan bahwa analisis homologi isolate 134 terhadap M. tuberculosis H37Rv adalah sebesar 99%. Tahap analisis mutasi menemukan terjadinya perubahan sitosin menjadi timin (CàT pada posisi -15 isolat 134 MDR-TB   ABSTRACT: Approximately 8-20% M. tuberculosis isolates that are resistant to isoniazid habe been known to have a mutation in inhA promoter region [1]. To find the mutation in inhA promoter region, it is necessary to carry out the amplification of the target fragment. The purpose of this research were to amplify the inhA promoter region and to find out if there is a mutation and type of mutation at MDR-TB isolate. DNA isolation was done by a modified Boom method. Target fragment was amplified by a pair primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ and reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’ using Polymerase Chain Reaction (PCR technique. Amplicon was sequenced in one forward direction. Homology analysis was conducted by online BLASTn program, while the mutation was identified by MEGA4. The result of this research showed that homology analysis of 134 was homolog

  9. Affinity selection-mass spectrometry and its emerging application to the high throughput screening of G protein-coupled receptors. (United States)

    Whitehurst, Charles E; Annis, D Allen


    Advances in combinatorial chemistry and genomics have inspired the development of novel affinity selection-based screening techniques that rely on mass spectrometry to identify compounds that preferentially bind to a protein target. Of the many affinity selection-mass spectrometry techniques so far documented, only a few solution-based implementations that separate target-ligand complexes away from unbound ligands persist today as routine high throughput screening platforms. Because affinity selection-mass spectrometry techniques do not rely on radioactive or fluorescent reporters or enzyme activities, they can complement traditional biochemical and cell-based screening assays and enable scientists to screen targets that may not be easily amenable to other methods. In addition, by employing mass spectrometry for ligand detection, these techniques enable high throughput screening of massive library collections of pooled compound mixtures, vastly increasing the chemical space that a target can encounter during screening. Of all drug targets, G protein coupled receptors yield the highest percentage of therapeutically effective drugs. In this manuscript, we present the emerging application of affinity selection-mass spectrometry to the high throughput screening of G protein coupled receptors. We also review how affinity selection-mass spectrometry can be used as an analytical tool to guide receptor purification, and further used after screening to characterize target-ligand binding interactions, enabling the classification of orthosteric and allosteric binders.

  10. Development of 99mTc labelled somatostatin analogues with high affinity for somatostatin receptors

    International Nuclear Information System (INIS)

    Maina, T.; Nock, B.; Nicolopoulou, A.; Tsipra, C.; Poppe, M.; Chiotellis, E.


    A recent development in oncology involves the use of metabolically stabilized peptide hormone analogues labelled with metallic radionuclides for the diagnosis or therapy of malignant disease. This approach was successfully applied for the first time in the visualization of somatostatin positive tumours and their metastases with 111 In DTPA-octreotide. In an effort to obtain a 99m Tc somatostatin receptor affine radioligand we describe herein the synthesis, radiochemistry and preliminary biological evaluation of two novel 99m Tc labelled somatostatin analogues, N 4 -TOC and N 4 -RC-160. In these compounds a tetraamine bifunctional unit was covalently attached to the N-terminal (D)Phe 1 of the peptide chain using Boc-protection strategies. The peptide conjugates were purified by high performance liquid chromatography (HPLC) and characterized by UV/Vis and ES-MS spectroscopies. As revealed by HPLC, 99m Tc labelling was quantitative under mild conditions, leading to a single 99m Tc species in high specific activities. Affinity of 99m Tc N 4 -TOC for the somatostatin receptor, as determined by in vitro binding assays in rat brain cortex membranes, was found unaffected by the presence of the bulky metal chelate. The binding properties of 99m Tc N 4 -RC-160 could not be determined by this assay due to an extremely high non-specific binding of this radioligand, and will be shortly investigated by other methods. Tissue distribution in healthy mice revealed that 99m Tc N 4 -TOC is clearing mainly through the kidneys and the urinary tract whereas 99m Tc N 4 -RC-160 shows a high accumulation in the liver as a result of its lipophilicity. Analysis of urine samples by HPLC showed that 99m Tc N 4 -TOC is excreted integer from the body of mice, while 99m Tc N 4 -RC-160 is totally transformed to an unidentified hydrophilic metabolite in vivo. The location of this metabolism is currently investigated. In vivo blocking experiments using animals pre-treated with 50 μg octreotide

  11. Trace element affinities in two high-Ge coals from China

    Energy Technology Data Exchange (ETDEWEB)

    Jing Li; Xinguo Zhuang; Xavier Querol [China University of Geosciences, Wuhan (China). Faculty of Earth Resources


    The Lincang (Yunnan Province, Southwest China) and Wulantuga (Inner Mongolia, Northeast China) coal deposits are known because of the high-Ge content. These coals have also a high concentration of a number of other elements. To determine the mode of occurrence of the enriched elements in both coals, six density fractions from {lt} 1.43 to {gt} 2.8 g/cm{sup 3} were obtained from two representative samples using heavy-liquids. A number of peculiar geochemical patterns characterize these high-Ge coals. Thus, the results of the chemical analysis of these density fractions showed that both coals (very distant and of a different geological age) are highly enriched (compared with the usual worldwide coal concentration ranges) in Ge, As, Sb, W, Be, and Tl. This may be due to similar geochemistry of hydrothermal fluids influencing the Earth Crust in these regions of China. Moreover, Wulantuga coal (Early Cretaceous subbituminous coal) is also enriched in Ca, Mg, and Na, and Lincang coal (Neogene subbituminous coal) in K, Rb, Nb, Mo, Sn, Cs, and U. A group of elements consisting of Ge, W, B, Nb, and Sb mostly occur with an organic affinity in both coals. Additionally, Be, U, and Mo (and partially Mn and Zn) in Lincang, and Na and Mg in Wulantuga occur also with a major organic affinity. Both coals have sulfide-arsenide mineral assemblages (Fe, S, As, Sn, and Pb, and in addition to Tl, Ta, and Cs in the Lincang coal). The occurrence of Al, P, Li, Sc, Ti, V, Cr, and Zr in both coals, and Ba in Lincang, are associated with the mineral assemblage of silico-aluminates and minor heavy minerals. Furthermore, P, Na, Li, Sc, Ti, Ga, Rb, Zr, Cr, Ba, Th, and LREE (La, Ce, Pr, Nd, and Gd) in Lincang are associated with mineral assemblages of phosphates and minor heavy minerals. The two later mineral assemblages are derived from the occurrence of detrital minerals. 34 refs., 7 figs., 3 tabs.

  12. Visual and Plasmon Resonance Absorption Sensor for Adenosine Triphosphate Based on the High Affinity between Phosphate and Zr(IV)


    Qi, Wenjing; Liu, Zhongyuan; Zhang, Wei; Halawa, Mohamed Ibrahim; Xu, Guobao


    Zr(IV) can form phosphate and Zr(IV) (?PO3 2??Zr4+?) complex owing to the high affinity between Zr(IV) with phosphate. Zr(IV) can induce the aggregation of gold nanoparticles (AuNPs), while adenosine triphosphate(ATP) can prevent Zr(IV)-induced aggregation of AuNPs. Herein, a visual and plasmon resonance absorption (PRA)sensor for ATP have been developed using AuNPs based on the high affinity between Zr(IV)with ATP. AuNPs get aggregated in the presence of certain concentrations of Zr(IV). Aft...

  13. High density and ligand affinity confer ultrasensitive signal detection by a guanylyl cyclase chemoreceptor (United States)

    Pichlo, Magdalena; Bungert-Plümke, Stefanie; Weyand, Ingo; Seifert, Reinhard; Bönigk, Wolfgang; Strünker, Timo; Kashikar, Nachiket Dilip; Goodwin, Normann; Müller, Astrid; Körschen, Heinz G.; Collienne, Ursel; Pelzer, Patric; Van, Qui; Enderlein, Jörg; Klemm, Clementine; Krause, Eberhard; Trötschel, Christian; Poetsch, Ansgar; Kremmer, Elisabeth


    Guanylyl cyclases (GCs), which synthesize the messenger cyclic guanosine 3′,5′-monophosphate, control several sensory functions, such as phototransduction, chemosensation, and thermosensation, in many species from worms to mammals. The GC chemoreceptor in sea urchin sperm can decode chemoattractant concentrations with single-molecule sensitivity. The molecular and cellular underpinnings of such ultrasensitivity are not known for any eukaryotic chemoreceptor. In this paper, we show that an exquisitely high density of 3 × 105 GC chemoreceptors and subnanomolar ligand affinity provide a high ligand-capture efficacy and render sperm perfect absorbers. The GC activity is terminated within 150 ms by dephosphorylation steps of the receptor, which provides a means for precise control of the GC lifetime and which reduces “molecule noise.” Compared with other ultrasensitive sensory systems, the 10-fold signal amplification by the GC receptor is surprisingly low. The hallmarks of this signaling mechanism provide a blueprint for chemical sensing in small compartments, such as olfactory cilia, insect antennae, or even synaptic boutons. PMID:25135936

  14. Specific, high affinity receptors for insulin-like growth factor II in the rat kidney glomerulus

    International Nuclear Information System (INIS)

    Haskell, J.F.; Pillion, D.J.; Meezan, E.


    Rat renal glomeruli were isolated by a technique involving kidney perfusion with a solution containing magnetic iron oxide particles, followed by homogenization, sieving, and concentration over a strong magnet. Isolated glomeruli were treated with 1% Triton X-100 to solubilize plasma membrane components, while insoluble basement membrane components were removed by centrifugation. [ 125 I]Insulin-like growth factor II (IGF-II) binding to this preparation was competitively inhibited by increasing amounts of unlabeled IGF-II, with 50% inhibition at an IGF-II concentration of 1 ng/ml. [ 125 I]IGF-II was covalently cross-linked with disuccinimidyl suberate to its receptor in rat renal glomeruli and a specific high mol wt (255,000) band could be identified on autoradiograms of dodecyl sulfate-polyacrylamide gels. [ 125 I]IGF-II binding and cross-linking to this band was inhibited by a polyclonal antibody against the type II IGF receptor. These results demonstrate for the first time that the isolated rat renal glomerulus contains a high affinity receptor for IGF-II

  15. Inhibition of high affinity choline uptake by N-allyl-3-quinuclidinol

    International Nuclear Information System (INIS)

    Asermely, K.E.; O'Neill, J.J.


    The peripheral actions of N-allyl-3-quinuclidinol (N-Al-3-OHQ) on high affinity choline uptake (HAChU) on rat phrenic nerve diaphragm are described. Endplate regions (EPA) identified by the Koelle histochemical techniques for acetylcholinesterase, were dissected from adult rat hemidiaphragms and placed in cold Krebs solution (pH-7.35). All measurements of HAChU were at 37 0 C in buffers containing tritium choline (5 μM 0.124 μC/mmole) at intervals of 1, 2, 4, 8, 15 and 30 min. Tissues were washed 3x, digested in 1N NaOH and counted for tritium in Chaikoff's solution. All data are expressed as pmole Ch/g wet weight. Comparison between EPA and non-EPA tissue demonstrate HAChU and slow choline diffusion, respectively. Steady state is observed in 15 min. N-Al-3-OHQ produces 15% inhibition at 5 x 10 -5 M compared with 50% inhibition on brain synaptosomes. At 5 x 10 -4 M N-Al-3-OHQ, 30% inhibition is observed. Attempts to deplete ACh by pre-stimulation with high K + -ion (25 mM) were unsuccessful; tissue 3 H-choline uptake appeared to oscillate over a 30 min period

  16. Inhibition of high affinity choline uptake by N-allyl-3-quinuclidinol

    Energy Technology Data Exchange (ETDEWEB)

    Asermely, K.E.; O' Neill, J.J.


    The peripheral actions of N-allyl-3-quinuclidinol (N-Al-3-OHQ) on high affinity choline uptake (HAChU) on rat phrenic nerve diaphragm are described. Endplate regions (EPA) identified by the Koelle histochemical techniques for acetylcholinesterase, were dissected from adult rat hemidiaphragms and placed in cold Krebs solution (pH-7.35). All measurements of HAChU were at 37/sup 0/C in buffers containing tritium choline (5 0.124 at intervals of 1, 2, 4, 8, 15 and 30 min. Tissues were washed 3x, digested in 1N NaOH and counted for tritium in Chaikoff's solution. All data are expressed as pmole Ch/g wet weight. Comparison between EPA and non-EPA tissue demonstrate HAChU and slow choline diffusion, respectively. Steady state is observed in 15 min. N-Al-3-OHQ produces 15% inhibition at 5 x 10/sup -5/ M compared with 50% inhibition on brain synaptosomes. At 5 x 10/sup -4/ M N-Al-3-OHQ, 30% inhibition is observed. Attempts to deplete ACh by pre-stimulation with high K/sup +/-ion (25 mM) were unsuccessful; tissue /sup 3/H-choline uptake appeared to oscillate over a 30 min period.

  17. Two high-affinity ligand binding states of uterine estrogen receptor distinguished by modulation of hydrophobic environment

    International Nuclear Information System (INIS)

    Hutchens, T.W.; Li, C.M.; Zamah, N.M.; Besch, P.K.


    The steroid binding function of soluble (cytosolic) estrogen receptors from calf uteri was evaluated under conditions known to modify the extent of hydrophobic interaction with receptor-associated proteins. Receptor preparations were equilibrated into 6 M urea buffers and control buffers by chromatography through small columns of Sephadex G-25 or by dialysis at 0.6 0 C. Equilibrium dissociation constants (K/sub d/) and binding capacities (n) of experimental and control receptor preparations were determined by 13-point Scatchard analyses using concentrations of 17β-[ 3 H]estradiol from 0.05 to 10 nM. Nonspecific binding was determined at each concentration by parallel incubations with a 200-fold molar excess of the receptor-specific competitor diethylstilbestrol. The control receptor population was consistently found to be a single class of binding sites with a high affinity for estradiol which was unaffected by G-25 chromatography, by dialysis, by dilution, or by the presence of 0.4 M KCl. However, equilibration into 6 M urea induced a discrete (10-fold) reduction in receptor affinity to reveal a second, thermodynamically stable, high-affinity binding state. The presence of 0.4 M KCl did not significantly influence the discrete change in receptor affinity induced by urea. The effects of urea on both receptor affinity and binding capacity were reversible, suggesting a lack of covalent modification. These results demonstrate nonenzymatic means by which not only the binding capacity but also the affinity of receptor for estradiol can be reversibly controlled, suggesting that high concentrations of urea might be more effectively utilized during the physicochemical characterization and purification of steroid receptor proteins

  18. Fc-Binding Ligands of Immunoglobulin G: An Overview of High Affinity Proteins and Peptides

    Directory of Open Access Journals (Sweden)

    Weonu Choe


    Full Text Available The rapidly increasing application of antibodies has inspired the development of several novel methods to isolate and target antibodies using smart biomaterials that mimic the binding of Fc-receptors to antibodies. The Fc-binding domain of antibodies is the primary binding site for e.g., effector proteins and secondary antibodies, whereas antigens bind to the Fab region. Protein A, G, and L, surface proteins expressed by pathogenic bacteria, are well known to bind immunoglobulin and have been widely exploited in antibody purification strategies. Several difficulties are encountered when bacterial proteins are used in antibody research and application. One of the major obstacles hampering the use of bacterial proteins is sample contamination with trace amounts of these proteins, which can invoke an immune response in the host. Many research groups actively develop synthetic ligands that are able to selectively and strongly bind to antibodies. Among the reported ligands, peptides that bind to the Fc-domain of antibodies are attractive tools in antibody research. Besides their use as high affinity ligands in antibody purification chromatography, Fc-binding peptides are applied e.g., to localize antibodies on nanomaterials and to increase the half-life of proteins in serum. In this review, recent developments of Fc-binding peptides are presented and their binding characteristics and diverse applications are discussed.

  19. Carbonate-sensitive phytotransferrin controls high-affinity iron uptake in diatoms (United States)

    McQuaid, Jeffrey B.; Kustka, Adam B.; Oborník, Miroslav; Horák, Aleš; McCrow, John P.; Karas, Bogumil J.; Zheng, Hong; Kindeberg, Theodor; Andersson, Andreas J.; Barbeau, Katherine A.; Allen, Andrew E.


    In vast areas of the ocean, the scarcity of iron controls the growth and productivity of phytoplankton. Although most dissolved iron in the marine environment is complexed with organic molecules, picomolar amounts of labile inorganic iron species (labile iron) are maintained within the euphotic zone and serve as an important source of iron for eukaryotic phytoplankton and particularly for diatoms. Genome-enabled studies of labile iron utilization by diatoms have previously revealed novel iron-responsive transcripts, including the ferric iron-concentrating protein ISIP2A, but the mechanism behind the acquisition of picomolar labile iron remains unknown. Here we show that ISIP2A is a phytotransferrin that independently and convergently evolved carbonate ion-coordinated ferric iron binding. Deletion of ISIP2A disrupts high-affinity iron uptake in the diatom Phaeodactylum tricornutum, and uptake is restored by complementation with human transferrin. ISIP2A is internalized by endocytosis, and manipulation of the seawater carbonic acid system reveals a second-order dependence on the concentrations of labile iron and carbonate ions. In P. tricornutum, the synergistic interaction of labile iron and carbonate ions occurs at environmentally relevant concentrations, revealing that carbonate availability co-limits iron uptake. Phytotransferrin sequences have a broad taxonomic distribution and are abundant in marine environmental genomic datasets, suggesting that acidification-driven declines in the concentration of seawater carbonate ions will have a negative effect on this globally important eukaryotic iron acquisition mechanism.

  20. Humic Acid Confers HIGH-AFFINITY K+ TRANSPORTER 1-Mediated Salinity Stress Tolerance in Arabidopsis. (United States)

    Khaleda, Laila; Park, Hee Jin; Yun, Dae-Jin; Jeon, Jong-Rok; Kim, Min Gab; Cha, Joon-Yung; Kim, Woe-Yeon


    Excessive salt disrupts intracellular ion homeostasis and inhibits plant growth, which poses a serious threat to global food security. Plants have adapted various strategies to survive in unfavorable saline soil conditions. Here, we show that humic acid (HA) is a good soil amendment that can be used to help overcome salinity stress because it markedly reduces the adverse effects of salinity on Arabidopsis thaliana seedlings. To identify the molecular mechanisms of HA-induced salt stress tolerance in Arabidopsis, we examined possible roles of a sodium influx transporter HIGH-AFFINITY K+ TRANSPORTER 1 (HKT1). Salt-induced root growth inhibition in HKT1 overexpressor transgenic plants (HKT1-OX) was rescued by application of HA, but not in wild-type and other plants. Moreover, salt-induced degradation of HKT1 protein was blocked by HA treatment. In addition, the application of HA to HKT1-OX seedlings led to increased distribution of Na+ in roots up to the elongation zone and caused the reabsorption of Na+ by xylem and parenchyma cells. Both the influx of the secondary messenger calcium and its cytosolic release appear to function in the destabilization of HKT1 protein under salt stress. Taken together, these results suggest that HA could be applied to the field to enhance plant growth and salt stress tolerance via post-transcriptional control of the HKT1 transporter gene under saline conditions.

  1. Enhanced membrane pore formation through high-affinity targeted antimicrobial peptides.

    Directory of Open Access Journals (Sweden)

    Christopher J Arnusch

    Full Text Available Many cationic antimicrobial peptides (AMPs target the unique lipid composition of the prokaryotic cell membrane. However, the micromolar activities common for these peptides are considered weak in comparison to nisin, which follows a targeted, pore-forming mode of action. Here we show that AMPs can be modified with a high-affinity targeting module, which enables membrane permeabilization at low concentration. Magainin 2 and a truncated peptide analog were conjugated to vancomycin using click chemistry, and could be directed towards specific membrane embedded receptors both in model membrane systems and whole cells. Compared with untargeted vesicles, a gain in permeabilization efficacy of two orders of magnitude was reached with large unilamellar vesicles that included lipid II, the target of vancomycin. The truncated vancomycin-peptide conjugate showed an increased activity against vancomycin resistant Enterococci, whereas the full-length conjugate was more active against a targeted eukaryotic cell model: lipid II containing erythrocytes. This study highlights that AMPs can be made more selective and more potent against biological membranes that contain structures that can be targeted.

  2. Early signs of pathological cognitive aging in mice lacking high-affinity nicotinic receptors.

    Directory of Open Access Journals (Sweden)

    Eleni eKonsolaki


    Full Text Available In order to address pathological cognitive decline effectively, it is critical to adopt early preventive measures in individuals considered at risk. It is therefore essential to develop approaches that identify such individuals before the onset of irreversible dementia. Α deficient cholinergic system has been consistently implicated as one of the main factors associated with a heightened vulnerability to the aging process. In the present study we used mice lacking high affinity nicotinic receptors (β2-/-, which have been proposed as an animal model of accelerated/premature cognitive aging. Our aim was to identify behavioural signs that could serve as indicators or predictors of impending cognitive decline. We used test batteries in order to assess cognitive functions and additional tasks to investigate spontaneous behaviours, such as species-specific activities and exploration/locomotion in a novel environment. Our data confirm and extend the hypothesis that β2-/- animals exhibit age-related cognitive impairments, manifested in both spatial learning and recognition memory tasks. In addition, we reveal deficits in spontaneous behaviour and habituation processes earlier in life. To our knowledge, this is the first study to perform an extensive behavioural examination of an animal model of premature cognitive aging, and our results suggest that β2-nAChR dependent cognitive deterioration progressively evolves from initial subtle behavioural changes to global dementia due to the combined effect of the neuropathology and aging.

  3. Physiological epidermal growth factor concentrations activate high affinity receptors to elicit calcium oscillations.

    Directory of Open Access Journals (Sweden)

    Béatrice Marquèze-Pouey

    Full Text Available Signaling mediated by the epidermal growth factor (EGF is crucial in tissue development, homeostasis and tumorigenesis. EGF is mitogenic at picomolar concentrations and is known to bind its receptor on high affinity binding sites depending of the oligomerization state of the receptor (monomer or dimer. In spite of these observations, the cellular response induced by EGF has been mainly characterized for nanomolar concentrations of the growth factor, and a clear definition of the cellular response to circulating (picomolar concentrations is still lacking. We investigated Ca2+ signaling, an early event in EGF responses, in response to picomolar doses in COS-7 cells where the monomer/dimer equilibrium is unaltered by the synthesis of exogenous EGFR. Using the fluo5F Ca2+ indicator, we found that picomolar concentrations of EGF induced in 50% of the cells a robust oscillatory Ca2+ signal quantitatively similar to the Ca2+ signal induced by nanomolar concentrations. However, responses to nanomolar and picomolar concentrations differed in their underlying mechanisms as the picomolar EGF response involved essentially plasma membrane Ca2+ channels that are not activated by internal Ca2+ store depletion, while the nanomolar EGF response involved internal Ca2+ release. Moreover, while the picomolar EGF response was modulated by charybdotoxin-sensitive K+ channels, the nanomolar response was insensitive to the blockade of these ion channels.

  4. Physiological epidermal growth factor concentrations activate high affinity receptors to elicit calcium oscillations. (United States)

    Marquèze-Pouey, Béatrice; Mailfert, Sébastien; Rouger, Vincent; Goaillard, Jean-Marc; Marguet, Didier


    Signaling mediated by the epidermal growth factor (EGF) is crucial in tissue development, homeostasis and tumorigenesis. EGF is mitogenic at picomolar concentrations and is known to bind its receptor on high affinity binding sites depending of the oligomerization state of the receptor (monomer or dimer). In spite of these observations, the cellular response induced by EGF has been mainly characterized for nanomolar concentrations of the growth factor, and a clear definition of the cellular response to circulating (picomolar) concentrations is still lacking. We investigated Ca2+ signaling, an early event in EGF responses, in response to picomolar doses in COS-7 cells where the monomer/dimer equilibrium is unaltered by the synthesis of exogenous EGFR. Using the fluo5F Ca2+ indicator, we found that picomolar concentrations of EGF induced in 50% of the cells a robust oscillatory Ca2+ signal quantitatively similar to the Ca2+ signal induced by nanomolar concentrations. However, responses to nanomolar and picomolar concentrations differed in their underlying mechanisms as the picomolar EGF response involved essentially plasma membrane Ca2+ channels that are not activated by internal Ca2+ store depletion, while the nanomolar EGF response involved internal Ca2+ release. Moreover, while the picomolar EGF response was modulated by charybdotoxin-sensitive K+ channels, the nanomolar response was insensitive to the blockade of these ion channels.

  5. High-affinity cannabinoid binding site in brain: A possible marijuana receptor

    International Nuclear Information System (INIS)

    Nye, J.S.


    The mechanism by which delta 9 tetrahydrocannabinol (delta 9 THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5'-Trimethylammonium-delta 8 THC (TMA) is a positively charged analog of delta- 8 THC modified on the 5' carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of [ 3 H]-5'-trimethylammonium-delta- 8 THC ([ 3 H]TMA) to rat neuronal membranes. [ 3 H]TMA binds saturably and reversibly to brain membranes with high affinity to apparently one class of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of [ 3 H]TMA binding activity of approximately 60,000 daltons apparent molecular weight

  6. A high affinity Ca2(+)-ATPase on the surface membrane of Leishmania donovani promastigote

    International Nuclear Information System (INIS)

    Ghosh, J.; Ray, M.; Sarkar, S.; Bhaduri, A.


    A Ca2(+)-dependent ATP-hydrolytic activity was detected in the crude membrane ghost of the promastigote or vector form of the protozoal parasite Leishmania donovani, the pathogen responsible for kala azar. The Ca2(+)-ATPase was purified to apparent homogeneity after solubilization with deoxycholate. The enzyme consists of two subunits of Mr = 51,000 and 57,000 and has an apparent molecular weight of 215,000 +/- 12,000. The enzyme activity is exclusively dependent on Ca2+, and the pure enzyme can hydrolyze 1.6 mumol of ATP/min/mg of protein. The apparent Km for Ca2+ is 35 nM, which is further reduced to 12 nM in the presence of heterologous calmodulin. The enzyme is sensitive to vanadate, but is insensitive to oligomycin and ouabain. The enzyme is strongly associated with the plasma membrane and has its catalytic site oriented toward the cytoplasmic face. The enzyme spans across the plasma membrane as surface labeling with radioiodine shows considerable radioactivity in the completely purified enzyme. The localization and orientation of this high affinity, calmodulin-sensitive Ca2(+)-ATPase suggest some role of this enzyme in Ca2+ movement in the life cycle of this protozoal parasite

  7. A high affinity Ca2(+)-ATPase on the surface membrane of Leishmania donovani promastigote

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, J.; Ray, M.; Sarkar, S.; Bhaduri, A. (Indian Institute of Chemical Biology, Calcutta (India))


    A Ca2(+)-dependent ATP-hydrolytic activity was detected in the crude membrane ghost of the promastigote or vector form of the protozoal parasite Leishmania donovani, the pathogen responsible for kala azar. The Ca2(+)-ATPase was purified to apparent homogeneity after solubilization with deoxycholate. The enzyme consists of two subunits of Mr = 51,000 and 57,000 and has an apparent molecular weight of 215,000 +/- 12,000. The enzyme activity is exclusively dependent on Ca2+, and the pure enzyme can hydrolyze 1.6 mumol of ATP/min/mg of protein. The apparent Km for Ca2+ is 35 nM, which is further reduced to 12 nM in the presence of heterologous calmodulin. The enzyme is sensitive to vanadate, but is insensitive to oligomycin and ouabain. The enzyme is strongly associated with the plasma membrane and has its catalytic site oriented toward the cytoplasmic face. The enzyme spans across the plasma membrane as surface labeling with radioiodine shows considerable radioactivity in the completely purified enzyme. The localization and orientation of this high affinity, calmodulin-sensitive Ca2(+)-ATPase suggest some role of this enzyme in Ca2+ movement in the life cycle of this protozoal parasite.

  8. NK1 receptor fused to beta-arrestin displays a single-component, high-affinity molecular phenotype. (United States)

    Martini, Lene; Hastrup, Hanne; Holst, Birgitte; Fraile-Ramos, Alberto; Marsh, Mark; Schwartz, Thue W


    Arrestins are cytosolic proteins that, upon stimulation of seven transmembrane (7TM) receptors, terminate signaling by binding to the receptor, displacing the G protein and targeting the receptor to clathrin-coated pits. Fusion of beta-arrestin1 to the C-terminal end of the neurokinin NK1 receptor resulted in a chimeric protein that was expressed to some extent on the cell surface but also accumulated in transferrin-labeled recycling endosomes independently of agonist stimulation. As expected, the fusion protein was almost totally silenced with respect to agonist-induced signaling through the normal Gq/G11 and Gs pathways. The NK1-beta-arrestin1 fusion construct bound nonpeptide antagonists with increased affinity but surprisingly also bound two types of agonists, substance P and neurokinin A, with high, normal affinity. In the wild-type NK1 receptor, neurokinin A (NKA) competes for binding against substance P and especially against antagonists with up to 1000-fold lower apparent affinity than determined in functional assays and in homologous binding assays. When the NK1 receptor was closely fused to G proteins, this phenomenon was eliminated among agonists, but the agonists still competed with low affinity against antagonists. In contrast, in the NK1-beta-arrestin1 fusion protein, all ligands bound with similar affinity independent of the choice of radioligand and with Hill coefficients near unity. We conclude that the NK1 receptor in complex with arrestin is in a high-affinity, stable, agonist-binding form probably best suited to structural analysis and that the receptor can display binding properties that are nearly theoretically ideal when it is forced to complex with only a single intracellular protein partner.

  9. Novel high-affinity and selective biaromatic 4-substituted ¿-hydroxybutyric acid (GHB) analogues as GHB ligands

    DEFF Research Database (Denmark)

    Høg, Signe; Wellendorph, Petrine; Nielsen, Birgitte


    Gamma-hydroxybutyrate (GHB) is a metabolite of gamma-aminobutyric acid (GABA) and has been proposed to function as a neurotransmitter or neuromodulator. GHB is used in the treatment of narcolepsy and is a drug of abuse. GHB binds to both GABA(B) receptors and specific high-affinity GHB sites...

  10. Are basophil histamine release and high affinity IgE receptor expression involved in asymptomatic skin sensitization?

    DEFF Research Database (Denmark)

    Jensen, Bettina Margrethe; Assing, K; Jensen, Lone Hummelshøj


    Immunoglobulin (Ig)E-sensitized persons with positive skin prick test, but no allergy symptoms, are classified as being asymptomatic skin sensitized (AS). The allergic type 1 disease is dependant on IgE binding to the high affinity IgE-receptor (FcepsilonRI) expressed on basophils and mast cells....

  11. Differences between high-affinity forskolin binding sites in dopamine-riche and other regions of rat brain

    International Nuclear Information System (INIS)

    Poat, J.A.; Cripps, H.E.; Iversen, L.L.


    Forskolin labelled with [ 3 H] bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg 2+ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no further increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins

  12. New Synthesis and Tritium Labeling of a Selective Ligand for Studying High-Affinity γ-Hydroxybutyrate (GHB) Binding Sites

    DEFF Research Database (Denmark)

    Vogensen, Stine B.; Marek, Ales; Bay, Tina


    3-Hydroxycyclopent-1-enecarboxylic acid (HOCPCA, 1) is a potent ligand for the high-affinity GHB binding sites in the CNS. An improved synthesis of 1 together with a very efficient synthesis of [3H]-1 is described. The radiosynthesis employs in situ generated lithium trimethoxyborotritide. Screen...

  13. 99mTc(CO)3-DTMA bombesin conjugates having high affinity for the GRP receptor

    International Nuclear Information System (INIS)

    Lane, Stephanie R.; Veerendra, Bhadrasetty; Rold, Tammy L.; Sieckman, Gary L.; Hoffman, Timothy J.; Jurisson, Silvia S.; Smith, Charles J.


    Introduction: Targeted diagnosis of specific human cancer types continues to be of significant interest in nuclear medicine. 99m Tc is ideally suited as a diagnostic radiometal for in vivo tumor targeting due to its ideal physical characteristics and diverse labeling chemistries in numerous oxidation states. Methods: In this study, we report a synthetic approach toward design of a new tridentate amine ligand for the organometallic aqua-ion [ 99m Tc(H 2 O) 3 (CO) 3 ] + . The new chelating ligand framework, 2-(N,N'-Bis(tert-butoxycarbonyl)diethylenetriamine) acetic acid (DTMA), was synthesized from a diethylenetriamine precursor and fully characterized by mass spectrometry and nuclear magnetic resonance spectroscopy ( 1 H and 13 C). DTMA was conjugated to H 2 N-(X)-BBN(7-14)NH 2 , where X=an amino acid or aliphatic pharmacokinetic modifier and BBN=bombesin peptide, by means of solid phase peptide synthesis. DTMA-(X)-BBN(7-14)NH 2 conjugates were purified by reversed-phase high-performance chromatography and characterized by electrospray-ionization mass spectrometry. Results: The new conjugates were radiolabeled with [ 99m Tc(H 2 O) 3 (CO) 3 ] + produced via Isolink radiolabeling kits to produce [ 99m Tc(CO) 3 -DTMA-(X)-BBN(7-14)NH 2 ]. Radiolabeled conjugates were purified by reversed-phase high-performance chromatography. Effective receptor binding behavior was evaluated in vitro and in vivo. Conclusions: [ 99m Tc(CO) 3 -DTMA-(X)-BBN(7-14)NH 2 ] conjugates displayed very high affinity for the gastrin releasing peptide receptor in vitro and in vivo. Therefore, these conjugates hold some propensity to be investigated as molecular imaging agents that specifically target human cancers uniquely expressing the gastrin releasing peptide receptor subtypes

  14. Computational modeling and molecular imprinting for the development of acrylic polymers with high affinity for bile salts. (United States)

    Yañez, Fernando; Chianella, Iva; Piletsky, Sergey A; Concheiro, Angel; Alvarez-Lorenzo, Carmen


    This work has focused on the rational development of polymers capable of acting as traps of bile salts. Computational modeling was combined with molecular imprinting technology to obtain networks with high affinity for cholate salts in aqueous medium. The screening of a virtual library of 18 monomers, which are commonly used for imprinted networks, identified N-(3-aminopropyl)-methacrylate hydrochloride (APMA.HCl), N,N-diethylamino ethyl methacrylate (DEAEM) and ethyleneglycol methacrylate phosphate (EGMP) as suitable functional monomers with medium-to-high affinity for cholic acid. The polymers were prepared with a fix cholic acid:functional monomer mole ratio of 1:4, but with various cross-linking densities. Compared to polymers prepared without functional monomer, both imprinted and non-imprinted microparticles showed a high capability to remove sodium cholate from aqueous medium. High affinity APMA-based particles even resembled the performance of commercially available cholesterol-lowering granules. The imprinting effect was evident in most of the networks prepared, showing that computational modeling and molecular imprinting can act synergistically to improve the performance of certain polymers. Nevertheless, both the imprinted and non-imprinted networks prepared with the best monomer (APMA.HCl) identified by the modeling demonstrated such high affinity for the template that the imprinting effect was less important. The fitting of adsorption isotherms to the Freundlich model indicated that, in general, imprinting increases the population of high affinity binding sites, except when the affinity of the functional monomer for the target molecule is already very high. The cross-linking density was confirmed as a key parameter that determines the accessibility of the binding points to sodium cholate. Materials prepared with 9% mol APMA and 91% mol cross-linker showed enough affinity to achieve binding levels of up to 0.4 mmol g(-1) (i.e., 170 mg g(-1)) under flow

  15. Providing affinity

    DEFF Research Database (Denmark)

    Guglielmi, Michel; Johannesen, Hl


    , Essex, Hertfordshire, Norfolk and Suffolk. Research found that there was a lack of identity or sense of belonging and nothing anchoring people to the region as a whole. Common affinity is somehow forced to the people of East England and thereby we came to the conclusion that a single landmark...... and potential situations but also virtual events that calls for an undeterminated process of resolution. This process is activated by the user who co-produces the actualisation as an answer to a virtual reality that we defined at the first place. The potential situations or the possible it is a fantomatic real....... The possible is like the real. It is determinated and it only lakes existence. While the possible is already made, the virtual is like a problematic which needs to be resolved and actualized. Our installations are based on high tech interactivity where we use sensors and remote communication to offer a sense...

  16. High-affinity RNA aptamers to C-reactive protein (CRP): newly developed pre-elution methods for aptamer selection

    International Nuclear Information System (INIS)

    Orito, N; Umekage, S; Sakai, E; Tanaka, T; Kikuchi, Y; Sato, K; Kawauchi, S; Tanaka, H


    We have developed a modified SELEX (systematic evolution of ligands by exponential enrichment) method to obtain RNA aptamers with high affinity to C-reactive protein (CRP). CRP is a clinical biomarker present in plasma, the level of which increases in response to infections and noninfectious inflammation. The CRP level is also an important prognostic indicator in patients with several syndromes. At present, CRP content in blood is measured immunochemically using antibodies. To develop a more sensitive method using RNA aptamers, we have attempted to obtain high-affinity RNA aptamers to CRP. We succeeded in obtaining an RNA aptamer with high affinity to CRP using a CRP-immobilized Sepharose column and pre-elution procedure. Pre-elution is a method that removes the weak binding portion from a selected RNA population by washing for a short time with buffer containing CRP. By surface plasmon-resonance (SPR) analysis, the affinity constant of this aptamer for CRP was calculated to be K D = 2.25x10 -9 (M). The secondary structure, contact sites with CRP protein, and application of this aptamer will be described.

  17. Identification and properties of very high affinity brain membrane-binding sites for a neurotoxic phospholipase from the taipan venom

    Energy Technology Data Exchange (ETDEWEB)

    Lambeau, G.; Barhanin, J.; Schweitz, H.; Qar, J.; Lazdunski, M. (Centre de Biochimie, Nice (France))


    Four new monochain phospholipases were purified from the Oxyuranus scutellatus (taipan) venom. Three of them were highly toxic when injected into mice brain. One of these neurotoxic phospholipases, OS2, was iodinated and used in binding experiments to demonstrate the presence of two families of specific binding sites in rat brain synaptic membranes. The affinities were exceptionally high, Kd1 = 1.5 +/- 0.5 pM and Kd2 = 45 +/- 10 pM, and the maximal binding capacities were Bmax 1 = 1 +/- 0.4 and Bmax 2 = 3 +/- 0.5 pmol/mg of protein. Both binding sites were sensitive to proteolysis and demonstrated to be located on proteins of Mr 85,000-88,000 and 36,000-51,000 by cross-linking and photoaffinity labeling techniques. The binding of {sup 125}I-OS2 to synaptic membranes was dependent on Ca2+ ions and enhanced by Zn2+ ions which inhibit phospholipase activity. Competition experiments have shown that, except for beta-bungarotoxin, a number of known toxic snake or bee phospholipases have very high affinities for the newly identified binding sites. A good correlation (r = 0.80) was observed between toxicity and affinity but not between phospholipase activity and affinity.

  18. Identification and properties of very high affinity brain membrane-binding sites for a neurotoxic phospholipase from the taipan venom

    International Nuclear Information System (INIS)

    Lambeau, G.; Barhanin, J.; Schweitz, H.; Qar, J.; Lazdunski, M.


    Four new monochain phospholipases were purified from the Oxyuranus scutellatus (taipan) venom. Three of them were highly toxic when injected into mice brain. One of these neurotoxic phospholipases, OS2, was iodinated and used in binding experiments to demonstrate the presence of two families of specific binding sites in rat brain synaptic membranes. The affinities were exceptionally high, Kd1 = 1.5 +/- 0.5 pM and Kd2 = 45 +/- 10 pM, and the maximal binding capacities were Bmax 1 = 1 +/- 0.4 and Bmax 2 = 3 +/- 0.5 pmol/mg of protein. Both binding sites were sensitive to proteolysis and demonstrated to be located on proteins of Mr 85,000-88,000 and 36,000-51,000 by cross-linking and photoaffinity labeling techniques. The binding of 125 I-OS2 to synaptic membranes was dependent on Ca2+ ions and enhanced by Zn2+ ions which inhibit phospholipase activity. Competition experiments have shown that, except for beta-bungarotoxin, a number of known toxic snake or bee phospholipases have very high affinities for the newly identified binding sites. A good correlation (r = 0.80) was observed between toxicity and affinity but not between phospholipase activity and affinity

  19. Energy-dependent dissociation of ATP from high affinity catalytic sites of beef heart mitochondrial adenosine triphosphatase

    International Nuclear Information System (INIS)

    Penefsky, H.S.


    Incubation of [gamma- 32 P]ATP with a molar excess of the membrane-bound form of mitochondrial ATPase (F1) results in binding of the bulk of the radioactive nucleotide in high affinity catalytic sites (Ka = 10(12) M-1). Subsequent initiation of respiration by addition of succinate or NADH is accompanied by a profound decrease in the affinity for ATP. About one-third of the bound radioactive ATP appears to dissociate, that is, the [gamma- 32 P]ATP becomes accessible to hexokinase. The NADH-stimulated dissociation of [gamma- 32 P]ATP is energy-dependent since the stimulation is inhibited by uncouplers of oxidative phosphorylation and is prevented by respiratory chain inhibitors. The rate of the energy-dependent dissociation of ATP that occurs in the presence of NADH, ADP, and Pi is commensurate with the measured initial rate of ATP synthesis in NADH-supported oxidative phosphorylation catalyzed by the same submitochondrial particles. Thus, the rate of dissociation of ATP from the high affinity catalytic site of submitochondrial particles meets the criterion of kinetic competency under the conditions of oxidative phosphorylation. These experiments provide evidence in support of the argument that energy conserved during the oxidation of substrates by the respiratory chain can be utilized to reduce the very tight binding of product ATP in high affinity catalytic sites and to promote dissociation of the nucleotide

  20. Blockage of High-Affinity Choline Transporter Increases Visceral Hypersensitivity in Rats with Chronic Stress

    Directory of Open Access Journals (Sweden)

    Chen Zhao


    Full Text Available Background. Visceral hypersensitivity is a common feature of irritable bowel syndrome. Cholinergic system involves in the development of visceral hypersensitivity, and high-affinity choline transporter (CHT1 is of crucial importance in choline uptake system. However, involvement of CHT1 in visceral hypersensitivity remains unknown. The research aimed to study the CHT1 expression in dorsal root ganglions (DRGs and the role of CHT1 in visceral hypersensitivity. Methods. Repetitive water avoidance stress (WAS was used to induce visceral hypersensitivity in rats. Colorectal distension (CRD was determined, and the abdominal withdrawal reflex (AWR and threshold intensity data were recorded to measure the visceral sensitivity. After intraperitoneal injection of hemicholinium-3 (HC-3, the specific inhibitor of CHT1, CRD data were also recorded. The CHT1 expression of DRGs was investigated by Western blotting, immunohistochemistry, and quantitative RT-PCR. Acetylcholine levels in the DRGs were detected by the assay kit. Results. Repetitive WAS increased the AWR score of CRD at high distension pressure and decreased the mean threshold of rats. The CHT1 expression and acetylcholine concentration of DRG were significantly increased in WAS rats. After the administration of HC-3, the AWR score in WAS group was significantly increased at higher distension pressure while the threshold intensity was significantly reduced compared to the normal saline group. Acetylcholine concentration was significantly lower than the normal saline rats. Conclusion. Our research firstly reports that CHT1 is overexpressed in noninflammatory visceral hypersensitivity, and blockage of CHT1 can enhance the visceral hypersensitivity. CHT1 may play an inhibitory role in visceral hypersensitivity.

  1. Blockage of High-Affinity Choline Transporter Increases Visceral Hypersensitivity in Rats with Chronic Stress (United States)


    Background Visceral hypersensitivity is a common feature of irritable bowel syndrome. Cholinergic system involves in the development of visceral hypersensitivity, and high-affinity choline transporter (CHT1) is of crucial importance in choline uptake system. However, involvement of CHT1 in visceral hypersensitivity remains unknown. The research aimed to study the CHT1 expression in dorsal root ganglions (DRGs) and the role of CHT1 in visceral hypersensitivity. Methods Repetitive water avoidance stress (WAS) was used to induce visceral hypersensitivity in rats. Colorectal distension (CRD) was determined, and the abdominal withdrawal reflex (AWR) and threshold intensity data were recorded to measure the visceral sensitivity. After intraperitoneal injection of hemicholinium-3 (HC-3), the specific inhibitor of CHT1, CRD data were also recorded. The CHT1 expression of DRGs was investigated by Western blotting, immunohistochemistry, and quantitative RT-PCR. Acetylcholine levels in the DRGs were detected by the assay kit. Results Repetitive WAS increased the AWR score of CRD at high distension pressure and decreased the mean threshold of rats. The CHT1 expression and acetylcholine concentration of DRG were significantly increased in WAS rats. After the administration of HC-3, the AWR score in WAS group was significantly increased at higher distension pressure while the threshold intensity was significantly reduced compared to the normal saline group. Acetylcholine concentration was significantly lower than the normal saline rats. Conclusion Our research firstly reports that CHT1 is overexpressed in noninflammatory visceral hypersensitivity, and blockage of CHT1 can enhance the visceral hypersensitivity. CHT1 may play an inhibitory role in visceral hypersensitivity. PMID:29849603

  2. High-affinity hemoglobin and blood oxygen saturation in diving emperor penguins. (United States)

    Meir, Jessica U; Ponganis, Paul J


    The emperor penguin (Aptenodytes forsteri) thrives in the Antarctic underwater environment, diving to depths greater than 500 m and for durations longer than 23 min. To examine mechanisms underlying the exceptional diving ability of this species and further describe blood oxygen (O2) transport and depletion while diving, we characterized the O2-hemoglobin (Hb) dissociation curve of the emperor penguin in whole blood. This allowed us to (1) investigate the biochemical adaptation of Hb in this species, and (2) address blood O2 depletion during diving, by applying the dissociation curve to previously collected partial pressure of O2 (PO2) profiles to estimate in vivo Hb saturation (SO2) changes during dives. This investigation revealed enhanced Hb-O2 affinity (P50=28 mmHg, pH 7.5) in the emperor penguin, similar to high-altitude birds and other penguin species. This allows for increased O2 at low blood PO2 levels during diving and more complete depletion of the respiratory O2 store. SO2 profiles during diving demonstrated that arterial SO2 levels are maintained near 100% throughout much of the dive, not decreasing significantly until the final ascent phase. End-of-dive venous SO2 values were widely distributed and optimization of the venous blood O2 store resulted from arterialization and near complete depletion of venous blood O2 during longer dives. The estimated contribution of the blood O2 store to diving metabolic rate was low and highly variable. This pattern is due, in part, to the influx of O2 from the lungs into the blood during diving, and variable rates of tissue O2 uptake.

  3. Cartilage Acidic Protein 2 a hyperthermostable, high affinity calcium-binding protein. (United States)

    Anjos, Liliana; Gomes, Ana S; Melo, Eduardo P; Canário, Adelino V; Power, Deborah M


    Cartilage Acidic Protein 2 (CRTAC2) is a novel protein present from prokaryotes to vertebrates with abundant expression in the teleost fish pituitary gland and an isoform of CRTAC1, a chondrocyte marker in humans. The two proteins are non-integrins containing N-terminal integrin-like Ca(2+)-binding motifs and their structure and function remain to be assigned. Structural studies of recombinant sea bream (sb)CRTAC2 revealed it is composed of 8.8% α-helix, 33.4% β-sheet and 57.8% unordered protein. sbCRTAC2 bound Ca(2+) with high affinity (K(d)=1.46nM) and favourable Gibbs free energy (∆G=-12.4kcal/mol). The stoichiometry for Ca(2+) bound to sbCRTAC2 at saturation indicated six Ca(2+) ligand-binding sites exist per protein molecule. No conformational change in sbCRTAC2 occurred in the presence of Ca(2+). Fluorescence emission revealed that the tertiary structure of the protein is hyperthermostable between 25°C and 95°C and the fully unfolded state is only induced by chemical denaturing (4M GndCl). sbCRTAC has a widespread tissue distribution and is present as high molecular weight aggregates, although strong reducing conditions promote formation of the monomer. sbCRTAC2 promotes epithelial cell outgrowth in vitro suggesting it may share functional homology with mammalian CRTAC1, recently implicated in cell-cell and cell-matrix interactions. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Characterization of high-affinity (/sup 3/H)ouabain binding in the rat central nervous system

    Energy Technology Data Exchange (ETDEWEB)

    Hauger, R.; Luu, H.M.; Meyer, D.K.; Goodwin, F.K.; Paul, S.M.


    The characteristics of (/sup 3/H)ouabain binding were examined in various areas of rat brain. In the striatum, Scatchard analysis revealed a single class of high-affinity binding sites with an apparent binding affinity (KD) of 10.4 +/- 0.9 nM and an estimated binding capacity (Bmax) of 7.6 +/- 1.9 pmol/mg protein. Similar monophasic Scatchard plots were found in the brainstem, cerebellum, hypothalamus, and frontal cerebral cortex. (/sup 3/H)Ouabain binding to rat brain was sodium- and ATP-dependent and strongly inhibited by potassium. Proscillariden A was the most potent cardiac glycoside tested in inhibiting specific (/sup 3/H)ouabain binding to brain membranes, and the rank order of inhibitory potencies for a series of cardiac glycosides was similar to that previously reported for inhibition of heart Na,K-ATPase. To assess whether the high-affinity binding sites for (/sup 3/H)ouabain were localized to neuronal or nonneuronal membranes, the effect of discrete kainic acid lesions on striatal (/sup 3/H)ouabain binding was examined. Kainic acid lesions of the striatum reduced (/sup 3/H)ouabain binding to striatal homogenates by 79.6 +/- 1.6%. This suggests that the high-affinity (/sup 3/H)ouabain binding sites measured in our experiments are localized to neuronal elements. Thus, the high-affinity binding of (/sup 3/H)ouabain to brain membranes may selectively label a neuronal form or conformation of Na,K-ATPase.

  5. Carbon-11-labelling of a novel, trishomocubane-derived, high affinity and selectivity DAT ligand

    International Nuclear Information System (INIS)

    Dolle, F.; Le Helleix, St.; Peyronneau, M.A.; Saba, W.; Tournier, N.; Valette, H.; Banister, S.; Kassiou, M.


    Complete text of publication follows: Objectives: Parkinson's disease, schizophrenia, attention deficit disorder and drug abuse are related to abnormalities within the brain's dopaminergic system. The neuronal dopamine transporter (DAT) plays a key role in regulating the synaptic concentration of dopamine and thus dopamine neurotransmission in the brain. Since the DAT can be considered as a marker of the integrity and number of the presynaptic striatal dopamine-producing neurons, considerable efforts have been spent in recent years on the design and development of DAT-selective radioligands for use in Positron Emission Tomography (PET) studies. Notably, the tropane PE2I and its fluorinated analogue LBT-999 were identified as having high affinity and selectivity for the DAT over the norepinephrine transporter (NET) and the serotonin transporter (SERT). Besides tropanes, only a few bicyclic frameworks, e.g. bicyclo[2.2.2]octanes, have delivered compounds with high affinity for the DAT. Recently, novel poly-carbocyclic DAT ligands with selectivity over the NET and the SERT were reported. The lead compound of this series (1, N-methyl-N-(3-fluoro) benzyl-pentacyclo[ 2, 6 .0 3, 10 .0 5, 9 ] undec-8-ylamine, Ki = 1.2 nM, ≥ 8300-fold selectivity over NET and SERT) was selected as a potential candidate for imaging the DAT with PET and isotopically labelled with carbon-11 using [ 11 C]methyl triflate. Methods: The trishomocubane derivatives 1 (reference) and 2 (precursor for labelling with carbon-11) were prepared from commercially available Cookson's diketone in 6 and 7 steps, respectively. Carbon-11 labelling of 1 was performed using a TRACERLab FX-C Pro synthesizer (GEMS) and comprises (1) trapping at -10 C of [ 11 C]MeOTf in acetone (0.4 mL) containing the nor-derivative 2 (0.6-0.9 mg, free base) and aq. 3N NaOH (8 μL); (2) heating at 110 C for 2 min; (3) concentration to dryness and taking up the residue in 1.0 mL of the HPLC mobile phase; (4) purification

  6. Structure-based engineering to restore high affinity binding of an isoform-selective anti-TGFβ1 antibody (United States)

    Honey, Denise M.; Best, Annie; Qiu, Huawei


    ABSTRACT Metelimumab (CAT192) is a human IgG4 monoclonal antibody developed as a TGFβ1-specific antagonist. It was tested in clinical trials for the treatment of scleroderma but later terminated due to lack of efficacy. Subsequent characterization of CAT192 indicated that its TGFβ1 binding affinity was reduced by ∼50-fold upon conversion from the parental single-chain variable fragment (scFv) to IgG4. We hypothesized this result was due to decreased conformational flexibility of the IgG that could be altered via engineering. Therefore, we designed insertion mutants in the elbow region and screened for binding and potency. Our results indicated that increasing the elbow region linker length in each chain successfully restored the isoform-specific and high affinity binding of CAT192 to TGFβ1. The crystal structure of the high binding affinity mutant displays large conformational rearrangements of the variable domains compared to the wild-type antigen-binding fragment (Fab) and the low binding affinity mutants. Insertion of two glycines in both the heavy and light chain elbow regions provided sufficient flexibility for the variable domains to extend further apart than the wild-type Fab, and allow the CDR3s to make additional interactions not seen in the wild-type Fab structure. These interactions coupled with the dramatic conformational changes provide a possible explanation of how the scFv and elbow-engineered Fabs bind TGFβ1 with high affinity. This study demonstrates the benefits of re-examining both structure and function when converting scFv to IgG molecules, and highlights the potential of structure-based engineering to produce fully functional antibodies. PMID:29333938

  7. High-throughput and multiplexed regeneration buffer scouting for affinity-based interactions

    NARCIS (Netherlands)

    Geuijen, K.P.M.; Schasfoort, R.B.; Wijffels, R.H.; Eppink, M.H.M.


    Affinity-based analyses on biosensors depend partly on regeneration between measurements. Regeneration is performed with a buffer that efficiently breaks all interactions between ligand and analyte while maintaining the active binding site of the ligand. We demonstrated a regeneration buffer

  8. Locked nucleic acid (LNA): High affinity targeting of RNA for diagnostics and therapeutics

    DEFF Research Database (Denmark)

    Kauppinen, S.; Vester, Birte; Wengel, Jesper


    Locked nucleic acid (LNA) is a nucleic acid analogue containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked in an RNA mimicking sugar conformation. This conformational restriction results in unprecedented hybridization affinity towards complementary single stranded RN...

  9. A pharmacological profile of the high-affinity GluK5 kainate receptor

    DEFF Research Database (Denmark)

    Møllerud, Stine; Kastrup, Jette Sandholm Jensen; Pickering, Darryl S


    -hydroxyisoxazol-4-yl)propionate (ATPA), dihydrokainate and (2 S,4 R)−4-methyl-glutamate (SYM2081) have higher affinity at GluK3 compared to GluK5. Since some studies have indicated that GluK5 is associated with various diseases in the central nervous system (e.g. schizophrenia, temporal lobe epilepsy, bipolar...

  10. High-affinity small molecule-phospholipid complex formation: binding of siramesine to phosphatidicacid

    DEFF Research Database (Denmark)

    Khandelia, Himanshu


    , comparable to the affinities for the binding of small molecule ligands to proteins, was measured for phosphatidic acid (PA, mole fraction of XPA ) 0.2 in phosphatidylcholine vesicles), yielding a molecular partition coefficient of 240 ( 80 × 106. An MD simulation on the siramesine:PA interaction...

  11. Synthetic Receptors for the High-Affinity Recognition of O-GlcNAc Derivatives

    NARCIS (Netherlands)

    Rios, Pablo; Carter, Tom S; Mooibroek, Tiddo J; Crump, Matthew P; Lisbjerg, Micke; Pittelkow, Michael; Supekar, Nitin T; Boons, Geert-Jan|info:eu-repo/dai/nl/088245489; Davis, Anthony P


    The combination of a pyrenyl tetraamine with an isophthaloyl spacer has led to two new water-soluble carbohydrate receptors ("synthetic lectins"). Both systems show outstanding affinities for derivatives of N-acetylglucosamine (GlcNAc) in aqueous solution. One receptor binds the methyl glycoside

  12. 14-O-Methylmorphine: A Novel Selective Mu-Opioid Receptor Agonist with High Efficacy and Affinity. (United States)

    Zádor, Ferenc; Balogh, Mihály; Váradi, András; Zádori, Zoltán S; Király, Kornél; Szűcs, Edina; Varga, Bence; Lázár, Bernadette; Hosztafi, Sándor; Riba, Pál; Benyhe, Sándor; Fürst, Susanna; Al-Khrasani, Mahmoud


    14-O-methyl (14-O-Me) group in morphine-6-O-sulfate (M6SU) or oxymorphone has been reported to be essential for enhanced affinity, potency and antinociceptive effect of these opioids. Herein we report on the pharmacological properties (potency, affinity and efficacy) of the new compound, 14-O-methylmorphine (14-O-MeM) in in vitro. Additionally, we also investigated the antinociceptive effect of the novel compound, as well as its inhibitory action on gastrointestinal transit in in vivo. The potency and efficacy of test compound were measured by [ 35 S]GTPγS binding, isolated mouse vas deferens (MVD) and rat vas deferens (RVD) assays. The affinity of 14-O-MeM for opioid receptors was assessed by radioligand binding and MVD assays. The antinociceptive and gastrointestinal effects of the novel compound were evaluated in the rat tail-flick test and charcoal meal test, respectively. Morphine, DAMGO, Ile 5,6 deltorphin II, deltorphin II and U-69593 were used as reference compounds. 14-O-MeM showed higher efficacy (E max ) and potency (EC 50 ) than morphine in MVD, RVD or [ 35 S]GTPγS binding. In addition, 14-O-MeM compared to morphine showed higher affinity for μ-opioid receptor (MOR). In vivo, in rat tail-flick test 14-O-MeM proved to be stronger antinociceptive agent than morphine after peripheral or central administration. Additionally, both compounds inhibited the gastrointestinal peristalsis. However, when the antinociceptive and antitransit doses for each test compound are compared, 14-O-MeM proved to have slightly more favorable pharmacological profile. Our results affirm that 14-O-MeM, an opioid of high efficacy and affinity for MOR can be considered as a novel analgesic agent of potential clinical value. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Selective induction of high-ouabain-affinity isoform of Na sup + -K sup + -ATPase by thyroid hormone

    Energy Technology Data Exchange (ETDEWEB)

    Haber, R.S.; Loeb, J.N. (Columbia Univ., New York, NY (USA))


    The administration of thyroid hormone is known to result in an induction of the Na{sup +}-K{sup +}-adenosinetriphosphatase (Na{sup +}-K{sup +}-ATPase) in rat skeletal muscle and other thyroid hormone-responsive tissues. Since the Na{sup +}-K{sup +}-ATPase in a variety of mammalian tissues has recently been reported to exist in at least two forms distinguishable by differing affinities for the inhibitory cardiac glycoside ouabain. The authors have studied the effects of 3,3{prime},5-triiodo-L-thyronine (T{sub 3}) treatment on these two forms of the enzyme in rat diaphragm. The inhibition of Na{sup +}-K{sup +}-ATPase activity in a crude membrane fraction by varying concentrations of ouabain conformed to a biphasic pattern consistent with the presence of two distinct isoforms with inhibition constants (K{sub I}s) for ouabain of {approximately}10{sup {minus}7} and 10{sup {minus}4} M, respectively. Measurement of the specific binding of ({sup 3}H)ouabain to these membranes confirmed the presence of a class of high-affinity ouabain binding sites with a dissociation constant (K{sub d}) of slightly less than 10{sup {minus}7}M, whose maximal binding capacity was increased by T{sub 3} treatment by 185%. Binding studies in unfractionated homogenates of diaphragm similarly demonstrated the presence of high-affinity sites whose maximal binding capacity was increased by T{sub 3} treatment. Quantitation of both the high- and low-ouabain-affinity forms of the Na{sup +}-K{sup +}-ATPase by ouabain-dependent phosphorylation from ({sup 32}P)orthophosphate confirmed that T{sub 3} treatment markedly increased the number of high-affinity sites while having little effect on the number of low-affinity sites. These observations provide, to our knowledge, the first demonstration that these two forms of the Na{sup +}-K{sup +}-ATPase are subject to selective hormonal induction.

  14. Discovery of PF-06928215 as a high affinity inhibitor of cGAS enabled by a novel fluorescence polarization assay. (United States)

    Hall, Justin; Brault, Amy; Vincent, Fabien; Weng, Shawn; Wang, Hong; Dumlao, Darren; Aulabaugh, Ann; Aivazian, Dikran; Castro, Dana; Chen, Ming; Culp, Jeffrey; Dower, Ken; Gardner, Joseph; Hawrylik, Steven; Golenbock, Douglas; Hepworth, David; Horn, Mark; Jones, Lyn; Jones, Peter; Latz, Eicke; Li, Jing; Lin, Lih-Ling; Lin, Wen; Lin, David; Lovering, Frank; Niljanskul, Nootaree; Nistler, Ryan; Pierce, Betsy; Plotnikova, Olga; Schmitt, Daniel; Shanker, Suman; Smith, James; Snyder, William; Subashi, Timothy; Trujillo, John; Tyminski, Edyta; Wang, Guoxing; Wong, Jimson; Lefker, Bruce; Dakin, Leslie; Leach, Karen


    Cyclic GMP-AMP synthase (cGAS) initiates the innate immune system in response to cytosolic dsDNA. After binding and activation from dsDNA, cGAS uses ATP and GTP to synthesize 2', 3' -cGAMP (cGAMP), a cyclic dinucleotide second messenger with mixed 2'-5' and 3'-5' phosphodiester bonds. Inappropriate stimulation of cGAS has been implicated in autoimmune disease such as systemic lupus erythematosus, thus inhibition of cGAS may be of therapeutic benefit in some diseases; however, the size and polarity of the cGAS active site makes it a challenging target for the development of conventional substrate-competitive inhibitors. We report here the development of a high affinity (KD = 200 nM) inhibitor from a low affinity fragment hit with supporting biochemical and structural data showing these molecules bind to the cGAS active site. We also report a new high throughput cGAS fluorescence polarization (FP)-based assay to enable the rapid identification and optimization of cGAS inhibitors. This FP assay uses Cy5-labelled cGAMP in combination with a novel high affinity monoclonal antibody that specifically recognizes cGAMP with no cross reactivity to cAMP, cGMP, ATP, or GTP. Given its role in the innate immune response, cGAS is a promising therapeutic target for autoinflammatory disease. Our results demonstrate its druggability, provide a high affinity tool compound, and establish a high throughput assay for the identification of next generation cGAS inhibitors.

  15. Discovery of PF-06928215 as a high affinity inhibitor of cGAS enabled by a novel fluorescence polarization assay

    Energy Technology Data Exchange (ETDEWEB)

    Hall, Justin; Brault, Amy; Vincent, Fabien; Weng, Shawn; Wang, Hong; Dumlao, Darren; Aulabaugh, Ann; Aivazian, Dikran; Castro, Dana; Chen, Ming; Culp, Jeffrey; Dower, Ken; Gardner, Joseph; Hawrylik, Steven; Golenbock, Douglas; Hepworth, David; Horn, Mark; Jones, Lyn; Jones, Peter; Latz, Eicke; Li, Jing; Lin, Lih-Ling; Lin, Wen; Lin, David; Lovering, Frank; Niljanskul, Nootaree; Nistler, Ryan; Pierce, Betsy; Plotnikova, Olga; Schmitt, Daniel; Shanker, Suman; Smith, James; Snyder, William; Subashi, Timothy; Trujillo, John; Tyminski, Edyta; Wang, Guoxing; Wong, Jimson; Lefker, Bruce; Dakin, Leslie; Leach, Karen (UMASS, MED); (Pfizer)


    Cyclic GMP-AMP synthase (cGAS) initiates the innate immune system in response to cytosolic dsDNA. After binding and activation from dsDNA, cGAS uses ATP and GTP to synthesize 2', 3' -cGAMP (cGAMP), a cyclic dinucleotide second messenger with mixed 2'-5' and 3'-5' phosphodiester bonds. Inappropriate stimulation of cGAS has been implicated in autoimmune disease such as systemic lupus erythematosus, thus inhibition of cGAS may be of therapeutic benefit in some diseases; however, the size and polarity of the cGAS active site makes it a challenging target for the development of conventional substrate-competitive inhibitors. We report here the development of a high affinity (KD = 200 nM) inhibitor from a low affinity fragment hit with supporting biochemical and structural data showing these molecules bind to the cGAS active site. We also report a new high throughput cGAS fluorescence polarization (FP)-based assay to enable the rapid identification and optimization of cGAS inhibitors. This FP assay uses Cy5-labelled cGAMP in combination with a novel high affinity monoclonal antibody that specifically recognizes cGAMP with no cross reactivity to cAMP, cGMP, ATP, or GTP. Given its role in the innate immune response, cGAS is a promising therapeutic target for autoinflammatory disease. Our results demonstrate its druggability, provide a high affinity tool compound, and establish a high throughput assay for the identification of next generation cGAS inhibitors.

  16. Twins in spirit part II: DOTATATE and high-affinity DOTATATE - the clinical experience

    Energy Technology Data Exchange (ETDEWEB)

    Brogsitter, Claudia; Zoephel, Klaus; Hartmann, Holger; Kotzerke, Joerg [Technische Universitaet Dresden, Department of Nuclear Medicine, Dresden (Germany); Schottelius, Margret; Wester, Hans-Juergen [Technische Universitaet Muenchen, Pharmaceutical Radiochemistry and Department of Nuclear Medicine, Muenchen (Germany)


    Over recent decades interest in diagnosis and treatment of neuroendocrine tumours (NET) has steadily grown. The basis for diagnosis and therapy of NET with radiolabelled somatostatin (hsst) analogues is the variable overexpression of hsst receptors (hsst1-5 receptors). We hypothesized that radiometal derivatives of DOTA-iodo-Tyr{sup 3}-octreotide analogues might be excellent candidates for somatostatin receptor imaging. We therefore explored the diagnostic potential of {sup 68}Ga-DOTA-iodo-Tyr{sup 3}-octreotate [{sup 68}Ga-DOTA,3-iodo-Tyr{sup 3},Thr{sup 8}]octreotide ({sup 68}Ga-HA-DOTATATE; HA, high-affinity) compared to the established {sup 68}Ga-DOTA-Tyr{sup 3}-octreotate ({sup 68}Ga-DOTATATE) in vivo. The study included 23 patients with known somatostatin receptor-positive metastases from NETs, thyroid cancer or glomus tumours who were investigated with both {sup 68}Ga-HA-DOTATATE and {sup 68}Ga-DOTATATE. A patient-based and a lesion-based comparative analysis was carried out of normal tissue distribution and lesion detectability in a qualitative and a semiquantitative manner. {sup 68}Ga-HA-DOTATATE and {sup 68}Ga-DOTATATE showed comparable uptake in the liver (SUV{sub mean} 8.9 ± 2.2 vs. 9.3 ± 2.5, n.s.), renal cortex (SUV{sub mean} 13.3 ± 3.9 vs. 14.5 ± 3.7, n.s.) and spleen (SUV{sub mean} 24.0 ± 6.7 vs. 22.9 ± 7.3, n.s.). A somewhat higher pituitary uptake was found with {sup 68}Ga-HA-DOTATATE (SUV{sub mean} 6.3 ± 1.8 vs. 5.4 ± 2.1, p < 0.05). On a lesion-by-lesion basis a total of 344 lesions were detected. {sup 68}Ga-HA-DOTATATE demonstrated 328 lesions (95.3 % of total lesions seen), and {sup 68}Ga-DOTATATE demonstrated 332 lesions (96.4 %). The mean SUV{sub max} of all lesions was not significantly different between {sup 68}Ga-HA-DOTATATE and {sup 68}Ga-DOTATATE (17.8 ± 11.4 vs. 16.7 ± 10.7, n.s.). Our analysis demonstrated very good concordance between {sup 68}Ga-HA-DOTATATE and {sup 68}Ga-DOTATATE PET data. As the availability and use of {sup

  17. Dopamine inhibition of anterior pituitary adenylate cyclase is mediated through the high-affinity state of the D2 receptor

    International Nuclear Information System (INIS)

    Borgundvaag, B.; George, S.R.


    The diterpinoid forskolin stimulated adenylate cyclase activity (measured by conversion of [ 3 H]-ATP to [ 3 H]-cAMP) in anterior pituitary from male and female rats. Inhibition of stimulated adenylate cyclase activity by potent dopaminergic agonists was demonstrable only in female anterior pituitary. The inhibition of adenylate cyclase activity displayed a typically dopaminergic rank order of agonist potencies and could be completely reversed by a specific dopamine receptor antagonist. The IC 50 values of dopamine agonist inhibition of adenylate cyclase activity correlated with equal molarity with the dissociation constant of the high-affinity dopamine agonist-detected receptor binding site and with the IC 50 values for inhibition of prolactin secretion. These findings support the hypothesis that it is the high-affinity form of the D 2 dopamine receptor in anterior pituitary which is responsible for mediating the dopaminergic function of attenuating adenylate cyclase activity. 12 references, 4 figures, 1 table

  18. Rapid Diagnostic Assay for Intact Influenza Virus Using a High Affinity Hemagglutinin Binding Protein. (United States)

    Anderson, Caitlin E; Holstein, Carly A; Strauch, Eva-Maria; Bennett, Steven; Chevalier, Aaron; Nelson, Jorgen; Fu, Elain; Baker, David; Yager, Paul


    Influenza is a ubiquitous and recurring infection that results in approximately 500 000 deaths globally each year. Commercially available rapid diagnostic tests are based upon detection of the influenza nucleoprotein, which are limited in that they are unable to differentiate by species and require an additional viral lysis step. Sample preprocessing can be minimized or eliminated by targeting the intact influenza virus, thereby reducing assay complexity and leveraging the large number of hemagglutinin proteins on the surface of each virus. Here, we report the development of a paper-based influenza assay that targets the hemagglutinin protein; the assay employs a combination of antibodies and novel computationally designed, recombinant affinity proteins as the capture and detection agents. This system leverages the customizability of recombinant protein design to target the conserved receptor-binding pocket of the hemagglutinin protein and to match the trimeric nature of hemagglutinin for improved avidity. Using this assay, we demonstrate the first instance of intact influenza virus detection using a combination of antibody and affinity proteins within a porous network. The recombinant head region binder based assays yield superior analytical sensitivity as compared to the antibody based assay, with lower limits of detection of 3.54 × 10 7 and 1.34 × 10 7 CEID 50 /mL for the mixed and all binder stacks, respectively. Not only does this work describe the development of a novel influenza assay, it also demonstrates the power of recombinant affinity proteins for use in rapid diagnostic assays.

  19. Peptides in headlock ? a novel high-affinity and versatile peptide-binding nanobody for proteomics and microscopy


    Braun, Michael B.; Traenkle, Bjoern; Koch, Philipp A.; Emele, Felix; Weiss, Frederik; Poetz, Oliver; Stehle, Thilo; Rothbauer, Ulrich


    Nanobodies are highly valuable tools for numerous bioanalytical and biotechnical applications. Here, we report the characterization of a nanobody that binds a short peptide epitope with extraordinary affinity. Structural analysis reveals an unusual binding mode where the extended peptide becomes part of a ?-sheet structure in the nanobody. This interaction relies on sequence-independent backbone interactions augmented by a small number of specificity-determining side chain contacts. Once boun...

  20. Functional characterization of the high affinity IgG Receptor : making heads and tails of FcγRI

    NARCIS (Netherlands)

    van der Poel, C.E.


    This thesis focuses on human FcγRI, a high affinity receptor for antibodies of the IgG isotype. IgG is the most abundant antibody type in blood and all currently FDA approved therapeutic antibodies are of the IgG isotype. FcγRI, a member of the activating Fcγ receptors, exists as a complex of a

  1. Benzodiazepines have high-affinity binding sites and induce melanogenesis in B16/C3 melanoma cells.


    Matthew, E; Laskin, J D; Zimmerman, E A; Weinstein, I B; Hsu, K C; Engelhardt, D L


    We found that two markers of differentiation, tyrosinase (monophenol, dihydroxyphenylalanine:oxygen oxidoreductase, EC activity and melanin synthesis, are induced by diazepam in B16/C3 mouse melanoma cells. We also demonstrated high-affinity binding sites for [3H]diazepam in these cells by radioreceptor assay, and we visualized binding to the cell surface by fluorescence microscopy with a benzodiazepine analog conjugated to a fluorescein-labeled protein. Our studies also showed tha...

  2. Photoaffinity labeling of mammalian α1-adrenergic receptors: identification of the ligand binding subunit with a high affinity radioiodinated probe

    International Nuclear Information System (INIS)

    Leeb-Lundberg, L.M.F.; Dickinson, K.E.J.; Heald, S.L.


    A description is given of the synthesised and characterization of a novel high affinity radioiodinated α 1 -adrenergic receptor photoaffinity probe, 4-amino-6,7-dimethoxy-2-[4-[5-(4-azido-3-[ 125 I]iodophenyl)pentanoyl]-1-piperazinyl] quinazoline. In the absence of light, this ligand binds with high affinity (K/sub d/ = 130 pm) in a reverisble and saturable manner to sites in rat hepatic plasma membranes. The binding is stereoselective and competitively inhibited by adrenergic agonists and antagonists with an α 1 -adrenergic specificity. Upon photolysis, this ligand incorporates irreversibly into plasma membranes prepared from several mammalian tissues including rat liver, rat, guinea pig, and rabbit spleen, rabbit lung, and rabbit aorta vascular smooth muscle cells, also with typical α 1 -adrenergic specificity. Autoradiograms of such membrane samples subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis reveal a major specifically labeled polypeptide at M/sub 4/ = 78,000-85,000, depending on the tissue used, in addition to some lower molecular weight peptides. Protease inhibitors, in particular EDTA, a metalloprotease inhibitor, dramatically increases the predominance of the M/sub r/ = 78,000-85,000 polypeptide while attenuating the labeling of the lower molecular weight bands. This new high affinity radioiodinated photoaffinity probe should be of great value for the molecular characterization of the α 1 -adrenergic receptor

  3. Topography of the high-affinity lysine binding site of plasminogen as defined with a specific antibody probe

    International Nuclear Information System (INIS)

    Miles, L.A.; Plow, E.F.


    An antibody population that reacted with the high-affinity lysine binding site of human plasminogen was elicited by immunizing rabbits with an elastase degradation product containing kringles 1-3 (EDP I). This antibody was immunopurified by affinity chromatography on plasminogen-Sepharose and elution with 0.2 M 6-aminohexanoic acid. The eluted antibodies bound [ 125 I]EDP I, [ 125 I]Glu-plasminogen, and [ 125 I]Lys-plasminogen in radioimmunoassays, and binding of each ligand was at least 99% inhibited by 0.2 M 6-aminohexanoic acid. The concentrations for 50% inhibition of [ 125 I]EDP I binding by tranexamic acid, 6-aminohexanoic acid, and lysine were 2.6, 46, and l730 μM, respectively. Similar values were obtained with plasminogen and suggested that an unoccupied high-affinity lysine binding site was required for antibody recognition. The antiserum reacted exclusively with plasminogen derivatives containing the EDP I region and did not react with those lacking an EDP I region, or with tissue plasminogen activator or prothrombin, which also contains kringles. By immunoblotting analyses, a chymotryptic degradation product of M/sub r/ 20,000 was derived from EDP I that retained reactivity with the antibody. α 2 -Antiplasmin inhibited the binding of radiolabeled EDP I, Glu-plasminogen, or Lys-plasminogen by the antiserum, suggesting that the recognized site is involved in the noncovalent interaction of the inhibitor with plasminogen. The binding of [ 125 I]EDP I to fibrin was also inhibited by the antiserum. The observations provide independent evidence for the role of the high-affinity lysine binding site in the functional interactions of plasminogen with its primary substrate and inhibitor

  4. The role of antibody affinity and titre in immunity to Schistosoma mansoni following vaccination with highly irradiated cercariae

    International Nuclear Information System (INIS)

    Vignali, D.A.A.; Devey, M.E.; Bickle, Q.D.; Taylor, M.G.


    Sera from rabbits and rats vaccinated with highly irradiated cercariae of Schistosoma mansoni (VRabS, VRatS) were found to be of substantially higher affinity than sera from CBA mice vaccinated four times (4 x CVMS), single sex sera (SSS) or chronic infection sera (CIS). In contrast, immunoprecipitation studies demonstrated that sera from vaccinated LA mice (LVMS) recognized 125 I-labelled schistosomular surface antigens more intensely than sera from vaccinated HA mice (HVMS). However, peritoneal macrophages from HA and LA mice in the presence of HVMS, LVMS or 4 x CVMS, and naive macrophages activated in vitro with interferon-gamma (IFN-γ)/lipopolysaccharide (LPS) mediated comparable levels of schistosomula killing in vitro. The experiments described here provide evidence that the titre of antibody rather than its affinity may be a more critical factor in the development of optimal immunity to S. mansoni. (author)

  5. The role of antibody affinity and titre in immunity to Schistosoma mansoni following vaccination with highly irradiated cercariae

    Energy Technology Data Exchange (ETDEWEB)

    Vignali, D.A.A.; Devey, M.E.; Bickle, Q.D.; Taylor, M.G. (London School of Hygiene and Tropical Medicine (UK))


    Sera from rabbits and rats vaccinated with highly irradiated cercariae of Schistosoma mansoni (VRabS, VRatS) were found to be of substantially higher affinity than sera from CBA mice vaccinated four times (4 x CVMS), single sex sera (SSS) or chronic infection sera (CIS). In contrast, immunoprecipitation studies demonstrated that sera from vaccinated LA mice (LVMS) recognized {sup 125}I-labelled schistosomular surface antigens more intensely than sera from vaccinated HA mice (HVMS). However, peritoneal macrophages from HA and LA mice in the presence of HVMS, LVMS or 4 x CVMS, and naive macrophages activated in vitro with interferon-gamma (IFN-{gamma})/lipopolysaccharide (LPS) mediated comparable levels of schistosomula killing in vitro. The experiments described here provide evidence that the titre of antibody rather than its affinity may be a more critical factor in the development of optimal immunity to S. mansoni. (author).

  6. Affinity chromatography with pseudobiospecific ligands on high-performance supports for purification of proteins of biotechnological interest

    Directory of Open Access Journals (Sweden)

    N.B. Iannucci


    Full Text Available High-performance affinity matrices were obtained by attaching pseudobiospecific ligands to hollow-fibre membranes. The neutral protease contained in FlavourzymeTM was purified to homogeneity with Yellow 4R-HE affinity hollow-fibre membranes. Immobilisation of Red HE-3B allowed purification of a milk-clotting enzyme obtained by solid-state culture of Mucor bacilliformis. Copper immobilisation through iminodiacetic acid allowed fractionation of Biocon Bioconcentrated PlusTM to separate the pectinesterase-containing fraction. The productivity of the developed processes - 1900, 94 and 750 U/ml.min, respectively - was 10- to 15-fold higher than that achieved with the same ligands immobilised on agarose-based soft gels, mainly due to the shortening of the purification processes.

  7. Characterization of glucagon-like peptide-1 receptor beta-arrestin 2 interaction: a high-affinity receptor phenotype

    DEFF Research Database (Denmark)

    Jorgensen, Rasmus; Martini, Lene; Schwartz, Thue W


    To dissect the interaction between beta-arrestin ((beta)arr) and family B G protein-coupled receptors, we constructed fusion proteins between the glucagon-like peptide 1 receptor and (beta)arr2. The fusion constructs had an increase in apparent affinity selectively for glucagon, suggesting...... that (beta)arr2 interaction locks the receptor in a high-affinity conformation, which can be explored by some, but not all, ligands. The fusion constructs adopted a signaling phenotype governed by the tethered (beta)arr2 with an attenuated G protein-mediated cAMP signal and a higher maximal internalization...... of that which has previously been characterized for family A G protein-coupled receptors, suggesting similarities in the effect of (beta)arr interaction between family A and B receptors also at the molecular level....

  8. Structure-guided development of a high-affinity human Programmed Cell Death-1: Implications for tumor immunotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Lázár-Molnár, Eszter; Scandiuzzi, Lisa; Basu, Indranil; Quinn, Thomas; Sylvestre, Eliezer; Palmieri, Edith; Ramagopal, Udupi A.; Nathenson, Stanley G.; Guha, Chandan; Almo, Steven C.


    Programmed Cell Death-1 (PD-1) is an inhibitory immune receptor, which plays critical roles in T cell co-inhibition and exhaustion upon binding to its ligands PD-L1 and PD-L2. We report the crystal structure of the human PD-1 ectodomain and the mapping of the PD-1 binding interface. Mutagenesis studies confirmed the crystallographic interface, and resulted in mutant PD-1 receptors with altered affinity and ligand-specificity. In particular, a high-affinity mutant PD-1 (HA PD-1) exhibited 45 and 30-fold increase in binding to PD-L1 and PD-L2, respectively, due to slower dissociation rates. This mutant (A132L) was used to engineer a soluble chimeric Ig fusion protein for cell-based and in vivo studies. HA PD-1 Ig showed enhanced binding to human dendritic cells, and increased T cell proliferation and cytokine production in a mixed lymphocyte reaction (MLR) assay. Moreover, in an experimental model of murine Lewis lung carcinoma, HA PD-1 Ig treatment synergized with radiation therapy to decrease local and metastatic tumor burden, as well as in the establishment of immunological memory responses. Our studies highlight the value of structural considerations in guiding the design of a high-affinity chimeric PD-1 Ig fusion protein with robust immune modulatory properties, and underscore the power of combination therapies to selectively manipulate the PD-1 pathway for tumor immunotherapy.

  9. Structure-guided development of a high-affinity human Programmed Cell Death-1: Implications for tumor immunotherapy

    Directory of Open Access Journals (Sweden)

    Eszter Lázár-Molnár


    Full Text Available Programmed Cell Death-1 (PD-1 is an inhibitory immune receptor, which plays critical roles in T cell co-inhibition and exhaustion upon binding to its ligands PD-L1 and PD-L2. We report the crystal structure of the human PD-1 ectodomain and the mapping of the PD-1 binding interface. Mutagenesis studies confirmed the crystallographic interface, and resulted in mutant PD-1 receptors with altered affinity and ligand-specificity. In particular, a high-affinity mutant PD-1 (HA PD-1 exhibited 45 and 30-fold increase in binding to PD-L1 and PD-L2, respectively, due to slower dissociation rates. This mutant (A132L was used to engineer a soluble chimeric Ig fusion protein for cell-based and in vivo studies. HA PD-1 Ig showed enhanced binding to human dendritic cells, and increased T cell proliferation and cytokine production in a mixed lymphocyte reaction (MLR assay. Moreover, in an experimental model of murine Lewis lung carcinoma, HA PD-1 Ig treatment synergized with radiation therapy to decrease local and metastatic tumor burden, as well as in the establishment of immunological memory responses. Our studies highlight the value of structural considerations in guiding the design of a high-affinity chimeric PD-1 Ig fusion protein with robust immune modulatory properties, and underscore the power of combination therapies to selectively manipulate the PD-1 pathway for tumor immunotherapy.

  10. A study of the uptake of chloroquine in malaria-infected erythrocytes. High and low affinity uptake and the influence of glucose and its analogues. (United States)

    Diribe, C O; Warhurst, D C


    A study of concentration- and substrate-dependence of chloroquine uptake has been carried out on mouse erythrocytes infected with the chloroquine-sensitive NK65 and the chloroquine-resistant RC strains of Plasmodium berghei. The presence of drug binding sites of high and low affinity in such strains of P. berghei was confirmed. High affinity uptake sites in cells parasitized with chloroquine-sensitive and chloroquine-resistant parasites have similar characteristics, but in the sensitive strain the major component of chloroquine-uptake is at high affinity and dependent on the availability of ATP whilst in the resistant strain the major component of uptake is at low affinity and independent of energy. An absolute increase in the quantity of the low affinity site in erythrocytes parasitized with chloroquine-resistant P. berghei was noted, which may be related to an increase in quantity of parasite membrane.

  11. High affinity antigen recognition of the dual specific variants of herceptin is entropy-driven in spite of structural plasticity.

    Directory of Open Access Journals (Sweden)

    Jenny Bostrom

    Full Text Available The antigen-binding site of Herceptin, an anti-human Epidermal Growth Factor Receptor 2 (HER2 antibody, was engineered to add a second specificity toward Vascular Endothelial Growth Factor (VEGF to create a high affinity two-in-one antibody bH1. Crystal structures of bH1 in complex with either antigen showed that, in comparison to Herceptin, this antibody exhibited greater conformational variability, also called "structural plasticity". Here, we analyzed the biophysical and thermodynamic properties of the dual specific variants of Herceptin to understand how a single antibody binds two unrelated protein antigens. We showed that while bH1 and the affinity-improved bH1-44, in particular, maintained many properties of Herceptin including binding affinity, kinetics and the use of residues for antigen recognition, they differed in the binding thermodynamics. The interactions of bH1 and its variants with both antigens were characterized by large favorable entropy changes whereas the Herceptin/HER2 interaction involved a large favorable enthalpy change. By dissecting the total entropy change and the energy barrier for dual interaction, we determined that the significant structural plasticity of the bH1 antibodies demanded by the dual specificity did not translate into the expected increase of entropic penalty relative to Herceptin. Clearly, dual antigen recognition of the Herceptin variants involves divergent antibody conformations of nearly equivalent energetic states. Hence, increasing the structural plasticity of an antigen-binding site without increasing the entropic cost may play a role for antibodies to evolve multi-specificity. Our report represents the first comprehensive biophysical analysis of a high affinity dual specific antibody binding two unrelated protein antigens, furthering our understanding of the thermodynamics that drive the vast antigen recognition capacity of the antibody repertoire.

  12. Autoradiographic imaging and quantification of the high-affinity GHB binding sites in rodent brain using (3)H-HOCPCA

    DEFF Research Database (Denmark)

    Klein, A B; Bay, T; Villumsen, I S


    analogue, 3-hydroxycyclopent-1-enecarboxylic acid (HOCPCA) as a tritiated version ((3)H-HOCPCA) to radioactively label the specific GHB high-affinity binding site and gain further insight into the density, distribution and developmental profile of this protein. We show that, in low nanomolar concentrations...... brain development. Due to the high sensitivity of this radioligand, we were able to detect low levels of specific binding already at E15 in mouse brain, which increased progressively until adulthood. Collectively, we show that (3)H-HOCPCA is a highly sensitive radioligand, offering advantages over...

  13. Irreversible blockade of the high and low affinity (3H) naloxone binding sites by C-6 derivatives of morphinane-6-ones

    International Nuclear Information System (INIS)

    Krizsan, D.; Varga, E.; Benyhe, S.; Szucs, M.; Borsodi, A.; Hosztafi, S.


    C-6 derivatives-hydrazones, phenylhydrazones, dinitrophenylhydrazones, oximes and semicarbazones - of morphinane-6-ones were synthesized and their binding characteristics were studied on rat brain membranes. The dihydromorphinone and oxymorphone derivatives compete for the ( 3 H)naloxone binding sites with high affinity, while the dihydrocodeinone and oxycodone derivatives are less potent. The affinity of the new compounds is decreased for the delta sites as compared to the parent ligands. The ligands bearing bulky substituents also bind with low affinity to the kappa sites. The modification decreased the Na + -index of compounds indicating their mixed agonist-antagonist character. The dihydromorphinone derivatives are all capable to block irreversibly the high affinity binding site of ( 3 H)naloxone, whereas the dihydrocodeinone derivatives block irreversibly the low affinity site. A possible mechanism for the inhibition is suggested

  14. Affine-Invariant Geometric Constraints-Based High Accuracy Simultaneous Localization and Mapping

    Directory of Open Access Journals (Sweden)

    Gangchen Hua


    Full Text Available In this study we describe a new appearance-based loop-closure detection method for online incremental simultaneous localization and mapping (SLAM using affine-invariant-based geometric constraints. Unlike other pure bag-of-words-based approaches, our proposed method uses geometric constraints as a supplement to improve accuracy. By establishing an affine-invariant hypothesis, the proposed method excludes incorrect visual words and calculates the dispersion of correctly matched visual words to improve the accuracy of the likelihood calculation. In addition, camera’s intrinsic parameters and distortion coefficients are adequate for this method. 3D measuring is not necessary. We use the mechanism of Long-Term Memory and Working Memory (WM to manage the memory. Only a limited size of the WM is used for loop-closure detection; therefore the proposed method is suitable for large-scale real-time SLAM. We tested our method using the CityCenter and Lip6Indoor datasets. Our proposed method results can effectively correct the typical false-positive localization of previous methods, thus gaining better recall ratios and better precision.

  15. The production of high affinity monoclonal antibodies to human growth hormone

    International Nuclear Information System (INIS)

    Stuart, M.C.; Walichnowski, C.M.; Hussain, S.; Underwood, P.A.; Harman, D.F.; Rathjen, D.A.; Sturmer, S.R. von


    The primary aim of this work was to produce specific monoclonal antibodies to human growth hormone (hGH) for use in a diagnostic RIA of hGH levels in serum. Three different schedules were used for immunization of BALB/c mice and the splenocytes from each mouse were fused with myeloma cells Sp 2/0 Ag 14. Each fusion resulted in the production of hundreds of hybridomas secreting hGH-directed antibodies. Six antibodies have been fully characterized and have been grouped into pairs which recognize 3 different epitopes on the hGH molecule. One pair exhibits no cross reaction with the structurally related placental hormone, human placental lactogen (hPL), a second pair has low cross reaction with hPL (1.6-3%) and a third pair reacts equally well with hGH and hPL indicating binding to a common epitope in the 2 molecules. The highest affinity antibody, 74/6, which has an affinity constant of 4.4x10 10 l/mol and 3% cross-reactivity with hPL, has been used to establish a RIA for serum hGH measurements. Evidence is provided that hGH levels measured in this assay correlate well with those obtained in a conventional rabbit antiserum assay. (Auth.)

  16. A rhodamine-labeled citalopram analogue as a high-affinity fluorescent probe for the serotonin transporter

    DEFF Research Database (Denmark)

    Zhang, Peng; Jørgensen, Trine Nygaard; Løland, Claus Juul


    A novel fluorescent ligand was synthesized as a high-affinity, high specificity probe for visualizing the serotonin transporter (SERT). The rhodamine fluorophore was extended from an aniline substitution on the 5-position of the dihydroisobenzofuran ring of citalopram (2, 1-(3-(dimethylamino......)propyl)-1-(4-fluorophenyl)-1,3-dihydroisobenzofuran-5-carbonitrile), using an ethylamino linker. The resulting rhodamine-labeled ligand 8 inhibited [3H]5-HT uptake in COS-7 cells (Ki = 225 nM) with similar potency to the tropane-based JHC 1-064 (1), but with higher specificity towards the SERT relative...

  17. In Vitro and In Vivo Evaluations of A High Affinity and Specificity Photoacoustic Nanoparticle Targeting to Cancer

    DEFF Research Database (Denmark)

    Ma, Lixin; Xu, Hang; Lee, Li Ean

    oxide (SIO) nanoparticle as a potent cancer cell selective PA contrast agent, with a high binding affinity and selectivity to the gastrin releasing peptide receptor (GRPR) which is overexpressed in many human cancers including prostate cancer, breast cancer and small cell lung cancer etc.......Photoacoustic (PA) imaging uses a short-pulsed laser to create ultrasound signals for the high resolution acoustic imaging. The development of targeting PA contrast agents offers a unique opportunity to improve the early detection of cancer cells. This work aims to develop a silica coated iron...

  18. Insights from the Fungus Fusarium oxysporum Point to High Affinity Glucose Transporters as Targets for Enhancing Ethanol Production from Lignocellulose (United States)

    Ali, Shahin S.; Nugent, Brian; Mullins, Ewen; Doohan, Fiona M.


    Ethanol is the most-widely used biofuel in the world today. Lignocellulosic plant biomass derived from agricultural residue can be converted to ethanol via microbial bioprocessing. Fungi such as Fusarium oxysporum can simultaneously saccharify straw to sugars and ferment sugars to ethanol. But there are many bottlenecks that need to be overcome to increase the efficacy of microbial production of ethanol from straw, not least enhancement of the rate of fermentation of both hexose and pentose sugars. This research tested the hypothesis that the rate of sugar uptake by F. oxysporum would enhance the ethanol yields from lignocellulosic straw and that high affinity glucose transporters can enhance ethanol yields from this substrate. We characterized a novel hexose transporter (Hxt) from this fungus. The F. oxysporum Hxt represents a novel transporter with homology to yeast glucose signaling/transporter proteins Rgt2 and Snf3, but it lacks their C-terminal domain which is necessary for glucose signalling. Its expression level decreased with increasing glucose concentration in the medium and in a glucose uptake study the Km(glucose) was 0.9 mM, which indicated that the protein is a high affinity glucose transporter. Post-translational gene silencing or over expression of the Hxt in F. oxysporum directly affected the glucose and xylose transport capacity and ethanol yielded by F. oxysporum from straw, glucose and xylose. Thus we conclude that this Hxt has the capacity to transport both C5 and C6 sugars and to enhance ethanol yields from lignocellulosic material. This study has confirmed that high affinity glucose transporters are ideal candidates for improving ethanol yields from lignocellulose because their activity and level of expression is high in low glucose concentrations, which is very common during the process of consolidated processing. PMID:23382943

  19. Structural implications of hERG K+ channel block by a high-affinity minimally structured blocker (United States)

    Helliwell, Matthew V.; Zhang, Yihong; El Harchi, Aziza; Du, Chunyun; Hancox, Jules C.; Dempsey, Christopher E.


    Cardiac potassium channels encoded by human ether-à-go-go–related gene (hERG) are major targets for structurally diverse drugs associated with acquired long QT syndrome. This study characterized hERG channel inhibition by a minimally structured high-affinity hERG inhibitor, Cavalli-2, composed of three phenyl groups linked by polymethylene spacers around a central amino group, chosen to probe the spatial arrangement of side chain groups in the high-affinity drug-binding site of the hERG pore. hERG current (IhERG) recorded at physiological temperature from HEK293 cells was inhibited with an IC50 of 35.6 nm with time and voltage dependence characteristic of blockade contingent upon channel gating. Potency of Cavalli-2 action was markedly reduced for attenuated inactivation mutants located near (S620T; 54-fold) and remote from (N588K; 15-fold) the channel pore. The S6 Y652A and F656A mutations decreased inhibitory potency 17- and 75-fold, respectively, whereas T623A and S624A at the base of the selectivity filter also decreased potency (16- and 7-fold, respectively). The S5 helix F557L mutation decreased potency 10-fold, and both F557L and Y652A mutations eliminated voltage dependence of inhibition. Computational docking using the recent cryo-EM structure of an open channel hERG construct could only partially recapitulate experimental data, and the high dependence of Cavalli-2 block on Phe-656 is not readily explainable in that structure. A small clockwise rotation of the inner (S6) helix of the hERG pore from its configuration in the cryo-EM structure may be required to optimize Phe-656 side chain orientations compatible with high-affinity block. PMID:29545312

  20. Insights from the fungus Fusarium oxysporum point to high affinity glucose transporters as targets for enhancing ethanol production from lignocellulose.

    Directory of Open Access Journals (Sweden)

    Shahin S Ali

    Full Text Available Ethanol is the most-widely used biofuel in the world today. Lignocellulosic plant biomass derived from agricultural residue can be converted to ethanol via microbial bioprocessing. Fungi such as Fusarium oxysporum can simultaneously saccharify straw to sugars and ferment sugars to ethanol. But there are many bottlenecks that need to be overcome to increase the efficacy of microbial production of ethanol from straw, not least enhancement of the rate of fermentation of both hexose and pentose sugars. This research tested the hypothesis that the rate of sugar uptake by F. oxysporum would enhance the ethanol yields from lignocellulosic straw and that high affinity glucose transporters can enhance ethanol yields from this substrate. We characterized a novel hexose transporter (Hxt from this fungus. The F. oxysporum Hxt represents a novel transporter with homology to yeast glucose signaling/transporter proteins Rgt2 and Snf3, but it lacks their C-terminal domain which is necessary for glucose signalling. Its expression level decreased with increasing glucose concentration in the medium and in a glucose uptake study the Km((glucose was 0.9 mM, which indicated that the protein is a high affinity glucose transporter. Post-translational gene silencing or over expression of the Hxt in F. oxysporum directly affected the glucose and xylose transport capacity and ethanol yielded by F. oxysporum from straw, glucose and xylose. Thus we conclude that this Hxt has the capacity to transport both C5 and C6 sugars and to enhance ethanol yields from lignocellulosic material. This study has confirmed that high affinity glucose transporters are ideal candidates for improving ethanol yields from lignocellulose because their activity and level of expression is high in low glucose concentrations, which is very common during the process of consolidated processing.

  1. High Affinity, Developability and Functional Size: The Holy Grail of Combinatorial Antibody Library Generation

    Directory of Open Access Journals (Sweden)

    Kathrin Tissot


    Full Text Available Since the initial description of phage display technology for the generation of human antibodies, a variety of selection methods has been developed. The most critical parameter for all in vitro-based approaches is the quality of the antibody library. Concurrent evolution of the libraries has allowed display and selection technologies to reveal their full potential. They come in different flavors, from naïve to fully synthetic and differ in terms of size, quality, method of preparation, framework and CDR composition. Early on, the focus has mainly been on affinities and thus on library size and diversity. Subsequently, the increased awareness of developability and cost of goods as important success factors has spurred efforts to generate libraries with improved biophysical properties and favorable production characteristics. More recently a major focus on reduction of unwanted side effects through reduced immunogenicity and improved overall biophysical behavior has led to a re-evaluation of library design.

  2. Content-Based High-Resolution Remote Sensing Image Retrieval via Unsupervised Feature Learning and Collaborative Affinity Metric Fusion

    Directory of Open Access Journals (Sweden)

    Yansheng Li


    Full Text Available With the urgent demand for automatic management of large numbers of high-resolution remote sensing images, content-based high-resolution remote sensing image retrieval (CB-HRRS-IR has attracted much research interest. Accordingly, this paper proposes a novel high-resolution remote sensing image retrieval approach via multiple feature representation and collaborative affinity metric fusion (IRMFRCAMF. In IRMFRCAMF, we design four unsupervised convolutional neural networks with different layers to generate four types of unsupervised features from the fine level to the coarse level. In addition to these four types of unsupervised features, we also implement four traditional feature descriptors, including local binary pattern (LBP, gray level co-occurrence (GLCM, maximal response 8 (MR8, and scale-invariant feature transform (SIFT. In order to fully incorporate the complementary information among multiple features of one image and the mutual information across auxiliary images in the image dataset, this paper advocates collaborative affinity metric fusion to measure the similarity between images. The performance evaluation of high-resolution remote sensing image retrieval is implemented on two public datasets, the UC Merced (UCM dataset and the Wuhan University (WH dataset. Large numbers of experiments show that our proposed IRMFRCAMF can significantly outperform the state-of-the-art approaches.

  3. Inhibition of Enterococcus faecium adherence to collagen by antibodies against high-affinity binding subdomains of Acm. (United States)

    Nallapareddy, Sreedhar R; Sillanpää, Jouko; Ganesh, Vannakambadi K; Höök, Magnus; Murray, Barbara E


    Strains of Enterococcus faecium express a cell wall-anchored protein, Acm, which mediates adherence to collagen. Here, we (i) identify the minimal and high-affinity binding subsegments of Acm and (ii) show that anti-Acm immunoglobulin Gs (IgGs) purified against these subsegments reduced E. faecium TX2535 strain collagen adherence up to 73 and 50%, respectively, significantly more than the total IgGs against the full-length Acm A domain (28%) (P Acm adherence with functional subsegment-specific antibodies raises the possibility of their use as therapeutic or prophylactic agents.

  4. Susceptibility to endotoxin induced uveitis is not reduced in mice deficient in BLT1, the high affinity leukotriene B4 receptor


    Smith, J R; Subbarao, K; Franc, D T; Haribabu, B; Rosenbaum, J T


    Aim: To investigate the role of arachidonic acid derived chemotactic factor, LTB4, in the development of endotoxin induced uveitis (EIU), using mice deficient in the BLT1 gene which encodes the high affinity LTB4 receptor.

  5. Generation and characterization of a human-mouse chimeric high-affinity antibody that detects the DYKDDDDK FLAG peptide. (United States)

    Ikeda, Koki; Koga, Tomoaki; Sasaki, Fumiyuki; Ueno, Ayumi; Saeki, Kazuko; Okuno, Toshiaki; Yokomizo, Takehiko


    DYKDDDDK peptide (FLAG) is a useful tool for investigating the function and localization of proteins whose antibodies (Abs) are not available. We recently established a high-affinity monoclonal antibody (mAb) for FLAG (clone 2H8). The 2H8 Ab is highly sensitive for detecting FLAG-tagged proteins by flowcytometry and immunoprecipitation, but it can yield nonspecific signals in immunohistochemistry of mouse tissues because it is of mouse origin. In this study, we reduced nonspecific signals by generating a chimeric 2H8 Ab with Fc fragments derived from human immunoglobulin. We fused a 5' terminal cDNA fragments for the Fab region of 2H8 mAb with 3' terminal cDNA fragments for Fc region of human IgG1. We transfected both chimeric plasmids and purified the resulting human-mouse chimeric 2H8. The chimeric 2H8 Ab successfully detected FLAG-tagged proteins in flowcytometry with anti-human IgG secondary Ab with comparable sensitivity to 2H8 mAb. Importantly, chimeric 2H8 detected specific FLAG peptide signals without nonspecific signals in immunohistochemical analysis with mouse tissues. This human-mouse chimeric high-affinity anti-FLAG Ab will prove useful for future immunohistochemical analysis of mouse tissues. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Specific recognition of the C-terminal end of A beta 42 by a high affinity monoclonal antibody

    DEFF Research Database (Denmark)

    Axelsen, Trine Veje; Holm, Arne; Birkelund, Svend


    The neurotoxic peptide A beta(42) is derived from the amyloid precursor protein by proteolytic cleavage and is deposited in the brain of patients suffering from Alzheimer's disease (AD). In this study we generate a high affinity monoclonal antibody that targets the C-terminal end of A beta(42......) with high specificity. By this is meant that the paratope of the antibody must enclose the C-terminal end of A beta(42) including the carboxy-group of amino acid 42, and not just recognize a linear epitope in the C-terminal part of A beta. This has been accomplished by using a unique antigen construct made...... by the Ligand Presenting Assembly technology (LPA technology). This strategy results in dimeric presentation of the free C-terminal end of A beta(42). The generated Mab A beta1.1 is indeed specific for the C-terminal end of A beta(42) to which it binds with high affinity. Mab A beta1.1 recognizes the epitope...

  7. Affinity chromatographic purification of tetrodotoxin by use of tetrodotoxin-binding high molecular weight substances in the body fluid of shore crab (Hemigrapsus sanguineus) as ligands. (United States)

    Shiomi, K; Yamaguchi, S; Shimakura, K; Nagashima, Y; Yamamori, K; Matsui, T


    A purification method for tetrodotoxin (TTX), based on affinity chromatography using the TTX-binding high mol. wt substances in the body fluid of shore crab (Hemigrapsus sanguineus) as ligands, was developed. This method was particularly useful for analysis of TTX in biological samples with low concentrations of TTX. The affinity gel prepared was highly specific for TTX, having no ability to bind 4-epi-TTX and anhydro-TTX as well as saxitoxin.

  8. Structure of IL-22 Bound to Its High-Affinity IL-22R1 Chain

    Energy Technology Data Exchange (ETDEWEB)

    Jones, B.C.; Logsdon, N.J.; Walter, M.R. (UAB)


    IL-22 is an IL-10 family cytokine that initiates innate immune responses against bacterial pathogens and contributes to immune disease. IL-22 biological activity is initiated by binding to a cell-surface complex composed of IL-22R1 and IL-10R2 receptor chains and further regulated by interactions with a soluble binding protein, IL-22BP, which shares sequence similarity with an extracellular region of IL-22R1 (sIL-22R1). IL-22R1 also pairs with the IL-20R2 chain to induce IL-20 and IL-24 signaling. To define the molecular basis of these diverse interactions, we have determined the structure of the IL-22/sIL-22R1 complex. The structure, combined with homology modeling and surface plasmon resonance studies, defines the molecular basis for the distinct affinities and specificities of IL-22 and IL-10 receptor chains that regulate cellular targeting and signal transduction to elicit effective immune responses.

  9. Design of a peptidic turn with high affinity for HgII

    DEFF Research Database (Denmark)

    Pires, Sara; Habjanic, Jelena; Sezer, Murat


    A four amino acid peptide containing the ß-turn template dPro-Pro in the middle and two cysteines (Cys) in the terminal positions (CdPPC) has been synthesized and its mercury(II) coordination properties studied using different spectroscopic methods. The UV-vis, CD, (199m)Hg PAC, and Raman...... spectroscopic studies indicate the binding of Hg(II) to the two Cys, forming the dithiolatemercury(II) complex Hg(CdPPC). Electrospray ionization mass spectrometry corroborates the 1:1 complex formation. A log K = 40.0 was determined for the formation constant of the Hg(CdPPC) complex using competition...... potentiometric studies. Replacement of the dPro-Pro motif by a Pro-Pro unit generated a peptide (CPPC) capable of forming a similar species [Hg(CPPC)] but showing a lower affinity for Hg(II) (at least 3-3.5 orders of magnitude lower). The introduction of the dPro-Pro motif is crucial to induce the folding...

  10. Structural basis for high substrate-binding affinity and enantioselectivity of 3-quinuclidinone reductase AtQR

    International Nuclear Information System (INIS)

    Hou, Feng; Miyakawa, Takuya; Kataoka, Michihiko; Takeshita, Daijiro; Kumashiro, Shoko; Uzura, Atsuko; Urano, Nobuyuki; Nagata, Koji; Shimizu, Sakayu; Tanokura, Masaru


    Highlights: • Crystal structure of AtQR has been determined at 1.72 Å. • NADH binding induces the formation of substrate binding site. • AtQR possesses a conserved hydrophobic wall for stereospecific binding of substrate. • Additional Glu197 residue is critical to the high binding affinity. - Abstract: (R)-3-Quinuclidinol, a useful compound for the synthesis of various pharmaceuticals, can be enantioselectively produced from 3-quinuclidinone by 3-quinuclidinone reductase. Recently, a novel NADH-dependent 3-quinuclidionone reductase (AtQR) was isolated from Agrobacterium tumefaciens, and showed much higher substrate-binding affinity (>100 fold) than the reported 3-quinuclidionone reductase (RrQR) from Rhodotorula rubra. Here, we report the crystal structure of AtQR at 1.72 Å. Three NADH-bound protomers and one NADH-free protomer form a tetrameric structure in an asymmetric unit of crystals. NADH not only acts as a proton donor, but also contributes to the stability of the α7 helix. This helix is a unique and functionally significant part of AtQR and is related to form a deep catalytic cavity. AtQR has all three catalytic residues of the short-chain dehydrogenases/reductases family and the hydrophobic wall for the enantioselective reduction of 3-quinuclidinone as well as RrQR. An additional residue on the α7 helix, Glu197, exists near the active site of AtQR. This acidic residue is considered to form a direct interaction with the amine part of 3-quinuclidinone, which contributes to substrate orientation and enhancement of substrate-binding affinity. Mutational analyses also support that Glu197 is an indispensable residue for the activity

  11. Structural basis for high substrate-binding affinity and enantioselectivity of 3-quinuclidinone reductase AtQR

    Energy Technology Data Exchange (ETDEWEB)

    Hou, Feng; Miyakawa, Takuya [Department of Applied Biological Chemistry, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan); Kataoka, Michihiko [Division of Applied Life Sciences, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 559-8531 (Japan); Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Kitashirakawa-Oiwakecho, Sakyo-ku, Kyoto 606-8502 (Japan); Takeshita, Daijiro [Department of Applied Biological Chemistry, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan); Kumashiro, Shoko [Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Kitashirakawa-Oiwakecho, Sakyo-ku, Kyoto 606-8502 (Japan); Uzura, Atsuko [Research and Development Center, Nagase and Co., Ltd., 2-2-3 Muratani, Nishi-ku, Kobe 651-2241 (Japan); Urano, Nobuyuki [Division of Applied Life Sciences, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 559-8531 (Japan); Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Kitashirakawa-Oiwakecho, Sakyo-ku, Kyoto 606-8502 (Japan); Nagata, Koji [Department of Applied Biological Chemistry, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan); Shimizu, Sakayu [Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Kitashirakawa-Oiwakecho, Sakyo-ku, Kyoto 606-8502 (Japan); Faculty of Bioenvironmental Science, Kyoto Gakuen University, Sogabe-cho, Kameoka 621-8555 (Japan); Tanokura, Masaru, E-mail: [Department of Applied Biological Chemistry, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan)


    Highlights: • Crystal structure of AtQR has been determined at 1.72 Å. • NADH binding induces the formation of substrate binding site. • AtQR possesses a conserved hydrophobic wall for stereospecific binding of substrate. • Additional Glu197 residue is critical to the high binding affinity. - Abstract: (R)-3-Quinuclidinol, a useful compound for the synthesis of various pharmaceuticals, can be enantioselectively produced from 3-quinuclidinone by 3-quinuclidinone reductase. Recently, a novel NADH-dependent 3-quinuclidionone reductase (AtQR) was isolated from Agrobacterium tumefaciens, and showed much higher substrate-binding affinity (>100 fold) than the reported 3-quinuclidionone reductase (RrQR) from Rhodotorula rubra. Here, we report the crystal structure of AtQR at 1.72 Å. Three NADH-bound protomers and one NADH-free protomer form a tetrameric structure in an asymmetric unit of crystals. NADH not only acts as a proton donor, but also contributes to the stability of the α7 helix. This helix is a unique and functionally significant part of AtQR and is related to form a deep catalytic cavity. AtQR has all three catalytic residues of the short-chain dehydrogenases/reductases family and the hydrophobic wall for the enantioselective reduction of 3-quinuclidinone as well as RrQR. An additional residue on the α7 helix, Glu197, exists near the active site of AtQR. This acidic residue is considered to form a direct interaction with the amine part of 3-quinuclidinone, which contributes to substrate orientation and enhancement of substrate-binding affinity. Mutational analyses also support that Glu197 is an indispensable residue for the activity.

  12. Peptides in headlock – a novel high-affinity and versatile peptide-binding nanobody for proteomics and microscopy (United States)

    Braun, Michael B.; Traenkle, Bjoern; Koch, Philipp A.; Emele, Felix; Weiss, Frederik; Poetz, Oliver; Stehle, Thilo; Rothbauer, Ulrich


    Nanobodies are highly valuable tools for numerous bioanalytical and biotechnical applications. Here, we report the characterization of a nanobody that binds a short peptide epitope with extraordinary affinity. Structural analysis reveals an unusual binding mode where the extended peptide becomes part of a β-sheet structure in the nanobody. This interaction relies on sequence-independent backbone interactions augmented by a small number of specificity-determining side chain contacts. Once bound, the peptide is fastened by two nanobody side chains that clamp it in a headlock fashion. Exploiting this unusual binding mode, we generated a novel nanobody-derived capture and detection system. Matrix-coupled nanobody enables the fast and efficient isolation of epitope-tagged proteins from prokaryotic and eukaryotic expression systems. Additionally, the fluorescently labeled nanobody visualizes subcellular structures in different cellular compartments. The high-affinity-binding and modifiable peptide tag of this system renders it a versatile and robust tool to combine biochemical analysis with microscopic studies. PMID:26791954

  13. Peptides in headlock--a novel high-affinity and versatile peptide-binding nanobody for proteomics and microscopy. (United States)

    Braun, Michael B; Traenkle, Bjoern; Koch, Philipp A; Emele, Felix; Weiss, Frederik; Poetz, Oliver; Stehle, Thilo; Rothbauer, Ulrich


    Nanobodies are highly valuable tools for numerous bioanalytical and biotechnical applications. Here, we report the characterization of a nanobody that binds a short peptide epitope with extraordinary affinity. Structural analysis reveals an unusual binding mode where the extended peptide becomes part of a β-sheet structure in the nanobody. This interaction relies on sequence-independent backbone interactions augmented by a small number of specificity-determining side chain contacts. Once bound, the peptide is fastened by two nanobody side chains that clamp it in a headlock fashion. Exploiting this unusual binding mode, we generated a novel nanobody-derived capture and detection system. Matrix-coupled nanobody enables the fast and efficient isolation of epitope-tagged proteins from prokaryotic and eukaryotic expression systems. Additionally, the fluorescently labeled nanobody visualizes subcellular structures in different cellular compartments. The high-affinity-binding and modifiable peptide tag of this system renders it a versatile and robust tool to combine biochemical analysis with microscopic studies.

  14. High-affinity DNA-binding Domains of Replication Protein A (RPA) Direct SMARCAL1-dependent Replication Fork Remodeling* (United States)

    Bhat, Kamakoti P.; Bétous, Rémy; Cortez, David


    SMARCAL1 catalyzes replication fork remodeling to maintain genome stability. It is recruited to replication forks via an interaction with replication protein A (RPA), the major ssDNA-binding protein in eukaryotic cells. In addition to directing its localization, RPA also activates SMARCAL1 on some fork substrates but inhibits it on others, thereby conferring substrate specificity to SMARCAL1 fork-remodeling reactions. We investigated the mechanism by which RPA regulates SMARCAL1. Our results indicate that although an interaction between SMARCAL1 and RPA is essential for SMARCAL1 activation, the location of the interacting surface on RPA is not. Counterintuitively, high-affinity DNA binding of RPA DNA-binding domain (DBD) A and DBD-B near the fork junction makes it easier for SMARCAL1 to remodel the fork, which requires removing RPA. We also found that RPA DBD-C and DBD-D are not required for SMARCAL1 regulation. Thus, the orientation of the high-affinity RPA DBDs at forks dictates SMARCAL1 substrate specificity. PMID:25552480

  15. High-affinity DNA-binding domains of replication protein A (RPA) direct SMARCAL1-dependent replication fork remodeling. (United States)

    Bhat, Kamakoti P; Bétous, Rémy; Cortez, David


    SMARCAL1 catalyzes replication fork remodeling to maintain genome stability. It is recruited to replication forks via an interaction with replication protein A (RPA), the major ssDNA-binding protein in eukaryotic cells. In addition to directing its localization, RPA also activates SMARCAL1 on some fork substrates but inhibits it on others, thereby conferring substrate specificity to SMARCAL1 fork-remodeling reactions. We investigated the mechanism by which RPA regulates SMARCAL1. Our results indicate that although an interaction between SMARCAL1 and RPA is essential for SMARCAL1 activation, the location of the interacting surface on RPA is not. Counterintuitively, high-affinity DNA binding of RPA DNA-binding domain (DBD) A and DBD-B near the fork junction makes it easier for SMARCAL1 to remodel the fork, which requires removing RPA. We also found that RPA DBD-C and DBD-D are not required for SMARCAL1 regulation. Thus, the orientation of the high-affinity RPA DBDs at forks dictates SMARCAL1 substrate specificity. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Deltorphins: a family of naturally occurring peptides with high affinity and selectivity for delta opioid binding sites. (United States)

    Erspamer, V; Melchiorri, P; Falconieri-Erspamer, G; Negri, L; Corsi, R; Severini, C; Barra, D; Simmaco, M; Kreil, G


    Deltorphins are endogenous linear heptapeptides, isolated from skin extracts of frogs belonging to the genus Phyllomedusa, that have a higher affinity and selectivity for delta opioid binding sites than any other natural compound known. Two deltorphins with the sequence Tyr-Ala-Phe-Asp(or Glu)-Val-Val-Gly-NH2 have been isolated from skin extracts of Phyllomedusa bicolor. The alanine in position 2 is in the D configuration. These peptides, [D-Ala2]deltorphins I and II, show an even higher affinity for delta receptors than the previously characterized deltorphin, which contains D-methionine as the second amino acid. These peptides show some similarity to another constituent of Phyllomedusa skin, dermorphin, which is highly selective for mu-opioid receptors. These peptides all have the N-terminal sequence Tyr-D-Xaa-Phe, where D-Xaa is either D-alanine or D-methionine. While this structure seems to be capable of activating both mu and delta opioid receptors, differences in the C-terminal regions of these peptides are probably responsible for the observed high receptor selectivity of dermorphin and deltorphin.

  17. Biphasic regulation of development of the high-affinity saxitoxin receptor by innervation in rat skeletal muscle

    International Nuclear Information System (INIS)

    Sherman, S.J.; Catterall, W.A.


    Specific binding of 3 H-saxitoxin (STX) was used to quantitate the density of voltage-sensitive sodium channels in developing rat skeletal muscle. In adult triceps surae, a single class of sites with a KD . 2.9 nM and a density of 21 fmol/mg wet wt was detected. The density of these high-affinity sites increased from 2.0 fmol/mg wet wt to the adult value in linear fashion during days 2-25 after birth. Denervation of the triceps surae at day 11 or 17 reduced final saxitoxin receptor site density to 10.4 or 9.2 fmol/mg wet wt, respectively, without changing KD. Denervation of the triceps surae at day 5 did not alter the subsequent development of saxitoxin receptor sites during days 5-9 and accelerated the increase of saxitoxin receptor sites during days 9-13. After day 13, saxitoxin receptor development abruptly ceased and the density of saxitoxin receptor sites declined to 11 fmol/wg wet wt. These results show that the regulation of high-affinity saxitoxin receptor site density by innervation is biphasic. During the first phase, which is independent of continuing innervation, the saxitoxin receptor density increases to 47-57% of the adult level. After day 11, the second phase of development, which is dependent on continuing innervation, gives rise to the adult density of saxitoxin receptors

  18. Tsetse salivary gland proteins 1 and 2 are high affinity nucleic acid binding proteins with residual nuclease activity.

    Directory of Open Access Journals (Sweden)

    Guy Caljon

    Full Text Available Analysis of the tsetse fly salivary gland EST database revealed the presence of a highly enriched cluster of putative endonuclease genes, including tsal1 and tsal2. Tsal proteins are the major components of tsetse fly (G. morsitans morsitans saliva where they are present as monomers as well as high molecular weight complexes with other saliva proteins. We demonstrate that the recombinant tsetse salivary gland proteins 1&2 (Tsal1&2 display DNA/RNA non-specific, high affinity nucleic acid binding with K(D values in the low nanomolar range and a non-exclusive preference for duplex. These Tsal proteins exert only a residual nuclease activity with a preference for dsDNA in a broad pH range. Knockdown of Tsal expression by in vivo RNA interference in the tsetse fly revealed a partially impaired blood digestion phenotype as evidenced by higher gut nucleic acid, hematin and protein contents.

  19. ZipA binds to FtsZ with high affinity and enhances the stability of FtsZ protofilaments.

    Directory of Open Access Journals (Sweden)

    Anuradha Kuchibhatla

    Full Text Available A bacterial membrane protein ZipA that tethers FtsZ to the membrane is known to promote FtsZ assembly. In this study, the binding of ZipA to FtsZ was monitored using fluorescence spectroscopy. ZipA was found to bind to FtsZ with high affinities at three different (6.0, 6.8 and 8.0 pHs, albeit the binding affinity decreased with increasing pH. Further, thick bundles of FtsZ protofilaments were observed in the presence of ZipA under the pH conditions used in this study indicating that ZipA can promote FtsZ assembly and stabilize FtsZ polymers under unfavorable conditions. Bis-ANS, a hydrophobic probe, decreased the interaction of FtsZ and ZipA indicating that the interaction between FtsZ and ZipA is hydrophobic in nature. ZipA prevented the dilution induced disassembly of FtsZ polymers suggesting that it stabilizes FtsZ protofilaments. Fluorescein isothiocyanate-labeled ZipA was found to be uniformly distributed along the length of the FtsZ protofilaments indicating that ZipA stabilizes FtsZ protofilaments by cross-linking them.

  20. Cyclic GMP-AMP containing mixed phosphodiester linkages is an endogenous high-affinity ligand for STING. (United States)

    Zhang, Xu; Shi, Heping; Wu, Jiaxi; Zhang, Xuewu; Sun, Lijun; Chen, Chuo; Chen, Zhijian J


    The presence of microbial or self DNA in the cytoplasm of mammalian cells is a danger signal detected by the DNA sensor cyclic-GMP-AMP (cGAMP) synthase (cGAS), which catalyzes the production of cGAMP that in turn serves as a second messenger to activate innate immune responses. Here we show that endogenous cGAMP in mammalian cells contains two distinct phosphodiester linkages, one between 2'-OH of GMP and 5'-phosphate of AMP, and the other between 3'-OH of AMP and 5'-phosphate of GMP. This molecule, termed 2'3'-cGAMP, is unique in that it binds to the adaptor protein STING with a much greater affinity than cGAMP molecules containing other combinations of phosphodiester linkages. The crystal structure of STING bound to 2'3'-cGAMP revealed the structural basis of this high-affinity binding and a ligand-induced conformational change in STING that may underlie its activation. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Design, Synthesis, and Biological Evaluation of Small, High-Affinity Siglec-7 Ligands: Toward Novel Inhibitors of Cancer Immune Evasion. (United States)

    Prescher, Horst; Frank, Martin; Gütgemann, Stephan; Kuhfeldt, Elena; Schweizer, Astrid; Nitschke, Lars; Watzl, Carsten; Brossmer, Reinhard


    Natural killer cells are able to directly lyse tumor cells, thereby participating in the immune surveillance against cancer. Unfortunately, many cancer cells use immune evasion strategies to avoid their eradication by the immune system. A prominent escape strategy of malignant cells is to camouflage themselves with Siglec-7 ligands, thereby recruiting the inhibitory receptor Siglec-7 expressed on the NK cell surface which subsequently inhibits NK-cell-mediated lysis. Here we describe the synthesis and evaluation of the first, high-affinity low molecular weight Siglec-7 ligands to interfere with cancer cell immune evasion. The compounds are Sialic acid derivatives and bind with low micromolar K d values to Siglec-7. They display up to a 5000-fold enhanced affinity over the unmodified sialic acid scaffold αMe Neu5Ac, the smallest known natural Siglec-7 ligand. Our results provide a novel immuno-oncology strategy employing natural immunity in the fight against cancers, in particular blocking Siglec-7 with low molecular weight compounds.

  2. Amine-functionalized PVA-co-PE nanofibrous membrane as affinity membrane with high adsorption capacity for bilirubin. (United States)

    Wang, Wenwen; Zhang, Hao; Zhang, Zhifeng; Luo, Mengying; Wang, Yuedan; Liu, Qiongzhen; Chen, Yuanli; Li, Mufang; Wang, Dong


    In this study, poly(vinyl alcohol-co-ethylene) (PVA-co-PE) nanofibrous membrane was activated by sodium hydroxide and cyanuric chloride, and then the activated membranes were functionalized by 1,3-propanediamine, hexamethylenediamine and diethylenetriamine to be affinity membranes for bilirubin removal, respectively. The chemical structures and morphologies of membranes were investigated by SEM, FTIR and XPS. And the adsorption ability of different amine-functionalized nanofibrous membranes for bilirubin was characterized. Furthermore, the effects of temperature, initial concentration of bilirubin, NaCl concentration and BSA concentration on the adsorption capacity for bilirubin of diethylenetriamine-functionalized nanofibrous membrane were studied. Results indicated that the adsorption capacity for bilirubin of diethylenetriamine-functionalized nanofibrous membrane could reach 85mg/g membrane when the initial bilirubin concentration was 200mg/L while the adsorption capacity could be increased to 110mg/g membrane if the initial bilirubin concentration was more than 400mg/L. The dynamic adsorption of diethylenetriamine-functionalized nanofibrous membrane showed that the ligands of amine groups on the membrane surface could be used as far as possible by recirculating the plasma with certain flow rates. Therefore, the diethylenetriamine-functionalized PVA-co-PE nanofibrous membrane possessed high adsorption capacity for bilirubin and it can be candidate as affinity membrane for bilirubin removal. Copyright © 2016. Published by Elsevier B.V.

  3. Characterization of SynCAM surface trafficking using a SynCAM derived ligand with high homophilic binding affinity

    International Nuclear Information System (INIS)

    Breillat, Christelle; Thoumine, Olivier; Choquet, Daniel


    In order to better probe SynCAM function in neurons, we produced a fusion protein between the extracellular domain of SynCAM1 and the constant fragment of human IgG (SynCAM-Fc). Whether in soluble form or immobilized on latex microspheres, the chimera bound specifically to the surface of hippocampal neurons and recruited endogenous SynCAM molecules. SynCAM-Fc was also used in combination with Quantum Dots to follow the mobility of transfected SynCAM receptors at the neuronal surface. Both immobile and highly mobile SynCAM were found. Thus, SynCAM-Fc behaves as a high affinity ligand that can be used to study the function of SynCAM at the neuronal membrane

  4. High-Affinity Low-Capacity and Low-Affinity High-Capacity N-Acetyl-2-Aminofluorene (AAF) Macromolecular Binding Sites Are Revealed During the Growth Cycle of Adult Rat Hepatocytes in Primary Culture. (United States)

    Koch, Katherine S; Moran, Tom; Shier, W Thomas; Leffert, Hyam L


    Long-term cultures of primary adult rat hepatocytes were used to study the effects of N-acetyl-2-aminofluorene (AAF) on hepatocyte proliferation during the growth cycle; on the initiation of hepatocyte DNA synthesis in quiescent cultures; and, on hepatocyte DNA replication following the initiation of DNA synthesis. Scatchard analyses were used to identify the pharmacologic properties of radiolabeled AAF metabolite binding to hepatocyte macromolecules. Two classes of growth cycle-dependent AAF metabolite binding sites-a high-affinity low-capacity site (designated Site I) and a low-affinity high-capacity site (designated Site II)-associated with two spatially distinct classes of macromolecular targets, were revealed. Based upon radiolabeled AAF metabolite binding to purified hepatocyte genomic DNA or to DNA, RNA, proteins, and lipids from isolated nuclei, Site IDAY 4 targets (KD[APPARENT] ≈ 2-4×10-6 M and BMAX[APPARENT] ≈ 6 pmol/106 cells/24 h) were consistent with genomic DNA; and with AAF metabolized by a nuclear cytochrome P450. Based upon radiolabeled AAF binding to total cellular lysates, Site IIDAY 4 targets (KD[APPARENT] ≈ 1.5×10-3 M and BMAX[APPARENT] ≈ 350 pmol/106 cells/24 h) were consistent with cytoplasmic proteins; and with AAF metabolized by cytoplasmic cytochrome P450s. DNA synthesis was not inhibited by concentrations of AAF that saturated DNA binding in the neighborhood of the Site I KD. Instead, hepatocyte DNA synthesis inhibition required higher concentrations of AAF approaching the Site II KD. These observations raise the possibility that carcinogenic DNA adducts derived from AAF metabolites form below concentrations of AAF that inhibit replicative and repair DNA synthesis.

  5. Comparison of high affinity binding of 3H-proadifen and 3H-(-)-cocaine t rat liver membranes

    International Nuclear Information System (INIS)

    Ross, S.B.


    The characteristics of the binding of 3 H-proadifen to rat liver membranes were studied and compared to those of 3 H-cocaine. It was found that 3 H-proadifen was bound reversibly with high affinity (K D =1.8±0.5 nM) and large capacity (B max =2010±340 pmol/g wet tissue) to liver membranes. The corresponding values for the 3 H-cocaine binding were 3.5 nM and 1000 pmol/g wet tissue. The binding of 3 H-proadifen was mainly localised to the microsomal fraction. The number of binding sites was not increased by treatment of rats with phenobarbitone. With 1 μM CdCl 2 in the incubation buffer it was possible to differentiate between two 3 H-cocaine binding sites with K d values of 1.6 and 7.7 nM and B max values of 280 and 940 pmol/g wet liver tissue. S-(-)-Alaproclate inhibited the binding of 3 H-proadifen and 3 H-cocaine inhibited the binding of 3 H-proadifen (IC 50 =10 nM) and proadifen that of 3 H-cocaine (IC 50 =1 nM). There was a high correlation coefficient (r r =0.972; P 50 =100-500 nM): chloroquine, phenoxybenzamine, amitriptyline, ajmaline, remoxipride, imipramine and (-)-alaprenolol. CdCl 2 , ZnCl 2 and CuCl 2 inhibited the binding of both ligands with low Hill coefficients, indicating heterogeneous binding sites. The inhibition curve of Cd 2+ on the cocaine binding was biphasic with a high affinity part around 50 nM and a low affinity part at 15μM. The similarity of the characteristics of the binding of these ligands with that of 3 H-alaproclate is discussed. It is suggested that all three compounds bind to the same sites, although additional binding sites seem to exist for proadifen. (au) (9 refs.)

  6. Mapping of barley alpha-amylases and outer subsite mutants reveals dynamic high-affinity subsites and barriers in the long substrate binding cleft

    DEFF Research Database (Denmark)

    Kandra, L.; Abou Hachem, Maher; Gyemant, G.


    Subsite affinity maps of long substrate binding clefts in barley alpha-amylases, obtained using a series of maltooligosaccharides of degree of polymerization of 3-12, revealed unfavorable binding energies at the internal subsites -3 and -5 and at subsites -8 and +3/+4 defining these subsites...... as binding barriers. Barley a-amylase I mutants Y105A and T212Y at subsite -6 and +4 resulted in release or anchoring of bound substrate, thus modifying the affinities of other high-affinity subsites (-2 and +2) and barriers. The double mutant Y105A-T212Y displayed a hybrid subsite affinity profile......, converting barriers to binding areas. These findings highlight the dynamic binding energy distribution and the versatility of long maltooligosaccharide derivatives in mapping extended binding clefts in a-amylases....

  7. Contribution of katG, ahpC and inhA mutations to the detection of isoniazid-resistant Mycobacterium tuberculosis isolates from Lebanon and Syria

    Directory of Open Access Journals (Sweden)

    F Dabboussi


    Conclusions: This study showed that the pyrosequencing applied to katG, inhA promoter and ahpC-oxyR intergenic region was able to detect a relatively large proportion of Syrian INH-resistant MTB isolates (80.7% in Syria. This strategy may be inappropriate for Lebanese strains, as the genetic mechanisms of resistance remain unidentified for approximately half of the isolates, so it is quite possible to detect the presence of other mechanisms of resistance.

  8. Disruption of key NADH-binding pocket residues of the Mycobacterium tuberculosis InhA affects DD-CoA binding ability


    Shaw, Daniel J.; Robb, Kirsty; Vetter, Beatrice V.; Tong, Madeline; Molle, Virginie; Hunt, Neil T.; Hoskisson, Paul A.


    Tuberculosis (TB) is a global health problem that affects over 10 million people. There is an urgent need to develop novel antimicrobial therapies to combat TB. To achieve this, a thorough understanding of key validated drug targets is required. The enoyl reductase InhA, responsible for synthesis of essential mycolic acids in the mycobacterial cell wall, is the target for the frontline anti-TB drug isoniazid. To better understand the activity of this protein a series of mutants, targeted to t...

  9. Cyr61/CCN1 displays high-affinity binding to the somatomedin B(1-44 domain of vitronectin.

    Directory of Open Access Journals (Sweden)

    Ivo M B Francischetti


    Full Text Available Cyr61 is a member of the CCN (Cyr61, connective tissue growth, NOV family of extracellular-associated (matricellular proteins that present four distinct functional modules, namely insulin-like growth factor binding protein (IGFBP, von Willebrand factor type C (vWF, thrombospondin type 1 (TSP, and C-terminal growth factor cysteine knot (CT domain. While heparin sulphate proteoglycans reportedly mediate the interaction of Cyr61 with the matrix and cell surface, the role of other extracellular associated proteins has not been revealed.In this report, surface plasmon resonance (SPR experiments and solid-phase binding assays demonstrate that recombinant Cyr61 interacts with immobilized monomeric or multimeric vitronectin (VTNC with K(D in the nanomolar range. Notably, the binding site for Cyr61 was identified as the somatomedin B domain (SMTB(1-44 of VTNC, which mediates its interaction with PAI-1, uPAR, and integrin alphav beta3. Accordingly, PAI-1 outcompetes Cyr61 for binding to immobilized SMTB(1-44, and Cyr61 attenuates uPAR-mediated U937 adhesion to VTNC. In contrast, isothermal titration calorimetry shows that Cyr61 does not display high-affinity binding for SMTB(1-44 in solution. Nevertheless, competitive ELISA revealed that multimeric VTNC, heat-modified monomeric VTNC, or SMTB(1-44 at high concentrations attenuate Cyr61 binding to immobilized VTNC, while monomeric VTNC was ineffective. Therefore, immobilization of VTNC exposes cryptic epitopes that recognize Cyr61 with high affinity, as reported for a number of antibodies, beta-endorphin, and other molecules.The finding that Cyr61 interacts with the SMTB(1-44 domain suggests that VTNC represent a point of anchorage for CCN family members to the matrix. Results are discussed in the context of the role of CCN and VTNC in matrix biology and angiogenesis.

  10. Fundamental and practical studies on high-performance liquid affinity chromatography of biopolymers with novel stationary phases

    Energy Technology Data Exchange (ETDEWEB)

    Bacolod, M.D.


    Rigid microparticulate stationary phases having surface-bound metal chelating functions were developed and evaluated in high performance metal chelate affinity chromatography of proteins. Silica- and polystyrene-divinylbenzene-based metal chelate sorbents were produced in wide pore and in non-porous type of column packings. A major effort has been placed on development of non-porous highly crosslinked polystyrene-divinylbenzene (PSDVB). These PSDVB microparticles were produced by a two-step swelling polymerization, and exhibited excellent mechanical strength over a wide range of flow-rates and composition used in high performance liquid chromatography (HPLC). Simple and reproducible hydrophilic coatings were developed for the surface modification of hydrophobic PSDVB supports. A tetradentate metal chelating ligand, ethylenediamine-N, N[prime]-diacetic acid (EDDA), was covalently bound to the surface of the various supports. Sorbents having iminodiacetic acid (IDA) metal chelating functions were also evaluated. The hydrophilic character and surface coverage of various stationary phases were assessed chromatographically. Studies concerning the effects of eluent pH as well as the nature and concentration of salts on retention and selectivity with different metal chelate stationary phases having various immobilized metal ions were carried out. Elution schemes were developed for rapid separation of proteins in metal chelate affinity chromatography. EDDA stationary phases in metal forms can be viewed as complementary to IDA stationary phases since they afforded different selectivity and retentivity toward proteins. Hydrophilic PSDVB could be functionalized with IDA or EDDA metal chelating ligands or lectins. The non-porous metal chelate stationary phases afforded rapid separation of proteins by the development of multiple gradient systems, which permitted higher column peak capacity, enabling the separation of a greater number of proteins in a single chromatographic run.

  11. Affinities and densities of high-affinity [3H]muscimol (GABA-A) binding sites and of central benzodiazepine receptors are unchanged in autopsied brain tissue from cirrhotic patients with hepatic encephalopathy

    International Nuclear Information System (INIS)

    Butterworth, R.F.; Lavoie, J.; Giguere, J.F.; Pomier-Layrargues, G.


    The integrity of GABA-A receptors and of central benzodiazepine receptors was evaluated in membrane preparations from prefrontal cortex and caudate nuclei obtained at autopsy from nine cirrhotic patients who died in hepatic coma and an equal number of age-matched control subjects. Histopathological studies revealed Alzheimer Type II astrocytosis in all cases in the cirrhotic group; controls were free from neurological, psychiatric or hepatic diseases. Binding to GABA-A receptors was studied using [ 3 H]muscimol as radioligand. The integrity of central benzodiazepine receptors was evaluated using [ 3 H]flunitrazepam and [ 3 H]Ro15-1788. Data from saturation binding assays was analyzed by Scatchard plot. No modifications of either affinities (Kd) or densities (Bmax) of [ 3 H]muscimol of central benzodiazepine binding sites were observed. These findings do not support recent suggestions that alterations of either high-affinity GABA or benzodiazepine receptors play a significant role in the pathogenesis of hepatic encephalopathy

  12. Ultrasensitive direct competitive FLISA using highly luminescent quantum dot beads for tuning affinity of competing antigens to antibodies

    Energy Technology Data Exchange (ETDEWEB)

    Xiong, Sicheng; Zhou, Yaofeng; Huang, Xiaolin [State Key Laboratory of Food Science and Technology, Nanchang University, Nanchang 330047 (China); Yu, Ruijin [College of Science, Northwest A& F University, Yangling, Shaanxi 712100 (China); Lai, Weihua [State Key Laboratory of Food Science and Technology, Nanchang University, Nanchang 330047 (China); Xiong, Yonghua, E-mail: [State Key Laboratory of Food Science and Technology, Nanchang University, Nanchang 330047 (China)


    Herein, for the first time we report a novel direct competitive fluorescence-linked immunosorbent assay (dcFLISA) for the ultrasensitive detection of ochratoxin A (OTA) by introducing a large size polymer beads loaded with quantum dots (QBs) as carrier of competing antigen for decreasing binding affinity to antibody and enhancing the fluorescent signal intensity. When using 255 nm QBs as carrier of competing antigen, the equilibrium dissociation constant of QB based competing antigen to antibodies can be tuned to 100 times higher than that of the horseradish peroxidase (HRP) based competing antigen by controlling labeled amounts of antigen on the surface of QBs. Various parameters that influenced the sensitivity of dcFLISA were investigated and optimized. Under optimum detection parameters, the dynamic linear range of developed dcFLISA for detecting OTA was established at 0.05 pg/mL to 1.56 pg/mL with a half maximal inhibitory concentration at 0.14 ± 0.04 pg/mL (n = 5), which is three orders of magnitude lower than that of conventional HRP-based dcELISA (0.24 ng/mL). The developed FLISA is also highly accurate, reliable, and shows no cross reaction to other mycotoxins. In summary, the proposed method offers a straightforward approach to improve the sensitivity of direct competitive immunoassay for trace small chemical molecule detection in food quality control, environmental monitoring, and clinical diagnosis. - Highlights: • Highly luminescent QBs were used as a carrier of competing antigen for ultrasensitive detection of OTA. • It is the first time to use a large size QBs as a carrier for tuning affinity of competing antigen to antibodies. • IC{sub 50} value of QB-based dcFLISA is three orders of magnitude lower than that of HRP-based dcELISA.

  13. Ultrasensitive direct competitive FLISA using highly luminescent quantum dot beads for tuning affinity of competing antigens to antibodies

    International Nuclear Information System (INIS)

    Xiong, Sicheng; Zhou, Yaofeng; Huang, Xiaolin; Yu, Ruijin; Lai, Weihua; Xiong, Yonghua


    Herein, for the first time we report a novel direct competitive fluorescence-linked immunosorbent assay (dcFLISA) for the ultrasensitive detection of ochratoxin A (OTA) by introducing a large size polymer beads loaded with quantum dots (QBs) as carrier of competing antigen for decreasing binding affinity to antibody and enhancing the fluorescent signal intensity. When using 255 nm QBs as carrier of competing antigen, the equilibrium dissociation constant of QB based competing antigen to antibodies can be tuned to 100 times higher than that of the horseradish peroxidase (HRP) based competing antigen by controlling labeled amounts of antigen on the surface of QBs. Various parameters that influenced the sensitivity of dcFLISA were investigated and optimized. Under optimum detection parameters, the dynamic linear range of developed dcFLISA for detecting OTA was established at 0.05 pg/mL to 1.56 pg/mL with a half maximal inhibitory concentration at 0.14 ± 0.04 pg/mL (n = 5), which is three orders of magnitude lower than that of conventional HRP-based dcELISA (0.24 ng/mL). The developed FLISA is also highly accurate, reliable, and shows no cross reaction to other mycotoxins. In summary, the proposed method offers a straightforward approach to improve the sensitivity of direct competitive immunoassay for trace small chemical molecule detection in food quality control, environmental monitoring, and clinical diagnosis. - Highlights: • Highly luminescent QBs were used as a carrier of competing antigen for ultrasensitive detection of OTA. • It is the first time to use a large size QBs as a carrier for tuning affinity of competing antigen to antibodies. • IC_5_0 value of QB-based dcFLISA is three orders of magnitude lower than that of HRP-based dcELISA.

  14. High-affinity α4β2 nicotinic receptors mediate the impairing effects of acute nicotine on contextual fear extinction. (United States)

    Kutlu, Munir Gunes; Holliday, Erica; Gould, Thomas J


    Previously, studies from our lab have shown that while acute nicotine administered prior to training and testing enhances contextual fear conditioning, acute nicotine injections prior to extinction sessions impair extinction of contextual fear. Although there is also strong evidence showing that the acute nicotine's enhancing effects on contextual fear conditioning require high-affinity α4β2 nicotinic acetylcholine receptors (nAChRs), it is unknown which nAChR subtypes are involved in the acute nicotine-induced impairment of contextual fear extinction. In this study, we investigated the effects of acute nicotine administration on contextual fear extinction in knock-out (KO) mice lacking α4, β2 or α7 subtypes of nAChRs and their wild-type (WT) littermates. Both KO and WT mice were first trained and tested for contextual fear conditioning and received a daily contextual extinction session for 4 days. Subjects received intraperitoneal injections of nicotine (0.18 mg/kg) or saline 2-4 min prior to each extinction session. Our results showed that the mice that lack α4 and β2 subtypes of nAChRs showed normal contextual fear extinction but not the acute nicotine-induced impairment while the mice that lack the α7 subtype showed both normal contextual extinction and nicotine-induced impairment of contextual extinction. In addition, control experiments showed that acute nicotine-induced impairment of contextual fear extinction persisted when nicotine administration was ceased and repeated acute nicotine administrations alone did not induce freezing behavior in the absence of context-shock learning. These results clearly demonstrate that high-affinity α4β2 nAChRs are necessary for the effects of acute nicotine on contextual fear extinction. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Visual and Plasmon Resonance Absorption Sensor for Adenosine Triphosphate Based on the High Affinity between Phosphate and Zr(IV). (United States)

    Qi, Wenjing; Liu, Zhongyuan; Zhang, Wei; Halawa, Mohamed Ibrahim; Xu, Guobao


    Zr(IV) can form phosphate and Zr(IV) (-PO₃ 2- -Zr 4+ -) complex owing to the high affinity between Zr(IV) with phosphate. Zr(IV) can induce the aggregation of gold nanoparticles (AuNPs), while adenosine triphosphate(ATP) can prevent Zr(IV)-induced aggregation of AuNPs. Herein, a visual and plasmon resonance absorption (PRA)sensor for ATP have been developed using AuNPs based on the high affinity between Zr(IV)with ATP. AuNPs get aggregated in the presence of certain concentrations of Zr(IV). After the addition of ATP, ATP reacts with Zr(IV) and prevents AuNPs from aggregation, enabling the detection of ATP. Because of the fast interaction of ATP with Zr(IV), ATP can be detected with a detection limit of 0.5 μM within 2 min by the naked eye. Moreover, ATP can be detected by the PRA technique with higher sensitivity. The A 520nm / A 650nm values in PRA spectra increase linearly with the concentrations of ATP from 0.1 μM to 15 μM (r = 0.9945) with a detection limit of 28 nM. The proposed visual and PRA sensor exhibit good selectivity against adenosine, adenosine monophosphate, guanosine triphosphate, cytidine triphosphate and uridine triphosphate. The recoveries for the analysis of ATP in synthetic samples range from 95.3% to 102.0%. Therefore, the proposed novel sensor for ATP is promising for real-time or on-site detection of ATP.

  16. Visual and Plasmon Resonance Absorption Sensor for Adenosine Triphosphate Based on the High Affinity between Phosphate and Zr(IV

    Directory of Open Access Journals (Sweden)

    Wenjing Qi


    Full Text Available Zr(IV can form phosphate and Zr(IV (–PO32−–Zr4+– complex owing to the high affinity between Zr(IV with phosphate. Zr(IV can induce the aggregation of gold nanoparticles (AuNPs, while adenosine triphosphate(ATP can prevent Zr(IV-induced aggregation of AuNPs. Herein, a visual and plasmon resonance absorption (PRAsensor for ATP have been developed using AuNPs based on the high affinity between Zr(IVwith ATP. AuNPs get aggregated in the presence of certain concentrations of Zr(IV. After the addition of ATP, ATP reacts with Zr(IV and prevents AuNPs from aggregation, enabling the detection of ATP. Because of the fast interaction of ATP with Zr(IV, ATP can be detected with a detection limit of 0.5 μM within 2 min by the naked eye. Moreover, ATP can be detected by the PRA technique with higher sensitivity. The A520nm/A650nm values in PRA spectra increase linearly with the concentrations of ATP from 0.1 μM to 15 μM (r = 0.9945 with a detection limit of 28 nM. The proposed visual and PRA sensor exhibit good selectivity against adenosine, adenosine monophosphate, guanosine triphosphate, cytidine triphosphate and uridine triphosphate. The recoveries for the analysis of ATP in synthetic samples range from 95.3% to 102.0%. Therefore, the proposed novel sensor for ATP is promising for real-time or on-site detection of ATP.

  17. Generation of a novel high-affinity monoclonal antibody with conformational recognition epitope on human IgM. (United States)

    Sarikhani, Sina; Mirshahi, Manouchehr; Gharaati, Mohammad Reza; Mirshahi, Tooran


    As IgM is the first isotype of antibody which appears in blood after initial exposure to a foreign antigen in the pattern of primary response, detection, and quantification of this molecule in blood seems invaluable. To approach these goals, generation, and characterization of a highly specific mAb (monoclonal antibody) against human IgM were investigated. Human IgM immunoglobulins were used to immunize Balb/c mice. Spleen cells taken from the immunized animals were fused with SP2/O myeloma cells using PEG (polyethylene glycol, MW 1450) as fusogen. The hybridomas were cultured in HAT containing medium and supernatants from the growing hybrids were screened by enzyme-linked immunosorbent assay (ELISA) using plates coated with pure human IgM and the positive wells were then cloned at limiting dilutions. The best clone designated as MAN-1, was injected intraperitoneally to some Pristane-injected mice. Anti-IgM mAb was purified from the animals' ascitic fluid by protein-G sepharose followed by DEAE-cellulose ion exchange chromatography. MAN-1 interacted with human IgM with a very high specificity and affinity. The purity of the sample was tested by SDS-PAGE and the affinity constant was measured (K(a) = 3.5 x 10(9)M(-1). Immunoblotting and competitive ELISA were done and the results showed that the harvested antibody recognizes a conformational epitope on the mu chain of human IgM and there was no cross-reactivity with other subclasses of immunoglobulins. Furthermore, isotyping test was done and the results showed the subclass of the obtained mAb which was IgG(1)kappa.

  18. Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components. (United States)

    Baumstummler, A; Lehmann, D; Janjic, N; Ochsner, U A


    Slow off-rate modified aptamer (SOMAmer) reagents were generated to several Staphylococcus aureus cell surface-associated proteins via SELEX with multiple modified DNA libraries using purified recombinant or native proteins. High-affinity binding agents with sub-nanomolar Kd 's were obtained for staphylococcal protein A (SpA), clumping factors (ClfA, ClfB), fibronectin-binding proteins (FnbA, FnbB) and iron-regulated surface determinants (Isd). Further screening revealed several SOMAmers that specifically bound to Staph. aureus cells from all strains that were tested, but not to other staphylococci or other bacteria. SpA and ClfA SOMAmers proved useful for the selective capture and enrichment of Staph. aureus cells, as shown by culture and PCR, leading to improved limits of detection and efficient removal of PCR inhibitors. Detection of Staph. aureus cells was enhanced by several orders of magnitude when the bacterial cell surface was coated with SOMAmers followed by qPCR of the SOMAmers. Furthermore, fluorescence-labelled SpA SOMAmers demonstrated their utility as direct detection agents in flow cytometry. Significance and impact of the study: Monitoring for microbial contamination of food, water, nonsterile products or the environment is typically based on culture, PCR or antibodies. Aptamers that bind with high specificity and affinity to well-conserved cell surface epitopes represent a promising novel type of reagents to detect bacterial cells without the need for culture or cell lysis, including for the capture and enrichment of bacteria present at low cell densities and for the direct detection via qPCR or fluorescent staining. © 2014 Soma Logic, Inc. published by John Wiley & Sons Ltd On behalf of the society for Applied Microbiology.

  19. N-Acetyl-2-Aminofluorene (AAF) Processing in Adult Rat Hepatocytes in Primary Culture Occurs by High-Affinity Low-Velocity and Low-Affinity High-Velocity AAF Metabolite-Forming Systems. (United States)

    Koch, Katherine S; Moran, Tom; Shier, W Thomas; Leffert, Hyam L


    N-acetyl-2-aminofluorene (AAF) is a procarcinogen used widely in physiological investigations of chemical hepatocarcinogenesis. Its metabolic pathways have been described extensively, yet little is known about its biochemical processing, growth cycle expression, and pharmacological properties inside living hepatocytes-the principal cellular targets of this hepatocarcinogen. In this report, primary monolayer adult rat hepatocyte cultures and high specific-activity [ring G-3 H]-N-acetyl-2-aminofluorene were used to extend previous observations of metabolic activation of AAF by highly differentiated, proliferation-competent hepatocytes in long-term cultures. AAF metabolism proceeded by zero-order kinetics. Hepatocytes processed significant amounts of procarcinogen (≈12 μg AAF/106 cells/day). Five ring-hydroxylated and one deacetylated species of AAF were secreted into the culture media. Extracellular metabolite levels varied during the growth cycle (days 0-13), but their rank quantitative order was time invariant: 5-OH-AAF > 7-OH-AAF > 3-OH-AAF > N-OH-AAF > aminofluorene (AF) > 1-OH-AAF. Lineweaver-Burk analyses revealed two principal classes of metabolism: System I (high-affinity and low-velocity), Km[APPARENT] = 1.64 × 10-7  M and VMAX[APPARENT] = 0.1 nmol/106 cells/day and System II (low-affinity and high-velocity), Km[APPARENT] = 3.25 × 10-5  M and VMAX[APPARENT] = 1000 nmol/106 cells/day. A third system of metabolism of AAF to AF, with Km[APPARENT] and VMAX[APPARENT] constants of 9.6 × 10-5  M and 4.7 nmol/106 cells/day, was also observed. Evidence provided in this report and its companion paper suggests selective roles and intracellular locations for System I- and System II-mediated AAF metabolite formation during hepatocarcinogenesis, although some of the molecules and mechanisms responsible for multi-system processing remain to be fully defined.

  20. Haptoglobin-related protein is a high-affinity hemoglobin-binding plasma protein

    DEFF Research Database (Denmark)

    Nielsen, Marianne Jensby; Petersen, Steen Vang; Jacobsen, Christian


    Haptoglobin-related protein (Hpr) is a primate-specific plasma protein associated with apolipoprotein L-I (apoL-I)-containing high-density lipoprotein (HDL) particles shown to be a part of the innate immune defense. Despite the assumption hitherto that Hpr does not bind to hemoglobin, the present...

  1. Absence of high-affinity calreticulin autoantibodies in patients with systemic rheumatic diseases and coeliac disease

    DEFF Research Database (Denmark)

    Jørgensen, C S; Hansen, K B; Jacobsen, Søren


    agent. Using these conditions we found a relatively high level of non-specific binding in many sera. Antibodies to proteins that are used as blocking reagents in ELISA (bovine serum albumin (BSA), ovalbumin, skimmed milk powder) are frequently present in sera, and these may cause false-positive results...

  2. Radioiodsodestannylation. Convenient synthesis of a high affinity thromboxane A2/prostaglandin H2 receptor antagonist

    International Nuclear Information System (INIS)

    Mais, D.E.; Hamanaka, Nobuyuki


    Radioiodination of methyl-7-[(2R, 2S, 5R)-6,6-dimethyl-3-(4-trimethylstannylbenzenesulfononylamino3S) bicyclo[3.1.1]hept-2-yl]-5(Z)-heptenoate with [ 125 I] Na using a modification of the chloramine-T method in organic solvent is simple with high yields and site specific. The product, following hydrolysis of the ester, 7-[(2R, 2S, 3S, 5R)-6,6-dimethyl-3-(4[ 125 I]-iodobenzenesulfonylamino) bicyclo[3.1.1]hept-2-yl]-5(Z)-heptenoic acid [( 125 I]-ISAP), was purified by HPLC. The high specific activity and specific binding will make the ligand a useful tool for the characterization of thromboxane A 2 /prostaglandin H 2 receptors. (author)

  3. Selectable high-yield recombinant protein production in human cells using a GFP/YFP nanobody affinity support. (United States)

    Schellenberg, Matthew J; Petrovich, Robert M; Malone, Christine C; Williams, R Scott


    Recombinant protein expression systems that produce high yields of pure proteins and multi-protein complexes are essential to meet the needs of biologists, biochemists, and structural biologists using X-ray crystallography and cryo-electron microscopy. An ideal expression system for recombinant human proteins is cultured human cells where the correct translation and chaperone machinery are present. However, compared to bacterial expression systems, human cell cultures present several technical challenges to their use as an expression system. We developed a method that utilizes a YFP fusion-tag to generate recombinant proteins using suspension-cultured HEK293F cells. YFP is a dual-function tag that enables direct visualization and fluorescence-based selection of high expressing clones for and rapid purification using a high-stringency, high-affinity anti-GFP/YFP nanobody support. We demonstrate the utility of this system by expressing two large human proteins, TOP2α (340 KDa dimer) and a TOP2β catalytic core (260 KDa dimer). This robustly and reproducibly yields >10 mg/L liter of cell culture using transient expression or 2.5 mg/L using stable expression. Published 2018. This article is a US Government work and is in the public domain in the USA.

  4. Glucose uptake and growth of glucose-limited chemostat cultures of Aspergillus niger and a disruptant lacking MstA, a high-affinity glucose transporter

    DEFF Research Database (Denmark)

    Jørgensen, Thomas R; vanKuyk, Patricia A; Poulsen, Bjarne R


    This is a study of high-affinity glucose uptake in Aspergillus niger and the effect of disruption of a high-affinity monosaccharide-transporter gene, mstA. The substrate saturation constant (K(s)) of a reference strain was about 15 microM in glucose-limited chemostat culture. Disruption of mst......-affinity uptake system of A. niger. The mstA disruptant and a reference strain were cultivated in glucose-limited chemostat cultures at low, intermediate and high dilution rate (D=0.07 h(-1), 0.14 h(-1) and 0.20 h(-1)). Mycelium harvested from steady-state cultures was subjected to glucose uptake assays...

  5. High-gradient magnetic affinity separation of trypsin from porcine pancreatin

    DEFF Research Database (Denmark)

    Hubbuch, Jürgen; Thomas, Owen R. T.


    We introduce a robust and scale-flexible approach to macromolecule purification employing tailor-made magnetic adsorbents and high-gradient magnetic separation technology adapted from the mineral processing industries. Detailed procedures for the synthesis of large quantities of low-cost defined......-scale studies approximate to95% of the endogenous trypsin present in a crude porcine pancreatin feedstock was recovered with a purification factor of approximate to4.1 at the expense of only a 4% loss in a-amylase activity. Efficient recovery of trypsin from the same feedstock was demonstrated at a vastly...

  6. Scalable high-affinity stabilization of magnetic iron oxide nanostructures by a biocompatible antifouling homopolymer

    KAUST Repository

    Luongo, Giovanni


    Iron oxide nanostructures have been widely developed for biomedical applications, due to their magnetic properties and biocompatibility. In clinical application, the stabilization of these nanostructures against aggregation and non-specific interactions is typically achieved using weakly anchored polysaccharides, with better-defined and more strongly anchored synthetic polymers not commercially adopted due to complexity of synthesis and use. Here, we show for the first time stabilization and biocompatibilization of iron oxide nanoparticles by a synthetic homopolymer with strong surface anchoring and a history of clinical use in other applications, poly(2-methacryloyloxyethy phosphorylcholine) (poly(MPC)). For the commercially important case of spherical particles, binding of poly(MPC) to iron oxide surfaces and highly effective individualization of magnetite nanoparticles (20 nm) are demonstrated. Next-generation high-aspect ratio nanowires (both magnetite/maghemite and core-shell iron/iron oxide) are furthermore stabilized by poly(MPC)-coating, with nanowire cytotoxicity at large concentrations significantly reduced. The synthesis approach is exploited to incorporate functionality into the poly(MPC) chain is demonstrated by random copolymerization with an alkyne-containing monomer for click-chemistry. Taking these results together, poly(MPC) homopolymers and random copolymers offer a significant improvement over current iron oxide nanoformulations, combining straightforward synthesis, strong surface-anchoring and well-defined molecular weight.

  7. Scalable high-affinity stabilization of magnetic iron oxide nanostructures by a biocompatible antifouling homopolymer

    KAUST Repository

    Luongo, Giovanni; Campagnolo, Paola; Perez, Jose E.; Kosel, Jü rgen; Georgiou, Theoni K.; Regoutz, Anna; Payne, David J; Stevens, Molly M.; Ryan, Mary P.; Porter, Alexandra E; Dunlop, Iain E


    Iron oxide nanostructures have been widely developed for biomedical applications, due to their magnetic properties and biocompatibility. In clinical application, the stabilization of these nanostructures against aggregation and non-specific interactions is typically achieved using weakly anchored polysaccharides, with better-defined and more strongly anchored synthetic polymers not commercially adopted due to complexity of synthesis and use. Here, we show for the first time stabilization and biocompatibilization of iron oxide nanoparticles by a synthetic homopolymer with strong surface anchoring and a history of clinical use in other applications, poly(2-methacryloyloxyethy phosphorylcholine) (poly(MPC)). For the commercially important case of spherical particles, binding of poly(MPC) to iron oxide surfaces and highly effective individualization of magnetite nanoparticles (20 nm) are demonstrated. Next-generation high-aspect ratio nanowires (both magnetite/maghemite and core-shell iron/iron oxide) are furthermore stabilized by poly(MPC)-coating, with nanowire cytotoxicity at large concentrations significantly reduced. The synthesis approach is exploited to incorporate functionality into the poly(MPC) chain is demonstrated by random copolymerization with an alkyne-containing monomer for click-chemistry. Taking these results together, poly(MPC) homopolymers and random copolymers offer a significant improvement over current iron oxide nanoformulations, combining straightforward synthesis, strong surface-anchoring and well-defined molecular weight.

  8. Pharmacokinetics and biodistribution of a radioiodine labeled peptidomimetic ligand for high-affinity nerve growth factor receptors

    Energy Technology Data Exchange (ETDEWEB)

    Jung, K. H.; Kim, D. H.; Paik, J. Y.; Koh, B. H.; Bae, J. S.; Choe, Y. S.; Lee, K. H.; Kim, B. T. [Samsung Medical Center, Seoul (Korea, Republic of)


    Some of the obstacles for the clinical application of whole nerve growth factor (NGF) may be overcome by utilizing small molecule mimetics. We thus investigated the in vivo pharmacokinetics and biodistribution of a small cyclic peptide derived from NGF-[C(92-96)] with high receptor binding affinity. I-125 C(92-96) was labeled with the Bolton-Hunter method, and binding to TrkA/IgG chimeric protein was confirmed on a polyacrylamide gel after cross-linking. Pharmacokinetic analysis was performed in normal ICR mice intravenously injected with 0.5 MBq I-125 C(92-96) containing varying doses of C(92-96). Biodistribution studies were done at 6 h after injection. Cross-linkage analysis confirmed binding of I-125 C(92-96) to the high affinity NGF receptor, TrkA. Intravenously injected I-125 C(92-96) was cleared from the blood in a biexponential manner with an early T1/2{alpha} of 5.2 min and late T1/2{beta} of 121.3 min. Log blood-concentration decreased over time with a k-slope of 0.0025, clearance of 11.8{+-}0.5 ml/min, T1/2 of 4.1{+-}0.4 hr, and volume of distribution of 69.7{+-}4.6 ml. The pattern of elimination from the blood remained essentially unchanged regardless of the dose of added C(92-96), with dose-proportionate increases in AUCs and peak concentrations consistent with linear pharmacokinetics. Biodistribution studies demonstrated high kidney activity suggesting renal excretion of I-125 C(92-96). There were moderate levels of accumulation in the spleen, lungs and liver, followed by the myocardium and skeletal muscle, whereas brain uptake was low (< 0.2 %ID/gm). Intravenously administered C(92-96) follows linear pharmacokinetics, and is cleared from the circulation at a rate comparable to whole NGF despite its substantially smaller size. Although intravenous C(92-96) does not adequately reach brain tissue, clinically relevant doses can achieve major organ accumulation levels that may be sufficient to elicit biologic responses through NGF receptors.

  9. Pharmacokinetics and biodistribution of a radioiodine labeled peptidomimetic ligand for high-affinity nerve growth factor receptors

    International Nuclear Information System (INIS)

    Jung, K. H.; Kim, D. H.; Paik, J. Y.; Koh, B. H.; Bae, J. S.; Choe, Y. S.; Lee, K. H.; Kim, B. T.


    Some of the obstacles for the clinical application of whole nerve growth factor (NGF) may be overcome by utilizing small molecule mimetics. We thus investigated the in vivo pharmacokinetics and biodistribution of a small cyclic peptide derived from NGF-[C(92-96)] with high receptor binding affinity. I-125 C(92-96) was labeled with the Bolton-Hunter method, and binding to TrkA/IgG chimeric protein was confirmed on a polyacrylamide gel after cross-linking. Pharmacokinetic analysis was performed in normal ICR mice intravenously injected with 0.5 MBq I-125 C(92-96) containing varying doses of C(92-96). Biodistribution studies were done at 6 h after injection. Cross-linkage analysis confirmed binding of I-125 C(92-96) to the high affinity NGF receptor, TrkA. Intravenously injected I-125 C(92-96) was cleared from the blood in a biexponential manner with an early T1/2α of 5.2 min and late T1/2β of 121.3 min. Log blood-concentration decreased over time with a k-slope of 0.0025, clearance of 11.8±0.5 ml/min, T1/2 of 4.1±0.4 hr, and volume of distribution of 69.7±4.6 ml. The pattern of elimination from the blood remained essentially unchanged regardless of the dose of added C(92-96), with dose-proportionate increases in AUCs and peak concentrations consistent with linear pharmacokinetics. Biodistribution studies demonstrated high kidney activity suggesting renal excretion of I-125 C(92-96). There were moderate levels of accumulation in the spleen, lungs and liver, followed by the myocardium and skeletal muscle, whereas brain uptake was low (< 0.2 %ID/gm). Intravenously administered C(92-96) follows linear pharmacokinetics, and is cleared from the circulation at a rate comparable to whole NGF despite its substantially smaller size. Although intravenous C(92-96) does not adequately reach brain tissue, clinically relevant doses can achieve major organ accumulation levels that may be sufficient to elicit biologic responses through NGF receptors

  10. High-affinity multivalent wheat germ agglutinin ligands by one-pot click reaction

    Directory of Open Access Journals (Sweden)

    Henning S. G. Beckmann


    Full Text Available A series of six mono-, di-, and trivalent N,N’-diacetylchitobiose derivatives was conveniently prepared by employing a one-pot procedure for Cu(II-catalyzed diazo transfer and Cu(I-catalyzed azide–alkyne cycloaddition (CuAAC starting from commercially available amines. These glycoclusters were probed for their binding potencies to the plant lectin wheat germ agglutinin (WGA from Triticum vulgaris by an enzyme-linked lectin assay (ELLA employing covalently immobilized N-acetylglucosamine (GlcNAc as a reference ligand. IC50 values were in the low micromolar/high nanomolar range, depending on the linker between the two disaccharides. Binding enhancements β up to 1000 for the divalent ligands and 2800 for a trivalent WGA ligand, compared to N,N’-diacetylchitobiose as the corresponding monovalent ligand, were observed. Molecular modeling studies, in which the chitobiose moieties were fitted into crystallographically determined binding sites of WGA, correlate the binding enhancements of the multivalent ligands with their ability to bind to the protein in a chelating mode. The best WGA ligand is a trivalent cluster with an IC50 value of 220 nM. Calculated per mol of contained chitobiose, this is the best WGA ligand known so far.

  11. Surface Plasmon Resonance: New Biointerface Designs and High-Throughput Affinity Screening (United States)

    Linman, Matthew J.; Cheng, Quan Jason

    Surface plasmon resonance (SPR) is a surface optical technique that measures minute changes in refractive index at a metal-coated surface. It has become increasingly popular in the study of biological and chemical analytes because of its label-free measurement feature. In addition, SPR allows for both quantitative and qualitative assessment of binding interactions in real time, making it ideally suited for probing weak interactions that are often difficult to study with other methods. This chapter presents the biosensor development in the last 3 years or so utilizing SPR as the principal analytical technique, along with a concise background of the technique itself. While SPR has demonstrated many advantages, it is a nonselective method and so, building reproducible and functional interfaces is vital to sensing applications. This chapter, therefore, focuses mainly on unique surface chemistries and assay approaches to examine biological interactions with SPR. In addition, SPR imaging for high-throughput screening based on microarrays and novel hyphenated techniques involving the coupling of SPR to other analytical methods is discussed. The chapter concludes with a commentary on the current state of SPR biosensing technology and the general direction of future biosensor research.

  12. High-affinity uranyl-specific antibodies suitable for cellular imaging

    Energy Technology Data Exchange (ETDEWEB)

    Reisser-Rubrecht, L.; Torne-Celer, C.; Renier, W.; Averseng, O.; Plantevin, S.; Quemeneur, E.; Bellanger, L.; Vidaud, C. [CEA Valrho, DSV, IBEB, Serv Biochim et Toxicol Nucl, F-30207 Bagnols Sur Ceze (France)


    Monoclonal antibodies (mAbs) have proved to be valuable models for the study of protein-metal interactions, and previous reports have described very specific antibodies to chelated metal ions, including uranyl. We raised specific mAbs against UO{sub 2}{sup 2+}-DCP-BSA (DCP, 1, 10-phenanthroline-2,9-dicarboxylic acid) to generate new sets of antibodies that might cross-react with various complexed forms of uranyl in different environments for further application in the field of toxicology. Using counter-screening with UO{sub 2}{sup 2+}-DCP-casein, we selected two highly specific mAbs against uranyl-DCP (K{sub D} = 10-100 pM): U04S and U08S. Competitive assays in the presence of different metal ions (UO{sub 2}{sup 2+}, Fe{sup 3+}, Zn{sup 2+}, Cu{sup 2+}, and Ca{sup 2+}) showed that uranyl in solution can act as a good competitor, suggesting some antibody ability to cross-react with chelating groups other than DCP in the UO{sub 2}{sup 2+} equatorial coordination plane. Interestingly, one of the antibodies could be used for revealing uranyl cations in cell samples. Fluorescence activated cell sorting analyses after immuno-labeling revealed the interaction of uranyl with human kidney cells HK2. The intracellular accumulation of uranyl could be directly visualized by metal-immunostaining using fluorescent-labeled mAb. Our results suggest that U04S mAb epitopes mostly include the uranyl fraction and its para-topes can accommodate a wide variety of chelating groups. (authors)

  13. High-affinity uranyl-specific antibodies suitable for cellular imaging

    International Nuclear Information System (INIS)

    Reisser-Rubrecht, L.; Torne-Celer, C.; Renier, W.; Averseng, O.; Plantevin, S.; Quemeneur, E.; Bellanger, L.; Vidaud, C.


    Monoclonal antibodies (mAbs) have proved to be valuable models for the study of protein-metal interactions, and previous reports have described very specific antibodies to chelated metal ions, including uranyl. We raised specific mAbs against UO 2 2+ -DCP-BSA (DCP, 1, 10-phenanthroline-2,9-dicarboxylic acid) to generate new sets of antibodies that might cross-react with various complexed forms of uranyl in different environments for further application in the field of toxicology. Using counter-screening with UO 2 2+ -DCP-casein, we selected two highly specific mAbs against uranyl-DCP (K D = 10-100 pM): U04S and U08S. Competitive assays in the presence of different metal ions (UO 2 2+ , Fe 3+ , Zn 2+ , Cu 2+ , and Ca 2+ ) showed that uranyl in solution can act as a good competitor, suggesting some antibody ability to cross-react with chelating groups other than DCP in the UO 2 2+ equatorial coordination plane. Interestingly, one of the antibodies could be used for revealing uranyl cations in cell samples. Fluorescence activated cell sorting analyses after immuno-labeling revealed the interaction of uranyl with human kidney cells HK2. The intracellular accumulation of uranyl could be directly visualized by metal-immunostaining using fluorescent-labeled mAb. Our results suggest that U04S mAb epitopes mostly include the uranyl fraction and its para-topes can accommodate a wide variety of chelating groups. (authors)

  14. Immunostimulatory CpG-oligonucleotides induce functional high affinity IL-2 receptors on B-CLL cells: costimulation with IL-2 results in a highly immunogenic phenotype. (United States)

    Decker, T; Schneller, F; Kronschnabl, M; Dechow, T; Lipford, G B; Wagner, H; Peschel, C


    CpG-oligodeoxynucleotides (CpG-ODN) have been shown to induce proliferation, cytokine production, and surface molecule regulation in normal and malignant human B cells. In the present study, we investigated the potential of CpG-ODN to induce functional high-affinity receptors in leukemic and normal B cells and the effects of costimulation with IL-2 on proliferation, cytokine secretion, and surface molecule regulation. Highly purified B cells from B-CLL patients and normal controls were stimulated with CpG-ODN with or without IL-2. Expression of CD25 was determined using FACS, and the presence of high-affinity IL-2 receptors was determined by scatchard analysis. Costimulatory effects of IL-2 and CpG-ODN were investigated using proliferation assays, ELISA (IL-6, TNF-alpha), and FACS analysis (CD80, CD86 expression). Reactivity of autologous and allogeneic T cells toward activated B-CLL cells was determined in mixed lymphocyte reactions and Interferon-gamma Elispot assays. The CpG-ODN DSP30 caused a significantly stronger induction of the IL-2 receptor alpha chain in malignant as compared with normal B cells (p = 0.03). This resulted in the expression of functional high-affinity IL-2 receptors in B-CLL cells, but fewer numbers of receptors with less affinity were expressed in normal B cells. Although addition of IL-2 to CpG-ODN-stimulated cells augmented proliferation in both normal B cells and B-CLL cells, no costimulatory effect on cytokine production or surface molecule expression could be observed in normal B cells. In contrast, TNF-alpha and IL-6 production was increased in B-CLL cells, and the expression of CD80 and CD86 was further enhanced when IL-2 was used as a costimulus. Autologous and allogeneic immune recognition of B-CLL cells stimulated with CpG-ODN and IL-2 was increased compared with B-CLL cells stimulated with CpG-ODN alone. Stimulation of B-CLL cells with CpG-ODN and IL-2 might be an attractive strategy for potential immunotherapies for B

  15. High-Affinity Methanotrophy Informed by Genome-Wide Analysis of Upland Soil Cluster Alpha (USCα) from Axel Heiberg Island, Canadian High Arctic (United States)

    Rusley, C.; Onstott, T. C.; Lau, M.


    Methane (CH4) is a potent greenhouse gas whose proper budgeting is vital to climate predictions. Recent studies have identified upland Arctic mineral cryosols as consistent CH4 sinks, drawing CH4 from both the atmosphere and underlying anaerobic soil layers. Global atmospheric CH4 uptake is proposed to be mediated by high-affinity methanotrophs based on the detection of the marker gene pmoA (particulate methane monooxygenase beta subunit). However, a lack of pure cultures and scarcity of genomic information have hindered our understanding of their metabolic capabilities and versatility. Together with the missing genetic linkage between its pmoA and 16S ribosomal RNA (rRNA) gene, the factors that control the distribution and magnitude of high-affinity methanotrophy in the Arctic permafrost-affected region have remained elusive. Using 21 metagenomic datasets of surface soils obtained from long-term core incubation experiments,1 this bioinformatics study aimed to reconstruct the draft genome of the Upland Soil Cluster α-proteobacteria (USCα), the high-affinity methanotroph previously detected in the samples,2 and to determine its phylogeny and metabolic requirements. We obtained a genome bin containing the high-affinity form of the USCα-like pmoA gene. The 3.03 Mbp assembly is 91.6% complete with a unique set of single-copy marker genes. The 16S rRNA gene fragment of USCα belongs to the α-proteobacterial family Beijerinckiaceae. Genome annotation indicates possible formaldehyde oxidation via tetrahydromethanopterin-linked C1 transfer pathways, acetate utilization, carbon fixation via the Calvin-Benson-Bassham cycle, and glycogen production. Notably, the key enzymes for formaldehyde assimilation via the serine and ribulose monophosphate pathways are missing. The presence of genes encoding nitrate reductase and hemoglobin suggests adaptation to low O2 under water-logged conditions. Since USCα has versatile carbon metabolisms, it may not be an obligate methanotroph

  16. A soluble form of the high affinity IgE receptor, Fc-epsilon-RI, circulates in human serum.

    Directory of Open Access Journals (Sweden)

    Eleonora Dehlink

    Full Text Available Soluble IgE receptors are potential in vivo modulators of IgE-mediated immune responses and are thus important for our basic understanding of allergic responses. We here characterize a novel soluble version of the IgE-binding alpha-chain of Fc-epsilon-RI (sFcεRI, the high affinity receptor for IgE. sFcεRI immunoprecipitates as a protein of ∼40 kDa and contains an intact IgE-binding site. In human serum, sFcεRI is found as a soluble free IgE receptor as well as a complex with IgE. Using a newly established ELISA, we show that serum sFcεRI levels correlate with serum IgE in patients with elevated IgE. We also show that serum of individuals with normal IgE levels can be found to contain high levels of sFcεRI. After IgE-antigen-mediated crosslinking of surface FcεRI, we detect sFcεRI in the exosome-depleted, soluble fraction of cell culture supernatants. We further show that sFcεRI can block binding of IgE to FcεRI expressed at the cell surface. In summary, we here describe the alpha-chain of FcεRI as a circulating soluble IgE receptor isoform in human serum.

  17. High affinity γPNA sandwich hybridization assay for rapid detection of short nucleic acid targets with single mismatch discrimination. (United States)

    Goldman, Johnathan M; Zhang, Li Ang; Manna, Arunava; Armitage, Bruce A; Ly, Danith H; Schneider, James W


    Hybridization analysis of short DNA and RNA targets presents many challenges for detection. The commonly employed sandwich hybridization approach cannot be implemented for these short targets due to insufficient probe-target binding strengths for unmodified DNA probes. Here, we present a method capable of rapid and stable sandwich hybridization detection for 22 nucleotide DNA and RNA targets. Stable hybridization is achieved using an n-alkylated, polyethylene glycol γ-carbon modified peptide nucleic acid (γPNA) amphiphile. The γPNA's exceptionally high affinity enables stable hybridization of a second DNA-based probe to the remaining bases of the short target. Upon hybridization of both probes, an electrophoretic mobility shift is measured via interaction of the n-alkane modification on the γPNA with capillary electrophoresis running buffer containing nonionic surfactant micelles. We find that sandwich hybridization of both probes is stable under multiple binding configurations and demonstrate single base mismatch discrimination. The binding strength of both probes is also stabilized via coaxial stacking on adjacent hybridization to targets. We conclude with a discussion on the implementation of the proposed sandwich hybridization assay as a high-throughput microRNA detection method.

  18. High-Affinity Interaction of the K-Ras4B Hypervariable Region with the Ras Active Site (United States)

    Chavan, Tanmay S.; Jang, Hyunbum; Khavrutskii, Lyuba; Abraham, Sherwin J.; Banerjee, Avik; Freed, Benjamin C.; Johannessen, Liv; Tarasov, Sergey G.; Gaponenko, Vadim; Nussinov, Ruth; Tarasova, Nadya I.


    Ras proteins are small GTPases that act as signal transducers between cell surface receptors and several intracellular signaling cascades. They contain highly homologous catalytic domains and flexible C-terminal hypervariable regions (HVRs) that differ across Ras isoforms. KRAS is among the most frequently mutated oncogenes in human tumors. Surprisingly, we found that the C-terminal HVR of K-Ras4B, thought to minimally impact the catalytic domain, directly interacts with the active site of the protein. The interaction is almost 100-fold tighter with the GDP-bound than the GTP-bound protein. HVR binding interferes with Ras-Raf interaction, modulates binding to phospholipids, and slightly slows down nucleotide exchange. The data indicate that contrary to previously suggested models of K-Ras4B signaling, HVR plays essential roles in regulation of signaling. High affinity binding of short peptide analogs of HVR to K-Ras active site suggests that targeting this surface with inhibitory synthetic molecules for the therapy of KRAS-dependent tumors is feasible. PMID:26682817

  19. ZrFsy1, a high-affinity fructose/H+ symporter from fructophilic yeast Zygosaccharomyces rouxii.

    Directory of Open Access Journals (Sweden)

    Maria José Leandro

    Full Text Available Zygosaccharomyces rouxii is a fructophilic yeast than can grow at very high sugar concentrations. We have identified an ORF encoding a putative fructose/H(+ symporter in the Z. rouxii CBS 732 genome database. Heterologous expression of this ORF in a S. cerevisiae strain lacking its own hexose transporters (hxt-null and subsequent kinetic characterization of its sugar transport activity showed it is a high-affinity low-capacity fructose/H(+ symporter, with Km 0.45 ± 0.07 mM and Vmax 0.57 ± 0.02 mmol h(-1 (gdw(-1. We named it ZrFsy1. This protein also weakly transports xylitol and sorbose, but not glucose or other hexoses. The expression of ZrFSY1 in Z. rouxii is higher when the cells are cultivated at extremely low fructose concentrations (<0.2% and on non-fermentable carbon sources such as mannitol and xylitol, where the cells have a prolonged lag phase, longer duplication times and change their microscopic morphology. A clear phenotype was determined for the first time for the deletion of a fructose/H(+ symporter in the genome where it occurs naturally. The effect of the deletion of ZrFSY1 in Z. rouxii cells is only evident when the cells are cultivated at very low fructose concentrations, when the ZrFsy1 fructose symporter is the main active fructose transporter system.

  20. Development of a new high-affinity human antibody with antitumor activity against solid and blood malignancies. (United States)

    Sioud, Mouldy; Westby, Phuong; Vasovic, Vlada; Fløisand, Yngvar; Peng, Qian


    mAbs have emerged as a promising strategy for the treatment of cancer. However, in several malignancies, no effective antitumor mAbs are yet available. Identifying therapeutic mAbs that recognize common tumor antigens could render the treatment widely applicable. Here, a human single-chain variable fragment (scFv) antibody library was sequentially affinity selected against a panel of human cancer cell lines and an antibody fragment (named MS5) that bound to solid and blood cancer cells was identified. The MS5 scFv was fused to the human IgG1 Fc domain to generate an antibody (MS5-Fc fusion) that induced antibody-dependent cellular cytotoxicity and phagocytosis of cancer cells by macrophages. In addition, the MS5-Fc antibody bound to primary leukemia cells and induced antibody-dependent cellular cytotoxicity. In the majority of analyzed cancer cells, the MS5-Fc antibody induced cell surface redistribution of the receptor complexes, but not internalization, thus maximizing the accessibility of the IgG1 Fc domain to immune effector cells. In vitro stability studies showed that the MS5-Fc antibody was stable after 6 d of incubation in human serum, retaining ∼60% of its initial intact form. After intravenous injections, the antibody localized into tumor tissues and inhibited the growth of 3 different human tumor xenografts (breast, lymphoma, and leukemia). These antitumor effects were associated with tumor infiltration by macrophages and NK cells. In the Ramos B-cell lymphoma xenograft model, the MS5-Fc antibody exhibited a comparable antitumor effect as rituximab, a chimeric anti-CD20 IgG1 mAb. These results indicate that human antibodies with pan-cancer abilities can be generated from phage display libraries, and that the engineered MS5-Fc antibody could be an attractive agent for further clinical investigation.-Sioud, M., Westby, P., Vasovic, V., Fløisand, Y., Peng, Q. Development of a new high-affinity human antibody with antitumor activity against solid and

  1. An Effective Approach for Clustering InhA Molecular Dynamics Trajectory Using Substrate-Binding Cavity Features.

    Directory of Open Access Journals (Sweden)

    Renata De Paris

    Full Text Available Protein receptor conformations, obtained from molecular dynamics (MD simulations, have become a promising treatment of its explicit flexibility in molecular docking experiments applied to drug discovery and development. However, incorporating the entire ensemble of MD conformations in docking experiments to screen large candidate compound libraries is currently an unfeasible task. Clustering algorithms have been widely used as a means to reduce such ensembles to a manageable size. Most studies investigate different algorithms using pairwise Root-Mean Square Deviation (RMSD values for all, or part of the MD conformations. Nevertheless, the RMSD only may not be the most appropriate gauge to cluster conformations when the target receptor has a plastic active site, since they are influenced by changes that occur on other parts of the structure. Hence, we have applied two partitioning methods (k-means and k-medoids and four agglomerative hierarchical methods (Complete linkage, Ward's, Unweighted Pair Group Method and Weighted Pair Group Method to analyze and compare the quality of partitions between a data set composed of properties from an enzyme receptor substrate-binding cavity and two data sets created using different RMSD approaches. Ensembles of representative MD conformations were generated by selecting a medoid of each group from all partitions analyzed. We investigated the performance of our new method for evaluating binding conformation of drug candidates to the InhA enzyme, which were performed by cross-docking experiments between a 20 ns MD trajectory and 20 different ligands. Statistical analyses showed that the novel ensemble, which is represented by only 0.48% of the MD conformations, was able to reproduce 75% of all dynamic behaviors within the binding cavity for the docking experiments performed. Moreover, this new approach not only outperforms the other two RMSD-clustering solutions, but it also shows to be a promising strategy to

  2. Rational Modulation of the Induced-Fit Conformational Change for Slow-Onset Inhibition in Mycobacterium tuberculosis InhA. (United States)

    Lai, Cheng-Tsung; Li, Huei-Jiun; Yu, Weixuan; Shah, Sonam; Bommineni, Gopal R; Perrone, Victoria; Garcia-Diaz, Miguel; Tonge, Peter J; Simmerling, Carlos


    Slow-onset enzyme inhibitors are the subject of considerable interest as an approach to increasing the potency of pharmaceutical compounds by extending the residence time of the inhibitor on the target (the lifetime of the drug-receptor complex). However, rational modulation of residence time presents significant challenges because it requires additional mechanistic insight, such as the nature of the transition state for postbinding isomerization. Our previous work, based on X-ray crystallography, enzyme kinetics, and molecular dynamics simulation, suggested that the slow step in inhibition of the Mycobacterium tuberculosis enoyl-ACP reductase InhA involves a change in the conformation of the substrate binding loop from an open state in the initial enzyme-inhibitor complex to a closed state in the final enzyme-inhibitor complex. Here, we use multidimensional free energy landscapes for loop isomerization to obtain a computational model for the transition state. The results suggest that slow-onset inhibitors crowd key side chains on helices that slide past each other during isomerization, resulting in a steric clash. The landscapes become significantly flatter when residues involved in the steric clash are replaced with alanine. Importantly, this lower barrier can be increased by rational inhibitor redesign to restore the steric clash. Crystallographic studies and enzyme kinetics confirm the predicted effects on loop structure and flexibility, as well as inhibitor residence time. These loss and regain of function studies validate our mechanistic hypothesis for interactions controlling substrate binding loop isomerization, providing a platform for the future design of inhibitors with longer residence times and better in vivo potency. Similar opportunities for slow-onset inhibition via the same mechanism are identified in other pathogens.

  3. High affinity [3H]glibenclamide binding sites in rat neuronal and cardiac tissue: Localization and developmental characteristics

    International Nuclear Information System (INIS)

    Miller, J.A.; Velayo, N.L.; Dage, R.C.; Rampe, D.


    We examined the binding of the antidiabetic sulfonylurea [3H] glibenclamide to rat brain and heart membranes. High affinity binding was observed in adult rat forebrain (Kd = 137.3 pM, maximal binding site density = 91.8 fmol/mg of protein) and ventricle (Kd = 77.1 pM, maximal binding site density = 65.1 fmol/mg of protein). Binding site density increased approximately 250% in forebrain membranes during postnatal development but was constant in ventricular membranes. Quantitative autoradiography was used to examine the regional distribution of [3H] glibenclamide binding sites in sections from rat brain, spinal cord and heart. The greatest density of binding in adult brain was found in the substantia nigra and globus pallidus, whereas the other areas displayed heterogenous binding. In agreement with the membrane binding studies, 1-day-old rat brain had significantly fewer [3H]glibenclamide binding sites than adult brain. Additionally, the pattern of distribution of these sites was qualitatively different from that of the adult. In adult rat spinal cord, moderate binding densities were observed in spinal cord gray and displayed a rostral to caudal gradient. In adult rat heart, moderate binding densities were observed and the sites were distributed homogeneously. In conclusion, significant development of [3H]glibenclamide binding sites was seen in the brain but not the heart during postnatal maturation. Furthermore, a heterogeneous distribution of binding sites was observed in both the brain and spinal cord of adult rats

  4. A novel high-affinity sucrose transporter is required for virulence of the plant pathogen Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Ramon Wahl


    Full Text Available Plant pathogenic fungi cause massive yield losses and affect both quality and safety of food and feed produced from infected plants. The main objective of plant pathogenic fungi is to get access to the organic carbon sources of their carbon-autotrophic hosts. However, the chemical nature of the carbon source(s and the mode of uptake are largely unknown. Here, we present a novel, plasma membrane-localized sucrose transporter (Srt1 from the corn smut fungus Ustilago maydis and its characterization as a fungal virulence factor. Srt1 has an unusually high substrate affinity, is absolutely sucrose specific, and allows the direct utilization of sucrose at the plant/fungal interface without extracellular hydrolysis and, thus, without the production of extracellular monosaccharides known to elicit plant immune responses. srt1 is expressed exclusively during infection, and its deletion strongly reduces fungal virulence. This emphasizes the central role of this protein both for efficient carbon supply and for avoidance of apoplastic signals potentially recognized by the host.

  5. The RCK1 high-affinity Ca2+ sensor confers carbon monoxide sensitivity to Slo1 BK channels. (United States)

    Hou, Shangwei; Xu, Rong; Heinemann, Stefan H; Hoshi, Toshinori


    Carbon monoxide (CO) is a lethal gas, but it is also increasingly recognized as a physiological signaling molecule capable of regulating a variety of proteins. Among them, large-conductance Ca(2+)- and voltage-gated K(+) (Slo1 BK) channels, important in vasodilation and neuronal firing, have been suggested to be directly stimulated by CO. However, the molecular mechanism of the stimulatory action of CO on the Slo1 BK channel has not been clearly elucidated. We report here that CO reliably and repeatedly activates Slo1 BK channels in excised membrane patches in the absence of Ca(2+) in a voltage-sensor-independent manner. The stimulatory action of CO on the Slo1 BK channel requires an aspartic acid and two histidine residues located in the cytoplasmic RCK1 domain, and the effect persists under the conditions known to inhibit the conventional interaction between CO and heme in other proteins. We propose that CO acts as a partial agonist for the high-affinity divalent cation sensor in the RCK1 domain of the Slo1 BK channel.

  6. VNARs: An Ancient and Unique Repertoire of Molecules That Deliver Small, Soluble, Stable and High Affinity Binders of Proteins

    Directory of Open Access Journals (Sweden)

    Caroline Barelle


    Full Text Available At 420 million years, the variable domain of New Antigen Receptors or VNARs are undoubtedly the oldest (and smallest antigen binding single domains identified in the vertebrate kingdom. Their role as an integral part of the adaptive immune system of sharks has been well established and has served to provide a greater understanding of the evolution of humoral immunity; their cellular components and processes as well as the underlying genetic organization and molecular control mechanisms. Intriguingly, unlike the variable domain of the camelid heavy chain antibodies or VHH, VNARs do not conform to all of the characteristic properties of classical antibodies with an ancestral origin that clearly distinguishes them from true immunoglobulin antibodies. However, this uniqueness of their origin only adds to their potential as next generation therapeutic biologics with their structural and functional attributes and commercial freedom all enhancing their profile and current success. In fact their small size, remarkable stability, molecular flexibility and solubility, together with their high affinity and selectivity for target, all reinforce the potential of these domains as drug candidates. The purpose of this review is to provide an overview of the existing basic biology of these unique domains, to highlight the drug-like properties of VNARs and describe current progress in their journey towards the clinic.

  7. A Dualistic Conformational Response to Substrate Binding in the Human Serotonin Transporter Reveals a High Affinity State for Serotonin* (United States)

    Bjerregaard, Henriette; Severinsen, Kasper; Said, Saida; Wiborg, Ove; Sinning, Steffen


    Serotonergic neurotransmission is modulated by the membrane-embedded serotonin transporter (SERT). SERT mediates the reuptake of serotonin into the presynaptic neurons. Conformational changes in SERT occur upon binding of ions and substrate and are crucial for translocation of serotonin across the membrane. Our understanding of these conformational changes is mainly based on crystal structures of a bacterial homolog in various conformations, derived homology models of eukaryotic neurotransmitter transporters, and substituted cysteine accessibility method of SERT. However, the dynamic changes that occur in the human SERT upon binding of ions, the translocation of substrate, and the role of cholesterol in this interplay are not fully elucidated. Here we show that serotonin induces a dualistic conformational response in SERT. We exploited the substituted cysteine scanning method under conditions that were sensitized to detect a more outward-facing conformation of SERT. We found a novel high affinity outward-facing conformational state of the human SERT induced by serotonin. The ionic requirements for this new conformational response to serotonin mirror the ionic requirements for translocation. Furthermore, we found that membrane cholesterol plays a role in the dualistic conformational response in SERT induced by serotonin. Our results indicate the existence of a subpopulation of SERT responding differently to serotonin binding than hitherto believed and that membrane cholesterol plays a role in this subpopulation of SERT. PMID:25614630

  8. High-affinity human leucocyte antigen class I binding variola-derived peptides induce CD4(+) T cell responses more than 30 years post-vaccinia virus vaccination

    DEFF Research Database (Denmark)

    Wang, M.; Tang, Sheila Tuyet; Lund, Ole


    Interferon-gamma secreting T lymphocytes against pox virus-derived synthetic 9-mer peptides were tested by enzyme-linked immunospot in peripheral blood of individuals vaccinated with vaccinia virus more than 30 years ago. The peptides were characterized biochemically as high-affinity human leucoc...

  9. High-Affinity Sites Form an Interaction Network to Facilitate Spreading of the MSL Complex across the X Chromosome in Drosophila

    NARCIS (Netherlands)

    Ramírez, Fidel; Lingg, Thomas; Toscano, Sarah; Lam, Kin Chung; Georgiev, Plamen; Chung, Ho-Ryun; Lajoie, Bryan R; de Wit, Elzo; Zhan, Ye; de Laat, Wouter; Dekker, Job; Manke, Thomas; Akhtar, Asifa


    Dosage compensation mechanisms provide a paradigm to study the contribution of chromosomal conformation toward targeting and spreading of epigenetic regulators over a specific chromosome. By using Hi-C and 4C analyses, we show that high-affinity sites (HAS), landing platforms of the male-specific

  10. Isolation and partial characterization of gypsy moth BTR-270, an anionic brush border membrane glycoconjugate that binds Bacillus thuringiensis Cry1A toxins with high affinity (United States)

    Algimantas P. Valaitis; Jeremy L. Jenkins; Mi Kyong Lee; Donald H. Dean; Karen J. Garner


    BTR-270, a gypsy moth (Lymantria dispar) brush border membrane molecule that binds Bacillus thuringiensis (Bt) Cry1A toxins with high affinity, was purified by preparative gel electrophoresis. Rabbit antibodies specific for the Bt toxin-binding molecule were raised. Attempts to label BTR-270 by protein-directed techniques were...

  11. High- and low-affinity binding of S-citalopram to the human serotonin transporter mutated at 20 putatively important amino acid positions

    DEFF Research Database (Denmark)

    Plenge, Per; Wiborg, Ove


    of presumed importance. Binding of S-citalopram, both to the high-affinity-binding site and to the allosteric binding site, was measured in these mutants with the purpose of investigating the connection between the two binding sites. The amino acid substitutions did not introduce large changes in the two...

  12. Contrast-enhanced CT with a High-Affinity Cationic Contrast Agent for Imaging ex Vivo Bovine, Intact ex Vivo Rabbit, and in Vivo Rabbit Cartilage


    Stewart, Rachel C.; Bansal, Prashant N.; Entezari, Vahid; Lusic, Hrvoje; Nazarian, Rosalynn M.; Snyder, Brian D.; Grinstaff, Mark W.


    The high affinity of a cationic iodinated contrast agent for cartilage provides better tissue visualization, easier segmentation, higher contrast-to-noise ratios, and longer usable imaging windows and requires a lower dose of injected contrast agent compared with an anionic contrast agent.

  13. Soil carbon content and relative abundance of high affinity H2-oxidizing bacteria predict atmospheric H2 soil uptake activity better than soil microbial community composition

    NARCIS (Netherlands)

    Khdhiri, Mondher; Hesse, Laura; Popa, Maria Elena; Quiza, Liliana; Lalonde, Isabelle; Meredith, Laura K.; Röckmann, Thomas; Constant, Philippe


    Soil-atmosphere exchange of H2 is controlled by gas diffusion and the microbial production and oxidation activities in soil. Among these parameters, the H2 oxidation activity catalyzed by soil microorganisms harboring high affinity hydrogenase is the most difficult variable to parameterize because

  14. Amino propynyl benzoic acid building block in rigid spacers of divalent ligands binding to the Syk SH2 domains with equally high affinity as the natural ligand

    NARCIS (Netherlands)

    Dekker, Frank J; de Mol, Nico J; Fischer, Marcel J E; Liskamp, Rob M J; Dekker, Frank


    The construction of rigid spacers composed of amino propynyl benzoic acid building blocks is described. These spacers were used to link two phosphopeptide ligand sites towards obtaining divalent ligands with a high affinity for Syk tandem SH2 domains, which are important in signal transduction. The

  15. Report: Affinity Chromatography. (United States)

    Walters, Rodney R.


    Supports, affinity ligands, immobilization, elution methods, and a number of applications are among the topics considered in this discussion of affinity chromatography. An outline of the basic principles of affinity chromatography is included. (JN)


    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani


    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  17. Role of H2O2 on the kinetics of low-affinity high-capacity Na+-dependent alanine transport in SHR proximal tubular epithelial cells

    International Nuclear Information System (INIS)

    Pinto, Vanda; Pinho, Maria Joao; Jose, Pedro A.; Soares-da-Silva, Patricio


    Research highlights: → H 2 O 2 in excess is required for the presence of a low-affinity high-capacity component for the Na + -dependent [ 14 C]-L-alanine uptake in SHR PTE cells only. → It is suggested that Na + binding in renal ASCT2 may be regulated by ROS in SHR PTE cells. -- Abstract: The presence of high and low sodium affinity states for the Na + -dependent [ 14 C]-L-alanine uptake in immortalized renal proximal tubular epithelial (PTE) cells was previously reported (Am. J. Physiol. 293 (2007) R538-R547). This study evaluated the role of H 2 O 2 on the Na + -dependent [ 14 C]-L-alanine uptake of ASCT2 in immortalized renal PTE cells from Wistar Kyoto rat (WKY) and spontaneously hypertensive rat (SHR). Na + dependence of [ 14 C]-L-alanine uptake was investigated replacing NaCl with an equimolar concentration of choline chloride in vehicle- and apocynin-treated cells. Na + removal from the uptake solution abolished transport activity in both WKY and SHR PTE cells. Decreases in H 2 O 2 levels in the extracellular medium significantly reduced Na + -K m and V max values of the low-affinity high-capacity component in SHR PTE cells, with no effect on the high-affinity low-capacity state of the Na + -dependent [ 14 C]-L-alanine uptake. After removal of apocynin from the culture medium, H 2 O 2 levels returned to basal values within 1 to 3 h in both WKY and SHR PTE cells and these were found stable for the next 24 h. Under these experimental conditions, the Na + -K m and V max of the high-affinity low-capacity state were unaffected and the low-affinity high-capacity component remained significantly decreased 1 day but not 4 days after apocynin removal. In conclusion, H 2 O 2 in excess is required for the presence of a low-affinity high-capacity component for the Na + -dependent [ 14 C]-L-alanine uptake in SHR PTE cells only. It is suggested that Na + binding in renal ASCT2 may be regulated by ROS in SHR PTE cells.

  18. Alternative affinity tools: more attractive than antibodies?

    NARCIS (Netherlands)

    Ruigrok, V.J.B.; Levisson, M.; Eppink, M.H.M.; Smidt, H.; Oost, van der J.


    Antibodies are the most successful affinity tools used today, in both fundamental and applied research (diagnostics, purification and therapeutics). Nonetheless, antibodies do have their limitations, including high production costs and low stability. Alternative affinity tools based on nucleic acids

  19. A mix-and-read drop-based in vitro two-hybrid method for screening high-affinity peptide binders (United States)

    Cui, Naiwen; Zhang, Huidan; Schneider, Nils; Tao, Ye; Asahara, Haruichi; Sun, Zhiyi; Cai, Yamei; Koehler, Stephan A.; de Greef, Tom F. A.; Abbaspourrad, Alireza; Weitz, David A.; Chong, Shaorong


    Drop-based microfluidics have recently become a novel tool by providing a stable linkage between phenotype and genotype for high throughput screening. However, use of drop-based microfluidics for screening high-affinity peptide binders has not been demonstrated due to the lack of a sensitive functional assay that can detect single DNA molecules in drops. To address this sensitivity issue, we introduced in vitro two-hybrid system (IVT2H) into microfluidic drops and developed a streamlined mix-and-read drop-IVT2H method to screen a random DNA library. Drop-IVT2H was based on the correlation between the binding affinity of two interacting protein domains and transcriptional activation of a fluorescent reporter. A DNA library encoding potential peptide binders was encapsulated with IVT2H such that single DNA molecules were distributed in individual drops. We validated drop-IVT2H by screening a three-random-residue library derived from a high-affinity MDM2 inhibitor PMI. The current drop-IVT2H platform is ideally suited for affinity screening of small-to-medium-sized libraries (103–106). It can obtain hits within a single day while consuming minimal amounts of reagents. Drop-IVT2H simplifies and accelerates the drop-based microfluidics workflow for screening random DNA libraries, and represents a novel alternative method for protein engineering and in vitro directed protein evolution. PMID:26940078

  20. Mutational analysis of the high-affinity zinc binding site validates a refined human dopamine transporter homology model.

    Directory of Open Access Journals (Sweden)

    Thomas Stockner

    Full Text Available The high-resolution crystal structure of the leucine transporter (LeuT is frequently used as a template for homology models of the dopamine transporter (DAT. Although similar in structure, DAT differs considerably from LeuT in a number of ways: (i when compared to LeuT, DAT has very long intracellular amino and carboxyl termini; (ii LeuT and DAT share a rather low overall sequence identity (22% and (iii the extracellular loop 2 (EL2 of DAT is substantially longer than that of LeuT. Extracellular zinc binds to DAT and restricts the transporter's movement through the conformational cycle, thereby resulting in a decrease in substrate uptake. Residue H293 in EL2 praticipates in zinc binding and must be modelled correctly to allow for a full understanding of its effects. We exploited the high-affinity zinc binding site endogenously present in DAT to create a model of the complete transmemberane domain of DAT. The zinc binding site provided a DAT-specific molecular ruler for calibration of the model. Our DAT model places EL2 at the transporter lipid interface in the vicinity of the zinc binding site. Based on the model, D206 was predicted to represent a fourth co-ordinating residue, in addition to the three previously described zinc binding residues H193, H375 and E396. This prediction was confirmed by mutagenesis: substitution of D206 by lysine and cysteine affected the inhibitory potency of zinc and the maximum inhibition exerted by zinc, respectively. Conversely, the structural changes observed in the model allowed for rationalizing the zinc-dependent regulation of DAT: upon binding, zinc stabilizes the outward-facing state, because its first coordination shell can only be completed in this conformation. Thus, the model provides a validated solution to the long extracellular loop and may be useful to address other aspects of the transport cycle.

  1. Entrapment of alpha1-acid glycoprotein in high-performance affinity columns for drug-protein binding studies. (United States)

    Bi, Cong; Jackson, Abby; Vargas-Badilla, John; Li, Rong; Rada, Giana; Anguizola, Jeanethe; Pfaunmiller, Erika; Hage, David S


    A slurry-based method was developed for the entrapment of alpha1-acid glycoprotein (AGP) for use in high-performance affinity chromatography to study drug interactions with this serum protein. Entrapment was achieved based on the physical containment of AGP in hydrazide-activated porous silica supports and by using mildly oxidized glycogen as a capping agent. The conditions needed for this process were examined and optimized. When this type of AGP column was used in binding studies, the association equilibrium constant (Ka) measured by frontal analysis at pH 7.4 and 37°C for carbamazepine with AGP was found to be 1.0 (±0.5)×10(5)M(-1), which agreed with a previously reported value of 1.0 (±0.1)×10(5)M(-1). Binding studies based on zonal elution were conducted for several other drugs with such columns, giving equilibrium constants that were consistent with literature values. An entrapped AGP column was also used in combination with a column containing entrapped HSA in a screening assay format to compare the binding of various drugs to AGP and HSA. These results also agreed with previous data that have been reported in literature for both of these proteins. The same entrapment method could be extended to other proteins and to the investigation of additional types of drug-protein interactions. Potential applications include the rapid quantitative analysis of biological interactions and the high-throughput screening of drug candidates for their binding to a given protein. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. pH, Lactate, and Hypoxia: Reciprocity in Regulating High-Affinity Monocarboxylate Transporter Expression in Glioblastoma

    Directory of Open Access Journals (Sweden)

    James P. Caruso


    Full Text Available Highly malignant brain tumors harbor the aberrant propensity for aerobic glycolysis, the excessive conversion of glucose to lactic acid even in the presence of ample tissue oxygen. Lactic acid is rapidly effluxed to the tumor microenvironment via a group of plasma-membrane transporters denoted monocarboxylate transporters (MCTs to prevent “self-poisoning.” One isoform, MCT2, has the highest affinity for lactate and thus should have the ability to respond to microenvironment conditions such as hypoxia, lactate, and pH to help maintain high glycolytic flux in the tumor. Yet, MCT2 is considered to not respond to hypoxia, which is counterintuitive. Its response to tumor lactate has not been reported. In this report, we experimentally identify the transcription initiation site/s for MCT2 in astrocytes (normal and glioma (tumor. We then use a BACmid library to isolate a 4.2-kbp MCT2 promoter-exon I region and examine promoter response to glycolysis-mediated stimuli in glioma cells. Reporter analysis of nested-promoter constructs indicated response of MCT2 to hypoxia, pH, lactate, and glucose, the major physiological “players” that facilitate a tumor's growth and proliferation. Immunoblot analysis of native MCT2 expression under altered pH and hypoxia reflected the reporter data. The pH-mediated gene-regulation studies we describe are the first to record H+-based reporter studies for any mammalian system and demonstrate the exquisite response of the MCT2 gene to minute changes in tumor pH. Identical promoter usage also provides the first evidence of astrocytes harnessing the same gene regulatory regions to facilitate astrocyte-neuron lactate shuttling, a metabolic feature of normal brain.

  3. Hemoglobin affinity in Andean rodents

    Directory of Open Access Journals (Sweden)



    Full Text Available Blood hemoglobin oxygen affinity (P50 was measured in three Andean species and in the laboratory rat (control, all raised near sea level. Chinchilla lanigera (Molina, 1792 has an altitudinal habitat range from low Andean slopes up to 3000 m., while Chinchilla brevicaudata (Waterhouse, 1848 has an altitudinal range from 3000 to 5000 m. The laboratory type guinea pig, wild type guinea pig (Cavia porcellus, (Waterhouse, 1748, and laboratory rat (Rattus norvegicus were also raised at sea level. The Andean species had high hemoglobin oxygen affinities (low P50 compared with the rat. Chinchilla brevicaudata had a higher affinity than Chinchilla lanigera. The wild type guinea pig had a higher affinity than the laboratory type. As has been shown in other species, this is another example of an inverse correlation between the altitude level and the P50 values. This is the first hemoglobin oxygen affinity study in Chinchilla brevicaudata.

  4. Encoded library technology as a source of hits for the discovery and lead optimization of a potent and selective class of bactericidal direct inhibitors of Mycobacterium tuberculosis InhA. (United States)

    Encinas, Lourdes; O'Keefe, Heather; Neu, Margarete; Remuiñán, Modesto J; Patel, Amish M; Guardia, Ana; Davie, Christopher P; Pérez-Macías, Natalia; Yang, Hongfang; Convery, Maire A; Messer, Jeff A; Pérez-Herrán, Esther; Centrella, Paolo A; Alvarez-Gómez, Daniel; Clark, Matthew A; Huss, Sophie; O'Donovan, Gary K; Ortega-Muro, Fátima; McDowell, William; Castañeda, Pablo; Arico-Muendel, Christopher C; Pajk, Stane; Rullás, Joaquín; Angulo-Barturen, Iñigo; Alvarez-Ruíz, Emilio; Mendoza-Losana, Alfonso; Ballell Pages, Lluís; Castro-Pichel, Julia; Evindar, Ghotas


    Tuberculosis (TB) is one of the world's oldest and deadliest diseases, killing a person every 20 s. InhA, the enoyl-ACP reductase from Mycobacterium tuberculosis, is the target of the frontline antitubercular drug isoniazid (INH). Compounds that directly target InhA and do not require activation by mycobacterial catalase peroxidase KatG are promising candidates for treating infections caused by INH resistant strains. The application of the encoded library technology (ELT) to the discovery of direct InhA inhibitors yielded compound 7 endowed with good enzymatic potency but with low antitubercular potency. This work reports the hit identification, the selected strategy for potency optimization, the structure-activity relationships of a hundred analogues synthesized, and the results of the in vivo efficacy studies performed with the lead compound 65.

  5. The ketamine analogue methoxetamine and 3- and 4-methoxy analogues of phencyclidine are high affinity and selective ligands for the glutamate NMDA receptor.

    Directory of Open Access Journals (Sweden)

    Bryan L Roth

    Full Text Available In this paper we determined the pharmacological profiles of novel ketamine and phencyclidine analogues currently used as 'designer drugs' and compared them to the parent substances via the resources of the National Institute of Mental Health Psychoactive Drug Screening Program. The ketamine analogues methoxetamine ((RS-2-(ethylamino-2-(3-methoxyphenylcyclohexanone and 3-MeO-PCE (N-ethyl-1-(3-methoxyphenylcyclohexanamine and the 3- and 4-methoxy analogues of phencyclidine, (1-[1-(3-methoxyphenylcyclohexyl]piperidine and 1-[1-(4-methoxyphenylcyclohexyl]piperidine, were all high affinity ligands for the PCP-site on the glutamate NMDA receptor. In addition methoxetamine and PCP and its analogues displayed appreciable affinities for the serotonin transporter, whilst the PCP analogues exhibited high affinities for sigma receptors. Antagonism of the NMDA receptor is thought to be the key pharmacological feature underlying the actions of dissociative anaesthetics. The novel ketamine and PCP analogues had significant affinities for the NMDA receptor in radioligand binding assays, which may explain their psychotomimetic effects in human users. Additional actions on other targets could be important for delineating side-effects.

  6. High-affinity, noninhibitory pathogenic C1 domain antibodies are present in patients with hemophilia A and inhibitors (United States)

    Batsuli, Glaivy; Deng, Wei; Healey, John F.; Parker, Ernest T.; Baldwin, W. Hunter; Cox, Courtney; Nguyen, Brenda; Kahle, Joerg; Königs, Christoph; Li, Renhao; Lollar, Pete


    Inhibitor formation in hemophilia A is the most feared treatment-related complication of factor VIII (fVIII) therapy. Most inhibitor patients with hemophilia A develop antibodies against the fVIII A2 and C2 domains. Recent evidence demonstrates that the C1 domain contributes to the inhibitor response. Inhibitory anti-C1 monoclonal antibodies (mAbs) have been identified that bind to putative phospholipid and von Willebrand factor (VWF) binding epitopes and block endocytosis of fVIII by antigen presenting cells. We now demonstrate by competitive enzyme-linked immunosorbent assay and hydrogen-deuterium exchange mass spectrometry that 7 of 9 anti-human C1 mAbs tested recognize an epitope distinct from the C1 phospholipid binding site. These mAbs, designated group A, display high binding affinities for fVIII, weakly inhibit fVIII procoagulant activity, poorly inhibit fVIII binding to phospholipid, and exhibit heterogeneity with respect to blocking fVIII binding to VWF. Another mAb, designated group B, inhibits fVIII procoagulant activity, fVIII binding to VWF and phospholipid, fVIIIa incorporation into the intrinsic Xase complex, thrombin generation in plasma, and fVIII uptake by dendritic cells. Group A and B epitopes are distinct from the epitope recognized by the canonical, human-derived inhibitory anti-C1 mAb, KM33, whose epitope overlaps both groups A and B. Antibodies recognizing group A and B epitopes are present in inhibitor plasmas from patients with hemophilia A. Additionally, group A and B mAbs increase fVIII clearance and are pathogenic in a hemophilia A mouse tail snip bleeding model. Group A anti-C1 mAbs represent the first identification of pathogenic, weakly inhibitory antibodies that increase fVIII clearance. PMID:27381905

  7. High affinity anti-TIM-3 and anti-KIR monoclonal antibodies cloned from healthy human individuals.

    Directory of Open Access Journals (Sweden)

    Stefan Ryser

    Full Text Available We report here the cloning of native high affinity anti-TIM-3 and anti-KIR IgG monoclonal antibodies (mAbs from peripheral blood mononuclear cells (PBMC of healthy human donors. The cells that express these mAbs are rare, present at a frequency of less than one per 105 memory B-cells. Using our proprietary multiplexed screening and cloning technology CellSpot™ we assessed the presence of memory B-cells reactive to foreign and endogenous disease-associated antigens within the same individual. When comparing the frequencies of antigen-specific memory B-cells analyzed in over 20 screening campaigns, we found a strong correlation of the presence of anti-TIM-3 memory B-cells with memory B-cells expressing mAbs against three disease-associated antigens: (i bacterial DNABII proteins that are a marker for Gram negative and Gram positive bacterial infections, (ii hemagglutinin (HA of influenza virus and (iii the extracellular domain of anaplastic lymphoma kinase (ALK. One of the native anti-KIR mAbs has similar characteristics as lirilumab, an anti-KIR mAb derived from immunization of humanized transgenic mice that is in ongoing clinical trials. It is interesting to speculate that these native anti-TIM-3 and anti-KIR antibodies may function as natural regulatory antibodies, analogous to the pharmacological use in cancer treatment of engineered antibodies against the same targets. Further characterization studies are needed to define the mechanisms through which these native antibodies may function in healthy and disease conditions.

  8. How does pressure overload cause cardiac hypertrophy and dysfunction? High-ouabain affinity cardiac Na+ pumps are crucial. (United States)

    Blaustein, Mordecai P


    Left ventricular hypertrophy is frequently observed in hypertensive patients and is believed to be due to the pressure overload and cardiomyocyte stretch. Three recent reports on mice with genetically engineered Na + pumps, however, have demonstrated that cardiac ouabain-sensitive α 2 -Na + pumps play a key role in the pathogenesis of transaortic constriction-induced hypertrophy. Hypertrophy was delayed/attenuated in mice with mutant, ouabain-resistant α 2 -Na + pumps and in mice with cardiac-selective knockout or transgenic overexpression of α 2 -Na + pumps. The latter, seemingly paradoxical, findings can be explained by comparing the numbers of available (ouabain-free) high-affinity (α 2 ) ouabain-binding sites in wild-type, knockout, and transgenic hearts. Conversely, hypertrophy was accelerated in α 2 -ouabain-resistant (R) mice in which the normally ouabain-resistant α 1 -Na + pumps were mutated to an ouabain-sensitive (S) form (α 1 S/S α 2 R/R or "SWAP" vs. wild-type or α 1 R/R α 2 S/S mice). Furthermore, transaortic constriction-induced hypertrophy in SWAP mice was prevented/reversed by immunoneutralizing circulating endogenous ouabain (EO). These findings show that EO and its receptor, ouabain-sensitive α 2 , are critical factors in pressure overload-induced cardiac hypertrophy. This complements reports linking elevated plasma EO to hypertension, cardiac hypertrophy, and failure in humans and elucidates the underappreciated role of the EO-Na + pump pathway in cardiovascular disease. Copyright © 2017 the American Physiological Society.

  9. Functional mapping and implications of substrate specificity of the yeast high-affinity leucine permease Bap2. (United States)

    Usami, Yuki; Uemura, Satsohi; Mochizuki, Takahiro; Morita, Asami; Shishido, Fumi; Inokuchi, Jin-ichi; Abe, Fumiyoshi


    Leucine is a major amino acid in nutrients and proteins and is also an important precursor of higher alcohols during brewing. In Saccharomyces cerevisiae, leucine uptake is mediated by multiple amino acid permeases, including the high-affinity leucine permease Bap2. Although BAP2 transcription has been extensively analyzed, the mechanisms by which a substrate is recognized and moves through the permease remain unknown. Recently, we determined 15 amino acid residues required for Tat2-mediated tryptophan import. Here we introduced homologous mutations into Bap2 amino acid residues and showed that 7 residues played a role in leucine import. Residues I109/G110/T111 and E305 were located within the putative α-helix break in TMD1 and TMD6, respectively, according to the structurally homologous Escherichia coli arginine/agmatine antiporter AdiC. Upon leucine binding, these α-helix breaks were assumed to mediate a conformational transition in Bap2 from an outward-open to a substrate-binding occluded state. Residues Y336 (TMD7) and Y181 (TMD3) were located near I109 and E305, respectively. Bap2-mediated leucine import was inhibited by some amino acids according to the following order of severity: phenylalanine, leucine>isoleucine>methionine, tyrosine>valine>tryptophan; histidine and asparagine had no effect. Moreover, this order of severity clearly coincided with the logP values (octanol-water partition coefficients) of all amino acids except tryptophan. This result suggests that the substrate partition efficiency to the buried Bap2 binding pocket is the primary determinant of substrate specificity rather than structural amino acid side chain recognition. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Changes in medium radioactivity and composition accompany high-affinity uptake of glutamate and aspartate by mouse brain slices

    International Nuclear Information System (INIS)

    Latzkovits, L.; Neidle, A.; Lajtha, A.


    In measurements of high affinity transport in tissue slices, the incubation medium is often treated as an ''infinitely large pool''. External substrate concentrations, even at the micromolar level, are assumed to be constant and metabolic interactions between tissue and medium are neglected. In the present report we describe experiments in which glutamic and aspartic acid uptake by mouse brain slices were studied using techniques that could test these assumptions. Cerebral hemispheres were cut into 0.1 mm sections and about 90 mg of tissue incubated in 10 ml of oxygenated medium. After 45 minutes of equilibration, radioactive substrates were added and the concentrations and specific activities of the amino acids and their metabolites in the medium were determined. During the first 10 min following substrate addition, rapid decreases in glutamic and aspartic acid concentrations in the medium were accompanied by large decreases in specific activity caused by the continuous release of these amino acids from the tissue. In addition, extensive conversion of both substrates to glutamine and the preferential accumulation of this metabolite, in the medium, was found. These results demonstrate that metabolism and release occur simultaneously with uptake during transport experiments in vitro and that these processes can take place in specific tissue compartments. It is therefore necessary to measure the tissue and medium concentration levels of amino acids along with their radioactivity in such experiments, since all three processes (transport, metabolism, and compartmentation) are interrelated in the clearance of amino acids from the incubation medium and probably from the extracellular spaces in vivo as well

  11. Human metabolites of synthetic cannabinoids JWH-018 and JWH-073 bind with high affinity and act as potent agonists at cannabinoid type-2 receptors

    International Nuclear Information System (INIS)

    Rajasekaran, Maheswari; Brents, Lisa K.; Franks, Lirit N.; Moran, Jeffery H.; Prather, Paul L.


    K2 or Spice is an emerging drug of abuse that contains synthetic cannabinoids, including JWH-018 and JWH-073. Recent reports indicate that monohydroxylated metabolites of JWH-018 and JWH-073 retain high affinity and activity at cannabinoid type-1 receptors (CB 1 Rs), potentially contributing to the enhanced toxicity of K2 compared to marijuana. Since the parent compounds also bind to cannabinoid type-2 receptors (CB 2 Rs), this study investigated the affinity and intrinsic activity of JWH-018, JWH-073 and several monohydroxylated metabolites at human CB 2 Rs (hCB 2 Rs). The affinity of cannabinoids for hCB 2 Rs was determined by competition binding studies employing CHO-hCB 2 membranes. Intrinsic activity of compounds was assessed by G-protein activation and adenylyl cyclase (AC)-inhibition in CHO-hCB 2 cells. JWH-073, JWH-018 and several of their human metabolites exhibit nanomolar affinity and act as potent agonists at hCB 2 Rs. Furthermore, a major omega hydroxyl metabolite of JWH-073 (JWH-073-M5) binds to CB 2 Rs with 10-fold less affinity than the parent molecule, but unexpectedly, is equipotent in regulating AC-activity when compared to the parent molecule. Finally, when compared to CP-55,940 and Δ 9 -tetrahydrocannabinol (Δ 9 -THC), JWH-018, JWH-018-M5 and JWH-073-M5 require significantly less CB 2 R occupancy to produce similar levels of AC-inhibition, indicating that these compounds may more efficiently couple CB 2 Rs to AC than the well characterized cannabinoid agonists examined. These results indicate that JWH-018, JWH-073 and several major human metabolites of these compounds exhibit high affinity and demonstrate distinctive signaling properties at CB 2 Rs. Therefore, future studies examining pharmacological and toxicological properties of synthetic cannabinoids present in K2 products should consider potential actions of these drugs at both CB 1 and CB 2 Rs. - Highlights: • JWH-018 and JWH-073 are synthetic cannabinoids present in abused K2

  12. Human metabolites of synthetic cannabinoids JWH-018 and JWH-073 bind with high affinity and act as potent agonists at cannabinoid type-2 receptors

    Energy Technology Data Exchange (ETDEWEB)

    Rajasekaran, Maheswari; Brents, Lisa K.; Franks, Lirit N. [Department of Pharmacology and Toxicology, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Moran, Jeffery H. [Department of Pharmacology and Toxicology, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Arkansas Department of Public Health, Public Health Laboratory, Little Rock, AR 72205 (United States); Prather, Paul L., E-mail: [Department of Pharmacology and Toxicology, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States)


    K2 or Spice is an emerging drug of abuse that contains synthetic cannabinoids, including JWH-018 and JWH-073. Recent reports indicate that monohydroxylated metabolites of JWH-018 and JWH-073 retain high affinity and activity at cannabinoid type-1 receptors (CB{sub 1}Rs), potentially contributing to the enhanced toxicity of K2 compared to marijuana. Since the parent compounds also bind to cannabinoid type-2 receptors (CB{sub 2}Rs), this study investigated the affinity and intrinsic activity of JWH-018, JWH-073 and several monohydroxylated metabolites at human CB{sub 2}Rs (hCB{sub 2}Rs). The affinity of cannabinoids for hCB{sub 2}Rs was determined by competition binding studies employing CHO-hCB{sub 2} membranes. Intrinsic activity of compounds was assessed by G-protein activation and adenylyl cyclase (AC)-inhibition in CHO-hCB{sub 2} cells. JWH-073, JWH-018 and several of their human metabolites exhibit nanomolar affinity and act as potent agonists at hCB{sub 2}Rs. Furthermore, a major omega hydroxyl metabolite of JWH-073 (JWH-073-M5) binds to CB{sub 2}Rs with 10-fold less affinity than the parent molecule, but unexpectedly, is equipotent in regulating AC-activity when compared to the parent molecule. Finally, when compared to CP-55,940 and Δ{sup 9}-tetrahydrocannabinol (Δ{sup 9}-THC), JWH-018, JWH-018-M5 and JWH-073-M5 require significantly less CB{sub 2}R occupancy to produce similar levels of AC-inhibition, indicating that these compounds may more efficiently couple CB{sub 2}Rs to AC than the well characterized cannabinoid agonists examined. These results indicate that JWH-018, JWH-073 and several major human metabolites of these compounds exhibit high affinity and demonstrate distinctive signaling properties at CB{sub 2}Rs. Therefore, future studies examining pharmacological and toxicological properties of synthetic cannabinoids present in K2 products should consider potential actions of these drugs at both CB{sub 1} and CB{sub 2}Rs. - Highlights: • JWH-018

  13. Protoporphyrinogen oxidase: high affinity tetrahydrophthalimide radioligand for the inhibitor/herbicide-binding site in mouse liver mitochondria. (United States)

    Birchfield, N B; Casida, J E


    Protoporphyrinogen oxidase (protox), the last common enzyme in heme and chlorophyll biosynthesis, is the target of several classes of herbicides acting as inhibitors in both plants and mammals. N-(4-Chloro-2-fluoro-5-(propargyloxy)phenyl)-3,4,5,6-tetrahydro phthalimide (a potent protox inhibitor referred to as THP) was synthesized as a candidate radioligand ([3H]-THP) by selective catalytic reduction of 3,6-dihydrophthalic anhydride (DHPA) with tritium gas followed by condensation in 45% yield with 4-chloro-2-fluoro-5-(propargyloxy)aniline. Insertion of tritium at the 3 and 6 carbons of DHPA as well as the expected 4 and 5 carbons resulted in high specific activity [3H]THP (92 Ci/mmol). This radioligand undergoes rapid, specific, saturable, and reversible binding to the inhibitor/herbicide binding site of the protox component of cholate-solubilized mouse liver mitochondria with an apparent Kd of 0.41 nM and Bmax of 0.40 pmol/mg of protein. In the standard assay, mouse preparation (150 micrograms of protein) and [3H]THP (0.5 nM) are incubated in 500 microL of phosphate buffer at pH 7.2 for 15 min at 25 degrees C followed by addition of ammonium sulfate and filtration with glass fiber filters. The potencies of five nitrodiphenyl ethers and two other herbicides as inhibitors of [3H]THP binding correlate well with those for inhibition of protox activity (r2 = 0.97, n = 7), thus validating the binding assay as relevant to enzyme inhibition. It is also suitable to determine in vivo block as illustrated by an approximately 50% decrease in [3H]THP binding in liver mitochondria from mice treated ip with oxyfluorfen at 4 mg/kg. This is the first report of a binding assay for protox in mammals. The high affinity and specific activity of [3H]THP facilitate quantitation of protox and therefore research on a sensitive inhibition site for porphyrin biosynthesis.

  14. Na+-Dependent High-Affinity Nitrate, Phosphate and Amino Acids Transport in Leaf Cells of the Seagrass Posidonia oceanica (L. Delile

    Directory of Open Access Journals (Sweden)

    Lourdes Rubio


    Full Text Available Posidonia oceanica (L. Delile is a seagrass, the only group of vascular plants to colonize the marine environment. Seawater is an extreme yet stable environment characterized by high salinity, alkaline pH and low availability of essential nutrients, such as nitrate and phosphate. Classical depletion experiments, membrane potential and cytosolic sodium measurements were used to characterize the high-affinity NO3−, Pi and amino acids uptake mechanisms in this species. Net uptake rates of both NO3− and Pi were reduced by more than 70% in the absence of Na+. Micromolar concentrations of NO3− depolarized mesophyll leaf cells plasma membrane. Depolarizations showed saturation kinetics (Km = 8.7 ± 1 μM NO3−, which were not observed in the absence of Na+. NO3− induced depolarizations at increasing Na+ also showed saturation kinetics (Km = 7.2 ± 2 mM Na+. Cytosolic Na+ measured in P. oceanica leaf cells (17 ± 2 mM Na+ increased by 0.4 ± 0.2 mM Na+ upon the addition of 100 μM NO3−. Na+-dependence was also observed for high-affinity l-ala and l-cys uptake and high-affinity Pi transport. All together, these results strongly suggest that NO3−, amino acids and Pi uptake in P. oceanica leaf cells are mediated by high-affinity Na+-dependent transport systems. This mechanism seems to be a key step in the process of adaptation of seagrasses to the marine environment.

  15. DOTA-derivatives of octreotide dicarba-analogues with high affinity for somatostatin sst2,5 receptors (United States)

    Pratesi, Alessandro; Ginanneschi, Mauro; Lumini, Marco; Papini, Anna M.; Novellino, Ettore; Brancaccio, Diego; Carotenuto, Alfonso


    In vivo somatostatin receptor scintigraphy is a valuable method for the visualization of human endocrine tumours and their metastases. In fact, peptide ligands of somatostatin receptors (sst’s) conjugated with chelating agents are in clinical use. We have recently developed octreotide dicarba-analogues, which show interesting binding profiles at sst’s. In this context, it was mandatory to explore the possibility that our analogues could maintain their activity also upon conjugation with DOTA. In this paper, we report and discuss the synthesis, binding affinity and conformational preferences of three DOTA-conjugated dicarba-analogues of octreotide. Interestingly, two conjugated analogues exhibited nanomolar affinities on sst2 and sst5 somatostatin receptor subtypes.

  16. Fluorinated phenmetrazine "legal highs" act as substrates for high-affinity monoamine transporters of the SLC6 family. (United States)

    Mayer, Felix P; Burchardt, Nadine V; Decker, Ann M; Partilla, John S; Li, Yang; McLaughlin, Gavin; Kavanagh, Pierce V; Sandtner, Walter; Blough, Bruce E; Brandt, Simon D; Baumann, Michael H; Sitte, Harald H


    A variety of new psychoactive substances (NPS) are appearing in recreational drug markets worldwide. NPS are compounds that target various receptors and transporters in the central nervous system to achieve their psychoactive effects. Chemical modifications of existing drugs can generate NPS that are not controlled by current legislation, thereby providing legal alternatives to controlled substances such as cocaine or amphetamine. Recently, 3-fluorophenmetrazine (3-FPM), a derivative of the anorectic compound phenmetrazine, appeared on the recreational drug market and adverse clinical effects have been reported. Phenmetrazine is known to elevate extracellular monoamine concentrations by an amphetamine-like mechanism. Here we tested 3-FPM and its positional isomers, 2-FPM and 4-FPM, for their abilities to interact with plasma membrane monoamine transporters for dopamine (DAT), norepinephrine (NET) and serotonin (SERT). We found that 2-, 3- and 4-FPM inhibit uptake mediated by DAT and NET in HEK293 cells with potencies comparable to cocaine (IC 50 values 80 μM). Experiments directed at identifying transporter-mediated reverse transport revealed that FPM isomers induce efflux via DAT, NET and SERT in HEK293 cells, and this effect is augmented by the Na + /H + ionophore monensin. Each FPM evoked concentration-dependent release of monoamines from rat brain synaptosomes. Hence, this study reports for the first time the mode of action for 2-, 3- and 4-FPM and identifies these NPS as monoamine releasers with marked potency at catecholamine transporters implicated in abuse and addiction. This article is part of the Special Issue entitled 'Designer Drugs and Legal Highs.' Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  17. In Vivo Neutralization of α-Cobratoxin with High-Affinity Llama Single-Domain Antibodies (VHHs) and a VHH-Fc Antibody (United States)

    Richard, Gabrielle; Meyers, Ashley J.; McLean, Michael D.; Arbabi-Ghahroudi, Mehdi; MacKenzie, Roger; Hall, J. Christopher


    Small recombinant antibody fragments (e.g. scFvs and VHHs), which are highly tissue permeable, are being investigated for antivenom production as conventional antivenoms consisting of IgG or F(ab’)2 antibody fragments do not effectively neutralize venom toxins located in deep tissues. However, antivenoms composed entirely of small antibody fragments may have poor therapeutic efficacy due to their short serum half-lives. To increase serum persistence and maintain tissue penetration, we prepared low and high molecular mass antivenom antibodies. Four llama VHHs were isolated from an immune VHH-displayed phage library and were shown to have high affinity, in the low nM range, for α-cobratoxin (α–Cbtx), the most lethal component of Naja kaouthia venom. Subsequently, our highest affinity VHH (C2) was fused to a human Fc fragment to create a VHH2-Fc antibody that would offer prolonged serum persistence. After in planta (Nicotiana benthamiana) expression and purification, we show that our VHH2-Fc antibody retained high affinity binding to α–Cbtx. Mouse α–Cbtx challenge studies showed that our highest affinity VHHs (C2 and C20) and the VHH2-Fc antibody effectively neutralized lethality induced by α–Cbtx at an antibody:toxin molar ratio as low as ca. 0.75×:1. Further research towards the development of an antivenom therapeutic involving these anti-α-Cbtx VHHs and VHH2-Fc antibody molecules should involve testing them as a combination, to determine whether they maintain tissue penetration capability and low immunogenicity, and whether they exhibit improved serum persistence and therapeutic efficacy. PMID:23894495

  18. In vitro and in vivo evaluation of new radiolabeled neurotensin(8-13) analogues with high affinity for NT1 receptors

    International Nuclear Information System (INIS)

    Garayoa, Elisa Garcia-; Allemann-Tannahill, Lesley; Blaeuenstein, Peter; Willmann, Martine; Carrel-Remy, Nathalie; Tourwe, Dirk; Iterbeke, Koen; Conrath, Peter; Schubiger, P. August


    The potential utility of neurotensin (NT) in cancer diagnosis and therapy is limited by its rapid degradation. New stabilized analogues were synthesized, labeled with [ 99m Tc] and screened in vitro and in vivo. High affinity and rapid internalization were obtained in binding assays. Despite their longer human plasma half-lives, a rapid degradation was observed with low concentrations as used in biodistribution tests. The tumor uptake rates were rather low but tumor/blood ratios increased according to the stability raise

  19. Generation of high-affinity, internalizing anti-FGFR2 single-chain variable antibody fragment fused with Fc for targeting gastrointestinal cancers. (United States)

    Borek, Aleksandra; Sokolowska-Wedzina, Aleksandra; Chodaczek, Grzegorz; Otlewski, Jacek


    Fibroblast growth factor receptors (FGFRs) are promising targets for antibody-based cancer therapies, as their substantial overexpression has been found in various tumor cells. Aberrant activation of FGF receptor 2 (FGFR2) signaling through overexpression of FGFR2 and/or its ligands, mutations, or receptor amplification has been reported in multiple cancer types, including gastric, colorectal, endometrial, ovarian, breast and lung cancer. In this paper, we describe application of the phage display technology to produce a panel of high affinity single chain variable antibody fragments (scFvs) against the extracellular ligand-binding domain of FGFR2 (ECD_FGFR2). The binders were selected from the human single chain variable fragment scFv phage display libraries Tomlinson I + J and showed high specificity and binding affinity towards human FGFR2 with nanomolar KD values. To improve the affinity of the best binder selected, scFvF7, we reformatted it to a bivalent diabody format, or fused it with the Fc region (scFvF7-Fc). The scFvF7-Fc antibody construct presented the highest affinity for FGFR2, with a KD of 0.76 nM, and was selectively internalized into cancer cells overexpressing FGFR2, Snu-16 and NCI-H716. Finally, we prepared a conjugate of scFvF7-Fc with the cytotoxic drug monomethyl-auristatin E (MMAE) and evaluated its cytotoxicity. The conjugate delivered MMAE selectively to FGFR2-positive tumor cells. These results indicate that scFvF7-Fc-vcMMAE is a highly potent molecule for the treatment of cancers with FGFR2 overexpression.

  20. An in vitro-identified high-affinity nucleosome-positioning signal is capable of transiently positioning a nucleosome in vivo

    Directory of Open Access Journals (Sweden)

    Gracey Lia E


    Full Text Available Abstract Background The physiological function of eukaryotic DNA occurs in the context of nucleosomal arrays that can expose or obscure defined segments of the genome. Certain DNA sequences are capable of strongly positioning a nucleosome in vitro, suggesting the possibility that favorable intrinsic signals might reproducibly structure chromatin segments. As high-throughput sequencing analyses of nucleosome coverage in vitro and in vivo have become possible, a vigorous debate has arisen over the degree to which intrinsic DNA:nucleosome affinities orchestrate the in vivo positions of nucleosomes, thereby controlling physical accessibility of specific sequences in DNA. Results We describe here the in vivo consequences of placing a synthetic high-affinity nucleosome-positioning signal, the 601 sequence, into a DNA plasmid vector in mice. Strikingly, the 601 sequence was sufficient to position nucleosomes during an early phase after introduction of the DNA into the mice (when the plasmid vector transgene was active. This positioning capability was transient, with a loss of strong positioning at a later time point when the transgenes had become silent. Conclusions These results demonstrate an ability of DNA sequences selected solely for nucleosome affinity to organize chromatin in vivo, and the ability of other mechanisms to overcome these interactions in a dynamic nuclear environment.

  1. Deltorphins: a family of naturally occurring peptides with high affinity and selectivity for delta opioid binding sites.


    Erspamer, V; Melchiorri, P; Falconieri-Erspamer, G; Negri, L; Corsi, R; Severini, C; Barra, D; Simmaco, M; Kreil, G


    Deltorphins are endogenous linear heptapeptides, isolated from skin extracts of frogs belonging to the genus Phyllomedusa, that have a higher affinity and selectivity for delta opioid binding sites than any other natural compound known. Two deltorphins with the sequence Tyr-Ala-Phe-Asp(or Glu)-Val-Val-Gly-NH2 have been isolated from skin extracts of Phyllomedusa bicolor. The alanine in position 2 is in the D configuration. These peptides, [D-Ala2]deltorphins I and II, show an even higher affi...

  2. A potential therapy for chordoma via antibody-dependent cell-mediated cytotoxicity employing NK or high-affinity NK cells in combination with cetuximab. (United States)

    Fujii, Rika; Schlom, Jeffrey; Hodge, James W


    OBJECTIVE Chordoma is a rare bone tumor derived from the notochord and is resistant to conventional therapies such as chemotherapy, radiotherapy, and targeting therapeutics. Expression of epidermal growth factor receptor (EGFR) in a large proportion of chordoma specimens indicates a potential target for therapeutic intervention. In this study the authors investigated the potential role of the anti-EGFR antibody cetuximab in immunotherapy for chordoma. METHODS Since cetuximab is a monoclonal antibody of the IgG1 isotype, it has the potential to mediate antibody-dependent cell-mediated cytotoxicity (ADCC) employing natural killer (NK) cells as effectors. Polymorphisms in the CD16 allele expressed on NK cells have been shown to influence the degree of ADCC of tumor cells, with the high-affinity valine (V)/V allele being responsible for more lysis than the V/phenylalanine (F) or FF allele. Unfortunately, however, only approximately 10% of the population expresses the VV allele on NK cells. An NK cell line, NK-92, has now been engineered to endogenously express IL-2 and the high-affinity CD16 allele. These irradiated high-affinity (ha)NK cells were analyzed for lysis of chordoma cells with and without cetuximab, and the levels of lysis observed in ADCC were compared with those of NK cells from donors expressing the VV, VF, and FF alleles. RESULTS Here the authors demonstrate for the first time 1) that cetuximab in combination with NK cells can mediate ADCC of chordoma cells; 2) the influence of the NK CD16 polymorphism in cetuximab-mediated ADCC for chordoma cell lysis; 3) that engineered haNK cells-that is, cells transduced to express the CD16 V158 FcγRIIIa receptor-bind cetuximab with similar affinity to normal NK cells expressing the high-affinity VV allele; and 4) that irradiated haNK cells induce ADCC with cetuximab in chordoma cells. CONCLUSIONS These studies provide rationale for the use of cetuximab in combination with irradiated haNK cells for therapy for

  3. Covalent labeling of the beta-adrenergic ligand-binding site with para-(bromoacetamidyl)benzylcarazolol. A highly potent beta-adrenergic affinity label

    International Nuclear Information System (INIS)

    Dickinson, K.E.; Heald, S.L.; Jeffs, P.W.; Lefkowitz, R.J.; Caron, M.G.


    Para-(Bromoacetamidyl)benzylcarazolol (pBABC) was synthesized and found to be an extremely potent affinity label for beta-adrenergic receptors. Its interaction with mammalian (rabbit and hamster lung) and nonmammalian (turkey and frog erythrocyte) beta-adrenergic receptors was similar, displaying EC 50 values of 400-900 pM for inhibiting 125 I-cyanopindolol binding to these receptors. pBABC reduced the number of beta-adrenergic receptors in frog erythrocyte membranes, without any change in the affinity of the remaining sites for [ 125 I]iodocyanopindolol. pBABC has been radioiodinated. As assessed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, this affinity probe specifically labeled the beta-adrenergic peptide of a purified preparation of hamster lung, with high efficiency (approximately 40%) and with a pharmacological specificity characteristic of an interaction at the beta 2-adrenergic receptor ligand-binding site. Comparison of the proteolyzed products derived from purified receptor labeled with [ 125 I]pBABC and with the photoaffinity agent [ 125 I]p-azidobenzylcarazolol suggested that covalent labeling of the beta-adrenergic receptor by these probes occurs at similar domains of the beta-adrenergic receptor

  4. N- and C-terminally truncated forms of glucose-dependent insulinotropic polypeptide are high-affinity competitive antagonists of the human GIP receptor

    DEFF Research Database (Denmark)

    Hansen, L S; Sparre-Ulrich, A H; Christensen, M.


    functions and pharmacological potential. GIP(1-30)NH2 is a naturally occurring truncation of GIP(1-42). Here we characterize eight N-terminal trrncations of human GIP(1-30)NH2 : GIP(2- to 9-30)NH2 . EXPERIMENTAL APPROACH: COS-7 cells were transiently transfected with the human GIP receptor and assessed...... displayed lower affinities (Ki 2.3-347 nM) with highest affinities of GIP(3-30)NH2 and (5-30)NH2 . Agonism was only observed for GIP(1-30)NH2 with an Emax on 100% of GIP(1-42) and GIP(2-30)NH2 (Emax 20%). GIP(2- to 9-30)NH2 displayed antagonism (IC50 12-450 nM) and right-shifts of the GIP(1-42)-response......, but superior antagonist GIP(3-30)NH2 , that together with GIP(5-30)NH2 were high-affinity competitive antagonist and thus may be suitable tool compounds for basic GIP research and future pharmacological interventions....

  5. A viral, transporter associated with antigen processing (TAP)-independent, high affinity ligand with alternative interactions endogenously presented by the nonclassical human leukocyte antigen E class I molecule. (United States)

    Lorente, Elena; Infantes, Susana; Abia, David; Barnea, Eilon; Beer, Ilan; García, Ruth; Lasala, Fátima; Jiménez, Mercedes; Mir, Carmen; Morreale, Antonio; Admon, Arie; López, Daniel


    The transporter associated with antigen processing (TAP) enables the flow of viral peptides generated in the cytosol by the proteasome and other proteases to the endoplasmic reticulum, where they complex with nascent human leukocyte antigen (HLA) class I. Later, these peptide-HLA class I complexes can be recognized by CD8(+) lymphocytes. Cancerous cells and infected cells in which TAP is blocked, as well as individuals with unusable TAP complexes, are able to present peptides on HLA class I by generating them through TAP-independent processing pathways. Here, we identify a physiologically processed HLA-E ligand derived from the D8L protein in TAP-deficient vaccinia virus-infected cells. This natural high affinity HLA-E class I ligand uses alternative interactions to the anchor motifs previously described to be presented on nonclassical HLA class I molecules. This octameric peptide was also presented on HLA-Cw1 with similar binding affinity on both classical and nonclassical class I molecules. In addition, this viral peptide inhibits HLA-E-mediated cytolysis by natural killer cells. Comparison between the amino acid sequences of the presenting HLA-E and HLA-Cw1 alleles revealed a shared structural motif in both HLA class molecules, which could be related to their observed similar cross-reactivity affinities. This motif consists of several residues located on the floor of the peptide-binding site. These data expand the role of HLA-E as an antigen-presenting molecule.

  6. High affinity radiopharmaceuticals based upon lansoprazole for PET imaging of aggregated tau in Alzheimer's disease and progressive supranuclear palsy: synthesis, preclinical evaluation, and lead selection. (United States)

    Fawaz, Maria V; Brooks, Allen F; Rodnick, Melissa E; Carpenter, Garrett M; Shao, Xia; Desmond, Timothy J; Sherman, Phillip; Quesada, Carole A; Hockley, Brian G; Kilbourn, Michael R; Albin, Roger L; Frey, Kirk A; Scott, Peter J H


    Abnormally aggregated tau is the hallmark pathology of tauopathy neurodegenerative disorders and is a target for development of both diagnostic tools and therapeutic strategies across the tauopathy disease spectrum. Development of carbon-11- or fluorine-18-labeled radiotracers with appropriate affinity and specificity for tau would allow noninvasive quantification of tau burden using positron emission tomography (PET) imaging. We have synthesized [(18)F]lansoprazole, [(11)C]N-methyl lansoprazole, and [(18)F]N-methyl lansoprazole and identified them as high affinity radiotracers for tau with low to subnanomolar binding affinities. Herein, we report radiosyntheses and extensive preclinical evaluation with the aim of selecting a lead radiotracer for translation into human PET imaging trials. We demonstrate that [(18)F]N-methyl lansoprazole, on account of the favorable half-life of fluorine-18 and its rapid brain entry in nonhuman primates, favorable kinetics, low white matter binding, and selectivity for binding to tau over amyloid, is the lead compound for progression into clinical trials.

  7. High Affinity Radiopharmaceuticals Based Upon Lansoprazole for PET Imaging of Aggregated Tau in Alzheimer’s Disease and Progressive Supranuclear Palsy: Synthesis, Preclinical Evaluation, and Lead Selection (United States)


    Abnormally aggregated tau is the hallmark pathology of tauopathy neurodegenerative disorders and is a target for development of both diagnostic tools and therapeutic strategies across the tauopathy disease spectrum. Development of carbon-11- or fluorine-18-labeled radiotracers with appropriate affinity and specificity for tau would allow noninvasive quantification of tau burden using positron emission tomography (PET) imaging. We have synthesized [18F]lansoprazole, [11C]N-methyl lansoprazole, and [18F]N-methyl lansoprazole and identified them as high affinity radiotracers for tau with low to subnanomolar binding affinities. Herein, we report radiosyntheses and extensive preclinical evaluation with the aim of selecting a lead radiotracer for translation into human PET imaging trials. We demonstrate that [18F]N-methyl lansoprazole, on account of the favorable half-life of fluorine-18 and its rapid brain entry in nonhuman primates, favorable kinetics, low white matter binding, and selectivity for binding to tau over amyloid, is the lead compound for progression into clinical trials. PMID:24896980

  8. Alteration of the α1β2/α2β1 subunit interface contributes to the increased hemoglobin-oxygen affinity of high-altitude deer mice

    Energy Technology Data Exchange (ETDEWEB)

    Inoguchi, Noriko; Mizuno, Nobuhiro; Baba, Seiki; Kumasaka, Takashi; Natarajan, Chandrasekhar; Storz, Jay F.; Moriyama, Hideaki; Permyakov, Eugene A.


    Deer mice (Peromyscus maniculatus) that are native to high altitudes in the Rocky Mountains have evolved hemoglobins with an increased oxygen-binding affinity relative to those of lowland conspecifics. To elucidate the molecular mechanisms responsible for the evolved increase in hemoglobin-oxygen affinity, the crystal structure of the highland hemoglobin variant was solved and compared with the previously reported structure for the lowland variant. Highland hemoglobin yielded at least two crystal types, in which the longest axes were 507 and 230 Å. Using the smaller unit cell crystal, the structure was solved at 2.2 Å resolution. The asymmetric unit contained two tetrameric hemoglobin molecules. The analyses revealed that αPro50 in the highland hemoglobin variant promoted a stable interaction between αHis45 and heme that was not seen in the αHis50 lowland variant. The αPro50 mutation also altered the nature of atomic contacts at the α1β2/α2β1 intersubunit interfaces. These results demonstrate how affinity-altering changes in intersubunit interactions can be produced by mutations at structurally remote sites.

  9. A soluble, high-affinity, interleukin-4-binding protein is present in the biological fluids of mice

    International Nuclear Information System (INIS)

    Fernandez-Botran, R.; Vitetta, E.S.


    Cytokines such as interleukin 4 (IL-4) play a key role in the regulation of immune responses, but little is known about how their multiple activities are regulated in vivo. In this report, we demonstrate that an IL-4-binding protein (IL-4BP) is constitutively present in the biological fluids of mice (serum, ascites fluid, and urine). Binding of 125 I-labeled IL-4 to the IL-4BP is specific and saturable and can be inhibited by an excess of unlabeled IL-4 but not IL-2. The IL-4BP binds IL-4 with an affinity similar to that reported for the cellular IL-4 with an affinity similar to that reported for the cellular IL-4 receptor (K d ∼7 x 10 -11 M) and has a molecular mass of 30-40 kDa and pI values of 3.6-4.8. IL-4BP-containing biological fluids or purified IL-4BP competitively inhibit the binding of 125 I-labeled IL-4 to mouse T or B cells and inhibit the biological activity of IL-4 but not IL-2. The serum levels of IL-4BP in severe combined immunodeficiency (SCID) mice are lower than those of normal mice. The above findings suggest that IL-4BP plays an important immunoregulatory role in vivo

  10. A high-affinity, dimeric inhibitor of PSD-95 bivalently interacts with PDZ1-2 and protects against ischemic brain damage

    DEFF Research Database (Denmark)

    Bach, Anders*; Clausen, Bettina H; Møller, Magda


    Inhibition of the ternary protein complex of the synaptic scaffolding protein postsynaptic density protein-95 (PSD-95), neuronal nitric oxide synthase (nNOS), and the N-methyl-d-aspartate (NMDA) receptor is a potential strategy for treating ischemic brain damage, but high-affinity inhibitors are ...... of Tat-N-dimer (3 nmol/g) to mice subjected to focal cerebral ischemia reduces infarct volume with 40% and restores motor functions. Thus, Tat-N-dimer is a highly efficacious neuroprotective agent with therapeutic potential in stroke....

  11. Enhanced binding affinity, remarkable selectivity, and high capacity of CO 2 by dual functionalization of a rht-type metal-organic framework

    KAUST Repository

    Li, Baiyan


    Open and friendly: The smallest member of the rht-type metal-organic frameworks (MOFs, see picture) constructed by a hexacarboxylate ligand with a nitrogen-rich imino triazine backbone shows a significantly enhanced gas binding affinity relative to all other isoreticular rht-type MOFs. The high adsorption capacity and remarkable selectivity of CO 2 are attributed to the high density of open metal and Lewis basic sites in the framework. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Synthesis, biodistribution and in vitro evaluation of brain permeable high affinity type 2 cannabinoid receptor agonists [11C]MA2 and [18F]MA3

    Directory of Open Access Journals (Sweden)

    Muneer Ahamed


    Full Text Available Abstract The type 2 cannabinoid receptor (CB2 is a member of the endocannabinoid system and is known for its important role in (neuroinflammation. A PET-imaging agent that allows in vivo visualization of CB2 expression may thus allow quantification of neuroinflammation. In this paper, we report the synthesis, radiosynthesis, biodistribution and in vitro evaluation of a carbon-11 ([11C]MA2 and a fluorine-18 ([18F]MA3 labeled analogue of a highly potent N-arylamide oxadiazole CB2 agonist (EC50 = 0.015 nM. MA2 and MA3 behaved as potent CB2 agonist (EC50: 3 nM and 0.1 nM, respectively and their in vitro binding affinity for hCB2 was found to be 87 nM and 0.8 nM, respectively. Also MA3 (substituted with a fluoro ethyl group was found to have higher binding affinity and EC50 values when compared to the originally reported trifluoromethyl analogue 12. [11C]MA2 and [18F]MA3 were successfully synthesized with good radiochemical yield, high radiochemical purity and high specific activity. In mice, both tracers were efficiently cleared from blood and all major organs by the hepatobiliary pathway and importantly these compounds showed high brain uptake. In conclusion, [11C]MA2 and [18F]MA3 are shown to be high potent CB2 agonists with good brain uptake, these favorable characteristics makes them potential PET probes for in vivo imaging of brain CB2 receptors. However in view of its higher affinity and selectivity, further detailed evaluation of MA3 as a PET tracer for CB2 is warranted.

  13. Synthesis, Biodistribution and In vitro Evaluation of Brain Permeable High Affinity Type 2 Cannabinoid Receptor Agonists [11C]MA2 and [18F]MA3. (United States)

    Ahamed, Muneer; van Veghel, Daisy; Ullmer, Christoph; Van Laere, Koen; Verbruggen, Alfons; Bormans, Guy M


    The type 2 cannabinoid receptor (CB2) is a member of the endocannabinoid system and is known for its important role in (neuro)inflammation. A PET-imaging agent that allows in vivo visualization of CB2 expression may thus allow quantification of neuroinflammation. In this paper, we report the synthesis, radiosynthesis, biodistribution and in vitro evaluation of a carbon-11 ([ 11 C]MA2) and a fluorine-18 ([ 18 F]MA3) labeled analog of a highly potent N -arylamide oxadiazole CB2 agonist (EC 50 = 0.015 nM). MA2 and MA3 behaved as potent CB2 agonist (EC 50 : 3 nM and 0.1 nM, respectively) and their in vitro binding affinity for h CB2 was found to be 87 nM and 0.8 nM, respectively. Also MA3 (substituted with a fluoro ethyl group) was found to have higher binding affinity and EC 50 values when compared to the originally reported trifluoromethyl analog 12 . [ 11 C]MA2 and [ 18 F]MA3 were successfully synthesized with good radiochemical yield, high radiochemical purity and high specific activity. In mice, both tracers were efficiently cleared from blood and all major organs by the hepatobiliary pathway and importantly these compounds showed high brain uptake. In conclusion, [ 11 C]MA2 and [ 18 F]MA3 are shown to be high potent CB2 agonists with good brain uptake, these favorable characteristics makes them potential PET probes for in vivo imaging of brain CB2 receptors. However, in view of its higher affinity and selectivity, further detailed evaluation of MA3 as a PET tracer for CB2 is warranted.

  14. A binding-site barrier affects imaging efficiency of high affinity amyloid-reactive peptide radiotracers in vivo. (United States)

    Wall, Jonathan S; Williams, Angela; Richey, Tina; Stuckey, Alan; Huang, Ying; Wooliver, Craig; Macy, Sallie; Heidel, Eric; Gupta, Neil; Lee, Angela; Rader, Brianna; Martin, Emily B; Kennel, Stephen J


    Amyloid is a complex pathology associated with a growing number of diseases including Alzheimer's disease, type 2 diabetes, rheumatoid arthritis, and myeloma. The distribution and extent of amyloid deposition in body organs establishes the prognosis and can define treatment options; therefore, determining the amyloid load by using non-invasive molecular imaging is clinically important. We have identified a heparin-binding peptide designated p5 that, when radioiodinated, was capable of selectively imaging systemic visceral AA amyloidosis in a murine model of the disease. The p5 peptide was posited to bind effectively to amyloid deposits, relative to similarly charged polybasic heparin-reactive peptides, because it adopted a polar α helix secondary structure. We have now synthesized a variant, p5R, in which the 8 lysine amino acids of p5 have been replaced with arginine residues predisposing the peptide toward the α helical conformation in an effort to enhance the reactivity of the peptide with the amyloid substrate. The p5R peptide had higher affinity for amyloid and visualized AA amyloid in mice by using SPECT/CT imaging; however, the microdistribution, as evidenced in micro-autoradiographs, was dramatically altered relative to the p5 peptide due to its increased affinity and a resultant "binding site barrier" effect. These data suggest that radioiodinated peptide p5R may be optimal for the in vivo detection of discreet, perivascular amyloid, as found in the brain and pancreatic vasculature, by using molecular imaging techniques; however, peptide p5, due to its increased penetration, may yield more quantitative imaging of expansive tissue amyloid deposits.

  15. A binding-site barrier affects imaging efficiency of high affinity amyloid-reactive peptide radiotracers in vivo.

    Directory of Open Access Journals (Sweden)

    Jonathan S Wall

    Full Text Available Amyloid is a complex pathology associated with a growing number of diseases including Alzheimer's disease, type 2 diabetes, rheumatoid arthritis, and myeloma. The distribution and extent of amyloid deposition in body organs establishes the prognosis and can define treatment options; therefore, determining the amyloid load by using non-invasive molecular imaging is clinically important. We have identified a heparin-binding peptide designated p5 that, when radioiodinated, was capable of selectively imaging systemic visceral AA amyloidosis in a murine model of the disease. The p5 peptide was posited to bind effectively to amyloid deposits, relative to similarly charged polybasic heparin-reactive peptides, because it adopted a polar α helix secondary structure. We have now synthesized a variant, p5R, in which the 8 lysine amino acids of p5 have been replaced with arginine residues predisposing the peptide toward the α helical conformation in an effort to enhance the reactivity of the peptide with the amyloid substrate. The p5R peptide had higher affinity for amyloid and visualized AA amyloid in mice by using SPECT/CT imaging; however, the microdistribution, as evidenced in micro-autoradiographs, was dramatically altered relative to the p5 peptide due to its increased affinity and a resultant "binding site barrier" effect. These data suggest that radioiodinated peptide p5R may be optimal for the in vivo detection of discreet, perivascular amyloid, as found in the brain and pancreatic vasculature, by using molecular imaging techniques; however, peptide p5, due to its increased penetration, may yield more quantitative imaging of expansive tissue amyloid deposits.

  16. Characterization of an AtCCX5 gene from Arabidopsis thaliana that involves in high-affinity K+ uptake and Na+ transport in yeast

    International Nuclear Information System (INIS)

    Zhang, Xinxin; Zhang, Min; Takano, Tetsuo; Liu, Shenkui


    Highlights: → The AtCCX5 protein coding a putative cation calcium exchanger was characterized. → AtCCX5 expressed in yeast was localized in the plasma membrane and nuclear periphery. → AtCCX5 protein did not show the same transport properties as the CAXs. → AtCCX5 protein involves in mediating high-affinity K + uptake in yeast. → AtCCX5 protein also involves in Na + transport in yeast. -- Abstract: The gene for a putative cation calcium exchanger (CCX) from Arabidopsis thaliana, AtCCX5, was cloned and its function was analyzed in yeast. Green fluorescent protein-tagged AtCCX5 expressed in yeast was localized in the plasma membrane and nuclear periphery. The yeast transformants expressing AtCCX5 were created and their growth in the presence of various cations (K + , Na + , Ca 2+ , Mg 2+ , Fe 2+ , Cu 2+ , Co 2+ , Cd 2+ , Mn 2+ , Ba 2+ , Ni 2+ , Zn 2+ , and Li + ) were analyzed. AtCCX5 expression was found to affect the response to K + and Na + in yeast. The AtCCX5 transformant also showed a little better growth to Zn 2+ . The yeast mutant 9.3 expressing AtCCX5 restored growth of the mutant on medium with low K + (0.5 mM), and also suppressed its Na + sensitivity. Ion uptake experiments showed that AtCCX5 mediated relatively high-affinity K + uptake and was also involved in Na + transport in yeast. Taken together, these findings suggest that the AtCCX5 is a novel transport protein involves in mediating high-affinity K + uptake and Na + transport in yeast.

  17. Knock-down of a tonoplast localized low-affinity nitrate transporter OsNPF7.2 affects rice growth under high nitrate ssupply

    Directory of Open Access Journals (Sweden)

    Rui Hu


    Full Text Available The large nitrate transporter 1/peptide transporter family (NPF has been shown to transport diverse substrates, including nitrate, amino acids, peptides, phytohormones, and glucosinolates. However, the rice (Oryza sativa root-specific expressed member OsNPF7.2 has not been characterized. Here, our data show that OsNPF7.2 is a tonoplast localized low-affinity nitrate transporter, and affects rice growth under high nitrate supply. The expression analysis showed that OsNPF7.2 was mainly expressed in the elongation and maturation zones of roots, especially in the root sclerenchyma, cortex and stele. It was also induced by high concentrations of nitrate. Subcellular localization analysis showed that OsNPF7.2 was localized on the tonoplast of large and small vacuoles. Heterogenous expression in Xenopus laevis oocytes suggested that OsNPF7.2 was a low-affinity nitrate transporter. Knock-down of OsNPF7.2 retarded rice growth under high concentrations of nitrate. Therefore, we deduce that OsNPF7.2 plays a role in intracellular allocation of nitrate in roots, and thus influences rice growth under high nitrate supply.

  18. Molecular electron affinities

    International Nuclear Information System (INIS)

    Fukuda, E.K.


    Molecular electron affinities have historically been difficult quantities to measure accurately. These difficulties arise from differences in structure between the ion and neutral as well as the existence of excited negative ion states. To circumvent these problems, relative electron affinities were determined in this dissertation by studying equilibrium electron transfer reactions using a pulsed ion cyclotron resonance (ICR) spectrometer. Direct measurement of ion and neutral concentrations for reactions of the general type, A - + B = B - + A, allow calculation of the equilibrium constant and, therefore, the free energy change. The free energy difference is related to the difference in electron affinities between A and B. A relative electron affinity scale covering a range of about 45 kcal/mol was constructed with various substituted p-benzoquinones, nitrobenzenes, anhydrides, and benzophenones. To assign absolute electron affinities, various species with accurately known electron affinities are tied to the scale via ion-cyclotron double resonance bracketing techniques. After the relative scale is anchored to these species with well-known electron affinities, the scale is then used as a check on other electron affinity values as well as generating new electron affinity values. Many discrepancies were found between the electron affinities measured using the ICR technique and previous literature determinations

  19. Radiosynthesis and Evaluation of [(11)C]3-Hydroxycyclopent-1-enecarboxylic Acid as Potential PET Ligand for the High-Affinity γ-Hydroxybutyric Acid Binding Sites

    DEFF Research Database (Denmark)

    Jensen, Claus H; Hansen, Hanne D; Bay, Tina


    understanding of this population of binding sites. With its high specific affinity and monocarboxylate transporter (MCT1) mediated transport across the blood-brain barrier in pharmacological doses, 3-hydroxycyclopent-1-enecarboxylic acid (HOCPCA) seems like a suitable PET radiotracer candidate. Here, we report...... autoradiography on sections of pig brain was performed using [(3)H]HOCPCA. In vivo evaluation of [(11)C]HOCPCA showed no brain uptake, possibly due to a limited uptake of HOCPCA by the MCT1 transporter at tracer doses of [(11)C]HOCPCA....

  20. In vitro and in vivo evaluation of new radiolabeled neurotensin(8-13) analogues with high affinity for NT1 receptors

    Energy Technology Data Exchange (ETDEWEB)

    Garayoa, Elisa Garcia-; Allemann-Tannahill, Lesley; Blaeuenstein, Peter; Willmann, Martine; Carrel-Remy, Nathalie; Tourwe, Dirk; Iterbeke, Koen; Conrath, Peter; Schubiger, P. August E-mail:


    The potential utility of neurotensin (NT) in cancer diagnosis and therapy is limited by its rapid degradation. New stabilized analogues were synthesized, labeled with [{sup 99m}Tc] and screened in vitro and in vivo. High affinity and rapid internalization were obtained in binding assays. Despite their longer human plasma half-lives, a rapid degradation was observed with low concentrations as used in biodistribution tests. The tumor uptake rates were rather low but tumor/blood ratios increased according to the stability raise.

  1. Comparison of high affinity binding of {sup 3}H-proadifen and {sup 3}H-(-)-cocaine t rat liver membranes

    Energy Technology Data Exchange (ETDEWEB)

    Ross, S.B. [Astra Arcus AB, Dept. of Neuropharmacology, Soedertaelje (Sweden)


    The characteristics of the binding of {sup 3}H-proadifen to rat liver membranes were studied and compared to those of {sup 3}H-cocaine. It was found that {sup 3}H-proadifen was bound reversibly with high affinity (K{sub D}=1.8{+-}0.5 nM) and large capacity (B{sub max}=2010{+-}340 pmol/g wet tissue) to liver membranes. The corresponding values for the {sup 3}H-cocaine binding were 3.5 nM and 1000 pmol/g wet tissue. The binding of {sup 3}H-proadifen was mainly localised to the microsomal fraction. The number of binding sites was not increased by treatment of rats with phenobarbitone. With 1 {mu}M CdCl{sub 2} in the incubation buffer it was possible to differentiate between two {sup 3}H-cocaine binding sites with K{sub d} values of 1.6 and 7.7 nM and B{sub max} values of 280 and 940 pmol/g wet liver tissue. S-(-)-Alaproclate inhibited the binding of {sup 3}H-proadifen and {sup 3}H-cocaine inhibited the binding of {sup 3}H-proadifen (IC{sub 50}=10 nM) and proadifen that of {sup 3}H-cocaine (IC{sub 50}=1 nM). There was a high correlation coefficient (r{sub r}=0.972; P<0.01; n=12) in the Spearman rank test between the inhibitory potencies of compounds examined in both systems. Beside some potent alaproclate analogues a couple of compounds had moderately high affinity (IC{sub 50}=100-500 nM): chloroquine, phenoxybenzamine, amitriptyline, ajmaline, remoxipride, imipramine and (-)-alaprenolol. CdCl{sub 2}, ZnCl{sub 2} and CuCl{sub 2} inhibited the binding of both ligands with low Hill coefficients, indicating heterogeneous binding sites. The inhibition curve of Cd{sup 2+} on the cocaine binding was biphasic with a high affinity part around 50 nM and a low affinity part at 15{mu}M. The similarity of the characteristics of the binding of these ligands with that of {sup 3}H-alaproclate is discussed. It is suggested that all three compounds bind to the same sites, although additional binding sites seem to exist for proadifen. (au) (9 refs.).

  2. Coinheritance of High Oxygen Affinity Hb Helsinki [HBB: c.248A>T; β82(EF6)Lys→Met] with Hb H Disease. (United States)

    Lee, Shir-Ying; Goh, Jia-Hui; Tan, Karen M L; Liu, Te-Chih


    Hb Helsinki [HBB: c.248A>T; β82(EF6)Lys→Met] is a high oxygen affinity hemoglobin (Hb) causing polycythemia, whereas Hb H (β4) disease causes mild to severe chronic hemolytic anemia. The clinical characteristics, gel electrophoresis, capillary electrophoresis (CE) and molecular genotyping of a case of Hb Helsinki coinherited with Hb H disease in an ethnic Malay is described, illustrating the interaction between the β-globin variant and coinheritance of three α gene deletions. The proband was asymptomatic, exhibited microcytosis and a normal with Hb value.

  3. Blockade of the high-affinity noradrenaline transporter (NET) by the selective 5-HT reuptake inhibitor escitalopram: an in vivo microdialysis study in mice (United States)

    Nguyen, Hai T; Guiard, Bruno P; Bacq, Alexandre; David, Denis J; David, Indira; Quesseveur, Gaël; Gautron, Sophie; Sanchez, Connie; Gardier, Alain M


    BACKGROUND AND PURPOSE Escitalopram, the S(+)-enantiomer of citalopram is the most selective 5-HT reuptake inhibitor approved. Although all 5-HT selective reuptake inhibitors (SSRIs) increase extracellular levels of 5-HT ([5-HT]ext). some also enhance, to a lesser extent, extracellular levels of noradrenaline ([NA]ext). However, the mechanisms by which SSRIs activate noradrenergic transmission in the brain remain to be determined. EXPERIMENTAL APPROACH This study examined the effects of escitalopram, on both [5-HT]ext and [NA]ext in the frontal cortex (FCx) of freely moving wild-type (WT) and mutant mice lacking the 5-HT transporter (SERT−/−) by using intracerebral microdialysis. We explored the possibilities that escitalopram enhances [NA]ext, either by a direct mechanism involving the inhibition of the low- or high-affinity noradrenaline transporters, or by an indirect mechanism promoted by [5-HT]ext elevation. The forced swim test (FST) was used to investigate whether enhancing cortical [5-HT]ext and/or [NA]ext affected the antidepressant-like activity of escitalopram. KEY RESULTS In WT mice, a single systemic administration of escitalopram produced a significant increase in cortical [5-HT]ext and [NA]ext. As expected, escitalopram failed to increase cortical [5-HT]ext in SERT−/− mice, whereas its neurochemical effects on [NA]ext persisted in these mutants. In WT mice subjected to the FST, escitalopram increased swimming parameters without affecting climbing behaviour. Finally, escitalopram, at relevant concentrations, failed to inhibit cortical noradrenaline and 5-HT uptake mediated by low-affinity monoamine transporters. CONCLUSIONS AND IMPLICATIONS These experiments suggest that escitalopram enhances, although moderately, cortical [NA]extin vivo by a direct mechanism involving the inhibition of the high-affinity noradrenaline transporter (NET). PMID:22233336

  4. Screening for Natural Inhibitors of Topoisomerases I from Rhamnus davurica by Affinity Ultrafiltration and High-Performance Liquid Chromatography–Mass Spectrometry (United States)

    Chen, Guilin; Guo, Mingquan


    Topoisomerase I (Topo I) catalyzes topological interconversion of duplex DNA during DNA replication and transcription, and has been deemed as important antineoplastic targets. In this study, the fraction R.d-60 from ethyl acetate extracts of Rhamnus davurica showed higher inhibitory rates against SGC-7901 and HT-29 compared with the R.d-30 fraction in vitro. However, the specific active components of R.d-60 fraction remain elusive. To this end, a method based on bio-affinity ultrafiltration and high performance liquid chromatography/electrospray mass spectrometry (HPLC- ESI-MS/MS) was developed to rapidly screen and identify the Topo I inhibitors in this fraction. The enrichment factors (EFs) were calculated to evaluate the binding affinities between the bioactive constituents and Topo I. As a result, eight ligands were identified and six of which with higher EFs showed more potential antitumor activity. Furthermore, antiproliferative assays in vitro (IC50 values) with two representative candidates (apigenin, quercetin) against SGC-7901, HT-29 and Hep G2 cells were conducted and further validated. Finally, the structure-activity relationships revealed that flavones contain a C2-C3 double bond of C ring exhibited higher bio-affinities to Topo I than those without it. This integrated method combining Topo I ultrafiltration with HPLC-MS/MS proved to be very efficient in rapid screening and identification of potential Topo I inhibitors from the complex extracts of medicinal plants, and could be further explored as a valuable high-throughput screening platform in the early drug discovery stage. PMID:28919906

  5. New approaches for the reliable in vitro assessment of binding affinity based on high-resolution real-time data acquisition of radioligand-receptor binding kinetics. (United States)

    Zeilinger, Markus; Pichler, Florian; Nics, Lukas; Wadsak, Wolfgang; Spreitzer, Helmut; Hacker, Marcus; Mitterhauser, Markus


    Resolving the kinetic mechanisms of biomolecular interactions have become increasingly important in early-phase drug development. Since traditional in vitro methods belong to dose-dependent assessments, binding kinetics is usually overlooked. The present study aimed at the establishment of two novel experimental approaches for the assessment of binding affinity of both, radiolabelled and non-labelled compounds targeting the A 3 R, based on high-resolution real-time data acquisition of radioligand-receptor binding kinetics. A novel time-resolved competition assay was developed and applied to determine the K i of eight different A 3 R antagonists, using CHO-K1 cells stably expressing the hA 3 R. In addition, a new kinetic real-time cell-binding approach was established to quantify the rate constants k on and k off , as well as the dedicated K d of the A 3 R agonist [ 125 I]-AB-MECA. Furthermore, lipophilicity measurements were conducted to control influences due to physicochemical properties of the used compounds. Two novel real-time cell-binding approaches were successfully developed and established. Both experimental procedures were found to visualize the kinetic binding characteristics with high spatial and temporal resolution, resulting in reliable affinity values, which are in good agreement with values previously reported with traditional methods. Taking into account the lipophilicity of the A 3 R antagonists, no influences on the experimental performance and the resulting affinity were investigated. Both kinetic binding approaches comprise tracer administration and subsequent binding to living cells, expressing the dedicated target protein. Therefore, the experiments resemble better the true in vivo physiological conditions and provide important markers of cellular feedback and biological response.

  6. Specificity of Bacillus thuringiensis endotoxins is correlated with the presence of high-affinity binding sites in the brush border membrane of target insect midguts

    International Nuclear Information System (INIS)

    Hofmann, C.; Vanderbruggen, H.; Hoefte, H.; Van Rie, J.; Jansens, S.; Van Mellaert, H.


    Binding studies were performed with two 125 I-labeled Bacillus thuringiensis δ-endotoxins on brush border membrane vesicles prepared from the larval midgut of the tobacco hornworm Manduca sexta or the cabbage butterfly Pieris brassicae. One δ-endotoxin, Bt2-protoxin, is a 130-kDa recombinant crystalline protein from B. thuringiensis subsp. berliner. It kills larvae of both insect species. The active Bt2-toxin is a 60-kDa proteolytic fragment of the Bt2-protoxin. It binds saturably and with high affinity to brush border membrane vesicles from the midgut of both species. The other δ-endotoxin, Bt4412-protoxin, is a 136-kDa crystalline protein from B. thuringiensis subsp. thuringiensis, which is highly toxic for P. brassicae, but not for M. sexta larvae. Bt4412-toxin, obtained after proteolytic activation of Bt4412-protoxin, shows high-affinity saturable binding to P. brassicae vesicles but not to M. sexta vesicles. The correlation between toxicity and specific binding is further strengthened by competition studies. Other B. thuringiensis δ-endotoxins active against M. sexta compete for binding of 125 I-labeled Bt2-toxin to M. sexta vesicles, whereas toxins active against dipteran or coleopteran larvae do not compete. Bt2-toxin and Bt4412-toxin bind to different sites on P. brassicae vesicles

  7. Simultaneous high-throughput determination of interaction kinetics for drugs and cyclodextrins by high performance affinity chromatography with mass spectrometry detection. (United States)

    Wang, Caifen; Wang, Xiaobo; Xu, Xiaonan; Liu, Botao; Xu, Xu; Sun, Lixin; Li, Haiyan; Zhang, Jiwen


    The individual determination of the apparent dissociation rate constant (kd,app) using high performance affinity chromatography (HPAC) is a tedious process requiring numerous separate tests and massive data fitting, unable to provide the apparent association rate constant (ka) and equilibrium binding constant (Ka). In this study, a HPAC with mass spectrometry detection (HPAC-MS/MS) was employed to determine the drug-cyclodextrin (CD) interaction kinetics with low sample loading quantity (drugs determined in one injection. The kd,app measured by HPAC-MS/MS approach were 0.89 ± 0.07, 4.34 ± 0.01, 1.48 ± 0.01 and 7.77 ± 0.04 s(-1) for ketoprofen, trimethoprim, indapamide and acetaminophen, with kd,app for acetaminophen consistent with that from the HPAC method with UV detector in our previous studies. For twenty drugs with diverse structures and chemical properties, good correlationship was found between kd,app measured by single compound analysis method and high-throughput HPAC-MS/MS approach, with the correlation coefficient of 0.987 and the significance F less than 0.001. Comprehensive quantification of ka,app, kd,app and Ka values was further performed based on the measurement of kd,app by peak profiling method and Ka by the peak fitting method. And the investigation of the drug-CD interaction kinetics under different conditions indicated that the column temperature and mobile phase composition significantly affected the determination of ka,app, kd,app and Ka while also dependent on the acidity and basicity of drugs. In summary, the high-throughput HPAC-MS/MS approach has been demonstrated high efficiency in determination of the drug-CD primary interaction kinetic parameter, especially, kd,app, being proven as a novel tool in screening the right CD for the solubilization of the right drug. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Selection of imprinted nanoparticles by affinity chromatography. (United States)

    Guerreiro, António R; Chianella, Iva; Piletska, Elena; Whitcombe, Michael J; Piletsky, Sergey A


    Soluble molecularly imprinted nanoparticles were synthesised via iniferter initiated polymerisation and separated by size via gel permeation chromatography. Subsequent fractionation of these particles by affinity chromatography allowed the separation of high affinity fractions from the mixture of nanoparticles. Fractions selected this way possess affinity similar to that of natural antibodies (K(d) 6.6x10(-8)) M and were also able to discriminate between related functional analogues of the template.

  9. Synthesis of hapten and preparation of specific polyclonal antibody with high affinity for lenalidomide, the potent drug for treatment of multiple myeloma

    Directory of Open Access Journals (Sweden)

    Darwish Ibrahim A


    Full Text Available Abstract Background For therapeutic monitoring and pharmacokinetic studies of lenalidomide (LND, the potent drug for treatment of multiple myeloma (MM, a specific antibody was required for the development of a sensitive immunoassay system for the accurate determination of LND in plasma. Results In this study, a hapten of LND (N-glutaryl-LND was synthesized by introducing the glutaryl moiety, as a spacer, into the primary aromatic amine site of the LND molecular structure. The structure of the hapten (G-LND was confirmed by mass, 1H-NMR, and 13C spectrometric techniques. G-LND was coupled to each of bovine serum albumin (BSA and keyhole limpet hemocyanin (KLH proteins by ethyl-3-(3-dimethylaminopropyl carbodiimide as a coupling reagent. LND-KLH conjugate was used as an immunogen. Four female 2-3 months old New Zealand white rabbits were immunized with an emulsion of LND-KLH with Freund`s adjuvant. The immune response of the rabbits was monitored by direct enzyme-linked immunosorbent assay (ELISA using LND-BSA immobilized onto microwell plates as a solid phase. The rabbit that showed the highest antibody titer and affinity to LND was scarified and its sera were collected. The IgG fraction was isolated and purified by affinity chromatography on protein A column. The specificity of the purified antibody for LND was evaluated by indirect competitive ELISA using dexamethasone as a competitor as it is used with LND in a combination therapy. Conclusions The high affinity of the antibody (IC50 = 10 ng/mL will be useful in the development of an immunoassay system for the determination of plasma LND concentrations. Current research is going to optimize the assay conditions and validate the procedures for the routine application in clinical laboratories.

  10. Synthesis of hapten and preparation of specific polyclonal antibody with high affinity for lenalidomide, the potent drug for treatment of multiple myeloma. (United States)

    Darwish, Ibrahim A; Alzoman, Nourh Z; Abuhejail, Reem M; El-Samani, Tilal E


    For therapeutic monitoring and pharmacokinetic studies of lenalidomide (LND), the potent drug for treatment of multiple myeloma (MM), a specific antibody was required for the development of a sensitive immunoassay system for the accurate determination of LND in plasma. In this study, a hapten of LND (N-glutaryl-LND) was synthesized by introducing the glutaryl moiety, as a spacer, into the primary aromatic amine site of the LND molecular structure. The structure of the hapten (G-LND) was confirmed by mass, 1H-NMR, and 13C spectrometric techniques. G-LND was coupled to each of bovine serum albumin (BSA) and keyhole limpet hemocyanin (KLH) proteins by ethyl-3-(3-dimethylaminopropyl) carbodiimide as a coupling reagent. LND-KLH conjugate was used as an immunogen. Four female 2-3 months old New Zealand white rabbits were immunized with an emulsion of LND-KLH with Freund`s adjuvant. The immune response of the rabbits was monitored by direct enzyme-linked immunosorbent assay (ELISA) using LND-BSA immobilized onto microwell plates as a solid phase. The rabbit that showed the highest antibody titer and affinity to LND was scarified and its sera were collected. The IgG fraction was isolated and purified by affinity chromatography on protein A column. The specificity of the purified antibody for LND was evaluated by indirect competitive ELISA using dexamethasone as a competitor as it is used with LND in a combination therapy. The high affinity of the antibody (IC50 = 10 ng/mL) will be useful in the development of an immunoassay system for the determination of plasma LND concentrations. Current research is going to optimize the assay conditions and validate the procedures for the routine application in clinical laboratories.

  11. Online micro-solid-phase extraction based on boronate affinity monolithic column coupled with high-performance liquid chromatography for the determination of monoamine neurotransmitters in human urine. (United States)

    Yang, Xiaoting; Hu, Yufei; Li, Gongke


    Quantification of monoamine neurotransmitters is very important in diagnosing and monitoring of patients with neurological disorders. We developed an online analytical method to selectively determine urinary monoamine neurotransmitters, which coupled the boronate affinity monolithic column micro-solid-phase extraction with high-performance liquid chromatography (HPLC). The boronate affinity monolithic column was prepared by in situ polymerization of vinylphenylboronic acid (VPBA) and N,N'-methylenebisacrylamide (MBAA) in a stainless capillary column. The prepared monolithic column showed good permeability, high extraction selectivity and capacity. The column-to-column reproducibility was satisfactory and the enrichment factors were 17-243 for four monoamine neurotransmitters. Parameters that influence the online extraction efficiency, including pH of sample solution, flow rate of extraction and desorption, extraction volume and desorption volume were investigated. Under the optimized conditions, the developed method exhibited low limit of detection (0.06-0.80μg/L), good linearity (with R(2) between 0.9979 and 0.9993). The recoveries in urine samples were 81.0-105.5% for four monoamine neurotransmitters with intra- and inter-day RSDs of 2.1-8.2% and 3.7-10.6%, respectively. The online analytical method was sensitive, accurate, selective, reliable and applicable to analysis of trace monoamine neurotransmitters in human urine sample. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Efficient fabrication of high-capacity immobilized metal ion affinity chromatographic media: The role of the dextran-grafting process and its manipulation. (United States)

    Zhao, Lan; Zhang, Jingfei; Huang, Yongdong; Li, Qiang; Zhang, Rongyue; Zhu, Kai; Suo, Jia; Su, Zhiguo; Zhang, Zhigang; Ma, Guanghui


    Novel high-capacity Ni(2+) immobilized metal ion affinity chromatographic media were prepared through the dextran-grafting process. Dextran was grafted to an allyl-activated agarose-based matrix followed by functionalization for the immobilized metal ion affinity chromatographic media. With elaborate regulation of the allylation degree, dextran was completely or partly grafted to agarose microspheres, namely, completely dextran-grafted agarose microspheres and partly dextran-grafted ones, respectively. Confocal laser scanning microscope results demonstrated that a good adjustment of dextran-grafting degree was achieved, and dextran was distributed uniformly in whole completely dextran-grafted microspheres, while just distributed around the outside of the partly dextran-grafted ones. Flow hydrodynamic properties were improved greatly after the dextran-grafting process, and the flow velocity increased by about 30% compared with that of a commercial chromatographic medium (Ni Sepharose FF). A significant improvement of protein binding performance was also achieved by the dextran-grafting process, and partly dextran-grafted Ni(2+) chelating medium had a maximum binding capacity for His-tagged lactate dehydrogenase about 2.5 times higher than that of Ni Sepharose FF. The results indicated that this novel chromatographic medium is promising for applications in high-efficiency and large-scale protein purification. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Constitutive expression of a putative high-affinity nitrate transporter in Nicotiana plumbaginifolia: evidence for post-transcriptional regulation by a reduced nitrogen source. (United States)

    Fraisier, V; Gojon, A; Tillard, P; Daniel-Vedele, F


    The NpNRT2.1 gene encodes a putative inducible component of the high-affinity nitrate (NO3-) uptake system in Nicotiana plumbaginifolia. Here we report functional and physiological analyses of transgenic plants expressing the NpNRT2.1 coding sequence fused to the CaMV 35S or rolD promoters. Irrespective of the level of NO3- supplied, NO3- contents were found to be remarkably similar in wild-type and transgenic plants. Under specific conditions (growth on 10 mM NO3-), the steady-state NpNRT2. 1 mRNA level resulting from the deregulated transgene expression was accompanied by an increase in 15NO3- influx measured in the low concentration range. This demonstrates for the first time that the NRT2.1 sequence codes a limiting element of the inducible high-affinity transport system. Both 15NO3- influx and mRNA levels decreased in the wild type after exposure to ammonium, in agreement with previous results from many species. Surprisingly, however, influx was also markedly decreased in transgenic plants, despite stable levels of transgene expression in independent transformants after ammonium addition. We conclude that the conditions associated with the supply of a reduced nitrogen source such as ammonium, or with the generation of a further downstream metabolite, probably exert a repressive effect on NO3- influx at both transcriptional and post-transcriptional levels.

  14. Septide and neurokinin A are high-affinity ligands on the NK-1 receptor: evidence from homologous versus heterologous binding analysis. (United States)

    Hastrup, H; Schwartz, T W


    The three main tachykinins, substance P, neurokinin A (NKA), and neurokinin B, are believed to be selective ligands for respectively the NK-1, NK-2 and NK-3 receptors. However, NKA also has actions which cannot be mediated through its normal NK-2 receptor and the synthetic peptide [pGlu6,Pro9]-Substance P9-11--called septide--is known to have tachykinin-like actions despite its apparent lack of binding to any known tachykinin receptor. In the cloned NK-1 receptor expressed in COS-7 cells NKA and septide as expected were poor competitors for radiolabeled substance P. However, by using radiolabeled NKA and septide directly, it was found that both peptides in homologous binding assays as well as in competition against each other in fact bound to the NK-1 receptor with high affinity: Kd values of 0.51 +/- 0.15 nM (NKA) and 0.55 +/- 0.03 nM (septide). It is concluded that NKA and septide are high-affinity ligands for the NK-1 receptor but that they are poor competitors for substance P, which in contrast competes very well for binding with both NKA and septide.

  15. Fatty acid and drug binding to a low-affinity component of human serum albumin, purified by affinity chromatography

    DEFF Research Database (Denmark)

    Vorum, H; Pedersen, A O; Honoré, B


    Binding equilibria for decanoate to a defatted, commercially available human serum albumin preparation were investigated by dialysis exchange rate determinations. The binding isotherm could not be fitted by the general binding equation. It was necessary to assume that the preparation was a mixture...... of two albumin components about 40% of the albumin having high affinity and about 60% having low affinity. By affinity chromatography we succeeded in purifying the low-affinity component from the mixture. The high-affinity component, however, could not be isolated. We further analyzed the fatty acid...... and drug binding abilities of the low-affinity component. The fatty acids decanoate, laurate, myristate and palmitate were bound with higher affinity to the mixture than to the low-affinity component. Diazepam was bound with nearly the same affinity to the low-affinity component as to the albumin mixture...

  16. Continuous affine processes

    DEFF Research Database (Denmark)

    Buchardt, Kristian


    Affine processes possess the property that expectations of exponential affine transformations are given by a set of Riccati differential equations, which is the main feature of this popular class of processes. In this paper we generalise these results for expectations of more general transformati...

  17. SKF 525-A and cytochrome P-450 ligands inhibit with high affinity the binding of [3H]dextromethorphan and σligands to guinea pig brain

    International Nuclear Information System (INIS)

    Klein, M.; Canoll, P.D.; Musacchio, J.M.


    The DM 1 /σ 1 site binds dextromethorphan (DM) and σ receptor ligands. The broad binding specificity of this site and its peculiar subcellular distribution prompted us to explore the possibility that this site is a member of the cytochrome P-450 superfamily of enzymes. We tested the effects of the liver microsomal monooxygenase inhibitor SKF 525-A (Proadifen), and other P-450 substrates on the binding of [ 3 H]dextromethorphan, [ 3 H]3-(3-Hydroxyphenyl)-N-(1-propyl)piperidine and (+)-[ 3 H]1,3-Di-o-tolyl-guanidine ([ 3 H]DTG) to the guinea pig brain. SKF 525-A, l-lobeline and GBR-12909 inhibited the binding of the three labeled ligands with nM affinity. Each drug has identical nM K i values for the high-affinity site labeled by the three ligands. This indicated that they displaced the labeled ligands from the common DM 1 σ 1 site. Debrisoquine and sparteine, prototypical substrates for liver debrisoquine 4-hydroxylase, displayed K i values of 9-13 and 3-4 μM respectively against the three labeled ligands. These results, the broad specificity of the DM 1 /σ 1 binding site, and its peculiar subcellular distribution, raises the possibility that this binding site is a member of the cytochrome P-450 superfamily of isozymes, rather than a neurotransmitter receptor

  18. Vasoactive intestinal peptide (VIP) binds to guinea pig peritoneal eosinophils: A single class of binding sites with low affinity and high capacity

    International Nuclear Information System (INIS)

    Sakakibara, H.; Shima, K.; Takamatsu, J.; Said, S.I.


    VIP binds to specific receptors on lymphocytes and mononuclear cells and exhibits antiinflammatory properties. Eosinophils (Eos) contribute to inflammatory reactions but the regulation of Eos function is incompletely understood. The authors examined the binding of monoradioiodinated VIP, [Tyr( 125 I) 10 ] VIP ( 125 I-VIP), to Eos in guinea pigs. The interaction of 125 i-VIP with Eos was rapid, reversible, saturable and linearly dependent on the number of cells. At equilibrium the binding was competitively inhibited by native peptide or by the related peptide helodermin. Scatchard analysis suggested the presence of a single class of VIP binding sites with a low affinity and a high capacity. In the presence of isobutyl-methylxanthine, VIP, PHI or helodermin did not stimulate cyclic AMP accumulation in intact Eos, while PGE 2 or 1-isoproterenol did. VIP also did not inhibit superoxide anion generation from Eos stimulated by phorbol myristate acetate. The authors conclude that: (1) VIP binds to low-affinity, specific sites on guinea pig peritoneal eosinophils; (2) this binding is not coupled to stimulation of adenylate cyclase; and (3) the possible function of these binding sites is at present unknown

  19. Activation of high and low affinity dopamine receptors generates a closed loop that maintains a conductance ratio and its activity correlate

    Directory of Open Access Journals (Sweden)

    Wulf-Dieter Christian Krenz


    Full Text Available Neuromodulators alter network output and have the potential to destabilize a circuit. The mechanisms maintaining stability in the face of neuromodulation are not well described. Using the pyloric network in the crustacean stomatogastric nervous system, we show that dopamine (DA does not simply alter circuit output, but activates a closed loop in which DA-induced alterations in circuit output consequently drive a change in an ionic conductance to preserve a conductance ratio and its activity correlate. DA acted at low affinity type 1 receptors (D1Rs to induce an immediate modulatory decrease in the transient potassium current (IA of a pyloric neuron. This, in turn, advanced the activity phase of that component neuron, which disrupted its network function and thereby destabilized the circuit. DA simultaneously acted at high affinity D1Rs on the same neuron to confer activity-dependence upon the hyperpolarization activated current (Ih such that the DA-induced changes in activity subsequently reduced Ih. This DA-enabled, activity-dependent, intrinsic plasticity exactly compensated for the modulatory decrease in IA to restore the IA:Ih ratio and neuronal activity phase, thereby closing an open loop created by the modulator. Activation of closed loops to preserve conductance ratios may represent a fundamental operating principle neuromodulatory systems use to ensure stability in their target networks.

  20. Affinity-based, biophysical methods to detect and analyze ligand binding to recombinant proteins: matching high information content with high throughput. (United States)

    Holdgate, Geoff A; Anderson, Malcolm; Edfeldt, Fredrik; Geschwindner, Stefan


    Affinity-based technologies have become impactful tools to detect, monitor and characterize molecular interactions using recombinant target proteins. This can aid the understanding of biological function by revealing mechanistic details, and even more importantly, enables the identification of new improved ligands that can modulate the biological activity of those targets in a desired fashion. The selection of the appropriate technology is a key step in that process, as each one of the currently available technologies offers a characteristic type of biophysical information about the ligand-binding event. Alongside the indisputable advantages of each of those technologies they naturally display diverse restrictions that are quite frequently related to the target system to be studied but also to the affinity, solubility and molecular size of the ligands. This paper discusses some of the theoretical and experimental aspects of the most common affinity-based methods, what type of information can be gained from each one of those approaches, and what requirements as well as limitations are expected from working with recombinant proteins on those platforms and how those can be optimally addressed.

  1. Distribution and ultrastructure of neurons in opossum piriform cortex displaying immunoreactivity to GABA and GAD and high-affinity tritiated GABA uptake

    International Nuclear Information System (INIS)

    Haberly, L.B.; Hansen, D.J.; Feig, S.L.; Presto, S.


    GABAergic neurons have been identified in the piriform cortex of the opossum at light and electron microscopic levels by immunocytochemical localization of GABA and the GABA-synthesizing enzyme glutamic acid decarboxylase and by autoradiographic visualization of high-affinity 3 H-GABA uptake. Four major neuron populations have been distinguished on the basis of soma size, shape, and segregation at specific depths and locations: large horizontal cells in layer Ia of the anterior piriform cortex, small globular cells with thin dendrites concentrated in layers Ib and II of the posterior piriform cortex, and multipolar and fusiform cells concentrated in the deep part of layer III in anterior and posterior parts of the piriform cortex and the subjacent endopiriform nucleus. All four populations were well visualized with both antisera, but the large layer Ia horizontal cells displayed only very light 3 H-GABA uptake, thus suggesting a lack of local axon collaterals or lack of high-affinity GABA uptake sites. The large, ultrastructurally distinctive somata of layer Ia horizontal cells receive a very small number of symmetrical synapses; the thin, axonlike dendrites of small globular cells are exclusively postsynaptic and receive large numbers of both symmetrical and asymmetrical synapses, in contrast to somata which receive a small number of both types; and the deep multipolar and fusiform cells receive a highly variable number of symmetrical and asymmetrical synapses on somata and proximal dendrites. Labeled puncta of axon terminal dimensions were found in large numbers in the neuropil surrounding pyramidal cell somata in layer II and in the endopiriform nucleus. Moderately large numbers of labeled puncta were found in layer I at the depth of pyramidal cell apical dendrites with greater numbers in layer Ia at the depth of distal apical segments than in layer Ib

  2. Affinity in electrophoresis. (United States)

    Heegaard, Niels H H


    The journal Electrophoresis has greatly influenced my approaches to biomolecular affinity studies. The methods that I have chosen as my main tools to study interacting biomolecules--native gel and later capillary zone electrophoresis--have been the topic of numerous articles in Electrophoresis. Below, the role of the journal in the development and dissemination of these techniques and applications reviewed. Many exhaustive reviews on affinity electrophoresis and affinity CE have been published in the last few years and are not in any way replaced by the present deliberations that are focused on papers published by the journal.

  3. Two classes of astrocytes in the adult human and pig retina in terms of their expression of high affinity NGF receptor (TrkA). (United States)

    Ruiz-Ederra, Javier; Hitchcock, Peter F; Vecino, Elena


    Astrocytes have been implicated in axon guidance and synaptic regeneration in the retina and these processes involve activation of the high affinity nerve growth factor receptor, known as the tyrosine kinase A (TrkA) receptor. The purpose of the present study was to characterize the expression of TrkA in astrocytes of the adult pig and human retina. To this end, sections of human and pig retinas were immunolabeled with a combination of antibodies to glial fibrillary acidic protein (GFAP) and TrkA. Our study revealed that most of the GFAP-positive cells express TrkA, whereas a rare, novel subpopulation of astrocytes was found to be devoid of TrkA. Our results support the idea that astrocytes play an important neurotrophic role in the retina.

  4. Spot 42 Small RNA Regulates Arabinose-Inducible araBAD Promoter Activity by Repressing Synthesis of the High-Affinity Low-Capacity Arabinose Transporter (United States)

    Chen, Jiandong


    ABSTRACT The l-arabinose-inducible araBAD promoter (PBAD) enables tightly controlled and tunable expression of genes of interest in a broad range of bacterial species. It has been used successfully to study bacterial sRNA regulation, where PBAD drives expression of target mRNA translational fusions. Here we report that in Escherichia coli, Spot 42 sRNA regulates PBAD promoter activity by affecting arabinose uptake. We demonstrate that Spot 42 sRNA represses araF, a gene encoding the AraF subunit of the high-affinity low-capacity arabinose transporter AraFGH, through direct base-pairing interactions. We further show that endogenous Spot 42 sRNA is sufficient to repress araF expression under various growth conditions. Finally, we demonstrate this posttranscriptional repression has a biological consequence, decreasing the induction of PBAD at low levels of arabinose. This problem can be circumvented using strategies reported previously for avoiding all-or-none induction behavior, such as through constitutive expression of the low-affinity high-capacity arabinose transporter AraE or induction with a higher concentration of inducers. This work adds araF to the set of Spot 42-regulated genes, in agreement with previous studies suggesting that Spot 42, itself negatively regulated by the cyclic AMP (cAMP) receptor protein-cAMP complex, reinforces the catabolite repression network. IMPORTANCE The bacterial arabinose-inducible system is widely used for titratable control of gene expression. We demonstrate here that a posttranscriptional mechanism mediated by Spot 42 sRNA contributes to the functionality of the PBAD system at subsaturating inducer concentrations by affecting inducer uptake. Our finding extends the inputs into the known transcriptional control for the PBAD system and has implications for improving its usage for tunable gene expression. PMID:27849174

  5. Analysis of drug-protein binding using on-line immunoextraction and high-performance affinity microcolumns: Studies with normal and glycated human serum albumin. (United States)

    Matsuda, Ryan; Jobe, Donald; Beyersdorf, Jared; Hage, David S


    A method combining on-line immunoextraction microcolumns with high-performance affinity chromatography (HPAC) was developed and tested for use in examining drug-protein interactions with normal or modified proteins. Normal human serum albumin (HSA) and glycated HSA were used as model proteins for this work. High-performance immunoextraction microcolumns with sizes of 1.0-2.0 cm × 2.1mm i.d. and containing anti-HSA polyclonal antibodies were developed and tested for their ability to bind normal HSA or glycated HSA. These microcolumns were able to extract up to 82-93% for either type of protein at 0.05-0.10 mL/min and had a binding capacity of 0.34-0.42 nmol HSA for a 1.0 cm × 2.1mm i.d. microcolumn. The immunoextraction microcolumns and their adsorbed proteins were tested for use in various approaches for drug binding studies. Frontal analysis was used with the adsorbed HSA/glycated HSA to measure the overall affinities of these proteins for the drugs warfarin and gliclazide, giving comparable values to those obtained previously using similar protein preparations that had been covalently immobilized within HPAC columns. Zonal elution competition studies with gliclazide were next performed to examine the specific interactions of this drug at Sudlow sites I and II of the adsorbed proteins. These results were also comparable to those noted in prior work with covalently immobilized samples of normal HSA or glycated HSA. These experiments indicated that drug-protein binding studies can be carried out by using on-line immunoextraction microcolumns with HPAC. The same method could be used in the future with clinical samples and other drugs or proteins of interest in pharmaceutical studies or biomedical research. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. ADCC employing an NK cell line (haNK) expressing the high affinity CD16 allele with avelumab, an anti-PD-L1 antibody. (United States)

    Jochems, Caroline; Hodge, James W; Fantini, Massimo; Tsang, Kwong Y; Vandeveer, Amanda J; Gulley, James L; Schlom, Jeffrey


    NK-92 cells, and their derivative, designated aNK, were obtained from a patient with non-Hodgkin lymphoma. Prior clinical studies employing adoptively transferred irradiated aNK cells have provided evidence of clinical benefit and an acceptable safety profile. aNK cells have now been engineered to express IL-2 and the high affinity (ha) CD16 allele (designated haNK). Avelumab is a human IgG1 anti-PD-L1 monoclonal antibody, which has shown evidence of clinical activity in a range of human tumors. Prior in vitro studies have shown that avelumab has the ability to mediate antibody-dependent cell-mediated cytotoxicity (ADCC) of human tumor cells when combined with NK cells. In the studies reported here, the ability of avelumab to enhance the lysis of a range of human carcinoma cells by irradiated haNK cells via the ADCC mechanism is demonstrated; this ADCC is shown to be inhibited by anti-CD16 blocking antibody and by concanamycin A, indicating the use of the granzyme/perforin pathway in tumor cell lysis. Studies also show that while NK cells have the ability to lyse aNK or haNK cells, the addition of NK cells to irradiated haNK cells does not inhibit haNK-mediated lysis of human tumor cells, with or without the addition of avelumab. Avelumab-mediated lysis of tumor cells by irradiated haNK cells is also shown to be similar to that of NK cells bearing the V/V Fc receptor high affinity allele. These studies thus provide the rationale for the clinical evaluation of the combined use of avelumab with that of irradiated adoptively transferred haNK cells. © 2017 UICC.

  7. Lectin affinity electrophoresis. (United States)

    Kobayashi, Yuka


    An interaction or a binding event typically changes the electrophoretic properties of a molecule. Affinity electrophoresis methods detect changes in the electrophoretic pattern of molecules (mainly macromolecules) that occur as a result of biospecific interactions or complex formation. Lectin affinity electrophoresis is a very effective method for the detection and analysis of trace amounts of glycobiological substances. It is particularly useful for isolating and separating the glycoisomers of target molecules. Here, we describe a sensitive technique for the detection of glycoproteins separated by agarose gel-lectin affinity electrophoresis that uses antibody-affinity blotting. The technique is tested using α-fetoprotein with lectin (Lens culinaris agglutinin and Phaseolus vulgaris agglutinin)-agarose gels.

  8. A Generalized Affine Isoperimetric Inequality


    Chen, Wenxiong; Howard, Ralph; Lutwak, Erwin; Yang, Deane; Zhang, Gaoyong


    A purely analytic proof is given for an inequality that has as a direct consequence the two most important affine isoperimetric inequalities of plane convex geometry: The Blaschke-Santalo inequality and the affine isoperimetric inequality of affine differential geometry.

  9. Electron affinities: theoretical

    International Nuclear Information System (INIS)

    Kaufman, J.J.


    A brief description is given of the conceptual background and formalism of the various ab-initio and semi-ab-initio quantum computational techniques for calculating atomic and molecular electron affinities: Hartree--Fock--Roothaan SCF, configuration interaction (CI), multiconfiguration SCF (MC-SCF), Bethe--Goldstone, superposition of configurations (SOC), ab-initio effective core model potentials, Xα-MS, plus other less common methods. Illustrative and comparative examples of electron affinities calculated by these various methods are presented

  10. Domain interplay in the urokinase receptor. Requirement for the third domain in high affinity ligand binding and demonstration of ligand contact sites in distinct receptor domains

    DEFF Research Database (Denmark)

    Behrendt, N; Ronne, E; Dano, K


    by chemical cross-linking, but quantitative binding/competition studies showed that the apparent ligand affinity was 100- to 1000-fold lower than that of the intact suPAR. This loss of affinity was comparable with the loss found after cleavage between the first domain (D1) and D(2 + 3), using chymotrypsin...

  11. High-affinity binding of [3H]estradiol-17 beta by an estrogen receptor in the liver of the turtle

    International Nuclear Information System (INIS)

    Ho, S.M.; Fehrer, S.; Yu, M.; Liang, L.C.; Press, D.


    Specific [3H]estradiol-17 beta ([3H]E2) binding activity (EBA) with characteristics of an estrogen receptor (ER) was demonstrated in cytosols and nuclear extracts of the female turtle, Chrysemys picta. Three different receptor assays (dextran-coated charcoal assay, hydroxylapatite batch procedure, and DNA-cellulose chromatography) were evaluated in terms of their applicability in analyzing large numbers of samples. For the measurement of cytosolic EBA, the hydroxylapatite batch procedure was found to be the most reliable assay. On the other hand, the dextran-coated charcoal assay was found to be the most appropriate method for the measurement of nuclear EBA. Turtle hepatic EBA binds [3H]E2 with high affinity (cytosolic, 17.4 +/- 2.8 X 10(9) M-1; nuclear, 17.7 +/- 1.9 X 10(9) M-1), limited capacity (cytosolic, 133.7 +/- 4.6 fmol/g tissue; nuclear, 81.1 +/- 9.0 fmol/g tissue), and strict steroid specificity. The EBA bound natural estrogens (E2, estrone, estriol) as well as the nonsteroidal estrogen, diethylstilbestrol, but exhibited little affinity for androgens, progesterone, or corticosterone. The turtle hepatic EBA resembled mammalian and avian ERs in terms of binding characteristics; however, unlike mammalian and avian ERs it was shown to be heat-labile. Incubation at 30 degrees caused rapid loss of [3H]E2 binding activity in both cytosolic and nuclear fractions. The exchange between [3H]E2 and the endogenously bound estrogen was slow at 4 and 15 degrees, but the exchange process was facilitated in the presence of the chaotropic salt, NaSCN. Establishment of quantitation methods for both cytosolic and nuclear forms of EBA will enable future investigation of the mechanism and regulation of estrogen action in the liver of this turtle species

  12. Preliminary assessment of extrastriatal dopamine d-2 receptor binding in the rodent and nonhuman primate brains using the high affinity radioligand, {sup 18}F-fallypride

    Energy Technology Data Exchange (ETDEWEB)

    Mukherjee, Jogeshwar E-mail:; Yang, Z.-Y.; Brown, Terry; Lew, Robert; Wernick, Miles; Ouyang Xiaohu; Yasillo, Nicholas; Chen, C.-T.; Mintzer, Robert; Cooper, Malcolm


    We have identified the value of {sup 18}F-fallypride {l_brace}(S)-N-[(1-allyl-2-pyrrolidinyl)methyl]-5-(3-[{sup 18}F]fluoropropyl)-2,3-dim= ethoxybenzamide{r_brace}, as a dopamine D-2 receptor radiotracer for the study of striatal and extrastriatal receptors. Fallypride exhibits high affinities for D-2 and D-3 subtypes and low affinity for D-4 ({sup 3}H-spiperone IC{sub 50}s: D-2=0.05 nM [rat striata], D-3=0.30 nM [SF9 cell lines, rat recombinant], and D-4=240 nM [CHO cell lines, human recombinant]). Biodistribution in the rat brain showed localization of {sup 18}F-fallypride in striata and extrastriatal regions such as the frontal cortex, parietal cortex, amygdala, hippocampus, thalamus, and hypothalamus. In vitro autoradiographic studies in sagittal slices of the rat brain showed localization of {sup 18}F-fallypride in striatal and several extrastriatal regions, including the medulla. Positron emission tomography (PET) experiments with {sup 18}F-fallypride in male rhesus monkeys were carried out in a PET VI scanner. In several PET experiments, apart from the specific binding seen in the striatum, specific binding of {sup 18}F-fallypride was also identified in extracellular regions (in a lower brain slice, possibly the thalamus). Specific binding in the extrastriata was, however, significantly lower compared with that observed in the striata of the monkeys (extrastriata/cerebellum = 2, striata/cerebellum = 10). Postmortem analysis of the monkey brain revealed significant {sup 18}F-fallypride binding in the striata, whereas binding was also observed in extrastriatal regions such as the thalamus, cortical areas, and brain stem.

  13. Molecular cloning of a second subunit of the receptor for human granulocyte - macrophage colony-stimulating factor (GM-CSF): Reconstitution of a high-affinity GM-CSF receptor

    International Nuclear Information System (INIS)

    Hayashida, Kazuhiro; Kitamura, Toshio; Gorman, D.M.; Miyajima, Atsushi; Arai, Kenichi; Yokota, Takashi


    Using the mouse interleukin 3 (IL-3) receptor cDNA as a probe, the authors obtained a monologous cDNA (KH97) from a cDNA library of a human hemopoietic cell line, TF-1. The protein encoded by the KH97 cDNA has 56% amino acid sequence identity with the mouse IL-3 receptor and retains features common to the family of cytokine receptors. Fibroblasts transfected with the KH97 cDNA expressed a protein of 120 kDa but did not bind any human cytokines, including IL-3 and granulocyte - macrophage colony-stimulating factor (GM-CSF). Interestingly, cotransfection of cDNAs for KH97 and the low-affinity human GM-CSF receptor in fibroblasts resulted in formation of a high-affinity receptor for GM-CSF. The dissociation rate of GM-CSF from the reconstituted high-affinity receptor was slower than that from the low-affinity site, whereas the association rate was unchanged. Cross-linking of 125 I-labeled GM-CSF to fibroblasts cotransfected with both cDNAs revealed the same cross-linking patterns as in TF-1 cells - i.e., two major proteins of 80 and 120 kDa which correspond to the low-affinity GM-CSF receptor and the KH97 protein, respectively. These results indicate that the high-affinity GM-CSF receptor is composed of at least two components in a manner analogous to the IL-2 receptor. They therefore propose to designate the low-affinity GM-CSF receptor and the KH97 protein as the α and β subunits of the GM-CSF receptor, respectively

  14. CC12, a high-affinity ligand for [3H]cimetidine binding, is an improgan antagonist

    NARCIS (Netherlands)

    Hough, L.H.; Nalwalk, J.B.; Phillips, J.R.; Kern, B.; Shan, Z.; Wentland, M.; de Esch, I.J.P.; Janssen, EA; Barr, T.; Stadel, R.


    Improgan, a chemical congener of cimetidine, is a highly effective non-opioid analgesic when injected into the CNS. Despite extensive characterization, neither the improgan receptor, nor a pharmacological antagonist of improgan has been previously described. Presently, the specific binding of [

  15. Improving image segmentation by learning region affinities

    Energy Technology Data Exchange (ETDEWEB)

    Prasad, Lakshman [Los Alamos National Laboratory; Yang, Xingwei [TEMPLE UNIV.; Latecki, Longin J [TEMPLE UNIV.


    We utilize the context information of other regions in hierarchical image segmentation to learn new regions affinities. It is well known that a single choice of quantization of an image space is highly unlikely to be a common optimal quantization level for all categories. Each level of quantization has its own benefits. Therefore, we utilize the hierarchical information among different quantizations as well as spatial proximity of their regions. The proposed affinity learning takes into account higher order relations among image regions, both local and long range relations, making it robust to instabilities and errors of the original, pairwise region affinities. Once the learnt affinities are obtained, we use a standard image segmentation algorithm to get the final segmentation. Moreover, the learnt affinities can be naturally unutilized in interactive segmentation. Experimental results on Berkeley Segmentation Dataset and MSRC Object Recognition Dataset are comparable and in some aspects better than the state-of-art methods.

  16. Interactions of dopaminergic agonists and antagonists with dopaminergic D3 binding sites in rat striatum. Evidence that [3H]dopamine can label a high affinity agonist-binding state of the D1 dopamine receptor

    International Nuclear Information System (INIS)

    Leff, S.E.; Creese, I.


    The interactions of dopaminergic agonists and antagonists with 3 H-agonist labeled D3 dopaminergic binding sites of rat striatum have been characterized by radioligand-binding techniques. When the binding of [ 3 H]dopamine and [ 3 H]apomorphine to D2 dopamine receptors is blocked by the inclusion of D2 selective concentrations of unlabeled spiroperidol or domperidone, these ligands appear to label selectively the previously termed D3 binding site. Antagonist/[ 3 H]dopamine competition curves are of uniformly steep slope (nH . 1.0), suggesting the presence of a single D3 binding site. The relative potencies of antagonists to inhibit D3 specific [ 3 H]dopamine binding are significantly correlated with their potencies to block D1 dopamine receptors as measured by the inhibition of both dopamine-stimulated adenylate cyclase and [ 3 H]flupentixol-binding activities. The affinities of agonists to inhibit D3 specific [ 3 H]dopamine binding are also correlated with estimates of these agonists affinities for the high affinity binding component of agonist/[ 3 H]flupentixol competition curves. Both D3 specific [ 3 H] dopamine binding and the high affinity agonist-binding component of dopamine/[ 3 H]flupentixol competition curves show a similar sensitivity to guanine nucleotides. Taken together, these data strongly suggest that the D3 binding site is related to a high affinity agonist-binding state of the D1 dopamine receptor

  17. Assessing high affinity binding to HLA-DQ2.5 by a novel peptide library based approach

    DEFF Research Database (Denmark)

    Jüse, Ulrike; Arntzen, Magnus; Højrup, Peter


    Here we report on a novel peptide library based method for HLA class II binding motif identification. The approach is based on water soluble HLA class II molecules and soluble dedicated peptide libraries. A high number of different synthetic peptides are competing to interact with a limited amount...... library. The eluted sequences fit very well with the previously described HLA-DQ2.5 peptide binding motif. This novel method, limited by library complexity and sensitivity of mass spectrometry, allows the analysis of several thousand synthetic sequences concomitantly in a simple water soluble format....

  18. Carbon-11 labelling of eticlopride in two different positions - a selective high-affinity ligand for the study of dopamine D-2 receptors using PET

    International Nuclear Information System (INIS)

    Halldin, Christer; Hall, Haakan


    A new highly selective high-affinity dopamine D-2 receptor antagonist, eticlopride ((-)-(S)-5-chloro-3-ethyl-N-(1-ethyl-2-pyrrolidinyl)methyl)-6-methoxysalicylamide), was labelled with 11 C in two different positions ([N-ethyl- 11 C]eticlopride (I) and ([methyl- 11 C]eticlopride (II)). Product I was prepared by N-alkylation of the N-desethyl compound with [ 11 C]ethyl iodide. II was prepared by O-alkylation of the diphenolic precursor with [ 11 C]methyl iodide followed by separation of the two methylated products. The radiochemical yields were 15-20% (EOB) with an overall synthesis time of 45-60 min. Both compounds were isolated by semi-preparative HPLC and the radiochemical purity was in both cases > 99%. I was injected i.v. in a Cynomolgus monkey and brain radioactivity was measured by positron emission tomography (PET). The specific activity was 70 Ci/mmol at time of injection. There was a marked accumulation of radioactivity in the basal ganglia, regions known to have a high density of dopamine D-2 receptors. (author)

  19. Mitochondrial Ca2+ influx and efflux rates in guinea pig cardiac mitochondria: low and high affinity effects of cyclosporine A. (United States)

    Wei, An-Chi; Liu, Ting; Cortassa, Sonia; Winslow, Raimond L; O'Rourke, Brian


    Ca(2+) plays a central role in energy supply and demand matching in cardiomyocytes by transmitting changes in excitation-contraction coupling to mitochondrial oxidative phosphorylation. Matrix Ca(2+) is controlled primarily by the mitochondrial Ca(2+) uniporter and the mitochondrial Na(+)/Ca(2+) exchanger, influencing NADH production through Ca(2+)-sensitive dehydrogenases in the Krebs cycle. In addition to the well-accepted role of the Ca(2+)-triggered mitochondrial permeability transition pore in cell death, it has been proposed that the permeability transition pore might also contribute to physiological mitochondrial Ca(2+) release. Here we selectively measure Ca(2+) influx rate through the mitochondrial Ca(2+) uniporter and Ca(2+) efflux rates through Na(+)-dependent and Na(+)-independent pathways in isolated guinea pig heart mitochondria in the presence or absence of inhibitors of mitochondrial Na(+)/Ca(2+) exchanger (CGP 37157) or the permeability transition pore (cyclosporine A). cyclosporine A suppressed the negative bioenergetic consequences (ΔΨ(m) loss, Ca(2+) release, NADH oxidation, swelling) of high extramitochondrial Ca(2+) additions, allowing mitochondria to tolerate total mitochondrial Ca(2+) loads of >400nmol/mg protein. For Ca(2+) pulses up to 15μM, Na(+)-independent Ca(2+) efflux through the permeability transition pore accounted for ~5% of the total Ca(2+) efflux rate compared to that mediated by the mitochondrial Na(+)/Ca(2+) exchanger (in 5mM Na(+)). Unexpectedly, we also observed that cyclosporine A inhibited mitochondrial Na(+)/Ca(2+) exchanger-mediated Ca(2+) efflux at higher concentrations (IC(50)=2μM) than those required to inhibit the permeability transition pore, with a maximal inhibition of ~40% at 10μM cyclosporine A, while having no effect on the mitochondrial Ca(2+) uniporter. The results suggest a possible alternative mechanism by which cyclosporine A could affect mitochondrial Ca(2+) load in cardiomyocytes, potentially

  20. Pivotal role of α2 Na+ pumps and their high affinity ouabain binding site in cardiovascular health and disease (United States)

    Chen, Ling; Hamlyn, John M.; Leenen, Frans H. H.; Lingrel, Jerry B.; Wier, W. Gil; Zhang, Jin


    Abstract Reduced smooth muscle (SM)‐specific α2 Na+ pump expression elevates basal blood pressure (BP) and increases BP sensitivity to angiotensin II (Ang II) and dietary NaCl, whilst SM‐α2 overexpression lowers basal BP and decreases Ang II/salt sensitivity. Prolonged ouabain infusion induces hypertension in rodents, and ouabain‐resistant mutation of the α2 ouabain binding site (α2R/R mice) confers resistance to several forms of hypertension. Pressure overload‐induced heart hypertrophy and failure are attenuated in cardio‐specific α2 knockout, cardio‐specific α2 overexpression and α2R/R mice. We propose a unifying hypothesis that reconciles these apparently disparate findings: brain mechanisms, activated by Ang II and high NaCl, regulate sympathetic drive and a novel neurohumoral pathway mediated by both brain and circulating endogenous ouabain (EO). Circulating EO modulates ouabain‐sensitive α2 Na+ pump activity and Ca2+ transporter expression and, via Na+/Ca2+ exchange, Ca2+ homeostasis. This regulates sensitivity to sympathetic activity, Ca2+ signalling and arterial and cardiac contraction. PMID:27350568

  1. Production of low-affinity penicillin-binding protein by low- and high-resistance groups of methicillin-resistant Staphylococcus aureus. (United States)

    Murakami, K; Nomura, K; Doi, M; Yoshida, T


    Methicillin- and cephem-resistant Staphylococcus aureus (137 strains) for which the cefazolin MICs are at least 25 micrograms/ml could be classified into low-resistance (83% of strains) and high-resistance (the remaining 17%) groups by the MIC of flomoxef (6315-S), a 1-oxacephalosporin. The MICs were less than 6.3 micrograms/ml and more than 12.5 micrograms/ml in the low- and high-resistance groups, respectively. All strains produced penicillin-binding protein 2' (PBP 2'), which has been associated with methicillin resistance and which has very low affinity for beta-lactam antibiotics. Production of PBP 2' was regulated differently in low- and high-resistance strains. With penicillinase-producing strains of the low-resistance group, cefazolin, cefamandole, and cefmetazole induced PBP 2' production about 5-fold, while flomoxef induced production 2.4-fold or less. In contrast, penicillinase-negative variants of low-resistance strains produced PBP 2' constitutively in large amounts and induction did not occur. With high-resistance strains, flomoxef induced PBP 2' to an extent similar to that of cefazolin in both penicillinase-producing and -negative strains, except for one strain in which the induction did not occur. The amount of PBP 2' induced by beta-lactam antibiotics in penicillinase-producing strains of the low-resistance group correlated well with resistance to each antibiotic. Large amounts of PBP 2' in penicillinase-negative variants of the low-resistance group did not raise the MICs of beta-lactam compounds, although these strains were more resistant when challenged with flomoxef for 2 h. Different regulation of PBP 2' production was demonstrated in the high- and low-resistance groups, and factor(s) other than PBP 2' were suggested to be involved in the methicillin resistance of high-resistance strains. Images PMID:3499861

  2. [Structure-functional organization of eukaryotic high-affinity copper importer CTR1 determines its ability to transport copper, silver and cisplatin]. (United States)

    Skvortsov, A N; Zatulovskiĭ, E A; Puchkova, L V


    It was shown recently, that high affinity Cu(I) importer eukaryotic protein CTR1 can also transport in vitro abiogenic Ag(I) ions and anticancer drug cisplatin. At present there is no rational explanation how CTR1 can transfer platinum group, which is different by coordination properties from highly similar Cu(I) and Ag(I). To understand this phenomenon we analyzed 25 sequences of chordate CTR1 proteins, and found out conserved patterns of organization of N-terminal extracellular part of CTR1 which correspond to initial metal binding. Extracellular copper-binding motifs were qualified by their coordination properties. It was shown that relative position of Met- and His-rich copper-binding motifs in CTR1 predisposes the extracellular CTR1 part to binding of copper, silver and cisplatin. Relation between tissue-specific expression of CTR1 gene, steady-state copper concentration, and silver and platinum accumulation in organs of mice in vivo was analyzed. Significant positive but incomplete correlation exists between these variables. Basing on structural and functional peculiarities of N-terminal part of CTR1 a hypothesis of coupled transport of copper and cisplatin has been suggested, which avoids the disagreement between CTR1-mediated cisplatin transport in vitro, and irreversible binding of platinum to Met-rich peptides.

  3. PdeH, a high-affinity cAMP phosphodiesterase, is a key regulator of asexual and pathogenic differentiation in Magnaporthe oryzae.

    Directory of Open Access Journals (Sweden)

    Ravikrishna Ramanujam


    Full Text Available Cyclic AMP-dependent pathways mediate the communication between external stimuli and the intracellular signaling machinery, thereby influencing important aspects of cellular growth, morphogenesis and differentiation. Crucial to proper function and robustness of these signaling cascades is the strict regulation and maintenance of intracellular levels of cAMP through a fine balance between biosynthesis (by adenylate cyclases and hydrolysis (by cAMP phosphodiesterases. We functionally characterized gene-deletion mutants of a high-affinity (PdeH and a low-affinity (PdeL cAMP phosphodiesterase in order to gain insights into the spatial and temporal regulation of cAMP signaling in the rice-blast fungus Magnaporthe oryzae. In contrast to the expendable PdeL function, the PdeH activity was found to be a key regulator of asexual and pathogenic development in M. oryzae. Loss of PdeH led to increased accumulation of intracellular cAMP during vegetative and infectious growth. Furthermore, the pdeHDelta showed enhanced conidiation (2-3 fold, precocious appressorial development, loss of surface dependency during pathogenesis, and highly reduced in planta growth and host colonization. A pdeHDelta pdeLDelta mutant showed reduced conidiation, exhibited dramatically increased (approximately 10 fold cAMP levels relative to the wild type, and was completely defective in virulence. Exogenous addition of 8-Br-cAMP to the wild type simulated the pdeHDelta defects in conidiation as well as in planta growth and development. While a fully functional GFP-PdeH was cytosolic but associated dynamically with the plasma membrane and vesicular compartments, the GFP-PdeL localized predominantly to the nucleus. Based on data from cAMP measurements and Real-Time RTPCR, we uncover a PdeH-dependent biphasic regulation of cAMP levels during early and late stages of appressorial development in M. oryzae. We propose that PdeH-mediated sustenance and dynamic regulation of cAMP signaling

  4. An HIV-1 encoded peptide mimics the DNA binding loop of NF-κB and binds thioredoxin with high affinity

    International Nuclear Information System (INIS)

    Su Guoping; Wang Min; Taylor, Ethan Will


    Pro-fs is a human immunodeficiency virus type 1 (HIV-l)-encoded putative selenoprotein, predicted by a theoretical analysis of the viral genome; it is potentially expressed by a -1 frameshift from the protease coding region. Pro-fs has significant sequence similarity to the DNA binding loop of nuclear factor kappa B (NF-κB), which is known to bind thioredoxin (Trx). We hypothesize that the putative HIV-1 pro-fs gene product functions by mimicry of NF-κB via binding to Trx. The hypothesis was tested in vitro by co-immunoprecipitation and GST-pull down assays, using a purified mutant pro-fs protein, in which the two potential selenocysteine residues were mutated to cysteines, in order to permit expression in bacteria. Both experiments showed that pro-fs binds to human wild type Trx (Trx-wt) with high affinity. Mutation of the two conserved cysteine residues in the Trx active site redox center to serine (Ser) (Trx-CS) weakened but failed to abolish the interaction. In pro-fs-transfected 293T cells, using confocal microscopy and fluorescence resonance energy transfer (FRET), we have observed that pro-fs localizes in cell nuclei and forms oligomers. Upon stimulation by phorbol 12-myristate 13-acetate (PMA), Trx translocates into cell nuclei. Significant FRET efficiency was detected in the nuclei of PMA-stimulated 293T cells co-expressing fluorescence-tagged pro-fs and Trx-wt or Trx-CS. These results indicate that in living cells the double cysteine mutant of pro-fs binds to both Trx and Trx-CS with high affinity, suggesting that Trx-pro-fs binding is a structurally-specific interaction, involving more of the Trx molecule than just its active site cysteine residues. These results establish the capacity for functional mimicry of the Trx binding ability of the NF-κB/Rel family of transcription factors by the putative HIV-1 pro-fs protein

  5. 2,2'-Dithiobis(N-ethyl-spermine-5-carboxamide) is a high affinity, membrane-impermeant antagonist of the mammalian polyamine transport system. (United States)

    Huber, M; Pelletier, J G; Torossian, K; Dionne, P; Gamache, I; Charest-Gaudreault, R; Audette, M; Poulin, R


    We have synthesized 2,2'-dithiobis(N-ethyl-spermine-5-carboxamide) (DESC), its thiol monomer (MESC), and the mixed MESC-cysteamine disulfide (DEASC) as potential inhibitors of polyamine transport in mammalian cells. DESC was the most potent antagonist of spermine transport in ZR-75-1 human breast cancer cells, with Ki values of 5. 0 +/- 0.7, 80 +/- 31, and 16 +/- 3 microM for DESC, MESC, and DEASC, respectively. DESC also strongly blocked putrescine and spermidine uptake in ZR-75-1 cells (Ki = 1.6 +/- 0.5 and 2.7 +/- 1.1 microM, respectively). While DESC and MESC were purely competitive inhibitors of putrescine transport, DEASC was a mixed competitive/noncompetitive antagonist. Remarkably, DESC was virtually impermeant in ZR-75-1 cells despite its low Ki toward polyamine transport. The marked difference in affinity between DESC and MESC was essentially due to the tail-to-tail juxtaposition of two spermine-like structures, suggesting that dimeric ligands of the polyamine transporter might simultaneously interact with more than one binding site. While DESC strongly decreased the initial rate of [3H]spermidine transport, even a 40-fold molar excess of antagonist could not completely abolish intracellular spermidine accumulation. Moreover, as little as 0.3 microM spermidine fully restored growth in ZR-75-1 cells treated with an inhibitor of polyamine biosynthesis in the presence of 50 microM DESC, thus emphasizing the importance of uptake of trace amounts of exogenous polyamines. Thus, reducing the exogenous supply of polyamines with a potent competitive inhibitor may be kinetically inadequate to block replenishment of the polyamine pool in polyamine-depleted tumor cells that display high transport capacity. These results demonstrate that polyamine analogues cross-linked into a dimeric structure such as DESC interact with high affinity with the mammalian polyamine carrier without being used as substrates. These novel properties provide a framework for the design of

  6. Synthesis and characterization of [{sup 76}Br]-labeled high-affinity A{sub 3} adenosine receptor ligands for positron emission tomography

    Energy Technology Data Exchange (ETDEWEB)

    Kiesewetter, Dale O. [Positron Emission Tomography Radiochemistry Group, NIBIB, Clinical Center, National Institutes of Health, Bethesda, MD 20892 (United States)], E-mail:; Lang Lixin; Ma Ying; Bhattacharjee, Abesh Kumar [Positron Emission Tomography Radiochemistry Group, NIBIB, Clinical Center, National Institutes of Health, Bethesda, MD 20892 (United States); Gao, Zhan-Guo; Joshi, Bhalchandra V.; Melman, Artem; Castro, Sonia de; Jacobson, Kenneth A. [Molecular Recognition Section, Laboratory of Bioorganic Chemistry, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD 20892 (United States)


    Introduction: Bromine-76-radiolabeled analogues of previously reported high-affinity A{sub 3} adenosine receptor (A{sub 3}AR) nucleoside ligands have been prepared as potential radiotracers for positron emission tomography. Methods: The radiosyntheses were accomplished by oxidative radiobromination on the N{sup 6}-benzyl moiety of trimethyltin precursors. Biodistribution studies of the kinetics of uptake were conducted in awake rats. Results: We prepared an agonist ligand {l_brace}[{sup 76}Br](1'S,2'R,3'S,4'R,5'S)-4'-{l_brace}2-chloro-6-[(3-bromophenylmethyl)amino] purin-9-yl{r_brace}-1'-(methylaminocarbonyl)bicyclo[3.1.0]hexane-2',3'-diol (MRS3581){r_brace} in 59% radiochemical yield with a specific activity of 19.5 GBq/{mu}mol and an antagonist ligand {l_brace}[{sup 76}Br](1'R,2'R,3'S,4'R,5'S)-4'-(6-(3-bromobenzylamino) -2-chloro-9H-purin-9-yl)bicyclo[3.1.0]hexane-2',3'-diol (MRS5147){r_brace} in 65% radiochemical yield with a specific activity of 22 GBq/{mu}mol. The resultant products exhibited the expected high affinity (K{sub i}{approx}0.6 nM) and specific binding at the human A{sub 3}AR in vitro. Biodistribution studies in the rat showed uptake in the organs of excretion and metabolism. The antagonist MRS5147 exhibited increasing uptake in testes, an organ that contains significant quantities of A{sub 3}AR, over a 2-h time course, which suggests the presence of a specific A{sub 3}AR retention mechanism. Conclusion: We were able to compare uptake of the [{sup 76}Br]-labeled antagonist MRS5147 to [{sup 76}Br]agonist MRS3581. The antagonist MRS5147 shows increasing uptake in the testes, an A{sub 3}AR-rich tissue, suggesting that this ligand may have promise as a molecular imaging agent.

  7. Enhanced binding affinity, remarkable selectivity, and high capacity of CO 2 by dual functionalization of a rht-type metal-organic framework

    KAUST Repository

    Li, Baiyan; Zhang, Zhijuan; Li, Yi; Yao, Kexin; Zhu, Yihan; Deng, Zhiyong; Yang, Fen; Zhou, Xiaojing; Li, Guanghua; Wu, Haohan; Nijem, Nour; Chabal, Yves Jean; Lai, Zhiping; Han, Yu; Shi, Zhan; Feng, Shouhua; Li, Jing


    Open and friendly: The smallest member of the rht-type metal-organic frameworks (MOFs, see picture) constructed by a hexacarboxylate ligand with a nitrogen-rich imino triazine backbone shows a significantly enhanced gas binding affinity relative

  8. DOTA-NOC, a high-affinity ligand of somatostatin receptor subtypes 2, 3 and 5 for labelling with various radiometals

    International Nuclear Information System (INIS)

    Wild, Damian; Schmitt, Joerg S.; Ginj, Mihaela; Maecke, Helmut R.; Bernard, Bert F.; Krenning, Eric; Jong, Marion de; Wenger, Sandra; Reubi, Jean-Claude


    Earlier studies have shown that modification of the octapeptide octreotide in positions 3 and 8 may result in compounds with increased somatostatin receptor affinity that, if radiolabelled, display improved uptake in somatostatin receptor-positive tumours. The aim of a recent research study in our laboratory was to employ the parallel peptide synthesis approach by further exchanging the amino acid in position 3 of octreotide and coupling the macrocyclic chelator DOTA(1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid) to these peptides for labelling with radiometals like gallium-67 or -68, indium-111, yttrium-90 and lutetium-177. The purpose was to find radiopeptides with an improved somatostatin receptor binding profile in order to extend the spectrum of targeted tumours. A first peptide, [ 111 In, 90 Y-DOTA]-1-Nal 3 -octreotide ( 111 In, 90 Y-DOTA-NOC), was isolated which showed an improved profile. In III -DOTA-NOC exhibited the following IC 50 values (nM) when studied in competition with [ 125 I][Leu 8 , d-Trp 22 , Tyr 25 ]somatostatin-28 (values for Y III -DOTA-NOC are shown in parentheses): sstr2, 2.9±0.1 (3.3±0.2); sstr3, 8±2 (26±1.9); sstr5, 11.2±3.5 (10.4±1.6). Affinity towards sstr1 and 4 was very low or absent. In III -DOTA-NOC is superior to all somatostatin-based radiopeptides having this particular type of binding profile, including DOTA-lanreotide, and has three to four times higher binding affinity to sstr2 than In III ,Y III -DOTA-Tyr 3 -octreotide (In III ,Y III -DOTA-TOC). In addition, [ 111 In]DOTA-NOC showed a specific and high rate of internalization into AR4-2J rat pancreatic tumour cells which, after 4 h, was about two times higher than that of [ 111 In]DOTA-TOC and three times higher than that of [ 111 In]DOTA-octreotide ([ 111 In]DOTA-OC). The internalized radiopeptides were externalized intact upon 2 h of internalization followed by an acid wash. After 2-3 h of externalization a plateau is reached, indicating a steady

  9. Affine stochastic mortality

    NARCIS (Netherlands)

    Schrager, D.F.


    We propose a new model for stochastic mortality. The model is based on the literature on affine term structure models. It satisfies three important requirements for application in practice: analytical tractibility, clear interpretation of the factors and compatibility with financial option pricing

  10. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.


    Pairings on elliptic curves are being used in an increasing number of cryptographic applications on many different devices and platforms, but few performance numbers for cryptographic pairings have been reported on embedded and mobile devices. In this paper we give performance numbers for affine and

  11. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.; Abdalla, M.; Lange, T.


    We report on relative performance numbers for affine and projective pairings on a dual-core Cortex A9 ARM processor. Using a fast inversion in the base field and doing inversion in extension fields by using the norm map to reduce to inversions in smaller fields, we find a very low ratio of

  12. Quantification of human opiate receptor concentration and affinity using high and low specific activity ( sup 11 C)diprenorphine and positron emission tomography

    Energy Technology Data Exchange (ETDEWEB)

    Sadzot, B.; Price, J.C.; Mayberg, H.S.; Douglass, K.H.; Dannals, R.F.; Lever, J.R.; Ravert, H.T.; Wilson, A.A.; Wagner, H.N. Jr.; Feldman, M.A. (Johns Hopkins Medical Institutions, Baltimore, MD (USA))


    (11C)Diprenorphine, a weak partial opiate agonist, and positron emission tomography were used to obtain noninvasive regional estimates of opiate receptor concentration (Bmax) and affinity (Kd) in human brain. Different compartmental models and fitting strategies were compared statistically to establish the most reliable method of parameter estimation. Paired studies were performed in six normal subjects using high (769-5,920 Ci/mmol) and low (27-80 Ci/mmol) specific activity (SA) (11C)diprenorphine. Two subjects were studied a third time using high SA (11C)diprenorphine after a pretreatment with 1-1.5 mg/kg of the opiate antagonist naloxone. After the plasma radioactivity was corrected for metabolites, the brain data were analyzed using a three-compartment model and nonlinear least-squares curve fitting. Linear differential equations were used to describe the high SA (low receptor occupancy) kinetics. The k3/k4 ratio varied from 1.0 +/- 0.2 (occipital cortex) to 8.6 +/- 1.6 (thalamus). Nonlinear differential equations were used to describe the low SA (high receptor occupancy) kinetics and the curve fits provided the konf2 product. The measured free fraction of (11C)diprenorphine in plasma (f1) was 0.30 +/- 0.03, the average K1/k2 ratio from the two naloxone studies was 1.1 +/- 0.2, and the calculated free fraction of (11C)diprenorphine in the brain (f2) was 0.3. Using the paired SA studies, the estimated kinetic parameters, and f2, separate estimates of Bmax and Kd were obtained. Bmax varied from 2.3 +/- 0.5 (occipital cortex) to 20.6 +/- 7.3 (cingulate cortex) nM. The average Kd (eight brain regions) was 0.85 +/- 0.17 nM.

  13. Mobile Technology Affinity in Renal Transplant Recipients. (United States)

    Reber, S; Scheel, J; Stoessel, L; Schieber, K; Jank, S; Lüker, C; Vitinius, F; Grundmann, F; Eckardt, K-U; Prokosch, H-U; Erim, Y

    Medication nonadherence is a common problem in renal transplant recipients (RTRs). Mobile health approaches to improve medication adherence are a current trend, and several medication adherence apps are available. However, it is unknown whether RTRs use these technologies and to what extent. In the present study, the mobile technology affinity of RTRs was analyzed. We hypothesized significant age differences in mobile technology affinity and that mobile technology affinity is associated with better cognitive functioning as well as higher educational level. A total of 109 RTRs (63% male) participated in the cross-sectional study, with an overall mean age of 51.8 ± 14.2 years. The study included the Technology Experience Questionnaire (TEQ) for the assessment of mobile technology affinity, a cognitive test battery, and sociodemographic data. Overall, 57.4% of the patients used a smartphone or tablet and almost 45% used apps. The TEQ sum score was 20.9 in a possible range from 6 (no affinity to technology) to 30 (very high affinity). Younger patients had significantly higher scores in mobile technology affinity. The only significant gender difference was found in having fun with using electronic devices: Men enjoyed technology more than women did. Mobile technology affinity was positively associated with cognitive functioning and educational level. Young adult patients might profit most from mobile health approaches. Furthermore, high educational level and normal cognitive functioning promote mobile technology affinity. This should be kept in mind when designing mobile technology health (mHealth) interventions for RTRs. For beneficial mHealth interventions, further research on potential barriers and desired technologic features is necessary to adapt apps to patients' needs. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. MacA, a periplasmic membrane fusion protein of the macrolide transporter MacAB-TolC, binds lipopolysaccharide core specifically and with high affinity. (United States)

    Lu, Shuo; Zgurskaya, Helen I


    The Escherichia coli MacAB-TolC transporter has been implicated in efflux of macrolide antibiotics and secretion of enterotoxin STII. In this study, we found that purified MacA, a periplasmic membrane fusion protein, contains one tightly bound rough core lipopolysaccharide (R-LPS) molecule per MacA molecule. R-LPS was bound specifically to MacA protein with affinity exceeding that of polymyxin B. Sequence analyses showed that MacA contains two high-density clusters of positively charged amino acid residues located in the cytoplasmic N-terminal domain and the periplasmic C-terminal domain. Substitutions in the C-terminal cluster reducing the positive-charge density completely abolished binding of R-LPS. At the same time, these substitutions significantly reduced the functionality of MacA in the protection of E. coli against macrolides in vivo and in the in vitro MacB ATPase stimulation assays. Taken together, our results suggest that R-LPS or a similar glycolipid is a physiological substrate of MacAB-TolC.

  15. Premature Aging Phenotype in Mice Lacking High-Affinity Nicotinic Receptors: Region-Specific Changes in Layer V Pyramidal Cell Morphology. (United States)

    Konsolaki, Eleni; Skaliora, Irini


    The mechanisms by which aging leads to alterations in brain structure and cognitive deficits are unclear. Α deficient cholinergic system has been implicated as one of the main factors that could confer a heightened vulnerability to the aging process, and mice lacking high-affinity nicotinic receptors (β2(-/-)) have been proposed as an animal model of accelerated cognitive aging. To date, however, age-related changes in neuronal microanatomy have not been studied in these mice. In the present study, we examine the neuronal structure of yellow fluorescent protein (YFP(+)) layer V neurons in 2 cytoarchitectonically distinct cortical regions in wild-type (WT) and β2(-/-) animals. We find that (1) substantial morphological differences exist between YFP(+) cells of the anterior cingulate cortex (ACC) and primary visual cortex (V1), in both genotypes; (2) in WT animals, ACC cells are more susceptible to aging compared with cells in V1; and (3) β2 deletion is associated with a regionally and temporally specific increase in vulnerability to aging. ACC cells exhibit a prematurely aged phenotype already at 4-6 months, whereas V1 cells are spared in adulthood but strongly affected in old animals. Collectively, our data reveal region-specific synergistic effects of aging and genotype and suggest distinct vulnerabilities in V1 and ACC neurons. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail:

  16. Selective cortical decrease of high-affinity choline uptake carrier in Alzheimer's disease: an autoradiographic study using 3H-hemicholinium-3

    International Nuclear Information System (INIS)

    Rodriguez-Puertas, R.; Pazos, A.; Zarranz, J.J.; Pascual, J.


    H-hemicholinium-3 (H-HC-3) binding, a marker of the presynaptic high-affinity choline uptake carrier (HACU), was measured by autoradiography in several brain regions of 17 Alzheimer's disease (AD) patients and of 11 matched controls. A significant decrease in the density of H-HC-3 binding sites was found in entorhinal cortex, hippocampus and layers I-III of the frontal cortex. By contrast, in the caudate-putamen the number of H-HC-3 binding sites in AD cases was comparable to that of control striata. These data concur with previous results using classical presynaptic markers and reflect the loss in the activity of HACU, and, hence, in the synthesis of acetylcholine, that selectively occurs in cortical areas of AD brains due to the degeneration of presynaptic cholinergic terminals arising from the basal forebrain. However, the relatively low mean reduction in HACU in cortical areas (-40 %), together with the apparent indemnity of this marker in certain severely demented AD cases, suggest that AD dementia cannot be explained simply by the loss of presynaptic terminals originating in the basal forebrain. These data seem to be a good explanation for the poor response to cholinergic replacement in AD. (author)

  17. High Affinity vs. Native Fibronectin in the Modulation of αvβ3 Integrin Conformational Dynamics: Insights from Computational Analyses and Implications for Molecular Design.

    Directory of Open Access Journals (Sweden)

    Antonella Paladino


    Full Text Available Understanding how binding events modulate functional motions of multidomain proteins is a major issue in chemical biology. We address several aspects of this problem by analyzing the differential dynamics of αvβ3 integrin bound to wild type (wtFN10, agonist or high affinity (hFN10, antagonist mutants of fibronectin. We compare the dynamics of complexes from large-scale domain motions to inter-residue coordinated fluctuations to characterize the distinctive traits of conformational evolution and shed light on the determinants of differential αvβ3 activation induced by different FN sequences. We propose an allosteric model for ligand-based integrin modulation: the conserved integrin binding pocket anchors the ligand, while different residues on the two FN10's act as the drivers that reorganize relevant interaction networks, guiding the shift towards inactive (hFN10-bound or active states (wtFN10-bound. We discuss the implications of results for the design of integrin inhibitors.

  18. The Extracellular Domain of Human High Affinity Copper Transporter (hNdCTR1), Synthesized by E. coli Cells, Chelates Silver and Copper Ions In Vivo. (United States)

    Sankova, Tatiana P; Orlov, Iurii A; Saveliev, Andrey N; Kirilenko, Demid A; Babich, Polina S; Brunkov, Pavel N; Puchkova, Ludmila V


    There is much interest in effective copper chelators to correct copper dyshomeostasis in neurodegenerative and oncological diseases. In this study, a recombinant fusion protein for expression in Escherichia coli cells was constructed from glutathione-S-transferase (GST) and the N-terminal domain (ectodomain) of human high affinity copper transporter CTR1 (hNdCTR1), which has three metal-bound motifs. Several biological properties of the GST-hNdCTR1 fusion protein were assessed. It was demonstrated that in cells, the protein was prone to oligomerization, formed inclusion bodies and displayed no toxicity. Treatment of E. coli cells with copper and silver ions reduced cell viability in a dose- and time-dependent manner. Cells expressing GST-hNdCTR1 protein demonstrated resistance to the metal treatments. These cells accumulated silver ions and formed nanoparticles that contained AgCl and metallic silver. In this bacterial population, filamentous bacteria with a length of about 10 µm were often observed. The possibility for the fusion protein carrying extracellular metal binding motifs to integrate into the cell's copper metabolism and its chelating properties are discussed.

  19. The Extracellular Domain of Human High Affinity Copper Transporter (hNdCTR1, Synthesized by E. coli Cells, Chelates Silver and Copper Ions In Vivo

    Directory of Open Access Journals (Sweden)

    Tatiana P. Sankova


    Full Text Available There is much interest in effective copper chelators to correct copper dyshomeostasis in neurodegenerative and oncological diseases. In this study, a recombinant fusion protein for expression in Escherichia coli cells was constructed from glutathione-S-transferase (GST and the N-terminal domain (ectodomain of human high affinity copper transporter CTR1 (hNdCTR1, which has three metal-bound motifs. Several biological properties of the GST-hNdCTR1 fusion protein were assessed. It was demonstrated that in cells, the protein was prone to oligomerization, formed inclusion bodies and displayed no toxicity. Treatment of E. coli cells with copper and silver ions reduced cell viability in a dose- and time-dependent manner. Cells expressing GST-hNdCTR1 protein demonstrated resistance to the metal treatments. These cells accumulated silver ions and formed nanoparticles that contained AgCl and metallic silver. In this bacterial population, filamentous bacteria with a length of about 10 µm were often observed. The possibility for the fusion protein carrying extracellular metal binding motifs to integrate into the cell’s copper metabolism and its chelating properties are discussed.

  20. Involvement of the VDE homing endonuclease and rapamycin in regulation of the Saccharomyces cerevisiae GSH11 gene encoding the high affinity glutathione transporter. (United States)

    Miyake, Tsuyoshi; Hiraishi, Hiroyuki; Sammoto, Hiroyuki; Ono, Bun-Ichiro


    The Saccharomyces cerevisiae gene HGT1/GSH11 encodes the high affinity glutathione transporter and is repressed by cysteine added to the culture medium. It has been found previously that a 5'-upstream cis-element, CCGCCACAC, is responsible for regulating GSH11 expression and that several proteins bind to this element (Miyake, T., Kanayama, M., Sammoto, H., and Ono, B. (2002) Mol. Genet. Genomics 266, 1004-1011). In this report we present evidence that the most prominent of these proteins is VDE, known previously as the homing endonuclease encoded by VMA1. We show also that GSH11 is not expressed in a VDE-deleted strain and that inability to express the GSH11 of this strain is overcome by introduction of the coding region of VDE or the entire VMA1 gene. It is also found that VDE does not cut DNA in the vicinity of the GSH11 cis-element. Rapamycin, an inhibitor of the target of rapamycin (TOR) signal-transduction system, is found to enhance expression of GSH11 in a VDE-dependent manner under conditions of sulfur starvation. These results indicate that GSH11 is regulated by a system sensitive to sulfur starvation (presumably via cysteine depletion) and a more general system involving the nutritional starvation signal mediated by the TOR system. Both systems need to be operational (inhibition of TOR and sulfur starvation) for full expression of GSH11.

  1. Selective cortical decrease of high-affinity choline uptake carrier in Alzheimer`s disease: an autoradiographic study using {sup 3}H-hemicholinium-3

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez-Puertas, R; Pazos, A [Dept. of Physiology and Pharmacology, Unit of Pharmacology, Univ. of Cantabria, Santander (Spain); Zarranz, J J [Dept. of Neuroscience, Univ. of the Basque Country, Leioa (Spain); Pascual, J [Dept. of Medicine, Service of Neurology, Univ. Hospital ` Marques de Valdecilla` , Univ. of Cantabria, Santander (Spain)


    H-hemicholinium-3 (H-HC-3) binding, a marker of the presynaptic high-affinity choline uptake carrier (HACU), was measured by autoradiography in several brain regions of 17 Alzheimer`s disease (AD) patients and of 11 matched controls. A significant decrease in the density of H-HC-3 binding sites was found in entorhinal cortex, hippocampus and layers I-III of the frontal cortex. By contrast, in the caudate-putamen the number of H-HC-3 binding sites in AD cases was comparable to that of control striata. These data concur with previous results using classical presynaptic markers and reflect the loss in the activity of HACU, and, hence, in the synthesis of acetylcholine, that selectively occurs in cortical areas of AD brains due to the degeneration of presynaptic cholinergic terminals arising from the basal forebrain. However, the relatively low mean reduction in HACU in cortical areas (-40 %), together with the apparent indemnity of this marker in certain severely demented AD cases, suggest that AD dementia cannot be explained simply by the loss of presynaptic terminals originating in the basal forebrain. These data seem to be a good explanation for the poor response to cholinergic replacement in AD. (author).

  2. Organic cation transporter 2 (SLC22A2), a low-affinity and high-capacity choline transporter, is preferentially enriched on synaptic vesicles in cholinergic neurons. (United States)

    Nakata, T; Matsui, T; Kobayashi, K; Kobayashi, Y; Anzai, N


    Organic cation transporters (OCTs) are expressed mainly in the kidney and liver. OCTs transport intrinsic organic cations, including monoamine, dopamine, serotonine and choline, across the plasma membrane. Here, we demonstrate that OCT2 (SLC22A2) is expressed in cholinergic neurons, motoneurons in the anterior horn of the spinal cord, and is implicated in acetylcholine (Ach) recycling in presynaptic terminals. Application of rabbit anti-peptide antibody revealed that OCT2 was expressed in the anterior horn of the spinal cord. Double immunostaining of muscle sections with anti-OCT2 and alpha-bungarotoxin (BTX) revealed that OCT2 was localized in the neuromuscular junctions (NMJs). Immunoelectron microscopy revealed that OCT2 was localized both in synaptic vesicles (SVs) in presynaptic terminals around the motoneurons (C-terminals) and in SVs in nerve terminals in NMJs. The similarity in the distribution of OCT2 in cholinergic neurons and that of vesicular acetyl choline transporter (VAchT), and the fact that OCT2 can transport choline suggest that OCT2 could work as a low-affinity and high-capacity choline transporter at presynaptic terminals in cholinergic neurons in a firing-dependent manner. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.

  3. PCR-identification of a Nicotiana plumbaginifolia cDNA homologous to the high-affinity nitrate transporters of the crnA family. (United States)

    Quesada, A; Krapp, A; Trueman, L J; Daniel-Vedele, F; Fernández, E; Forde, B G; Caboche, M


    A family of high-affinity nitrate transporters has been identified in Aspergillus nidulans and Chlamydomonas reinhardtii, and recently homologues of this family have been cloned from a higher plant (barley). Based on six of the peptide sequences most strongly conserved between the barley and C. reinhardtii polypeptides, a set of degenerate primers was designed to permit amplification of the corresponding genes from other plant species. The utility of these primers was demonstrated by RT-PCR with cDNA made from poly(A)+ RNA from barley, C. reinhardtii and Nicotiana plumbaginifolia. A PCR fragment amplified from N. plumbaginifolia was used as probe to isolate a full-length cDNA clone which encodes a protein, NRT2;1Np, that is closely related to the previously isolated crnA homologue from barley. Genomic Southern blots indicated that there are only 1 or 2 members of the Nrt2 gene family in N. plumbaginifolia. Northern blotting showed that the Nrt2 transcripts are most strongly expressed in roots. The effects of external treatments with different N sources showed that the regulation of the Nrt2 gene(s) is very similar to that reported for nitrate reductase and nitrite reductase genes: their expression was strongly induced by nitrate but was repressed when reduced forms of N were supplied to the roots.

  4. The Mitochondrial Metallochaperone SCO1 Is Required to Sustain Expression of the High-Affinity Copper Transporter CTR1 and Preserve Copper Homeostasis

    Directory of Open Access Journals (Sweden)

    Christopher J. Hlynialuk


    Full Text Available Human SCO1 fulfills essential roles in cytochrome c oxidase (COX assembly and the regulation of copper (Cu homeostasis, yet it remains unclear why pathogenic mutations in this gene cause such clinically heterogeneous forms of disease. Here, we establish a Sco1 mouse model of human disease and show that ablation of Sco1 expression in the liver is lethal owing to severe COX and Cu deficiencies. We further demonstrate that the Cu deficiency is explained by a functional connection between SCO1 and CTR1, the high-affinity transporter that imports Cu into the cell. CTR1 is rapidly degraded in the absence of SCO1 protein, and we show that its levels are restored in Sco1−/− mouse embryonic fibroblasts upon inhibition of the proteasome. These data suggest that mitochondrial signaling through SCO1 provides a post-translational mechanism to regulate CTR1-dependent Cu import into the cell, and they further underpin the importance of mitochondria in cellular Cu homeostasis.

  5. Establishment of a novel high-affinity IgE receptor-positive canine mast cell line with wild-type c-kit receptors

    International Nuclear Information System (INIS)

    Amagai, Yosuke; Tanaka, Akane; Ohmori, Keitaro; Matsuda, Hiroshi


    Much is known regarding participations of mast cells with innate and acquired immunity by secreting various cytokines and chemical mediators. However, details of mast cell biology still remain unclear. In this study, we successfully established a novel growth factor-independent mast cell line (MPT-1) derived from canine mast cell tumor. MPT-1 cells manifested factor-independent proliferation as floating cells containing a large amount of histamine, as well as chymase-like dog mast cell protease 3, in cytosolic granules. Particularly, MPT-1 cells expressed high-affinity IgE receptors (FcεRI) and wild-type c-kit receptors. Degranulation of MPT-1 cells was induced not only by stimulation with calcium ionophore but also by cross-linkage of the surface IgE. Given that MPT-1 is the first mast cell line with FcεRI which has no c-kit mutations, MPT-1 cells may provide great contribution for investigation of IgE-mediated activation mechanisms of mast cells, leading to development of effective treatment for allergic disorders

  6. High affinity (3H) β-Alanine uptake by scar margins of ferric chloride-induced epileptogenic foci in rat isocortex

    International Nuclear Information System (INIS)

    Robitaille, Y.; Sherwin, A.


    Cortical astrocytes of normal mammalian brain are endowed with a high affinity uptake system for β-Alanine which is competitively inhibited by gamma aminobutyric acid (GABA), a neurotransmitter strongly implicated in epileptogenesis. The authors evaluated ( 3 H) β-Alanine uptake by reactive astrocytes proliferating within scar of epileptogenic foci induced in rat motor cortex by microinjections of 100 mM ferric chloride. Following in vitro incubation of scar tissue with ( 3 H) β-Alanine, ultrastructural morphometry of grain patterns at 5, 30 and 120 days post injection revealed early and significant grain count increases over astroglial processes, predominantly those related to perivascular glial end-feet. Astrocytic cell body and endothelial cell counts showed a more gradual and stepwise increase. Similar data were obtained by comparing visual and edited mean astrocytic grain counts. These results suggest that the enhanced uptake of reactive astrocytes may reflect a marked decrease of inhibitory GABAergic neurons within ferric chloride-induced scars. 7 figures, 1 table

  7. Affine field theories

    International Nuclear Information System (INIS)

    Cadavid, A.C.


    The author constructs a non-Abelian field theory by gauging a Kac-Moody algebra, obtaining an infinite tower of interacting vector fields and associated ghosts, that obey slightly modified Feynman rules. She discusses the spontaneous symmetry breaking of such theory via the Higgs mechanism. If the Higgs particle lies in the Cartan subalgebra of the Kac-Moody algebra, the previously massless vectors acquire a mass spectrum that is linear in the Kac-Moody index and has additional fine structure depending on the associated Lie algebra. She proceeds to show that there is no obstacle in implementing the affine extension of supersymmetric Yang-Mills theories. The result is valid in four, six and ten space-time dimensions. Then the affine extension of supergravity is investigated. She discusses only the loop algebra since the affine extension of the super-Poincare algebra appears inconsistent. The construction of the affine supergravity theory is carried out by the group manifold method and leads to an action describing infinite towers of spin 2 and spin 3/2 fields that interact subject to the symmetries of the loop algebra. The equations of motion satisfy the usual consistency check. Finally, she postulates a theory in which both the vector and scalar fields lie in the loop algebra of SO(3). This theory has an expanded soliton sector, and corresponding to the original 't Hooft-Polyakov solitonic solutions she now finds an infinite family of exact, special solutions of the new equations. She also proposes a perturbation method for obtaining an arbitrary solution of those equations for each level of the affine index

  8. A highly selective dispersive liquid-liquid microextraction approach based on the unique fluorous affinity for the extraction and detection of per- and polyfluoroalkyl substances coupled with high performance liquid chromatography tandem-mass spectrometry. (United States)

    Wang, Juan; Shi, Yali; Cai, Yaqi


    In the present study, a highly selective fluorous affinity-based dispersive liquid-liquid microextraction (DLLME) technique was developed for the extraction and analysis of per- and polyfluoroalkyl substances (PFASs) followed by high performance liquid chromatography tandem-mass spectrometry. Perfluoro-tert-butanol with multiple C-F bonds was chosen as the extraction solvent, which was injected into the aqueous samples with a dispersive solvent (acetonitrile) in a 120:800 (μL, v/v) mixture for PFASs enrichment. The fluorous affinity-based extraction mechanism was confirmed by the significantly higher extraction recoveries for PFASs containing multiple fluorine atoms than those for compounds with fewer or no fluorine atoms. The extraction recoveries of medium and long-chain PFASs (CF 2  > 5) exceeded 70%, except perfluoroheptanoic acid, while those of short-chain PFASs were lower than 50%, implying that the proposed DLLME may not be suitable for their extraction due to weak fluorous affinity. This highly fluoroselective DLLME technique can greatly decrease the matrix effect that occurs in mass spectrometry detection when applied to the analysis of urine samples. Under the optimum conditions, the relative recoveries of PFASs with CF 2  > 5 ranged from 80.6-121.4% for tap water, river water and urine samples spiked with concentrations of 10, 50 and 100 ng/L. The method limits of quantification for PFASs in water and urine samples were in the range of 0.6-8.7 ng/L. Furthermore, comparable concentrations of PFASs were obtained via DLLME and solid-phase extraction, confirming that the developed DLLME technique is a promising method for the extraction of PFASs in real samples. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Binding Affinity of a Highly Sensitive Au/Ag/Au/Chitosan-Graphene Oxide Sensor Based on Direct Detection of Pb2+ and Hg2+ Ions

    Directory of Open Access Journals (Sweden)

    Nur Hasiba Kamaruddin


    Full Text Available The study of binding affinity is essential in surface plasmon resonance (SPR sensing because it allows researchers to quantify the affinity between the analyte and immobilised ligands of an SPR sensor. In this study, we demonstrate the derivation of the binding affinity constant, K, for Pb2+ and Hg2+ ions according to their SPR response using a gold/silver/gold/chitosan–graphene oxide (Au/Ag/Au/CS–GO sensor for the concentration range of 0.1–5 ppm. The higher affinity of Pb2+ to binding with the CS–GO sensor explains the outstanding sensitivity of 2.05 °ppm−1 against 1.66 °ppm−1 of Hg2+. The maximum signal-to-noise ratio (SNR upon detection of Pb2+ is 1.53, and exceeds the suggested logical criterion of an SNR. The Au/Ag/Au/CS–GO SPR sensor also exhibits excellent repeatability in Pb2+ due to the strong bond between its functional groups and this cation. The adsorption data of Pb2+ and Hg2+ on the CS–GO sensor fits well with the Langmuir isotherm model where the affinity constant, K, of Pb2+ and Hg2+ ions is computed. The affinity of Pb2+ ions to the Au/Ag/Au/CS–GO sensor is significantly higher than that of Hg2+ based on the value of K, 7 × 105 M−1 and 4 × 105 M−1, respectively. The higher shift in SPR angles due to Pb2+ and Hg2+ compared to Cr3+, Cu2+ and Zn2+ ions also reveals the greater affinity of the CS–GO SPR sensor to them, thus supporting the rationale for obtaining K for these two heavy metals. This study provides a better understanding on the sensing performance of such sensors in detecting heavy metal ions.

  10. Design, Synthesis, and in Vitro Pharmacology of New Radiolabeled γ-Hydroxybutyric Acid Analogues Including Photolabile Analogues with Irreversible Binding to the High-Affinity γ-Hydroxybutyric Acid Binding Sites

    DEFF Research Database (Denmark)

    Sabbatini, Paola; Wellendorph, Petrine; Høg, Signe


    γ-Hydroxybutyric acid (GHB) is a psychotropic compound endogenous to the brain. Despite its potential physiological significance, the complete molecular mechanisms of action remain unexplained. To facilitate the isolation and identification of the high-affinity GHB binding site, we herein report ...

  11. Aluminium fluoride and magnesium, activators of heterotrimeric GTP-binding proteins, affect high-affinity binding of the fungal toxin fusicoccin to the fusicoccin-binding protein in oat root plasma membranes.

    NARCIS (Netherlands)

    de Boer, A.H.; Van der Molen, G.W.; Prins, H.B.A.; Korthout, H.A.A.J.; van der Hoeven, P.C.J.


    The fusicoccin-binding protein was solubilised from purified oat root plasma membranes. The solubilised protein retained full binding activity, provided that protease inhibitors were included. Sodium fluoride reduced the high-affinity [H-3]fusicoccin binding to almost zero in a

  12. Genetically based low oxygen affinities of felid hemoglobins: lack of biochemical adaptation to high-altitude hypoxia in the snow leopard (United States)

    Janecka, Jan E.; Nielsen, Simone S. E.; Andersen, Sidsel D.; Hoffmann, Federico G.; Weber, Roy E.; Anderson, Trevor; Storz, Jay F.; Fago, Angela


    ABSTRACT Genetically based modifications of hemoglobin (Hb) function that increase blood–O2 affinity are hallmarks of hypoxia adaptation in vertebrates. Among mammals, felid Hbs are unusual in that they have low intrinsic O2 affinities and reduced sensitivities to the allosteric cofactor 2,3-diphosphoglycerate (DPG). This combination of features compromises the acclimatization capacity of blood–O2 affinity and has led to the hypothesis that felids have a restricted physiological niche breadth relative to other mammals. In seeming defiance of this conjecture, the snow leopard (Panthera uncia) has an extraordinarily broad elevational distribution and occurs at elevations above 6000 m in the Himalayas. Here, we characterized structural and functional variation of big cat Hbs and investigated molecular mechanisms of Hb adaptation and allosteric regulation that may contribute to the extreme hypoxia tolerance of the snow leopard. Experiments revealed that purified Hbs from snow leopard and African lion exhibited equally low O2 affinities and DPG sensitivities. Both properties are primarily attributable to a single amino acid substitution, β2His→Phe, which occurred in the common ancestor of Felidae. Given the low O2 affinity and reduced regulatory capacity of feline Hbs, the extreme hypoxia tolerance of snow leopards must be attributable to compensatory modifications of other steps in the O2-transport pathway. PMID:26246610

  13. Labeling by ( sup 3 H)1,3-di(2-tolyl)guanidine of two high affinity binding sites in guinea pig brain: Evidence for allosteric regulation by calcium channel antagonists and pseudoallosteric modulation by sigma ligands

    Energy Technology Data Exchange (ETDEWEB)

    Rothman, R.B.; Reid, A.; Mahboubi, A.; Kim, C.H.; De Costa, B.R.; Jacobson, A.E.; Rice, K.C. (National Institute of Mental Health, Bethesda, MD (USA))


    Equilibrium binding studies with the sigma receptor ligand ({sup 3}H)1,3-di(2-tolyl)guanidine (({sup 3}H)DTG) demonstrated two high affinity binding sites in membranes prepared from guinea pig brain. The apparent Kd values of DTG for sites 1 and 2 were 11.9 and 37.6 nM, respectively. The corresponding Bmax values were 1045 and 1423 fmol/mg of protein. Site 1 had high affinity for (+)-pentazocine, haloperidol, (R)-(+)-PPP, carbepentane, and other sigma ligands, suggesting a similarity with the dextromethorphan/sigma 1 binding site described by Musacchio et al. (Life Sci. 45:1721-1732 (1989)). Site 2 had high affinity for DTG and haloperidol (Ki = 36.1 nM) and low affinity for most other sigma ligands. Kinetic experiments demonstrated that ({sup 3}H)DTG dissociated in a biphasic manner from both site 1 and site 2. DTG and haloperidol increased the dissociation rate of ({sup 3}H)DTG from site 1 and site 2, demonstrating the presence of pseudoallosteric interactions. Inorganic calcium channel blockers such as Cd2+ selectively increased the dissociation rate of ({sup 3}H)DTG from site 2, suggesting an association of this binding site with calcium channels.

  14. Labeling by [3H]1,3-di(2-tolyl)guanidine of two high affinity binding sites in guinea pig brain: Evidence for allosteric regulation by calcium channel antagonists and pseudoallosteric modulation by sigma ligands

    International Nuclear Information System (INIS)

    Rothman, R.B.; Reid, A.; Mahboubi, A.; Kim, C.H.; De Costa, B.R.; Jacobson, A.E.; Rice, K.C.


    Equilibrium binding studies with the sigma receptor ligand [ 3 H]1,3-di(2-tolyl)guanidine ([ 3 H]DTG) demonstrated two high affinity binding sites in membranes prepared from guinea pig brain. The apparent Kd values of DTG for sites 1 and 2 were 11.9 and 37.6 nM, respectively. The corresponding Bmax values were 1045 and 1423 fmol/mg of protein. Site 1 had high affinity for (+)-pentazocine, haloperidol, (R)-(+)-PPP, carbepentane, and other sigma ligands, suggesting a similarity with the dextromethorphan/sigma 1 binding site described by Musacchio et al. [Life Sci. 45:1721-1732 (1989)]. Site 2 had high affinity for DTG and haloperidol (Ki = 36.1 nM) and low affinity for most other sigma ligands. Kinetic experiments demonstrated that [ 3 H]DTG dissociated in a biphasic manner from both site 1 and site 2. DTG and haloperidol increased the dissociation rate of [ 3 H]DTG from site 1 and site 2, demonstrating the presence of pseudoallosteric interactions. Inorganic calcium channel blockers such as Cd2+ selectively increased the dissociation rate of [ 3 H]DTG from site 2, suggesting an association of this binding site with calcium channels

  15. SNF3 as high affinity glucose sensor and its function in supporting the viability of Candida glabrata under glucose-limited environment

    Directory of Open Access Journals (Sweden)

    Tzu Shan eNg


    Full Text Available Candida glabrata is an emerging human fungal pathogen that has efficacious nutrient sensing and responsiveness ability. It can be seen through its ability to thrive in diverse range of nutrient limited-human anatomical sites. Therefore, nutrient sensing particularly glucose sensing is thought to be crucial in contributing to the development and fitness of the pathogen. This study aimed to elucidate the role of SNF3 (Sucrose Non Fermenting 3 as a glucose sensor and its possible role in contributing to the fitness and survivability of C. glabrata in glucose-limited environment. The SNF3 knockout strain was constructed and subjected to different glucose concentrations to evaluate its growth, biofilm formation, amphotericin B susceptibility, ex vivo survivability and effects on the transcriptional profiling of the sugar receptor repressor (SRR pathway-related genes. The SNF3Δ strain showed a retarded growth in low glucose environments (0.01% and 0.1% in both fermentation and respiration-preferred conditions but grew well in high glucose concentration environments (1% and 2%. It was also found to be more susceptible to amphotericin B in low glucose environment (0.1% and macrophage engulfment but showed no difference in the biofilm formation capability. The deletion of SNF3 also resulted in the down-regulation of about half of hexose transporters genes (4 out of 9. Overall, the deletion of SNF3 causes significant reduction in the ability of C. glabrata to sense limited surrounding glucose and consequently disrupts its competency to transport and perform the uptake of this critical nutrient. This study highlighted the role of SNF3 as a high affinity glucose sensor and its role in aiding the survivability of C. glabrata particularly in glucose limited environment.

  16. A conserved motif in the linker domain of STAT1 transcription factor is required for both recognition and release from high-affinity DNA-binding sites. (United States)

    Hüntelmann, Bettina; Staab, Julia; Herrmann-Lingen, Christoph; Meyer, Thomas


    Binding to specific palindromic sequences termed gamma-activated sites (GAS) is a hallmark of gene activation by members of the STAT (signal transducer and activator of transcription) family of cytokine-inducible transcription factors. However, the precise molecular mechanisms involved in the signal-dependent finding of target genes by STAT dimers have not yet been very well studied. In this study, we have characterized a sequence motif in the STAT1 linker domain which is highly conserved among the seven human STAT proteins and includes surface-exposed residues in close proximity to the bound DNA. Using site-directed mutagenesis, we have demonstrated that a lysine residue in position 567 of the full-length molecule is required for GAS recognition. The substitution of alanine for this residue completely abolished both binding to high-affinity GAS elements and transcriptional activation of endogenous target genes in cells stimulated with interferon-γ (IFNγ), while the time course of transient nuclear accumulation and tyrosine phosphorylation were virtually unchanged. In contrast, two glutamic acid residues (E559 and E563) on each monomer are important for the dissociation of dimeric STAT1 from DNA and, when mutated to alanine, result in elevated levels of tyrosine-phosphorylated STAT1 as well as prolonged IFNγ-stimulated nuclear accumulation. In conclusion, our data indicate that the kinetics of signal-dependent GAS binding is determined by an array of glutamic acid residues located at the interior surface of the STAT1 dimer. These negatively charged residues appear to align the long axis of the STAT1 dimer in a position perpendicular to the DNA, thereby facilitating the interaction between lysine 567 and the phosphodiester backbone of a bound GAS element, which is a prerequisite for transient gene induction.

  17. Murine CMV Expressing the High Affinity NKG2D Ligand MULT-1: A Model for the Development of Cytomegalovirus-Based Vaccines

    Directory of Open Access Journals (Sweden)

    Lea Hiršl


    Full Text Available The development of a vaccine against human cytomegalovirus (CMV has been a subject of long-term medical interest. The research during recent years identified CMV as an attractive vaccine vector against infectious diseases and tumors. The immune response to CMV persists over a lifetime and its unique feature is the inflationary T cell response to certain viral epitopes. CMV encodes numerous genes involved in immunoevasion, which are non-essential for virus growth in vitro. The deletion of those genes results in virus attenuation in vivo, which enables us to dramatically manipulate its virulence and the immune response. We have previously shown that the murine CMV (MCMV expressing RAE-1γ, one of the cellular ligands for the NKG2D receptor, is highly attenuated in vivo but retains the ability to induce a strong CD8+ T cell response. Here, we demonstrate that recombinant MCMV expressing high affinity NKG2D ligand murine UL16 binding protein-like transcript (MULT-1 (MULT-1MCMV inserted in the place of its viral inhibitor is dramatically attenuated in vivo in a NK cell-dependent manner, both in immunocompetent adult mice and in immunologically immature newborns. MULT-1MCMV was more attenuated than the recombinant virus expressing RAE-1γ. Despite the drastic sensitivity to innate immune control, MULT-1MCMV induced an efficient CD8+ T cell response to viral and vectored antigens. By using in vitro assay, we showed that similar to RAE-1γMCMV, MULT-1 expressing virus provided strong priming of CD8+ T cells. Moreover, MULT-1MCMV was able to induce anti-viral antibodies, which after passing the transplacental barrier protect offspring of immunized mothers from challenge infection. Altogether, this study further supports the concept that CMV expressing NKG2D ligand possesses excellent characteristics to serve as a vaccine or vaccine vector.

  18. HAMS: High-Affinity Mass Spectrometry Screening. A High-Throughput Screening Method for Identifying the Tightest-Binding Lead Compounds for Target Proteins with No False Positive Identifications. (United States)

    Imaduwage, Kasun P; Go, Eden P; Zhu, Zhikai; Desaire, Heather


    A major challenge in drug discovery is the identification of high affinity lead compounds that bind a particular target protein; these leads are typically identified by high throughput screens. Mass spectrometry has become a detection method of choice in drug screening assays because the target and the ligand need not be modified. Label-free assays are advantageous because they can be developed more rapidly than assays requiring labels, and they eliminate the risk of the label interfering with the binding event. However, in commonly used MS-based screening methods, detection of false positives is a major challenge. Here, we describe a detection strategy designed to eliminate false positives. In this approach, the protein and the ligands are incubated together, and the non-binders are separated for detection. Hits (protein binders) are not detectable by MS after incubation with the protein, but readily identifiable by MS when the target protein is not present in the incubation media. The assay was demonstrated using three different proteins and hundreds of non-inhibitors; no false positive hits were identified in any experiment. The assay can be tuned to select for ligands of a particular binding affinity by varying the quantity of protein used and the immobilization method. As examples, the method selectively detected inhibitors that have K i values of 0.2 μM, 50 pM, and 700 pM. These findings demonstrate that the approach described here compares favorably with traditional MS-based screening methods. Graphical Abstract ᅟ.

  19. Pulmonary Administration of GW0742, a High-Affinity Peroxisome Proliferator-Activated Receptor Agonist, Repairs Collapsed Alveoli in an Elastase-Induced Mouse Model of Emphysema. (United States)

    Ozawa, Chihiro; Horiguchi, Michiko; Akita, Tomomi; Oiso, Yuki; Abe, Kaori; Motomura, Tomoki; Yamashita, Chikamasa


    Pulmonary emphysema is a disease in which lung alveoli are irreversibly damaged, thus compromising lung function. Our previous study revealed that all-trans-retinoic acid (ATRA) induces the differentiation of human lung alveolar epithelial type 2 progenitor cells and repairs the alveoli of emphysema model mice. ATRA also reportedly has the ability to activate peroxisome proliferator-activated receptor (PPAR) β/δ. A selective PPARβ/δ ligand has been reported to induce the differentiation of human keratinocytes during wound repair. Here, we demonstrate that treatment using a high-affinity PPARβ/δ agonist, GW0742, reverses the lung tissue damage induced by elastase in emphysema-model mice and improves respiratory function. Mice treated with elastase, which collapsed their alveoli, were then treated with either 10% dimethyl sulfoxide (DMSO) in saline (control group) or GW0742 (1.0 mg/kg twice a week) by pulmonary administration. Treatment with GW0742 for 2 weeks increased the in vivo expression of surfactant proteins A and D, which are known alveolar type II epithelial cell markers. GW0742 treatment also shortened the average distance between alveolar walls in the lungs of emphysema model mice, compared with a control group treated with 10% DMSO in saline. Treatment with GW0742 for 3 weeks also improved tissue elastance (cm H2O/mL), as well as the ratio of the forced expiratory volume in the first 0.05 s to the forced vital capacity (FEV 0.05/FVC). In each of these experiments, GW0742 treatment reversed the damage caused by elastase. In conclusion, PPARβ/δ agonists are potential therapeutic agents for pulmonary emphysema.

  20. Structure, High Affinity, and Negative Cooperativity of the Escherichia coli Holo-(Acyl Carrier Protein):Holo-(Acyl Carrier Protein) Synthase Complex

    Energy Technology Data Exchange (ETDEWEB)

    Marcella, Aaron M.; Culbertson, Sannie J.; Shogren-Knaak, Michael A.; Barb, Adam W.


    The Escherichia coli holo-(acyl carrier protein) synthase (ACPS) catalyzes the coenzyme A-dependent activation of apo-ACPP to generate holo-(acyl carrier protein) (holo-ACPP) in an early step of fatty acid biosynthesis. E. coli ACPS is sufficiently different from the human fatty acid synthase to justify the development of novel ACPS-targeting antibiotics. Models of E. coli ACPS in unliganded and holo-ACPP-bound forms solved by X-ray crystallography to 2.05 and 4.10 Å, respectively, revealed that ACPS bound three product holo-ACPP molecules to form a 3:3 hexamer. Solution NMR spectroscopy experiments validated the ACPS binding interface on holo-ACPP using chemical shift perturbations and by determining the relative orientation of holo-ACPP to ACPS by fitting residual dipolar couplings. The binding interface is organized to arrange contacts between positively charged ACPS residues and the holo-ACPP phosphopantetheine moiety, indicating product contains more stabilizing interactions than expected in the enzyme:substrate complex. Indeed, holo-ACPP bound the enzyme with greater affinity than the substrate, apo-ACPP, and with negative cooperativity. The first equivalent of holo-ACPP bound with a KD = 62 ± 13 nM, followed by the binding of two more equivalents of holo-ACPP with KD = 1.2 ± 0.2 μM. Cooperativity was not observed for apo-ACPP which bound with KD = 2.4 ± 0.1 μM. Strong product binding and high levels of holo-ACPP in the cell identify a potential regulatory role of ACPS in fatty acid biosynthesis.

  1. Structure, High Affinity, and Negative Cooperativity of the Escherichia coli Holo-(Acyl Carrier Protein):Holo-(Acyl Carrier Protein) Synthase Complex. (United States)

    Marcella, Aaron M; Culbertson, Sannie J; Shogren-Knaak, Michael A; Barb, Adam W


    The Escherichia coli holo-(acyl carrier protein) synthase (ACPS) catalyzes the coenzyme A-dependent activation of apo-ACPP to generate holo-(acyl carrier protein) (holo-ACPP) in an early step of fatty acid biosynthesis. E. coli ACPS is sufficiently different from the human fatty acid synthase to justify the development of novel ACPS-targeting antibiotics. Models of E. coli ACPS in unliganded and holo-ACPP-bound forms solved by X-ray crystallography to 2.05and 4.10Å, respectively, revealed that ACPS bound three product holo-ACPP molecules to form a 3:3 hexamer. Solution NMR spectroscopy experiments validated the ACPS binding interface on holo-ACPP using chemical shift perturbations and by determining the relative orientation of holo-ACPP to ACPS by fitting residual dipolar couplings. The binding interface is organized to arrange contacts between positively charged ACPS residues and the holo-ACPP phosphopantetheine moiety, indicating product contains more stabilizing interactions than expected in the enzyme:substrate complex. Indeed, holo-ACPP bound the enzyme with greater affinity than the substrate, apo-ACPP, and with negative cooperativity. The first equivalent of holo-ACPP bound with a K D =62±13nM, followed by the binding of two more equivalents of holo-ACPP with K D =1.2±0.2μM. Cooperativity was not observed for apo-ACPP which bound with K D =2.4±0.1μM. Strong product binding and high levels of holo-ACPP in the cell identify a potential regulatory role of ACPS in fatty acid biosynthesis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Crystal structure of the high-affinity Na+K+-ATPase-ouabain complex with Mg2+ bound in the cation binding site. (United States)

    Laursen, Mette; Yatime, Laure; Nissen, Poul; Fedosova, Natalya U


    The Na(+),K(+)-ATPase maintains electrochemical gradients for Na(+) and K(+) that are critical for animal cells. Cardiotonic steroids (CTSs), widely used in the clinic and recently assigned a role as endogenous regulators of intracellular processes, are highly specific inhibitors of the Na(+),K(+)-ATPase. Here we describe a crystal structure of the phosphorylated pig kidney Na(+),K(+)-ATPase in complex with the CTS representative ouabain, extending to 3.4 Å resolution. The structure provides key details on CTS binding, revealing an extensive hydrogen bonding network formed by the β-surface of the steroid core of ouabain and the side chains of αM1, αM2, and αM6. Furthermore, the structure reveals that cation transport site II is occupied by Mg(2+), and crystallographic studies indicate that Rb(+) and Mn(2+), but not Na(+), bind to this site. Comparison with the low-affinity [K2]E2-MgF(x)-ouabain structure [Ogawa et al. (2009) Proc Natl Acad Sci USA 106(33):13742-13747) shows that the CTS binding pocket of [Mg]E2P allows deep ouabain binding with possible long-range interactions between its polarized five-membered lactone ring and the Mg(2+). K(+) binding at the same site unwinds a turn of αM4, dragging residues Ile318-Val325 toward the cation site and thereby hindering deep ouabain binding. Thus, the structural data establish a basis for the interpretation of the biochemical evidence pointing at direct K(+)-Mg(2+) competition and explain the well-known antagonistic effect of K(+) on CTS binding.

  3. (3H)leukotriene B4 binding to the guinea pig spleen membranes: a rich tissue source for a high affinity leukotriene B4 receptor site

    International Nuclear Information System (INIS)

    Cheng, J.B.; Kohi, F.; Townley, R.G.


    To select a tissue rich for the high affinity leukotriene (LT)B 4 receptor site, they compared binding of 1 nM ( 3 H)LTB 4 (180 Ci/mmol) to the crude membrane preparations of guinea pig spleen, thymus, lung, uterus, bladder, brain, adrenal gland, small intestine, liver, kidney and heart. They found that the membrane preparations from spleen contained the highest binding activity per mg protein. They characterized the LTB 4 binding to the spleen preparation in detail. LTB 4 binding was rapid, reversible, stereoselective and saturable. The data from equilibrium experiments showed a linear Scatchard plot with a K/sub d/ of 1.6 nM and a binding site density of 259 fmol/mg prot. The rank order of agents competing for spleen ( 3 H)LTB 4 binding at 25 0 C was: LTB 4 (K/sub i/ = 2.8 nM) > 20-OH-LTB 4 (23 nM) > LTA 4 (48 nM) > LTA 4 methyl ester (0.13 μM) > 20-COOH-LTB 4 (> 6.6 μM) ≥ arachidonic acid (0.15 mM) similarly ordered FPL-55,712 (0.11 mM). At 4 0 C, LTB 4 (2.3 nM) competed at least 10x more effectively than 20-OH-LTB 4 (29 nM) and 20-COOH-LTB 4 (> 6.6 μM). HPLC analysis indicated that incubation of 84 ng LTB 4 with the spleen membrane at 25 0 C did not result in the formation of 20-OH-LTB 4 ( 3 H)LTB 4 receptor binding sites

  4. The high affinity K+ transporter AtHAK5 plays a physiological role in planta at very low K+ concentrations and provides a caesium uptake pathway in Arabidopsis. (United States)

    Qi, Zhi; Hampton, Corrina R; Shin, Ryoung; Barkla, Bronwyn J; White, Philip J; Schachtman, Daniel P


    Caesium (Cs(+)) is a potentially toxic mineral element that is released into the environment and taken up by plants. Although Cs(+) is chemically similar to potassium (K(+)), and much is known about K(+) transport mechanisms, it is not clear through which K(+) transport mechanisms Cs(+) is taken up by plant roots. In this study, the role of AtHAK5 in high affinity K(+) and Cs(+) uptake was characterized. It is demonstrated that AtHAK5 is localized to the plasma membrane under conditions of K(+) deprivation, when it is expressed. Growth analysis showed that AtHAK5 plays a role during severe K(+) deprivation. Under K(+)-deficient conditions in the presence of Cs(+), Arabidopsis seedlings lacking AtHAK5 had increased inhibition of root growth and lower Cs(+) accumulation, and significantly higher leaf chlorophyll concentrations than wild type. These data indicate that, in addition to transporting K(+) in planta, AtHAK5 also transports Cs(+). Further experiments showed that AtHAK5 mediated Cs(+) uptake into yeast cells and that, although the K(+) deficiency-induced expression of AtHAK5 was inhibited by low concentrations of NH(4)(+) in planta, Cs(+) uptake by yeast was stimulated by low concentrations of NH(4)(+). Interestingly, the growth of the Arabidopsis atakt1-1 mutant was more sensitive to Cs(+) than the wild type. This may be explained, in part, by increased expression of AtHAK5 in the atakt1-1 mutant. It is concluded that AtHAK5 is a root plasma membrane uptake mechanism for K(+) and Cs(+) under conditions of low K(+) availability.

  5. Dual regulation of root hydraulic conductivity and plasma membrane aquaporins by plant nitrate accumulation and high-affinity nitrate transporter NRT2.1. (United States)

    Li, Guowei; Tillard, Pascal; Gojon, Alain; Maurel, Christophe


    The water status and mineral nutrition of plants critically determine their growth and development. Nitrate (NO3(-)), the primary nitrogen source of higher plants, is known to impact the water transport capacity of roots (root hydraulic conductivity, Lpr). To explore the effects and mode of action of NO3(-) on Lpr, we used an extended set of NO3(-) transport (nrt1.1, nrt1.2, nrt1.5 and nrt2.1), signaling (nrt1.1 and nrt2.1) and metabolism (nia) mutants in Arabidopsis, grown under various NO3(-) conditions. First, a strong positive relationship between Lpr and NO3(-) accumulation, in shoots rather than in roots, was revealed. Secondly, a specific 30% reduction of Lpr in nrt2.1 plants unraveled a major role for the high-affinity NO3(-) transporter NRT2.1 in increasing Lpr These results indicate that NO3(-)signaling rather than nitrogen assimilation products governs Lpr in Arabidopsis. Quantitative real-time reverse transcription-PCR and enzyme-linked immunosorbent assays (ELISAs) were used to investigate the effects of NO3(-) availability on plasma membrane aquaporin (plasma membrane intrinsic protein; PIP) expression. Whereas PIP regulation mostly occurs at the post-translational level in wild-type plants, a regulation of PIPs at both the transcriptional and translational levels was uncovered in nrt2.1 plants. In conclusion, this work reveals that control of Arabidopsis Lpr and PIP functions by NO3(-) involves novel shoot to root signaling and NRT2.1-dependent functions. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email:

  6. High-affinity interaction of hnRNP A1 with conserved RNA structural elements is required for translation and replication of enterovirus 71. (United States)

    Levengood, Jeffrey D; Tolbert, Michele; Li, Mei-Ling; Tolbert, Blanton S


    Human Enterovirus 71 (EV71) is an emerging pathogen of infectious disease and a serious threat to public health. Currently, there are no antivirals or vaccines to slow down or prevent EV71 infections, thus underscoring the urgency to better understand mechanisms of host-enterovirus interactions. EV71 uses a type I internal ribosome entry site (IRES) to recruit the 40S ribosomal subunit via a pathway that requires the cytoplasmic localization of hnRNP A1, which acts as an IRES trans-activating factor. The mechanism of how hnRNP A1 trans activates EV71 RNA translation is unknown, however. Here, we report that the UP1 domain of hnRNP A1 interacts specifically with stem loop II (SLII) of the IRES, via a thermodynamically well-defined biphasic transition that involves conserved bulge 5'-AYAGY-3' and hairpin 5'-RY(U/A)CCA-3' loops. Calorimetric titrations of wild-type and mutant SLII constructs reveal these structural elements are essential to form a high-affinity UP1-SLII complex. Mutations that alter the bulge and hairpin primary or secondary structures abrogate the biphasic transition and destabilize the complex. Notably, mutations within the bulge that destabilize the complex correlate with a large reduction in IRES-dependent translational activity and impair EV71 replication. Taken together, this study shows that a conserved SLII structure is necessary to form a functional hnRNP A1-IRES complex, suggesting that small molecules that target this stem loop may have novel antiviral properties.

  7. Affine and quasi-affine frames for rational dilations

    DEFF Research Database (Denmark)

    Bownik, Marcin; Lemvig, Jakob


    In this paper we extend the investigation of quasi-affine systems, which were originally introduced by Ron and Shen [J. Funct. Anal. 148 (1997), 408-447] for integer, expansive dilations, to the class of rational, expansive dilations. We show that an affine system is a frame if, and only if......, the corresponding family of quasi-affine systems are frames with uniform frame bounds. We also prove a similar equivalence result between pairs of dual affine frames and dual quasi-affine frames. Finally, we uncover some fundamental differences between the integer and rational settings by exhibiting an example...

  8. Rhodamine-labeled 2beta-carbomethoxy-3beta-(3,4-dichlorophenyl)tropane analogues as high-affinity fluorescent probes for the dopamine transporter

    DEFF Research Database (Denmark)

    Cha, Joo Hwan; Zou, Mu-Fa; Adkins, Erika M


    linker. The resulting 2-substituted (5) and N-substituted (9) rhodamine-labeled ligands provided the highest DAT binding affinities expressed in COS-7 cells (Ki= 27 and 18 nM, respectively) in the series. Visualization of the DAT with 5 and 9 was demonstrated by confocal fluorescence laser scanning...

  9. Haemoglobin Rahere (beta Lys-Thr): A new high affinity haemoglobin associated with decreased 2, 3-diphosphoglycerate binding and relative polycythaemia. (United States)

    Lorkin, P A; Stephens, A D; Beard, M E; Wrigley, P F; Adams, L; Lehmann, H


    A new haemoglobin with increased oxygen affinity, beta82 (EF6) lysine leads to threonine (Hb Rahere), was found during the investigation of a patient who was found to have a raised haemoglobin concentration after a routine blood count. The substitution affects one of the 2, 3-diphosphoglycerate binding sites, resulting in an increased affinity for oxygen, but both the haem-haem interaction and the alkaline Bohr effect are normal in the haemolysate. This variant had the same mobility as haemoglobin A on electrophoresis at alkaline pH but was detected by measuring the whole blood oxygen affinity; it could be separated from haemoglobin A, however, by electrophoresis in agar at acid pH. The raised haemoglobin concentration was mainly due to a reduction in plasma volume (a relative polycythaemia) and was associated with a persistently raised white blood count. This case emphasises the need to measure the oxygen affinity of haemoglobin in all patients with absolute or relative polycythaemia when some obvious cause is not evident. PMID:124

  10. Synthesis of a Hoechst 32258 Analogue Amino Acid Building Block for Direct Incorporation of a Fluorescent High-Affinity DNA Binding Motif into Peptides

    DEFF Research Database (Denmark)

    Harrit, Niels; Behrens, Carsten; Nielsen, P. E.


    The synthesis of a new versatile "Hoechst 33258-like" Boc-protected amino acid building block for peptide synthesis is described. It is demonstrated that this new ligand is an effective mimic of Hoechst 33258 in terms of DNA affinity and sequence specificity. Furthermore, this minor groove binder...

  11. Low affinity uniporter carrier proteins can increase net substrate uptake rate by reducing efflux

    NARCIS (Netherlands)

    Bosdriesz, Evert; Wortel, Meike T.; Haanstra, Jurgen R.; Wagner, Marijke J.; De La Torre Cortés, Pilar; Teusink, Bas


    Many organisms have several similar transporters with different affinities for the same substrate. Typically, high-affinity transporters are expressed when substrate is scarce and low-affinity ones when it is abundant. The benefit of using low instead of high-affinity transporters remains unclear,

  12. Low affinity uniporter carrier proteins can increase net substrate uptake rate by reducing efflux

    NARCIS (Netherlands)

    Bosdriesz, Evert; Wortel, M.T.; Haanstra, Jurgen R.; Wagner, Marijke J.; De La Torre, P.; Teusink, Bas


    Many organisms have several similar transporters with different affinities for the same substrate. Typically, high-affinity transporters are expressed when substrate is scarce and low-affinity ones when it is abundant. The benefit of using low instead of high-affinity transporters remains

  13. Different endothelin receptor affinities in dog tissues

    International Nuclear Information System (INIS)

    Loeffler, B.M.L.; Loehrer, W.


    Endothelin (ET) is a long-lasting potent vasoconstrictor-peptide. Here the authors report different binding affinities of endothelin-1 (ET-1) to ET-receptors of various dog tissues. Crude microsomal fractions were prepared after homogenisation of dog tissues in 50 mM Tris/HCl, 20 mM MnCl2, 1 mM EDTA, pH 7.4 by differential centrifugation. Aliquots of microsomal fractions (70 micrograms of protein) were incubated at 25 degrees C for 180 min in the presence of 20 pM 125I-ET-1 and various concentrations of cold ET-1. Four different ET-1 receptor binding affinities were found: adrenals, cerebrum, liver, heart, skeletal muscle and stomach microsomal membranes contained high affinity binding sites (Kd 50 - 80 pM, Bmax 60 - 250 fmol/mg). In cerebellum and spleen medium affinity ET-1 receptors (Kd 350 pM, Bmax 880 and 1200 fmol/mg respectively) were present. In comparison lung and kidney microsomes contained a low affinity ET-1 receptor (Kd 800 and 880 pM, Bmax 1600 and 350 fmol/mg). Receptors of even lower affinity were present in heart, intestine and liver microsomes with Kd values of 3 - 6 nM

  14. Preclinical evaluation of multistep targeting of diasialoganglioside GD2 using a IgG-scFv bispecific antibody with high affinity for GD2 and DOTA metal complex (United States)

    Cheal, Sarah M.; Xu, Hong; Guo, Hong-fen; Zanzonico, Pat B.; Larson, Steven M.; Cheung, Nai-Kong


    Bispecific antibodies (BsAb) have proven to be useful targeting vectors for pretargeted radioimmunotherapy (PRIT). We sought to overcome key PRIT limitations such as high renal radiation exposure and immunogenicity (e.g. of streptavidin-antibody fusions), to advance clinical translation of this PRIT strategy for diasialoganglioside GD2-positive (GD2(+)) tumors. For this purpose, a IgG-scFv BsAb was engineered using the sequences for the anti-GD2 humanized monoclonal antibody hu3F8 (1) and C825, a murine scFv antibody with high affinity for the chelator 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA) complexed with beta-particle emitting radiometals such as 177Lu and 90Y (2, 3). A three-step regimen including hu3F8-C825, a dextran-based clearing agent, and p-aminobenzyl-DOTA radiolabeled with 177Lu (as 177Lu-DOTA-Bn; t1/2 = 6.71 days (d)) was optimized in immunocompromised mice carrying subcutaneous (s.c.) human GD2(+) neuroblastoma (NB) xenografts. Absorbed doses for tumor and normal tissues were ∼85 cGy/MBq and ≤3.7 cGy/MBq, respectively, with therapeutic indicies (TI) of 142 for blood and 23 for kidney. A therapy study (n = 5 per group; tumor volume: 240 ± 160 mm3) with three successive PRIT cycles (total 177Lu: ∼33 MBq; tumor dose ∼3400 cGy), revealed complete tumor response in 5/5 animals, with no recurrence up to 28 d post-treatment. Tumor ablation was confirmed histologically in 4/5 mice, and normal organs showed minimal overall toxicities. All non-treated mice required sacrifice within 12 d (>1.0 cm3 tumor volume). We conclude that this novel anti-GD2 PRIT approach has sufficient TI to successfully ablate s.c. GD2(+)–NB in mice while sparing kidney and bone marrow. PMID:24944121

  15. Antibody affinity maturation

    DEFF Research Database (Denmark)

    Skjødt, Mette Louise

    Yeast surface display is an effective tool for antibody affinity maturation because yeast can be used as an all-in-one workhorse to assemble, display and screen diversified antibody libraries. By employing the natural ability of yeast Saccharomyces cerevisiae to efficiently recombine multiple DNA...... laboratory conditions. A particular emphasis was put on using molecular techniques in conjunction with microenvironmental measurements (O2, pH, irradiance), a combination that is rarely found but provides a much more detailed understanding of “cause and effect” in complex natural systems...

  16. In Vitro and In Vivo Evaluation of Alexa Fluor 680-Bombesin[7–14]NH2 Peptide Conjugate, a High-Affinity Fluorescent Probe with High Selectivity for the Gastrin-Releasing Peptide Receptor

    Directory of Open Access Journals (Sweden)

    Lixin Ma


    Full Text Available Gastrin-releasing peptide (GRP receptors are overexpressed on several types of human cancer cells, including breast, prostate, small cell lung, and pancreatic cancers. Bombesin (BBN, a 14–amino acid peptide that is an analogue of human GRP, binds to GRP receptors with very high affinity and specificity. The aim of this study was to develop a new fluorescent probe based on BBN having high tumor uptake and optimal pharmacokinetics for specific targeting and optical imaging of human breast cancer tissue. In this study, solid-phase peptide synthesis was used to produce H2N-glycylglycylglycine-BBN[7–14]NH2 peptide with the following general sequence: H2N-G-G-G-Q-W-A-V-G-H-L-M-(NH2. This conjugate was purified by reversed-phase high-performance liquid chromatography and characterized by electrospray-ionization mass spectra. The fluorescent probe Alexa Fluor 680-G-G-G-BBN[7–14]NH2 conjugate was prepared by reaction of Alexa Fluor 680 succinimidyl ester to H2N-G-G-G-BBN[7–14]NH2 in dimethylformamide (DMF. In vitro competitive binding assays, using 125I-Tyr4-BBN as the radiolabeling gold standard, demonstrated an inhibitory concentration 50% value of 7.7 ± 1.4 nM in human T-47D breast cancer cells. Confocal fluorescence microscopy images of Alexa Fluor 680-G-G-G-BBN[7–14]NH2 in human T-47D breast cancer cells indicated specific uptake, internalization, and receptor blocking of the fluorescent bioprobe in vitro. In vivo investigations in SCID mice bearing xenografted T-47D breast cancer lesions demonstrated the ability of this new conjugate to specifically target tumor tissue with high selectivity and affinity.

  17. Crystal structure of the high-affinity Na+,K+-ATPase–ouabain complex with Mg2+ bound in the cation binding site

    DEFF Research Database (Denmark)

    Laursen, Mette; Yatime, Laure; Nissen, Poul


    of ouabain and the side chains of αM1, αM2, and αM6. Furthermore, the structure reveals that cation transport site II is occupied by Mg2+, and crystallographic studies indicate that Rb+ and Mn2+, but not Na+, bind to this site. Comparison with the low-affinity [K2]E2–MgFx–ouabain structure [Ogawa et al...

  18. The solutions of affine and conformal affine Toda field theory

    International Nuclear Information System (INIS)

    Papadopoulos, G.; Spence, B.


    We give new formulations of the solutions of the field equations of the affine Toda and conformal affine Toda theories on a cylinder and two-dimensional Minkowski space-time. These solutions are parameterised in terms of initial data and the resulting covariant phase spaces are diffeomorphic to the Hamiltonian ones. We derive the fundamental Poisson brackets of the parameters of the solutions and give the general static solutions for the affine theory. (authors). 10 refs

  19. Monastrol, a 3,4-dihydropyrimidin-2(1H)-thione, as structural scaffold for the development of modulators for GHB high-affinity binding sites and α1β2δ GABAA receptors

    DEFF Research Database (Denmark)

    Damgaard, Maria; Al-Khawaja, Anas; Nittegaard-Nielsen, Mia


    -affinity binding and is furthermore reported as an allosteric modulator selective for the α1β2δ GABAARs. Therefore, structural determinants for selectivity at the two targets were investigated. 39 structural diverse monastrol analogues were synthesized by employing the Biginelli cyclocondensation and examined......-affinity binding. However, three analogues of monastrol (11, 12 and 24) enhanced the maximal binding of [(3)H]NCS-382 to a higher maximal level than seen for monastrol itself. Selected compounds were further characterized as modulators at α1β2δ, α1β2γ2s and α1β2 GABAARs. Most of these modulators were shown to have...... δ-specific GABA-potentiating effects. The dual effect shown for monastrol to modulate the GHB high-affinity binding and α1β2δ GABAAR activity was also shown for the compounds 11, 18 and 24. Compound 29 displayed minimal modulatory effect on GABAARs and therefore appears to be a GHB high...

  20. Synthesis, in vitro validation and in vivo pharmacokinetics of [{sup 125}I]N-[2-(4-iodophenyl)ethyl]-N-methyl-2-(1-piperidinyl) ethylamine: A high-affinity ligand for imaging sigma receptor positive tumors

    Energy Technology Data Exchange (ETDEWEB)

    John, Christy S; Gulden, Mary E; Vilner, Bertold J; Bowen, Wayne D


    N-[2-(4-iodophenyl)ethyl]-N-methyl-2-(1-piperidinyl)ethylamine, IPEMP, and the corresponding bromo derivative, BrPEMP, have been synthesized and characterized. Both BrPEMP and IPEMP were evaluated for sigma-1 and sigma-2 subtype receptor affinities and found to possess very high affinities for both receptor subtypes. The precursor for radioiodination n-tributylstannylphenylethylpiperidinylethylamine was prepared from its bromo derivative by palladium-catalyzed stannylation reaction. Radioiodinated 4-[{sup 125}I]PEMP was readily prepared in high yields and high specific activity by oxidative iododestannylation reaction using chloramine-T as oxidizing agent. Sites labeled by 4-[{sup 125}I]PEMP in guinea pig brain membranes showed high affinity for BD1008, haloperidol, and (+)-pentazocine (Ki = 5.06 {+-} 0.40, 32.6 {+-} 2.75, and 48.1 {+-} 8.60 nM, respectively), which is consistent with sigma receptor pharmacology. Competition binding studies of 4-[{sup 125}I]PEMP in melanoma (A375) and MCF-7 breast cancer cells showed a high affinity, dose-dependent inhibition of binding with known sigma ligand N-[2-(3,4-dichlorophenyl)ethyl]-N-methyl-2-(1-pyrrolidinyl) ethylamine, BD1008 (Ki = 5, 11 nM, respectively), supporting the labeling of sigma sites in these cells. Haloperidol, however showed a weaker (Ki 100-200 nM) affinity for the sites labeled by 4-[{sup 125}I]PEMP in these cells. Biodistribution studies of 4-[{sup 125}I]PEMP in rats showed a fast clearance of this radiopharmaceutical from blood, liver, lung, and other organs. A co-injection of 4-IPEMP with 4-[{sup 125}I]PEMP resulted in 37%, 69%, and 35% decrease in activity in liver, kidney, and brain (organs possessing sigma receptors), respectively at 1-h postinjection. These results suggest that 4-[{sup 125}I]PEMP is a promising radiopharmaceutical for pursuing further studies in animal models with tumors.

  1. Fundamentals of affinity cell separations. (United States)

    Zhang, Ye; Lyons, Veronica; Pappas, Dimitri


    Cell separations using affinity methods continue to be an enabling science for a wide variety of applications. In this review, we discuss the fundamental aspects of affinity separation, including the competing forces for cell capture and elution, cell-surface interactions, and models for cell adhesion. Factors affecting separation performance such as bond affinity, contact area, and temperature are presented. We also discuss and demonstrate the effects of nonspecific binding on separation performance. Metrics for evaluating cell separations are presented, along with methods of comparing separation techniques for cell isolation using affinity capture. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Protein Cofactors Are Essential for High-Affinity DNA Binding by the Nuclear Factor κB RelA Subunit. (United States)

    Mulero, Maria Carmen; Shahabi, Shandy; Ko, Myung Soo; Schiffer, Jamie M; Huang, De-Bin; Wang, Vivien Ya-Fan; Amaro, Rommie E; Huxford, Tom; Ghosh, Gourisankar


    Transcription activator proteins typically contain two functional domains: a DNA binding domain (DBD) that binds to DNA with sequence specificity and an activation domain (AD) whose established function is to recruit RNA polymerase. In this report, we show that purified recombinant nuclear factor κB (NF-κB) RelA dimers bind specific κB DNA sites with an affinity significantly lower than that of the same dimers from nuclear extracts of activated cells, suggesting that additional nuclear cofactors might facilitate DNA binding by the RelA dimers. Additionally, recombinant RelA binds DNA with relatively low affinity at a physiological salt concentration in vitro. The addition of p53 or RPS3 (ribosomal protein S3) increases RelA:DNA binding affinity 2- to >50-fold depending on the protein and ionic conditions. These cofactor proteins do not form stable ternary complexes, suggesting that they stabilize the RelA:DNA complex through dynamic interactions. Surprisingly, the RelA-DBD alone fails to bind DNA under the same solution conditions even in the presence of cofactors, suggesting an important role of the RelA-AD in DNA binding. Reduced RelA:DNA binding at a physiological ionic strength suggests that multiple cofactors might be acting simultaneously to mitigate the electrolyte effect and stabilize the RelA:DNA complex in vivo. Overall, our observations suggest that the RelA-AD and multiple cofactor proteins function cooperatively to prime the RelA-DBD and stabilize the RelA:DNA complex in cells. Our study provides a mechanism for nuclear cofactor proteins in NF-κB-dependent gene regulation.

  3. Interrogating the Molecular Basis for Substrate Recognition in Serotonin and Dopamine Transporters with High-Affinity Substrate-Based Bivalent Ligands

    DEFF Research Database (Denmark)

    Andersen, Jacob; Ladefoged, Lucy Kate; Kristensen, Trine N. Bjerre


    insight into substrate recognition in SERT and DAT. An optimized bivalent ligand comprising two serotonin moieties binds SERT with 3,800-fold increased affinity compared to that of serotonin, suggesting that the human transporters have two distinct substrate binding sites. We show that the bivalent...... ligands are inhibitors of SERT and an experimentally validated docking model suggests that the bivalent compounds bind with one substrate moiety in the central binding site (the S1 site), whereas the other substrate moiety binds in a distinct binding site (the S2 site). A systematic study of nonconserved...

  4. Phosphopeptide enrichment by immobilized metal affinity chromatography

    DEFF Research Database (Denmark)

    Thingholm, Tine E.; Larsen, Martin R.


    Immobilized metal affinity chromatography (IMAC) has been the method of choice for phosphopeptide enrichment prior to mass spectrometric analysis for many years and it is still used extensively in many laboratories. Using the affinity of negatively charged phosphate groups towards positively...... charged metal ions such as Fe3+, Ga3+, Al3+, Zr4+, and Ti4+ has made it possible to enrich phosphorylated peptides from peptide samples. However, the selectivity of most of the metal ions is limited, when working with highly complex samples, e.g., whole-cell extracts, resulting in contamination from...

  5. Elongated membrane tethers, individually anchored by high affinity α4β1/VCAM-1 complexes, are the quantal units of monocyte arrests.

    Directory of Open Access Journals (Sweden)

    Calvin Chu

    Full Text Available The α4β1 integrin facilitates both monocyte rolling and adhesion to the vascular endothelium and is physiologically activated by monocyte chemoattractant protein (MCP-1. The current study investigated the initial events in the adhesion of THP-1 cells to immobilized Vascular Cell Adhesion Molecule 1 (VCAM-1. Using AFM force measurements, cell adhesion was shown to be mediated by two populations of α4β1/VCAM-1 complexes. A low affinity form of α4β1 was anchored to the elastic elements of the cytoskeleton, while a higher affinity conformer was coupled to the viscous elements of the cell membrane. Within 100 ms of contact, THP-1 cells, stimulated by co-immobilized MCP-1, exhibited a tremendous increase in adhesion to VCAM-1. Enhanced cell adhesion was accompanied by a local decoupling of the cell membrane from the cytoskeleton and the formation of long membrane tethers. The tethers were individually anchored by multiple α4β1/VCAM-1 complexes that prolonged the extension of the viscous tethers. In vivo, the formation of these membrane tethers may provide the quantal structural units for the arrest of rolling monocytes within the blood vessels.

  6. Mapping Affinities in Academic Organizations

    Directory of Open Access Journals (Sweden)

    Dario Rodighiero


    Full Text Available Scholarly affinities are one of the most fundamental hidden dynamics that drive scientific development. Some affinities are actual, and consequently can be measured through classical academic metrics such as co-authoring. Other affinities are potential, and therefore do not leave visible traces in information systems; for instance, some peers may share interests without actually knowing it. This article illustrates the development of a map of affinities for academic collectives, designed to be relevant to three audiences: the management, the scholars themselves, and the external public. Our case study involves the School of Architecture, Civil and Environmental Engineering of EPFL, hereinafter ENAC. The school consists of around 1,000 scholars, 70 laboratories, and 3 institutes. The actual affinities are modeled using the data available from the information systems reporting publications, teaching, and advising scholars, whereas the potential affinities are addressed through text mining of the publications. The major challenge for designing such a map is to represent the multi-dimensionality and multi-scale nature of the information. The affinities are not limited to the computation of heterogeneous sources of information; they also apply at different scales. The map, thus, shows local affinities inside a given laboratory, as well as global affinities among laboratories. This article presents a graphical grammar to represent affinities. Its effectiveness is illustrated by two actualizations of the design proposal: an interactive online system in which the map can be parameterized, and a large-scale carpet of 250 square meters. In both cases, we discuss how the materiality influences the representation of data, in particular the way key questions could be appropriately addressed considering the three target audiences: the insights gained by the management and their consequences in terms of governance, the understanding of the scholars’ own

  7. Lp-dual affine surface area (United States)

    Wei, Wang; Binwu, He


    According to the notion of Lp-affine surface area by Lutwak, in this paper, we introduce the concept of Lp-dual affine surface area. Further, we establish the affine isoperimetric inequality and the Blaschke-Santaló inequality for Lp-dual affine surface area. Besides, the dual Brunn-Minkowski inequality for Lp-dual affine surface area is presented.

  8. 2017 Guralp Affinity Digitizer Evaluation.

    Energy Technology Data Exchange (ETDEWEB)

    Merchant, Bion J.


    Sandia National Laboratories has tested and evaluated two Guralp Affinity digitizers. The Affinity digitizers are intended to record sensor output for seismic and infrasound monitoring applications. The purpose of this digitizer evaluation is to measure the performance characteristics in such areas as power consumption, input impedance, sensitivity, full scale, self- noise, dynamic range, system noise, response, passband, and timing. The Affinity digitizers are being evaluated for potential use in the International Monitoring System (IMS) of the Comprehensive Nuclear Test-Ban-Treaty Organization (CTBTO).

  9. The utility of affine variables and affine coherent states

    International Nuclear Information System (INIS)

    Klauder, John R


    Affine coherent states are generated by affine kinematical variables much like canonical coherent states are generated by canonical kinematical variables. Although all classical and quantum formalisms normally entail canonical variables, it is shown that affine variables can serve equally well for many classical and quantum studies. This general purpose analysis provides tools to discuss two major applications: (1) the completely successful quantization of a nonrenormalizable scalar quantum field theory by affine techniques, in complete contrast to canonical techniques which only offer triviality; and (2) a formulation of the kinematical portion of quantum gravity that favors affine kinematical variables over canonical kinematical variables, and which generates a framework in which a favorable analysis of the constrained dynamical issues can take place. All this is possible because of the close connection between the affine and the canonical stories, while the few distinctions can be used to advantage when appropriate. This article is part of a special issue of Journal of Physics A: Mathematical and Theoretical devoted to ‘Coherent states: mathematical and physical aspects’. (review)

  10. Motif III in superfamily 2 "helicases" helps convert the binding energy of ATP into a high-affinity RNA binding site in the yeast DEAD-box protein Ded1. (United States)

    Banroques, Josette; Doère, Monique; Dreyfus, Marc; Linder, Patrick; Tanner, N Kyle


    Motif III in the putative helicases of superfamily 2 is highly conserved in both its sequence and its structural context. It typically consists of the sequence alcohol-alanine-alcohol (S/T-A-S/T). Historically, it was thought to link ATPase activity with a "helicase" strand displacement activity that disrupts RNA or DNA duplexes. DEAD-box proteins constitute the largest family of superfamily 2; they are RNA-dependent ATPases and ATP-dependent RNA binding proteins that, in some cases, are able to disrupt short RNA duplexes. We made mutations of motif III (S-A-T) in the yeast DEAD-box protein Ded1 and analyzed in vivo phenotypes and in vitro properties. Moreover, we made a tertiary model of Ded1 based on the solved structure of Vasa. We used Ded1 because it has relatively high ATPase and RNA binding activities; it is able to displace moderately stable duplexes at a large excess of substrate. We find that the alanine and the threonine in the second and third positions of motif III are more important than the serine, but that mutations of all three residues have strong phenotypes. We purified the wild-type and various mutants expressed in Escherichia coli. We found that motif III mutations affect the RNA-dependent hydrolysis of ATP (k(cat)), but not the affinity for ATP (K(m)). Moreover, mutations alter and reduce the affinity for single-stranded RNA and subsequently reduce the ability to disrupt duplexes. We obtained intragenic suppressors of the S-A-C mutant that compensate for the mutation by enhancing the affinity for ATP and RNA. We conclude that motif III and the binding energy of gamma-PO(4) of ATP are used to coordinate motifs I, II, and VI and the two RecA-like domains to create a high-affinity single-stranded RNA binding site. It also may help activate the beta,gamma-phosphoanhydride bond of ATP. (c) 2009 Elsevier Ltd. All rights reserved.

  11. Compound immobilization and drug-affinity chromatography. (United States)

    Rix, Uwe; Gridling, Manuela; Superti-Furga, Giulio


    Bioactive small molecules act through modulating a yet unpredictable number of targets. It is therefore of critical importance to define the cellular target proteins of a compound as an entry point to understanding its mechanism of action. Often, this can be achieved in a direct fashion by chemical proteomics. As with any affinity chromatography, immobilization of the bait to a solid support is one of the earliest and most crucial steps in the process. Interfering with structural features that are important for identification of a target protein will be detrimental to binding affinity. Also, many molecules are sensitive to heat or to certain chemicals, such as acid or base, and might be destroyed during the process of immobilization, which therefore needs to be not only efficient, but also mild. The subsequent affinity chromatography step needs to preserve molecular and conformational integrity of both bait compound and proteins in order to result in the desired specific enrichment while ensuring a high level of compatibility with downstream analysis by mass spectrometry. Thus, the right choice of detergent, buffer, and protease inhibitors is also essential. This chapter describes a widely applicable procedure for the immobilization of small molecule drugs and for drug-affinity chromatography with subsequent protein identification by mass spectrometry.

  12. Representations of affine Hecke algebras

    CERN Document Server

    Xi, Nanhua


    Kazhdan and Lusztig classified the simple modules of an affine Hecke algebra Hq (q E C*) provided that q is not a root of 1 (Invent. Math. 1987). Ginzburg had some very interesting work on affine Hecke algebras. Combining these results simple Hq-modules can be classified provided that the order of q is not too small. These Lecture Notes of N. Xi show that the classification of simple Hq-modules is essentially different from general cases when q is a root of 1 of certain orders. In addition the based rings of affine Weyl groups are shown to be of interest in understanding irreducible representations of affine Hecke algebras. Basic knowledge of abstract algebra is enough to read one third of the book. Some knowledge of K-theory, algebraic group, and Kazhdan-Lusztig cell of Cexeter group is useful for the rest

  13. Contractions of affine spherical varieties

    International Nuclear Information System (INIS)

    Arzhantsev, I V


    The language of filtrations and contractions is used to describe the class of G-varieties obtainable as the total spaces of the construction of contraction applied to affine spherical varieties, which is well-known in invariant theory. These varieties are local models for arbitrary affine G-varieties of complexity 1 with a one-dimensional categorical quotient. As examples, reductive algebraic semigroups and three-dimensional SL 2 -varieties are considered

  14. CmRBP50 protein phosphorylation is essential for assembly of a stable phloem-mobile high-affinity ribonucleoprotein complex. (United States)

    Li, Pingfang; Ham, Byung-Kook; Lucas, William J


    RNA-binding proteins (RBPs) form ribonucleoprotein (RNP) complexes that play crucial roles in RNA processing for gene regulation. The angiosperm sieve tube system contains a unique population of transcripts, some of which function as long-distance signaling agents involved in regulating organ development. These phloem-mobile mRNAs are translocated as RNP complexes. One such complex is based on a phloem RBP named Cucurbita maxima RNA-binding protein 50 (CmRBP50), a member of the polypyrimidine track binding protein family. The core of this RNP complex contains six additional phloem proteins. Here, requirements for assembly of this CmRBP50 RNP complex are reported. Phosphorylation sites on CmRBP50 were mapped, and then coimmunoprecipitation and protein overlay studies established that the phosphoserine residues, located at the C terminus of CmRBP50, are critical for RNP complex assembly. In vitro pull-down experiments revealed that three phloem proteins, C. maxima phloem protein 16, C. maxima GTP-binding protein, and C. maxima phosphoinositide-specific phospholipase-like protein, bind directly with CmRBP50. This interaction required CmRBP50 phosphorylation. Gel mobility-shift assays demonstrated that assembly of the CmRBP50-based protein complex results in a system having enhanced binding affinity for phloem-mobile mRNAs carrying polypyrimidine track binding motifs. This property would be essential for effective long-distance translocation of bound mRNA to the target tissues.

  15. Two zinc-binding domains in the transporter AdcA from Streptococcus pyogenes facilitate high-affinity binding and fast transport of zinc. (United States)

    Cao, Kun; Li, Nan; Wang, Hongcui; Cao, Xin; He, Jiaojiao; Zhang, Bing; He, Qing-Yu; Zhang, Gong; Sun, Xuesong


    Zinc is an essential metal in bacteria. One important bacterial zinc transporter is AdcA, and most bacteria possess AdcA homologs that are single-domain small proteins due to better efficiency of protein biogenesis. However, a double-domain AdcA with two zinc-binding sites is significantly overrepresented in Streptococcus species, many of which are major human pathogens. Using molecular simulation and experimental validations of AdcA from Streptococcus pyogenes , we found here that the two AdcA domains sequentially stabilize the structure upon zinc binding, indicating an organization required for both increased zinc affinity and transfer speed. This structural organization appears to endow Streptococcus species with distinct advantages in zinc-depleted environments, which would not be achieved by each single AdcA domain alone. This enhanced zinc transport mechanism sheds light on the significance of the evolution of the AdcA domain fusion, provides new insights into double-domain transporter proteins with two binding sites for the same ion, and indicates a potential target of antimicrobial drugs against pathogenic Streptococcus species. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Circulating chromatin-anti-chromatin antibody complexes bind with high affinity to dermo-epidermal structures in murine and human lupus nephritis

    DEFF Research Database (Denmark)

    Fismen, S; Hedberg, A; Fenton, K A


    Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo-epidermal i......Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo......-epidermal immune complex deposits have similar molecular composition as glomerular deposits, (ii) whether chromatin fragments bind dermo-epidermal structures, and (iii) whether deposits in nephritic glomeruli predispose for accumulation of similar deposits in skin. Paired skin and kidney biopsies from nephritic...... (NZBxNZW)F1 and MRL-lpr/lpr mice and from five patients with lupus nephritis were analysed by immunofluorescence, immune electron microscopy (IEM) and co-localization TUNEL IEM. Affinity of chromatin fragments for membrane structures was determined by surface plasmon resonance. Results demonstrated (i...

  17. Allosteric Inhibition of Bcr-Abl Kinase by High Affinity Monobody Inhibitors Directed to the Src Homology 2 (SH2)-Kinase Interface* (United States)

    Wojcik, John; Lamontanara, Allan Joaquim; Grabe, Grzegorz; Koide, Akiko; Akin, Louesa; Gerig, Barbara; Hantschel, Oliver; Koide, Shohei


    Bcr-Abl is a constitutively active kinase that causes chronic myelogenous leukemia. We have shown that a tandem fusion of two designed binding proteins, termed monobodies, directed to the interaction interface between the Src homology 2 (SH2) and kinase domains and to the phosphotyrosine-binding site of the SH2 domain, respectively, inhibits the Bcr-Abl kinase activity. Because the latter monobody inhibits processive phosphorylation by Bcr-Abl and the SH2-kinase interface is occluded in the active kinase, it remained undetermined whether targeting the SH2-kinase interface alone was sufficient for Bcr-Abl inhibition. To address this question, we generated new, higher affinity monobodies with single nanomolar KD values targeting the kinase-binding surface of SH2. Structural and mutagenesis studies revealed the molecular underpinnings of the monobody-SH2 interactions. Importantly, the new monobodies inhibited Bcr-Abl kinase activity in vitro and in cells, and they potently induced cell death in chronic myelogenous leukemia cell lines. This work provides strong evidence for the SH2-kinase interface as a pharmacologically tractable site for allosteric inhibition of Bcr-Abl. PMID:26912659

  18. Allosteric Inhibition of Bcr-Abl Kinase by High Affinity Monobody Inhibitors Directed to the Src Homology 2 (SH2)-Kinase Interface. (United States)

    Wojcik, John; Lamontanara, Allan Joaquim; Grabe, Grzegorz; Koide, Akiko; Akin, Louesa; Gerig, Barbara; Hantschel, Oliver; Koide, Shohei


    Bcr-Abl is a constitutively active kinase that causes chronic myelogenous leukemia. We have shown that a tandem fusion of two designed binding proteins, termed monobodies, directed to the interaction interface between the Src homology 2 (SH2) and kinase domains and to the phosphotyrosine-binding site of the SH2 domain, respectively, inhibits the Bcr-Abl kinase activity. Because the latter monobody inhibits processive phosphorylation by Bcr-Abl and the SH2-kinase interface is occluded in the active kinase, it remained undetermined whether targeting the SH2-kinase interface alone was sufficient for Bcr-Abl inhibition. To address this question, we generated new, higher affinity monobodies with single nanomolar KD values targeting the kinase-binding surface of SH2. Structural and mutagenesis studies revealed the molecular underpinnings of the monobody-SH2 interactions. Importantly, the new monobodies inhibited Bcr-Abl kinase activity in vitro and in cells, and they potently induced cell death in chronic myelogenous leukemia cell lines. This work provides strong evidence for the SH2-kinase interface as a pharmacologically tractable site for allosteric inhibition of Bcr-Abl. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Radiosynthesis and in vitro evaluation of 2-(N-alkyl-N-1'-11C-propyl)amino-5-hydroxytetralin analogs as high affinity agonists for dopamine D-2 receptors

    International Nuclear Information System (INIS)

    Shi Bingzhi; Narayanan, Tanjore K.; Yang, Z.-Y.; Christian, Bradley T.; Mukherjee, Jogeshwar


    We have developed radiotracers based on agonists that may potentially allow the in vivo assessment of the high affinity (HA) state of the dopamine D-2 receptors. The population of HA state, which is likely the functional state of the receptor, may be altered in certain diseases. We carried out radiosyntheses and evaluated the binding affinities, lipophilicity, and in vitro autoradiographic binding characteristics of three dopamine D-2 receptor agonists: (±)-2-(N,N-dipropyl)amino-5-hydroxytetralin (5-OH-DPAT), (±)-2-(N-phenethyl-N-propyl)amino-5-hydroxytetralin (PPHT), and (±)-2-(N-cyclohexylethyl-N-propyl)amino-5-hydroxytetralin (ZYY-339). In 3 H-spiperone assays using rat striata, ZYY-339 exhibited subnanomolar affinity for D-2 receptor sites ( IC 50 =0.010 nM), PPHT was somewhat weaker ( IC 50 =0.65 nM), and 5-OH-DPAT exhibited the weakest affinity ( IC 50 =2.5 nM) of the three compounds. Radiosynthesis of these derivatives, 2-(N-propyl-N-1'- 11 C-propyl)amino-5-hydroxytetralin ( 11 C-5-OH-DPAT), 2-(N-phenethyl-N-1'- 11 C-propyl)amino-5-hydroxytetralin ( 11 C-PPHT), and 2-(N-cyclohexylethyl-N-1'- 11 C-propyl)amino-5-hydroxytetralin ( 11 C-ZYY-339) was achieved by first synthesizing 11 C-1-propionyl chloride and subsequent coupling with the appropriate secondary amine precursor to form the respective amide, which was then reduced to provide the desired tertiary amine products. The final products were obtained by reverse-phase high performance liquid chromatography (HPLC) purification in radiochemical yields of 5-10% after 60-75 min from the end of 11 CO 2 trapping and with specific activities in the range of 250-1,000 Ci/mmol. In vitro autoradiographs in rat brain slices with 11 C-5-OH-DPAT, 11 C-PPHT, and 11 C-ZYY-339 revealed selective binding of the three radiotracers to the dopamine D-2 receptors in the striata

  20. The C-terminal SH2 domain of p85 accounts for the high affinity and specificity of the binding of phosphatidylinositol 3-kinase to phosphorylated platelet-derived growth factor beta receptor. (United States)

    Klippel, A; Escobedo, J A; Fantl, W J; Williams, L T


    Upon stimulation by its ligand, the platelet-derived growth factor (PDGF) receptor associates with the 85-kDa subunit of phosphatidylinositol (PI) 3-kinase. The 85-kDa protein (p85) contains two Src homology 2 (SH2) domains and one SH3 domain. To define the part of p85 that interacts with the PDGF receptor, a series of truncated p85 mutants was analyzed for association with immobilized PDGF receptor in vitro. We found that a fragment of p85 that contains a single Src homology domain, the C-terminal SH2 domain (SH2-C), was sufficient for directing the high-affinity interaction with the receptor. Half-maximal binding of SH2-C to the receptor was observed at an SH2-C concentration of 0.06 nM. SH2-C, like full-length p85, was able to distinguish between wild-type PDGF receptor and a mutant receptor lacking the PI 3-kinase binding site. An excess of SH2-C blocked binding of full-length p85 and PI 3-kinase to the receptor but did not interfere with the binding of two other SH2-containing proteins, phospholipase C-gamma and GTPase-activating protein. These results demonstrate that a region of p85 containing a single SH2 domain accounts both for the high affinity and specificity of binding of PI 3-kinase to the PDGF receptor. Images PMID:1312663

  1. Identification and characterization of an alternative splice variant of Mpl with a high affinity for TPO and its activation of ERK1/2 signaling. (United States)

    Wang, Qiong; Sun, Rui; Wu, Leyan; Huang, Junfeng; Wang, Ping; Yuan, Hailong; Qiu, Feifei; Xu, Xiaohong; Wu, Di; Yu, Ying; Liu, Xin; Zhang, Qing


    The thrombopoietin receptor is a crucial element in thrombopoietin-initiated signaling pathways, which stimulates the differentiation of normal hematopoietic progenitor cells, the maturation of megakaryocytes, and the generation of platelets. In this study, we identified a novel activating variant of thrombopoietin receptor, termed Mpl-D, in human megakaryoblastic leukemia Dami cells and demonstrated that the binding affinity of the Mpl-D receptor for thrombopoietin is enhanced. Cell cycle analysis revealed that in the presence of thrombopoietin, most Mpl-D expressing NIH3T3 (NIH3T3/Mpl-D) cells were prevalent in G1 phase while the S and G2/M populations were less frequently observed. Unexpectedly, thrombopoietin induced strong and prolonged ERK1/2 signaling in NIH3T3/Mpl-D cells compared with its receptor wild-type expressing NIH3T3 (NIH3T3/Mpl-F) cells. Further analysis of the mRNA levels of cyclin D1/D2 in NIH3T3/Mpl-D cells demonstrated markedly down-regulated expression compared to NIH3T3/Mpl-F cells in the presence of thrombopoietin. Thus, the prolonged activation of ERK1/2 by Mpl-D might lead to G1 cell cycle arrest through a profound reduction of cyclin D1/D2 in order to support cell survival without proliferation. We also provided tertiary structural basis for the Mpl-D and thrombopoietin interaction, which might provide insights into how Mpl-D effectively increases binding to thrombopoietin and significantly contributes to its specific signaling pathway. These results suggest a new paradigm for the regulation of cytokine receptor expression and function through the alternative splicing variant of Mpl in Dami cells, which may play a role in the pathogenesis of megakaryoblastic leukemia. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Follicle-stimulating hormone (FSH) unmasks specific high affinity FSH-binding sites in cell-free membrane preparations of porcine granulosa cells

    Energy Technology Data Exchange (ETDEWEB)

    Ford, K.A.; LaBarbera, A.R.


    The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase in receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.

  3. Dimerization Is Not a Determining Factor for Functional High Affinity Human Plasminogen Binding by the Group A Streptococcal Virulence Factor PAM and Is Mediated by Specific Residues within the PAM a1a2 Domain* (United States)

    Bhattacharya, Sarbani; Liang, Zhong; Quek, Adam J.; Ploplis, Victoria A.; Law, Ruby; Castellino, Francis J.


    A emm53 subclass of Group A Streptococcus pyogenes (GAS) interacts tightly with human plasma plasminogen (hPg) and plasmin (hPm) via the kringle 2 (K2hPg) domain of hPg/hPm and the N-terminal a1a2 regions of a GAS coiled-coil M-like protein (PAM). Previous studies have shown that a monomeric PAM fragment, VEK30 (residues 97–125 + Tyr), interacted specifically with isolated K2hPg. However, the binding strength of VEK30 (KD = 56 nm) was ∼60-fold weaker than that of full-length dimeric PAM (KD = 1 nm). To assess whether this attenuated binding was due to the inability of VEK30 to dimerize, we defined the minimal length of PAM required to dimerize using a series of peptides with additional PAM residues placed at the NH2 and COOH termini of VEK30. VEK64 (PAM residues 83–145 + Tyr) was found to be the smallest peptide that adopted an α-helical dimer, and was bound to K2hPg with nearly the same affinity as PAM (KD = 1–2 nm). However, addition of two PAM residues (Arg126-His127) to the COOH terminus of VEK30 (VEK32) maintained a monomeric peptidic structure, but exhibited similar K2hPg binding affinity as full-length dimeric PAM. We identified five residues in a1a2 (Arg113, His114, Glu116, Arg126, His127), mutation of which reduced PAM binding affinity for K2hPg by ∼1000-fold. Replacement of these critical residues by Ala in the GAS genome resulted in reduced virulence, similar to the effects of inactivating the PAM gene entirely. We conclude that rather than dimerization of PAM, the five key residues in the binding domain of PAM are essential to mediate the high affinity interaction with hPg, leading to increased GAS virulence. PMID:24962580

  4. Dimerization is not a determining factor for functional high affinity human plasminogen binding by the group A streptococcal virulence factor PAM and is mediated by specific residues within the PAM a1a2 domain. (United States)

    Bhattacharya, Sarbani; Liang, Zhong; Quek, Adam J; Ploplis, Victoria A; Law, Ruby; Castellino, Francis J


    A emm53 subclass of Group A Streptococcus pyogenes (GAS) interacts tightly with human plasma plasminogen (hPg) and plasmin (hPm) via the kringle 2 (K2hPg) domain of hPg/hPm and the N-terminal a1a2 regions of a GAS coiled-coil M-like protein (PAM). Previous studies have shown that a monomeric PAM fragment, VEK30 (residues 97-125 + Tyr), interacted specifically with isolated K2hPg. However, the binding strength of VEK30 (KD = 56 nm) was ∼60-fold weaker than that of full-length dimeric PAM (KD = 1 nm). To assess whether this attenuated binding was due to the inability of VEK30 to dimerize, we defined the minimal length of PAM required to dimerize using a series of peptides with additional PAM residues placed at the NH2 and COOH termini of VEK30. VEK64 (PAM residues 83-145 + Tyr) was found to be the smallest peptide that adopted an α-helical dimer, and was bound to K2hPg with nearly the same affinity as PAM (KD = 1-2 nm). However, addition of two PAM residues (Arg(126)-His(127)) to the COOH terminus of VEK30 (VEK32) maintained a monomeric peptidic structure, but exhibited similar K2hPg binding affinity as full-length dimeric PAM. We identified five residues in a1a2 (Arg(113), His(114), Glu(116), Arg(126), His(127)), mutation of which reduced PAM binding affinity for K2hPg by ∼ 1000-fold. Replacement of these critical residues by Ala in the GAS genome resulted in reduced virulence, similar to the effects of inactivating the PAM gene entirely. We conclude that rather than dimerization of PAM, the five key residues in the binding domain of PAM are essential to mediate the high affinity interaction with hPg, leading to increased GAS virulence. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Coordination of two high-affinity hexamer peptides to copper(II) and palladium(II) models of the peptide-metal chelation site on IMAC resins. (United States)

    Chen, Y; Pasquinelli, R; Ataai, M; Koepsel, R R; Kortes, R A; Shepherd, R E


    The coordination of peptides Ser-Pro-His-His-Gly-Gly (SPHHGG) and (His)6 (HHHHHH) to [PdII(mida)(D2O)] (mida2- = N-methyliminodiacetate) was studied by 1H NMR as model reactions for CuII(iminodiacetate)-immobilized metal affinity chromatography (IMAC) sites. This is the first direct physical description of peptide coordination for IMAC. A three-site coordination is observed which involves the first, third, and fourth residues along the peptide chain. The presence of proline in position 2 of SPHHGG achieves the best molecular mechanics and bonding angles in the coordinated peptide and enhances the interaction of the serine amino nitrogen. Histidine coordination of H1, H3, and H4 of (His)6 and H3 and H4 of SPHHGG was detected by 1H NMR contact shifts and H/D exchange of histidyl protons. The EPR spectra of SPHHGG and HHHHHH attached to the [CuII(mida)] unit were obtained for additional modeling of IMAC sites. EPR parameters of the parent [Cu(mida)(H2O)2] complex are representative: gzz = 2.31; gyy = 2.086; gxx = 2.053; A parallel = 161G; AN = 19G (three line, one N coupling). Increased rhombic distortion is detected relative to the starting aqua complex in the order of [Cu(mida)L] for distortion of HHHHHH > SPHHGG > (H2O)2. The lowering of symmetry is also seen in the decrease in the N-shf coupling, presumably to the imino nitrogen of mida2- in the order 19 G (H2O), 16 G (SPHHGG) and 11 G (HHHHHH). Visible spectra of the [Cu(mida)(SPHHGG)] and [Cu(mida)(HHHHHH)] as a function of pH indicate coordination of one histidyl donor at ca. 4.5, two in the range of pH 5-7, and two chelate ring attachments involving the terminal amino donor for SPHHGG or another histidyl donor of HHHHHH in the pH domain of 7-8 in agreement with the [PdII(mida)L] derivatives which form the two-chelate-ring attachment even at lower pH as shown by the 1H NMR methods.

  6. The Structure of Affine Buildings

    CERN Document Server

    Weiss, Richard M


    In The Structure of Affine Buildings, Richard Weiss gives a detailed presentation of the complete proof of the classification of Bruhat-Tits buildings first completed by Jacques Tits in 1986. The book includes numerous results about automorphisms, completions, and residues of these buildings. It also includes tables correlating the results in the locally finite case with the results of Tits's classification of absolutely simple algebraic groups defined over a local field. A companion to Weiss's The Structure of Spherical Buildings, The Structure of Affine Buildings is organized around the clas

  7. A shortcut to high-affinity Ga-68 and Cu-64 radiopharmaceuticals: one-pot click chemistry trimerisation on the TRAP platform. (United States)

    Baranyai, Zsolt; Reich, Dominik; Vágner, Adrienn; Weineisen, Martina; Tóth, Imre; Wester, Hans-Jürgen; Notni, Johannes


    Due to its 3 carbonic acid groups being available for bioconjugation, the TRAP chelator (1,4,7-triazacyclononane-1,4,7-tris(methylene(2-carboxyethylphosphinic acid))) is chosen for the synthesis of trimeric bioconjugates for radiolabelling. We optimized a protocol for bio-orthogonal TRAP conjugation via Cu(I)-catalyzed Huisgen-cycloaddition of terminal azides and alkynes (CuAAC), including a detailed investigation of kinetic properties of Cu(II)-TRAP complexes. TRAP building blocks for CuAAC, TRAP(alkyne)3 and TRAP(azide)3 were obtained by amide coupling of propargylamine/3-azidopropyl-1-amine, respectively. For Cu(II) complexes of neat and triply amide-functionalized TRAP, the equilibrium properties as well as pseudo-first-order Cu(II)-transchelation, using 10 to 30 eq. of NOTA and EDTA, were studied by UV-spectrophotometry. Dissociation of any Cu(II)-TRAP species was found to be independent on the nature or excess of a competing chelator, confirming a proton-driven two-step mechanism. The respective thermodynamic stability constants (log K(ML): 19.1 and 17.6) and dissociation rates (k: 38 × 10(-6) and 7 × 10(-6) s(-1), 298 K, pH 4) show that the Cu(II) complex of the TRAP-conjugate possesses lower thermodynamic stability but higher kinetic inertness. At pH 2-3, its demetallation with NOTA was complete within several hours/days at room temperature, respectively, enabling facile Cu(II) removal after click coupling by direct addition of NOTA trihydrochloride to the CuAAC reaction mixture. Notwithstanding this, an extrapolated dissociation half life of >100 h at 37 °C and pH 7 confirms the suitability of TRAP-bioconjugates for application in Cu-64 PET (cf. t(1/2)(Cu-64) = 12.7 h). To showcase advantages of the method, TRAP(DUPA-Pep)3, a trimer of the PSMA inhibitor DUPA-Pep, was synthesized using 1 eq. TRAP(alkyne)3, 3.3 eq. DUPA-Pep-azide, 10 eq. Na ascorbate, and 1.2 eq. Cu(II)-acetate. Its PSMA affinity (IC50), determined by the competition assay on LNCa

  8. Identification of the ligand-binding subunit of the human 5-hydroxytryptamine1A receptor with N-(p-azido-m-[125I] iodophenethyl)spiperone, a high affinity radioiodinated photoaffinity probe

    International Nuclear Information System (INIS)

    Raymond, J.R.; Fargin, A.; Lohse, M.J.; Regan, J.W.; Senogles, S.E.; Lefkowitz, R.J.; Caron, M.G.


    The ligand-binding subunit of the human 5-hydroxytryptamine1A (5-HT1A) receptor transiently expressed in COS-7 cells and of the native human 5-HT1A receptor derived from hippocampus and frontal cortex were identified by photoaffinity labeling with N-(p-azido-m-[125I]iodophenethyl)spiperone [( 125I]N3-NAPS), previously characterized as a high affinity radioiodinated D2-dopamine receptor probe. The identity of the ligand-binding subunit was confirmed by immunoprecipitation with an antipeptide rabbit antiserum, JWR21, raised against a synthetic peptide derived from the predicted amino acid sequence of the putative third intracellular loop of the human 5-HT1A receptor. In transiently transfected COS-7 cells expressing 14 +/- 3 pmol/mg of protein human 5-HT1A receptors, a single broad 75-kDa band was photoaffinity labeled by [125I]N3-NAPS. This band displayed the expected pharmacology of the 5-HT1A receptor, as evidenced by the ability of a series of competing ligands to block [125I]N3-NAPS photoincorporation. Moreover, antiserum JWR21 specifically and quantitatively immunoprecipitated the 75-kDa photoaffinity-labeled band from a soluble extract of the transfected COS-7 cell membranes, further confirming its identity. Finally, utilizing a combination of photoaffinity labeling and immunoprecipitation, the native ligand-binding subunit of 62-64 kDa was identified in human hippocampus and frontal cortex. The availability of the high specific activity, high affinity, photoaffinity ligand [125I]N3-NAPS and of a potent immunoprecipitating antiserum (JWR21) should greatly facilitate the biochemical characterization of the human 5-HT1A receptor

  9. Affinity biosensors: techniques and protocols

    National Research Council Canada - National Science Library

    Rogers, Kim R; Mulchandani, Ashok


    ..., and government to begin or expand their biosensors research. This volume, Methods in Biotechnology vol. 7: Affinity Biosensors: Techniques and Protocols, describes a variety of classical and emerging transduction technologies that have been interfaced to bioaffinity elements (e.g., antibodies and receptors). Some of the reas...

  10. Slc5a8, a Na+-coupled high-affinity transporter for short-chain fatty acids, is a conditional tumour suppressor in colon that protects against colitis and colon cancer under low-fibre dietary conditions. (United States)

    Gurav, Ashish; Sivaprakasam, Sathish; Bhutia, Yangzom D; Boettger, Thomas; Singh, Nagendra; Ganapathy, Vadivel


    Mammalian colon harbours trillions of bacteria under physiological conditions; this symbiosis is made possible because of a tolerized response from the mucosal immune system. The mechanisms underlying this tolerogenic phenomenon remain poorly understood. In the present study we show that Slc5a8 (solute carrier gene family 5a, member 8), a Na(+)-coupled high-affinity transporter in colon for the bacterial fermentation product butyrate, plays a critical role in this process. Among various immune cells in colon, dendritic cells (DCs) are unique not only in their accessibility to luminal contents but also in their ability to induce tolerogenic phenotype in T-cells. We found that DCs exposed to butyrate express the immunosuppressive enzymes indoleamine 2,3-dioxygenase 1 (IDO1) and aldehyde dehydrogenase 1A2 (Aldh1A2), promote conversion of naive T-cells into immunosuppressive forkhead box P3(+) (FoxP3(+)) Tregs (regulatory T-cells) and suppress conversion of naive T-cells into pro-inflammatory interferon (IFN)-γ-producing cells. Slc5a8-null DCs do not induce IDO1 and Aldh1A2 and do not generate Tregs or suppress IFN-γ-producing T-cells in response to butyrate. We also provide in vivo evidence for an obligatory role for Slc5a8 in suppression of IFN-γ-producing T-cells. Furthermore, Slc5a8 protects against colitis and colon cancer under conditions of low-fibre intake but not when dietary fibre intake is optimal. This agrees with the high-affinity nature of the transporter to mediate butyrate entry into cells. We conclude that Slc5a8 is an obligatory link between dietary fibre and mucosal immune system via the bacterial metabolite butyrate and that this transporter is a conditional tumour suppressor in colon linked to dietary fibre content. © 2015 Authors; published by Portland Press Limited.

  11. Engineering of an Extremely Thermostable Alpha/Beta Barrel Scaffold to Serve as a High Affinity Molecular Recognition Element for Use in Sensor Applications (United States)


    Molecular Recognition Element For Use in Sensor Applications Report Title The overall goal of the project was to evolve a highly thermostable enzyme ( alcohol ...SECURITY CLASSIFICATION OF: The overall goal of the project was to evolve a highly thermostable enzyme ( alcohol dehydrogenase D (AdhD) from Pyrococcus...furiosus) to bind an explosive molecule, RDX. The enzyme naturally catalyzes the nicotinamide cofactor-dependent oxidation or reduction of alcohols

  12. Identification of high-affinity anti-IL-1 α autoantibodies in normal human serum as an interfering substance in a sensitive enzyme-linked immunosorbent assay for IL-1 α

    International Nuclear Information System (INIS)

    Mae, N.; Liberato, D.J.; Chizzonite, R.; Satoh, H.


    A highly reproducible, sensitive, and specific sandwich enzyme-linked immunosorbent assay (ELISA) for recombinant human IL-1 α (rhIL-1 alpha) has been developed. Results from this ELISA have demonstrated that the concentration of rhIL-1 α added to normal human serum (NHS) decreased by 16.3% after 3 h and 24.9% after 6 h at room temperature. Molecular exclusion column chromatography with Sephacryl S-300 HR revealed that 125I-labeled IL-1 α added to normal human serum rapidly formed higher molecular weight complexes without indication of proteolytic degradation. The observed reduction in immunoreactivity was correlated with this protein complex formation and accounted for the apparent instability of rhIL-1 α in NHS. Immunoblot analysis indicated that the molecular weight of the binding protein was 150-160K, and the IL-1 α binding activity was removed and recovered from NHS by Protein-G affinity chromatography; indicating that the binding protein was IL-1 α-specific IgG. The binding of 125I-labeled IL-1 α to the serum binding proteins could be inhibited by unlabeled IL-1 alpha (IC50 = 7.4 x 10(-11) M) but not by unlabeled IL-1 β. Kinetic analysis with 125I-labeled IL-1 alpha revealed that the average binding affinity of these IL-1 α-specific IgGs was 4.7 x 10(10) M-1. These results suggest that these autoantibodies may interfere with the detection of IL-1 α in human serum by various assay systems and also could be a regulator of circulating IL-1 α

  13. A high-affinity inhibitor of yeast carboxypeptidase Y is encoded by TFS1 and shows homology to a family of lipid binding proteins

    DEFF Research Database (Denmark)

    Bruun, A W; Svendsen, I; Sørensen, S O


    signals for transport into the endoplasmic reticulum. Surprisingly, Ic is encoded by TFS1, which has previously been isolated as a high-copy suppressor of cdc25-1. CDC25 encodes the putative GTP exchange factor for Ras1p/Ras2p in yeast. In an attempt to rationalize this finding, we looked...... degree of specificity, showing a 200-fold higher Ki toward a carboxypeptidase from Candida albicans which is highly homologous to carboxypeptidase Y. The TFS1 gene product shows extensive similarity to a class of proteins termed "21-23-kDa lipid binding proteins", members of which are found in several...

  14. Synergy of two low-affinity NLSs determines the high avidity of influenza A virus nucleoprotein NP for human importin α isoforms. (United States)

    Wu, Wei; Sankhala, Rajeshwer S; Florio, Tyler J; Zhou, Lixin; Nguyen, Nhan L T; Lokareddy, Ravi K; Cingolani, Gino; Panté, Nelly


    The influenza A virus nucleoprotein (NP) is an essential multifunctional protein that encapsidates the viral genome and functions as an adapter between the virus and the host cell machinery. NPs from all strains of influenza A viruses contain two nuclear localization signals (NLSs): a well-studied monopartite NLS1 and a less-characterized NLS2, thought to be bipartite. Through site-directed mutagenesis and functional analysis, we found that NLS2 is also monopartite and is indispensable for viral infection. Atomic structures of importin α bound to two variants of NLS2 revealed NLS2 primarily binds the major-NLS binding site of importin α, unlike NLS1 that associates with the minor NLS-pocket. Though peptides corresponding to NLS1 and NLS2 bind weakly to importin α, the two NLSs synergize in the context of the full length NP to confer high avidity for importin α7, explaining why the virus efficiently replicates in the respiratory tract that exhibits high levels of this isoform. This study, the first to functionally characterize NLS2, demonstrates NLS2 plays an important and unexpected role in influenza A virus infection. We propose NLS1 and NLS2 form a bipartite NLS in trans, which ensures high avidity for importin α7 while preventing non-specific binding to viral RNA.

  15. The affine quantum gravity programme

    CERN Document Server

    Klauder, J R


    The central principle of affine quantum gravity is securing and maintaining the strict positivity of the matrix left brace g-hat sub a sub b (x)right brace composed of the spatial components of the local metric operator. On spectral grounds, canonical commutation relations are incompatible with this principle, and they must be replaced by noncanonical, affine commutation relations. Due to the partial second-class nature of the quantum gravitational constraints, it is advantageous to use the recently developed projection operator method, which treats all quantum constraints on an equal footing. Using this method, enforcement of regularized versions of the gravitational operator constraints is formulated quite naturally by means of a novel and relatively well-defined functional integral involving only the same set of variables that appears in the usual classical formulation. It is anticipated that skills and insight to study this formulation can be developed by studying special, reduced-variable models that sti...

  16. Affine invariants of convex polygons. (United States)

    Flusser, Jan


    In this correspondence, we prove that the affine invariants, for image registration and object recognition, proposed recently by Yang and Cohen (see ibid., vol.8, no.7, p.934-46, July 1999) are algebraically dependent. We show how to select an independent and complete set of the invariants. The use of this new set leads to a significant reduction of the computing complexity without decreasing the discrimination power.

  17. The endocytic receptor megalin binds the iron transporting neutrophil-gelatinase-associated lipocalin with high affinity and mediates its cellular uptake

    DEFF Research Database (Denmark)

    Hvidberg, Vibeke; Jacobsen, Christian; Strong, Roland K


    Neutrophil-gelatinase-associated lipocalin (NGAL) is a prominent protein of specific granules of human neutrophils also synthesized by epithelial cells during inflammation. NGAL binds bacterial siderophores preventing bacteria from retrieving iron from this source. Also, NGAL may be important in ...... by surface plasmon resonance analysis. Furthermore, a rat yolk sac cell line known to express high levels of megalin, endocytosed NGAL by a mechanism completely blocked by an antibody against megalin.......Neutrophil-gelatinase-associated lipocalin (NGAL) is a prominent protein of specific granules of human neutrophils also synthesized by epithelial cells during inflammation. NGAL binds bacterial siderophores preventing bacteria from retrieving iron from this source. Also, NGAL may be important...

  18. High affinity and temperature sensitivity of blood oxygen binding in Pangasianodon hypophthalmus due to lack of chloride-hemoglobin allosteric interaction

    DEFF Research Database (Denmark)

    Damsgaard, Christian; Phuong, Le My; Huong, Do Thi Thanh


    Air-breathing fishes represent interesting organisms in terms of understanding the physiological changes associated with the terrestrialization of vertebrates, and, further, are of great socio-economic importance for aquaculture in Southeast Asia. To understand how environmental factors......, such as high temperature, affect O2 transport in air-breathing fishes, this study assessed the effects of temperature on O2 binding of blood and Hb in the economically important air-breathing fish Pangasianodon hypophthalmus. To determine blood O2 binding properties, blood was drawn from resting cannulated...

  19. Tris-(hydroxyamino)triazines: high-affinity chelating tridentate O,N,O-hydroxylamine ligand for the cis-V(V)O2(+) cation. (United States)

    Nikolakis, Vladimiros A; Exarchou, Vassiliki; Jakusch, Tamás; Woolins, J Derek; Slawin, Alexandra M Z; Kiss, Tamás; Kabanos, Themistoklis A


    The treatment of the trichloro-1,3,5-triazine with N-methylhydroxylamine hydrochloride results in the replacement of the three chlorine atoms of the triazine ring with the function -N(OH)CH(3) yielding the symmetrical tris-(hydroxyamino)triazine ligand H(3)trihyat. Reaction of the ligand H(3)trihyat with NaV(V)O(3) in aqueous solution followed by addition of Ph(4)PCl gave the mononuclear vanadium(V) compound Ph(4)P[V(V)O(2)(Htrihyat)] (1). The structure of compound 1 was determined by X-ray crystallography and indicates that this compound has a distorted square-pyramidal arrangement around vanadium. The ligand Htrihyat(2-) is bonded to vanadium atom in a tridentate fashion at the triazine ring nitrogen atom and the two deprotonated hydroxylamido oxygen atoms. The high electron density of the triazine ring nitrogen atoms, which results from the resonative contribution of electrons of exocyclic nitrogen atoms, leads to a very strong V-N bond. The cis-[V(V)O(2)(Htrihyat)](-) species exhibits high hydrolytic stability in aqueous solution over a wide pH range, 2.5-11.5, as was evidenced by potentiometry.

  20. Small scale affinity purification and high sensitivity reversed phase nanoLC-MS N-glycan characterization of mAbs and fusion proteins. (United States)

    Higel, Fabian; Seidl, Andreas; Demelbauer, Uwe; Sörgel, Fritz; Frieß, Wolfgang


    N-glycosylation is a complex post-translational modification with potential effects on the efficacy and safety of therapeutic proteins and known influence on the effector function of biopharmaceutical monoclonal antibodies (mAbs). Comprehensive characterization of N-glycosylation is therefore important in biopharmaceutical development. In early development, e.g. during pool or clone selection, however, only minute protein amounts of multiple samples are available for analytics. High sensitivity and high throughput methods are thus needed. An approach based on 96-well plate sample preparation and nanoLC-MS of 2- anthranilic acid or 2-aminobenzoic acid (AA) labeled N-glycans for the characterization of biopharmaceuticals in early development is reported here. With this approach, 192 samples can be processed simultaneously from complex matrices (e.g., cell culture supernatant) to purified 2-AA glycans, which are then analyzed by reversed phase nanoLC-MS. Attomolar sensitivity has been achieved by use of nanoelectrospray ionization, resulting in detailed glycan maps of mAbs and fusion proteins that are exemplarily shown in this work. Reproducibility, robustness and linearity of the approach are demonstrated, making use in a routine manner during pool or clone selection possible. Other potential fields of application, such as glycan biomarker discovery from serum samples, are also presented.

  1. In vitro and in vivo evaluation of a (18F-labeled high affinity NOTA conjugated bombesin antagonist as a PET ligand for GRPR-targeted tumor imaging.

    Directory of Open Access Journals (Sweden)

    Zohreh Varasteh

    Full Text Available Expression of the gastrin-releasing peptide receptor (GRPR in prostate cancer suggests that this receptor can be used as a potential molecular target to visualize and treat these tumors. We have previously investigated an antagonist analog of bombesin (D-Phe-Gln-Trp-Ala-Val-Gly-His-Sta-Leu-NH2, RM26 conjugated to 1,4,7-triazacyclononane-N,N',N''-triacetic acid (NOTA via a diethylene glycol (PEG2 spacer (NOTA-P2-RM26 labeled with (68Ga and (111In. We found that this conjugate has favorable properties for in vivo imaging of GRPR-expression. The focus of this study was to develop a (18F-labelled PET agent to visualize GRPR. NOTA-P2-RM26 was labeled with (18F using aluminum-fluoride chelation. Stability, in vitro binding specificity and cellular processing tests were performed. The inhibition efficiency (IC50 of the [(natF]AlF-NOTA-P2-RM26 was compared to that of the (natGa-loaded peptide using (125I-Tyr(4-BBN as the displacement radioligand. The pharmacokinetics and in vivo binding specificity of the compound were studied. NOTA-P2-RM26 was labeled with (18F within 1 h (60-65% decay corrected radiochemical yield, 55 GBq/µmol. The radiopeptide was stable in murine serum and showed high specific binding to PC-3 cells. [(natF]AlF-NOTA-P2-RM26 showed a low nanomolar inhibition efficiency (IC50=4.4±0.8 nM. The internalization rate of the tracer was low. Less than 14% of the cell-bound radioactivity was internalized after 4 h. The biodistribution of [(18F]AlF-NOTA-P2-RM26 demonstrated rapid blood clearance, low liver uptake and low kidney retention. The tumor uptake at 3 h p.i. was 5.5±0.7 %ID/g, and the tumor-to-blood, -muscle and -bone ratios were 87±42, 159±47, 38±16, respectively. The uptake in tumors, pancreas and other GRPR-expressing organs was significantly reduced when excess amount of non-labeled peptide was co-injected. The low uptake in bone suggests a high in vivo stability of the Al-F bond. High contrast PET image was obtained 3 h p

  2. High affinity RNA targeting by oligonucleotides displaying aromatic stacking and amino groups in the major groove. Comparison of triazoles and phenylsubstituents

    DEFF Research Database (Denmark)

    Kumar, Pawan; Hornum, Mick; Nielsen, Lise Junker


    Three 5-modified 2'-deoxyuridine nucleosides were synthesized and incorporated into oligonucleotides and compared with the previously published 5-(1-phenyl-1,2,3-triazol-4-yl)-2'-deoxyuridine monomer W. The introduction of an aminomethyl group on the phenyl group led to monomer X, which was found...... to thermally stabilize a 9-mer DNA:RNA duplex, presumably through the partial neutralization of the negative charge of the backbone. By also taking advantage of the stacking interactions in the major groove of two or more of the monomer X, an extremely high thermal stability was obtained. A regioisomer...... monomer Z was incorporated for comparison, and it was found to give a more neutral influence on duplex stability indicating less efficient stacking interactions. The duplexes were investigated by CD spectroscopy and MD simulations....

  3. Rab3a is critical for trapping alpha-MSH granules in the high Ca²⁺-affinity pool by preventing constitutive exocytosis.

    Directory of Open Access Journals (Sweden)

    Simon Sedej

    Full Text Available Rab3a is a small GTPase of the Rab3 subfamily that acts during late stages of Ca²⁺-regulated exocytosis. Previous functional analysis in pituitary melanotrophs described Rab3a as a positive regulator of Ca²⁺-dependent exocytosis. However, the precise role of the Rab3a isoform on the kinetics and intracellular [Ca²⁺] sensitivity of regulated exocytosis, which may affect the availability of two major peptide hormones, α-melanocyte stimulating hormone (α-MSH and β-endorphin in plasma, remain elusive. We employed Rab3a knock-out mice (Rab3a KO to explore the secretory phenotype in melanotrophs from fresh pituitary tissue slices. High resolution capacitance measurements showed that Rab3a KO melanotrophs possessed impaired Ca²⁺-triggered secretory activity as compared to wild-type cells. The hampered secretion was associated with the absence of cAMP-guanine exchange factor II/ Epac2-dependent secretory component. This component has been attributed to high Ca²⁺-sensitive release-ready vesicles as determined by slow photo-release of caged Ca²⁺. Radioimmunoassay revealed that α-MSH, but not β-endorphin, was elevated in the plasma of Rab3a KO mice, indicating increased constitutive exocytosis of α-MSH. Increased constitutive secretion of α-MSH from incubated tissue slices was associated with reduced α-MSH cellular content in Rab3a-deficient pituitary cells. Viral re-expression of the Rab3a protein in vitro rescued the secretory phenotype of melanotrophs from Rab3a KO mice. In conclusion, we suggest that Rab3a deficiency promotes constitutive secretion and underlies selective impairment of Ca²⁺-dependent release of α-MSH.

  4. Quantitative autoradiography of the binding sites for [125I] iodoglyburide, a novel high-affinity ligand for ATP-sensitive potassium channels in rat brain

    International Nuclear Information System (INIS)

    Gehlert, D.R.; Gackenheimer, S.L.; Mais, D.E.; Robertson, D.W.


    We have developed a high specific activity ligand for localization of ATP-sensitive potassium channels in the brain. When brain sections were incubated with [ 125 I]iodoglyburide (N-[2-[[[(cyclohexylamino)carbonyl]amino]sulfonyl]ethyl]-5- 125 I-2- methoxybenzamide), the ligand bound to a single site with a KD of 495 pM and a maximum binding site density of 176 fmol/mg of tissue. Glyburide was the most potent inhibitor of specific [ 125 I]iodoglyburide binding to rat forebrain sections whereas iodoglyburide and glipizide were slightly less potent. The binding was also sensitive to ATP which completely inhibited binding at concentrations of 10 mM. Autoradiographic localization of [ 125 I]iodoglyburide binding indicated a broad distribution of the ATP-sensitive potassium channel in the brain. The highest levels of binding were seen in the globus pallidus and ventral pallidum followed by the septohippocampal nucleus, anterior pituitary, the CA2 and CA3 region of the hippocampus, ventral pallidum, the molecular layer of the cerebellum and substantia nigra zona reticulata. The hilus and dorsal subiculum of the hippocampus, molecular layer of the dentate gyrus, cerebral cortex, lateral olfactory tract nucleus, olfactory tubercle and the zona incerta contained relatively high levels of binding. A lower level of binding (approximately 3- to 4-fold) was found throughout the remainder of the brain. These results indicate that the ATP-sensitive potassium channel has a broad presence in the rat brain and that a few select brain regions are enriched in this subtype of neuronal potassium channels

  5. C. difficile 630Δerm Spo0A regulates sporulation, but does not contribute to toxin production, by direct high-affinity binding to target DNA.

    Directory of Open Access Journals (Sweden)

    Katharina E Rosenbusch

    Full Text Available Clostridium difficile is a Gram positive, anaerobic bacterium that can form highly resistant endospores. The bacterium is the causative agent of C. difficile infection (CDI, for which the symptoms can range from a mild diarrhea to potentially fatal pseudomembranous colitis and toxic megacolon. Endospore formation in Firmicutes, including C. difficile, is governed by the key regulator for sporulation, Spo0A. In Bacillus subtilis, this transcription factor is also directly or indirectly involved in various other cellular processes. Here, we report that C. difficile Spo0A shows a high degree of similarity to the well characterized B. subtilis protein and recognizes a similar binding sequence. We find that the laboratory strain C. difficile 630Δerm contains an 18bp-duplication near the DNA-binding domain compared to its ancestral strain 630. In vitro binding assays using purified C-terminal DNA binding domain of the C. difficile Spo0A protein demonstrate direct binding to DNA upstream of spo0A and sigH, early sporulation genes and several other putative targets. In vitro binding assays suggest that the gene encoding the major clostridial toxin TcdB may be a direct target of Spo0A, but supernatant derived from a spo0A negative strain was no less toxic towards Vero cells than that obtained from a wild type strain, in contrast to previous reports. These results identify for the first time direct (putative targets of the Spo0A protein in C. difficile and make a positive effect of Spo0A on production of the large clostridial toxins unlikely.

  6. In-silico screening and validation of high-affinity tetra-peptide inhibitor of Leishmania donovani O-acetyl serine sulfhydrylase (OASS). (United States)

    Kant, Vishnu; Vijayakumar, Saravanan; Sahoo, Ganesh Chandra; Chaudhery, Shailendra S; Das, Pradeep


    OASS is a specific enzyme that helps Leishmania parasite to survive the oxidative stress condition in human macrophages. SAT C-terminal peptides in several organisms, including Leishmania, were reported to inhibit or reduce the activity of OASS. Small peptide and small molecules mimicking the SAT C-terminal residues are designed and tested for the inhibition of OASS in different organisms. Hence, in this study, all the possible tetra-peptide combinations were designed and screened based on the docking ability with Leishmania donovani OASS (Ld-OASS). The top ranked peptides were further validated for the stability using 50 ns molecular dynamic simulation. In order to identify the better binding capability of the peptides, the top peptides complexed with Ld-OASS were also subjected to molecular dynamic simulation. The docking and simulation results favored the peptide EWSI to possess greater advantage than previously reported peptide (DWSI) in binding with Ld-OASS active site. Also, screening of non-peptide inhibitor of Asinex Biodesign library based on the shape similarity of EWSI and DWSI was performed. The top similar molecules of each peptides were docked on to Ld-OASS active site and subsequently simulated for 20 ns. The results suggested that the ligand that shares high shape similarity with EWSI possess better binding capability than the ligand that shares high shape similarity with DWSI. This study revealed that the tetra-peptide EWSI had marginal advantage over DWSI in binding with Ld-OASS, thereby providing basis for defining a pharmacophoric scaffold for the design of peptidomimetic inhibitors as well as non-peptide inhibitors of Ld-OASS.

  7. Rank Two Affine Manifolds in Genus 3


    Aulicino, David; Nguyen, Duc-Manh


    We complete the classification of rank two affine manifolds in the moduli space of translation surfaces in genus three. Combined with a recent result of Mirzakhani and Wright, this completes the classification of higher rank affine manifolds in genus three.

  8. Spectral affinity in protein networks. (United States)

    Voevodski, Konstantin; Teng, Shang-Hua; Xia, Yu


    Protein-protein interaction (PPI) networks enable us to better understand the functional organization of the proteome. We can learn a lot about a particular protein by querying its neighborhood in a PPI network to find proteins with similar function. A spectral approach that considers random walks between nodes of interest is particularly useful in evaluating closeness in PPI networks. Spectral measures of closeness are more robust to noise in the data and are more precise than simpler methods based on edge density and shortest path length. We develop a novel affinity measure for pairs of proteins in PPI networks, which uses personalized PageRank, a random walk based method used in context-sensitive search on the Web. Our measure of closeness, which we call PageRank Affinity, is proportional to the number of times the smaller-degree protein is visited in a random walk that restarts at the larger-degree protein. PageRank considers paths of all lengths in a network, therefore PageRank Affinity is a precise measure that is robust to noise in the data. PageRank Affinity is also provably related to cluster co-membership, making it a meaningful measure. In our experiments on protein networks we find that our measure is better at predicting co-complex membership and finding functionally related proteins than other commonly used measures of closeness. Moreover, our experiments indicate that PageRank Affinity is very resilient to noise in the network. In addition, based on our method we build a tool that quickly finds nodes closest to a queried protein in any protein network, and easily scales to much larger biological networks. We define a meaningful way to assess the closeness of two proteins in a PPI network, and show that our closeness measure is more biologically significant than other commonly used methods. We also develop a tool, accessible at, that allows the user to quickly find nodes closest to a queried vertex in any protein

  9. Spectral affinity in protein networks

    Directory of Open Access Journals (Sweden)

    Teng Shang-Hua


    Full Text Available Abstract Background Protein-protein interaction (PPI networks enable us to better understand the functional organization of the proteome. We can learn a lot about a particular protein by querying its neighborhood in a PPI network to find proteins with similar function. A spectral approach that considers random walks between nodes of interest is particularly useful in evaluating closeness in PPI networks. Spectral measures of closeness are more robust to noise in the data and are more precise than simpler methods based on edge density and shortest path length. Results We develop a novel affinity measure for pairs of proteins in PPI networks, which uses personalized PageRank, a random walk based method used in context-sensitive search on the Web. Our measure of closeness, which we call PageRank Affinity, is proportional to the number of times the smaller-degree protein is visited in a random walk that restarts at the larger-degree protein. PageRank considers paths of all lengths in a network, therefore PageRank Affinity is a precise measure that is robust to noise in the data. PageRank Affinity is also provably related to cluster co-membership, making it a meaningful measure. In our experiments on protein networks we find that our measure is better at predicting co-complex membership and finding functionally related proteins than other commonly used measures of closeness. Moreover, our experiments indicate that PageRank Affinity is very resilient to noise in the network. In addition, based on our method we build a tool that quickly finds nodes closest to a queried protein in any protein network, and easily scales to much larger biological networks. Conclusion We define a meaningful way to assess the closeness of two proteins in a PPI network, and show that our closeness measure is more biologically significant than other commonly used methods. We also develop a tool, accessible at, that allows the user to

  10. Hydrophilic Nb{sup 5+}-immobilized magnetic core–shell microsphere – A novel immobilized metal ion affinity chromatography material for highly selective enrichment of phosphopeptides

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Xueni; Liu, Xiaodan; Feng, Jianan [Pharmaceutical Analysis Department, School of Pharmacy, Fudan University, Shanghai 201203 (China); Li, Yan, E-mail: [Pharmaceutical Analysis Department, School of Pharmacy, Fudan University, Shanghai 201203 (China); Deng, Chunhui [Department of Chemistry and Institutes of Biomedical Sciences, Fudan University, Shanghai 200433 (China); Duan, Gengli [Pharmaceutical Analysis Department, School of Pharmacy, Fudan University, Shanghai 201203 (China)


    Highlights: • A new IMAC material (Fe{sub 3}O{sub 4}@PD-Nb{sup 5+}) was synthesized. • The strong magnetic behaviors of the microspheres ensure fast and easy separation. • The enrichment ability was tested by human serum and nonfat milk. • The results were compared with other IMAC materials including the commercial kits. • All results proved the good enrichment ability, especially for multiphosphopeptides. - Abstract: Rapid and selective enrichment of phosphopeptides from complex biological samples is essential and challenging in phosphorylated proteomics. In this work, for the first time, niobium ions were directly immobilized on the surface of polydopamine-coated magnetic microspheres through a facile and effective synthetic route. The Fe{sub 3}O{sub 4}@polydopamine-Nb{sup 5+} (denoted as Fe{sub 3}O{sub 4}@PD-Nb{sup 5+}) microspheres possess merits of high hydrophilicity and good biological compatibility, and demonstrated low limit of detection (2 fmol). The selectivity was also basically satisfactory (β-casein:BSA = 1:500) to capture phosphopeptides. They were also successfully applied for enrichment of phosphopeptides from real biological samples such as human serum and nonfat milk. Compared with Fe{sub 3}O{sub 4}@PD-Ti{sup 4+} microspheres, the Fe{sub 3}O{sub 4}@PD-Nb{sup 5+} microspheres exhibit superior selectivity to multi-phosphorylated peptides, and thus may be complementary to the conventional IMAC materials.

  11. Lp-mixed affine surface area (United States)

    Wang, Weidong; Leng, Gangsong


    According to the three notions of mixed affine surface area, Lp-affine surface area and Lp-mixed affine surface area proposed by Lutwak, in this article, we give the concept of ith Lp-mixed affine surface area such that the first and second notions of Lutwak are its special cases. Further, some Lutwak's results are extended associated with this concept. Besides, applying this concept, we establish an inequality for the volumes and dual quermassintegrals of a class of star bodies.

  12. Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes. (United States)

    De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M


    Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.

  13. Synthesis and pre-clinical evaluation of a new class of high-affinity {sup 18}F-labeled PSMA ligands for detection of prostate cancer by PET imaging

    Energy Technology Data Exchange (ETDEWEB)

    Kelly, James; Amor-Coarasa, Alejandro; Williams, Clarence; Ponnala, Shashikanth [Weill Cornell Medicine, Division of Radiopharmaceutical Sciences and Molecular Imaging Innovations Institute, Department of Radiology, New York, NY (United States); Nikolopoulou, Anastasia [Weill Cornell Medicine, Division of Radiopharmaceutical Sciences and Molecular Imaging Innovations Institute, Department of Radiology, New York, NY (United States); Weill Cornell Medicine, Citigroup Biomedical Imaging Center, New York, NY (United States); Kim, Dohyun [Weill Cornell Medicine, Citigroup Biomedical Imaging Center, New York, NY (United States); Babich, John W. [Weill Cornell Medicine, Division of Radiopharmaceutical Sciences and Molecular Imaging Innovations Institute, Department of Radiology, New York, NY (United States); Weill Cornell Medicine, Citigroup Biomedical Imaging Center, New York, NY (United States); Weill Cornell Medicine, Meyer Cancer Center, New York, NY (United States)


    Current clinical imaging of PSMA-positive prostate cancer by positron emission tomography (PET) mainly features {sup 68}Ga-labeled tracers, notably [{sup 68}Ga]Ga-PSMA-HBED-CC. The longer half-life of fluorine-18 offers significant advantages over Ga-68, clinically and logistically. We aimed to develop high-affinity PSMA inhibitors labeled with fluorine-18 as alternative tracers for prostate cancer. Six triazolylphenyl ureas and their alkyne precursors were synthesized from the Glu-urea-Lys PSMA binding moiety. PSMA affinity was determined in a competitive binding assay using LNCaP cells. The [{sup 18}F]triazoles were isolated following a Cu(I)-catalyzed click reaction between the alkynes and [{sup 18}F]fluoroethylazide. The {sup 18}F-labeled compounds were evaluated in nude mice bearing LNCaP tumors and compared to [{sup 68}Ga]Ga-PSMA-HBED-CC and [{sup 18}F]DCFPyL. Biodistribution studies of the two tracers with the highest imaged-derived tumor uptake and highest PSMA affinity were undertaken at 1 h, 2 h and 4 h post-injection (p.i.), and co-administration of PMPA was used to determine whether uptake was PSMA-specific. F-18-labeled triazolylphenyl ureas were prepared with a decay-corrected RCY of 20-40 %, >98 % radiochemical and chemical purity, and specific activity of up to 391 GBq/μmol. PSMA binding (IC{sub 50}) ranged from 3-36 nM. The position of the triazole influenced tumor uptake (3 > 4 > 2), and direct conjugation of the triazole with the phenylurea moiety was preferred to insertion of a spacer group. Image-derived tumor uptake ranged from 6-14 %ID/g at 2 h p.i., the time of maximum tumor uptake; uptake of [{sup 68}Ga]Ga-PSMA-HBED-CC and [{sup 18}F]DCFPyL was 5-6 %ID/g at 1-3 h p.i., the time of maximum tumor uptake. Biodistribution studies of the two most promising compounds gave maximum tumor uptakes of 10.9 ± 1.0 % and 14.3 ± 2.5 %ID/g, respectively, as compared to 6.27 ± 1.44 %ID/g for [{sup 68}Ga]Ga-PSMA-HBED-CC. Six [{sup 18}F

  14. Synthesis and pre-clinical evaluation of a new class of high-affinity "1"8F-labeled PSMA ligands for detection of prostate cancer by PET imaging

    International Nuclear Information System (INIS)

    Kelly, James; Amor-Coarasa, Alejandro; Williams, Clarence; Ponnala, Shashikanth; Nikolopoulou, Anastasia; Kim, Dohyun; Babich, John W.


    Current clinical imaging of PSMA-positive prostate cancer by positron emission tomography (PET) mainly features "6"8Ga-labeled tracers, notably ["6"8Ga]Ga-PSMA-HBED-CC. The longer half-life of fluorine-18 offers significant advantages over Ga-68, clinically and logistically. We aimed to develop high-affinity PSMA inhibitors labeled with fluorine-18 as alternative tracers for prostate cancer. Six triazolylphenyl ureas and their alkyne precursors were synthesized from the Glu-urea-Lys PSMA binding moiety. PSMA affinity was determined in a competitive binding assay using LNCaP cells. The ["1"8F]triazoles were isolated following a Cu(I)-catalyzed click reaction between the alkynes and ["1"8F]fluoroethylazide. The "1"8F-labeled compounds were evaluated in nude mice bearing LNCaP tumors and compared to ["6"8Ga]Ga-PSMA-HBED-CC and ["1"8F]DCFPyL. Biodistribution studies of the two tracers with the highest imaged-derived tumor uptake and highest PSMA affinity were undertaken at 1 h, 2 h and 4 h post-injection (p.i.), and co-administration of PMPA was used to determine whether uptake was PSMA-specific. F-18-labeled triazolylphenyl ureas were prepared with a decay-corrected RCY of 20-40 %, >98 % radiochemical and chemical purity, and specific activity of up to 391 GBq/μmol. PSMA binding (IC_5_0) ranged from 3-36 nM. The position of the triazole influenced tumor uptake (3 > 4 > 2), and direct conjugation of the triazole with the phenylurea moiety was preferred to insertion of a spacer group. Image-derived tumor uptake ranged from 6-14 %ID/g at 2 h p.i., the time of maximum tumor uptake; uptake of ["6"8Ga]Ga-PSMA-HBED-CC and ["1"8F]DCFPyL was 5-6 %ID/g at 1-3 h p.i., the time of maximum tumor uptake. Biodistribution studies of the two most promising compounds gave maximum tumor uptakes of 10.9 ± 1.0 % and 14.3 ± 2.5 %ID/g, respectively, as compared to 6.27 ± 1.44 %ID/g for ["6"8Ga]Ga-PSMA-HBED-CC. Six ["1"8F]triazolylphenyl ureas were prepared in good radiochemical yield

  15. Manifolds with integrable affine shape operator

    Directory of Open Access Journals (Sweden)

    Daniel A. Joaquín


    Full Text Available This work establishes the conditions for the existence of vector fields with the property that theirs covariant derivative, with respect to the affine normal connection, be the affine shape operatorS in hypersurfaces. Some results are obtained from this property and, in particular, for some kind of affine decomposable hypersurfaces we explicitely get the actual vector fields.

  16. Affinity Spaces and 21st Century Learning (United States)

    Gee, James Paul


    This article discusses video games as "attractors" to "affinity spaces." It argues that affinity spaces are key sites today where people teach and learn 21st Century skills. While affinity spaces are proliferating on the Internet as interest-and-passion-driven sites devoted to a common set of endeavors, they are not new, just…

  17. Using Affinity Diagrams to Evaluate Interactive Prototypes

    DEFF Research Database (Denmark)

    Lucero, Andrés


    our particular use of affinity diagramming in prototype evaluations. We reflect on a decade’s experience using affinity diagramming across a number of projects, both in industry and academia. Our affinity diagramming process in interaction design has been tailored and consists of four stages: creating...

  18. (D-Pen2,4 prime -125I-Phe4,D-Pen5)enkephalin: A selective high affinity radioligand for delta opioid receptors with exceptional specific activity

    Energy Technology Data Exchange (ETDEWEB)

    Knapp, R.J.; Sharma, S.D.; Toth, G.; Duong, M.T.; Fang, L.; Bogert, C.L.; Weber, S.J.; Hunt, M.; Davis, T.P.; Wamsley, J.K. (Department of Pharmacology, University of Arizona, College of Medicine, Tucson (United States))


    (D-Pen2,4{prime}-125I-Phe4,D-Pen5)enkephalin ((125I)DPDPE) is a highly selective radioligand for the delta opioid receptor with a specific activity (2200 Ci/mmol) that is over 50-fold greater than that of tritium-labeled DPDPE analogs. (125I)DPDPE binds to a single site in rat brain membranes with an equilibrium dissociation constant (Kd) value of 421 {plus minus} 67 pM and a receptor density (Bmax) value of 36.4 {plus minus} 2.7 fmol/mg protein. The high affinity of this site for delta opioid receptor ligands and its low affinity for mu or kappa receptor-selective ligands are consistent with its being a delta opioid receptor. The distribution of these sites in rat brain, observed by receptor autoradiography, is also consistent with that of delta opioid receptors. Association and dissociation binding kinetics of 1.0 nM (125I) DPDPE are monophasic at 25 degrees C. The association rate (k + 1 = 5.80 {plus minus} 0.88 {times} 10(7) M-1 min-1) is about 20- and 7-fold greater than that measured for 1.0 nM (3H) DPDPE and 0.8 nM (3H) (D-Pen2,4{prime}-Cl-Phe4, D-Pen5)enkephalin, respectively. The dissociation rate of (125I)DPDPE (0.917 {plus minus} 0.117 {times} 10(-2) min-1) measured at 1.0 nM is about 3-fold faster than is observed for either of the other DPDPE analogs. The rapid binding kinetics of (125I)DPDPE is advantageous because binding equilibrium is achieved with much shorter incubation times than are required for other cyclic enkephalin analogs. This, in addition to its much higher specific activity, makes (125I)DPDPE a valuable new radioligand for studies of delta opioid receptors.

  19. Experimental and theoretical binding affinity between polyvinylpolypyrrolidone and selected phenolic compounds from food matrices. (United States)

    Durán-Lara, Esteban F; López-Cortés, Xaviera A; Castro, Ricardo I; Avila-Salas, Fabián; González-Nilo, Fernando D; Laurie, V Felipe; Santos, Leonardo S


    Polyvinylpolypyrrolidone (PVPP) is a fining agent, widely used in winemaking and brewing, whose mode of action in removing phenolic compounds has not been fully characterised. The aim of this study was to evaluate the experimental and theoretical binding affinity of PVPP towards six phenolic compounds representing different types of phenolic species. The interaction between PVPP and phenolics was evaluated in model solutions, where hydroxyl groups, hydrophobic bonding and steric hindrance were characterised. The results of the study indicated that PVPP exhibits high affinity for quercetin and catechin, moderate affinity for epicatechin, gallic acid and lower affinity for 4-methylcatechol and caffeic acid. The affinity has a direct correlation with the hydroxylation degree of each compound. The results show that the affinity of PVPP towards phenols is related with frontier orbitals. This work demonstrates a direct correlation between the experimental affinity and the interaction energy calculations obtained through computational chemistry methods. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Mimicking of Arginine by Functionalized N(ω)-Carbamoylated Arginine As a New Broadly Applicable Approach to Labeled Bioactive Peptides: High Affinity Angiotensin, Neuropeptide Y, Neuropeptide FF, and Neurotensin Receptor Ligands As Examples. (United States)

    Keller, Max; Kuhn, Kilian K; Einsiedel, Jürgen; Hübner, Harald; Biselli, Sabrina; Mollereau, Catherine; Wifling, David; Svobodová, Jaroslava; Bernhardt, Günther; Cabrele, Chiara; Vanderheyden, Patrick M L; Gmeiner, Peter; Buschauer, Armin


    Derivatization of biologically active peptides by conjugation with fluorophores or radionuclide-bearing moieties is an effective and commonly used approach to prepare molecular tools and diagnostic agents. Whereas lysine, cysteine, and N-terminal amino acids have been mostly used for peptide conjugation, we describe a new, widely applicable approach to peptide conjugation based on the nonclassical bioisosteric replacement of the guanidine group in arginine by a functionalized carbamoylguanidine moiety. Four arginine-containing peptide receptor ligands (angiotensin II, neurotensin(8-13), an analogue of the C-terminal pentapeptide of neuropeptide Y, and a neuropeptide FF analogue) were subject of this proof-of-concept study. The N(ω)-carbamoylated arginines, bearing spacers with a terminal amino group, were incorporated into the peptides by standard Fmoc solid phase peptide synthesis. The synthesized chemically stable peptide derivatives showed high receptor affinities with Ki values in the low nanomolar range, even when bulky fluorophores had been attached. Two new tritiated tracers for angiotensin and neurotensin receptors are described.

  1. The affine quantum gravity programme

    International Nuclear Information System (INIS)

    Klauder, John R


    The central principle of affine quantum gravity is securing and maintaining the strict positivity of the matrix { g-hat ab (x)} composed of the spatial components of the local metric operator. On spectral grounds, canonical commutation relations are incompatible with this principle, and they must be replaced by noncanonical, affine commutation relations. Due to the partial second-class nature of the quantum gravitational constraints, it is advantageous to use the recently developed projection operator method, which treats all quantum constraints on an equal footing. Using this method, enforcement of regularized versions of the gravitational operator constraints is formulated quite naturally by means of a novel and relatively well-defined functional integral involving only the same set of variables that appears in the usual classical formulation. It is anticipated that skills and insight to study this formulation can be developed by studying special, reduced-variable models that still retain some basic characteristics of gravity, specifically a partial second-class constraint operator structure. Although perturbatively nonrenormalizable, gravity may possibly be understood nonperturbatively from a hard-core perspective that has proved valuable for specialized models. Finally, developing a procedure to pass to the genuine physical Hilbert space involves several interconnected steps that require careful coordination

  2. Affine-projective field laws

    International Nuclear Information System (INIS)

    Murphy, G.L.


    The general topic of geometric unified field theories is discussed in the first section. Some reasons are given for pursuing such theories, and some criticisms are considered. The second section develops the fundamental equations of a purely affine theory which is invariant under projective transformations of the affine connection. This theory is a generalization of that of Schrodinger. Possible identifications for the space-time metric are considered in Sec. III. Sections IV and V deal with the limits of pure gravitation and electrodynamics. In the symmetric limit, Einstein's vacuum equations with cosmological term are recovered. The theory also contains a generalized electrodynamic set of equations which is very similar to the Born-Infeld set. In the weak-field approximation, a finite mass must be attributed to the photon. The problem of motion for charges is discussed here, and it is argued that criticisms of unified field theories because of a supposed inability to produce the Lorentz force law are probably not justified. Three more speculative sections deal with possible explanations of nuclear forces, the spin-torsion relation, and particle structure

  3. Transformations Based on Continuous Piecewise-Affine Velocity Fields

    DEFF Research Database (Denmark)

    Freifeld, Oren; Hauberg, Søren; Batmanghelich, Kayhan


    We propose novel finite-dimensional spaces of well-behaved transformations. The latter are obtained by (fast and highly-accurate) integration of continuous piecewise-affine velocity fields. The proposed method is simple yet highly expressive, effortlessly handles optional constraints (e.g., volum...

  4. Antisymmetric tensor generalizations of affine vector fields. (United States)

    Houri, Tsuyoshi; Morisawa, Yoshiyuki; Tomoda, Kentaro


    Tensor generalizations of affine vector fields called symmetric and antisymmetric affine tensor fields are discussed as symmetry of spacetimes. We review the properties of the symmetric ones, which have been studied in earlier works, and investigate the properties of the antisymmetric ones, which are the main theme in this paper. It is shown that antisymmetric affine tensor fields are closely related to one-lower-rank antisymmetric tensor fields which are parallelly transported along geodesics. It is also shown that the number of linear independent rank- p antisymmetric affine tensor fields in n -dimensions is bounded by ( n + 1)!/ p !( n - p )!. We also derive the integrability conditions for antisymmetric affine tensor fields. Using the integrability conditions, we discuss the existence of antisymmetric affine tensor fields on various spacetimes.

  5. Affine LIBOR Models with Multiple Curves

    DEFF Research Database (Denmark)

    Grbac, Zorana; Papapantoleon, Antonis; Schoenmakers, John


    are specified following the methodology of the affine LIBOR models and are driven by the wide and flexible class of affine processes. The affine property is preserved under forward measures, which allows us to derive Fourier pricing formulas for caps, swaptions, and basis swaptions. A model specification...... with dependent LIBOR rates is developed that allows for an efficient and accurate calibration to a system of caplet prices....

  6. Connections between quantized affine algebras and superalgebras

    International Nuclear Information System (INIS)

    Zhang, R.B.


    Every affine superalgebra with a symmetrizable Cartan matrix is closely related to an ordinary affine algebra with the same Cartan matrix. It is shown that the quantum supergroup associated with the former is essentially isomorphic to the quantum group associated with the latter in an appropriate class of representations. At the classical level, each integrable irreducible highest weight representation of the affine superalgebra has a corresponding irreducible representation of the affine algebra, which has the same weight space decomposition. (author). 5 refs, 3 tabs

  7. A Novel Vertex Affinity for Community Detection

    Energy Technology Data Exchange (ETDEWEB)

    Yoo, Andy [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Sanders, Geoffrey [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Henson, Van [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Vassilevski, Panayot [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)


    We propose a novel vertex affinity measure in this paper. The new vertex affinity quantifies the proximity between two vertices in terms of their clustering strength and is ideal for such graph analytics applications as community detection. We also developed a framework that combines simple graph searches and resistance circuit formulas to compute the vertex affinity efficiently. We study the properties of the new affinity measure empirically in comparison to those of other popular vertex proximity metrics. Our results show that the existing metrics are ill-suited for community detection due to their lack of fundamental properties that are essential for correctly capturing inter- and intra-cluster vertex proximity.

  8. Quantitative relationship between antibody affinity and antibody avidity

    International Nuclear Information System (INIS)

    Griswold, W.R.


    The relationship between antibody avidity, measured by the dissociation of the antigen-antibody bond in antigen excess, and antibody affinity was studied. Complexes of radiolabelled antigen and antibody of known affinity were prepared in vitro and allowed to stand for seven days to reach equilibrium. Then nonlabelled antigen in one hundred fold excess was added to dissociate the complexes. After an appropriate incubation the fraction of antigen bound to antibody was measured by the ammonium sulfate precipitation method. The dissociation index was the fraction bound in the experimental sample divided by the fraction bound in the control. The correlation coefficient between the dissociation index and the antibody binding constant was 0.92 for early dissociation and 0.98 for late dissociation. The regression equation relating the binding constant to the dissociation index was K = 6.4(DI) + 6.25, where DI is the late dissociation index and K is the logarithm to the base 10 of the binding constant. There is a high correlation between avidity and affinity of antibody. Antibody affinity can be estimated from avidity data. The stability of antigen-antibody complexes can be predicted from antibody affinity

  9. A combined prediction strategy increases identification of peptides bound with high affinity and stability to porcine MHC class I molecules SLA-1*04:01, SLA-2*04:01, and SLA-3*04:01

    DEFF Research Database (Denmark)

    Pedersen, Lasse Eggers; Rasmussen, Michael; Harndahl, Mikkel


    constitute an attractive protocol to select target peptides from the vast pool of viral proteome peptides. We have earlier reported the peptide binding motif of the porcine MHC-I molecules SLA-1*04:01 and SLA-2*04:01, identified by an ELISA affinity-based positional scanning combinatorial peptide library...

  10. Enhanced binding capacity of boronate affinity adsorbent via surface modification of silica by combination of atom transfer radical polymerization and chain-end functionalization for high-efficiency enrichment of cis-diol molecules

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Wei; He, Maofang; Wang, Chaozhan; Wei, Yinmao, E-mail:


    Boronate affinity materials have been widely used for specific separation and preconcentration of cis-diol molecules, but most do not have sufficient capacity due to limited binding sites on the material surface. In this work, we prepared a phenylboronic acid-functionalized adsorbent with a high binding capacity via the combination of surface-initiated atom transfer radical polymerization (SI-ATRP) and chain-end functionalization. With this method, the terminal chlorides of the polymer chains were used fully, and the proposed adsorbent contains dense boronic acid polymers chain with boronic acid on the chain end. Consequently, the proposed adsorbent possesses excellent selectivity and a high binding capacity of 513.6 μmol g{sup −1} for catechol and 736.8 μmol g{sup −1} for fructose, which are much higher than those of other reported adsorbents. The dispersed solid-phase extraction (dSPE) based on the prepared adsorbent was used for extraction of three cis-diol drugs (i.e., epinephrine, isoprenaline and caffeic acid isopropyl ester) from plasma; the eluates were analyzed by HPLC-UV. The reduced amount of adsorbent (i.e., 2.0 mg) could still eliminate interferences efficiently and yielded a recovery range of 85.6–101.1% with relative standard deviations ranging from 2.5 to 9.7% (n = 5). The results indicated that the proposed strategy could serve as a promising alternative to increase the density of surface functional groups on the adsorbent; thus, the prepared adsorbent has the potential to effectively enrich cis-diol substances in real samples. - Highlights: • Boronate adsorbent is prepared via ATRP and chain-end functionalization. • The adsorbent has quite high binding capacity for cis-diols. • Binding capacity is easily manipulated by ATRP condition. • Chain-end functionalization can improve binding capacity significantly. • Reduced adsorbent is consumed in dispersed solid-phase extraction of cis-diols.

  11. Affinity membranes for hormone removal from aqueous solutions

    NARCIS (Netherlands)

    Urmenyi, A.M.; Poot, Andreas A.; Wessling, Matthias; Mulder, M.H.V.


    A novel affinity membrane was prepared by covalent binding of antibodies (against 17--estradiol) to a micro-porous poly(ethylene vinyl alcohol) (EVAL) membrane, taking benefit from the high surface area of EVAL membranes and the large number of reactive groups available for further surface

  12. On affine non-negative matrix factorization

    DEFF Research Database (Denmark)

    Laurberg, Hans; Hansen, Lars Kai


    We generalize the non-negative matrix factorization (NMF) generative model to incorporate an explicit offset. Multiplicative estimation algorithms are provided for the resulting sparse affine NMF model. We show that the affine model has improved uniqueness properties and leads to more accurate id...

  13. Global affine differential geometry of hypersurfaces

    CERN Document Server

    Li, An-Min; Zhao, Guosong; Hu, Zejun


    This book draws a colorful and widespread picture of global affine hypersurface theory up to the most recent state. Moreover, the recent development revealed that affine differential geometry- as differential geometry in general- has an exciting intersection area with other fields of interest, like partial differential equations, global analysis, convex geometry and Riemann surfaces.

  14. Complementary three-dimensional quantitative structure-activity relationship modeling of binding affinity and functional potency

    DEFF Research Database (Denmark)

    Tosco, Paolo; Ahring, Philip K; Dyhring, Tino


    Complementary 3D-QSAR modeling of binding affinity and functional potency is proposed as a tool to pinpoint the molecular features of the ligands, and the corresponding amino acids in the receptor, responsible for high affinity binding vs those driving agonist behavior and receptor activation. Th...

  15. Improved methodology for the affinity isolation of human protein complexes expressed at near endogenous levels

    DEFF Research Database (Denmark)

    Domanski, Michal; Molloy, Kelly; Jiang, Hua


    An efficient and reliable procedure for the capture of affinity-tagged proteins and associated complexes from human cell lines is reported. Through multiple optimizations, high yield and low background affinity-purifications are achieved from modest quantities of human cells expressing endogenous...

  16. The Cutting Edge of Affinity Electrophoresis Technology (United States)

    Kinoshita, Eiji; Kinoshita-Kikuta, Emiko; Koike, Tohru


    Affinity electrophoresis is an important technique that is widely used to separate and analyze biomolecules in the fields of biology and medicine. Both quantitative and qualitative information can be gained through affinity electrophoresis. Affinity electrophoresis can be applied through a variety of strategies, such as mobility shift electrophoresis, charge shift electrophoresis or capillary affinity electrophoresis. These strategies are based on changes in the electrophoretic patterns of biological macromolecules that result from interactions or complex-formation processes that induce changes in the size or total charge of the molecules. Nucleic acid fragments can be characterized through their affinity to other molecules, for example transcriptional factor proteins. Hydrophobic membrane proteins can be identified by means of a shift in the mobility induced by a charged detergent. The various strategies have also been used in the estimation of association/disassociation constants. Some of these strategies have similarities to affinity chromatography, in that they use a probe or ligand immobilized on a supported matrix for electrophoresis. Such methods have recently contributed to profiling of major posttranslational modifications of proteins, such as glycosylation or phosphorylation. Here, we describe advances in analytical techniques involving affinity electrophoresis that have appeared during the last five years. PMID:28248262

  17. The Cutting Edge of Affinity Electrophoresis Technology. (United States)

    Kinoshita, Eiji; Kinoshita-Kikuta, Emiko; Koike, Tohru


    Affinity electrophoresis is an important technique that is widely used to separate and analyze biomolecules in the fields of biology and medicine. Both quantitative and qualitative information can be gained through affinity electrophoresis. Affinity electrophoresis can be applied through a variety of strategies, such as mobility shift electrophoresis, charge shift electrophoresis or capillary affinity electrophoresis. These strategies are based on changes in the electrophoretic patterns of biological macromolecules that result from interactions or complex-formation processes that induce changes in the size or total charge of the molecules. Nucleic acid fragments can be characterized through their affinity to other molecules, for example transcriptional factor proteins. Hydrophobic membrane proteins can be identified by means of a shift in the mobility induced by a charged detergent. The various strategies have also been used in the estimation of association/disassociation constants. Some of these strategies have similarities to affinity chromatography, in that they use a probe or ligand immobilized on a supported matrix for electrophoresis. Such methods have recently contributed to profiling of major posttranslational modifications of proteins, such as glycosylation or phosphorylation. Here, we describe advances in analytical techniques involving affinity electrophoresis that have appeared during the last five years.

  18. Novel trends in affinity biosensors: current challenges and perspectives

    International Nuclear Information System (INIS)

    Arugula, Mary A; Simonian, Aleksandr


    Molecular biorecognition processes facilitate physical and biochemical interactions between molecules in all crucial metabolic pathways. Perhaps the target analyte and the biorecognition element interactions have the most impactful use in biosensing applications. Traditional analytical sensing systems offer excellent biorecognition elements with the ability to detect and determine the presence of analytes. High affinity antibodies and DNA play an important role in the development of affinity biosensors based on electrochemical, optical and mass sensitive approaches. Advancements in this area routinely employ labels, label free, nanoparticles, multifunctional matrices, carbon nanotubes and other methods to meet the requirements of its own application. However, despite increasing affinity ceilings for conventional biosensors, the field draws back in meeting specifically important demands, such as long-term stability, ultrasensitivity, rapid detection, extreme selectivity, strong biological base, calibration, in vivo measurements, regeneration, satisfactory performance and ease of production. Nevertheless, recent efforts through this line have produced novel high-tech nanosensing systems such as ‘aptamers’ and ‘phages’ which exhibit high-throughput sensing. Aptamers and phages are powerful tools that excel over antibodies in sensibility, stability, multi-detection, in vivo measurements and regeneration. Phages are superior in stability, screening for affinity-based target molecules ranging from small to proteins and even cells, and easy production. In this review, we focus mainly on recent developments in affinity-based biosensors such as immunosensors, DNA sensors, emphasizing aptasensors and phage-based biosensors basing on novel electrochemical, optical and mass sensitive detection techniques. We also address enzyme inhibition-based biosensors and the current problems associated with the above sensors and their future perspectives. (topical review)

  19. Affinity Strings: Enterprise Data for Resource Recommendations

    Directory of Open Access Journals (Sweden)

    Shane Nackerud


    Full Text Available The University of Minnesota Libraries have created a MyLibrary portal, with databases and e-journals targeted to users, based on their affiliations. The University's enterprise authentication system provides an "affinity string", now used to personalize the MyLibrary portal. This affinity string automates discovery of a user's relationship to the University--describing a user's academic department and degree program or position at the University. Affinity strings also provide the Libraries with an anonymized view of resource usage, allowing data collection that respects users' privacy and lays the groundwork for automated recommendation of relevant resources based on the practices and habits of their peers.

  20. Electrochemical affinity biosensors for detection of mycotoxins: A review. (United States)

    Vidal, Juan C; Bonel, Laura; Ezquerra, Alba; Hernández, Susana; Bertolín, Juan R; Cubel, Carlota; Castillo, Juan R


    This review discusses the current state of electrochemical biosensors in the determination of mycotoxins in foods. Mycotoxins are highly toxic secondary metabolites produced by molds. The acute toxicity of these results in serious human and animal health problems, although it has been only since early 1960s when the first studied aflatoxins were found to be carcinogenic. Mycotoxins affect a broad range of agricultural products, most important cereals and cereal-based foods. A majority of countries, mentioning especially the European Union, have established preventive programs to control contamination and strict laws of the permitted levels in foods. Official methods of analysis of mycotoxins normally requires sophisticated instrumentation, e.g. liquid chromatography with fluorescence or mass detectors, combined with extraction procedures for sample preparation. For about sixteen years, the use of simpler and faster analytical procedures based on affinity biosensors has emerged in scientific literature as a very promising alternative, particularly electrochemical (i.e., amperometric, impedance, potentiometric or conductimetric) affinity biosensors due to their simplicity and sensitivity. Typically, electrochemical biosensors for mycotoxins use specific antibodies or aptamers as affinity ligands, although recombinant antibodies, artificial receptors and molecular imprinted polymers show potential utility. This article deals with recent advances in electrochemical affinity biosensors for mycotoxins and covers complete literature from the first reports about sixteen years ago. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. [Separation of osteoclasts by lectin affinity chromatography]. (United States)

    Itokazu, M; Tan, A; Tanaka, S


    Newborn rat calvaria bone cells obtained by digestion were fractionated on columns of wheat-germ agglutinin (WGA) sepharose 6MB for osteoclast isolation. The initial nonspecific binding cells which were passed through the WGA sepharose column by a buffer acquired a high enzyme activity of alkaline phosphatase, but not that of acid phosphatase. However, elution of cells using a buffer with the addition of N-acetyl-D-glucosamine resulted in a high acid phosphatase activity but no alkaline phosphatase activity. The former WGA binding negative fraction enriched osteoblasts averaging 30 microns in size. The latter WGA binding positive fraction enriched osteoclasts ranging from 20 microns to 60 microns in size. The electron-microscope clearly demonstrated the cellular details of osteoclasts. Isolated cell counts showed a ratio of six to four. These results indicate that our method of osteoclast isolation is simple and useful in lectin affinity chromatography because all cells have sugar moieties on their surface and the binding of osteoclasts can be reversed by the addition of specific lectin-binding sugars to the eluting buffer.

  2. Affinity purification of recombinant human plasminogen activator ...

    African Journals Online (AJOL)

    Affinity purification of recombinant human plasminogen activator from ... Screening antibody was performed using rhPA milk in an ELISA-elution assay. ... useful for purifying other tPA mutants or other novel recombinant milkderived proteins.


    Despite the amount of resources that have been invested by national and international academic, government, and commercial sectors to develop affinity-based biosensor products, little obvious success has been realized through commercialization of these devices for specific applic...

  4. Quantum deformation of the affine transformation algebra

    International Nuclear Information System (INIS)

    Aizawa, N.; Sato, Haru-Tada


    We discuss a quantum deformation of the affine transformation algebra in one-dimensional space. It is shown that the quantum algebra has a non-cocommutative Hopf algebra structure, simple realizations and quantum tensor operators. (orig.)

  5. Dynamics of Open Systems with Affine Maps

    International Nuclear Information System (INIS)

    Zhang Da-Jian; Liu Chong-Long; Tong Dian-Min


    Many quantum systems of interest are initially correlated with their environments and the reduced dynamics of open systems are an interesting while challenging topic. Affine maps, as an extension of completely positive maps, are a useful tool to describe the reduced dynamics of open systems with initial correlations. However, it is unclear what kind of initial state shares an affine map. In this study, we give a sufficient condition of initial states, in which the reduced dynamics can always be described by an affine map. Our result shows that if the initial states of the combined system constitute a convex set, and if the correspondence between the initial states of the open system and those of the combined system, defined by taking the partial trace, is a bijection, then the reduced dynamics of the open system can be described by an affine map. (paper)

  6. On the Lp affine isoperimetric inequalities

    Indian Academy of Sciences (India)

    surface area measure on convex bodies. We also establish the reverse version of -Petty projection inequality and an affine isoperimetric inequality of − p K . Author Affiliations. Wuyang Yu1 Gangsong Leng2. Institute of Management Decision ...

  7. Production of enzymatically active recombinant full-length barley high pI alpha-glucosidase of glycoside family 31 by high cell-density fermentation of Pichia pastoris and affinity purification

    DEFF Research Database (Denmark)

    Næsted, Henrik; Kramhøft, Birte; Lok, F.


    Recombinant barley high pI alpha-glucosidase was produced by high cell-density fermentation of Pichia pastoris expressing the cloned full-length gene. The gene was amplified from a genomic clone and exons (coding regions) were assembled by overlap PCR. The resulting cDNA was expressed under contr...... nM x s(-1), and 85 s(-1) using maltose as substrate. This work presents the first production of fully active recombinant alpha-glucosidase of glycoside hydrolase family 31 from higher plants. (c) 2005 Elsevier Inc. All rights reserved....

  8. Mycobacterium tuberculosis nucleoid-associated DNA-binding protein H-NS binds with high-affinity to the Holliday junction and inhibits strand exchange promoted by RecA protein. (United States)

    Sharadamma, N; Harshavardhana, Y; Singh, Pawan; Muniyappa, K


    A number of studies have shown that the structure and composition of bacterial nucleoid influences many a processes related to DNA metabolism. The nucleoid-associated proteins modulate not only the DNA conformation but also regulate the DNA metabolic processes such as replication, recombination, repair and transcription. Understanding of how these processes occur in the context of Mycobacterium tuberculosis nucleoid is of considerable medical importance because the nucleoid structure may be constantly remodeled in response to environmental signals and/or growth conditions. Many studies have concluded that Escherichia coli H-NS binds to DNA in a sequence-independent manner, with a preference for A-/T-rich tracts in curved DNA; however, recent studies have identified the existence of medium- and low-affinity binding sites in the vicinity of the curved DNA. Here, we show that the M. tuberculosis H-NS protein binds in a more structure-specific manner to DNA replication and repair intermediates, but displays lower affinity for double-stranded DNA with relatively higher GC content. Notably, M. tuberculosis H-NS was able to bind Holliday junction (HJ), the central recombination intermediate, with substantially higher affinity and inhibited the three-strand exchange promoted by its cognate RecA. Likewise, E. coli H-NS was able to bind the HJ and suppress DNA strand exchange promoted by E. coli RecA, although much less efficiently compared to M. tuberculosis H-NS. Our results provide new insights into a previously unrecognized function of H-NS protein, with implications for blocking the genome integration of horizontally transferred genes by homologous and/or homeologous recombination.

  9. High-Mannose Specific Lectin and Its Recombinants from a Carrageenophyta Kappaphycus alvarezii Represent a Potent Anti-HIV Activity Through High-Affinity Binding to the Viral Envelope Glycoprotein gp120. (United States)

    Hirayama, Makoto; Shibata, Hiromi; Imamura, Koji; Sakaguchi, Takemasa; Hori, Kanji


    We previously reported that a high-mannose binding lectin KAA-2 from the red alga Kappaphycus alvarezii, which is an economically important species and widely cultivated as a source of carrageenans, had a potent anti-influenza virus activity. In this study, the full-length sequences of two KAA isoforms, KAA-1 and KAA-2, were elucidated by a combination of peptide mapping and complementary DNA (cDNA) cloning. They consisted of four internal tandem-repeated domains, which are conserved in high-mannose specific lectins from lower organisms, including a cyanobacterium Oscillatoria agardhii and a red alga Eucheuma serra. Using an Escherichia coli expression system, an active recombinant form of KAA-1 (His-tagged rKAA-1) was successfully generated in the yield of 115 mg per liter of culture. In a detailed oligosaccharide binding analysis by a centrifugal ultrafiltration-HPLC method with 27 pyridylaminated oligosaccharides, His-tagged rKAA-1 and rKAA-1 specifically bound to high-mannose N-glycans with an exposed α1-3 mannose in the D2 arm as the native lectin did. Predicted from oligosaccharide binding specificity, a surface plasmon resonance analysis revealed that the recombinants exhibit strong interaction with gp120, a heavily glycosylated envelope glycoprotein of HIV with high association constants (1.48 - 1.61 × 10(9) M(-1)). Native KAAs and the recombinants inhibited the HIV-1 entry at IC50s of low nanomolar levels (7.3-12.9 nM). Thus, the recombinant proteins would be useful as antiviral reagents targeting the viral surface glycoproteins with high-mannose N-glycans, and the cultivated alga K. alvarezii could also be a good source of not only carrageenans but also this functional lectin(s).

  10. The metric-affine gravitational theory as the gauge theory of the affine group

    International Nuclear Information System (INIS)

    Lord, E.A.


    The metric-affine gravitational theory is shown to be the gauge theory of the affine group, or equivalently, the gauge theory of the group GL(4,R) of tetrad deformations in a space-time with a locally Minkowskian metric. The identities of the metric-affine theory, and the relationship between them and those of general relativity and Sciama-Kibble theory, are derived. (Auth.)

  11. Myoglobin oxygen affinity in aquatic and terrestrial birds and mammals. (United States)

    Wright, Traver J; Davis, Randall W


    Myoglobin (Mb) is an oxygen binding protein found in vertebrate skeletal muscle, where it facilitates intracellular transport and storage of oxygen. This protein has evolved to suit unique physiological needs in the muscle of diving vertebrates that express Mb at much greater concentrations than their terrestrial counterparts. In this study, we characterized Mb oxygen affinity (P50) from 25 species of aquatic and terrestrial birds and mammals. Among diving species, we tested for correlations between Mb P50 and routine dive duration. Across all species examined, Mb P50 ranged from 2.40 to 4.85 mmHg. The mean P50 of Mb from terrestrial ungulates was 3.72±0.15 mmHg (range 3.70-3.74 mmHg). The P50 of cetaceans was similar to terrestrial ungulates ranging from 3.54 to 3.82 mmHg, with the exception of the melon-headed whale, which had a significantly higher P50 of 4.85 mmHg. Among pinnipeds, the P50 ranged from 3.23 to 3.81 mmHg and showed a trend for higher oxygen affinity in species with longer dive durations. Among diving birds, the P50 ranged from 2.40 to 3.36 mmHg and also showed a trend of higher affinities in species with longer dive durations. In pinnipeds and birds, low Mb P50 was associated with species whose muscles are metabolically active under hypoxic conditions associated with aerobic dives. Given the broad range of potential globin oxygen affinities, Mb P50 from diverse vertebrate species appears constrained within a relatively narrow range. High Mb oxygen affinity within this range may be adaptive for some vertebrates that make prolonged dives. © 2015. Published by The Company of Biologists Ltd.

  12. Hirota's solitons in the affine and the conformal affine Toda models

    International Nuclear Information System (INIS)

    Aratyn, H.; Constantinidis, C.P.; Ferreira, L.A.; Gomes, J.F.; Zimerman, A.H.


    We use Hirota's method formulated as a recursive scheme to construct a complete set of soliton solutions for the affine Toda field theory based on an arbitrary Lie algebra. Our solutions include a new class of solitons connected with two different types of degeneracies encountered in Hirota's perturbation approach. We also derive an universal mass formula for all Hirota's solutions to the affine Toda model valid for all underlying Lie groups. Embedding of the affine Toda model in the conformal affine Toda model plays a crucial role in this analysis. (orig.)

  13. Student award for outstanding research winner in the Ph.D. category for the 2017 society for biomaterials annual meeting and exposition, april 5-8, 2017, Minneapolis, Minnesota: Characterization of protein interactions with molecularly imprinted hydrogels that possess engineered affinity for high isoelectric point biomarkers. (United States)

    Clegg, John R; Zhong, Justin X; Irani, Afshan S; Gu, Joann; Spencer, David S; Peppas, Nicholas A


    Molecularly imprinted polymers (MIPs) with selective affinity for protein biomarkers could find extensive utility as environmentally robust, cost-efficient biomaterials for diagnostic and therapeutic applications. In order to develop recognitive, synthetic biomaterials for prohibitively expensive protein biomarkers, we have developed a molecular imprinting technique that utilizes structurally similar, analogue proteins. Hydrogel microparticles synthesized by molecular imprinting with trypsin, lysozyme, and cytochrome c possessed an increased affinity for alternate high isoelectric point biomarkers both in isolation and plasma-mimicking adsorption conditions. Imprinted and non-imprinted P(MAA-co-AAm-co-DEAEMA) microgels containing PMAO-PEGMA functionalized polycaprolactone nanoparticles were net-anionic, polydisperse, and irregularly shaped. MIPs and control non-imprinted polymers (NIPs) exhibited regions of Freundlich and BET isotherm adsorption behavior in a range of non-competitive protein solutions, where MIPs exhibited enhanced adsorption capacity in the Freundlich isotherm regions. In a competitive condition, imprinting with analogue templates (trypsin, lysozyme) increased the adsorption capacity of microgels for cytochrome c by 162% and 219%, respectively, as compared to a 122% increase provided by traditional bulk imprinting with cytochrome c. Our results suggest that molecular imprinting with analogue protein templates is a viable synthetic strategy for enhancing hydrogel-biomarker affinity and promoting specific protein adsorption behavior in biological fluids. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 1565-1574, 2017. © 2017 Wiley Periodicals, Inc.

  14. Piecewise affine control for fast unmanned ground vehicles


    Benine Neto , André; Grand , Christophe


    International audience; Unmanned ground vehicles (UGV) may experience skidding when moving at high speeds, and therefore have its safety jeopardized. For this reason the nonlinear dynamics of lateral tire forces must be taken into account into the design of steering controllers for autonomous vehicles. This paper presents the design of a state feedback piecewise affine controller applied to an UGV to coordinate the steering and torque distribution inputs in order to reduce vehicle skidding on...

  15. Quantitative analysis of multiple kappa-opioid receptors by selective and nonselective ligand binding in guinea pig spinal cord: Resolution of high and low affinity states of the kappa 2 receptors by a computerized model-fitting technique

    International Nuclear Information System (INIS)

    Tiberi, M.; Magnan, J.


    The binding characteristics of selective and nonselective opioids have been studied in whole guinea pig spinal cord, using a computer fitting method to analyze the data obtained from saturation and competition studies. The delineation of specific binding sites labeled by the mu-selective opioid [3H]D-Ala2,MePhe4,Gly-ol5-enkephalin (Kd = 2.58 nM, R = 4.52 pmol/g of tissue) and by the delta-selective opioid [3H]D-Pen2, D-Pen5-enkephalin (Kd = 2.02 nM, R = 1.47 pmol/g of tissue) suggests the presence of mu and delta-receptors in the spinal cord tissue. The presence of kappa receptors was probed by the kappa-selective opioid [3H]U69593 (Kd = 3.31 nM, R = 2.00 pmol/g of tissue). The pharmacological characterization of the sites labeled by [3H]U69593 confirms the assumption that this ligand discriminates kappa receptors in guinea pig spinal cord. The benzomorphan [3H]ethylketazocine labels a population of receptors with one homogeneous affinity state (Kd = 0.65 nM, R = 7.39 pmol/g of tissue). The total binding capacity of this ligand was not different from the sum of the binding capacities of mu, delta-, and kappa-selective ligands. Under mu- and delta-suppressed conditions, [3H]ethylketazocine still binds to receptors with one homogeneous affinity state (Kd = 0.45 nM, R = 1.69 pmol/g of tissue). Competition studies performed against the binding of [3H]ethylketazocine under these experimental conditions reveal that the pharmacological profile of the radiolabeled receptors is similar to the profile of the kappa receptors labeled with [3H]U69593. Saturation studies using the nonselective opioid [3H]bremazocine demonstrate that this ligand binds to spinal cord membranes with heterogeneous affinities (Kd1 = 0.28 nM, R1 = 7.91 pmol/g of tissue; Kd2 = 3.24 nM, R2 = 11.2 pmol/g of tissue)

  16. Quantitative analysis of multiple kappa-opioid receptors by selective and nonselective ligand binding in guinea pig spinal cord: Resolution of high and low affinity states of the kappa 2 receptors by a computerized model-fitting technique

    Energy Technology Data Exchange (ETDEWEB)

    Tiberi, M.; Magnan, J. (Universite de Montreal, Quebec (Canada))


    The binding characteristics of selective and nonselective opioids have been studied in whole guinea pig spinal cord, using a computer fitting method to analyze the data obtained from saturation and competition studies. The delineation of specific binding sites labeled by the mu-selective opioid (3H)D-Ala2,MePhe4,Gly-ol5-enkephalin (Kd = 2.58 nM, R = 4.52 pmol/g of tissue) and by the delta-selective opioid (3H)D-Pen2, D-Pen5-enkephalin (Kd = 2.02 nM, R = 1.47 pmol/g of tissue) suggests the presence of mu and delta-receptors in the spinal cord tissue. The presence of kappa receptors was probed by the kappa-selective opioid (3H)U69593 (Kd = 3.31 nM, R = 2.00 pmol/g of tissue). The pharmacological characterization of the sites labeled by (3H)U69593 confirms the assumption that this ligand discriminates kappa receptors in guinea pig spinal cord. The benzomorphan (3H)ethylketazocine labels a population of receptors with one homogeneous affinity state (Kd = 0.65 nM, R = 7.39 pmol/g of tissue). The total binding capacity of this ligand was not different from the sum of the binding capacities of mu, delta-, and kappa-selective ligands. Under mu- and delta-suppressed conditions, (3H)ethylketazocine still binds to receptors with one homogeneous affinity state (Kd = 0.45 nM, R = 1.69 pmol/g of tissue). Competition studies performed against the binding of (3H)ethylketazocine under these experimental conditions reveal that the pharmacological profile of the radiolabeled receptors is similar to the profile of the kappa receptors labeled with (3H)U69593. Saturation studies using the nonselective opioid (3H)bremazocine demonstrate that this ligand binds to spinal cord membranes with heterogeneous affinities (Kd1 = 0.28 nM, R1 = 7.91 pmol/g of tissue; Kd2 = 3.24 nM, R2 = 11.2 pmol/g of tissue).

  17. Specificity and affinity quantification of flexible recognition from underlying energy landscape topography.

    Directory of Open Access Journals (Sweden)

    Xiakun Chu


    Full Text Available Flexibility in biomolecular recognition is essential and critical for many cellular activities. Flexible recognition often leads to moderate affinity but high specificity, in contradiction with the conventional wisdom that high affinity and high specificity are coupled. Furthermore, quantitative understanding of the role of flexibility in biomolecular recognition is still challenging. Here, we meet the challenge by quantifying the intrinsic biomolecular recognition energy landscapes with and without flexibility through the underlying density of states. We quantified the thermodynamic intrinsic specificity by the topography of the intrinsic binding energy landscape and the kinetic specificity by association rate. We found that the thermodynamic and kinetic specificity are strongly correlated. Furthermore, we found that flexibility decreases binding affinity on one hand, but increases binding specificity on the other hand, and the decreasing or increasing proportion of affinity and specificity are strongly correlated with the degree of flexibility. This shows more (less flexibility leads to weaker (stronger coupling between affinity and specificity. Our work provides a theoretical foundation and quantitative explanation of the previous qualitative studies on the relationship among flexibility, affinity and specificity. In addition, we found that the folding energy landscapes are more funneled with binding, indicating that binding helps folding during the recognition. Finally, we demonstrated that the whole binding-folding energy landscapes can be integrated by the rigid binding and isolated folding energy landscapes under weak flexibility. Our results provide a novel way to quantify the affinity and specificity in flexible biomolecular recognition.

  18. Protein isolation using affinity chromatography

    NARCIS (Netherlands)

    Besselink, T.


    Many product or even waste streams in the food industry contain components that may have potential for e.g. functional foods. These streams are typically large in volume and the components of interest are only present at low concentrations. A robust and highly selective separation process should

  19. On Affine Fusion and the Phase Model

    Directory of Open Access Journals (Sweden)

    Mark A. Walton


    Full Text Available A brief review is given of the integrable realization of affine fusion discovered recently by Korff and Stroppel. They showed that the affine fusion of the su(n Wess-Zumino-Novikov-Witten (WZNW conformal field theories appears in a simple integrable system known as the phase model. The Yang-Baxter equation leads to the construction of commuting operators as Schur polynomials, with noncommuting hopping operators as arguments. The algebraic Bethe ansatz diagonalizes them, revealing a connection to the modular S matrix and fusion of the su(n WZNW model. The noncommutative Schur polynomials play roles similar to those of the primary field operators in the corresponding WZNW model. In particular, their 3-point functions are the su(n fusion multiplicities. We show here how the new phase model realization of affine fusion makes obvious the existence of threshold levels, and how it accommodates higher-genus fusion.

  20. Affine coherent states and Toeplitz operators (United States)

    Hutníková, Mária; Hutník, Ondrej


    We study a parameterized family of Toeplitz operators in the context of affine coherent states based on the Calderón reproducing formula (= resolution of unity on L_2( {R})) and the specific admissible wavelets (= affine coherent states in L_2( {R})) related to Laguerre functions. Symbols of such Calderón-Toeplitz operators as individual coordinates of the affine group (= upper half-plane with the hyperbolic geometry) are considered. In this case, a certain class of pseudo-differential operators, their properties and their operator algebras are investigated. As a result of this study, the Fredholm symbol algebras of the Calderón-Toeplitz operator algebras for these particular cases of symbols are described. This article is part of a special issue of Journal of Physics A: Mathematical and Theoretical devoted to ‘Coherent states: mathematical and physical aspects’.

  1. High affinity capture and concentration of quinacrine in polymorphonuclear neutrophils via vacuolar ATPase-mediated ion trapping: Comparison with other peripheral blood leukocytes and implications for the distribution of cationic drugs

    Energy Technology Data Exchange (ETDEWEB)

    Roy, Caroline; Gagné, Valérie; Fernandes, Maria J.G.; Marceau, François, E-mail:


    Many cationic drugs are concentrated in acidic cell compartments due to low retro-diffusion of the protonated molecule (ion trapping), with an ensuing vacuolar and autophagic cytopathology. In solid tissues, there is evidence that phagocytic cells, e.g., histiocytes, preferentially concentrate cationic drugs. We hypothesized that peripheral blood leukocytes could differentially take up a fluorescent model cation, quinacrine, depending on their phagocytic competence. Quinacrine transport parameters were determined in purified or total leukocyte suspensions at 37 °C. Purified polymorphonuclear leukocytes (PMNLs, essentially neutrophils) exhibited a quinacrine uptake velocity inferior to that of lymphocytes, but a consistently higher affinity (apparent K{sub M} 1.1 vs. 6.3 μM, respectively). However, the vacuolar (V)-ATPase inhibitor bafilomycin A1 prevented quinacrine transport or initiated its release in either cell type. PMNLs capture most of the quinacrine added at low concentrations to fresh peripheral blood leukocytes compared with lymphocytes and monocytes (cytofluorometry). Accumulation of the autophagy marker LC3-II occurred rapidly and at low drug concentrations in quinacrine-treated PMNLs (significant at ≥ 2.5 μM, ≥ 2 h). Lymphocytes contained more LAMP1 than PMNLs, suggesting that the mass of lysosomes and late endosomes is a determinant of quinacrine uptake V{sub max}. PMNLs, however, exhibited the highest capacity for pinocytosis (uptake of fluorescent dextran into endosomes). The selectivity of quinacrine distribution in peripheral blood leukocytes may be determined by the collaboration of a non-concentrating plasma membrane transport mechanism, tentatively identified as pinocytosis in PMNLs, with V-ATPase-mediated concentration. Intracellular reservoirs of cationic drugs are a potential source of toxicity (e.g., loss of lysosomal function in phagocytes). - Highlights: • Quinacrine is concentrated in acidic organelles via V-ATPase-mediated ion

  2. High affinity capture and concentration of quinacrine in polymorphonuclear neutrophils via vacuolar ATPase-mediated ion trapping: Comparison with other peripheral blood leukocytes and implications for the distribution of cationic drugs

    International Nuclear Information System (INIS)

    Roy, Caroline; Gagné, Valérie; Fernandes, Maria J.G.; Marceau, François


    Many cationic drugs are concentrated in acidic cell compartments due to low retro-diffusion of the protonated molecule (ion trapping), with an ensuing vacuolar and autophagic cytopathology. In solid tissues, there is evidence that phagocytic cells, e.g., histiocytes, preferentially concentrate cationic drugs. We hypothesized that peripheral blood leukocytes could differentially take up a fluorescent model cation, quinacrine, depending on their phagocytic competence. Quinacrine transport parameters were determined in purified or total leukocyte suspensions at 37 °C. Purified polymorphonuclear leukocytes (PMNLs, essentially neutrophils) exhibited a quinacrine uptake velocity inferior to that of lymphocytes, but a consistently higher affinity (apparent K M 1.1 vs. 6.3 μM, respectively). However, the vacuolar (V)-ATPase inhibitor bafilomycin A1 prevented quinacrine transport or initiated its release in either cell type. PMNLs capture most of the quinacrine added at low concentrations to fresh peripheral blood leukocytes compared with lymphocytes and monocytes (cytofluorometry). Accumulation of the autophagy marker LC3-II occurred rapidly and at low drug concentrations in quinacrine-treated PMNLs (significant at ≥ 2.5 μM, ≥ 2 h). Lymphocytes contained more LAMP1 than PMNLs, suggesting that the mass of lysosomes and late endosomes is a determinant of quinacrine uptake V max . PMNLs, however, exhibited the highest capacity for pinocytosis (uptake of fluorescent dextran into endosomes). The selectivity of quinacrine distribution in peripheral blood leukocytes may be determined by the collaboration of a non-concentrating plasma membrane transport mechanism, tentatively identified as pinocytosis in PMNLs, with V-ATPase-mediated concentration. Intracellular reservoirs of cationic drugs are a potential source of toxicity (e.g., loss of lysosomal function in phagocytes). - Highlights: • Quinacrine is concentrated in acidic organelles via V-ATPase-mediated ion trapping

  3. Exploration of the dopamine transporter: in vitro and in vivo characterization of a high-affinity and high-specificity iodinated tropane derivative (E)-N-(3-iodoprop-2-enyl)-2β-carbomethoxy- 3β-(4'-methylphenyl)nortropane (PE2I)

    International Nuclear Information System (INIS)

    Guilloteau, Denis; Emond, Patrick; Baulieu, Jean-Louis; Garreau, Lucette; Frangin, Yves; Pourcelot, Leandre; Mauclaire, Laurent; Besnard, Jean-Claude; Chalon, Sylvie


    For the diagnosis and follow-up of neurodegenerative diseases, many cocaine derivatives have been proposed as radioligands to explore the dopamine transporter. As none of them have all the criteria of specificity and kinetics for human use, we have developed a new derivative, (E)-N-(3-iodoprop-2-enyl)-2β-carbomethoxy-3β-(4'-methylphenyl)nortropane (PE2I), which displays promising properties. We report the characterization of PE2I in vitro on rat striatal membranes and in vivo in rats and in monkeys. PE2I had a high affinity (Kd=0.09±0.01 nM) and high specificity for the dopamine transporter. In rats we observed a high accumulation in the striatum; by contrast, a very low fixation was measured in the cortex. Moreover, a preinjection of a saturating dose of GBR 12909 prevented the striatal accumulation of PE2I by 74%. These results confirmed the specificity of PE2I for the dopamine transporter. In vivo in monkeys, SPECT studies showed a high accumulation in striatum. Moreover, an equilibrium state was obtained 1 h after injection. PE2I seemed to be the most promising ligand for the dopamine transporter exploration by SPECT using a single-day protocol.

  4. The dynamics of metric-affine gravity

    International Nuclear Information System (INIS)

    Vitagliano, Vincenzo; Sotiriou, Thomas P.; Liberati, Stefano


    Highlights: → The role and the dynamics of the connection in metric-affine theories is explored. → The most general second order action does not lead to a dynamical connection. → Including higher order invariants excites new degrees of freedom in the connection. → f(R) actions are also discussed and shown to be a non- representative class. - Abstract: Metric-affine theories of gravity provide an interesting alternative to general relativity: in such an approach, the metric and the affine (not necessarily symmetric) connection are independent quantities. Furthermore, the action should include covariant derivatives of the matter fields, with the covariant derivative naturally defined using the independent connection. As a result, in metric-affine theories a direct coupling involving matter and connection is also present. The role and the dynamics of the connection in such theories is explored. We employ power counting in order to construct the action and search for the minimal requirements it should satisfy for the connection to be dynamical. We find that for the most general action containing lower order invariants of the curvature and the torsion the independent connection does not carry any dynamics. It actually reduces to the role of an auxiliary field and can be completely eliminated algebraically in favour of the metric and the matter field, introducing extra interactions with respect to general relativity. However, we also show that including higher order terms in the action radically changes this picture and excites new degrees of freedom in the connection, making it (or parts of it) dynamical. Constructing actions that constitute exceptions to this rule requires significant fine tuned and/or extra a priori constraints on the connection. We also consider f(R) actions as a particular example in order to show that they constitute a distinct class of metric-affine theories with special properties, and as such they cannot be used as representative toy

  5. Engineering an antibody with picomolar affinity to DOTA chelates of multiple radionuclides for pretargeted radioimmunotherapy and imaging

    Energy Technology Data Exchange (ETDEWEB)

    Orcutt, Kelly Davis; Slusarczyk, Adrian L. [Department of Chemical Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Cieslewicz, Maryelise [Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Ruiz-Yi, Benjamin [Department of Chemical Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Bhushan, Kumar R. [Division of Hematology/Oncology, Beth Israel Deaconess Medical Center, Boston, MA 02215 (United States); Frangioni, John V. [Division of Hematology/Oncology, Beth Israel Deaconess Medical Center, Boston, MA 02215 (United States); Department of Radiology, Beth Israel Deaconess Medical Center, Boston, MA 02215 (United States); Wittrup, K. Dane, E-mail: wittrup@mit.ed [Department of Chemical Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States)


    Introduction: In pretargeted radioimmunotherapy (PRIT), a bifunctional antibody is administered and allowed to pre-localize to tumor cells. Subsequently, a chelated radionuclide is administered and captured by cell-bound antibody while unbound hapten clears rapidly from the body. We aim to engineer high-affinity binders to 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA) chelates for use in PRIT applications. Methods: We mathematically modeled antibody and hapten pharmacokinetics to analyze hapten tumor retention as a function of hapten binding affinity. Motivated by model predictions, we used directed evolution and yeast surface display to affinity mature the 2D12.5 antibody to DOTA, reformatted as a single chain variable fragment (scFv). Results: Modeling predicts that for high antigen density and saturating bsAb dose, a hapten-binding affinity of 100 pM is needed for near-maximal hapten retention. We affinity matured 2D12.5 with an initial binding constant of about 10 nM to DOTA-yttrium chelates. Affinity maturation resulted in a 1000-fold affinity improvement to biotinylated DOTA-yttrium, yielding an 8.2{+-}1.9 picomolar binder. The high-affinity scFv binds DOTA complexes of lutetium and gadolinium with similar picomolar affinity and indium chelates with low nanomolar affinity. When engineered into a bispecific antibody construct targeting carcinoembryonic antigen, pretargeted high-affinity scFv results in significantly higher tumor retention of a {sup 111}In-DOTA hapten compared to pretargeted wild-type scFv in a xenograft mouse model. Conclusions: We have engineered a versatile, high-affinity, DOTA-chelate-binding scFv. We anticipate it will prove useful in developing pretargeted imaging and therapy protocols to exploit the potential of a variety of radiometals.

  6. A novel affinity purification method to isolate peptide specific antibodies

    DEFF Research Database (Denmark)

    Karlsen, Alan E; Lernmark, A; Kofod, Hans


    Site-specific, high affinity polyclonal antisera are effectively and successfully produced by immunizing rabbits with synthetic peptides. The use of these antisera in subsequent immune analysis is often limited because of non-specific binding. We describe a new and simple method to effectively...... affinity-purify anti-peptide antibodies. To test our system, rabbits were immunized with model peptides representing sequences of the putative rabbit growth hormone receptor and several HLA-DQ beta-chain molecules. Polystyrene plastic beads were coated with peptides. Immune serum was incubated...... with the beads and after a wash step the bound antibodies were eluted in 1 M acetic acid. The eluted material was composed predominantly of intact immunoglobulin as evidenced by the presence of heavy and light chain bands in SDS-PAGE. The eluted antibodies were peptide specific in ELISA and bound only to intact...

  7. Extreme disorder in an ultrahigh-affinity protein complex (United States)

    Borgia, Alessandro; Borgia, Madeleine B.; Bugge, Katrine; Kissling, Vera M.; Heidarsson, Pétur O.; Fernandes, Catarina B.; Sottini, Andrea; Soranno, Andrea; Buholzer, Karin J.; Nettels, Daniel; Kragelund, Birthe B.; Best, Robert B.; Schuler, Benjamin


    Molecular communication in biology is mediated by protein interactions. According to the current paradigm, the specificity and affinity required for these interactions are encoded in the precise complementarity of binding interfaces. Even proteins that are disordered under physiological conditions or that contain large unstructured regions commonly interact with well-structured binding sites on other biomolecules. Here we demonstrate the existence of an unexpected interaction mechanism: the two intrinsically disordered human proteins histone H1 and its nuclear chaperone prothymosin-α associate in a complex with picomolar affinity, but fully retain their structural disorder, long-range flexibility and highly dynamic character. On the basis of closely integrated experiments and molecular simulations, we show that the interaction can be explained by the large opposite net charge of the two proteins, without requiring defined binding sites or interactions between specific individual residues. Proteome-wide sequence analysis suggests that this interaction mechanism may be abundant in eukaryotes.

  8. Extreme disorder in an ultrahigh-affinity protein complex

    DEFF Research Database (Denmark)

    Borgia, Alessandro; Borgia, Madeleine B; Bugge, Katrine


    Molecular communication in biology is mediated by protein interactions. According to the current paradigm, the specificity and affinity required for these interactions are encoded in the precise complementarity of binding interfaces. Even proteins that are disordered under physiological conditions...... with picomolar affinity, but fully retain their structural disorder, long-range flexibility and highly dynamic character. On the basis of closely integrated experiments and