Study on a charcoal-based monitor for Rn-220 in air

International Nuclear Information System (INIS)

Yu Yiqiao; Solomon, S.B.

1993-01-01

Activated charcoal has been used in both passive monitors (Cohen, Pondy et al. 1987) and active monitors (Solomon and Gan, 1989) for the measurements of 222 Rn in air. Cooled, charcoal-impregnated filters, viewed in-situ by a solid state alpha detector, have been used for 220 Rn-in-breath studies. In general, γ ray counting of 220 Rn samples collected on activated charcoal has not been used. This paper describes the development and calibration of a charcoal based monitor designed to measure 220 Rn levels down to a lower limit of 10 Bq m -3 over sampling periods of 4 to 15 h. The activity of 212 Pb (10.6 h) produced from 220 Rn (55.6 s) collected in an activated charcoal-based sampler is 1/700 the total 220 Rn activity. A typical Hp-Ge detector has a MDL for a two-hours count of approximately 0.1 Bq of 212 Pb for the 239 keV γ-ray. For a MDL of 10 Bq·m -3 of 220 Rn in air, a volume of at least 7 m 3 must be sampled, assuming no breakthrough. The present charcoal-based 220 Rn monitor is designed to maximize the path length through the activated charcoal while sufficient cross-sectional area is retained to allow flow rates up to 0.03 m 3 ·kg -1 is packed into a specially designed aluminum container. The container is modeled on a Marinelli beaker to maximize the counting efficiency, while the sample flow through the chambers of the monitor is optimized to maintain radial symmetry. experiments demonstrated that 94% of 220 Rn was adsorbed by the charcoal in the monitor under a flow rate of 0.03 m 3 ·min -1 at 25 degree C and 85%. RH in 15 h. The monitor is designed to fit over a 70 mm diameter Hp-Ge detector. Preliminary measurements of 220 Rn in two buildings and a cave, using the active monitors and 'grabing' samples under a flow rate of 0.03 m 3 ·min -1 and a period of 4 h, indicated concentrations of between 18.6 and 142.0 Bq·m 3

Attached, unattached fraction of progeny concentrations and equilibrium factor for dose assessments from {sup 222}Rn and {sup 220}Rn

Energy Technology Data Exchange (ETDEWEB)

Singh, Parminder; Saini, Komal; Bajwa, Bikramjit Singh [Guru Nanak Dev University, Department of Physics, Amritsar, Punjab (India); Mishra, Rosaline; Sahoo, Bijay Kumar [Bhabha Atomic Research Centre, Radiological Physics and Advisory Division, Mumbai (India)

2016-08-15

In this study, measurements of indoor radon ({sup 222}Rn), thoron ({sup 220}Rn) and their equilibrium equivalent concentration (EEC) were carried out in 96 dwellings from 22 different villages situated in Hamirpur district, Himachal Pradesh, India, by using LR-115 type II-based pinhole twin cup dosimeters and deposition-based progeny sensors (DRPS/DTPS). The annual average indoor {sup 222}Rn and {sup 220}Rn concentrations observed in these dwellings were 63.82 and 89.59 Bq/m{sup 3}, respectively, while the average EEC (attached + unattached) for {sup 222}Rn and {sup 220}Rn was 29.28 and 2.74 Bq/m{sup 3}. For {sup 222}Rn (f{sub Rn}) and {sup 220}Rn (f{sub Tn}), the average values of unattached fraction were 0.11 and 0.09, respectively. The equilibrium factors for radon (F{sub Rn}) and thoron (F{sub Tn}) varied from 0.12 to 0.77 with an average of 0.50, and from 0.01 to 0.34 with an average of 0.05, respectively. The annual inhalation dose due to mouth and nasal breathing was calculated using dose conversion factors and unattached fractions. The indoor annual effective doses for {sup 222}Rn (AEDR) and {sup 220}Rn (AEDT) were found to be 1.92 and 0.83 mSv a{sup -1}, respectively. The values of {sup 222}Rn/{sup 220}Rn concentrations and annual effective doses obtained in the present study are within the safe limits as recommended by the International Commission on Radiological Protection for indoor dwelling exposure conditions. (orig.)

Development of an aerosol chamber for calibration of 220Rn progeny detectors

Science.gov (United States)

Sorimachi, Atsuyuki; Ishikawa, Tetsuo; Tokonami, Shinji

2014-09-01

This paper describes an aerosol chamber system that can be used for calibrations and performance experiments of passive 220Rn progeny detectors. For the purpose of this study, an aerosol generation system using carnauba wax as the aerosol material was mounted into the 220Rn chamber. We used the chamber to measure characteristics of the equilibrium factor (F) of 220Rn and unattached fraction (fp) of 220Rn progeny, which are important parameters for dose estimation. The first experiment showed that continuous and stable generation of the unattached and aerosol-attached 220Rn progeny concentrations was obtained. We observed that the spatial distributions in the chamber of the vertical profiles of the unattached and aerosol-attached 220Rn progeny concentrations were homogeneous, as were the particle number concentration and count median diameter. The values of F and fp and their characteristics observed in this study were in the same range as the values reported from indoor measurements. We found that the characteristics of F and fp were dependent on the aerosol conditions (particle diameter and particle number concentration).

Development of method for quantification of 222Rn exhalation ratio at radioactive waste dam and soil study as mitigator material

International Nuclear Information System (INIS)

Macacini, Jose Flavio

2008-01-01

The Brazilian uranium mining company (INB) processed 2.32 10 6 tons of uranium ore in its ore treatment unit (UTM - Caldas), located in the Pocos de Caldas plateau. During 16 years of operation, this unit discarded 2.39 10 6 tons of solid waste in a tailing dam, with an average activity concentration of 226 Ra of 7311 ± 184 Bq kg -1 . Most of the atoms of 222 Rn generated from the radioactive waste of the tailing dam remain bounded to the mineral structure. However, a fraction of these atoms can be released from the mineral structure and then emanate. Reaching the porous space of the waste piles, the 222 Rn moves towards the interface waste-atmosphere, exhaling into the atmosphere. The featuring properties of the 222 Rn transport and the biological damage caused by its progeny transform this small chain of radionuclides into a scourge of nature. Because of that, the dry area of the tailing dam was the scope of this work. A methodology was developed for quantifying the exhalation rate of 222 Rn. Moreover, the soil from its surroundings was experimentally evaluated as a cover material to reduce the exhalation of 222 Rn. A collector of 222 Rn was developed, being denominated 607. This collector was proved to be exact and precise after laboratory tests, when a standard for 222 Rn exhalation was prepared with caldasite, an uranium ore with high concentration of 226 Ra (26611 ± 581 Bq kg -1 ), crushed to the granulometric interval from 1.168 mm to 0.589 mm. The results of 222 Rn exhalation rate using the collector 607 were not influenced by the adsorption of water steam, considering sampling periods lower than 5 days and mass of water steam lower than 7 g. Sampling for measuring 222 Rn exhalation rates in the dry area of the tailing dam was carried out using the collector 607, following the experimental design established by the United States Environmental Protection Agency (US EPA). The average exhalation rate in the west part of the tailing dam was 1.30 ± 1.24 Bq m

Energy-dependent etching-related impacts on CR-39 alpha detection efficiency for the Rn-222 and Rn-220 decay chains

Science.gov (United States)

Tan, Y.; Yuan, H.; Kearfott, K. J.

2018-04-01

CR-39 detectors are widely used to measure environmental levels of Rn-222, Rn-220 and their progeny. Prior research reported the CR-39 detection efficiency for alpha particles from Rn-222, Rn-220 and their progeny under a variety of etching conditions. This paper provides an explanation for interesting observations included in that work, namely that the critical incidence angle decreases with the increasing particle energy and the detection efficiency for 8.78 MeV alpha particles is zero. This paper explains these phenomena from a consideration of the interaction of alpha particles with the CR-39 detectors and the physics of etching dynamics. The proposed theory provides a rationale for an approach to optimizing the etching conditions of CR-39 detector for measuring Rn-222, Rn-220 and their progenies.

Improved automated analysis of radon (222Rn) and thoron (220Rn) in natural waters.

Science.gov (United States)

Dimova, Natasha; Burnett, William C; Lane-Smith, Derek

2009-11-15

Natural radon ((222)Rn) and thoron ((220)Rn) can be used as tracers of various chemical and physical processes in the environment. We present here results from an extended series of laboratory experiments intended to improve the automated analysis of (222)Rn and (220)Rn in water using a modified RAD AQUA (Durridge Inc.) system. Previous experience with similar equipment showed that it takes about 30-40 min for the system to equilibrate to radon-in-water concentration increases and even longer for the response to return to baseline after a sharp spike. While the original water/gas exchanger setup was built only for radon-in-water measurement, our goal here is to provide an automated system capable of high resolution and good sensitivity for both radon- and thoron-in-water detections. We found that faster water flow rates substantially improved the response for both isotopes while thoron is detected most efficiently at airflow rates of 3 L/min. Our results show that the optimum conditions for fastest response and sensitivity for both isotopes are at water flow rates up to 17 L/min and an airflow rate of 3 L/min through the detector. Applications for such measurements include prospecting for naturally occurring radioactive material (NORM) in pipelines and locating points of groundwater/surface water interaction.

Radon exhalation from granitic rocks

International Nuclear Information System (INIS)

Del Claro, Flávia; Paschuk, Sergei A.; Corrêa, Janine N.; Mazer, Wellington; Narloch, Danielle Cristine; Martin, Aline Cristina; Denyak, Valeriy

2017-01-01

Naturally occurring radionuclides such as radon ( 222 Rn), its decay products and other elements from the radioactive series of uranium ( 238 U and 235 U) and thorium ( 232 Th) are an important source of human exposure to natural radioactivity. The worldwide evaluation of health radiobiological effects and risks from population exposure to natural radionuclides is a growing concern. About 50% of personal radiation annual dose is related to radionuclides such as radon ( 222 Rn), thoron ( 220 Rn), radium ( 226 Ra), thorium ( 232 Th) and potassium ( 40 K), which are present in modern materials commonly used in construction of dwellings and buildings. The radioactivity of marbles and granites is of big concern since under certain conditions the radioactivity levels of these materials can be hazardous to the population and require the implementation of mitigation procedures. Present survey of the 222 Rn and 220 Rn activity concentration liberated in the air was performed using commercialized Brazilian granite rocks at national market as well as exported to other countries. The 222 Rn and 220 Rn measurements were performed using the AlphaGUARD instant monitor and RAD7 detector, respectively. This study was performed at the Applied Nuclear Physics Laboratory of the Federal University of Technology – Paraná (UTFPR). Obtained results of radon concentration activity in air exhaled studied samples of granites varied from 3±1 Bq/m 3 to 2087±19 Bq/m 3 , which shows that some samples of granitic rocks represent rather elevated health risk the population. (author)

Determining chance coincidence, survival factor and decay factor in 220Rn delayed coincidence measurement

International Nuclear Information System (INIS)

Huang Derong; Yan Yongjun; Zhou Jianliang; Qiu Shoukang

2013-01-01

The method and calculation formulas to determine the chance coincidence in the 220 Rn coincidence measurement are introduced in this paper. The poisson distribution is introduced to correct the chance coincidence. The relative deviation of the true coincidence between the method and the Giffin's is within 5% after the correction of the cohance coincidence. The measurement of 220 Rn is done by comparative measurement with RAD7. The results shows that 220 Rn can be measured by the method with a relative deviation of 14%. Mean while, for the 220 Rn flow regime is difficult to meet the condition of calculation formulas, a solution to solve the survival factor and decay factor is proposed and the error come from the useage of theoretical calculation formula is avoided. (authors)

Seasonal and spatial variations in Rn-222 and Rn-220 in soil gas, and implications for indoor radon levels

International Nuclear Information System (INIS)

Sharman, G.

1992-01-01

Rn-222 enters dwellings as a component of soil gas drawn from the soil by mass flow driven by the pressure difference between the house and soil beneath. In a site on Northampton Sand Ironstone (Aalenian), a preferred path of emanation (hotspot) was found. A difference of 63 Bq L -1 Rn-222 was recorded in July between this point and another 3 m away. Rn-222 in this hotspot shows 12% less variation annually than the surrounding rock. During winter, Rn-222 values within 1.6 m of the house were 44% lower than those at more than 4 m away. Rn-222 showed a 99.5% negative correlation with wind run, showing that on this soil wind pressure can significantly reduce radon in the soil at 500 mm depth. Rn-220 in soil gas correlated positively at the 99.5% level with grass and air temperatures. Rn-220 was not associated with the hotspot. (Author)

Radon exhalation from granitic rocks

Energy Technology Data Exchange (ETDEWEB)

Del Claro, Flávia; Paschuk, Sergei A.; Corrêa, Janine N.; Mazer, Wellington; Narloch, Danielle Cristine; Martin, Aline Cristina [Universidade Tecnológica Federal do Paraná (UTFPR), Curitiba, PR (Brazil); Denyak, Valeriy, E-mail: flaviadelclaro@gmail.com, E-mail: spaschuk@gmail.com, E-mail: janine_nicolosi@hotmail.com, E-mail: denyak@gmail.com [Instituto de Pesquisa Pelé Pequeno Príncipe (IPPP), Curitiba, PR (Brazil)

2017-07-01

Naturally occurring radionuclides such as radon ({sup 222}Rn), its decay products and other elements from the radioactive series of uranium ({sup 238}U and {sup 235}U) and thorium ({sup 232}Th) are an important source of human exposure to natural radioactivity. The worldwide evaluation of health radiobiological effects and risks from population exposure to natural radionuclides is a growing concern. About 50% of personal radiation annual dose is related to radionuclides such as radon ({sup 222}Rn), thoron ({sup 220}Rn), radium ({sup 226}Ra), thorium ({sup 232}Th) and potassium ({sup 40}K), which are present in modern materials commonly used in construction of dwellings and buildings. The radioactivity of marbles and granites is of big concern since under certain conditions the radioactivity levels of these materials can be hazardous to the population and require the implementation of mitigation procedures. Present survey of the {sup 222}Rn and {sup 220}Rn activity concentration liberated in the air was performed using commercialized Brazilian granite rocks at national market as well as exported to other countries. The {sup 222}Rn and {sup 220}Rn measurements were performed using the AlphaGUARD instant monitor and RAD7 detector, respectively. This study was performed at the Applied Nuclear Physics Laboratory of the Federal University of Technology – Paraná (UTFPR). Obtained results of radon concentration activity in air exhaled studied samples of granites varied from 3±1 Bq/m{sup 3} to 2087±19 Bq/m{sup 3}, which shows that some samples of granitic rocks represent rather elevated health risk the population. (author)

The correlation between exhalation from rocks and indoor concentration of 222Rn in the Sydney area

International Nuclear Information System (INIS)

MCKenzie, D.R.; Lenzen, M.; Solomon, S.B.

2001-01-01

The results of a survey of indoor 222 Rn concentrations of 350 dwellings in the Sydney area are combined with measurements of 222 Rn exhalation rates of principal rock types in the survey area. A linear regression is predicted which yields a positive regression coefficient of b=2.4±0.3, a constant of a=3.4±0.5, and a correlation coefficient of R 2 =0.15. This correlation was found to be highly significant by using three different statistical tests. The ratio of the indoor 222 Rn concentrations in dwellings built on the two dominant rock types, the Wianamatta Shale and the Hawkesbury Sandstone, was found to be about 1.6. Copyright (2001) Australasian Radiation Protection Society Inc

Development of a PIN diode based on-line measurement system for Radon (222Rn) and Thoron (220Rn) in environment

International Nuclear Information System (INIS)

Ashokkumar, P.; Chaudhury, Probal; Sumesh, C.G.; Sahoo, B.K.; Gaware, J.J.; Mayya, Y.S.

2014-01-01

Radon, thoron and their progenies are universally present in outdoor air, and can reach higher levels in indoor air due to poor ventilation. Several instruments have been developed for accurate measurement of radon and thoron in the environment. Semiconductor detector based system employing spectroscopic method has been proved to be the best among them. A PIN diode based electrostatic collection type online real-time instrument has been developed in Bhabha Atomic Research Centre for simultaneous measurement of radon and thoron in an environment while both 222 Rn and 220 Rn are present. This system can be used for determination of radon and thoron concentrations at residence or workplace. Furthermore, since the 222 Rn and 220 Rn are differentiated from each other through spectroscopy, this monitor can be used even in a mixed radon/thoron environment

Exhalation velocity of radon-222 of Dutch building materials and the influence of paint systems

International Nuclear Information System (INIS)

Dijk, W. van; Jong, P. de

1989-02-01

In order to achieve a better insight concerning the source terms of radon in the Dutch dwelling in the framework of the RENA-programme an investigation has been performed into the exhalation velocity of radon-222 from building materials. From this investigation it turned out that the ventilation factor does not have any influence upon the exhalation velocity, neither an influence of alteration of air pressure could be demonstrated. The influence of air humidity upon the exhalation velocity showed a twofold picture; for gypsum a linear increase of the exhalation velocity with vapour pressure was found, while for concrete a linear decrease with vapour pressure was observed. Further it has been investigated in how far paint systems diminish the exhalation velocity of the Rn-222 from gypsum and concrete. Acryl paints, mostly used in the Dutch dwelling, did not show a decrease of the exhalation velocity and structure paints did even cause an increase of the exhalation velocity. Other types of paint based on chlorous rubber, epoxy resins and poly-urethane, in contrast, showed a clear reduction. From these those based on poly-urethane showed the largest reduction (60-75%) at a double sided treatment of the wall. With the help of a mathematical modelling of the exhalation estimations have been made of the exhalation velocity of Rn-222 at single sided treatment of a wall and for the exhalation velocity of Rn-220. For the fore mentioned poly-urethane-paints this yelds, at an estimate, a reduction of respectively 90-95% and 100%. (author). 40 refs.; 15 figs.; 8 tabs

Exhalation of radon and thoron from phosphogypsum uses as building material

International Nuclear Information System (INIS)

Vanmarcke, H.

1996-01-01

The radioactive properties of two types of phosphogypsum, were determined. Gypsum plates with different thickness were produced. The 226 Ra and 232 Th concentrations were measured by means of high resolution gamma spectrometry. The results are for type 1 226 Ra: 75 Bq/kg and 232 Th 230 Bq/kg and for type 2 226 Ra: 155 Bq/kg and 232 Th: 160 Bq/kg. The radon ( 222 Rn) exhalation rate was evaluated by closing the plates in airtight barrels and measuring the radon concentration. The exhalation rate of type 1 is 1.2 10-5 Bq/(kg s) and type 2 4.7 10-5 Bq/(kg s). In combination with the 226 Ra concentration an emanating fraction of respectively 7.6% and 14% is obtained. The 222 Rn (thoron) exhalation of the plates was determined by measuring the concentration of the decay products in a chamber of 1 m 3 with normal aerosol concentrations. The exhalation rate was found to be independent of the thickness of the plates, as expected from the short half-life of 220 Rn. Covering the entire surface of the plates with two layers of a common Latex paint decreased the thoron exhalation by a factor of 10 to 20. The laboratory results for the radon and thoron exhalation were converted using realistic assumptions for a room. The contribution of phosphogypsum to the average radon concentration in a room is found to be about 1 Bq/m 3 for type 1 and 4 Bq/m 3 for type 2 resulting in an annual effective dose of the order of 0.1 mSv/year. The contribution to the effective dose from the thoron exhalation is much greater, namely, 1.8 mSv/year for type I and 0.9 mSv/year for type 2. Painting the gypsum lowers the thoron dose by a factor of 10 to 20 making the thoron dose comparable to that of radon. (author)

Simultaneous determination of Rn-220 and Rn-222 concentrations in atmospheres by cellulose nitrate ionographic detectors

International Nuclear Information System (INIS)

Lobao, N.

1977-01-01

A method for the indoor determination of airborne radon and radon daughters is described, based in the utilization of cellulose nitrate (CN) ionographic detectors (LR-115-Kodak-Pathe) These track-etching detectors are coupled to an air sample and to a difusion chamber respectively. In the first system ambient air is pulled through a fiber glass filter for collection of airborne radon daughters (Flow: 230 ml/min). In the second system, the cellulose nitrate detectors is coupled/min). In the second system, the cellulose nitrate detectors is coupled to a difusion chamber electrostatic precipitator arrangement. Here the CN detector will register only the alpha particles given off by the decay products of Rn-222 formed within the sensitive volume of electrostatic precipitator. The construction of calibration curves for the two systems using adequate steady-state concentrations of Rn-220 and Rn-222 in an exposure chamber (1 cubic meter), will allow the use of the system for measurement of measurement of averaged integrated radon concentrations. The CN attached to the CN attached to the air sampler is exposed in the reference atmosphere with and without a mylar filter for discrimination of alpha particles with different energies Field sampling indicated however, that efficiency of the two systems are still low for the measurement of environmental levels of Rn-220 and Rn-222 within houses of the AENR, recommendations for efficienty improvement of the system are proposed [pt

Comparison of methods and instruments for 222Rn/220Rn progeny measurement

International Nuclear Information System (INIS)

Liu Yanyang; Shang Bing; Wu Yunyun; Zhou Qingzhi

2012-01-01

In this paper, comparisons were made among three methods of measurement (grab measurement, continuous measurement and integrating measurement) and also measurement of different instruments for a radon/thoron mixed chamber. Taking the optimized five-segment method as a comparison criterion, for the equilibrium-equivalent concentration of 222 Rn, measured results of Balm and 24 h integrating detectors are 31% and 29% higher than the criterion, the results of Wl x, however, is 20% lower; and for 220 Rn progeny, the results of Fiji-142, Kf-602D, BWLM and 24 h integrating detector are 86%, 18%, 28% and 36% higher than the criterion respectively, except that of WLx, which is 5% lower. For the differences shown, further research is needed. (authors)

Prediction of 222 Rn exhalation rates from phosphogypsum based stacks. Part I: parametric mathematical modeling

International Nuclear Information System (INIS)

Rabi, Jose A.; Mohamad, Abdulmajeed A.

2004-01-01

Radon-222 is a radionuclide exhaled from phosphogypsum by-produced at phosphate fertilizer industries. Alternative large-scale application of this waste may indicate a material substitute for civil engineering provided that environmental issues concerning its disposal and management are overcome. The first part of this paper outlines a steady-state two-dimensional model for 222 Rn transport through porous media, inside which emanation (source term) and decay (sink term) exist. Boussinesq approach is evoked for the laminar buoyancy-driven interstitial air flow, which is also modeled according to Darcy-Brinkman formulation. In order to account for simultaneous effects of entailed physical parameters, governing equations are cast into dimensionless form. Apart from usual controlling parameters like Reynolds, Prandtl, Schmidt, Grashof and Darcy numbers, three unconventional dimensionless groups are put forward. Having in mind 222 Rn transport in phosphogypsum-bearing porous media, the physical meaning of those newly introduced parameters and representative values for the involved physical parameters are presented. A limiting diffusion-dominated scenario is addressed, for which an analytical solution is deduced for boundary conditions including an impermeable phosphogypsum stack base and a non-zero fixed concentration activity at the stack top. Accordingly, an expression for the average Sherwood number corresponding to the normalized 222 Rn exhalation rate is presented

Development of an integrated sampler based on direct 222Rn/220Rn progeny sensors in flow-mode for estimating unattached/attached progeny concentration

International Nuclear Information System (INIS)

Mishra, Rosaline; Sapra, B.K.; Mayya, Y.S.

2009-01-01

A flow-mode integrated sampler consisting of a wire-mesh and filter-paper array along with passive solid state nuclear track detectors has been developed for estimating unattached and attached fraction of 222 Rn/ 220 Rn progeny concentration. The essential element of this sampler is the direct 222 Rn/ 220 Rn progeny sensor (DRPS/DTPS), which is an absorber-mounted-LR115 type nuclear track detector that selectively registers the alpha particles emitted from the progeny deposited on its surface. During sampling at a specified flow-rate, the unattached progeny is captured on the wire-mesh; while the attached progeny gets transmitted and is captured on the filter-paper. The alpha particles emitted by the deposited progeny atoms are registered on the sensors placed at a specified distance facing the wire-mesh and the filter-paper, respectively. The various steps involved in the development of this flow-mode direct progeny sampler such as the optimization of the sampling rate and the distance between the sensor and the deposition substrate are discussed. The sensitivity factor of the DTPS-loaded sampler for 220 Rn progeny deposited on the wire-mesh and filter-paper is found to be 23.77 ± 0.64 (track cm -2 h -1 ) (Bq m -3 ) -1 and 22.30 ± 0.18 (track cm -2 h -1 ) (Bq m -3 ) -1 , respectively; while that of DRPS-loaded sampler for 222 Rn progeny deposition, is 3.03 ± 0.14 (track cm -2 h -1 ) (Bq m -3 ) -1 and 2.08 ± 0.07 (track cm -2 h -1 ) (Bq m -3 ) -1 , respectively. The highlight of this flow-mode sampler is its high sensitivity and that it utilizes the passive technique for estimating the unattached and attached progeny concentration, thus doing away with the alpha counting procedures.

Internal exposure from building materials exhaling (222)Rn and (220)Rn as compared to external exposure due to their natural radioactivity content.

Science.gov (United States)

Ujić, Predrag; Celiković, Igor; Kandić, Aleksandar; Vukanac, Ivana; Durasević, Mirjana; Dragosavac, Dusan; Zunić, Zora S

2010-01-01

The main scope of this paper is to point out the importance of introducing radon and thoron exhalation measurements from building materials in the regulating frame. Currently (2009), such a regulation of this kind of exposure is not explicitly included in the Serbian regulating network. To this end, this work reports concentration measurements of (226)Ra, (232)Th and (40)K and radon and thoron exhalation rates from building materials used in Serbia. Following detailed analysis, it was noticed that both internal exposures to radon and/or thoron exhaling from building materials may exceed external exposures to their precursors contained therein.

National survey on the natural radioactivity and Rn-222 exhalation rate of building materials in the Netherlands

NARCIS (Netherlands)

de Jong, P.; van Dijk, W.; van der Graaf, E.R.; de Groot, A.V.

The present study reports on results of a nationwide survey on the natural radioactivity concentrations and Rn-222 exhalation rates of the prevailing building materials in the Netherlands. In total 100 samples were taken and analyzed for the activity concentrations of Ra-226, Ra-228, Th-228, and

Radon and Thoron Exhalation Rates from Surface Soil of Bangka - Belitung Islands, Indonesia

Directory of Open Access Journals (Sweden)

Syarbaini Syarbaini

2015-03-01

Full Text Available DOI:10.17014/ijog.2.1.35-42Radon and thoron exhalation rate from soil is one of the most important factors that can influence the radioactivity level in the environment. Radon and thoron gases are produced by the decay of the radioactive elements those are radium and thorium in the soil, where its concentration depends on the soil conditions and the local geological background. In this paper, the results of radon and thoron exhalation rate measurements from surface soil of Bangka Belitung Islands at thirty six measurement sites are presented. Exhalation rates of radon and thoron were measured by using an accumulation chamber equipped with a solid-state alpha particle detector. Furthermore, the correlations between radon and thoron exhalation rates with their parent nuclide (226Ra and 232Th concentrations in collected soil samples from the same locations were also evaluated. The result of the measurement shows that mostly the distribution of radon and thoron is similar to 226Ra and 232Th, eventhough it was not a good correlation between radon and thoron exhalation rate with their parent activity concentrations (226Ra and 232Th due to the environmental factors that can influence the radon and thoron mobilities in the soil. In comparison to a world average, Bangka Belitung Islands have the 222Rn and 220Rn exhalation rates higher than the world average value for the regions with normal background radiation.

Study of Rn-222 exhalation in phosphogypsum through the adsorption technique in activated coal; Estudo da exalacao de Rn-222 em fosfogesso por meio da tecnica de adsorcao em carvao ativado

Energy Technology Data Exchange (ETDEWEB)

Nisti, Marcelo Bessa; Campos, Marcia Pires de, E-mail: mbnisti@ipen.b, E-mail: mpcampos@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

2011-10-26

The radon exhalation was estimated through the adsorption in activated carbon technique. Classified as TENORM, the radon exhalation determination on the phosphogypsum piles was performed through the adsorption ratio of radon in activated carbon, from the concentration of descendants of {sup 222}Rn, {sup 214}Pb and {sup 214}Bi obtained by gamma spectrometry. The results obtained in this work were compatibles with the values found in the literature

Method for incorporation monitoring - Studies on measurement and interpretation of radionuclide excretion, particularly thorium decay products, via exhaled breath

International Nuclear Information System (INIS)

Anon

1998-01-01

The development and application of a measuring method is described for thorium incorporation monitoring by way of measuring Rn-220 (thoron) in exhaled breath. The method is intended for application to monitoring the incorporation of thorium by occupationally exposed persons in compliance with the regulatory guide on health physics monitoring for determination of whole-body dose. (orig./CB) [de

Use of Activated Charcoal for 220Rn Adsorption for Operations Associated with the Uranium Deposit in the Auxiliary Charcoal Bed at the Molten Salt Reactor Experiment Facility

International Nuclear Information System (INIS)

Coleman, R.L.

1999-01-01

Measurements have been collected with the purpose of evaluating the effectiveness of activated charcoal for the removal of 220 Rn from process off-gas at the Molten Salt Reactor Experiment (MSRE) at Oak Ridge National Laboratory. A series of bench-scale tests were performed at superficial flow velocities of 10, 18, 24, and 33 cm/s (20, 35, 47, and 65 ft/min) with a continuous input concentration of 220 Rn in the range of 9 x 10 3 pCi/L. In addition, two tests were performed at the MSRE facility by flowing helium through the auxiliary charcoal bed uranium deposit. These tests were performed so that the adsorptive effectiveness could be evaluated with a relatively high concentration of 220 Rn. In addition to measuring the effectiveness of activated charcoal as a 220 Rn adsorption media, the source term for available 220 Rn in the deposit is actually available for removal and that the relative activity of fission gases is very small when compared to 220 Rn. The measurement data were then used to evaluate the expected effectiveness of a proposed charcoal adsorption bed consisting of a right circular cylinder having a diameter of 43 cm and a length of 91 cm (17 in. I.D. x 3 ft.). The majority of the measurement data predicts an overall 220Rn activity reduction factor of about 1 x 10 9 for such a design; however, two measurements collected at a flow velocity of 18 cm/s (35 ft/min) indicated that the reduction factor could be as low as 1 x 10 6 . The adsorptive capacity of the proposed trap was also evaluated to determine the expected life prior to degradation of performance. Taking a conservative vantage point during analysis, it was estimated that the adsorption effectiveness should not begin to deteriorate until a 220 Rn activity on the order of 10 10 Ci has been processed. It was therefore concluded that degradation of performance would likely occur as the result of causes other than filling by radon progeny

Natural 222Rn and 220Rn indicate the impact of the Water–Sediment Regulation Scheme (WSRS) on submarine groundwater discharge in the Yellow River estuary, China

International Nuclear Information System (INIS)

Xu, Bochao; Xia, Dong; Burnett, William C.; Dimova, Natasha T.; Wang, Houjie; Zhang, Longjun; Gao, Maosheng; Jiang, Xueyan; Yu, Zhigang

2014-01-01

Highlights: • 220 Rn and 222 Rn were combined to locate intensive SGD sites. • Influence of WSRS to SGD was found for the first time. • SGD was a dominant nutrient pathway in the Yellow River estuary. - Abstract: Submarine groundwater discharge (SGD) in estuaries brings important influences to coastal ecosystems. In this study, we observed significant SGD in the Yellow River estuary, including a fresh component, during the Water–Sediment Regulation Scheme (WSRS) period. We used the 222 Rn and 220 Rn isotope pair to locate sites of significant SGD within the study area. Three apparent SGD locations were found during a non-WSRS period, one of which became much more pronounced, according to the remarkably elevated radon levels, during the WSRS. Increased river discharge (from 245 m 3 s −1 to 3560 m 3 s −1 ) and the elevated river water level (from 11 m to 13 m) during the WSRS led to a higher hydraulic head, enhancing groundwater discharge in the estuary. Our results suggest that high river discharge (>3000 m 3 s −1 ) might be necessary for elevated fresh submarine groundwater discharging (FSGD). Vertical profiles of salinity, DO and turbidity anomalies along the benthic boundary layer also indicated significant FSGD in the estuary during the WSRS. Nutrient concentrations had positive correlations with 222 Rn during a 24-h observation, which indicates that SGD is a dominant nutrient pathway in this area

222Rn and 220Rn concentrations measured in various natural honey samples by using nuclear track detectors and resulting radiation doses to the members of the rural populations in Morocco

International Nuclear Information System (INIS)

Misdaq, M. A.; Mortassim, A.

2008-01-01

Radon ( 222 Rn) and thoron ( 220 Rn) concentrations were measured in sixteen natural honey material samples collected from different regions in Morocco by using CR-39 and LR-115 type II solid state nuclear track detectors (SSNTDs). The concentrations of these radionuclides were also measured in nectar solutions corresponding to the studied honey samples. The measured concentrations of 222 Rn and 220 Rn in honey samples ranged from (2.3 ± 0.2) to (8.1 ± 0.6) Bq.l -1 and (1.8 ± 0.1) to (3.9 ± 0.3) Bq.l -1 , respectively. Committed equivalent doses due to annual intakes of 222 Rn were evaluated in the human gastrointestinal tract compartments of adult members of the Moroccan populations from the ingestion of studied honey samples. The influence of the target tissue mass and activities due to 222 Rn on the annual committed equivalent doses in the compartments of the human gastrointestinal tract was investigated. (authors)

Extensive radioactive characterization of a phosphogypsum stack in SW Spain: {sup 226}Ra, {sup 238}U, {sup 210}Po concentrations and {sup 222}Rn exhalation rate

Energy Technology Data Exchange (ETDEWEB)

Abril, Jose-Maria, E-mail: jmabril@us.es [Dpto. Fisica Aplicada I, Universidad de Sevilla, EUITA, Ctra Utrera Km 1, 41013 Seville (Spain); Garcia-Tenorio, Rafael, E-mail: gtenorio@us.es [Dpto. Fisica Aplicada II, Universidad de Sevilla, ETSA, Avda. Reina Mercedes s/n, 41012 Seville (Spain); Manjon, Guillermo, E-mail: manjon@us.es [Dpto. Fisica Aplicada II, Universidad de Sevilla, ETSA, Avda. Reina Mercedes s/n, 41012 Seville (Spain)

2009-05-30

Phosphogypsum (PG) is a by-product of the phosphate fertilizer industries that contains relatively high concentrations of uranium series radionuclides. The US-EPA regulates the agriculture use of PG, attending to its {sup 226}Ra content and to the {sup 222}Rn exhalation rate from inactive stacks. Measurements of {sup 222}Rn exhalation rates in PG stacks typically show a large and still poorly understood spatial and temporal variability, and the published data are scarce. This work studies an inactive PG stack in SW Spain of about 0.5 km{sup 2} from where PG can be extracted for agriculture uses, and an agriculture soil 75 km apart, being representative of the farms to be amended with PG. Activity concentrations of {sup 226}Ra, {sup 238}U and {sup 210}Po have been measured in 30 PG samples (0-90 cm horizon) allowing for the construction of maps with spatial distributions in the PG stack and for the characterization of the associated PG inputs to agriculture soils. Averaged {sup 226}Ra concentrations for the stack were 730 {+-} 60 Bq kg{sup -1} (d.w.), over the US-EPA limit of 370 Bq kg{sup -1}. {sup 222}Rn exhalation rate has been measured by the charcoal canister method in 49 sampling points with 3 canisters per sampling point. Values in PG stack were under the US-EPA limit of 2600 Bq m{sup -2} h{sup -1}, but they were one order of magnitude higher than those found in the agriculture soil. Variability in radon emissions has been studied at different spatial scales. Radon exhalation rates were correlated with {sup 226}Ra concentrations and daily potential evapotranspiration (ETo). They increased with ETo in agriculture soils, but showed an opposite behaviour in the PG stack.

Design of real-time monitoring and control system of 222Rn/220Rn sampling for radon chamber

International Nuclear Information System (INIS)

Wu Rongyan; Zhao Xiuliang; Zhang Meiqin; Yu Hong

2008-01-01

This paper describes the design of 222 Rn/ 220 Rn sampling monitoring and control system based on single-chip microcomputer of series Intel51. The hardware design involves the choosing and usage of sensors-chips, A/D conversion-chip, USB interface-chip, keyboard-chip, digital display-chip, photoelectric coupling isolation-chips and drive circuit-chips of the direct current pump. Software design is composed by software of Personal Computer (PC) and software of Single Chip Microcomputer (SCM). The data acquisition and conversion and the flux control of direct current pump are realized by using soft of Visual Basic and assemble language. The program flow charts are given. Furthermore, we improved the stability of the direct current pump by means of PID Control Algorithms. (authors)

National survey on the natural radioactivity and 222Rn exhalation rate of building materials in The Netherlands.

Science.gov (United States)

de Jong, P; van Dijk, W; van der Graaf, E R; de Groot, T J H

2006-09-01

The present study reports on results of a nation-wide survey on the natural radioactivity concentrations and Rn exhalation rates of the prevailing building materials in the Netherlands. In total 100 samples were taken and analyzed for the activity concentrations of Ra, Ra, Th, and K and for their Rn exhalation rate. The sampled materials consisted of gypsum products, aerated concrete, sand-lime and clay bricks, mortars and concrete, representing about 95% of the stony building materials used in the construction of Dutch homes. The laboratory analyses were performed according to two well-documented standard procedures, the interlaboratory reproducibility of which is found to be within 5% on average. The highest radionuclide concentrations were found in a porous inner wall brick to which fly ash was added. The second highest were clay bricks with average Ra and Ra levels around 40 Bq kg. Concrete and mortar show the highest exhalation rates with a fairly broad range of 1 to 13 microBq (kg s). Low natural radioactivity levels are associated with either natural gypsum (products) or gypsum from flue gas desulphurization units, and low exhalation rates with clay bricks. To evaluate the radiological impact the radioactivity concentrations in each sample were combined into a so-called dose factor, representing the absorbed dose rate in a room with a floor, walls and ceiling of 20 cm of the material in question. For that purpose, calculations with the computer codes MCNP, Marmer and MicroShield on the specific absorbed dose rates were incorporated in the paper. The results of these codes corresponded within 6% and average values were calculated at 0.90, 1.10, and 0.080 nGy h per Bq kg for the U series, the Th series, and K, respectively. Model calculations on the external dose rate, based on the incidence of the various building materials in 1,336 living rooms, are in accordance with measured data.

GUM approach to uncertainty estimations for online 220Rn concentration measurements using Lucas scintillation cell

International Nuclear Information System (INIS)

Sathyabama, N.

2014-01-01

It is now widely recognized that, when all of the known or suspected components of errors have been evaluated and corrected, there still remains an uncertainty, that is, a doubt about how well the result of the measurement represents the value of the quantity being measured. Evaluation of measurement data - Guide to the expression of Uncertainty in Measurement (GUM) is a guidance document, the purpose of which is to promote full information on how uncertainty statements are arrived at and to provide a basis for the international comparison of measurement results. In this paper, uncertainty estimations following GUM guidelines have been made for the measured values of online thoron concentrations using Lucas scintillation cell to prove that the correction for disequilibrium between 220 Rn and 216 Po is significant in online 220 Rn measurements

Prediction of 222 Rn exhalation rates from phosphogypsum based stacks. Part II: preliminary numerical results

International Nuclear Information System (INIS)

Rabi, Jose A.; Mohamad, Abdulmajeed A.

2004-01-01

The first part of this paper proposes a steady-state 2-D model for 222 Rn transport in phosphogypsum stacks. In this second part, the dimensionless model equations are solved numerically with the help of an existing finite-volume simulator that has been successfully used to solve heat and mass transfer problems in porous media. As a test case, a rectangular shaped stack is considered in order to verify the ability of the proposed parametric approach to account for concurrent effects on the 222 Rn exhalation into the local atmosphere. Air flow is supposed to be strictly buoyancy driven and the ground is assumed to be impermeable to 222 Rn and at a higher temperature under the stack base. Dimensionless controlling parameters are set to representative values and results are presented for Grashof number in the range 10 6 ≤Gr≤ 10 8 , corresponding to very small to small temperature differences between incoming air and ground underneath the stack base. For the particular set of parameters and inasmuch as Gr increases, streamlines presented basically the same pattern while internal isotherms and iso concentration lines remained almost unchanged. Total average Sherwood number proved to be rather insensitive to Gr while total average Nusselt increased slightly with Gr. (author)

Design and operation of an automated beta-particle counting system for the measurement of 220Rn (and 222Rn) progeny

International Nuclear Information System (INIS)

Bigu, J.

1992-01-01

A fully automated system of the continuous (active) type has been designed for the unattended quantification of 222 Rn progeny and 220 Rn progeny in calibration and test facilities, as well as working and living environments. The system uses a β-particle detector and associated electronic circuitry, in conjunction with an in-house microprocessor-based processing interface card and a personal computer, operated by specially developed in-house software. The system represents a significant improvement over systems using α-particle detectors because of its enhanced flexibility of design and virtual elimination of plate-out effects in the sampling head, and of self-absorption phenomena in the sampling filter. The β-particle system was tested and calibrated in a Radon and Thoron Test Facility of the walk-in type under a variety of experimental conditions. (author)

Radon exhalations of rock samples from the Muellenbach uranium test mine

International Nuclear Information System (INIS)

Keller, G.; Dudler, R.

1985-01-01

Radiation exposure of workers in underground mines with high U/Ra concentration is mostly due to inhalation of the short-lived radioactive decay products of the noble gas radon. Knowledge of the Rn-222 exhalation rates of walls and rocks as well as the contributing influencing parameters is therefore of interest for radiation protection purposes. Measurements showed that in the hours following shortfiring operations, the fresh dirt and the new walls had several times the exhalation rates of older dirt and walls. Measurements of exhalation rates on drill cores can help to assess exhalation for an adequate layout of the mine ventilation system. (orig./PW) [de

Exhalation of Rn-222 from soil: some aspects of variations

International Nuclear Information System (INIS)

Raghavayya, M.; Khan, A.H.; Padmanabhan, N.; Srivastava, G.K.

1982-01-01

The exhalation of radon from soil and uranium mill tailings piles is discussed. This process is a complex phenomenon. The exhalation rate depends on such variables as radium content, moisture content and porosity of soil, variation of atmospheric pressure, humidity, temperature, wind speed, etc. In an attempt to eliminate variations introduced by geographical location the exhalation rate is estimated at a fixed location. Measurements were carried out almost daily over a one year period. Exhalation rate has shown a wide variation, from almost zero to plus 900 pCi/m 2 .min. Measurements are still being continued. It was seen that exhalation rate fell drastically soon after a heavy shower when the ground was soaking wet. Emanation was found to increase as the ground began to dry and fall again when the ground was bone dry. Radon exhalation rates were also measured at different locations on a uranium tailings pile. Here also wide variation was observed

Uranium distribution and radon exhalation from Brazilian dimension stones

International Nuclear Information System (INIS)

Amaral, P.G.Q.; Galembeck, T.M.B.; Bonotto, D.M.; Artur, A.C.

2012-01-01

This paper provides evaluations of the radiometric behavior and exhalation patterns of radon gas in decorative and dimension stones explored in the Brazilian states of Minas Gerais and Espírito Santo, given the importance of determining radon gas concentrations in human-inhabited environments. A total of 10 silicate rock types were studied, featuring different petrographic/petrophysical characteristics given by seven magmatic rocks (three of which are granitic pegmatites) and three metamorphic rocks. The study, comprising radiometric data of U and monitoring of 222 Rn gas exhalation, shows a strong correlation between petrographic parameters and the physical properties of rocks. U levels ranged between 2.9 and 37 ppm, revealing a good coherence between the presence and the absence of radioactive element-bearing accessory minerals for each rock type. The rate of radon exhalation from the stones is related to the petrographic/petrophysical features of each material. By comparing the 222 Rn level generated by a rock to the amount effectively emanated by it, the rate of emanated gas proves to be insignificant; also, a rock that produces more Rn will not always emanate more. Simulations performed to estimate the radon levels inside residences or any given indoor environment showed that nine samples attained values below the 4 pCi/L EPA limit, whereas one was above that limit. - Highlights: ► Integration of distinct radiometric data acquired in dimension stones. ► Dimension stones are extensively commercialized abroad. ► Rn exhalation above the EPA threshold limit of 4 pCi/L.

Uranium distribution and radon exhalation from Brazilian dimension stones

Energy Technology Data Exchange (ETDEWEB)

Amaral, P.G.Q.; Galembeck, T.M.B. [Departamento de Petrologia e Metalogenia, Instituto de Geociencias e Ciencias Exatas, Universidade Estadual Paulista (UNESP), Av. 24-A No. 1515, C.P. 178, CEP 13506-900, Rio Claro, Sao Paulo (Brazil); Bonotto, D.M., E-mail: danielbonotto@yahoo.com.br [Departamento de Petrologia e Metalogenia, Instituto de Geociencias e Ciencias Exatas, Universidade Estadual Paulista (UNESP), Av. 24-A No. 1515, C.P. 178, CEP 13506-900, Rio Claro, Sao Paulo (Brazil); Artur, A.C. [Departamento de Petrologia e Metalogenia, Instituto de Geociencias e Ciencias Exatas, Universidade Estadual Paulista (UNESP), Av. 24-A No. 1515, C.P. 178, CEP 13506-900, Rio Claro, Sao Paulo (Brazil)

2012-04-15

This paper provides evaluations of the radiometric behavior and exhalation patterns of radon gas in decorative and dimension stones explored in the Brazilian states of Minas Gerais and Espirito Santo, given the importance of determining radon gas concentrations in human-inhabited environments. A total of 10 silicate rock types were studied, featuring different petrographic/petrophysical characteristics given by seven magmatic rocks (three of which are granitic pegmatites) and three metamorphic rocks. The study, comprising radiometric data of U and monitoring of {sup 222}Rn gas exhalation, shows a strong correlation between petrographic parameters and the physical properties of rocks. U levels ranged between 2.9 and 37 ppm, revealing a good coherence between the presence and the absence of radioactive element-bearing accessory minerals for each rock type. The rate of radon exhalation from the stones is related to the petrographic/petrophysical features of each material. By comparing the {sup 222}Rn level generated by a rock to the amount effectively emanated by it, the rate of emanated gas proves to be insignificant; also, a rock that produces more Rn will not always emanate more. Simulations performed to estimate the radon levels inside residences or any given indoor environment showed that nine samples attained values below the 4 pCi/L EPA limit, whereas one was above that limit. - Highlights: Black-Right-Pointing-Pointer Integration of distinct radiometric data acquired in dimension stones. Black-Right-Pointing-Pointer Dimension stones are extensively commercialized abroad. Black-Right-Pointing-Pointer Rn exhalation above the EPA threshold limit of 4 pCi/L.

Natural radioactivity and radon exhalation rates in man-made tiles used as building materials in Japan.

Science.gov (United States)

Iwaoka, K; Hosoda, M; Suwankot, N; Omori, Y; Ishikawa, T; Yonehara, H; Tokonami, S

2015-11-01

Man-made tiles frequently used in Japan were collected, and activity concentrations and radon ((222)Rn) exhalation rates in these tiles were measured. Dose estimations for inhabitants living in houses built using these tiles were also carried out. The activity concentrations of (226)Ra, (228)Ra and (40)K in the man-made tiles were 31-170, 35-110 and 260-980 Bq kg(-1), respectively. The (222)Rn exhalation rates in the tiles were 8.8-21 μBq m(-2) s(-1). The ranges of experimental activity concentrations and (222)Rn exhalation rates were almost identical to those of natural rocks used as typical building materials in Japan. The maximum value of effective dose to inhabitants living in houses built with the man-made tiles was 0.14 mSv y(-1), which is lower than the reference level range (1-20 mSv y(-1)) for abnormally high levels of natural background radiation published in the ICRP Publication 103. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Long-term temporal variability of the radon-222 exhalation flux from a landform covered by low uranium grade waste rock

International Nuclear Information System (INIS)

Bollhöfer, Andreas; Doering, Che

2016-01-01

Radon-222 exhalation flux densities from two different substrates of several metres thickness, waste rock and waste rock mixed with approximately 30% lateritic material, were measured over a period of five years in the wet-dry tropics of Northern Australia. Fourteen measurement campaigns using activated charcoal canisters (n > 1000) covered both dry and wet seasons and showed differences in seasonal and long term trends of the "2"2"2Rn exhalation flux densities normalised to the "2"2"6Ra activity concentrations of the substrate. Dry season "2"2"2Rn exhalation was generally higher for the mixed substrate, due to the larger fraction of fines. Seasonality established within the first year of landform construction on the mixed substrate, due to the higher water holding capacity of the lateritic material. In contrast, waste rock only shows no seasonality until years four and five after construction, when average normalised dry season "2"2"2Rn exhalation flux densities from waste rock increase to values (0.47 ± 0.06 mBq m"−"2 s"−"1 per Bq kg"−"1) similar to the mixed substrate (0.64 ± 0.08 mBq m"−"2 s"−"1 per Bq kg"−"1), likely due to an increase in fines from rapid weathering of the schistose waste rock. Volumetric water content has been used to parametrize relative "2"2"2Rn exhalation and we determined that wet season "2"2"2Rn exhalation is about 40% of the dry season exhalation. - Highlights: • We determined "2"2"2Rn exhalation flux densities normalised to "2"2"6Ra activity concentrations (R_E_-_R) for two substrates. • R_E_-_R was lower for waste rock only compared to waste rock blended with 30% fine grained lateritic material. • Seasonality in waste rock "2"2"2Rn exhalation flux densities established 4 years after construction. • Wet season R_E_-_R was about 40% of the dry season R_E_-_R.

Measurements of octupole collectivity in $^{220,222}$Rn and $^{222,224}$Ra using Coulomb excitation

CERN Multimedia

Kruecken, R; Larsen, A; Hurst, A M; Voulot, D; Grahn, T; Clement, E; Wadsworth, R; Gernhaeuser, R A; Siem, S; Huyse, M L; Iwanicki, J S

2008-01-01

We propose to exploit the unique capability of ISOLDE to provide post-accelerated $^{220,222}$Rn and $^{222,224}$Ra ion beams from the REX facility to enable the Coulomb excitation of the first 3$^{-}$ states in these nuclei. By measuring the $\\gamma$-ray yields of the E1 decays from the 3$^{-}$ state using the MINIBALL array we can obtain the transition matrix elements. This will give quantitative information about octupole correlations in these nuclei. We require 22 shifts to fulfil the aims of the experiment.

Monte Carlo simulation of semiconductor detector response to "2"2"2Rn and "2"2"0Rn environments

International Nuclear Information System (INIS)

Irlinger, J.; Trinkl, S.; Wielunksi, M.; Tschiersch, J.; Rühm, W.

2016-01-01

A new electronic radon/thoron monitor employing semiconductor detectors based on a passive diffusion chamber design has been recently developed at the Helmholtz Zentrum München (HMGU). This device allows for acquisition of alpha particle energy spectra, in order to distinguish alpha particles originating from radon and radon progeny decays, as well as those originating from thoron and its progeny decays. A Monte-Carlo application is described which uses the Geant4 toolkit to simulate these alpha particle spectra. Reasonable agreement between measured and simulated spectra were obtained for both "2"2"0Rn and "2"2"2Rn, in the energy range between 1 and 10 MeV. Measured calibration factors could be reproduced by the simulation, given the uncertainties involved in the measurement and simulation. The simulated alpha particle spectra can now be used to interpret spectra measured in mixed radon/thoron atmospheres. The results agreed well with measurements performed in both radon and thoron gas environments. It is concluded that the developed simulation allows for an accurate prediction of calibration factors and alpha particle energy spectra. - Highlights: • A method was developed to simulate alpha particle spectra from radon/thoron decay. • New monitor features alpha-particle-spectroscopy based on silicon detectors. • A method is presented to quantify radon/thoron concentrations in mixed atmospheres. • The calibration factor can be simulated for various environmental parameters.

Dependence of indoor 222Rn level on building materials

International Nuclear Information System (INIS)

Tso, M.W.; Ng, C.; Leung, J.K.C.

1993-01-01

The radionuclide contents of typical building materials used in Hong Kong were studied by γ spectroscopic analysis. The physical properties of these building materials affecting the production and transportation of 222 Rn to the surrounding air were examined; these include the emanation coefficient of 2 '2 2 Rn of the material, the diffusion coefficient of 222 Rn in the material and the effect of surface coating and temperature on the rate of 222 Rn exhalation. Results obtained in this study explain the indoor 222 Rn concentration observed in our previous surveys and also suggest that the main source of indoor 222 Rn in Hong Kong is building material. (3 figs., 4 tabs.)

Study of radon exhalation from phosphogypsum plates and blocks from different origins

International Nuclear Information System (INIS)

Costa, Lucas Jose Pereira da

2011-01-01

Phosphogypsum is a waste of the fertilizer industry that concentrates radionuclides. In this work, the 222 Rn exhalation rate from phosphogypsum plates and blocks from different origins used at dwellings construction was studied. The 222 Rn exhalation rate was determined through the accumulation chamber technique with solid state nuclear track detectors (SSNTD). The effective dose for an individual living in a residence built with phosphogypsum based materials was evaluated. It also was calculated the 222 Rn exhalation rate through the UNSCEAR model, from the 226 Ra concentration in the materials, in order to compare the experimental results. It was evaluated the contribution of building component (paint) to the reduction of 222 Rn exhalation rate. The plates and blocks were manufactured with phosphogypsum from Bunge Fertilizantes, Ultrafertil and Fosfertil. Blocks manufactured with ordinary gypsum was also evaluated. The average results obtained were 0.19 ± 0.06 Bq m-2 h-1, 1.3 ± 0.3 Bq m -2 h -1 and 0.41 ± 0.07 Bq m -2 h -1 for plates manufactured with phosphogypsum from Bunge Fertilizer, Ultrafertil and Fosfertil, respectively. For the phosphogypsum blocks the values were 0.11 ± 0.01 Bq m -2 h-1, 1.2 ± 0.6 Bq m -2 h -1 , 0.47 ± 0.15 Bq m -2 h -1 , for Bunge, Ultrafertil and Fosfertil. The blocks manufactured with ordinary gypsum presented average value of 0.18 ± 0.08 Bq m -2 h'- 1 . All phosphogypsum plates and blocks evaluated in this study presented effective dose for radon inhalation lower than the recommended value of 1mSv y -1 , the annual effective dose limit for public exposure by International Commission on Radiological Protection. (author)

The influence of the nature of soil and plant and pollution on the 238U, 232Th, 222Rn and 220Rn concentrations in various natural honey samples using nuclear track detectors: impact on the adult consumers

International Nuclear Information System (INIS)

Misdaq, M.A.; Mortassim, A.

2009-01-01

238 U and 232 Th concentrations as well as 222 Rn and 220 Rn α-activities per unit volume were measured in various natural honey samples collected from different regions in Morocco using CR-39 and LR-115 type II solid state nuclear track detectors (SSNTDs). These radionuclides were also measured in soils, plant flowers and nectar solutions corresponding to the honey samples studied. In addition, these radionuclides were measured in different imported honey samples. The measured 238 U, 232 Th, 222 Rn and 220 Rn concentrations ranged from (1.5 ± 0.1) mBq kg -1 to (10.6 ± 0.6) mBq kg -1 , (1.1 ± 0.1) mBq kg -1 to (4.2 ± 0.2) mBq kg -1 , (1.5 ± 0.1) Bq kg -1 to (10.6 ± 0.6) Bq kg -1 and (1.1 ± 0.1) Bq kg -1 to (4.2 ± 0.2) Bq kg -1 for the honey samples studied, respectively. Annual 238 U, 232 Th and 222 Rn intakes by Moroccan adults from the consumption of honey were assessed. The influence of the nature of soil and plant on the 238 U and 232 Th contents of the studied honey samples was investigated. These measurements were completed by an investigation of the 238 U and 232 Th transfer between soils and plant flowers and that between plant flowers and honey, and also by the investigation of the influence of pollution due to different material dusts on 238 U, 232 Th and 222 Rn in the honey samples studied. Committed equivalent doses due to the annual intake of 238 U, 232 Th and 222 Rn were evaluated in the organs of adult members of the Moroccan rural population from the ingestion of the honey samples. The maximum total committed effective dose due to 238 U, 232 Th and 222 Rn from the ingestion of natural honey by the Moroccan rural population was found to be equal to 0.64 μSνy -1 . (author)

Variation in radon exhalation from the ground on the active fault in Kobe

Energy Technology Data Exchange (ETDEWEB)

Yasuoka, Y.; Shinogi, M. [Kobe Pharmaceutical Univ., Kobe, Hyogo (Japan)

1998-12-31

Since 27 January 1997, the measurements of radon (Rn-222) exhaled from the ground have been made continuously by the use of PICO-RAD detector (Packard instrument Co.) at monitoring stations on Ashiya active fault. The fault may have been slipped by the Kobe earthquake (magnitude 7.2, 17 January 1995). The variation of relative radon exhalation on the fault was large. We guessed the large variation of relative radon exhalation on the fault was caused by not only the influence of meteorology but also the influence of other factors. (author)

Studies on radon exhalation rate from building materials of Mysuru district, Karnataka

International Nuclear Information System (INIS)

Chandini, M.; Lavanya, B.S.K.; Chandrashekara, M.S.; Pruthvi Rani, K.S.

2017-01-01

In the present study, mass exhalation rate of 222 Rn from soil and building materials was studied using scintillation based Smart Radon Monitor (SRM) and also using Solid State Nuclear Track Detectors (SSNTD) employing Can Technique, following standard procedure. Mass exhalation rate of 222 Rn from various building material samples such as brick, sand, cement, concrete and from different types of flooring materials was determined. The results obtained from these methods were compared and analysed. The samples of construction materials were collected from various locations of Mysuru city. The city has an area of about 128 sq km with population of about 1 million. Mining industries of magnetite, dunite and lime stone are located around Mysuru city. In addition to this, quarrying and crushing of granite stones for building activities also exist nearby

The measurement of thoron (220Rn) concentration in indoor air continuously using pylon model WLx

International Nuclear Information System (INIS)

Hasnel Sofyan

2011-01-01

The concentration of thoron ( 220 Rn) in particular location can be higher than radon ( 220 Rn), however, its presence is always neglected. This might be due to the difficulties in calibration and discrimination between radon and thoron. From biokinetic and dosimetric model, it has been known that the dominant contribution of thoron to the effective dose is in the lungs. UNSCEAR estimates the doses contribution of thoron and its progenies is between 5-10% of the annual dose received by the general public and the risk level is 4.4 times greater than radon and progenies. Therefore, it is necessary to study the thoron concentration in indoor air and workplaces. Radon-thoron concentration in indoor air can be determined by direct methods using Pylon Model WLx device and passive methods using Solid State Nuclear Track Detector (SSNTDs). In this research the measurement of thoron was carried out continuously using Pylon Model WLx equipment that is sensitive to radon for 24, 65, 72, 116 and 154 hours in different rooms. The measurement result showed that the mean value of thoron working level (WL) concentration obtained in room-1 was 2.53 ± 0.67 Bq/m 3 with maximum and minimum of thoron concentrations were 3.37 and 2.22 Bq/m 3 respectively. From the measurement in different locations, it was obtained that the largest and smallest average concentrations of thoron progenies were 0.83 ± 0.23 Bq/m 3 and 0.29 ± 0.64 Bq/m 3 , while the maximum and minimum concentration values were 7.80 Bq/m 3 and 0.01 Bq/m 3 respectively. Pylon Model WLx device is not enables to be used for longer and large scale survey area concurrently, so the SSNTDs which is sensitive to the emission of alpha particles and can measure cumulative thoron concentrations is required. (author)

Measurements of ²²²Rn, ²²⁰Rn, and CO₂ Emissions in Natural CO₂ Fields in Wyoming: MVA Techniques for Determining Gas Transport and Caprock Integrity

Energy Technology Data Exchange (ETDEWEB)

Kaszuba, John [Univ. of Wyoming, Laramie, WY (United States); Sims, Kenneth [Univ. of Wyoming, Laramie, WY (United States)

2014-09-30

An integrated field-laboratory program evaluated the use of radon and CO₂ flux measurements to constrain source and timescale of CO₂ fluxes in environments proximate to CO₂ storage reservoirs. By understanding the type and depth of the gas source, the integrity of a CO₂ storage reservoir can be assessed and monitored. The concept is based on correlations of radon and CO₂ fluxes observed in volcanic systems. This fundamental research is designed to advance the science of Monitoring, Verification, and Accounting (MVA) and to address the Carbon Storage Program goal of developing and validating technologies to ensure 99 percent storage performance. Graduate and undergraduate students conducted the research under the guidance of the Principal Investigators; in doing so they were provided with training opportunities in skills required for implementing and deploying CCS technologies. Although a final method or “tool” was not developed, significant progress was made. The field program identified issues with measuring radon in environments rich in CO₂. Laboratory experiments determined a correction factor to apply to radon measurements made in CO₂-bearing environments. The field program also identified issues with radon and CO₂-flux measurements in soil gases at a natural CO₂ analog. A systematic survey of radon and CO₂ flux in soil gases at the LaBarge CO₂ Field in Southwest Wyoming indicates that measurements of ²²²Rn (radon), ²²⁰Rn (thoron), and CO₂ flux may not be a robust method for monitoring the integrity of a CO₂ storage reservoir. The field program was also not able to correlate radon and CO₂ flux in the CO₂-charged springs of the Thermopolis hydrothermal system. However, this part of the program helped to motivate the aforementioned laboratory experiments that determined

Activated charcoal adsorber bed as a 222Rn hold up system for application in uranium mining industries

International Nuclear Information System (INIS)

Sudeep Kumara, K.; Karunakara, N.; Sahoo, B.K.; Gaware, J.J.; Sapra, B.K.; Mayya, Y.S.

2018-01-01

222 Rn, produced due to the decay of 226 Ra, can accumulate to high concentrations, and if adequate ventilation is not provided the workers may inhale the 222 Rn laden air, which would result in elevated inhalation dose in Uranium mining and milling operations. Similarly, in thorium mining and processing plants, the 220 Rn generated during monazite processing and thorium handling facility is of concern. In a previous publication it has been shown that adsorption in a flow-through charcoal bed offers an excellent method of alleviating the release of 220 Rn into occupational and public domain. In this paper we examine the utility of TMS as a 222 Rn hold up/delay system by evaluating its performance parameters such as breakthrough time (τ) and adsorption coefficient (K) at different flow rates

Comparison of outdoor activity size distributions of 220 Rn and 222 Rn progeny and their Influences on lung dosimetry distributions

International Nuclear Information System (INIS)

Mohamed, A.; El-Hussein, A.; Ahmed, A.

2005-01-01

In the case of internally deposited radionuclides, direct measurement of the energy absorbed from ionizing radiation emitted by the decaying radionuclides is rarely, if ever, possible. Therefore, one must rely on dosimetric models to obtain estimates of the spatial and temporal patterns of energy deposition in human lung. T These models always need some information about the parameters of activity size distributions of thoron and radon progeny. In the present work, the attached and unattached activity size distributions of thoron and radon progeny were measured in outdoor air of El-Minia, Egypt. The attached samples were collected using a low pressure Berner cascade impactor technique, while a constructed screen diffusion b attery was used for collecting the unattached samples. Most of the attached activities for 222 Rn and 220 Rn progeny were associated with the aerosol particles of the accumulation mode. The activity size distribution of thoron progeny was found to be shifted to slightly smaller particle size, compared to radon progeny. An analytical method has been developed to compute the local energy deposition of 2l2 Bi alpha particles in a target volume of 1 jam spheres located at different depths in bronchial epithelium. In order to reach the target, alpha particles travel either through tissue alone (near-wall dose) or through air and tissue (far-wall dose). It was found that the contribution of near-wall dose is higher than that of the far wall dose. While the depth-dose distributions for nuclides uniformly distributed within the epithelium are practically constant with

The correlations between Radon in soil gas and its exhalation and concentration in air in the southern part of Syria

International Nuclear Information System (INIS)

Shweikani, R.; Hushari, M.

2005-01-01

The aim of this work is to measure the concentration of the radon ( 222 Rn) in soil air, 222 Rn exhalation from soil and 222 Rn in outdoor air which may have great influence on 222 Rn levels in houses. 222 Ra activity concentrations were also determined in soil samples. The studied areas are located in southern part of Syria. The common bed rock of this area is black and massive granite which are poor in uranium content [Jubeli Y.M., 1990. Uranium exploration in Syria. Internal Technical Report, vol. 1 (in English), vol. 2 (in Arabic), SAEC, Damascus; Technoexport (USSR), 1966. In: Ponikarov (Ed.), The Geological Map of Syria Scale: 1:200.000, Ministry of Industry, Damascus, Syria]. Results showed that the maximum measurement in all areas was 32500Bqm -3 in soil air with an exhalation rate of 9Bqm -2 s -1 in Darra region and 66.43Bqm -3 of radon in open air, with 77Bqkg -1 of radium content in soil (Damascus suburb). In addition, correlations between Rn in soil and exhalation of Radon from soil and radon in houses were found in some areas (Sweda and Darra), while, no correlations were found in other studied areas. Moreover, no correlation between radon in houses and radon measurements in soil and in outdoors were found. This was attributed to the methodology used and the influence of building design and inhabitants behavior

Radon mass exhalation rate in soil samples at South Bengaluru city, Karnataka, India

International Nuclear Information System (INIS)

Poojitha, C.G.; Pranesha, T.S.; Ganesh, K.E.; Sahoo, B.K.; Sapra, B.K.

2017-01-01

Radon mass exhalation rate in soil samples collected from different locations of South Bengaluru city were measured using scintillation based Smart radon thoron monitor (RnDuo). It has been observed that the mass exhalation rate estimated due to presence of radon concentration in soil samples ranges from 39.18 - 265.58 mBq/kg/h with an average value of 115.64 mBq/kg/h. Finally we compare our results with similar investigation from different parts of India. (author)

Effects of Using Light-Weight Concrete on Indoor Radon Concentration in High-Rise Buildings

Energy Technology Data Exchange (ETDEWEB)

Yu, K.N.; Cheung, T.; Koo, S.Y

1999-07-01

Light-weight concrete (LWC) (or drywall construction) has been used for partition walls in public housing in Hong Kong for about 10 years. A previous laboratory investigation showed that all types of LWC had considerably smaller Rn exhalation rates than those from normal concrete (NC), and could thus theoretically reduce the indoor Rn concentrations and the corresponding radiation dose from Rn. In the present investigation, a survey of Rn exhalation rates and indoor Rn concentrations at 39 dwelling sites built using LWC were carried out using charcoal canisters and {gamma}-spectroscopy. The mean Rn exhalation rate and the mean Rn concentration were around 1.6 mBq.s{sup -1}.m{sup -2} and 19 Bq.m{sup -3}, respectively, which were significantly smaller thanthe corresponding values of 12 mBq.s{sup -1}.m{sup -2} and 33 Bq.m{sup -3} for NC sites. The statistical t-test showed that both the mean Rn exhalation rate and the mean Rn concentration for NC and LWC sites walls were different at the 100% confidence level. The Rn exhalation rate from an LWC surface was, on average, only about 14% of that from an NC surface, while the Rn concentration in an LWC site was, on average, about 58% of that in an NC site, which were significant. A person living at an LWC site receives an average annual equivalent dose smaller than one living at an NC site by an amount as large as 1 mSv. Therefore, the use of LWC for partition walls can be a simple and economical way to reduce the indoor Rn concentrations and the corresponding radiation dose from Rn. Furthermore, the mean Rn concentration theoretically predicted from the mean Rn exhalation rate agreed excellently with that from measurements. (author)

Active and passive measurements of radon/thoron exhalation from coal and flyash samples collected from various thermal power plants of Delhi, India

International Nuclear Information System (INIS)

Singh, Lalit Mohan; Kumar, Rajesh; Sahoo, B.K.; Sapra, B.K.; Rajendra Prasad

2013-01-01

Measurement of radon ( 222 Rn) exhalation from coal, flyash and soil samples was carried out using active (Scintillation based Smart Radon Monitor) as well as passive technique (SSNTD based Can technique). In addition, thoron ( 220 Rn) exhalation measurements were also made for the above samples using Scintillation based Smart Thoron Monitor. To the best of our knowledge, thoron exhalation measurement is first of its kind in India. In this study, a total of 26 samples collected from Badarpur Thermal Power Station, Badarpur and Rajghat Power Station, Rajghat, Delhi were analysed. Thoron surface exhalation rate measured by Scintillation based Thoron Monitor for Badarpur Thermal Power Station varied from 327.8 Bq/m 2 /h to 874.2 Bq/m 2 /h and for Rajghat Thermal Power Station it varied from 176.0 Bq/m 2 /h to 781.1 Bq/m 2 /h. Similarly, the radon mass exhalation rate measured by active technique varied from 12.13 mBq/Kg/h to 118.08 mBq/Kg/h for the samples collected from Badarpur Thermal Power Station; while it varied from 15.00 Bq/Kg/h to 168.07 mBq/Kg/h for the samples collected from Rajghat Thermal Power station. On the other hand, result of measurements made by the conventional Can technique were significantly lower varying from 0.44 mBq/Kg/h to 2.34 mBq/Kg/h for Rajghat Thermal Power Station and from 0.78 mBq/Kg/h to 2.88 mBq/Kg/h for Badarpur Thermal Power Station. This vast variation in the results obtained by active and passive techniques is due to the fact that the active technique accounts for the effect of back-diffusion and possible leakage from the chamber in the process of least square fitting of exponential model while it is not so in the case of SSNTD based Can technique. In view of this, results of active technique are more reliable as compared to the passive technique. More importantly, there was no thoron interference in the radon measurement by the active technique. Further experiments are being carried out using controlled radon and thoron

PO.RA project. An analysis on gas radon concentrations in soil versus fluctuations in the groundwater table

International Nuclear Information System (INIS)

Serentha', C.; Torretta, M.

2001-01-01

Man is daily exposed to natural radiation, mainly due to cosmic rays and natural radioactive elements, whose most important radioactive daughters are 222 Rn (radon) and 220 Rn (thoron). Being these ones gaseous, they can spread through the ground, reaching the atmosphere and accumulating in rooms, where their concentrations may be very high. As radon exhalation is strongly connected with the hydrogeological features of the environment, this study tried to find a relationship between fluctuations in the groundwater table and gas radon concentrations in soil, in order to try estimates of indoor radon concentrations [it

222Rn and decay products in outdoor and indoor environments

International Nuclear Information System (INIS)

Samuelsson, C.

1984-05-01

Radon-222 (radon) and radon daughter (RnD) measurement methodologies are analysed from both theoretical and experimental points of view. It is shown that exhalation from enclosed porous materials can be described in terms of the time-dependent diffusion theory. Deficiencies in the established accumulator method of radon exhalation measurement are shown. By the existing methods, the true free exhalation rate of thin samples may be underestimated by a factor of (1+α- 1 ), in radon-tight accumulators (α is the outer to inner volume ratio of the sample). The term back-diffusion is clarified and shown applicable to steady-state conditions only. The wire-screen technique is utilized to separate aerosol-attached and unattached RnD in a 3 m 3 radon cell. The effect of air-filtration on the RnDs is expressed as individual activity concentrations as well as in terms of effective dose equivalent rate, H. H has been reduced by a factor between 1.3 and 2.5 for the small-sized areosol particles used (surface area median less than 100 nm), at the filtration rate constant 5 h- 1 . The exact reduction value is dependent on initial aerosol load, type of filter, and dose model (Jacobi-Eisfeld and James-Birchall in this investigation). The concentration of radon and Pb-210 in the Arctic summer air averaged 75+-21 and 0.075+-0.028 mBq m- 3 , during the Swedish Ymer-80 expedition. It is shown that steadystate equilibrium models are unsuitable for estimation of the mean aerosol residence time in ocean air. A good qualitative agreement between radon-levels and the time since the air mass left larger land areas was found. The radon-222 and long-lived daughter (Pb-210, Po-210) measurements are insensitive to ship- and local contaminations. (author)

Radionuclide content in some building materials and their radon exhalation

International Nuclear Information System (INIS)

Holy, K.; Sykora, I.; Chudy, M.; Polaskova, A.; Hola, O.

1995-01-01

The activity concentrations of natural radionuclides in sands, gravels, cements and in different kinds of concretes were measured by γ-spectrometric methods. The 222 Rn exhalation rate from concretes was measured by closed chamber method and the emanation coefficient was calculated. Both used methods are described in detail and obtained results are discussed from point of view of allowed hygienic limits. (author) 11 refs.; 2 figs.; 5 tabs

Soil gas 222Rn and volcanic activity at El Hierro (Canary Islands) before and after the 2011 submarine eruption

Science.gov (United States)

Padilla, G.; Hernández, P. A.; Padrón, E.; Barrancos, J.; Melián, G.; Dionis, S.; Rodríguez, F.; Nolasco, D.; Calvo, D.; Hernández, I.; Pereza, M. D.; Pérez, N. M.

2012-04-01

El Hierro (278 km2) is the southwesternmost island of the Canarian archipelago. From June 19, 2011 to January 2012, more than 11,950 seismic events have been detected by the seismic network of IGN. On 10 October 2011 the earthquake swarm changed its behaviour and produced a harmonic tremor due to magma movement, indicating that a submarine eruption located at 2 km south of La Restinga had started which is still in progress. Since 2003, the ITER Environmental Research Division now integrated in the Instituto Volcanológico de Canarias, INVOLCAN, has regularly performed soil gas surveys at El Hierro as a geochemical tool for volcanic surveillance. Among the investigated gases, soil gas radon (222Rn) and thoron (220Rn) have played a special attention. Both gases are characterized to ascend towards the surface mainly through cracks or faults via diffusion or advection, mechanisms dependent of both soil porosity and permeability, which in turn vary as a function of the stress/strain changes at depth. Years before the starts of the volcanic-seismic crisis on July 17, 2011, a volcanic multidisciplinary surveillance program was implemented at El Hierro including discrete and continuous measurements of 222Rn and 220Rn. Two soil gas 222Rn surveys had been carried out at El Hierro in 2003 and 2011, and four continuous geochemical monitoring stations for 222Rn and 220Rn measurements had been installed (HIE02, HIE03, HIE04 and HIE08). Soil gas 222Rn surveys were carried out at the surface environment of El Hierro after selecting 600 sampling observation sites (about 40 cm depth). Geochemical stations measure 222Rn and 220Rn activities by pumping the gas from a PVC pipe inserted 1m in the ground and thermally isolated. The results of the 2003 and 2011 soil gas 222Rn surveys show clearly a relatively higher observed 222Rn activities in the surface environment on 2011 than those observed on 2003 when no anomalous seismicity were taking place beneath El Hierro. The observed

Estimation of 222Rn flux and its effect on the atmospheric 222Rn concentration at Hachijo-jima Island, Japan

International Nuclear Information System (INIS)

Ohkura, Takehisa; Yamazawa, Hiromi; Moriizumi, Jun; Hirao, Shigekazu; Iida, Takao

2010-01-01

222 Rn fluxes from the ground surface and 226 Ra contents in soil were measured on Hachijo-jima Island, which is a solitary island in the Pacific Ocean located about 200 km to the south of the main island of Japan, to evaluate fractional contributions of the locally exhaled 222 Rn and the long-range transported one to the surface air concentration measured on this island. Averages of 222 Rn flux and 226 Ra content in dry soil were evaluated to be 0.9±0.4 mBq m -2 s -1 and 6.8±0.2 Bq kg -1 , respectively. These are considerably smaller than the respective values of 9.7±0.8 mBq m -2 s -1 and 23.2±0.4 Bq kg -1 measured at Nagoya as a reference. The lower value of the 226 Ra content and the even lower 222 Rn flux on this island can be attributed to the basaltic geology and the soil's coarse texture moisture, respectively. A simple model calculation assuming a typical nocturnal condition showed that the measured 222 Rn flux would cause only a small increase in the surface air concentration by 0.035 to 0.072 Bq m -3 (relative contribution of 1 to 12%) in addition to the long-range transported 222 Rn under a typical nocturnal condition. The contribution of the local flux would be smaller than that under nocturnal condition. This local 222 Rn component is negligible as compared with the concentration of the long-range transported 222 Rn (0.6 to 3.6 Bq m -3 ). It is, therefore, concluded that Hachijo-jima Island is suitable for measuring the long-range transported atmospheric 222 Rn in East Asia region. (author)

Determination of the exhalation rate of radon and thoron from building materials by detectors Cr-39

International Nuclear Information System (INIS)

Vasidov, A.

2005-01-01

Full text: The building materials (BM) such as granite, bricks, sand, cement etc., contain uranium and thorium in various amounts. Therefore the knowledge of true value exhalation rate of Rn and Tn from BM represents scientific and practical interest in environmental radiation protection. In present work, we have used calibrated plastic cups with two detectors Cr-39. The detected surface of the cup is situated in perpendicular position surface BM and were exposed for 20-30 days. The first detector fixed the bottom on distance from surface of BM and records alpha particles from Rn-222 only. The second detector records alpha particles of the thoron and radon. After exposition, the detectors chemically etched and analyzed. The values of the exhalation rate per unit area of the granite, concrete, fired and unfired bricks, sand, cement, alabaster varied 0.091 - 0.1 Bq m -2 h -1 for the radon, 200 - 5800 Bq m -2 h - 1 for the thoron, accordingly

Relation between 222Rn concentration in outdoor air and lower atmosphere

International Nuclear Information System (INIS)

Kataoka, Toshio; Mori, Tadashige; Yunoki, Eiji; Michihiro, Kenshuh; Sugiyama, Hirokazu; Shimizu, Mitsuo; Tsukamoto, Osamu; Sahashi, Ken.

1991-01-01

Using the height of the surface-based inversion layer obtained by the acoustic sounder returns and the variation of the 222 Rn concentration in the outdoor air during the presence of the surface-based inversion layer, the exhalation rate of 222 Rn is estimated to be 0.020 Bq·m -2 ·s -1 , which is observed elsewhere on land. Furthermore, the exposure rate at 1 m above the air-ground interface due to the short-lived 222 Rn daughters in the outdoor air during the presence of the surface-based inversion layer can be estimated using the height of the surface-based inversion layer and the 222 Rn concentrations in the outdoor air at the ground level before and after the onset of the surface-based inversion layer. From these treatment, it is clearly demonstrated that the monostatic acoustic sounder is useful as a supplementary method for a weather survey which forms a part of monitoring around the nuclear facilities. (author)

Study of radon exhalation from phosphogypsum plates and blocks from different origins; Estudo da exalacao de radonio em placas e tijolos de fosfogesso de diferentes procedencias

Energy Technology Data Exchange (ETDEWEB)

Costa, Lucas Jose Pereira da

2011-07-01

Phosphogypsum is a waste of the fertilizer industry that concentrates radionuclides. In this work, the {sup 222}Rn exhalation rate from phosphogypsum plates and blocks from different origins used at dwellings construction was studied. The {sup 222}Rn exhalation rate was determined through the accumulation chamber technique with solid state nuclear track detectors (SSNTD). The effective dose for an individual living in a residence built with phosphogypsum based materials was evaluated. It also was calculated the {sup 222}Rn exhalation rate through the UNSCEAR model, from the {sup 226}Ra concentration in the materials, in order to compare the experimental results. It was evaluated the contribution of building component (paint) to the reduction of {sup 222}Rn exhalation rate. The plates and blocks were manufactured with phosphogypsum from Bunge Fertilizantes, Ultrafertil and Fosfertil. Blocks manufactured with ordinary gypsum was also evaluated. The average results obtained were 0.19 {+-} 0.06 Bq m-2 h-1, 1.3 {+-} 0.3 Bq m{sup -2} h{sup -1} and 0.41 {+-} 0.07 Bq m{sup -2} h{sup -1} for plates manufactured with phosphogypsum from Bunge Fertilizer, Ultrafertil and Fosfertil, respectively. For the phosphogypsum blocks the values were 0.11 {+-} 0.01 Bq m{sup -2} h-1, 1.2 {+-} 0.6 Bq m{sup -2} h{sup -1}, 0.47 {+-} 0.15 Bq m{sup -2} h{sup -1}, for Bunge, Ultrafertil and Fosfertil. The blocks manufactured with ordinary gypsum presented average value of 0.18 {+-} 0.08 Bq m{sup -2} h'-{sup 1}. All phosphogypsum plates and blocks evaluated in this study presented effective dose for radon inhalation lower than the recommended value of 1mSv y{sup -1}, the annual effective dose limit for public exposure by International Commission on Radiological Protection. (author)

Evaluation of exhaled nitric oxide in schoolchildren at different exhalation flow rates.

Science.gov (United States)

Pedroletti, Christophe; Zetterquist, Wilhelm; Nordvall, Lennart; Alving, Kjell

2002-09-01

Nitric oxide (NO) in exhaled air is believed to reflect allergic inflammation in the airways. Measured levels of exhaled NO vary with the exhaled flow rate, which therefore must be standardized. The aim of this study was to estimate the optimal exhalation flow rate when measuring NO in exhaled air. We studied 15 asthmatic children (8-18 y) with elevated NO levels and 15 age-matched controls and focused on how the quality of the NO curve profile, the discriminatory power, and the reproducibility were influenced by the exhalation flow rate. We used an on-line system for NO measurements at six different exhalation flow rates in the interval of 11-382 mL/s. The fraction of exhaled nitric oxide (FENO) was highly flow-dependent as was expected. Intermediate flow rates yielded a flat and stable NO plateau and were considerably easier to interpret than those obtained at the highest and lowest flow rates. The ratio of FENO between asthmatics and controls was lower at higher flow rates and a considerable overlap in NO values was demonstrated at all flow rates except 50 mL/s. The reproducibility was much lower at more extreme flow rates and was best at 50 mL/s. We conclude that a target exhalation flow rate of approximately 50 mL/s is to be preferred using the single-breath method for on-line NO measurements in schoolchildren.

Environmental 222Rn as a background source in the solar neutrino experiment GALLEX

International Nuclear Information System (INIS)

Wojcik, M.

1996-01-01

The radiochemical neutrino experiment GALLEX is described. Its aim is to measure the flux of low energy solar neutrinos. In this experiment it is essential to suppress strongly the background of environmental origin, like charged cosmic rays, neutrons and gamma rays. In low-level radioactivity measurements performed in deep underground laboratory where flux of charged comic rays is strongly reduced, radon (Rn) exhaled from rock or concrete walls forms a most important strong, time-dependent background component. In this work the impact of Rn on the GALLEX experiment has been discussed and attempts to recognize and minimize its influence on the counter background were described. 63 refs, 22 figs, 11 tabs

Natural radioactivity and radon specific exhalation rate of zircon sands

International Nuclear Information System (INIS)

Righi, S.; Verita, S.; Bruzzi, L.; Albertazzi, A.

2006-01-01

The study focuses on the radon emanation from zircon sands and their derivatives, which are widely used in many sectors of industry. In particular, the results obtained by experimental measurements on samples of zircon sands and zircon flours commonly used in Italian ceramic industries are reported. Zircon sands contain a significant concentration of natural radioactivity because Th and U may substitute zirconium in the zircon crystal lattice. The relevant routes of exposure of workers to T.E.N.O.R.M. from zircon materials are external radiation and internal exposure, either by inhalation of aerosols in dusty working conditions or by inhalation of radon in workplaces. The main objective of this investigation is to provide experimental data able to better calculate the internal exposure of workers due to radon inhalation. Zircon samples were surveyed for natural radioactivity, radon specific exhalation rate and emanation fraction. Measurements of radioactivity concentration were carried out using γ-spectrometry. Methods used for determining radon consisted in determining the 222 Rn activity accumulated in a vessel after a given accumulation build-up time. The average activity concentrations of 238 U and 232 Th in samples result about 2600 and 550 Bq kg-1, respectively; these concentrations are significantly higher than the world average noticed in soils, rocks and Earth crust. The 222 Rn specific exhalation rates result very low probably due to the low porosity of the material and the consequent difficulty for radon to be released from the zircon crystal lattice. (author)

The estimation of doses to the inhabitants arising from natural radiation source in the high background radiation area of Yangjiang, China

International Nuclear Information System (INIS)

Yuan Yongling; Shen Hong; Morishima, H.; Wei Lvxin; Jian Yuannu

2004-01-01

Objective: The purposes is to estimate the average annual effective dose of the inhabitants and absorbed dose in some human tissues and organs arising from natural radiation sources in the High Background Radiation Area (HBRA) of Yangjiang and in the neighboring Control Area (CA). In order to provide more effective evidence for analyzing the dose-effect relationships among the cohort members in the investigated areas, authors divided the local inhabitant into different dose-groups. Methods: The authors measured the environmental gamma external radiation levels and individual accumulated doses of 5293 people in the investigated areas. The concentrations for 222 Rn, 220 Rn and their decay products in air were also surveyed. The authors estimated the internal doses of natural radionuclides based on the results obtained from measurements in food, in drinking water, in human teeth, in several human tissues, in human placenta, and in activity concentration of exhaled 222 Rn and 220 Rn of the residents living in the investigated areas. Results: The estimation of average annual effective doses in HBRA and CA based on the data of environmental measurements of radiation level respectively are 2.12 ± 0.29 mSv a -1 and 0.69 ± 0.09 mSv a -1 . The sources of higher background radiation in HBRA are mainly contributed from terrestrial gamma radiation. The estimation of average annual effective doses to the residents arising from inhalation of 222 Rn, 220 Rn and their decay products was 3.28 mSv a -1 in HBRA, while that in CA was 1.03 mSv a -1 . The values of the absorbed dose of the residents in their trachea-bronchial tree and lung in HBRA arising from inhalation of 222 Rn, 220 Rn and their decay products are 5.40 mGy a -1 and 1.08 mGy a -1 respectively, which are about four times of the values of the absorbed dose in CA. The estimation of average annual effective doses to the inhabitants caused by 226 Ra and 228 Ra in HBRA and CA were 281.88 μSv a -1 and 84.54 μSv a -1

Environmental {sup 222}Rn as a background source in the solar neutrino experiment GALLEX

Energy Technology Data Exchange (ETDEWEB)

Wojcik, M. [Uniwersytet Jagiellonski, Cracow (Poland). Inst. Fizyki; BOREXINO

1996-12-31

The radiochemical neutrino experiment GALLEX is described. Its aim is to measure the flux of low energy solar neutrinos. In this experiment it is essential to suppress strongly the background of environmental origin, like charged cosmic rays, neutrons and gamma rays. In low-level radioactivity measurements performed in deep underground laboratory where flux of charged comic rays is strongly reduced, radon (Rn) exhaled from rock or concrete walls forms a most important strong, time-dependent background component. In this work the impact of Rn on the GALLEX experiment has been discussed and attempts to recognize and minimize its influence on the counter background were described. 63 refs, 22 figs, 11 tabs.

Environmental {sup 222}Rn as a background source in the solar neutrino experiment GALLEX

Energy Technology Data Exchange (ETDEWEB)

Wojcik, M [Uniwersytet Jagiellonski, Cracow (Poland). Inst. Fizyki; BOREXINO,

1997-12-31

The radiochemical neutrino experiment GALLEX is described. Its aim is to measure the flux of low energy solar neutrinos. In this experiment it is essential to suppress strongly the background of environmental origin, like charged cosmic rays, neutrons and gamma rays. In low-level radioactivity measurements performed in deep underground laboratory where flux of charged comic rays is strongly reduced, radon (Rn) exhaled from rock or concrete walls forms a most important strong, time-dependent background component. In this work the impact of Rn on the GALLEX experiment has been discussed and attempts to recognize and minimize its influence on the counter background were described. 63 refs, 22 figs, 11 tabs.

Comparison of Select Analytes in Exhaled Aerosol from E-Cigarettes with Exhaled Smoke from a Conventional Cigarette and Exhaled Breaths

Directory of Open Access Journals (Sweden)

Gerald A. Long

2014-10-01

Full Text Available Exhaled aerosols were collected following the use of two leading U.S. commercial electronic cigarettes (e-cigarettes and a conventional cigarette by human subjects and analyzed for phenolics, carbonyls, water, glycerin and nicotine using a vacuum-assisted filter pad capture system. Exhaled breath blanks were determined for each subject prior to each product use and aerosol collection session. Distribution and mass balance of exhaled e-cigarette aerosol composition was greater than 99.9% water and glycerin, and a small amount (<0.06% of nicotine. Total phenolic content in exhaled e-cigarette aerosol was not distinguishable from exhaled breath blanks, while total phenolics in exhaled cigarette smoke were significantly greater than in exhaled e-cigarette aerosol and exhaled breaths, averaging 66 µg/session (range 36 to 117 µg/session. The total carbonyls in exhaled e-cigarette aerosols were also not distinguishable from exhaled breaths or room air blanks. Total carbonyls in exhaled cigarette smoke was significantly greater than in exhaled e-cigarette aerosols, exhaled breath and room air blanks, averaging 242 µg/session (range 136 to 352 µg/session. These results indicate that exhaled e-cigarette aerosol does not increase bystander exposure for phenolics and carbonyls above the levels observed in exhaled breaths of air.

Intrinsic backgrounds from Rn and Kr in the XENON100 experiment

Energy Technology Data Exchange (ETDEWEB)

Aprile, E.; Anthony, M.; Perio, P. de; Gao, F.; Goetzke, L.W.; Greene, Z.; Lin, Q.; Plante, G.; Rizzo, A.; Zhang, Y. [Columbia University, Physics Department, New York, NY (United States); Aalbers, J.; Breur, P.A.; Brown, A.; Colijn, A.P.; Decowski, M.P.; Hogenbirk, E.; Tiseni, A. [Nikhef and the University of Amsterdam, Amsterdam (Netherlands); Agostini, F. [INFN-Laboratori Nazionali del Gran Sasso, L' Aquila (Italy); Gran Sasso Science Institute, L' Aquila (Italy); University of Bologna, Department of Physics and Astrophysics, Bologna (Italy); INFN-Bologna (Italy); Alfonsi, M.; Geis, C.; Grignon, C.; Oberlack, U.; Scheibelhut, M.; Schindler, S. [Johannes Gutenberg-Universitaet Mainz, Institut fuer Physik and Exzellenzcluster PRISMA, Mainz (Germany); Amaro, F.D.; Cardoso, J.M.R.; Lopes, J.A.M.; Santos, J.M.F. dos; Silva, M. [University of Coimbra, LIBPhys, Department of Physics, Coimbra (Portugal); Arneodo, F.; Benabderrahmane, M.L.; Di Giovanni, A.; Maris, I. [New York University Abu Dhabi, Abu Dhabi (United Arab Emirates); Barrow, P.; Baudis, L.; Galloway, M.; Kazama, S.; Kessler, G.; Kish, A.; Mayani, D.; Pakarha, P.; Piastra, F.; Wulf, J. [University of Zurich, Physik-Institut, Zurich (Switzerland); Bauermeister, B.; Calven, J.; Conrad, J.; Ferella, A.D.; Moraa, K.; Pelssers, B. [Stockholm University, AlbaNova, Oskar Klein Centre, Department of Physics, Stockholm (Sweden); Berger, T.; Brown, E.; Piro, M.C. [Rensselaer Polytechnic Institute, Department of Physics, Applied Physics and Astronomy, Troy, NY (United States); Bruenner, S.; Cichon, D.; Eurin, G.; Hasterok, C.; Lindner, M.; Marrodan Undagoitia, T.; Pizzella, V.; Rauch, L.; Rupp, N.; Schreiner, J.; Simgen, H. [Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany); Bruno, G.; Rosso, A.G.; Molinario, A.; Wang, Z. [INFN-Laboratori Nazionali del Gran Sasso, L' Aquila (Italy); Gran Sasso Science Institute, L' Aquila (Italy); Budnik, R.; Itay, R.; Landsman, H.; Lellouch, D.; Levinson, L.; Manfredini, A.; Priel, N. [Weizmann Institute of Science, Department of Particle Physics and Astrophysics, Rehovot (Israel); Buetikofer, L.; Coderre, D.; Kaminsky, B.; Schumann, M.; Sivers, M. von [Universitaet Freiburg, Physikalisches Institut, Freiburg (Germany); Cervantes, M.; Lang, R.F.; Masson, D.; Reichard, S. [Purdue University, Department of Physics and Astronomy, West Lafayette, IN (United States); Cussonneau, J.P.; Diglio, S.; Masbou, J.; Micheneau, K.; Persiani, R.; Thers, D. [CNRS/IN2P3, Universite de Nantes, SUBATECH, IMT Atlantique, Nantes (France); Di Gangi, P.; Garbini, M.; Massoli, F.V.; Sartorelli, G.; Selvi, M. [University of Bologna, Department of Physics and Astrophysics, Bologna (Italy); INFN-Bologna (Italy); Fei, J.; Lombardi, F.; Ni, K.; Ye, J. [University of California, Department of Physics, San Diego, CA (United States); Fieguth, A.; Murra, M.; Vargas, M.; Weinheimer, C.; Wittweg, C. [Westfaelische Wilhelms-Universitaet Muenster, Institut fuer Kernphysik, Muenster (Germany); Fulgione, W. [INFN-Laboratori Nazionali del Gran Sasso, L' Aquila (Italy); Gran Sasso Science Institute, L' Aquila (Italy); INFN-Torino (Italy); Osservatorio Astrofisico di Torino, Torino (Italy); Lindemann, S. [Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany); Universitaet Freiburg, Physikalisches Institut, Freiburg (Germany); Messina, M. [Columbia University, Physics Department, New York, NY (United States); New York University Abu Dhabi, Abu Dhabi (United Arab Emirates); Naganoma, J.; Shagin, P. [Rice University, Department of Physics and Astronomy, Houston, TX (United States); Pienaar, J. [Purdue University, Department of Physics and Astronomy, West Lafayette, IN (United States); University of Chicago, Department of Physics, Kavli Institute of Cosmological Physics, Chicago, IL (United States); Ramirez Garcia, D. [Johannes Gutenberg-Universitaet Mainz, Institut fuer Physik and Exzellenzcluster PRISMA, Mainz (Germany); Universitaet Freiburg, Physikalisches Institut, Freiburg (Germany); Reuter, C. [University of Zurich, Physik-Institut, Zurich (Switzerland); Purdue University, Department of Physics and Astronomy, West Lafayette, IN (United States); Lavina, L.S. [Universite Paris Diderot, CNRS/IN2P3, LPNHE, Universite Pierre et Marie Curie, Paris (France); Stein, A.; Wang, H. [University of California, Physics and Astronomy Department, Los Angeles, CA (United States); Trinchero, G. [INFN-Torino (Italy); Osservatorio Astrofisico di Torino, Torino (Italy); Tunnell, C. [Nikhef and the University of Amsterdam, Amsterdam (Netherlands); University of Chicago, Department of Physics, Kavli Institute of Cosmological Physics, Chicago, IL (United States); Weber, M. [Columbia University, Physics Department, New York, NY (United States); Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany); Wei, Y. [University of Zurich, Physik-Institut, Zurich (Switzerland); University of California, Department of Physics, San Diego, CA (United States); Collaboration: XENON Collaboration

2018-02-15

In this paper, we describe the XENON100 data analyses used to assess the target-intrinsic background sources radon ({sup 222}Rn), thoron ({sup 220}Rn) and krypton ({sup 85}Kr). We detail the event selections of high-energy alpha particles and decay-specific delayed coincidences. We derive distributions of the individual radionuclides inside the detector and quantify their abundances during the main three science runs of the experiment over a period of ∝ 4 years, from January 2010 to January 2014. We compare our results to external measurements of radon emanation and krypton concentrations where we find good agreement. We report an observed reduction in concentrations of radon daughters that we attribute to the plating-out of charged ions on the negatively biased cathode. (orig.)

Intrinsic backgrounds from Rn and Kr in the XENON100 experiment

International Nuclear Information System (INIS)

Aprile, E.; Anthony, M.; Perio, P. de; Gao, F.; Goetzke, L.W.; Greene, Z.; Lin, Q.; Plante, G.; Rizzo, A.; Zhang, Y.; Aalbers, J.; Breur, P.A.; Brown, A.; Colijn, A.P.; Decowski, M.P.; Hogenbirk, E.; Tiseni, A.; Agostini, F.; Alfonsi, M.; Geis, C.; Grignon, C.; Oberlack, U.; Scheibelhut, M.; Schindler, S.; Amaro, F.D.; Cardoso, J.M.R.; Lopes, J.A.M.; Santos, J.M.F. dos; Silva, M.; Arneodo, F.; Benabderrahmane, M.L.; Di Giovanni, A.; Maris, I.; Barrow, P.; Baudis, L.; Galloway, M.; Kazama, S.; Kessler, G.; Kish, A.; Mayani, D.; Pakarha, P.; Piastra, F.; Wulf, J.; Bauermeister, B.; Calven, J.; Conrad, J.; Ferella, A.D.; Moraa, K.; Pelssers, B.; Berger, T.; Brown, E.; Piro, M.C.; Bruenner, S.; Cichon, D.; Eurin, G.; Hasterok, C.; Lindner, M.; Marrodan Undagoitia, T.; Pizzella, V.; Rauch, L.; Rupp, N.; Schreiner, J.; Simgen, H.; Bruno, G.; Rosso, A.G.; Molinario, A.; Wang, Z.; Budnik, R.; Itay, R.; Landsman, H.; Lellouch, D.; Levinson, L.; Manfredini, A.; Priel, N.; Buetikofer, L.; Coderre, D.; Kaminsky, B.; Schumann, M.; Sivers, M. von; Cervantes, M.; Lang, R.F.; Masson, D.; Reichard, S.; Cussonneau, J.P.; Diglio, S.; Masbou, J.; Micheneau, K.; Persiani, R.; Thers, D.; Di Gangi, P.; Garbini, M.; Massoli, F.V.; Sartorelli, G.; Selvi, M.; Fei, J.; Lombardi, F.; Ni, K.; Ye, J.; Fieguth, A.; Murra, M.; Vargas, M.; Weinheimer, C.; Wittweg, C.; Fulgione, W.; Lindemann, S.; Messina, M.; Naganoma, J.; Shagin, P.; Pienaar, J.; Ramirez Garcia, D.; Reuter, C.; Lavina, L.S.; Stein, A.; Wang, H.; Trinchero, G.; Tunnell, C.; Weber, M.; Wei, Y.

2018-01-01

In this paper, we describe the XENON100 data analyses used to assess the target-intrinsic background sources radon ( 222 Rn), thoron ( 220 Rn) and krypton ( 85 Kr). We detail the event selections of high-energy alpha particles and decay-specific delayed coincidences. We derive distributions of the individual radionuclides inside the detector and quantify their abundances during the main three science runs of the experiment over a period of ∝ 4 years, from January 2010 to January 2014. We compare our results to external measurements of radon emanation and krypton concentrations where we find good agreement. We report an observed reduction in concentrations of radon daughters that we attribute to the plating-out of charged ions on the negatively biased cathode. (orig.)

Comparison of active and passive methods for radon exhalation from a high-exposure building material

International Nuclear Information System (INIS)

Abbasi, A.; Mirekhtiary, F.

2013-01-01

The radon exhalation rates and radon concentrations in granite stones used in Iran were measured by means of a high-resolution high purity Germanium gamma-spectroscopy system (passive method) and an AlphaGUARD model PQ 2000 (active method). For standard rooms (4.0 x 35.0 m area x 32.8 height) where ground and walls have been covered by granite stones, the radon concentration and the radon exhalation rate by two methods were calculated. The activity concentrations of 226 Ra in the selected granite samples ranged from 3.8 to 94.2 Bq kg -1 . The radon exhalation rate from the calculation of the 226 Ra activity concentration was obtained. The radon exhalation rates were 1.31-7.86 Bq m -2 h -1 . The direction measurements using an AlphaGUARD were from 218 to 1306 Bq m -3 with a mean of 625 Bq m -3 . Also, the exhalation rates measured by the passive and active methods were compared and the results of this study were the same, with the active method being 22% higher than the passive method. (authors)

Thoron-in-breath monitoring at CRNL

International Nuclear Information System (INIS)

Peterman, B.F.

1985-04-01

This report contains a description of the thoron-in-breath monitor (TIBM) developed at CRNL. This monitor can be used to estimate the amount of thorium (Th-232 and/or Th-228) in humans. Thoron-in-breath monitoring is based on the fact that thoron (Rn-220) is a decay product of thorium, and hence deposited thorium produces thoron in vivo, a fraction of which will be exhaled. Experiences with the TIBM indicate that the monitoring is easy to perform and the results in terms of contaminated vs uncontaminated subjects can be easily interpreted. Work on relationships between thoron exhaled and deposited thorium and hence between thoron exhaled and dose, is continuing

A new method for the determination of radium-228, thorium-228, and radium-224 in groundwaters via thoron (radon-220)

International Nuclear Information System (INIS)

Smith, M.R.; Lautensleger, A.W.; Laul, J.C.

1988-01-01

An improved method for determining radium and thorium from the 232 Th decay series has been developed which measures the activity of 220 Rn as an assay of its parents. Although some ingrowth corrections and minor separation procedures for Th are required, the results to date show that the dynamic counting of 220 Rn via de-emanation and alpha counting by the alpha-scintillation method is preferable. The method for lower limit detection depends on the emanation rate. (author) 3 refs.; 6 figs

High-spin yrast isomers in 211Rn and 212Rn with enhanced E3 decays

International Nuclear Information System (INIS)

Dracoulis, G.D.; Byrne, A.P.; Fabricius, B.

1990-01-01

New isomeric states with J π =69/2 + ,τ m = 13 (1) ns in 211 Rn and J π =33 - ,τ m = 7(1) ns in 212 Rn have been identified. They decay by enchanced E3 transitions with strengths of 33(3) and 43(6) single particle units to the known 63/2 - and 30 + isomers 211 Rn and 212 Rn, respectively. The excitation energies and transition strengths agree well with predictions of the multi-particle, octupole-vibration coupled model. 13 refs., 2 tabs., 3 figs

The effect of the composition and production process of concrete on the 222Rn exhalation rate

NARCIS (Netherlands)

Jong, P. de; Dijk, W. van; Hulst, J.G.A. van; Heijningen, R.J.J. van

1997-01-01

In a series of 18 concrete samples, the influence of several parameters related to composition and production processes on the radon exhalation rate was studied. The investigated parameters were: amount and type of cement, water-cement ratio, curing conditions and curing time, type of aggregates,

Indoor "2"2"2Rn concentration in the exhibition and storage rooms of Polish geological museums

International Nuclear Information System (INIS)

Długosz-Lisiecka, Magdalena; Krystek, Marcin; Raczyński, Paweł; Głuszek, Ewa; Kietlińska-Michalik, Barbara; Niechwedowicz, Mariusz

2017-01-01

The radon exhaled from radioactive mineral collections exhibited in five Polish geological museums may influence its total indoor concentration. Radon concentrations measured in the exhibition halls do not pose a risk for visitors or museum staff. However, air exceeding the action limit for workers (equal to 300 Bq/m"3) was noted in the storage rooms of two museums. Significant"2"2"2Rn activity concentrations equal to more than ~300 kBq/m"3were measured inside lead containers where radioactive minerals were stored. - Highlights: • In this "2"2"2Rn radionuclide measurements in 5 Polish geological museums have been done. • The review of "2"2"2Rn activity in the air in areas containing radioactive geological collections is not a routine protocol, and is not included in the national radon monitoring program. • Therefore the radiological exposure for museum staff resulting from inhalation of gaseous radon and its products has been including.

Radon exhalation rate and natural radionuclide content in building materials of high background areas of Ramsar, Iran.

Science.gov (United States)

Bavarnegin, E; Fathabadi, N; Vahabi Moghaddam, M; Vasheghani Farahani, M; Moradi, M; Babakhni, A

2013-03-01

Radon exhalation rates from building materials used in high background radiation areas (HBRA) of Ramsar were measured using an active radon gas analyzer with an emanation container. Radon exhalation rates from these samples varied from below the lower detection limit up to 384 Bq.m(-2) h(-1). The (226)Ra, (232)Th and (40)K contents were also measured using a high resolution HPGe gamma- ray spectrometer system. The activity concentration of (226)Ra, (232)Th and (40)K content varied from below the minimum detection limit up to 86,400 Bq kg(-1), 187 Bq kg(-1) and 1350 Bq kg(-1), respectively. The linear correlation coefficient between radon exhalation rate and radium concentration was 0.90. The result of this survey shows that radon exhalation rate and radium content in some local stones used as basements are extremely high and these samples are main sources of indoor radon emanation as well as external gamma radiation from uranium series. Copyright © 2012 Elsevier Ltd. All rights reserved.

Joint determination of the concentrations of the 222Rn and 220Rn decay products in air

International Nuclear Information System (INIS)

Terent'ev, M.V.

1987-01-01

The authors describe a modification of the Kuznets and Markov methods normally employed for the determination of radon 220 and 222 daughter alpha product concentration in air in which an air sample is taken for 10 minutes on a filter at a flow rate of 10-40 liters per minute. After the conclusion of sampling the filter activity is measured for another 10 minutes. In order to then determine the latent energy of the radon 222 daughter products and to bring into account the radon 220 daughter products in the total activity measurements of the filter are taken for a second time for 30 minutes five hours after initial sampling. The level of latent energy of the combined daughter products are calculated by an equation which incorporates alpha particle detection efficiency, aerosol retention efficiency in the filter, and the Kuznets coefficients, and analyzes the separate and combined contributions of both daughter products from both sampling periods. A statistical analysis employing the Markov method is also depicted in modified form and is recommended when a more rapid analysis of air radioactivity is mandated

A process-based 222radon flux map for Europe and its comparison to long-term observations

Science.gov (United States)

Karstens, U.; Schwingshackl, C.; Schmithüsen, D.; Levin, I.

2015-11-01

Detailed 222radon (222Rn) flux maps are an essential pre-requisite for the use of radon in atmospheric transport studies. Here we present a high-resolution 222Rn flux map for Europe, based on a parameterization of 222Rn production and transport in the soil. The 222Rn exhalation rate is parameterized based on soil properties, uranium content, and modelled soil moisture from two different land-surface reanalysis data sets. Spatial variations in exhalation rates are primarily determined by the uranium content of the soil, but also influenced by soil texture and local water-table depth. Temporal variations are related to soil moisture variations as the molecular diffusion in the unsaturated soil zone depends on available air-filled pore space. The implemented diffusion parameterization was tested against campaign-based 222Rn soil profile measurements. Monthly 222Rn exhalation rates from European soils were calculated with a nominal spatial resolution of 0.083° × 0.083° and compared to long-term direct measurements of 222Rn exhalation rates in different areas of Europe. The two realizations of the 222Rn flux map, based on the different soil moisture data sets, both realistically reproduce the observed seasonality in the fluxes but yield considerable differences for absolute flux values. The mean 222Rn flux from soils in Europe is estimated to be 10 mBq m-2 s-1 (ERA-Interim/Land soil moisture) or 15 mBq m-2 s-1 (GLDAS (Global Land Data Assimilation System) Noah soil moisture) for the period 2006-2010. The corresponding seasonal variations with low fluxes in winter and high fluxes in summer range in the two realizations from ca. 7 to ca. 14 mBq m-2 s-1 and from ca. 11 to ca. 20 mBq m-2 s-1, respectively. These systematic differences highlight the importance of realistic soil moisture data for a reliable estimation of 222Rn exhalation rates. Comparison with observations suggests that the flux estimates based on the GLDAS Noah soil moisture model on average better

A process-based 222radon flux map for Europe and its comparison to long-term observations

International Nuclear Information System (INIS)

Karstens, U.; Schwingshackl, C.; Schmithuesen, D.; Levin, I.

2015-01-01

Detailed 222 radon ( 222 Rn) flux maps are an essential pre-requisite for the use of radon in atmospheric transport studies. Here we present a high-resolution 222 Rn flux map for Europe, based on a parameterization of 222 Rn production and transport in the soil. The 222 Rn exhalation rate is parameterized based on soil properties, uranium content, and modelled soil moisture from two different land-surface reanalysis data sets. Spatial variations in exhalation rates are primarily determined by the uranium content of the soil, but also influenced by soil texture and local water-table depth. Temporal variations are related to soil moisture variations as the molecular diffusion in the unsaturated soil zone depends on available air-filled pore space. The implemented diffusion parameterization was tested against campaign-based 222 Rn soil profile measurements. Monthly 222 Rn exhalation rates from European soils were calculated with a nominal spatial resolution of 0.083 x 0.083 and compared to long-term direct measurements of 222 Rn exhalation rates in different areas of Europe. The two realizations of the 222 Rn flux map, based on the different soil moisture data sets, both realistically reproduce the observed seasonality in the fluxes but yield considerable differences for absolute flux values. The mean 222 Rn flux from soils in Europe is estimated to be 10 mBq m -2 s -1 (ERA-Interim/Land soil moisture) or 15 mBq m -2 s -1 (GLDAS (Global Land Data Assimilation System) Noah soil moisture) for the period 2006-2010. The corresponding seasonal variations with low fluxes in winter and high fluxes in summer range in the two realizations from ca. 7 to ca. 14 mBq m -2 s -1 and from ca. 11 to ca. 20 mBq m -2 s -1 , respectively. These systematic differences highlight the importance of realistic soil moisture data for a reliable estimation of 222 Rn exhalation rates. Comparison with observations suggests that the flux estimates based on the GLDAS Noah soil moisture model on

Assessment of natural radiation exposure and radon exhalation rates from the soil of Islamabad District of Pakistan

International Nuclear Information System (INIS)

Mujahid, S.A.

2007-01-01

Complete text of publication follows. The earth's crust is a main source of natural radionuclides in soils and rocks. The specific levels of background gamma radiation depend upon the geological composition of each lithologically separated area, and the content of the rock from which the soils originate the radioactive elements of 226Rn, 232Th and 40K. These naturally occurring radionuclides of terrestrial origin in soil can be a source of external radiation exposure through the gamma ray emission whereas internal exposure occurs through the inhalation of radon gas. The measurements of natural radioactivity and the assessment of radiological hazards in the soil samples of Islamabad district of Pakistan have been carried out using High Purity Germanium (HPGe) detector. The radon exhalation rates from these samples have also been estimated employing the 'closed-can' technique of passive dosimeters. The measured activities of 226Ra, 232Th and 40K were found in the range 14 - 30, 18 - 40 and 301 - 655 Bq.kg-1. The annual effective dose was calculated in the range 0.15 - 0.31 mSv. The values of external and internal hazard indices were less than 1. The radon exhalation rates these areas were found in the range 200 - 345 mBq.m-2h-1.

Radon transport modelling: User's guide to RnMod3d

International Nuclear Information System (INIS)

Andersen, C.E.

2000-08-01

RnMod3d is a numerical computer model of soil-gas and radon transport in porous media. It can be used, for example, to study radon entry from soil into houses in response to indoor-outdoor pressure differences or changes in atmospheric pressure. It can also be used for flux calculations of radon from the soil surface or to model radon exhalation from building materials such as concrete. The finite-volume model is a technical research tool, and it cannot be used meaningfully without good understanding of the involved physical equations. Some understanding of numerical mathematics and the programming language Pascal is also required. Originally, the code was developed for internal use at Risoe only. With this guide, however, it should be possible for others to use the model. Three-dimensional steady-state or transient problems with Darcy flow of soil gas and combined generation, radioactive decay, diffusion and advection of radon can be solved. Moisture is included in the model, and partitioning of radon between air, water and soil grains (adsorption) is taken into account. Most parameters can change in time and space, and transport parameters (diffusivity and permeability) may be anisotropic. This guide includes benchmark tests based on simple problems with known solutions. RnMod3d has also been part of an international model intercomparison exercise based on more complicated problems without known solutions. All tests show that RnMod3d gives results of good quality. (au)

High-spin isomer in 211Rn, and the shape of the yrast line

International Nuclear Information System (INIS)

Dracoulis, G.D.; Fahlander, C.; Poletti, A.R.

1981-08-01

High spin yrast states in 211 Rn have been identified. A 61/2 - , 380 ns isomer found at 8856 keV is characterised as a core-excited configuration. The average shape of the yrast line shows a smooth behaviour with spin, in contrast to its neighbour 212 Rn. This difference is attributed to the presence of the neutron hole

Development of a predictive methodology for identifying high radon exhalation potential areas

International Nuclear Information System (INIS)

Ielsch, G.

2001-01-01

Radon 222 is a radioactive natural gas originating from the decay of radium 226 which itself originates from the decay of uranium 23 8 naturally present in rocks and soil. Inhalation of radon gas and its decay products is a potential health risk for man. Radon can accumulate in confined environments such as buildings, and is responsible for one third of the total radiological exposure of the general public to radiation. The problem of how to manage this risk then arises. The main difficulty encountered is due to the large variability of exposure to radon across the country. A prediction needs to be made of areas with the highest density of buildings with high radon levels. Exposure to radon varies depending on the degree of confinement of the habitat, the lifestyle of the occupants and particularly emission of radon from the surface of the soil on which the building is built. The purpose of this thesis is to elaborate a methodology for determining areas presenting a high potential for radon exhalation at the surface of the soil. The methodology adopted is based on quantification of radon exhalation at the surface, starting from a precise characterization of the main local geological and pedological parameters that control the radon source and its transport to the ground/atmosphere interface. The methodology proposed is innovative in that it combines a cartographic analysis, parameters integrated into a Geographic Information system, and a simplified model for vertical transport of radon by diffusion through pores in the soil. This methodology has been validated on two typical areas, in different geological contexts, and gives forecasts that generally agree with field observations. This makes it possible to identify areas with a high exhalation potential within a range of a few square kilometers. (author)

A process-based {sup 222}radon flux map for Europe and its comparison to long-term observations

Energy Technology Data Exchange (ETDEWEB)

Karstens, U. [Max-Planck-Instistut fuer Biogeochemie, Jena (Germany); Schwingshackl, C.; Schmithuesen, D.; Levin, I. [Heidelberg Univ. (Germany). Inst. fuer Umweltphysik

2015-07-01

Detailed {sup 222}radon ({sup 222}Rn) flux maps are an essential pre-requisite for the use of radon in atmospheric transport studies. Here we present a high-resolution {sup 222}Rn flux map for Europe, based on a parameterization of {sup 222}Rn production and transport in the soil. The {sup 222}Rn exhalation rate is parameterized based on soil properties, uranium content, and modelled soil moisture from two different land-surface reanalysis data sets. Spatial variations in exhalation rates are primarily determined by the uranium content of the soil, but also influenced by soil texture and local water-table depth. Temporal variations are related to soil moisture variations as the molecular diffusion in the unsaturated soil zone depends on available air-filled pore space. The implemented diffusion parameterization was tested against campaign-based {sup 222}Rn soil profile measurements. Monthly {sup 222}Rn exhalation rates from European soils were calculated with a nominal spatial resolution of 0.083 x 0.083 and compared to long-term direct measurements of {sup 222}Rn exhalation rates in different areas of Europe. The two realizations of the {sup 222}Rn flux map, based on the different soil moisture data sets, both realistically reproduce the observed seasonality in the fluxes but yield considerable differences for absolute flux values. The mean {sup 222}Rn flux from soils in Europe is estimated to be 10 mBq m{sup -2} s{sup -1} (ERA-Interim/Land soil moisture) or 15 mBq m{sup -2} s{sup -1} (GLDAS (Global Land Data Assimilation System) Noah soil moisture) for the period 2006-2010. The corresponding seasonal variations with low fluxes in winter and high fluxes in summer range in the two realizations from ca. 7 to ca. 14 mBq m{sup -2} s{sup -1} and from ca. 11 to ca. 20 mBq m{sup -2} s{sup -1}, respectively. These systematic differences highlight the importance of realistic soil moisture data for a reliable estimation of {sup 222}Rn exhalation rates. Comparison with

A study of indoor radon, thoron and their exhalation rates in the environment of Fazilka district, Punjab, India

Science.gov (United States)

Narang, Saurabh; Kumar, Deepak; Sharma, Dinesh Kumar; Kumar, Ajay

2018-02-01

Over the last few decades, the study of radioactive radon gas has gained huge momentum due to its possible role in health related hazards. In the present work, pin-hole twin chamber single entrance dosimeters have been used for track measurements of radon and thoron. The annual average radon concentration varies from 50.3 to 204 Bq/m3 at all locations. Almost all the values are below the safe range provided by ICRP. Radon concentration is found to be higher in winter as compared to other seasons. Variation of radon with quality of dwellings is also discussed. The values of annual effective dose due to radon and thoron are also well within the range provided by ICRP and WHO. Radon and thoron exhalation rates are measured using SMART RnDuo monitor. The radon mass exhalation rates ranged from 11 to 71 mBq/kg/h while the thoron surface values ranged from 36 to 2048 Bq/m2/h. All the values are on the lower side. A weak correlation is found between radon and thoron concentrations and their exhalation rates. When compared with the values of other parts of northern India, the values of present investigation are on higher side.

Radon exhalation rate and natural radionuclide content in building materials of high background areas of Ramsar, Iran

International Nuclear Information System (INIS)

Bavarnegin, E.; Fathabadi, N.; Vahabi Moghaddam, M.; Vasheghani Farahani, M.; Moradi, M.; Babakhni, A.

2013-01-01

Radon exhalation rates from building materials used in high background radiation areas (HBRA) of Ramsar were measured using an active radon gas analyzer with an emanation container. Radon exhalation rates from these samples varied from below the lower detection limit up to 384 Bq.m −2 h −1 . The 226 Ra, 232 Th and 40 K contents were also measured using a high resolution HPGe gamma- ray spectrometer system. The activity concentration of 226 Ra, 232 Th and 40 K content varied from below the minimum detection limit up to 86,400 Bq kg −1 , 187 Bq kg −1 and 1350 Bq kg −1 , respectively. The linear correlation coefficient between radon exhalation rate and radium concentration was 0.90. The result of this survey shows that radon exhalation rate and radium content in some local stones used as basements are extremely high and these samples are main sources of indoor radon emanation as well as external gamma radiation from uranium series. -- Highlights: ► In the selection process of local samples, portable scintillometer (NaI) was used. ► The activity concentration of 226 Ra varied from below the MDL up to 86400 Bq kg −1 . ► The activity concentration of 232 Th varied from below the MDL up to 187 Bq kg −1 . ► The activity concentration of 40 K varied from below the MDL up to 1350 Bq kg −1

PO.RA project. An analysis on gas radon concentrations in soil versus fluctuations in the groundwater table; Progetto PO.RA.. Analisi della concentrazione di gas radon nel non saturo in relazione alla soggiacenza della falda freatica

Energy Technology Data Exchange (ETDEWEB)

Serentha' , C.; Torretta, M. [Agenzia Regionale per la Protezione dell' Ambiente della Lombardia, Dipartimento di Monza, Monza (Italy)

2001-09-01

Man is daily exposed to natural radiation, mainly due to cosmic rays and natural radioactive elements, whose most important radioactive daughters are {sup 222}Rn (radon) and {sup 220}Rn (thoron). Being these ones gaseous, they can spread through the ground, reaching the atmosphere and accumulating in rooms, where their concentrations may be very high. As radon exhalation is strongly connected with the hydrogeological features of the environment, this study tried to find a relationship between fluctuations in the groundwater table and gas radon concentrations in soil, in order to try estimates of indoor radon concentrations. [Italian] L'uomo e' quotidianamente esposto ad una radioattivita' di origine naturale, dovuta principalmente ai raggi cosmici ed alla presenza di alcuni elementi radioattivi naturali, i cui discendenti radioattivi piu' importanti sono il {sup 222}Rn (radon) e il {sup 220}Rn (thoron). Tali elementi, a causa della loro natura gassosa, si possono diffondere attraverso il terreno e raggiungere l'atmosfera sovrastante; cio' puo' provocarne l'accumulo in ambienti chiusi, dando luogo a concentrazioni anche elevate con possibili conseguenze sulla salute. Poiche' l'esalazione del gas radon e' foremente legata alle caratteristiche idrogeologiche dell'ambiente, in questo lavoro si e' cercato di definire una relazione che legasse le variazioni della soggiacenza della falda freatica alle variazioni della concentrazione del gas radon nel non saturo, al fine di verificare se sia possibile effettuare un'attivita' previsionale applicabile ai rilievi di gas radon indoor.

Survey of Gamma Dose and Radon Exhalation Rate from Soil Surface of High Background Natural Radiation Areas in Ramsar, Iran

Directory of Open Access Journals (Sweden)

Rouhollah Dehghani

2013-09-01

Full Text Available Background: Radon is a radioactive gas and the second leading cause of death due to lung cancer after smoking. Ramsar is known for having the highest levels of natural background radiation on earth. Materials and Methods: In this research study, 50 stations of high radioactivity areas of Ramsar were selected in warm season of the year. Then gamma dose and radon exhalation rate were measured.Results: Results showed that gamma dose and radon exhalation rate were in the range of 51-7100 nSv/hr and 9-15370 mBq/m2s, respectively.Conclusion: Compare to the worldwide average 16 mBq/m2s, estimated average annual effective of Radon exhalation rate in the study area is too high.

Radon transport modelling: User's guide to RnMod3d

Energy Technology Data Exchange (ETDEWEB)

Andersen, C.E

2000-08-01

RnMod3d is a numerical computer model of soil-gas and radon transport in porous media. It can be used, for example, to study radon entry from soil into houses in response to indoor-outdoor pressure differences or changes in atmospheric pressure. It can also be used for flux calculations of radon from the soil surface or to model radon exhalation from building materials such as concrete. The finite-volume model is a technical research tool, and it cannot be used meaningfully without good understanding of the involved physical equations. Some understanding of numerical mathematics and the programming language Pascal is also required. Originally, the code was developed for internal use at Risoe only. With this guide, however, it should be possible for others to use the model. Three-dimensional steady-state or transient problems with Darcy flow of soil gas and combined generation, radioactive decay, diffusion and advection of radon can be solved. Moisture is included in the model, and partitioning of radon between air, water and soil grains (adsorption) is taken into account. Most parameters can change in time and space, and transport parameters (diffusivity and permeability) may be anisotropic. This guide includes benchmark tests based on simple problems with known solutions. RnMod3d has also been part of an international model intercomparison exercise based on more complicated problems without known solutions. All tests show that RnMod3d gives results of good quality. (au)

Hydrogen peroxide in exhaled breath condensate: A clinical study

Directory of Open Access Journals (Sweden)

C Nagaraja

2012-01-01

Full Text Available Objectives: To study the ongoing inflammatory process of lung in healthy individuals with risk factors and comparing with that of a known diseased condition. To study the inflammatory response to treatment. Background: Morbidity and mortality of respiratory diseases are raising in trend due to increased smokers, urbanization and air pollution, the diagnosis of these conditions during early stage and management can improve patient′s lifestyle and morbidity. Materials and Methods: One hundred subjects were studied from July 2010 to September 2010; the level of hydrogen peroxide concentration in exhaled breath condensate was measured using Ecocheck. Results: Of the 100 subjects studied, 23 were healthy individuals with risk factors (smoking, exposure to air pollution, and urbanization; the values of hydrogen peroxide in smokers were 200-2220 nmol/l and in non-smokers 340-760 nmol/l. In people residing in rural areas values were 20-140 nmol/l in non-smokers and 180 nmol/l in smokers. In chronic obstructive pulmonary disease cases, during acute exacerbations values were 540-3040 nmol/l and 240-480 nmol/l following treatment. In acute exacerbations of bronchial asthma, values were 400-1140 nmol/l and 100-320 nmol/l following treatment. In cases of bronchiectasis, values were 300-340 nmol/l and 200-280 nmol/l following treatment. In diagnosed pneumonia cases values were 1060-11800 nmol/l and 540-700 nmol/l following treatment. In interstitial lung diseases, values ranged from 220-720 nmol/l and 210-510 nmol/l following treatment. Conclusion: Exhaled breath condensate provides a non-invasive means of sampling the lower respiratory tract. Collection of exhaled breath condensate might be useful to detect the oxidative destruction of the lung as well as early inflammation of the airways in a healthy individual with risk factors and comparing the inflammatory response to treatment.

Protocol proposal for radon concentration mensuration from granitic rocks in marble factory

International Nuclear Information System (INIS)

Del Claro, Flavia

2016-01-01

Naturally occurring radionuclides such as radon ( 222 Rn), its decay products and other elements from the radioactive series of uranium ( 238 U and 235 U) and thorium ( 232 Th) are an important source of human exposure to natural radioactivity. The worldwide evaluation of health radiobiological effects and risks from population exposure to natural radionuclides is a growing concern. Radionuclides such as radon ( 222 Rn), the thoron ( 220 Rn), radio ( 2 '2'6Ra), thorium ( 23 '2Th) and potassium ( 40 K) may occur in materials commonly used in construction of dwellings and buildings. Thus, the radioactivity from marbles and granites is of importance, so that under certain conditions these materials radioactivity levels can be hazardous requiring the implementation of mitigation measurements. This research presents a technical protocol marble factories for the control human exposure to natural radioactivity exhaled from granitic rocks. The protocol was based on measurements of the 222 Rn and 220 Rn concentration in Brazilian granite rocks commonly nationally and exported. The 222 Rn and 220 Rn measurements were done using the AlphaGUARD (Saphymo GmbH) and RAD7 (Durridge Company) apparatus, respectively. The samples of granite were sealed in glass jars for 40 days in to achieve secular equilibrium between 226 Ra and 222 Rn radionuclides. The measurements were performed on Applied Nuclear Physics Laboratory at the Federal Technological University of Parana. Also, solid-state nuclear track detectors CR-39 were installed in a marble factory environments located in Curitiba - Parana for the evaluation of 222 Rn concentrations in workplaces. The CR-39 detectors were exposed for about 90 days and submitted to etching process. The alpha particle tracks were observed using an optical microscope. Some granite samples analyzed presented 222 Rn concentrations of attention, since the average values ranged from 3 ± 1 Bq/m 3 to 2087 ± 19 Bq/m 3 . The results obtained

Radon soil-gas concentration and exhalation from mine tailings dams in South Africa

Energy Technology Data Exchange (ETDEWEB)

Ongori, J.; Lindsay, R. [University of the Western Cape, Department of Physics, Private Bag X17, Bellville 7535 (South Africa); Newman, R. [Stellenbosch University, Department of Physics, Private Bag X1 Matieland 7602 (South Africa); Maleka, P. [iThemba LABS, Department of Nuclear Physics, P. O. Box 722, Somerset West 7129 (South Africa)

2014-07-01

In Africa as well as in the world, South Africa plays an important role in the mining industry which dates back almost 120 years. Mining activities in South Africa mainly take place in Gauteng Province. Every year million of tons of rocks are taken from underground, milled and processed to extract gold. The uranium bearing tailings are disposed in dumpsites. These tailings dumps contain considerable amounts of radium ({sup 226}Ra) and have therefore been identified as large sources of radon ({sup 222}Rn). Radon is a noble gas formed by the decay of radium which in turn is derived from the radioactive decay of uranium ({sup 238}U). Radon release from these tailings dumps pose health concerns for the surrounding communities. Radon soil gas concentrations and exhalations from a non-operational mine dump (Kloof) which belongs to Carletonville Gold Field, Witwatersrand, South Africa have been investigated. The continuous radon monitor, the Durridge RAD7 was used to measure {sup 222}Rn soil gas concentration in the tailings dump at five different spots. The radon soil gas concentration levels were measured at depths starting from 30 cm below ground/air interface up to 110 cm at intervals of 20 cm. The concentrations recorded ranged from 26±1 to 472±23 kBq.m{sup -3}. Furthermore, thirty four soil samples were taken from the spots where radon soil gas measurements were measured for laboratory-based measurement using the low background Hyper Pure Germanium (HPGe) gamma-ray detector available at the Environmental Radioactivity Laboratory (ERL), iThemba LABS, Western Cape Province. The soil samples were collected in the depth range 0-30 cm. After analysis the weighted average activity concentrations in the soils samples were 308±7 Bq.kg{sup -1}, 255±5 Bq.kg{sup -1} and 18±1 Bq.kg{sup -1} for {sup 238}U, {sup 40}K and {sup 232}Th, respectively. A number of factors such as the radium activity concentration and its distribution in soil grains, soil grain size, soil porosity

Levels of thoron and progeny in high background radiation area of southeastern coast of Odisha (India))

International Nuclear Information System (INIS)

Ramola, R. C.; Gusain, G. S.; Rautela, B. S.; Sagar, D. V.; Prasad, G.; Shahoo, S. K.; Ishikawa, T.; Omori, Y.; Janik, M.; Sorimachi, A.; Tokonami, S.

2012-01-01

Exposure to radon, 222 Rn, is assumed to be the most significant source of natural radiation to human beings in most cases. It is thought that radon and its progeny are major factors that cause cancer. The presence of thoron, 220 Rn, was often neglected because it was considered that the quantity of thoron in the environment is less than that of radon. However, recent studies have shown that a high thoron concentration was found in some regions and the exposure to 220 Rn and its progeny can equal or several time exceed that of 220 Rn and its progeny. The results of thoron and its progeny measurements in the houses of high background radiation area (HBRA) of the southeastern coast of Odisha (India)) presented here. This area is one of the high background radiation areas in India with a large deposit of monazite sand which is the probable source of thoron. Both active and passive methods were employed for the measurement of thoron and its progeny in cement, brick and mud houses in the study area. Thoron concentration was measured using RAD-7 and Raduet. A CR-39 track detector was employed for the measurement of environmental thoron progeny, both in active and passive modes. Thoron and its progeny concentrations were found to be comparatively high in the area. A comparison between the results obtained with various techniques is presented in this paper. (authors)

Levels of thoron and progeny in high background radiation area of southeastern coast of Odisha (India))

Energy Technology Data Exchange (ETDEWEB)

Ramola, R C; Gusain, G S; Rautela, B S [Dept. of Physics, H.N.B. Garhwal Univ., Badshahi Thaul Campus, Tehri Garhwal 249199 (India); Sagar, D V [Health Physics Unit EAD, BARC, IRE, OSCOM, Matikhalo, Ganjam, Odisha 761 045 (India); Prasad, G; Shahoo, S K; Ishikawa, T; Omori, Y; Janik, M [National Inst. of Radiological Sciences, Anagawa 4-9-1, Inage-ku, Chiba 263-8555 (Japan); Sorimachi, A; Tokonami, S [Inst. of Radiation Emergency Medicine, Hirosaki Univ., Aomori 036-8564 (Japan)

2012-07-01

Exposure to radon, {sup 222}Rn, is assumed to be the most significant source of natural radiation to human beings in most cases. It is thought that radon and its progeny are major factors that cause cancer. The presence of thoron, {sup 220}Rn, was often neglected because it was considered that the quantity of thoron in the environment is less than that of radon. However, recent studies have shown that a high thoron concentration was found in some regions and the exposure to {sup 220}Rn and its progeny can equal or several time exceed that of {sup 220}Rn and its progeny. The results of thoron and its progeny measurements in the houses of high background radiation area (HBRA) of the southeastern coast of Odisha (India)) presented here. This area is one of the high background radiation areas in India with a large deposit of monazite sand which is the probable source of thoron. Both active and passive methods were employed for the measurement of thoron and its progeny in cement, brick and mud houses in the study area. Thoron concentration was measured using RAD-7 and Raduet. A CR-39 track detector was employed for the measurement of environmental thoron progeny, both in active and passive modes. Thoron and its progeny concentrations were found to be comparatively high in the area. A comparison between the results obtained with various techniques is presented in this paper. (authors)

The influence of thoron on measurement results of radon exhalation rate

CERN Document Server

Xiao De Tao; Ling Qiu; Leung, J K C

2002-01-01

Because of thoron exhalation, the measurement results of radon exhalation rate using a local still method is usually larger than the true value of radon flux rate of the monitored material surface. The influence of sup 2 sup 1 sup 6 Po(ThA) on radon exhalation rate can be eliminated for sensitive radon monitors. Theoretical evaluations of the influence of sup 2 sup 1 sup 2 Bi(ThC) and sup 2 sup 1 sup 2 Po(ThC')on radon exhalation rate are carried out in a sampler with diameter of 188 mm, and height of 125 mm, and supplied electrostatic field inside (generated by high voltage and electret) under following conditions: the sampling time are 1, 2, 3 h, respectively, thoron exhalation rate is 100 times of radon's. The calculation results indicate that the measurement results of radon flux rate are possibly 35.5% larger than true value due to the influence of thoron for fast and multifunctional radon monitors with electret, high voltage, respectively and using CR-39 SSNTD as detector, but this influence is negligib...

Performance test of passive radon–thoron discriminative detectors on environmental parameters

International Nuclear Information System (INIS)

Sorimachi, Atsuyuki; Tokonami, Shinji; Omori, Yasutaka; Ishikawa, Tetsuo

2012-01-01

This paper describes how humidity, wind and ambient aerosols in air influence the detection responses of passive detectors. Two types of alpha track detectors based on a passive radon ( 222 Rn)–thoron ( 220 Rn) discriminative measurement technique were used: the Raduet and Radopot detectors that were developed and calibrated by the National Institute of Radiological Sciences, Japan. The initial experiment showed that the infiltration rate of 220 Rn onto sponges with a high air exchange rate for the Raduet detectors was one third lower than that onto filters for the Radopot detectors. Little distinct dependence on humidity was observed for the 222 Rn detection responses of both detectors. For 220 Rn, the detection responses of both detectors for the high air exchange rate seemed to decrease slightly at high humidity conditions. The 220 Rn detection responses of the Radopot detectors had little influence from wind speed. The 220 Rn detection responses of the Raduet detectors for the high air exchange rate seemed to decrease at low wind speeds. Furthermore, there was little difference between the detection responses in the presence and absence of ambient aerosol particles because the ambient aerosols were filtered out during their passive diffusion through the sponges and filters for the Raduet and Radopot detectors, respectively.

Mapping of 222Rn and 4He in soil gas over a karstic limestone-granite boundary: correlation of high indoor 222Rn with zones of enhanced permeability

International Nuclear Information System (INIS)

O'Connor, P.J.; Gallagher, V.; Van den Boom, G.

1992-01-01

Recent indoor radon reconnaissance surveys in Ireland have identified buildings with high radon concentrations (up to 1700 Bq.m -3 ) overlying Carboniferous karstic limestone sequences in the western part of the country. A detailed investigation of indoor 222 Rn and soil gas 222 Rn and 4 He concentrations has been carried out over a karstic limestone-uraniferous granite boundary in County Galway. High indoor 222 Rn concentrations occur in dwellings over both lithologies. Radon migratory routes in bedrock and overburden appear to be controlled by zones of enhanced permeability, e.g. fractures, faults, etc. which are defined by linear arrays of elevated 4 He soil gas values. While the ultimate source of radon remains conjectural, the greatly enhanced permeability of karstified limestone is thought to be of fundamental importance in providing a means of rapid radon transport into overlying soils and buildings. (author)

Assessing RN-to-RN peer review on clinical units.

Science.gov (United States)

Pfeiffer, Judith A; Wickline, Mary A; Deetz, Jill; Berry, Elise S

2012-04-01

The primary purpose of this study was to measure informal registered nurse (RN)-to-RN peer review (defined as collegial communication about the quality of nursing care) at the work-unit level. Survey design with cluster sampling of 28 hospital or ambulatory care units (n = 541 respondents). Results were compared with existing patient safety and satisfaction data. A chi-squared test was used to compare responses against nurse characteristics. Nurses agreed that RN-to-RN peer review takes place on their units, but no correlation with patient safety and satisfaction data was found. Misunderstandings about the meaning of peer review were evident. Open-ended comments revealed barriers to peer review: fear of retribution, language barriers and lack of professionalism. Nurses need clarification of peer review. Issues with common language in a professional environment need to be addressed and nurses can learn collaboration from each other's cultures. Managers should support RN-to-RN peer review on clinical units. Methods used here may be useful to assess current departmental nurse peer review. © 2011 Blackwell Publishing Ltd.

Time variation of 222Rn concentration and gamma level in a half-basement room

International Nuclear Information System (INIS)

Iimoto, Takeshi; Eguchi, Hoshio; Kosako, Toshiso; Sugiura, Nobuyuki

1998-01-01

Correlation between 222 Rn (radon) concentration and gamma level in a half-basement has been discussed. In order to decrease the background count of a whole-body counter (WBC), a ventilation blower of 72 m 2 h -1 was installed. The device succeeded in a big reduction of radon concentration in the half-basement and then the background of WBC (NaI(Tl)) decreased to the 76.5% of the saturated value. Through a radon saturation test the exhalation rate of radon from concrete wall was estimated as 2.1 Bqm -2 h -1 by a simple model calculation. In addition, through a ventilation test, the procedure was analyzed by another simple model. (author)

Thoron exhalation rate monitor with absorber

International Nuclear Information System (INIS)

Xiao Detao; Zhao Guizhi

2003-01-01

A measurement method of thoron exhalation rate is developed based on the characteristic of thorium C' which emits a α particle with higher energy than those of α particles released from radon and radon progenies. The principles of discriminating radon and realizing thoron exhalation rate measurement on the material surface with absorber, the passive and integrated thoron exhalation rate monitor studied, and its calibration coefficient determination method are introduced. The effectiveness of mitigating thoron exhalation rate of wall surface by depressurization inside wall and thoron exhalation rates on some materials surfaces were measured by using the studied monitors. The calibration coefficient of the studied monitor is R=0.246 cm -2 ·(kBq·m -3 ·h) -1 . The lower limit of detection is LLD=18.4 mBq·m -2 ·s -1 when the sampling period is 7 days and the standard deviation of background track densities of the adopted CR-39 SSNTD is s T =1.6 cm -2

Application of the can technique and radon gas analyzer for radon exhalation measurements

Energy Technology Data Exchange (ETDEWEB)

Fazal-ur-Rehman E-mail: fazalr@kfupm.edu.sa; Al-Jarallah, M.I.; Musazay, M.S.; Abu-Jarad, F

2003-12-01

A passive 'can technique' and an active radon gas analyzer with an emanation container were applied for radon exhalation rate measurements from different construction materials, viz. five marble seven ceramic and 100 granite tiles used in Saudi Arabia. The marble and ceramic tiles did not show detectable radon exhalation using the active radon gas analyzer system. However the granite tiles showed relatively high radon exhalations, indicating a relatively high uranium content. A comparison of the radon exhalation rates measured by the two techniques showed a linear correlation coefficient of 0.57. The radon exhalation rates from the granites varied from 0.02 to 6.58 Bq m{sup -2} h{sup -1} with an average of 1.35{+-}1.40 Bq m{sup -2} h{sup -1}. The geometric mean and the geometric standard deviation of the frequency distribution were found to be 0.80 and 3.1, respectively. The track density found on the nuclear track detectors in the can technique exposed to the granites, having high exhalation rates, varied linearly with exposure time with a linear correlation coefficient of 0.99. This experimental finding agrees with the theoretical prediction. The can technique showed sensitivity to low radon exhalation rates from ceramic, marble and some granite over a period of 2 months, which were not detectable by the active radon gas analyzer system. The reproducibility of data with both measuring techniques was found to be within a 7% deviation.

Suggestions for inclulsion of radon exhalation control target in building materials radioactivity standards

International Nuclear Information System (INIS)

Liu Fudong; Liu Senlin; Pan Ziqiang; Zhang Yonggui

2010-01-01

The specific-activity and radon exhalation rate from 26 building material samples from different areas were measured with high pure germanium (HPGe) gamma spectrometer and activated carbon cartridge. It is shown that the radium content is not completely relevant to radon exhalation rate from some building material. The existing national standards on 'The Limit of Radionuclides in Building Materials' (GB 6566-2001) only present internal exposure index as control target but not for radon exhalation rate; in fact, the radon exhalation rate from building materials is closely nearly related to indoor radon concentration. So we suggest that the radon exhalation control target should be included in the national standards on 'The Limit of Radionuclides in Building Materials'. (authors)

Expected indoor 222Rn levels in counties with very high and very low lung cancer rates

International Nuclear Information System (INIS)

Cohen, B.L.

1989-01-01

Counties in the US with high lung cancer rates should have higher average 222 Rn levels than counties with low lung cancer rates, assuming the average 222 Rn level in a county is not correlated with other factors that cause lung cancer. The magnitude of this effect was calculated, using the absolute risk model, the relative risk model, and an intermediate model, for females who died in 1950-1969. The results were similar for all three models. We concluded that, ignoring migration, the average Rn level in the highest lung cancer counties should be about three times higher than in the lowest lung cancer counties according to the theory. Preliminary data are presented indicating that the situation is quite the opposite: The average Rn level in the highest lung cancer counties was only about one-half that in the lowest lung cancer counties

Radon exhalation rates of some granites used in Serbia

Directory of Open Access Journals (Sweden)

Nikolić Mladen D.

2015-01-01

Full Text Available In order to address concern about radon exhalation in building material, radon exhalation rate was determined for different granites available on Serbian market. Radon exhalation rate, along with mass exhalation rate and effective radium content were determined by closed chamber method and active continuous radon measurement technique. For this research, special chambers were made and tested for back diffusion and leakage, and the radon concentrations measured were included in the calculation of radon exhalation. The radon exhalation rate ranged from 0.161 Bq/m2h to 0.576 Bq/m2h, the mass exhalation rate from 0.167 Bq/kgh to 0.678 Bq/kgh, while the effective radium content was found to be from 12.37 Bq/kg to 50.23 Bq/kg. The results indicate that the granites used in Serbia have a low level of radon exhalation.

Development of a predictive methodology for identifying high radon exhalation potential areas; Mise au point d'une methodologie predictive des zones a fort potentiel d'exhalation du radon

Energy Technology Data Exchange (ETDEWEB)

Ielsch, G

2001-07-01

Radon 222 is a radioactive natural gas originating from the decay of radium 226 which itself originates from the decay of uranium 23 8 naturally present in rocks and soil. Inhalation of radon gas and its decay products is a potential health risk for man. Radon can accumulate in confined environments such as buildings, and is responsible for one third of the total radiological exposure of the general public to radiation. The problem of how to manage this risk then arises. The main difficulty encountered is due to the large variability of exposure to radon across the country. A prediction needs to be made of areas with the highest density of buildings with high radon levels. Exposure to radon varies depending on the degree of confinement of the habitat, the lifestyle of the occupants and particularly emission of radon from the surface of the soil on which the building is built. The purpose of this thesis is to elaborate a methodology for determining areas presenting a high potential for radon exhalation at the surface of the soil. The methodology adopted is based on quantification of radon exhalation at the surface, starting from a precise characterization of the main local geological and pedological parameters that control the radon source and its transport to the ground/atmosphere interface. The methodology proposed is innovative in that it combines a cartographic analysis, parameters integrated into a Geographic Information system, and a simplified model for vertical transport of radon by diffusion through pores in the soil. This methodology has been validated on two typical areas, in different geological contexts, and gives forecasts that generally agree with field observations. This makes it possible to identify areas with a high exhalation potential within a range of a few square kilometers. (author)

Protocol proposal for radon concentration mensuration from granitic rocks in marble factory; Proposta de protocolo para medicao de concentracoes de radonio proveniente de rochas graniticas em marmorarias

Energy Technology Data Exchange (ETDEWEB)

Del Claro, Flavia

2016-11-01

Naturally occurring radionuclides such as radon ({sup 222}Rn), its decay products and other elements from the radioactive series of uranium ({sup 238}U and {sup 235}U) and thorium ({sup 232}Th) are an important source of human exposure to natural radioactivity. The worldwide evaluation of health radiobiological effects and risks from population exposure to natural radionuclides is a growing concern. Radionuclides such as radon ({sup 222}Rn), the thoron ({sup 220}Rn), radio ({sup 2}'2'6Ra), thorium ({sup 23}'2Th) and potassium ({sup 40}K) may occur in materials commonly used in construction of dwellings and buildings. Thus, the radioactivity from marbles and granites is of importance, so that under certain conditions these materials radioactivity levels can be hazardous requiring the implementation of mitigation measurements. This research presents a technical protocol marble factories for the control human exposure to natural radioactivity exhaled from granitic rocks. The protocol was based on measurements of the {sup 222}Rn and {sup 220}Rn concentration in Brazilian granite rocks commonly nationally and exported. The {sup 222}Rn and {sup 220}Rn measurements were done using the AlphaGUARD (Saphymo GmbH) and RAD7 (Durridge Company) apparatus, respectively. The samples of granite were sealed in glass jars for 40 days in to achieve secular equilibrium between {sup 226}Ra and {sup 222}Rn radionuclides. The measurements were performed on Applied Nuclear Physics Laboratory at the Federal Technological University of Parana. Also, solid-state nuclear track detectors CR-39 were installed in a marble factory environments located in Curitiba - Parana for the evaluation of {sup 222}Rn concentrations in workplaces. The CR-39 detectors were exposed for about 90 days and submitted to etching process. The alpha particle tracks were observed using an optical microscope. Some granite samples analyzed presented {sup 222}Rn concentrations of attention, since the average

Determination of committed effective doses to skin due to 238U, 232Th and 222Rn from the application of various Moroccan black soap (Saboun Beldi) samples by members of the general public

International Nuclear Information System (INIS)

Misdaq, M. A.; Outeqablit, K.

2010-01-01

238 U, 232 Th, 222 Rn and 220 Rn concentrations were measured inside various Moroccan black soap samples widely used by the Moroccan population in traditional baths (Hammams) by using both CR-39 and LR-115 type II solid state nuclear track detectors. The measured 238 U, 232 Th, 222 Rn and 220 Rn concentrations, respectively, ranged from (3.7±0.2) to (11.7±0.7) mBq kg -1 , (0.11±0.01) to (0.32±0.02) mBq kg -1 , (3.8±0.2) to (11.6±0.6) Bq kg -1 and (0.10±0.01) to (0.31±0.02) Bq kg -1 for the Moroccan black soap samples studied. The influence of pollution on the concentrations of these radionuclides inside the considered Moroccan black soap was investigated. A new dosimetric model for evaluating annual committed effective doses due to 238 U, 232 Th and 222 Rn to the skin of different age groups of the Moroccan populations from the application of the black soap samples studied was developed. The maximum total committed effective dose to the skin due to 238 U, 232 Th and 222 Rn from the application of unpolluted black soap samples 20 min per week by the Moroccan populations was found to be equal to (0.88±0.05) μSv y -1 cm -2 . (authors)

Interpretation of radon isotope levels in geothermal fields

International Nuclear Information System (INIS)

Barry, B.J.; Whitehead, N.E.

1997-01-01

Measurements of 220 Rn and 222 Rn levels at Wairakei have been studied in relation to a model which considers the times taken for two separate processes, desorption of gases from the rock and fluid movement to a well. The relatively high 220 Rn levels are indicative of fluid movement through porous aquifer rock. (author)

Determination of radon exhalation from construction materials using VOC emission test chambers.

Science.gov (United States)

Richter, M; Jann, O; Kemski, J; Schneider, U; Krocker, C; Hoffmann, B

2013-10-01

The inhalation of (222) Rn (radon) decay products is one of the most important reasons for lung cancer after smoking. Stony building materials are an important source of indoor radon. This article describes the determination of the exhalation rate of stony construction materials by the use of commercially available measuring devices in combination with VOC emission test chambers. Five materials - two types of clay brick, clinker brick, light-weight concrete brick, and honeycomb brick - generally used for wall constructions were used for the experiments. Their contribution to real room concentrations was estimated by applying room model parameters given in ISO 16000-9, RP 112, and AgBB. This knowledge can be relevant, if for instance indoor radon concentration is limited by law. The test set-up used here is well suited for application in test laboratories dealing with VOC emission testing. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Application of passive type radon detectors to find fissures in banks caused by the southern Hyogo prefectural earthquake in Japan

International Nuclear Information System (INIS)

Saegusa, J.; Yamasaki, K.; Tsujimoto, T.; Morishima, H.; Shimo, M.; Murakami, A.; Hasegawa, T.

1996-01-01

Innumerable fissures were formed widely in Hanshin area in Japan by the former southern Hyogo prefectural earthquake occurred on Jan.17, 1995. In this study, as a preliminary investigation, we applied passive type radon detector Pico-Rad (U.S. Packard Instrument Co. Ltd.) with hemispheric plastic cover over them around the fissure along on the bank of two reservoirs to examine whether there is possibility to find fissures using the characteristics of 222 Rn migration. One of the reservoir, Taniyamakami-ike, is located at the north of the Awaji-shima island at a distance of about 4 km from the seismic center of this earthquake. On the whole, 222 Rn exhalation rates were high on a line of 2 m below the edge of the bank and got lower in proportion to the distance from this line. Those top of the bank had middle values among the lines. The mean 222 Rn exhalation rate was 4.7 mBq m -2 s -1 , and in these data we found some singularly high 222 Rn points. The other reservoir named Hosho-ike is located at northwestern Nagaokakyo city of Kyoto prefecture and the Komyoji active faulting runs from north to south parallel with the bank about 120 m to the west. In this bank, a fissure about 50 m in length and 0.1 m in width was taken shape. 222 Rn exhalation rates were relatively high on the top of the bank compared with on the slope of the bank. The mean 222 Rn exhalation rate of 5 points which were measured on the fissure was 16 mBq m -2 s -1 , and that which were measured on about 1 m to the east from the fissure was 4.9 mBq m -2 s -1 and in case about 1 m to the west was 4.2 mBq m -2 s -1 . From these results we concluded that there is a possibility to find fissures inside the bank using the characteristics of 222 Rn migration. Our future objective is to find fissures inside banks non-destructively. (author)

The origin of mouth-exhaled ammonia.

Science.gov (United States)

Chen, W; Metsälä, M; Vaittinen, O; Halonen, L

2014-09-01

It is known that the oral cavity is a production site for mouth-exhaled NH3. However, the mechanism of NH3 production in the oral cavity has been unclear. Since bacterial urease in the oral cavity has been found to produce ammonia from oral fluid urea, we hypothesize that oral fluid urea is the origin of mouth-exhaled NH3. Our results show that under certain conditions a strong correlation exists between oral fluid urea and oral fluid ammonia (NH4(+)+NH3) (rs = 0.77, p oral fluid NH3 and mouth-exhaled NH3 (rs = 0.81, p oral fluid pH. Bacterial urease catalyses the hydrolysis of oral fluid urea to ammonia (NH4(+)+NH3). Oral fluid ammonia (NH4(+)+NH3) and pH determine the concentration of oral fluid NH3, which evaporates from oral fluid into gas phase and turns to mouth-exhaled NH3.

Prognostic Role of Exhaled Breath Condensate pH and Fraction Exhaled Nitric Oxide in Systemic Sclerosis Related Interstitial Lung Disease.

Science.gov (United States)

Guillen-Del Castillo, Alfredo; Sánchez-Vidaurre, Sara; Simeón-Aznar, Carmen P; Cruz, María J; Fonollosa-Pla, Vicente; Muñoz, Xavier

2017-03-01

Interstitial lung disease (ILD) is one of the major causes of death in systemic sclerosis (SSc). This study investigated exhaled breath (EB) and exhaled breath condensate (EBC) biomarkers in patients with SSc and analyzed their role as a prognostic tool in SSc-related ILD. Fraction exhaled nitric oxide (FeNO) and exhaled carbon monoxide (eCO) measured in EB, together with pH, nitrite, nitrate and interleukin-6 levels measured in EBC were prospectively analyzed in 35 patients with SSc. Twelve patients had established ILD by chest high-resolution computed tomography (HRCT), and 23 patients showed no evidence of ILD. EB and EBC biomarkers were determined at inclusion, and pulmonary function tests were annually performed during 4 years of follow-up. No differences at baseline biomarkers levels were found between groups. In all patients studied, low EBC pH levels were associated with a decreased diffusing capacity for carbon monoxide (DLCO) during follow-up. Low FeNO levels were correlated with lower forced vital capacity (FVC) at baseline, 4years of follow-up and with a decrease in FVC and DLCO during monitoring. Among ILD patients, high eCO levels were correlated with lower baseline FVC. In the global cohort, a worse progression-free survival was identified in patients with EBC pH values lower than 7.88 and FeNO levels lower than 10.75ppb (Log Rank P=.03 and P<.01, respectively). EB and EBC could help to detect patients likely to present a deterioration on lung function during follow up. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.

Exhaled CO, a predictor of lung function?

DEFF Research Database (Denmark)

Fabricius, Peder; Scharling, Henrik; Løkke, Anders

2007-01-01

and whether CO could provide additional information to usual measures of smoking regarding prediction of present lung function and decline in lung function over an extended period of time. METHOD: Cigarette smokers from the Copenhagen City Heart Study with valid measures of lung function and exhaled CO......; in total 3738 subjects, 2096 women and 1642 men. RESULTS: Subjects not inhaling had slightly lower exhaled CO values than those inhaling, but substantially higher values than non-smokers (PSmokers of plain cigarettes had slightly lower CO values than smokers of filter cigarettes (P...BACKGROUND: Smoking is associated with an accelerated loss of lung function and inhalation accelerates the decline further. Exhaled CO reflects the exposure of smoke to the lungs. AIM: To investigate whether self-reported inhalation and type of cigarette influenced the level of exhaled CO...

Diesel oil removal by immobilized Pseudoxanthomonas sp. RN402.

Science.gov (United States)

Nopcharoenkul, Wannarak; Netsakulnee, Parichat; Pinyakong, Onruthai

2013-06-01

Pseudoxanthomonas sp. RN402 was capable of degrading diesel, crude oil, n-tetradecane and n-hexadecane. The RN402 cells were immobilized on the surface of high-density polyethylene plastic pellets at a maximum cell density of 10(8) most probable number (MPN) g(-1) of plastic pellets. The immobilized cells not only showed a higher efficacy of diesel oil removal than free cells but could also degrade higher concentrations of diesel oil. The rate of diesel oil removal by immobilized RN402 cells in liquid culture was 1,050 mg l(-1) day(-1). Moreover, the immobilized cells could maintain high efficacy and viability throughout 70 cycles of bioremedial treatment of diesel-contaminated water. The stability of diesel oil degradation in the immobilized cells resulted from the ability of living RN402 cells to attach to material surfaces by biofilm formation, as was shown by CLSM imaging. These characteristics of the immobilized RN402 cells, including high degradative efficacy, stability and flotation, make them suitable for the purpose of continuous wastewater bioremediation.

Exhalation of radon and thoron from ground surface

International Nuclear Information System (INIS)

Megumi, Kazuko

1978-01-01

When radon and thoron in the environment are considered, the exhalations of radon and thoron from the ground surface are important. The following matters are described: a method of measuring directly the quantities of radon and thoron exhaled from the ground surface, the respective quantities measured by the method in summer and winter, and the dependence of the exhalations upon soil particle sizes. In this direct method, to obtain the exhalation quantities, radon and thoron from the ground surface are adsorbed in granular active carbon, and the γ-ray spectra are measured. The method is capable of measuring radon and thoron simultaneously in direct and inexpensive manner. For continuous measurement, however, it needs further improvement. The measurements by the method revealed the difference between summer and winter, the effect of rainfall, the dependence on soil particle size and on soil moisture of radon and thoron exhalations. (J.P.N.)

Variation of radon exhalation on building materials

International Nuclear Information System (INIS)

Liu Fudong; Liu Senlin; Wang Chunhong; Pan Ziqiang; Zhang Yonggui; Ji Dong

2009-01-01

The 19 samples from different building material factories were collected for four kinds of building materials. The activity concentration and radon exhalation of building materials were measured. The radon exhalations of building materials are not obviously different if the component is same and the processes of building materials are similar. However, the radon exhalations of same kind of building material are greatly different if the components are different and the processes of building material are varied even if the activity concentrations of building material are similar. (authors)

Radon concentration and exhalation rates in building material samples from crushing zone in Shivalik Foot Hills

International Nuclear Information System (INIS)

Pundir, Anil; Kamboj, Sunil; Bansal, Vakul; Chauhan, R.P.; Rana, Rajinder Singh

2012-01-01

Radon ( 222 Rn) is an inert radioactive gas in the decay chain of uranium ( 238 U). It continuously emanates from soil to the atmosphere. Radon and its progeny are the major natural radioactive sources for the ambient radioactivity on Earth. A number of studies on radon were performed in recent decades focusing on its transport and movement in the atmosphere under different meteorological conditions. Building materials are the main source of radon inside buildings. Some construction materials are naturally more radioactive and removal of such material from the earth's crust and their subsequent use in construction of buildings further enhances the radioactivity level. The knowledge of radioactivity level in the building materials makes us aware about the management, guidelines and standards in construction of buildings. The main objective of the present investigations is to measure radon Concentration and exhalation rates in the samples collected from the Crushing zone of Shivalik foot hills. Different types of materials are being used in Northern part of India for construction of dwellings. For the measurement of radon concentration and its exhalation rates in building materials, LR-115 detectors were exposed in closed plastic canisters for three months. At the end of the exposure time, the detectors were subjected to a chemical etching process in 2.5N NaOH solution. The tracks produced by the alpha particles were observed and counted under an optical Olympus microscope at 600X. The measured track density was converted into radon concentration using a calibration factor. The surface and mass exhalation rates of radon have also been calculated using present data. The results indicate that the radon concentration varies appreciably from sample to sample and they were found to satisfy the safety criteria. There are samples in which radon concentration is higher and may enhance the indoor radiation levels when used as building construction materials. (author)

Development of a predictive methodology for identifying high radon exhalation potential areas; Mise au point d'une methodologie predictive des zones a fort potentiel d'exhalation du radon

Energy Technology Data Exchange (ETDEWEB)

Ielsch, G

2001-07-01

Radon 222 is a radioactive natural gas originating from the decay of radium 226 which itself originates from the decay of uranium 23 8 naturally present in rocks and soil. Inhalation of radon gas and its decay products is a potential health risk for man. Radon can accumulate in confined environments such as buildings, and is responsible for one third of the total radiological exposure of the general public to radiation. The problem of how to manage this risk then arises. The main difficulty encountered is due to the large variability of exposure to radon across the country. A prediction needs to be made of areas with the highest density of buildings with high radon levels. Exposure to radon varies depending on the degree of confinement of the habitat, the lifestyle of the occupants and particularly emission of radon from the surface of the soil on which the building is built. The purpose of this thesis is to elaborate a methodology for determining areas presenting a high potential for radon exhalation at the surface of the soil. The methodology adopted is based on quantification of radon exhalation at the surface, starting from a precise characterization of the main local geological and pedological parameters that control the radon source and its transport to the ground/atmosphere interface. The methodology proposed is innovative in that it combines a cartographic analysis, parameters integrated into a Geographic Information system, and a simplified model for vertical transport of radon by diffusion through pores in the soil. This methodology has been validated on two typical areas, in different geological contexts, and gives forecasts that generally agree with field observations. This makes it possible to identify areas with a high exhalation potential within a range of a few square kilometers. (author)

Determine concentration radon 222Rn in the air inside and outside the buildings at the summer province of Baghdad

International Nuclear Information System (INIS)

Al-Ataby, N.R.; Aisa, B.H.; Jebir, H.M.; Hatem, J.N.

2010-01-01

In this study, Was use of solid-state nuclear track detectors in the measurement of concentrations of radon 222 Rn inside and outside of the buildings in the summer and winter of the Baghdad province and because of the high features of the technical sensitivity and efficiency to record track of charged particles (such as protons and alpha particles and fission fragments) . Is the radon of Environmental Pollutions that is caused health problems , that was seemed the concern at the problem of pollution, radon gas 222 Rn and thoron gas 220 Rn and the considerable risk resulting from exposure to these isotopes by alpha particles emitted which have proved the relationship between exposure to emitted alpha particles with the incidence of disease of lung cancer. In this study, measured the concentration of radon 222 Rn inside and outside buildings in the summer and winter in several areas from the Baghdad province and as showed in the attached tables. Been studied the environmental radioactivity and measurement of the concentration of radon gas in the air in different parts of the city of Baghdad. the highest concentration was Found in the second Orf ali (A) (of the Sadr City) for the summer and was (37.973 Bq/m3) outside the building and ((53.400 Bq/m3 inside the building, either for the winter season was (55.773 Bq/m3) outside the building and (Bq/m3 58.148) inside the building for the same region and This is the concentration within the limits allowed

Radon exhalation from building materials for decorative use

Energy Technology Data Exchange (ETDEWEB)

Chen Jing, E-mail: jing.chen@hc-sc.gc.c [Radiation Protection Bureau, Health Canada, 775 Brookfield Road, Ottawa K1A 1C1 (Canada); Rahman, Naureen M.; Atiya, Ibrahim Abu [Radiation Protection Bureau, Health Canada, 775 Brookfield Road, Ottawa K1A 1C1 (Canada)

2010-04-15

Long-term exposure to radon increases the risk of developing lung cancer. There is considerable public concern about radon exhalation from building materials and the contribution to indoor radon levels. To address this concern, radon exhalation rates were determined for 53 different samples of drywall, tile and granite available on the Canadian market for interior home decoration. The radon exhalation rates ranged from non-detectable to 312 Bq m{sup -2} d{sup -1}. Slate tiles and granite slabs had relatively higher radon exhalation rates than other decorative materials, such as ceramic or porcelain tiles. The average radon exhalation rates were 30 Bq m{sup -2} d{sup -1} for slate tiles and 42 Bq m{sup -2} d{sup -1} for granite slabs of various types and origins. Analysis showed that even if an entire floor was covered with a material having a radon exhalation rate of 300 Bq m{sup -2} d{sup -1}, it would contribute only 18 Bq m{sup -3} to a tightly sealed house with an air exchange rate of 0.3 per hour. Generally speaking, building materials used in home decoration make no significant contribution to indoor radon for a house with adequate air exchange.

Radon concentration and exhalation measurements with semiconductor detector and electrostatic precipitator working in a closed circulation system

International Nuclear Information System (INIS)

Wojcik, M.; Morawska, L.

1982-01-01

An apparatus is described and a method presented for the determination of concentration of radon emanated from solid and liquid samples. In this method an object or a sample of air is closed in an hermetically sealed chamber. The air contaminated by radon and its daughters is circulated in a closed system a few times through an electrostatic precipitator mounted in one housing with a semiconductor Si Li detector. The concentration of radon is determined by the alpha activity measurement of its daughters. The sensitivity of the apparatus is very high. While calculating a radon concentration from an activity measurement of RaA (fast method) the sensitivity is about 0.07 pCi/l and when measuring the activity of RaC' (slow method) it is 0.008 pCi/l. Due to the application of an electrostatic precipitator and a silicon detector it is possible to perform alpha spectrometric measurements and thus separate activities of RaA, RaC', and ThC and to calculate 222 Rn or 220 Rn concentrations. The efficiency of RaA, RaB, RaC, ThB and ThC collection is constant, due to the method involving the circulation of the air through the electrostatic precipitator several times. (author)

Unit type differences in RN workgroup job satisfaction.

Science.gov (United States)

Boyle, Diane K; Miller, Peggy A; Gajewski, Byron J; Hart, Sara E; Dunton, Nancy

2006-10-01

Using cross-sectional data from the 2004 National Database of Nursing Quality Indicators (NDNQI) RN Satisfaction Survey, differences in RN workgroup job satisfaction were examined among 10 unit types--medical-surgical, step-down, critical care, pediatric, maternal-newborn, psychiatric, emergency department, rehabilitation, surgical services, and outpatient clinics and labs. The national sample included RN workgroups in 2,900 patient care units (55,516 RNs; 206 hospitals in 44 states). Workgroup satisfaction across all unit types was moderate. RN workgroups in pediatric units were the most satisfied, whereas those in surgical services and emergency department unit types were least satisfied. A consistent finding across all unit types was high satisfaction with the specific domains of nurse-to-nurse interaction, professional status, and professional development versus much lower satisfaction with task, decision making, and pay. Findings can be used to inform and develop investigations that examine specific aspects of the work environment for RN workgroups in various unit types.

Dispersal of Exhaled Air and Personal Exposure in Displacement Ventilated Rooms

DEFF Research Database (Denmark)

Bjørn, Erik; Nielsen, Peter Vilhelm

2002-01-01

The influence of the human exhalation on flow fields, contaminant distributions, and personal exposures in displacement ventilated rooms is studied together with the effects of physical movement. Experiments are conducted in full-scale test rooms with life-sized breathing thermal manikins....... Numerical simulations support the experiments. Air exhaled through the mouth can lock in a thermally stratified layer, if the vertical temperature gradient in breathing zone height is sufficiently large. With exhalation through the nose, exhaled air flows to the upper part of the room. The exhalation flow...

Aluminum gallium nitride (GaN)/GaN high electron mobility transistor-based sensors for glucose detection in exhaled breath condensate.

Science.gov (United States)

Chu, Byung Hwan; Kang, Byoung Sam; Hung, Sheng Chun; Chen, Ke Hung; Ren, Fan; Sciullo, Andrew; Gila, Brent P; Pearton, Stephen J

2010-01-01

Immobilized aluminum gallium nitride (AlGaN)/GaN high electron mobility transistors (HEMTs) have shown great potential in the areas of pH, chloride ion, and glucose detection in exhaled breath condensate (EBC). HEMT sensors can be integrated into a wireless data transmission system that allows for remote monitoring. This technology offers the possibility of using AlGaN/GaN HEMTs for extended investigations of airway pathology of detecting glucose in EBC without the need for clinical visits. HEMT structures, consisting of a 3-microm-thick undoped GaN buffer, 30-A-thick Al(0.3)Ga(0.7)N spacer, and 220-A-thick silicon-doped Al(0.3)Ga(0.7)N cap layer, were used for fabricating the HEMT sensors. The gate area of the pH, chloride ion, and glucose detection was immobilized with scandium oxide (Sc(2)O(3)), silver chloride (AgCl) thin film, and zinc oxide (ZnO) nanorods, respectively. The Sc(2)O(3)-gated sensor could detect the pH of solutions ranging from 3 to 10 with a resolution of approximately 0.1 pH. A chloride ion detection limit of 10(-8) M was achieved with a HEMT sensor immobilized with the AgCl thin film. The drain-source current of the ZnO nanorod-gated AlGaN/GaN HEMT sensor immobilized with glucose oxidase showed a rapid response of less than 5 seconds when the sensor was exposed to the target glucose in a buffer with a pH value of 7.4. The sensor could detect a wide range of concentrations from 0.5 nM to 125 microM. There is great promise for using HEMT-based sensors to enhance the detection sensitivity for glucose detection in EBC. Depending on the immobilized material, HEMT-based sensors can be used for sensing different materials. These electronic detection approaches with rapid response and good repeatability show potential for the investigation of airway pathology. The devices can also be integrated into a wireless data transmission system for remote monitoring applications. This sensor technology could use the exhaled breath condensate to measure the

The exhalant jet of mussels Mytilus edulis

DEFF Research Database (Denmark)

Riisgard, Hans Ulrik; Jørgensen, Bo Hoffmann; Lundgreen, Kim

2011-01-01

shell lengths. Here, we present results of a detailed study of fully open mussels Mytilus edulis in terms of filtration rate, exhalant siphon aperture area, jet velocity, gill area and body dry weight, all as a function of shell length (mean +/- SD) over the range 16.0 +/- 0.4 to 82.6 +/- 2.9 mm...... detailed 2-component velocity distributions near the exhalant siphon in 5 planes parallel to the axis of the jet and the major axis of the oval aperture, and hence estimates of momentum and kinetic energy flows in addition to mean velocity. Data obtained on particles inside the exhalant jet of filtered...

Uniformity in radon exhalation from construction materials using can technique

Energy Technology Data Exchange (ETDEWEB)

El-Amri, E.A.; Al-Jarallah, M.I. E-mail: mibrahim@kfupm.edu.sa; Abu-Jarad, F.; Fazal-ur-Rehman

2003-06-01

The uniformity in radon exhalation rates for 46 tiles of granite, marble and ceramic used as construction materials were determined using 'Can Technique' employing CR-39 nuclear track detectors (NTDs). On each tile, two sealed cans, each enclosing one NTD fixed at the center of the tile surface area covered by the can, were mounted at two different locations of each individual tiles. The track production rates on the NTDs representing radon exhalation rates were measured. The radon exhalation rates from the surface of individual tiles showed uniform exhalations within the calculated uncertainties of the measured values. This makes Can Technique an alternative simple method to measure radon exhalation rates. Calibration required to convert track production rates into radon exhalation rates for the used can and NTD was done using an active technique. The correlation between the measurements by the two techniques shows a good linear correlation coefficient (0.83)

Interview med børn

DEFF Research Database (Denmark)

Interview med børn handler om børneinterview i forbindelse med forskning. Bogen er tænkt som inspiration til og afsæt for metodiske refleksioner i forbindelse med inddragelse af børn som informanter.......Interview med børn handler om børneinterview i forbindelse med forskning. Bogen er tænkt som inspiration til og afsæt for metodiske refleksioner i forbindelse med inddragelse af børn som informanter....

Radon and thoron in cave dwellings (Yan'an, China)

International Nuclear Information System (INIS)

Wiegand, J.; Feige, S.; Xie Quingling; Schreiber, U.; Wieditz, K.; Wittmann, C.; Luo Xiarong

2000-01-01

222 Rn and 220 Rn concentrations were measured in cave dwellings and brick houses in the region of Yan'an (China) during summer 1997. The underground dwellings are built into Quaternary loess, and all investigated houses are founded on it. The median values of indoor 222 Rn and 220 Rn concentrations are 42 (n = 18) and 77Bq m -3 (n = 15) for brick houses and 92 (n = 23) and 215 (n = 17) Bq m -3 for cave dwellings. To classify the dwellings in respect to their cave-character, the fraction of walls having a direct contact to the loess is calculated for each dwelling. While the 222 Rn concentrations are increasing with higher fractions, the 220 Rn concentrations are not correlated with this fraction. On the other hand, due to the short half-life of 220 Rn the distance from the measuring point to the walls is negatively correlated with the 220 Rn concentration, while there is no correlation with the 222 Rn concentration. Therefore, concentric isolines of 220 Rn concentrations showing a strong gradient were detected in cave dwellings. An influence of the ventilation rate is distinct for 222 Rn but weak for 220 Rn. The effective dose rates for 222 Rn and 220 Rn and their progenies are calculated for brick houses (2.7 mSv y -1 ), cave dwellings (7.1 mSv y -1 ), and for traditional cave dwellings with a bed foundation built with loess (16.7 mSv y -1 ). These calculations are based on summer measurements only. It is expected that the true effective dose rates will be significantly higher

Effect of humidity on radon exhalation rate from concrete

International Nuclear Information System (INIS)

Yamanishi, Hirokuni; Obayashi, Haruo; Tsuji, Naruhito; Nakayoshi, Hisao

1998-01-01

The objective of the present study is evaluation of seasonal humidity effect on radon exhalation rate from concrete. Three concrete pieces have been placed in three different fixed humidity circumstances for about a year. The three fixed humidities are selected 3, 10, 25 g m -3 in absolute humidity, those correspond to dry condition as control, winter and summer, respectively. Radon exhalation rate from each concrete piece is measured every one month during humidity exposure. Under the lower humidity, radon exhalation rate from concrete is small. On the contrary, radon exhalation rate is large in the higher humidity circumstance. This trend is consistent with the seasonal variation of indoor air radon concentration in low air-exchange-rate room. (author)

Exhaled methane concentration profiles during exercise on an ergometer

Science.gov (United States)

Szabó, A; Ruzsanyi, V; Unterkofler, K; Mohácsi, Á; Tuboly, E; Boros, M; Szabó, G; Hinterhuber, H; Amann, A

2016-01-01

Exhaled methane concentration measurements are extensively used in medical investigation of certain gastrointestinal conditions. However, the dynamics of endogenous methane release is largely unknown. Breath methane profiles during ergometer tests were measured by means of a photoacoustic spectroscopy based sensor. Five methane-producing volunteers (with exhaled methane level being at least 1 ppm higher than room air) were measured. The experimental protocol consisted of 5 min rest—15 min pedalling (at a workload of 75 W)—5 min rest. In addition, hemodynamic and respiratory parameters were determined and compared to the estimated alveolar methane concentration. The alveolar breath methane level decreased considerably, by a factor of 3–4 within 1.5 min, while the estimated ventilation-perfusion ratio increased by a factor of 2–3. Mean pre-exercise and exercise methane concentrations were 11.4 ppm (SD:7.3) and 2.8 ppm (SD:1.9), respectively. The changes can be described by the high sensitivity of exhaled methane to ventilationperfusion ratio and are in line with the Farhi equation. PMID:25749807

Reproducibility of exhaled nitric oxide measurements in overweight and obese adults

NARCIS (Netherlands)

Thijs, Willemien; de Mutsert, Renée; le Cessie, Saskia; Hiemstra, Pieter S.; Rosendaal, Frits R.; Middeldorp, Saskia; Rabe, Klaus F.

2014-01-01

Exhaled nitric oxide is a noninvasive measure of airway inflammation that can be detected by a handheld device. Obesity may influence the reproducibility of exhaled nitric oxide measurements, by - for instance - decreased expiratory reserve volume. We analyzed triple exhaled nitric oxide

Fuel Exhaling Fuel Cell.

Science.gov (United States)

Manzoor Bhat, Zahid; Thimmappa, Ravikumar; Devendrachari, Mruthyunjayachari Chattanahalli; Kottaichamy, Alagar Raja; Shafi, Shahid Pottachola; Varhade, Swapnil; Gautam, Manu; Thotiyl, Musthafa Ottakam

2018-01-18

State-of-the-art proton exchange membrane fuel cells (PEMFCs) anodically inhale H 2 fuel and cathodically expel water molecules. We show an unprecedented fuel cell concept exhibiting cathodic fuel exhalation capability of anodically inhaled fuel, driven by the neutralization energy on decoupling the direct acid-base chemistry. The fuel exhaling fuel cell delivered a peak power density of 70 mW/cm 2 at a peak current density of 160 mA/cm 2 with a cathodic H 2 output of ∼80 mL in 1 h. We illustrate that the energy benefits from the same fuel stream can at least be doubled by directing it through proposed neutralization electrochemical cell prior to PEMFC in a tandem configuration.

Spectroscopy of 211Rn approaching the valence limit

International Nuclear Information System (INIS)

Davidson, P.M.; Dracoulis, G.D.; Byrne, A.P.; Kibedi, T.; Fabricus, B.; Baxter, A.M.; Stuchbery, A.E.; Poletti, A.R.; Schiffer, K.J.

1993-01-01

High-spin states in 211 Rn were populated using the reaction 198 Pt( 18 O, 5n) at 96 MeV. Their decay was studied using γ-ray and electron spectroscopy. The known level scheme is extended up to a spin of greater than 69/2 and many non-yrast states are added. Semi-empirical shell-model calculations and the properties of related states in 210 Rn and 212 Rn are used to assign configurations to some of the non-yrast states. The properties of the high-spin states observed are compared to the predictions of the multi-particle octupole-coupling model and the semi-empirical shell model. The maximum reasonable spin available from the valence particles and holes in 77/2 and states are observed to near this limit. (orig.)

Personal factors affecting thoron exhalation from occupationally acquired thorium body burdens

International Nuclear Information System (INIS)

Stebbings, J.H.

1985-01-01

Thorium workers with thorium body burdens (primarily thoracic) above 0.7 nCi 224 Ra equivalent are shown to exhale about 15% of thoron produced in vivo, compared to 5% exhaled by subjects with body burdens in the range of 0.4 to 0.7 nCi 224 Ra. There was a false negative correlation between average adult daily cigarettes smoked and thoron exhalation. White blood cell counts that were about 85% of expected were observed in seven subjects exhaling greater than or equal to 100 pCi of thoron above predicted; no other variable examined showed a clear pattern of association. These differences in fractional thoron exhalation, and their consequences, are discussed. 3 references, 4 figures, 8 tables

Determination of Rn concentration in groundwater

International Nuclear Information System (INIS)

Takada, Shigeru; Handa, Madoka; Okano, Yasuhiro; Saito, Masaaki; Suzuki, Takashi

1984-01-01

The method of prediction of earthquakes by the change of concentration of Rn in groundwater was developed by U.S.S.R. and People's Republic of China, and was not known clearly. Since 1975, the research works on this subject were commenced by University of Tokyo, Geological Survey of Agency of Industrial Science and Technology and Tokyo Metropolitan Isotopic Research Center. Along with the development of an automatic continuous measuring apparatus with high reliability, the systems for the measurement of the Rn concentration in groundwater were established. At the time of the earthquake off Izu-Oshima on January 14, 1978, clear precursor was found in an artesian flowing well in Nakaizu 0f Izu Peninsula, and the unusual phenomena which seemed be the precursor of an earthquake were recognized in other districts of Izu and Tokai. On August 8, 1983, an earthquake of magnitude 6 occurred in the boundary region of Yamanashi and Kanagawa Prefectures. Preceding the earthquake, the unusual change of the concentration of Rn was recognized at several observation wells in Tokyo, and the unusual change was observed after the earthquake also. The possibility that the unusual change of the Rn concentration in groundwater is the precursor of earthquakes is high, and this phenomenon is expected to make contribution for the prediction of earthquakes, though there remain many problems to be solved. Further works are scheduled to establish the practical method of predicting earthquakes. (Isimitsu, A.)

Valence configurations in 214Rn

International Nuclear Information System (INIS)

Dracoulis, G.D.; Byrne, A.P.; Stuchbery, A.E.; Bark, R.A.; Poletti, A.R.

1987-01-01

Excited states of 214 Rn, up to spins of ≅ 24 ℎ have been studied using γ-ray and electron spectroscopy following the 208 Pb( 9 Be,3n) 214 Rn reaction. The level scheme (which differs substantially from earlier work) is compared with the results of a semi-empirical shell model calculation. The availability of high-spin orbitals for the four valence protons and two valence neutrons, and the effect of the attractive proton-neutron interaction, leads to the prediction of high-spin states at an unusually low excitation energy. Experimentally, the high level density leads to difficulties in the level scheme assignments at high spin. Nevertheless, configuration assignments, supported by transition strengths deduced from the measured lifetimes (in the nanosecond region) are suggested for the main yrast states. The decay properties also suggest that configuration mixing is important. The possibility of a gradual transition to octupole deformation, implied by the decay properties of the 11 - and 10 + yrast states is also discussed. (orig.)

Fractal characters and hurst exponent of radon exhalation rate from uranium Tailings

International Nuclear Information System (INIS)

Hu Hanqiao; Tan Kaixuan; Li Chunguang; Lv Junwen; Liu Dong

2010-01-01

The uranium tailings radon exhalation is an important environmental problem. The change of the radon exhalation rate of uranium tailings with the time through laboratory experiments is measured, and the results show that the radon exhalation rate of the tailings change obviously with time in non-periodic oscillations. Applying fractal analysis to the radon exhalation rate time-series data by R/S method, the Hurst exponent of the entire time series data is 0.83, the fractal dimension is 1.17. Mobile Hurst exponent is between 0.5 and 0.8 in most cases. The Hurst exponent of the experiments in the later part are below 0.5. The exhalation rate of uranium tailings radon does not meet the long-term trend of random walk theory, the radon exhalation rate has long-term memory, but the short-term memory is not distinct. The radon exhalation from uranium tailings is a deterministic chaotic dynamics. (authors)

Indoor thoron and radon progeny measurements

International Nuclear Information System (INIS)

Tu, K.W.; George, A.C.; Lowder, W.M.; Gogolak, C.V.

1992-01-01

Measurements of indoor thoron ( 220 Rn) and radon ( 222 Rn) progeny activities were conducted in 40 homes and six public buildings in five states. A commercial alpha spectrometer system and four portable alpha integrating sampling monitors using diffused junction silicon detectors were used for sampling and recording of radionuclide data in particular the potential alpha energy concentrations (PAEC). The data were analysed for the ratios of PAEC- 220 Rn to PAEC- 222 Rn, and the correlations between the two quantities, and their estimated annual effective dose equivalent (AEDE). The results show that the PAEC ratios were 0.09, 0.6, 0.55, and 0.47, respectively, for all homes with the PAEC- 222 Rn > 400, between 100 and 400, -3 , and the total of all homes tested; the AEDE ratios were 0.03, 0.21, 0.19 and 0.16, respectively. No strong correlations were found between PAEC- 220 Rn and PAEC- 222 Rn, and between basement and ground floor data for PAEC- 220 Rn, but the PAEC- 222 Rn data showed a strong correlation between the basement and the ground floor values. Simultaneous measurements of PAEC- 220 Rn and PAEC- 222 Rn on the ground floor and in the basement of each of the 23 single-family houses tested suggests that 220 Rn entry from building materials may be as significant as from the underlying soil. (author)

Spectroscopy of 211Rn approaching the valence limit

International Nuclear Information System (INIS)

Davidson, P.M.; Dracoulis, G.D.; Kibedi, T.; Fabricius, B.; Baxter, A.M.; Stuchbery, A.E.; Poletti, A.R.; Schiffer, K.J.

1993-02-01

High spin states in 211 Rn were populated using the reaction 198 Pt( 18 O,5n) at 96 MeV. The decay was studied using γ-ray and electron spectroscopy. The known level scheme is extended up to a spin of greater than 69/2 and many non-yrast states are added. Semi-empirical shell model calculations and the properties of related states in 210 Rn and 212 Rn are used to assign configurations to some of the non-yrast states. The properties of the high spin states observed are compared to the predictions of the Multi-Particle Octupole Coupling model and the semi-empirical shell model. The maximum reasonable spin available from the valence particles and holes is 77/2 and states are observed to near this limit. 12 refs., 4 tabs., 8 figs

Delebørn i tal

DEFF Research Database (Denmark)

Ottosen, Mai Heide; Mathilde Hansen Stage, Sofie

Hvordan påvirker samværsordninger børns hverdagsliv? Fungerer forældresamarbejdet anderledes, når der er en deleordning, og trives børn med udstrakt samvær bedre eller dårligere end andre skilsmissebørn? Med udgangspunkt i SFI’s Børneforløbsundersøgelse, som følger 6000 børn fra 1995, bliver der ...

Radon exhalation study in cements and other building materials

International Nuclear Information System (INIS)

Singh, J.; Sharma, N.

2012-01-01

Radon is a radioactive inert gas, which is produced during the decay of radium, an element present in the naturally occurring uranium series. In the recent past, environmental scientists all over the world have been expressing great concern about the radiation hazard from radon and its short lived daughter products inside buildings. The radon concentration inside a building depends upon the radon exhalation from the building materials used for the construction and the soil underneath the building. In the present investigations, a comparative study for radon exhalation rate has been carried out in some Indian and Pakistani cements and other building materials being used locally such as sand, soil, bricks, marbles, CaCO 3 , POPs by using Track Etch Technique. The Pakistani cement with the trade name 'Elephant' shows the minimum mass exhalation rate while the Indian 'Birla White' cement has shown the maximum. Among the other building materials studied, CaCO 3 has shown the minimum, while local soil the maximum mass exhalation rate. Out of the fired clay bricks, roof tiles, floor tiles and different marbles, floor tiles have the minimum areal exhalation rate while roof tiles the maximum. (author)

Characteristics of radon and thoron exhalation rates in Okinawa, subtropical region of Japan

International Nuclear Information System (INIS)

Shiroma, Y.; Kina, S.; Fujitani, T.; Hosoda, M.; Sorimachi, A.; Ishikawa, T.; Sahoo, S. K.; Tokonami, S.; Furukawa, M.

2012-01-01

Radon and thoron exhalation rates from the ground surface were estimated in three islands of Okinawa Prefecture, a subtropical region of Japan. In situ measurements of the exhalation rates were conducted at a total of 88 points using an accumulation technique with a ZnS(Ag) scintillation detector. The radon and thoron exhalation rates were calculated to be 1-137(arithmetic mean: 21) mBq m -2 s -1 and 32-6244 (1801) mBq m -2 s -1 , respectively. In the surface soil samples collected at 53 measurement points, 238 U and 232 Th series concentrations were estimated to be 17.9-254.0 (64.0) Bq kg -1 dry and 17.8-136.1 (58.8) Bq kg -1 dry, respectively. The maximum rates and concentrations were observed in the dark red soil area. Recent studies strongly suggest that the base material of the soils may be the eolian dust derived from the southeastern part of China, a high background radiation area. The eolian dust is, therefore, considered to be an enhancer for the radon and thoron exhalations in Okinawa. (authors)

Indoor {sup 22}Rn and {sup 222}Rn concentration measurements inside the Teotihuacan pyramids using NTD and E-PERM methodologies

Energy Technology Data Exchange (ETDEWEB)

Espinosa, G. [Instituto de Fisica, UNAM, Apartado Postal 20-364, 01000 Mexico, D.F. (Mexico)]. E-mail: espinosa@fisica.unam.mx; Golzarri, J.I. [Instituto de Fisica, UNAM, Apartado Postal 20-364, 01000 Mexico, D.F. (Mexico); Martinez, T. [Facultad de Quimica, UNAM, Edificio D, Ciudad Universitaria, Mexico, D.F. (Mexico); Navarrete, M. [Facultad de Quimica, UNAM, Edificio D, Ciudad Universitaria, Mexico, D.F. (Mexico); Bogard, J. [Oak Ridge National Laboratory, P.O. Box 2008, Oak Ridge, TN 37831-6480 (United States); Martinez, G. [Coordinacion Nacional de Conservacion del Patrimonio Cultural, Xicotencatl y General Anaya s/n, 04120 Mexico, D.F. (Mexico); Juarez, F. [Instituto de Geofisica, UNAM, Ciudad Universitaria, 04510 Mexico, D.F. (Mexico)

2005-11-15

Measurements of {sup 22}Rn (Thoron) and {sup 222}Rn (Radon) concentrations, inside the Sun and Moon pyramids of Teotihuacan's archeological zone in Mexico, are reported in this work. Two well-established methods, nuclear track detectors (NTDs), using open-close end cups with internal and external detectors of CR-39 polymer, and electret-passive environmental radon monitoring (E-PERM) were used for the measurements. This experiment had two objectives: to obtain better confidence in the {sup 22}Rn and {sup 222}Rn measurements inside the archeological tunnels, and to compare the data obtained in each one of the two methods. This experiment is specially interesting because of the very peculiar conditions where the measurements are made: high humidity, labyrinths with air currents, but almost constant temperature inside of the pyramid tunnels and galleries, notwithstanding of the temperature changes between the day and the night outside of the pyramid body. The {sup 222}Rn concentrations found in both the pyramids were lower than the action level proposed by the ICRP-65. These tunnels are not open to the public, but researchers from the Anthropology Institutions spend part of their time working there, in periods varying from 3 to 5 months.

High-spin states in 214Rn, 216Ra and a study of even-even N=128 systematics

Science.gov (United States)

Lönnroth, T.; Horn, D.; Baktash, C.; Lister, C. J.; Young, G. R.

1983-01-01

High-spin states in 214Rn and 216Ra have been studied by means of the reaction 208Pb(13C, α 3n γ)214Rn and 208Pb(13C, 5n γ)216Ra at beam energies in the range 75-95 MeV. In-beam spectroscopy techniques, including γ-decay excitation functions, α-γ coincidences, γ-γ coincidences, γ-ray angular distributions, and pulsed-beam-γ timing, were utilized to establish level energies, γ-ray multipolarities, Jπ assignments, and isomeric lifetimes. Excited states with spins up to 23ℏ in 214Rn and ~30ℏ in 216Ra were observed. Isomers were found in 214Rn at 1625 keV (T12=9 ns, Jπ=8+), 1787 keV (22 ns, 10+), 3485 keV (95 ns, 16), 4509 keV (230 ns, 20), and 4738 keV (8 ns, 22), and in 216Ra at 1708 keV (8 ns, 8+) and 5868 keV (10 ns, ~24). B(EL) values were deduced and compared to previously known lead-region electric transition rates. Shell-model calculations were performed and used to make configurational assignments. The absence of major α-decay branching in the isomers is explained and the systematic behavior of N=128 even-even nuclei is discussed. NUCLEAR STRUCTURE 208Pb(13C, α 3n γ)214Rn, 208Pb(13C, 5n γ) 216Ra, Elab=75-95 MeV. Measured α-γ coin, γ-γ(t) coin, I(θ), pulsed-beam-γ timing. Deduced level schemes, Jπ, T12, B(EL), multipolarities. Shell model calculations, Ge(Li) and Si detectors, enriched target.

Environmental impact of CO2, Rn, Hg degassing from the rupture zones produced by Wenchuan M s 8.0 earthquake in western Sichuan, China.

Science.gov (United States)

Zhou, Xiaocheng; Chen, Zhi; Cui, Yueju

2016-10-01

The concentrations and flux of CO2, (222)Radon (Rn), and gaseous elemental mercury (Hg) in soil gas were investigated based on the field measurements in June 2010 at ten sites along the seismic rupture zones produced by the May 12, 2008, Wenchuan M s 8.0 earthquake in order to assess the environmental impact of degassing of CO2, Rn and Hg. Soil gas concentrations of 344 sampling points were obtained. Seventy measurements of CO2, Rn and Hg flux by the static accumulation chamber method were performed. The results of risk assessment of CO2, Rn and Hg concentration in soil gas showed that (1) the concentration of CO2 in the epicenter of Wenchuan M s 8.0 earthquake and north end of seismic ruptures had low risk of asphyxia; (2) the concentrations of Rn in the north segment of seismic ruptures had high levels of radon, Maximum was up to level 4, according to Chinese code (GB 50325-2001); (3) the average geoaccumulation index I geo of soil Hg denoted the lack of soil contamination, and maximum values classified the soil gas as moderately to strongly polluted in the epicenter. The investigation of soil gas CO2, Rn and Hg degassing rate indicated that (1) the CO2 in soil gas was characterized by a mean [Formula: see text] of -20.4 ‰ and by a mean CO2 flux of 88.1 g m(-2) day(-1), which were in the range of the typical values for biologic CO2 degassing. The maximum of soil CO2 flux reached values of 399 g m(-2) day(-1) in the epicenter; (2) the soil Rn had higher exhalation in the north segment of seismic ruptures, the maximum reached value of 1976 m Bq m(-2) s(-1); (3) the soil Hg flux was lower, ranging from -2.5 to 18.7 n g m(-2) h(-1) and increased from south to north. The mean flux over the all profiles was 4.2 n g m(-2) h(-1). The total output of CO2 and Hg degassing estimated along seismic ruptures for a survey area of 18.17 km(2) were approximately 0.57 Mt year(-1) and 688.19 g year(-1). It is recommended that land-use planners should

High-spin states in 214Rn, 216Ra and a study of even-even N = 128 systematics

International Nuclear Information System (INIS)

Loennroth, T.; Horn, D.; Baktash, C.; Lister, C.J.; Young, G.R.

1983-01-01

High-spin states in 214 Rn and 216 Ra have been studied by means of the reaction 208 Pb( 13 C, α 3n #betta#) 214 Rn and 208 Pb( 13 C, 5n #betta#) 216 Ra at beam energies in the range 75--95 MeV. In-beam spectroscopy techniques, including #betta#-decay excitation functions, α-#betta# coincidences, #betta#-#betta# coincidences, #betta#-ray angular distributions, and pulsed-beam-#betta# timing, were utilized to establish level energies, #betta#-ray multipolarities, J/sup π/ assignments, and isomeric lifetimes. Excited states with spins up to 23h in 214 Rn and roughly-equal30h in 216 Ra were observed. Isomers were found in 214 Rn at 1625 keV (T/sub 1/2/ = 9 ns, J/sup π/ = 8 + ), 1787 keV (22 ns, 10 + ), 3485 keV (95 ns, 16), 4509 keV (230 ns, 20), and 4738 keV (8 ns, 22), and in 216 Ra at 1708 keV (8 ns, 8 + ) and 5868 keV (10 ns, approx.24). B(EL) values were deduced and compared to previously known lead-region electric transition rates. Shell-model calculations were performed and used to make configurational assignments. The absence of major α-decay branching in the isomers is explained and the systematic behavior of N = 128 even-even nuclei is discussed

High-spin states in 214Rn, 216Ra and a study of even-even N = 128 systematics

International Nuclear Information System (INIS)

Loennroth, T.; Horn, D.; Baktash, C.; Lister, C.J.; Young, G.R.

1981-09-01

High-spin states in 214 Rn and 216 Ra have been studied by means of the reaction 208 Pb( 13 C,α3nγ) 214 Rn and 208 Pb( 13 C,5nγ) 216 Ra at beam energies in the range 75-95 MeV. In-beam spectroscopy techniques, including γ-decay excitation functions, α-γ coincidences, γ-γ coincidences, γ-ray angular distributions and pulsed-beam-γ timing, were utilized to establish level energies, γ-ray multipolarities, JHπ assignments and isomeric lifetimes. Excited states with spins up to 23 h/2π in 214 Rn and 30 h/2π in 216 Ra were established. Isomers are found in 214 Rn at 1625 keV (9 ns, 8 + ), 1787 keV (22 ns, 10 + ), 3485 keV (95 ns, 16 + ), 4509 keV (230 ns, 20 + ) and 4735 keV (8.0 ns, 22 + ) and in 216 Ra at 1710 keV (8 ns, 8 + ) and 5868 keV (10 ns, 24 - ). B(EL) values are derived and compared to previously known lead-region electric transition rates. Shell-model calculations are performed on the basis of which configuration assignment is made. The absence of α-decay branching in the isomers is explained. The systematical behaviour of N = 128 even-even nuclei is discussed. Effective moments of inertia are derived. (author)

Magnetic moments, E3 transitions and the structure of high spin core excited states in 211Rn

International Nuclear Information System (INIS)

Poletti, A.R.; Dracoulis, G.D.; Byrne, A.P.; Stuchbery, A.E.; Poletti, S.J.; Gerl, J.; Lewis, P.M.

1985-03-01

The results of g-factor measurements of high spin states in 211 Rn are: Esub(x)=8856+Δsup(') keV (Jsup(π)=63/2 - ), g=0.626(7); 6101+Δsup(') keV (49/2 + ), 0.766(8); 5247+Δsup(') keV (43/2 - ), 0.74(2); 3927+Δsup(') keV (35/2 + ), 1/017(12); 1578+Δsup(') keV (17/2 - ), 0.912(9). These results together with measured E3 transition strengths and shell model calculations are used to assign configurations to the core excited states in 211 Rn. Mixed configurations are required to explain the g-factors and enhanced E3 strengths simultaneously

Magnetic moments, E3 transitions and the structure of high-spin core excited states in 211Rn

International Nuclear Information System (INIS)

Poletti, A.R.; Dracoulis, G.D.; Byrne, A.P.; Stuchbery, A.E.; Poletti, S.J.; Gerl, J.; Lewis, P.M.

1985-01-01

The results of g-factor measurements of high-spin states in 211 Rn are: Esub(x)=8856+Δ' keV (Jsup(π)=63/2 - ), g=0.626(7); 6101+Δ' keV (49/2 + ), 0.766(8); 5347+Δ' keV (43/2 - ), 0.74(2); 3927+Δ keV (35/2 + ), 1.017(12); 1578+Δ keV (17/2 - ), 0.912(9). These results together with measured E3 transition strengths and shell model calculations are used to assign configurations to the core excited states in 211 Rn. Mixed configurations are required to explain the g-factors and enhanced E3 strengths simultaneously. (orig.)

Influence of Sensory Stimulation on Exhaled Volatile Organic Compounds.

Science.gov (United States)

Mazzatenta, A; Pokorski, M; Di Tano, A; Cacchio, M; Di Giulio, C

2016-01-01

The real-time exhaled volatile organic compounds (VOCs) have been suggested as a new biomarker to detect and monitor physiological processes in the respiratory system. The VOCs profile in exhaled breath reflects the biochemical alterations related to metabolic changes, organ failure, and neuronal activity, which are, at least in part, transmitted via the lungs to the alveolar exhaled breath. Breath analysis has been applied to investigate cancer, lung failure, and neurodegenerative diseases. There are by far no studies on the real-time monitoring of VOCs in sensory stimulation in healthy subjects. Therefore, in this study we investigated the breath parameters and exhaled VOCs in humans during sensory stimulation: smell, hearing, sight, and touch. Responses sensory stimulations were recorded in 12 volunteers using an iAQ-2000 sensor. We found significant effects of sensory stimulation. In particular, olfactory stimulation was the most effective stimulus that elicited the greatest VOCs variations in the exhaled breath. Since the olfactory pathway is distinctly driven by the hypothalamic and limbic circuitry, while other senses project first to the thalamic area and then re-project to other brain areas, the findings suggest the importance of olfaction and chemoreception in the regulation lung gas exchange. VOCs variations during sensory activation may become putative indicators of neural activity.

Dispersion of exhaled droplet nuclei in a two-bed hospital ward with three different ventilation systems

DEFF Research Database (Denmark)

Qian, H.; Li, Y.; Nielsen, Peter V.

2006-01-01

hospital ward with three ventilation systems, i.e. mixing, downward and displacement ventilation. Two life-size breathing thermal manikins were used to simulate a source patient and a receiving patient. The exhalation jet from a bed-lying manikin was visualized using smoke. N2O was used as tracer gas...... are well mixed in the ward. Bed distance does not affect the personal exposure of the receiving patient. For displacement ventilation, the exhaled jet can penetrate a long distance. A high concentration layer of exhaled droplet nuclei because of thermal stratification locking has also been observed...

Inferring 222Rn soil fluxes from ambient 222Rn activity and eddy covariance measurements of CO2

Directory of Open Access Journals (Sweden)

S. van der Laan

2016-11-01

Full Text Available We present a new methodology, which we call Single Pair of Observations Technique with Eddy Covariance (SPOT-EC, to estimate regional-scale surface fluxes of 222Rn from tower-based observations of 222Rn activity concentration, CO2 mole fractions and direct CO2 flux measurements from eddy covariance. For specific events, the regional (222Rn surface flux is calculated from short-term changes in ambient (222Rn activity concentration scaled by the ratio of the mean CO2 surface flux for the specific event to the change in its observed mole fraction. The resulting 222Rn surface emissions are integrated in time (between the moment of observation and the last prior background levels and space (i.e. over the footprint of the observations. The measurement uncertainty obtained is about ±15 % for diurnal events and about ±10 % for longer-term (e.g. seasonal or annual means. The method does not provide continuous observations, but reliable daily averages can be obtained. We applied our method to in situ observations from two sites in the Netherlands: Cabauw station (CBW and Lutjewad station (LUT. For LUT, which is an intensive agricultural site, we estimated a mean 222Rn surface flux of (0.29 ± 0.02 atoms cm−2 s−1 with values  > 0.5 atoms cm−2 s−1 to the south and south-east. For CBW we estimated a mean 222Rn surface flux of (0.63 ± 0.04 atoms cm−2 s−1. The highest values were observed to the south-west, where the soil type is mainly river clay. For both stations good agreement was found between our results and those from measurements with soil chambers and two recently published 222Rn soil flux maps for Europe. At both sites, large spatial and temporal variability of 222Rn surface fluxes were observed which would be impractical to measure with a soil chamber. SPOT-EC, therefore, offers an important new tool for estimating regional-scale 222Rn surface fluxes. Practical applications furthermore include

The evaluation of radiation level and dose of workers in Guangzhou metro line 1

International Nuclear Information System (INIS)

Zhang Lin; Hu Canyun; Meng Xiaolian; He Zhan

2006-01-01

Objective: To find out the level of radiation and effective dose of workers in Guangzhou Metro line 1. Methods: In metro stations, external Gamma-ray exposure rates were obtained by FD-71A radiance measurer, 222 Rn and 220 Rn concentrations were obtained by using Rn-Tn solid state nuclear track detectors developed by The National Institute for Radiological Protection and Nuclear Safety, Chinese Centre for Disease Control. The annual Effective dose from Gamma, 222 Rn and 220 Rn were calculated. Results: The external Gamma-ray exposure average rate is 17.74 x 10 -8 Gy/h. The average concentration of 222 Rn is 59.8 Bq/m 3 . The average concentration of 220 Rn is 32.1 Bq/m 3 . The total annual effective dose from Gamma, 222 Rn and 220 Rn is 2.878 mSv/a. Conclusion: In the stations of Guangzhou in metro line 1, no more effective radiation dose to the workers has measured. (authors)

Postprandial changes in the exhalation of radon from the environment

International Nuclear Information System (INIS)

Rundo, J.; Markun, F.; Plondke, N.J.

1978-01-01

The exhalation of radon originally inhaled from the home environment and dissolved in body fluids and tissues has been studied serially for periods of several hours in six persons. The observation of a pronounced postprandial peak in the rate of exhalation of radon shows that the similar peak observed in the exhalation of radon produced from radium in vivo results from the flushing of a reservoir in soft tissue and not from a change in the fraction lost from bone

Determination of Polycyclic Aromatic Hydrocarbons In Exhaled Cigarette Smoke

Directory of Open Access Journals (Sweden)

Moldoveanu SC

2014-12-01

Full Text Available The retention by humans of 20 polycyclic aromatic hydrocarbons (PAHs from mainstream cigarette smoke was evaluated. The analysis was done by a new technique using solid phase extraction (SPE for the cleanup and the concenration of PAHs. The new technique has excellent sensitivity and accuracy, which were necessary for the analysis of the very low levels of PAHs present in the exhaled cigarette smoke. The study was done on a common commercial cigarette with 10.6 mg ‘tar’ by U.S. Federal Trade Commission (FTC recommendation. The results were obtained from ten human subjects, each smoking three cigarettes. The exhaled smoke was collected using a vacuum assisted procedure that avoids strain in exhaling. The study showed that the PAHs with a molecular weight lower than about 170 Daltons are retained with high efficiency. The heavier molecules are less retained, but even compounds such as indeno[1,2,3-cd]pyrene, dibenz[a, h]anthracene, and benzoperylene are retained with efficiencies around 50%. The dependence of retention efficiency for PAHs (in % on their octanol-water partition coefficient (LogPow was found to be nonlinear and showed considerable variability for several compounds that have very close LogPow values. Better correlation was obtained between the retention efficiency and PAHs vapor pressure (Log VP.

Matérn thinned Cox processes

DEFF Research Database (Denmark)

Andersen, Ina Trolle; Hahn, Ute

2016-01-01

and hard core behaviour can be achieved by applying a dependent Matérn thinning to a Cox process. An exact formula for the intensity of a Matérn thinned shot noise Cox process is derived from the Palm distribution. For the more general class of Matérn thinned Cox processes, formulae for the intensity...

Matérn thinned Cox processes

DEFF Research Database (Denmark)

Andersen, Ina Trolle; Hahn, Ute

of clustering and hard core behaviour can be achieved by applying a dependent Matérn thinning to a Cox process. An exact formula for the intensity of a Matérn thinned shot noise Cox process is derived from the Palm distribution. For the more general class of Matérn thinned Cox processes, formulae...

Stressede børn

DEFF Research Database (Denmark)

Tonseberg, Signe

2016-01-01

Stressede børn får det bedre, når deres krop får lov at tale. Fysioterapeut Pernille Thomsen lærer børn at bruge kroppen, så de trives bedre. Og der er ingen hokuspokus, for det hele bygger på naturvidenskabelig forskning i kroppens hormoner og stress....

Influence of building materials process technology on radon exhalation

International Nuclear Information System (INIS)

Liu Fudong; Wang Chunhong; Liu Senlin; Ji Dong; Zhang Yonggui; Pan Ziqiang

2009-01-01

The building materials were produced through changing raw material ingredient, baking temperature, pressure difference between surface and interior of building material, grain diameter etc. Experiment indicates that change of raw material ingredient ratio can obviously influence the radon exhalation from building material, followed by baking temperature; and pressure difference does not have significant influence on radon exhalation. For the factory to produce shale-brick, the radon exhalation is relatively low under the condition that coal gangue accounts for 40%-50%, the grain diameter is less than 2 mm, the baking temperature is about 960 degree C or 1 020 degree C and the pressure difference is 85 kPa. (authors)

Determination of radon exhalation rates from tiles using active and passive techniques

International Nuclear Information System (INIS)

Al-Jarallah, M.I.; Abu-Jarad, F.; Fazal-ur-Rehman

2001-01-01

Measurements of radon exhalation rates for selected samples of tiles used in Saudi Arabia were carried out using active and passive measuring techniques. These samples were granite, marble and ceramic. In the active method, a PC-based radon gas analyzer with emanation container was used, while, in the passive method, PM-355 nuclear track detectors with the 'can technique' were applied for 180 days. A comparison of the exhalation rates measured by the two techniques showed a good linear correlation coefficient of 0.7. The granite samples showed an average radon exhalation rate of 0.7 Bq m -2 h -1 , which was higher than that of marble and ceramic by more than twofold. The radon exhalation rates measured by the 'can technique' showed a non-uniform exhalation from the surface of the same tile

Minoritetsdanske børn i dagtilbud

DEFF Research Database (Denmark)

Tireli, Üzeyir

2015-01-01

Dagtilbud skal fremme børns trivsel, sundhed, udvikling og læring, Dette er et lovmæssig krav, som gælder for alle børn i Danmark. Minoritetsdanske børn anderledes grundvilkår giver dog store udfordringer for dagtilbuddene - for hvordan sikrer man, at også børn fra kulturelle minoriteter får opti...

Radon Exhalation from some Finishing Materials Frequently used in Syria

International Nuclear Information System (INIS)

Shweikani, R.; Raja, G.

2011-01-01

Building materials are one of the main radon sources in dwellings. Therefore, the determination of radon exhalation from these materials will help in prediction the existence of dwelling with potential radon risk. Ceramic tiles and marble samples were collected from Syrian local market. The correlation between radon exhalation from these materials and radium-226 content was studied. Results showed that there is no clear relation between radium content and radon exhalation rate, and the exhalation of radon did not exceed the permissible limits of American Environment Protection Agency (EPA). In addition, the additional annual dose from radon and gamma of the natural radioactivity in ceramic and marble when used as finishing materials in houses was also estimated and found to be not exceeding 20 μSv and 35 μSv from radon and gamma respectively. (author)

Radon exhalation from some Finishing Materials frequently used in Syria

International Nuclear Information System (INIS)

Shweikani, R.; Raja, G.

2009-02-01

Building materials are one of the main radon sources in dwellings. Therefore, the determination of radon exhalation from these materials will help in prediction the existence of dwelling with potential radon risk. Ceramic tiles and marble samples were collected from Syrian local market. The correlation between radon exhalation from these materials and radium-226 content were studied. Results showed that there is no clear relation between radium content and radon exhalation rate, and the exhalation of radon did not exceed the permissible limits of American Environment Protection Agency (EPA). In addition, the additional annual dose from radon and gamma of the natural radioactivity in ceramic and marble when used as finishing materials in houses were also estimated and found to be not exceeding 20 μSv and μ35 Sv from radon and gamma respectively. (author)

Studying radon exhalation rates variability from phosphogypsum piles in the SW of Spain

Energy Technology Data Exchange (ETDEWEB)

López-Coto, I., E-mail: israel.lopez@dfa.uhu.es [Dpto. Física Aplicada, Facultad CC. Experimentales, University of Huelva, Campus de El Carmen s/n, 21007 Huelva (Spain); Mas, J.L. [Dpto. Física Aplicada I. Escuela Politécnica Superior, University of Sevilla, C/Virgen de Africa 7, 41012 Sevilla (Spain); Vargas, A. [Universitat Politècnica de Catalunya, Instituto de Técnicas Energéticas, Campus Sud Edificio ETSEIB, Planta 0, Pabellón C, Av. Diagonal 647, 08028 Barcelona (Spain); Bolívar, J.P. [Dpto. Física Aplicada, Facultad CC. Experimentales, University of Huelva, Campus de El Carmen s/n, 21007 Huelva (Spain)

2014-09-15

Highlights: • Variability of radon exhalation rates from PG piles has been studied using numerical simulation supported by experimental data. • Most relevant parameters controlling the exhalation rate are radon potential and moisture saturation. • Piling up the waste increasing the height instead of the surface allows the reduction of the exhalation rate. • A proposed cover here is expected to allow exhalation rates reductions up to 95%. - Abstract: Nearly 1.0 × 10{sup 8} tonnes of phosphogypsum were accumulated during last 50 years on a 1200 ha disposal site near Huelva town (SW of Spain). Previous measurements of exhalation rates offered very variable values, in such a way that a worst case scenario could not be established. Here, new experimental data coupled to numerical simulations show that increasing the moisture contents or the temperature reduces the exhalation rate whilst increasing the radon potential or porosity has the contrary effect. Once the relative effects are compared, it can be drawn that the most relevant parameters controlling the exhalation rate are radon potential (product of emanation factor by {sup 226}Ra concentration) and moisture saturation of PG. From wastes management point of view, it can be concluded that piling up the waste increasing the height instead of the surface allows the reduction of the exhalation rate. Furthermore, a proposed cover here is expected to allow exhalation rates reductions up to 95%. We established that the worst case scenario corresponds to a situation of extremely dry winter. Under these conditions, the radon exhalation rate (0.508 Bq m{sup −2} s{sup −1}) would be below though close to the upper limit established by U.S.E.P.A. for inactive phopsphogypsum piles (0.722 Bq m{sup −2} s{sup −1})

Levels of Rn and its daughters in houses in the northern part of China

International Nuclear Information System (INIS)

Zhang Yulin; Wang Gongpeng; Yu Shui; Wang Yuping; Li Weina.

1993-01-01

In this paper we described the levels of Rn and Rn daughters and their diurnal variation in spring and autumn in 18 typical houses in Harbin, Changchun and Jinxi. The results showed that there was no difference in levels of Rn and Rn daughters inside and outside the new and old houses in spring. The Rn concentration was 7.4∼12.5 Bq m -3 . The level of Rn daughters was 1.0-1.3 mWL. Both of them generally increased in winter and the Rn concentration was 15.1-95.1 Bq m -3 . The potential energy of Rn daughters was 4.6-21.3 mWL. The potential energy of Rn daughters in new houses were 20 and 10 times those in spring in Changchun and Harbin respectively and Rn concentrations were 10 and 4 times those in spring respectively. Rn concentrations in a few houses exceeded 200 Bq m -3 . It was lower from 12:00 to 20:00 and slightly higher from 20:00 to the next morning, and the high concentration peak can be found at morning from 4:00 to 6:00 after 24 hours continuous observation. The results was in agreement with those reported in UNSCEAR 1982 Report

A micromegas detector for {sup 222}Rn emanations measurements

Energy Technology Data Exchange (ETDEWEB)

García, J. A.; Garza, J. G.; Irastorza, I. G.; Mirallas, H. [Laboratorio de Física Nuclear y Altas Energías, Universidad de Zaragoza, Zaragoza (Spain)

2013-08-08

The {sup 222}Rn emanation has significant contribution in the overall background for rare event searches experiments. In order to measure this emanations a high sensitivity detector has been designed. The detection method is based on the electrostatic collection of the {sup 222}Rn daughters on a Micromegas detector. Using a chamber with a volume of 21.2 l for the collection of {sup 218}Po and {sup 214}Po progeny of {sup 222}Rn and a 12 × 12cm{sup 2} pixelized Micromegas for the α detection. The advantages of the Micromegas detectors are the low intrinsic radioactivity and the track reconstruction of the α’s, having excellent capabilities for event discrimination.

Mere Musik til Byens Børn

DEFF Research Database (Denmark)

Holst, Finn

Førsteårsrapport på København Kommunes treårige projekt Mere Musik til Byens Børn - et pilotprojekt med henblik på at sikre, at flere børn i København får mulighed for at deltage i forskellige former for frivillig musikundervisning. Særligt fokuseres der på at fremme, at alle børn i hele byen...

Determination of radon exhalation rates from tiles using active and passive techniques

Energy Technology Data Exchange (ETDEWEB)

Al-Jarallah, M.I. E-mail: mibrahim@kfupm.edu.sa; Abu-Jarad, F.; Fazal-ur-Rehman

2001-06-01

Measurements of radon exhalation rates for selected samples of tiles used in Saudi Arabia were carried out using active and passive measuring techniques. These samples were granite, marble and ceramic. In the active method, a PC-based radon gas analyzer with emanation container was used, while, in the passive method, PM-355 nuclear track detectors with the 'can technique' were applied for 180 days. A comparison of the exhalation rates measured by the two techniques showed a good linear correlation coefficient of 0.7. The granite samples showed an average radon exhalation rate of 0.7 Bq m{sup -2} h{sup -1}, which was higher than that of marble and ceramic by more than twofold. The radon exhalation rates measured by the 'can technique' showed a non-uniform exhalation from the surface of the same tile.

Contribution of 222Rn in domestic water supplies to 222Rn in indoor air in Colorado homes

International Nuclear Information System (INIS)

Lawrence, E.P.; Wanty, R.B.; Nyberg, P.

1992-01-01

The contribution of 222Rn from domestic water wells to indoor air was investigated in a study of 28 houses near Conifer, CO. Air concentrations determined by alpha-track detectors (ATDs) and continuous radon monitors were compared with the predictions of a single-cell model. In many of the houses, the water supply was shown to contribute significantly to levels of indoor 222Rn. The data from the ATD study were augmented with a continuous monitoring study of a house near Lyons, CO. The well water in that house has the highest known concentration of 222Rn in water yet reported (93 MBq m-3). The temporal pattern in the indoor 222Rn concentration corresponds to water-use records. In general, it is difficult to quantify the proportion of indoor radon attributable to water use. Several lines of evidence suggest that the single-cell model underestimates this proportion. Continuous-monitoring data, although useful, are impractical due to the cost of the equipment. We propose a protocol for 222Rn measurement based on three simultaneous integrating radon detectors that may help estimate the proportion of indoor 222Rn derived from the water supply

Electret filter collects more exhaled albumin than glass condenser

Science.gov (United States)

Jia, Ziru; Liu, Hongying; Li, Wang; Xie, Dandan; Cheng, Ke; Pi, Xitian

2018-01-01

Abstract In recent years, noninvasive diagnosis based on biomarkers in exhaled breath has been extensively studied. The procedure of biomarker collection is a key step. However, the traditional condenser method has low efficacy in collecting nonvolatile compounds especially the protein biomarkers in breath. To solve this deficiency, here we propose an electret filter method. Exhaled breath of 6 volunteers was collected with a glass condenser and an electret filter. The amount of albumin was analyzed. Furthermore, the difference of exhaled albumin between smokers and nonsmokers was evaluated. The electret filter method collected more albumin than the glass condenser method at the same breath volume level (P albumin than nonsmokers were also observed (P albumin than nonsmokers. PMID:29384875

Impacts of exhalation flow on the microenvironment around the human body under different room temperatures

Science.gov (United States)

Jafari, Mohammad Javad; Gharari, Noradin; Azari, Mansour Rezazade; Ashrafi, Khosro

2018-04-01

Exhalation flow and room temperature can have a considerable effect on the microenvironment in the vicinity of human body. In this study, impacts of exhalation flow and room temperature on the microenvironment around a human body were investigated using a numerical simulation. For this purpose, a computational fluid dynamic program was applied to study thermal plume around a sitting human body at different room temperatures of a calm indoor room by considering the exhalation flow. The simulation was supported by some experimental measurements. Six different room temperatures (18 to 28 °C) with two nose exhalation modes (exhalation and non-exhalation) were investigated. Overhead and breathing zone velocities and temperatures were simulated in different scenarios. This study finds out that the exhalation through the nose has a significant impact on both quantitative and qualitative features of the human microenvironment in different room temperatures. At a given temperature, the exhalation through the nose can change the location and size of maximum velocity at the top of the head. In the breathing zone, the effect of exhalation through the nose on velocity and temperature distribution was pronounced for the point close to mouth. Also, the exhalation through the nose strongly influences the thermal boundary layer on the breathing zone while it only minimally influences the convective boundary layer on the breathing zone. Overall results demonstrate that it is important to take the exhalation flow into consideration in all areas, especially at a quiescent flow condition with low temperature.

Assessment of the radiological impact of gamma and radon dose rates at former U mining sites in Tajikistan

International Nuclear Information System (INIS)

Lespukh, E.; Stegnar, P.; Yunusov, M.; Tilloboev, H.; Zyazev, G.; Kayukov, P.; Hosseini, A.; Strømman, G.; Salbu, B.

2013-01-01

An assessment of the radiological situation due to exposure to gamma radiation, radon ( 222 Rn) and thoron ( 220 Rn) was carried out at former uranium (U) mining and processing sites in Taboshar and at Digmai in Tajikistan. Gamma dose rate measurements were made using various field instruments. 222 Rn/ 220 Rn measurements were carried out with field instruments for instantaneous measurements and then discriminative 222 Rn/ 220 Rn solid state nuclear track detectors (SSNTD) were used for longer representative measurements. The detectors were exposed for an extended period of time in different outdoor and indoor public and residential environments at the selected U legacy sites. The results showed that gamma, 222 Rn and 220 Rn doses were in general low, which consequently implies a low to relatively low radiological risk. The radiation doses deriving from external radiation (gamma dose rate), indoor 222 Rn and 220 Rn with their short-lived progenies did not exceed national or international standards. At none of the sites investigated did the average individual annual effective doses exceed 10 mSv, the recommended threshold value for the general public. A radiation hazard could be associated with exceptional situations, such as elevated exposures to ionizing radiation at the Digmai tailings site and/or in industrial facilities, where gamma and 222 Rn/ 220 Rn dose rates could reach values of several 10 mSv/a. Current doses of ionizing radiation do not represent a hazard to the health of the resident public, with the exception of some specific situations. These issues should be adequately addressed to further reduce needless exposure of the resident public to ionizing radiation

Detection of creatinine in exhaled breath of humans with chronic kidney disease by extractive electrospray ionization mass spectrometry.

Science.gov (United States)

Zeng, Qian; Li, Penghui; Cai, Yunfeng; Zhou, Wei; Wang, Haidong; Luo, Jiao; Ding, Jianhua; Chen, Huanwen

2016-02-09

Exhaled breath contains chemicals that have a diagnostic value in human pathologies. Here in vivo breath analysis of creatinine has been demonstrated by constructing a novel platform based on extractive electrospray ionization mass spectrometry (EESI-MS) without sample pretreatment. Under optimized experimental conditions, the limit of creatinine detection in breath was 30.57 ng L(-1), and the linear range of detection was from 0.3 μg L(-1) to 100 μg L(-1). The concentration range of creatinine in the exhaled breath of 50 volunteers with chronic kidney disease was from 42 pptv to 924 pptv, and the range of the relative standard deviations was from 9.3% to 19.2%. The method provides high sensitivity, high specificity and high speed for semi-quantitative analysis of creatinine in exhaled human breath.

Effect of aging on the concentrations of nitrous oxide in exhaled air

Energy Technology Data Exchange (ETDEWEB)

Mitsui, T.; Shimaoka, K.; Miyamura, M. [Research Center of Health, Physical Fitness and Sports, Nagoya University, Nagoya (Japan); Kato, N. [Chukyo Women`s University, Obu (Japan)

1997-12-03

Trace gases in exhaled air have been used as a simple means of assessing metabolic reactions. The investigations of trace gases derived from bacteria in human exhalation are usually hydrogen (H{sub 2}) or methane (CH{sub 4}). On the other hand, nitrous oxide (N{sub 2}O) is also derived from microorganisms, especially denitrifying bacteria. Although many kinds of denitrifying bacteria have been isolated on and in the human body, there has been few concerning N{sub 2}O. We studied 222 healthy people from the age of 5 to 85 years. The analysis of N{sub 2}O in exhaled air was carried out by a infrared-photoacoustic (IR-PAS) analyzer. It was found that N{sub 2}0 ranged from 0 to 1670 ppbv in exhaled air and that 59% (131) of the subjects were producers N{sub 2}O. A highly significant relationship was observed between age and concentrations of N{sub 2}O (r=0.40, P<0.01). The rate of production in young children and in the aged was significantly higher than that in adults aged 20-39 years (P<0.01), and less than 30% were producers during puberty. The change of normal microflora and in human body with aging may have caused the significant relationship between age and emissions of N{sub 2}O

Hydrogen peroxide in exhaled air of healthy children: reference values

NARCIS (Netherlands)

Q. Jobsis (Quirijn); R.H. Raatgeep (Rolien); S.L. Schellekens; W.C.J. Hop (Wim); P.W.M. Hermans (Peter); J.C. de Jongste (Johan)

1998-01-01

textabstractAn increased content of hydrogen peroxide (H2O2), a marker of inflammation, has been described in the condensate of exhaled air from adults and children with inflammatory lung disorders, including asthma. However, the normal range of [H2O2] in the exhaled

Determination of Carbonyl Compounds in Exhaled Cigarette Smoke

Directory of Open Access Journals (Sweden)

Moldoveanu S

2014-12-01

Full Text Available This paper presents the findings on a quantitative evaluation of carbonyl levels in exhaled cigarette smoke from human subjects. The cigarettes evaluated include products with 5.0 mg ‘tar’, 10.6 mg ‘tar’ and 16.2 mg ‘tar’, where ‘tar’ is defined as the weight of total wet particulate matter (TPM minus the weight of nicotine and water, and the cigarettes are smoked following U.S. Federal Trade Commission (FTC recommendations. The measured levels of carbonyls in the exhaled smoke were compared with calculated yields of carbonyls in the inhaled smoke and a retention efficiency was obtained. The number of human subjects included a total of ten smokers for the 10.6 mg ‘tar’, five for the 16.2 mg ‘tar’, and five for the 5.0 mg ‘tar’ product, each subject smoking three cigarettes. The analyzed carbonyl compounds included several aldehydes (formaldehyde, acetaldehyde, acrolein, propionaldehyde, crotonaldehyde and n-butyraldehyde, and two ketones (acetone and 2-butanone. The smoke collection from the human subjects was vacuum assisted. Exhaled smoke was collected on Cambridge pads pretreated with a solution of dinitrophenylhydrazine (DNPH followed by high performance liquid chromatography (HPLC analysis of the dinitrophenylhydrazones of the carbonyl compounds. The cigarette butts from the smokers were collected and analyzed for nicotine. The nicotine levels for the cigarette butts from the smokers were used to calculate the level of carbonyls in the inhaled smoke, based on calibration curves. These were generated separately by analyzing the carbonyls in smoke and the nicotine in the cigarette butts obtained by machine smoking under different puffing regimes. The comparison of the level of carbonyl compounds in exhaled smoke with that from the inhaled smoke showed high retention of all the carbonyls. The retention of aldehydes was above 95% for all three different ‘tar’ levels cigarettes. The ketones were retained with a

Exhaled nitric oxide levels in school children in relation to IgE sensitisation and window pane condensation.

Science.gov (United States)

Janson, Christer; Kalm-Stephens, Pia; Foucard, Tony; Norbäck, Dan; Alving, Kjell; Nordvall, S Lennart

2005-08-01

A positive relation between exhaled nitric oxide (NO) levels and allergen exposure has been found in some studies whereas there is less information on how non-allergen environmental factors influences exhaled NO. To study the relationship between exhaled NO levels in schoolchildren in relation to IgE sensitisation and allergenic and non-allergenic environmental factors. This study comprised 374 schoolchildren (13-14 years of age) who performed exhaled NO-measurements and skin prick tests. Exposure to allergens, respiratory infections, environmental tobacco smoke and home window pane condensation, the latter an indicator of high humidity and poor ventilation was evaluated through questionnaires. In IgE-sensitised children sensitisation to pets was a more important determinant of exhaled NO than sensitisation to pollen. Higher NO levels were found in cat-sensitised children with a cat or other furred pets at home compared to cat-sensitised children without pets (geometric mean, 24.0 vs. 13.9 ppb, P=0.03). Significantly higher exhaled NO levels were found in non-sensitised children that reported having a cold (5.7 vs. 3.8 ppb, P<0.001) or lived in homes with window pane condensation (7.1 vs. 4.4 ppb, P=0.01) than in non-sensitised children without a cold and window pane condensation, respectively. These associations were not found in children that were sensitised to inhalation allergens. Allergen exposure seems to be the most important determinant for exhaled NO levels in IgE-sensitised children whereas in non-sensitised children NO levels were associated with respiratory infections and home window pane condensation.

Online Measurement of Exhaled NO Concentration and Its Production Sites by Fast Non-equilibrium Dilution Ion Mobility Spectrometry

Science.gov (United States)

Peng, Liying; Jiang, Dandan; Wang, Zhenxin; Liu, Jiwei; Li, Haiyang

2016-03-01

Exhaled nitric oxide (NO) is one of the most promising breath markers for respiratory diseases. Its profile for exhalation and the respiratory NO production sites can provide useful information for medical disease diagnosis and therapeutic procedures. However, the high-level moisture in exhaled gas always leads to the poor selectivity and sensitivity for ion spectrometric techniques. Herein, a method based on fast non-equilibrium dilution ion mobility spectrometry (NED-IMS) was firstly proposed to directly monitor the exhaled NO profile on line. The moisture interference was eliminated by turbulently diluting the original moisture to 21% of the original with the drift gas and dilution gas. Weak enhancement was observed for humid NO response and its limit of detection at 100% relative humidity was down to 0.58 ppb. The NO concentrations at multiple exhalation flow rates were measured, while its respiratory production sites were determined by using two-compartment model (2CM) and Högman and Meriläinen algorithm (HMA). Last but not the least, the NO production sites were analyzed hourly to tentatively investigate the daily physiological process of NO. The results demonstrated the capacity of NED-IMS in the real-time analysis of exhaled NO and its production sites for clinical diagnosis and assessment.

Liquid chromatography/mass spectrometry analysis of exhaled leukotriene B4 in asthmatic children

Directory of Open Access Journals (Sweden)

Barnes Peter J

2005-10-01

Full Text Available Abstract Background The role of leukotriene (LT B4, a potent inflammatory mediator, in atopic asthmatic and atopic nonasthmatic children is largely unknown. The lack of a gold standard technique for measuring LTB4 in exhaled breath condensate (EBC has hampered its quantitative assessment in this biological fluid. We sought to measure LTB4 in EBC in atopic asthmatic children and atopic nonasthmatic children. Exhaled nitric oxide (NO was measured as an independent marker of airway inflammation. Methods Fifteen healthy children, 20 atopic nonasthmatic children, 25 steroid-naïve atopic asthmatic children, and 22 atopic asthmatic children receiving inhaled corticosteroids were studied. The study design was of cross-sectional type. Exhaled LTB4 concentrations were measured using liquid chromatography/mass spectrometry-mass spectrometry (LC/MS/MS with a triple quadrupole mass spectrometer. Exhaled NO was measured by chemiluminescence with a single breath on-line method. LTB4 values were expressed as the total amount (in pg of eicosanoid expired in the 15-minute breath test. Kruskal-Wallis test was used to compare groups. Results Compared with healthy children [87.5 (82.5–102.5 pg, median and interquartile range], exhaled LTB4 was increased in steroid-naïve atopic asthmatic [255.1 (175.0–314.7 pg, p 4 than steroid-naïve asthmatics [125.0 (25.0–245.0 pg vs 255.1 (175.0–314.7 pg, p Conclusion In contrast to exhaled NO concentrations, exhaled LTB4 values are selectively elevated in steroid-naïve atopic asthmatic children, but not in atopic nonasthmatic children. Although placebo control studies are warranted, inhaled corticosteroids seem to reduce exhaled LTB4 in asthmatic children. LC/MS/MS analysis of exhaled LTB4 might provide a non-invasive, sensitive, and quantitative method for airway inflammation assessment in asthmatic children.

Exhaled nitric oxide in paediatric asthma and cystic fibrosis.

Science.gov (United States)

Lundberg, J O; Nordvall, S L; Weitzberg, E; Kollberg, H; Alving, K

1996-01-01

Nitric oxide (NO) is present in exhaled air of humans. This NO is mostly produced in the upper airways, whereas basal NO excretion in the lower airways is low. Children with Kartagener's syndrome have an almost total lack of NO in nasally derived air, whereas adult asthmatics have increased NO in orally exhaled air. NO excretion was measured in the nasal cavity and in orally exhaled air in 19 healthy children, in 36 age matched subjects with asthma, and in eight children with cystic fibrosis. NO levels in orally exhaled air were similar in controls and in children with cystic fibrosis, at 4.8 (SD 1.2) v 5.8 (0.8) parts per billion (ppb), but were increased in asthmatic children who were untreated or were being treated only with low doses of inhaled steroids (13.8 (2.5) ppb). Nasal NO levels were reduced by about 70% in children with cystic fibrosis compared to controls and asthmatics. Measurements of airway NO release in different parts of the airways may be useful in non-invasive diagnosis and monitoring of inflammatory airway diseases. PMID:8984919

Sensory evaluation and chemical analysis of exhaled and dermally emitted bioeffluents

DEFF Research Database (Denmark)

Tsushima, S.; Wargocki, Pawel; Tanabe, S.

2018-01-01

Conditions in which exhaled and dermally emitted bioeffluents could be sampled separately or together (whole-body emission) were created. Five lightly dressed males exhaled the air through a mask to another, identical chamber or without a mask to the chamber in which they were sitting; the outdoor......) was less acceptable, and the odor intensity was higher than when only exhaled bioeffluents were present. The presence or absence of exhaled bioeffluents in the unoccupied chamber made no significant difference to sensory assessments. At 28°C and with ozone present, the odor intensity increased and the PAQ...... was less acceptable in the chambers with whole-body bioeffluents. The concentrations of nonanal, decanal, geranylacetone, and 6-MHO were higher when dermally emitted bioeffluents were present; they increased further when ozone was present. The concentration of squalene then decreased and increased again...

Ethane and n-pentane in exhaled breath are biomarkers of exposure not effect

DEFF Research Database (Denmark)

Gorham, Katrine A; Andersen, Mads Peter Sulbæk; Meinardi, Simone

2009-01-01

The relationship of exhaled ethane and n-pentane to exhaled NO, carbonylated proteins, and indoor/outdoor atmospheric pollutants were examined in order to evaluate ethane and n-pentane as potential markers of airway inflammation and/or oxidative stress. Exhaled NO and carbonylated proteins were...... found to have no significant associations with either ethane (p = 0.96 and p = 0.81, respectively) or n-pentane (p = 0.44 and 0.28, respectively) when outliers were included. In the case where outliers were removed n-pentane was found to be inversely associated with carbonylated proteins. Exhaled...... hydrocarbons adjusted for indoor hydrocarbon concentrations were instead found to be positively associated with air pollutants (NO, NO(2) and CO), suggesting pollutant exposure is driving exhaled hydrocarbon concentrations. Given these findings, ethane and n-pentane do not appear to be markers of airway...

Ethane and n-pentane in exhaled breath are biomarkers of exposure not effect.

Science.gov (United States)

Gorham, Katrine A; Sulbaek Andersen, Mads P; Meinardi, Simone; Delfino, Ralph J; Staimer, Norbert; Tjoa, Thomas; Rowland, F Sherwood; Blake, Donald R

2009-02-01

The relationship of exhaled ethane and n-pentane to exhaled NO, carbonylated proteins, and indoor/outdoor atmospheric pollutants were examined in order to evaluate ethane and n-pentane as potential markers of airway inflammation and/or oxidative stress. Exhaled NO and carbonylated proteins were found to have no significant associations with either ethane (p = 0.96 and p = 0.81, respectively) or n-pentane (p = 0.44 and 0.28, respectively) when outliers were included. In the case where outliers were removed n-pentane was found to be inversely associated with carbonylated proteins. Exhaled hydrocarbons adjusted for indoor hydrocarbon concentrations were instead found to be positively associated with air pollutants (NO, NO(2) and CO), suggesting pollutant exposure is driving exhaled hydrocarbon concentrations. Given these findings, ethane and n-pentane do not appear to be markers of airway inflammation or oxidative stress.

Potential of Mass Spectrometry in Developing Clinical Laboratory Biomarkers of Nonvolatiles in Exhaled Breath.

Science.gov (United States)

Beck, Olof; Olin, Anna-Carin; Mirgorodskaya, Ekaterina

2016-01-01

Exhaled breath contains nonvolatile substances that are part of aerosol particles of submicrometer size. These particles are formed and exhaled as a result of normal breathing and contain material from distal airways of the respiratory system. Exhaled breath can be used to monitor biomarkers of both endogenous and exogenous origin and constitutes an attractive specimen for medical investigations. This review summarizes the present status regarding potential biomarkers of nonvolatile compounds in exhaled breath. The field of exhaled breath condensate is briefly reviewed, together with more recent work on more selective collection procedures for exhaled particles. The relation of these particles to the surfactant in the terminal parts of the respiratory system is described. The literature on potential endogenous low molecular weight compounds as well as protein biomarkers is reviewed. The possibility to measure exposure to therapeutic and abused drugs is demonstrated. Finally, the potential future role and importance of mass spectrometry is discussed. Nonvolatile compounds exit the lung as aerosol particles that can be sampled easily and selectively. The clinical applications of potential biomarkers in exhaled breath comprise diagnosis of disease, monitoring of disease progress, monitoring of drug therapy, and toxicological investigations. © 2015 American Association for Clinical Chemistry.

Increased ethane exhalation, an in vivo index of lipid peroxidation, in alcohol-abusers.

Science.gov (United States)

Lettéron, P; Duchatelle, V; Berson, A; Fromenty, B; Fisch, C; Degott, C; Benhamou, J P; Pessayre, D

1993-01-01

Ethane exhalation was measured in 42 control subjects, 52 patients with various non-alcoholic liver diseases, and 89 alcohol abusers who had been admitted to hospital for alcohol withdrawal and assessment of liver disease (six with normal liver tests, 10 with steatosis with or without fibrosis, six with alcoholic hepatitis, 29 with cirrhosis, 34 with both cirrhosis and alcoholic hepatitis, and four with both cirrhosis and a hepatocellular carcinoma). Ethane exhalation was similar in control subjects and in patients with non-alcoholic liver diseases, but was five times higher in alcohol abusers. Ethane exhalation in alcohol abusers was significantly, but very weakly, correlated with the daily ethanol intake before hospital admission, and the histological score for steatosis, but not with the inflammation or alcoholic hepatitis scores. Ethane exhalation was inversely correlated with the duration of abstinence before the test. In nine alcoholic patients, the exhalation of ethane was measured repeatedly, and showed slow improvement during abstinence. Ethane exhalation was significantly but weakly correlated with the Pugh's score in patients with alcoholic cirrhosis. It is concluded that the mean ethane exhalation is increased in alcohol abusers. One of the possible mechanisms may be the presence of oxidizable fat in the liver. The weak correlation with the Pugh's score is consistent with the contribution of many other factors in the progression to severe liver disease. PMID:8472992

Radon and thoron concentrations in traditional cave dwellings and soil beds

International Nuclear Information System (INIS)

Shang Bing; Cui Hongxing; Li Hongzhou

2003-01-01

This paper describes the measured results of 222 Rn and 220 Tn concentrations in six cave dwellings and adobe Kang in Ning county of Gansu Province by using Rn-Tn solid-state nuclear track detectors. 222 Rn and 220 Tn concentrations are 161 and 307 Bq·m -3 (10 cm from soil wall), 99 and 158 Bq·m -3 (middle of the room) in cave dwellings, and 133 and 317 Bq·m -3 (5 cm above adobe Kang), 179 and 145 Bq·m -3 (20 cm above adobe Kang) on soil beds, respectively. 222 Rn and 220 Tn concentrations near the wall are higher than those obtained other place in the room. 222 Rn and 220 Tn concentrations above the adobe Kang are related to the distance from the surface of adobe Kang and heating situation. The residents sleep directly on the beds, especially for the children, the time staying on the adobe Kang are longer than other position. The dose of 222 Rn and 220 Tn from the traditional adobe Kang should be continuously studied

Integrative genomic analysis of interleukin-36RN and its prognostic value in cancer.

Science.gov (United States)

Lv, Zhilei; Fan, Jinshuo; Zhang, Xiuxiu; Huang, Qi; Han, Jieli; Wu, Feng; Hu, Guorong; Guo, Mengfei; Jin, Yang

2016-02-01

Interleukin (IL)-36RN, previously known as IL1-F5 and IL-1δ, shares a 360-kb region of chromosome 2q13 with members of IL-1 systems. IL-36RN encodes an anti-inflammatory cytokine, IL-36 receptor antagonist (IL-36Ra). In spite of IL-36Ra showing the highest homology to IL-1 receptor (IL-1R) antagonist, it differs from the latter in aspects including its binding to IL-lRrp2 but not to IL-1R1. IL-36RN is mainly expressed in epithelial cells and has important roles in inflammatory diseases. In the present study, IL-36RN was identified in the genomes of 27 species, including human, chimpanzee, mouse, horse and dolphin. Human IL-36RN was mainly expressed in the eye, head and neck, fetal heart, lung, testis, cervix and placenta; furthermore, it was highly expressed in bladder and parathyroid tumors. Furthermore, a total of 30 single nucleotide polymorphisms causing missense mutations were determined, which are considered to be the causes of various diseases, such as generalized pustular psoriasis. In addition, the link between IL-36RN and the prognosis of certain cancer types was revealed through meta-analysis. Tumor-associated transcriptional factors c-Fos, activator protein-1, c-Jun and nuclear factor κB were found to bind to the upstream region in the IL-36RN gene. This may indicate that IL-36RN is involved in tumorigenesis and tumor progression through the regulation of tumor-associated transcriptional factors. The present study identified IL-36RN in various species and investigated the associations between IL-36RN and cancer prognosis, which would determine whether IL-36RN drove the evolution of the various species with regard to tumorigenesis.

Radiochemical and radioecological studies on Brazilian areas of high natural background. Progress report, October 30, 1974--October 30, 1975

International Nuclear Information System (INIS)

Costa-Ribeiro, C.; Penna-Franca, E.; Rocha-Nogueira, A.; Christian-Pfeiffer, W.

1975-11-01

The absorption of 212 Pb and/or 212 Bi by ertythrocytes was investigated in an attempt to explain the in vivo genesis of somatic chromosomal aberrations of the type detected in peripheral blood lymphocytes of workers professionally exposed to 220 Rn and its decay products, as well as in dwellers of Brazilian areas of high natural radioactivity

Radiological risk of actinon (219Rn)

International Nuclear Information System (INIS)

Crawford, D.J.

1981-12-01

The research reported was designed to provide information on the following subjects: (1) development of the functional relations between exposure to the 219 Rn decay chain and pertinent health effects; (2) specification of the circumstances under which a significant concentration of the decay chain may occur; (3) recommendation of an exposure standard which will provide protection of the public from significant elevation of health effects; and (4) an assessment of the impact of 219 Rn on determinations of the concentration of the 222 Rn decay chain and/or its precursors

Extreme levels of 222Rn and U in a private water supply

International Nuclear Information System (INIS)

Lowry, J.D.; Hoxie, D.C.; Moreau, E.

1987-01-01

In 1985, the Maine Department of Human Services discovered a private water supply in Leeds, ME, that contains over 40,700 BqL -1 (1.1 x 10 +6 pCil -1 ) of 222 Rn on average, and ranges between 13,300 and 59,200 Bql -1 . The well water also contains a gross alpha concentration of approximately 10.0 BqL -1 (270 pCiL -1 ), of which more than 95 percent is U (403 ugL -1 ). The ratio of 234 U to 238 U averages 1.17, which compares closely to the sea water at 1.14. The Ra content comprises less than 2 percent of the gross alpha. The levels of 222 Rn and U are considered to be extremely high, with the 222 Rn being the highest known level the authors are aware of for a drinking water supply. This area of Maine has geologic features characteristic of those shown by others to have a high potential for elevated levels of 222 Rn and other radioisotopes. The purpose of this paper is to update the information presented previously about this site, in particular to the ramifications on treatment alternatives associated with the presence of both 222 Rn and U in a water supply

Influence of air pollution on exhaled carbon monoxide levels in smokers and non-smokers. A prospective cross-sectional study.

Science.gov (United States)

Maga, Mikołaj; Janik, Maciej K; Wachsmann, Agnieszka; Chrząstek-Janik, Olga; Koziej, Mateusz; Bajkowski, Mateusz; Maga, Paweł; Tyrak, Katarzyna; Wójcik, Krzysztof; Gregorczyk-Maga, Iwona; Niżankowski, Rafał

2017-01-01

The poor air quality and cigarette smoking are the most important reasons for increased carbon monoxide (CO) level in exhaled air. However, the influence of high air pollution concentration in big cities on the exhaled CO level has not been well studied yet. To evaluate the impact of smoking habit and air pollution in the place of living on the level of CO in exhaled air. Citizens from two large cities and one small town in Poland were asked to complete a survey disclosing their place of residence, education level, work status and smoking habits. Subsequently, the CO level in their exhaled air was measured. Air quality data, obtained from the Regional Inspectorates of Environmental Protection, revealed the differences in atmospheric CO concentration between locations. 1226 subjects were divided into 4 groups based on their declared smoking status and place of living. The average CO level in exhaled air was significantly higher in smokers than in non-smokers (p<0.0001) as well as in non-smokers from big cities than non-smokers from small ones (p<0.0001). Created model showed that non-smokers from big cities have odds ratio of 125.3 for exceeding CO cutoff level of 4ppm compared to non-smokers from small towns. The average CO level in exhaled air is significantly higher in smokers than non-smokers. Among non-smokers, the average exhaled CO level is significantly higher in big city than small town citizens. These results suggest that permanent exposure to an increased concentration of air pollution and cigarette smoking affect the level of exhaled CO. Copyright © 2016 Elsevier Inc. All rights reserved.

Further Development of an Exhaled microRNA Biomarker of Lung Cancer Risk

Science.gov (United States)

2017-08-01

AWARD NUMBER: W81XWH-16-1-0328 TITLE: Further Development of an Exhaled microRNA Biomarker of Lung Cancer Risk PRINCIPAL INVESTIGATOR: Dr...4. TITLE AND SUBTITLE Further Development of an Exhaled microRNA Biomarker of Lung Cancer Risk 5b. GRANT NUMBER W81XWH 16-1-0328 5c. PROGRAM...devise a non-invasive airway based exhaled microRNA metric for lung cancer risk, initial work to be tested in a case control study. We expanded the

Variations of Rn-222 concentration in the Bratislava air

International Nuclear Information System (INIS)

Holy, K.; Bohm, R.; Polaskova, A.

1996-01-01

222 Rn is produced by alpha decay of 222 Ra in roil. A small fraction of totally produced 222 Rn escapes from coil particles into soil air. Then 222 Rn is transported predominantly by molecular diffusion into outdoor atmosphere. The radon concentration in the outdoor atmosphere is not stable. It varies irregularly depending on meteorological conditions. However there were found out regular daily and remand variations of 222 Rn concentration in outdoor atmosphere. These variations were measured in numerous works and results are summarized f.e. in work of Gesell. A simple model described the annual variations of 222 Rn concentration war published by Minato. A mathematical analysis of daily course of 222 Rn concentration in outdoor atmosphere was realized by Garzon et al. Some results of our study of 222 Rn variations in outdoor atmosphere of Bratislava are shown in this report. (author)

Retirement Financial Planning and the RN: An Integrative Literature Review.

Science.gov (United States)

Keele, Shanna; Alpert, Patricia T

2015-10-01

This integrative literature review examined the current research on RN retirement. The review identified 3 critical gaps in knowledge: (a) minimal knowledge regarding the economic impact on RN retirement, (b) incomplete information regarding the demographics of RN retirement, and (c) a scarcity of prospective longitudinal RN workforce studies. Future research must address these gaps to better address RN workforce sustainability.

High spin states and Yrast isomers in 211Rn

International Nuclear Information System (INIS)

Poletti, A.R.; Dracoulis, G.D.; Fahlander, C.; Morrison, I.

1981-01-01

Excited states in 211 Rn with spins up to 53/2 have been identified using (HI,xn) reactions and γ-ray techniques. A shell model calculation can reproduce the ordering of the yrast sequence up to spin 41/2 - . Several yrast isomers have been identified. Enhanced E3 transitions are observed and their systematic occurrence in this region discussed. The influence of the neutron hole, and possible core excitations on the effective moment of inertia are also pointed out

High spin states and yrast isomers in 211Rn

International Nuclear Information System (INIS)

Poletti, A.R.; Dracoulis, G.D.; Fahlander, C.; Morrison, I.

1980-12-01

Excited states in 211 Rn with spins up to 53/2 have been identified using (HI,xn) reactions and γ-ray techniques. A shell model calculation can reproduce the ordering of the yrast sequence up to spin 41/2. Several yrast isomers have been identified. Enhanced E3 transitions are observed and their systematic occurrence in this region discussed. The influence of the neutron hole, and possible core excitations on the effective moment of inertia are also pointed out

Radon exhalation rate on the Sivrice (Elazig ) fault zone

International Nuclear Information System (INIS)

Sahin, S.; Kuluoeztuerk, M. F.; Dogru, M.

2009-01-01

Four radon monitoring stations were built on the Sivrice Fault Zone which is a part of the East Anatolian Fault System that one of the very important two fault systems which tends to produce earthquake in Turkey. Radon exhalation rate were analyzed in the soil and water samples which collected around the stations. Radon exhalation rate in the soil and water samples were determined by using CR-39 that it is plastic detector.

222Rn alpha dose to organs other than lung

International Nuclear Information System (INIS)

Harley, N.H.; Robbins, E.S.

1991-01-01

The alpha dose to cells in tissues or organs other theft the lung has been calculated using the solubility coefficients for 222 Rn measured in human tissue. The annual alpha dose equivalent f rom 222 Rn and decay products in most tissues is a maximum of 30% of the annual average natural background dose equivalent (1 mSv) for external and internally deposited nuclides. The dose to the small population of lymphocytes located in or under the bronchial epithelium is a special case and their annual dose equivalent is essentially the same as that to basal cells in bronchial epithelium (200 mSv) for continuous exposure to 200 Bq M -3 . The significance of this dose is uncertain because the only excess cancer observed in follow up studies of underground miners with high 222 Rn exposure is bronchogenic carcinoma

222Rn flux and soil air concentration profiles in West-Germany. Soil 222Rn as tracer for gas transport in the unsaturated soil zone

International Nuclear Information System (INIS)

Doerr, H.; Muennich, K.O.

1990-01-01

Measurements of the 222 Rn activity concentration profile in the soil and the 222 Rn flux in West-Germany are presented. The spatial pattern of the 222 Rn flux depends more on soil type than on the 226 Ra activity of the soil material. The average 222 Rn flux from sandy soils is 1000-2000 dpm m -2 h -1 and 4000-6000 dpm m -2 h -1 froam loamy and clayey soils. Weekly 222 Rn flux measurements during a period of 1 year at a sandy site show no significant temporal variations. At a clayey site, the 222 Rn flux tends to be higher in summer than in winter. The permeability coefficient P Rn , obtained from simultaneous 222 Rn flux and concentration profile measurements in various soils, can be expressed as a function of the soil parameters total porosity ε 0 , soil moisture F, tortuosity k and the molecular diffusion coefficient D 0 of 222 Rn in air: P = D 0 ((ε 0 -F)/k-const.). The flux of any other gas into or out of the soil can thus be calculated from its measured concentration profile in the soil and from the 222 Rn permeability coefficient, replacing the molecular diffusion coefficient of 222 Rn by that of the specific gas under consideration. As an example, this method of flux determination is demonstrated for the soil CO 2 flux to the atmosphere and for the flux of atmospheric CH 4 into the soil. (author) 14 refs

Using a chemiresistor-based alkane sensor to distinguish exhaled breaths of lung cancer patients from subjects with no lung cancer.

Science.gov (United States)

Tan, Jiunn-Liang; Yong, Zheng-Xin; Liam, Chong-Kin

2016-10-01

Breath alkanes are reported to be able to discriminate lung cancer patients from healthy people. A simple chemiresistor-based sensor was designed to respond to alkanes by a change in resistance measured by a digital multimeter connected to the sensor. In preclinical experiments, the sensor response was found to have a strong positive linear relationship with alkane compounds and not responsive to water. This study aimed to determine the ability of the alkane sensor to distinguish the exhaled breaths of lung cancer patients from that of chronic obstructive pulmonary disease (COPD) patients and control subjects without lung cancer. In this cross-sectional study, 12 treatment-naive patients with lung cancer, 12 ex- or current smokers with COPD and 13 never-smokers without lung disease were asked to exhale through a drinking straw into a prototype breath-in apparatus made from an empty 125 mL Vitagen ® bottle with the chemiresistor sensor attached at its inside bottom to measure the sensor peak output (percentage change of baseline resistance measured before exhalation to peak resistance) and the time taken for the baseline resistance to reach peak resistance. Analysis of multivariate variance and post-hoc Tukey test revealed that the peak output and the time to peak values for the lung cancer patients were statistically different from that for both the COPD patients and the controls without lung disease, Pillai's Trace =0.393, F=3.909, df = (4, 64), P=0.007. A 2.20% sensor peak output and a 90-s time to peak gave 83.3% sensitivity and 88% specificity in diagnosing lung cancer. Tobacco smoking did not affect the diagnostic accuracy of the sensor. The alkane sensor could discriminate patients with lung cancer from COPD patients and people without lung disease. Its potential utility as a simple, cheap and non-invasive test for early lung cancer detection needs further studies.

Blinde børn - integration eller isolation?

DEFF Research Database (Denmark)

Bengtsson, Steen; Cayuelas Mateu, Nuria; Høst, Anders

Blinde børn har i de senere årtier været integreret i den almindelige skole. Men betyder det, at de bliver bedre forberedt til et integreret liv som voksne? Det er langt fra sikkert, viser denne undersøgelse af blinde børn. Skolen sørger for, at de blinde børn har en støttelærer, så de får det he...

Exhaled nitric oxide concentration in patients after heart transplantation.

Science.gov (United States)

Nadziakiewicz, P; Knapik, P; Zakliczyński, M; Zembala, M; Urbańska, E; Pacholewicz, J

2007-11-01

Nitric oxide (NO) is present in exhaled air in humans and its level may decrease in heart diseases. In the present study we prospectively investigated how heart transplantation treated with oral immunosuppresive drugs based on ciclosporine A influences the exhaled NO concentration (exNO). The study was performed in 17 patients after heart transplantation in various time after procedure and 15 nonsmoking healthy volunteers as a control group. Patients after heart transplantation were free of clinical signs of rejection. End-tidal concentration of exNO was measured by the use of a chemiluminescence method. We found no statistically significant differences in the exNO level between patients after heart transplantation and healthy controls (6.81+/-2.70 part per billion (ppb) in the transplant group vs. 6.01+/-3.43 ppb in the control group). We conclude that heart transplantation and immunosuppresive therapy do not influence the exhaled NO concentration.

Fremtidens biblioteksbetjening af børn

DEFF Research Database (Denmark)

Høyrup, Helene

2008-01-01

Rapporten er resultatet af et tværministerielt udvalgsarbejde nedsat af Kulturministeriet.  Kommissoriet har været at nytænke biblioteksbetjeningen af børn, så den passer til vidensamfundet.  Udvalgsarbejdet munder ud i ti bud for fremtidens biblioteksbetjening af børn....

Radium and radon exhalation rate in soil samples of Hassan district of South Karnataka, India

International Nuclear Information System (INIS)

Jagadeesha, B.G.; Narayana, Y.

2016-01-01

The radon exhalation rate was measured in 32 soil samples collected from Hassan district of South Karnataka. Radon exhalation rate of soil samples was measured using can technique. The results show variation of radon exhalation rate with radium content of the soil samples. A strong correlation was observed between effective radium content and radon exhalation rate. In the present work, an attempt was made to assess the levels of radon in the environment of Hassan. Radon activities were found to vary from 2.25±0.55 to 270.85±19.16 Bq m"-"3 and effective radium contents vary from 12.06±2.98 to 1449.56±102.58 mBq kg"-"1. Surface exhalation rates of radon vary from 1.55±0.47 to 186.43±18.57 mBq m"-"2 h"-"1, and mass exhalation rates of radon vary from 0.312±0.07 to 37.46±2.65 mBq kg"-"1 h"-"1. (authors)

An Acoustic-Based Method to Detect and Quantify the Effect of Exhalation into a Dry Powder Inhaler.

Science.gov (United States)

Holmes, Martin S; Seheult, Jansen N; O'Connell, Peter; D'Arcy, Shona; Ehrhardt, Carsten; Healy, Anne Marie; Costello, Richard W; Reilly, Richard B

2015-08-01

Dry powder inhaler (DPI) users frequently exhale into their inhaler mouthpiece before the inhalation step. This error in technique compromises the integrity of the drug and results in poor bronchodilation. This study investigated the effect of four exhalation factors (exhalation flow rate, distance from mouth to inhaler, exhalation duration, and relative air humidity) on dry powder dose delivery. Given that acoustic energy can be related to the factors associated with exhalation sounds, we then aimed to develop a method of identifying and quantifying this critical inhaler technique error using acoustic based methods. An in vitro test rig was developed to simulate this critical error. The effect of the four factors on subsequent drug delivery were investigated using multivariate regression models. In a further study we then used an acoustic monitoring device to unobtrusively record the sounds 22 asthmatic patients made whilst using a Diskus(™) DPI. Acoustic energy was employed to automatically detect and analyze exhalation events in the audio files. All exhalation factors had a statistically significant effect on drug delivery (pacoustic method detected exhalations with an accuracy of 89.1%. We were able to classify exhalations occurring 5 cm or less in the direction of the inhaler mouthpiece or recording device with a sensitivity of 72.2% and specificity of 85.7%. Exhaling into a DPI has a significant detrimental effect. Acoustic based methods can be employed to objectively detect and analyze exhalations during inhaler use, thus providing a method of remotely monitoring inhaler technique and providing personalized inhaler technique feedback.

Mathematical model of radon activity measurements

Energy Technology Data Exchange (ETDEWEB)

Paschuk, Sergei A.; Correa, Janine N.; Kappke, Jaqueline; Zambianchi, Pedro, E-mail: sergei@utfpr.edu.br, E-mail: janine_nicolosi@hotmail.com [Universidade Tecnologica Federal do Parana (UTFPR), Curitiba, PR (Brazil); Denyak, Valeriy, E-mail: denyak@gmail.com [Instituto de Pesquisa Pele Pequeno Principe, Curitiba, PR (Brazil)

2015-07-01

Present work describes a mathematical model that quantifies the time dependent amount of {sup 222}Rn and {sup 220}Rn altogether and their activities within an ionization chamber as, for example, AlphaGUARD, which is used to measure activity concentration of Rn in soil gas. The differential equations take into account tree main processes, namely: the injection of Rn into the cavity of detector by the air pump including the effect of the traveling time Rn takes to reach the chamber; Rn release by the air exiting the chamber; and radioactive decay of Rn within the chamber. Developed code quantifies the activity of {sup 222}Rn and {sup 220}Rn isotopes separately. Following the standard methodology to measure Rn activity in soil gas, the air pump usually is turned off over a period of time in order to avoid the influx of Rn into the chamber. Since {sup 220}Rn has a short half-life time, approximately 56s, the model shows that after 7 minutes the activity concentration of this isotope is null. Consequently, the measured activity refers to {sup 222}Rn, only. Furthermore, the model also addresses the activity of {sup 220}Rn and {sup 222}Rn progeny, which being metals represent potential risk of ionization chamber contamination that could increase the background of further measurements. Some preliminary comparison of experimental data and theoretical calculations is presented. Obtained transient and steady-state solutions could be used for planning of Rn in soil gas measurements as well as for accuracy assessment of obtained results together with efficiency evaluation of chosen measurements procedure. (author)

Etched track technique to measure sup 2 sup 2 sup 2 Rn and sup 2 sup 2 sup 0 Rn fluxes on soil surface

CERN Document Server

Csige, I

2003-01-01

sup 2 sup 2 sup 2 Rn and sup 2 sup 2 sup 0 Rn in the human environment are considered to be a risk factor because of the radiation dose due to the inhalation of their short-lived daughters. Main source of radon is usually the soil; therefore the measurement of fluxes of sup 2 sup 2 sup 2 Rn and sup 2 sup 2 sup 0 Rn on soil surfaces is often a relevant parameter to characterise building site radon potential. An etched track detector technique was developed to measure long-time average sup 2 sup 2 sup 2 Rn and sup 2 sup 2 sup 0 Rn fluxes. (R.P.)

Recent Swedish experiences in 222Rn control

International Nuclear Information System (INIS)

Swedjemark, G.A.; Maekitalo, A.

1990-01-01

Swedish local authorities are responsible for decreasing 222 Rn progeny concentrations in homes in their municipalities. To obtain an overall view of their experiences, concerned national authorities sent a questionnaire in 1986 to local authorities. The results were intended to form one basis for decisions by the government regarding revised statements on financial contributions, limits, etc. The results were also intended to be of use to national authorities in determining limits and recommendations and to local authorities in their field work. One result of the survey was an enhanced interest in the Rn problem among Swedish politicians and the mass media. This increased attention resulted in new plans for continued work to decrease Rn levels indoors during 1987-1989, on both a national and a local level. The experiences of the local authorities show that Rn progeny concentrations decreased to below the design level in 95% of newly built houses investigated. It was also found that Rn progeny concentrations were below the limit for reconstruction in 53% of existing homes that previously had levels exceeding the limit

Determination of thoron and radon ratio by liquid scintillation spectrometry

International Nuclear Information System (INIS)

Yoshikawa, H.; Nakanishi, T.; Nakahara, H.

2006-01-01

A portable liquid scintillation counter was applied for the analysis of alpha-ray energy spectrum to determine the ratio of 220 Rn/ 222 Rn in fumarolic gas in the field. A surface-polished vial was developed, by which a Gaussian distribution could be approximated for the alpha-ray energy spectra and the peak areas of the nuclides could be estimated independently, because of the wide FWHM in the liquid scintillation pulse. A fumarolic gas sample was collected in Mt. Kamiyama (Hakoneyama geothermal field in Japan) having low 220 Rn/ 222 Rn ratio of 2.20 ± 0.13. (author)

Transitioning the RN to Ambulatory Care: An Investment in Orientation.

Science.gov (United States)

Allen, Juliet Walshe

2016-01-01

Registered nurses (RNs) struggle when transitioning from the inpatient setting to the outpatient clinical environment because it results in a diverse skill-set shift. The RN, considered an outpatient revenue source, experiences a decrease in peer-to-peer relationships, changes in leadership responsibilities, and changes in workgroup dynamics (supervision of unlicensed clinical personnel who function under the direction of the physician, not the RN). Ambulatory organizations find themselves implementing clinical orientation programs that may not delineate the attributes of the RN. This diminishes their value while emphasizing the unlicensed technical skill set. Creating a core RN orientation program template is paramount for the transition of the RN to the ambulatory setting. The literature reveals several areas where improving the value of the RN will ultimately enhance recruitment and retention, patient care outcomes, and leverage the RN role within any organization. Eleven 30-minute in-depth telephone interviews were conducted in addition to 4 nurse observations to explore the lived experience of the RN in ambulatory care. The findings disclosed an overarching theme of nurse isolation and offered insightful underpinnings for the nurse leader as ambulatory growth continues and nurse leaders further endorse the RN presence in the ambulatory setting.

Change of Exhaled Acetone Concentration in a Diabetic Patient with Acute Decompensated Heart Failure.

Science.gov (United States)

Yokokawa, Tetsuro; Ichijo, Yasuhiro; Houtsuki, Yu; Matsumoto, Yoshiyuki; Oikawa, Masayoshi; Yoshihisa, Akiomi; Sugimoto, Koichi; Nakazato, Kazuhiko; Suzuki, Hitoshi; Saitoh, Shu-Ichi; Shimouchi, Akito; Takeishi, Yasuchika

2017-10-21

In heart failure patients, exhaled acetone concentration, a noninvasive biomarker, is increased according to heart failure severity. Moreover, exhaled acetone concentration is also known to be affected by diabetes mellitus. However, there have been no reports on exhaled acetone concentration in heart failure patients with diabetes mellitus. A 77-year old man was admitted to our hospital with acute decompensated heart failure and atrioventricular block. He had controlled diabetes mellitus under insulin treatment with hemoglobin A1c of 6.5%. He underwent treatment of diuretics and permanent pacemaker implantation. His condition improved and he was discharged at Day 12. Due to the heart failure improvement, his levels of exhaled acetone concentration decreased from 1.623 ppm at admission to 0.664 ppm at discharge. This is the first report to reveal a change of exhaled acetone concentration in a diabetic patient with acute decompensated heart failure.

A Pilot Study to Assess Solanesol Levels in Exhaled Cigarette Smoke

Directory of Open Access Journals (Sweden)

Moldoveanu SC

2014-12-01

Full Text Available This paper describes the results obtained during the measurement of the level of solanesol in exhaled cigarette smoke from human subjects. The study was performed with three different cigarettes with U.S. Federal Trade Commission (FTC ‘tar’ values of 5.0 mg, 10.6 mg, and 16.2 mg. The number of human subjects was ten smokers for each of the evaluated products, each subject smoking three cigarettes within one hour. The exhaled smoke was collected using a vacuum assisted procedure that avoids strain in exhaling, and the solanesol was analyzed using an original high performance liquid chromatography (HPLC technique. The cigarette butts from the smokers were collected and also analyzed for solanesol. The results obtained for the cigarette butts from the smokers were used to calculate the level of solanesol delivered to the smoker, based on calibration curves. These curves were generated separately by analyzing the solanesol in smoke and in the cigarette butts obtained by machine smoking under different puffing regimes. Knowing the levels of solanesol delivered to the smoker and the exhaled levels it was possible to calculate the retention and retention % of this compound from mainstream smoke for different cigarettes types. The amount of retained solanesol is the lowest for the 5.0 mg ‘tar’ product, and the highest for the 16.2 mg ‘tar’ product, although there is not much difference between the 10.6 mg ‘tar’ product and the 16.2 mg ‘tar’ product. For the 10.6 mg ‘tar’ cigarettes the retention % was between 60% and 72%, for the 5.0 mg product the retention % was slightly lower ranging between 53% and 70%, while for the 16.2 mg ‘tar’ product, the retention % was slightly higher ranging between 62% and 82%.

Exhalation of I-131 after radioiodine therapy: time dependence and chemical form

International Nuclear Information System (INIS)

Schomaecker, K.; Fischer, T.; Eschner, W.; Gaidouk, M.I.; Schicha, H.

2001-01-01

Aim: The change of both amount and chemical forms of radioiodine exhaled in the air of rooms with patients on the therapy ward should be investigated depending on radioactivity applied, time after application, and kind of thyroid disease. Methods: The air of ward-rooms of 62 patients with thyroid carcinoma, Graves' Disease, and autonomy which received different therapy doses, was investigated with an portable constant air flow sampler. Different chemical iodine species (organic, elemental, aerosol bound) were collected during 8 hr in various filters until 3 days after application of the radioiodine capsule, according to their chemical form. The radioactivity in the filters was measured with a well counter on defined time points after application. Results: The radioactivity exhaled was between 0,008 and 0,03% related to activity of radioiodine applied. The percentage of radioiodine exhaled related to the activity applied, differed significantly depending on disease and changed as follows: Grave's disease > autonomy > carcinoma. The exhalation of radioiodine became stronger with increasing applied activities and showed an exponential decrease with time. The most part of radioiodine was present in organic bound form. This organic portion decreased with time in favour of the other iodine species. Conclusion: The degree of accumulation of radioiodine orally applied within thyroid seems to be in direct proportion to the extend of its exhalation. Further measurements directly in the breathing air of RIT-patients are necessary, in order to clarify the relationship between degree of thyroid uptake and quantity as well as chemical form of radioiodine exhaled. (orig.) [de

Human exhaled air energy harvesting with specific reference to PVDF film

Directory of Open Access Journals (Sweden)

Manisha Rajesh Mhetre

2017-02-01

Full Text Available Spirometer is a medical equipment used to measure lung capacity of a human being. It leads to diagnosis of several diseases. The researchers worked on harvesting energy from human exhalation while carrying out measurements using spirometer. A prototype has been developed using piezoelectric material i.e. PVDF (polyvinylidene fluoride film as sensor. This paper presents the methodology and experimentation carried out for exhaled air energy harvesting using PVDF film. Experimental results obtained are encouraging. Measurements are also carried out on various subjects having different height, weight, age and gender. Data analysis shows variation in the energy harvested with different physical parameters and gender. Experimentation shows that voltage generated due to exhaled air is promising for harvesting.

222Rn levels in Kingsville, Texas, and vicinity near an in situ uranium mine

International Nuclear Information System (INIS)

McGehee, T.L.; Martino, M.R.; Harr, T.L.; Samudio, A.

1994-01-01

An investigation of the 222 Rn levels in ground water, soils, and indoor air has disclosed two 222 Rn ground-water anomalies in the Kingsville, Texas, area from uranium-enriched sandstones of the Evangeline aquifer. Indoor air 222 Rn levels were measured in summer 1991 (from undetectable to 3.2 pCi/l) and winter 1991-1992 (0.01 to 3.98 pCi/l) to determine seasonal extremes and risk to the public. Soil 222 Rn concentration maps ranging from undetectable to 75.4 pCi/l correlate to the low levels found in homes. Results of this study are based on analyses of 218 water samples, 52 in situ soil samples, and 104 indoor air samples. Water samples were injected into a scintillation mix (EPA/EERF-Manual-78-1) and analyzed by liquid scintillation techniques. Indoor air and soil samples were collected using passive charcoal canisters and analyzed by gamma-ray detection techniques (EPA 520/5-87-005). One ground-water 222 Rn anomaly lies near the permitted boundary of a large uranium deposit that is being mined. Private wells near the ore body yielded, 1,023 to 23,256 pCi/l at the well head. A second anomaly is located 2.5 mi (4 km) north of the uranium ore body near Naval Air Station, Kingsville. Private water wells in this area yielded 442 to 1,950 pCi/l 222 Rn at the well head. The radon anomalies are related to subsurface mineralization, which is one of the known natural geologic hazards of this area. Indoor air 222 Rn levels are well below the U.S. Environmental Protection Agency (US/EPA) action limit of 4 pCi/l. However, the high levels of 222 RN in ground water should be mitigated before entry into the home environment. High 222 Rn levels in ground water were reduced to background levels in household waters by use of a pre-introduction large-capacity holding tank

220Radon (Thoron) and progeny exposures in the front-end of nuclear fuel cycle activities with special reference to radioactive minerals, thorium and rare earths processing

International Nuclear Information System (INIS)

Pillai, P.M.B.

2008-01-01

Radon is a major Source of radiation exposure both at home and work places due to its universal presence. The International Commission on Radiological Protection has always treated the radioactive noble gas radon ( 222 Rn) and its isotope thoron ( 220 Rn) as a separate subject. ICRP Publication 65 (ICRP, 1993) summarizes the current knowledge of health effects of inhaled radon and its decay products and gives recommendations/guidelines for the control of exposures due to high radon levels encountered in dwellings and work places. A major departure from earlier publications on the subject is the entirely epidemiological considerations for developing the recommendations. In work place monitoring the progeny concentrations are of primary concern than the gases themselves. However radon/thoron gas measurements may also be used provided reliable information on the equilibrium factors are available. Though many developments have taken place and many options are available for individual monitoring for radon (mainly progeny) exposures of occupational workers, a viable personal dosimeter for individual monitoring for thoron daughters is yet to materialize. The doses are mostly estimated by making use of work place monitoring data in combination with occupancy factors

Transforming RN education: clinical learning and clinical knowledge development.

Science.gov (United States)

Benner, P

1993-04-01

Transforming RN education has the potential for transforming clinical teaching and learning for all students. The returning RN student offers possibilities for clinical learning that the generic student does not have, but this should not cause us to limit the returning RN student to the generic level. Where possible innovative programs should be developed to move the RN student from baccalaureate level to the Master's level. As educators, we should take the opportunity to increase the numbers of nurses who are educationally prepared to move into advanced levels of practice. The returning RN student offers a rich human resource for the profession, and a rich resource for improving our clinical teaching as well as our practice.

A long range transport model of Rn-222

International Nuclear Information System (INIS)

Ikebe, Y.; Kojima, S.; Shimo, M.

1993-01-01

In this report, we propose an analytical treatment about temporal variation of 222 Rn concentration in the atmosphere with an aim to clarify origin and transport of 222 Rn. Based on the results of numerical simulation of radon, we separate the 222 Re concentration measured at Nagoya into the following two components : (1) 222 Rn atom originated near from the measuring site, which is denoted by 'diurnal variation component'. From numerical simulation of radon, it has been shown that the measured diurnal variation can be explained by this component. (2) 222 Rn atoms originated far from the measuring site (including Chinese Continent), which is denoted by 'background component'. For this component, we propose here a one layer transport model using air mass trajectory technique. By this model we can explain the temporal variation of background component and seasonal variation of 222 Rn at Nagoya. (3 figs.)

Ra-226 and Rn-222 in saline water compartments of the Aral Sea region

International Nuclear Information System (INIS)

Schettler, Georg; Oberhänsli, Hedi; Hahne, Knut

2015-01-01

Highlights: • 222 Rn and 226 Ra concentrations in different water compartments of the Aral Sea region. • 226 Ra-analysis based on 222 Rn-ingrowth versus MS-analysis after solid-phase extraction. • 226 Ra in different groundwater types of the Aral Sea Basin. • 222 Rn distribution in the Aral Sea, western basin. - Abstract: The Aral Sea has been shrinking since 1963 due to extensive irrigation and the corresponding decline in the river water inflow. Understanding of the current hydrological situation demands an improved understanding of the surface water/groundwater dynamics in the region. 222 Rn and 226 Ra measurements can be used to trace groundwater discharge into surface waters. Data of these radiometric parameters were not previously available for the study region. We determined 222 Rn activities after liquid phase extraction using Liquid Scintillation Counting (LSC) with peak-length discrimination and analyzed 226 Ra concentrations in different water compartments of the Amu Darya Delta (surface waters, unconfined groundwater, artesian water, and water profiles from the closed Large Aral Sea (western basin). The water samples comprise a salinity range between 1 and 263 g/l. The seasonal dynamics of solid/water interaction under an arid climate regime force the hydrochemical evolution of the unconfined groundwater in the Amu Darya Delta to high-salinity Na(Mg)Cl(SO 4 ) water types. The dissolved radium concentrations in the waters were mostly very low due to mineral over-saturation, extensive co-precipitation of radium and adsorption of radium on coexisting solid substrates. The analysis of very low 226 Ra concentrations (<10 ppq) at remote study sites is a challenge. We used the water samples to test and improve different analytical methods. In particular, we modified a procedure developed for the α-spectrometric determination of 226 Ra after solid phase extraction of radium using 3M Empore™ High Performance Extraction Disks (Purkl, 2002) for the

Study of different factors which can explain the radon exhalation potential of soils; Recherche de differents parametres caracterisant le potentiel d`exhalation en radon des sols

Energy Technology Data Exchange (ETDEWEB)

Demongeot, St

1997-10-27

Radon is a natural radioactive gas belonging to the Uranium-238 chain, which is present in the earth crust and produced by the disintegration of radium-226. It is considered as the major source of radiological exposure of man to natural radiation because it can accumulate in indoor atmosphere. So, this health risk must be take into account.The aim of this study is to find some tools in order to identify high radon level area. The first part of this study has consisted in measurement of radon emission from different not sufficient for the estimation of the radon exhalation potential in a given area. In the second part of this work, we have studied the variations of in situ radon concentration as a function of different geological and pedologic parameters of the site. With the results obtained, we have determined the data which have to be considered, and the methodology to be applied for the determination of the radon exhalation of a given area. Furthermore, by the mean of numerical simulations (TRACH Model), it was possible to know the scale of radon flux variation in a given point versus the hydric state of the ground and thus the permeability: these parameters are not easy to measure because of their variabilities with time. The methodology ESPERAS (EStimation du Potential d`Exhalation en Radon des Sols) developed during this work was applied first, at a local scale and then to greater area. The values estimated by this way are in a good agreement with the results of measurements. So, we can determine the areas which are affected by high radon levels. (author)

Radon exhalation rates of concrete modified with fly ash and silica fumes

International Nuclear Information System (INIS)

Amit Kumar; Chauhan, R.P.; Mehta, Vimal; Kant, K.

2013-01-01

The radiological impact of the environmental gas radon to the health of general public is of concern since many decades. Cement used for the construction blended with fly ash and silica fumes is recommended by Government in order to avoid the soil and environmental pollution. But these addition step-up the Indoor radon level in the dwelling due to radioactivity contents. The exhalation of radon from concrete blended with silica fumes and fly ash depends upon addition level, porosity, moisture and radioactivity content. In order to optimize the level of substitution of silica fumes and fly ash, measurements of radon exhalation rates from the concrete blended with different proportions of fly ash and silica fumes was carried out using active scintillation radon monitor. The effect of porosity, moisture, back diffusion and radioactivity content of the concrete on exhalation rates is studied. The measured exhalation rates were extrapolated for indoor radon concentration and effective dose equivalent using ICRP, 1987 recommendations. (author)

Radiological risk of actinon (/sup 219/Rn)

Energy Technology Data Exchange (ETDEWEB)

Crawford, D.J.

1981-12-01

The research reported was designed to provide information on the following subjects: (1) development of the functional relations between exposure to the /sup 219/Rn decay chain and pertinent health effects; (2) specification of the circumstances under which a significant concentration of the decay chain may occur; (3) recommendation of an exposure standard which will provide protection of the public from significant elevation of health effects; and (4) an assessment of the impact of /sup 219/Rn on determinations of the concentration of the /sup 222/Rn decay chain and/or its precursors.

Correlation among the terrestrial gamma radiation, the indoor air 222Rn, and the tap water 222Rn in Switzerland

International Nuclear Information System (INIS)

Buchli, R.; Burkart, W.

1989-01-01

The external gamma radiation and the indoor air Rn (222Rn) concentration were measured in 55 houses of the South East Grisons, the Urseren valley, and the Upper Rhine valley (crystalline subsoils) and in 39 houses of the Molasse basin and the Helvetic nappes (sedimentary subsoils). In homes located on a crystalline subsoil, a mean cellar gamma level of 1.40 mGy y-1 was measured, which is twice the mean gamma level of 0.70 mGy y-1 found in homes built on a sedimentary subsoil. The cellar 222Rn gas concentration is about six times higher in houses with a crystalline subsoil (1232 Bq m-3) than in houses with a sedimentary subsoil (201 Bq m-3). Although a weak correlation is observed between the mean gamma radiation levels and mean cellar 222Rn gas concentrations for the five subregions investigated, the gamma levels and the 222Rn gas concentrations do not correlate for single homes. For the population living on the ground floor of a house with a crystalline subsoil, the gamma radiation and the indoor air 222Rn lead to estimated mean exposures of 1.16 mSv and 9.44 mSv effective dose equivalent per year, respectively. In houses with a sedimentary subsoil, these mean exposures lead to 0.68 mSv y-1 and 3.22 mSv y-1, respectively. A mean tap water 222Rn content of 38.3 Bq L-1 and 10.4 Bq L-1 was measured in 31 villages with a crystalline subsoil and 73 villages with a sedimentary subsoil, respectively. Radon-222 degasing from the tap water into the indoor air leads to an additional exposure of about 0.11 mSv y-1 and 0.03 mSv y-1 in homes with a crystalline subsoil and homes with a sedimentary subsoil, respectively

High-resolution ion pulse ionization chamber with air filling for the {sup 222}Rn decays detection

Energy Technology Data Exchange (ETDEWEB)

Gavrilyuk, Yu.M.; Gangapshev, A.M.; Gezhaev, A.M.; Etezov, R.A.; Kazalov, V.V.; Kuzminov, V.V. [Baksan Neutrino Observatory,Institute for Nuclear Research RAS, 361609 Neutrino (Russian Federation); Panasenko, S.I. [V.N.Karazin Kharkiv National University, 61022 Kharkiv (Ukraine); Ratkevich, S.S., E-mail: ssratk@gmail.com [V.N.Karazin Kharkiv National University, 61022 Kharkiv (Ukraine); Tekueva, D.A.; Yakimenko, S.P. [Baksan Neutrino Observatory,Institute for Nuclear Research RAS, 361609 Neutrino (Russian Federation)

2015-11-21

The construction and characteristics of the cylindrical ion pulse ionization chamber (CIPIC) with a working volume of 3.2 L are described. The chamber is intended to register α-particles from the {sup 222}Rn and its daughter's decays in the filled air sample. The detector is less sensitive to electromagnetic pick-ups and mechanical noises. The digital pulse processing method is proposed to improve the energy resolution of the ion pulse ionization chamber. An energy resolution of 1.6% has been achieved for the 5.49 MeV α-line. The dependence of the energy resolution on high voltage and working media pressure has been investigated and the results are presented. - Highlights: • The construction and characteristics of the cylindrical ion pulse ionization chamber (CIPIC) with a working volume of 3.2 L are described. • The chamber is intended to register alpha-particles from {sup 222}Rn and its daughter's decays in the filled air sample. • The detector is less sensitive to electromagnetic pick-ups and mechanical noises. • An energy resolution of 1.6% has been achieved for the 5.49 MeV alpha-line. The dependence of the energy resolution on high voltage and working media pressure have been investigated and the results are presented.

RN-BSN Students' Perceptions of the Differences in Practice of the ADN- and BSN-Prepared RN.

Science.gov (United States)

Matthias, April D; Kim-Godwin, Yeoun Soo

2016-01-01

This study explored RN-BSN students' perceptions of practice differences between nurses prepared with an ADN and BSN. Five themes were identified in 20 students' discussion posts: "a nurse is a nurse" at the bedside, beyond the bedside, BSN wanted, digging deeper, and appraisal. Results illustrate the need for educators to assist nurses in translating the differentiated educational competencies to the practice role of the bedside RN.

Experimental and Numerical Investigation of Effect of Air Stability on Exhaled Air Dispersion

DEFF Research Database (Denmark)

Xu, Chunwen; Gong, Guangcai; Nielsen, Peter Vilhelm

2014-01-01

studies. As the thermal stratification under displacement ventilation blocks the vertical movement of exhaled air, the exhaled contaminant may be trapped between temperature stratifications. As the dispersion of contaminant is closely related to the health of human indoors, the temperature structure...... was used for experimental study, and a numerical person was built to simulate the manikin. The velocity, temperature and concentration of tracer gas in exhaled air are affected by air stability to different degrees. The similarity of this effect among these parameters can also be observed through numerical...

Characterization of 222Rn entry into a basement structure surrounded by low permeability soil

International Nuclear Information System (INIS)

Ward, D.C.

1992-01-01

An experimental facility has been developed to monitor the entry rate and concentration of 222 Rn in two basement type structures surrounded by soil having a permeability on the order of 1- -12 m 2 . A data acquisition system recorded environmental conditions outside and inside the structures, including basement air exchange rates, every 15 min. Indoor 222 Rn concentrations ranged from 400 to 1400 Bq m -3 . The observed 222 Rn entry rate is highly variable and has two primary components; a constant input rate caused by diffusion of 222 Rn through the concrete walls and floor, and a variable rate that depends upon indoor-soil pressure differentials of only a few pascals. Pressure differentials are dependent upon wind speed and wind direction. Stack effect was not significant. During a two week period, with relatively calm winds, diffusion through the concrete walls and floor plus the floor-wall joint accounted for more than 80% of the total 222 Rn entry

Analytical FcRn affinity chromatography for functional characterization of monoclonal antibodies

Science.gov (United States)

Schlothauer, Tilman; Rueger, Petra; Stracke, Jan Olaf; Hertenberger, Hubert; Fingas, Felix; Kling, Lothar; Emrich, Thomas; Drabner, Georg; Seeber, Stefan; Auer, Johannes; Koch, Stefan; Papadimitriou, Apollon

2013-01-01

The neonatal Fc receptor (FcRn) is important for the metabolic fate of IgG antibodies in vivo. Analysis of the interaction between FcRn and IgG in vitro might provide insight into the structural and functional integrity of therapeutic IgG that may affect pharmacokinetics (PK) in vivo. We developed a standardized pH gradient FcRn affinity liquid chromatography method with conditions closely resembling the physiological mechanism of interaction between IgG and FcRn. This method allows the separation of molecular IgG isoforms, degradation products and engineered molecules based on their affinity to FcRn. Human FcRn was immobilized on the column and a linear pH gradient from pH 5.5 to 8.8 was applied. FcRn chromatography was used in comparison to surface plasmon resonance to characterize different monoclonal IgG preparations, e.g., oxidized or aggregated species. Wild-type and engineered IgGs were compared in vitro by FcRn chromatography and in vivo by PK studies in huFcRn transgenic mice. Analytical FcRn chromatography allows differentiation of IgG samples and variants by peak pattern and retention time profile. The method can distinguish: 1) IgGs with different Fabs, 2) oxidized from native IgG, 3) aggregates from monomer and 4) antibodies with mutations in the Fc part from wild-type IgGs. Changes in the FcRn chromatographic behavior of mutant IgGs relative to the wild-type IgG correlate to changes in the PK profile in the FcRn transgenic mice. These results demonstrate that FcRn affinity chromatography is a useful new method for the assessment of IgG integrity. PMID:23765230

Measurement of the radon exhalation rate from the medium surface by tracing the radon concentration

International Nuclear Information System (INIS)

Yanliang Tan; Detao Xiao

2013-01-01

The paper will present a method based on the accumulation chamber technique for measuring of radon exhalation from the medium surface. A radon monitor traces the change of radon concentration in the accumulation chamber, and then the radon exhalation can be obtained accurately through linear fit. Based on our recent experiments, the radon exhalation rate from the medium surface obtained from this method is in good agreement with the actual exhalation rate of our simulation facility. This method is superior to the competition method which obtains the radon exhalation through the exponential fit by an external PC-system. The calculation for the exponential fit is very easy by computer and related software. However, for portable instruments, the single chip microcomputer can't calculate the exponential fit rapidly. Thus, this method is usable for developing the new portable instrument to classify building materials, etc. (author)

222Rn in wine cellars in Hungary

International Nuclear Information System (INIS)

Csige, I.; Hunyadi, I.; Szerbin, P.; Juhasz, L.

2004-01-01

We measured seasonal average 222 Rn activity concentrations in the air of 60 wine cellars in the Tokajhegyalja and Villany wine regions of Hungary using Radamon type etched track radon detectors. The exposure period was 3 months, matching the seasons of 2003-2004. We also used an ionization chamber-type continuous 222 Rn-monitor (AlphaGUARD PQ222, Genitron Instruments, Germany) to study temporal variations of 222 Rn activity concentration in a selected wine cellar in the Tokajhegyalja wine region. This instruments also recorded temperature, atmospheric pressure and relative humidity data. The etched track detector data revealed that the 222 Rn activity concentrations in the air of wine cellars spread over a wide range, from the ambient outdoor concentration of 6 Bq.m -3 up to 6 kBq.m -3 characteristic of natural caves. The temporal variation of 222 Rn activity concentration in the air of the selected cellar varied inversely with the variation of the atmospheric pressure. Earlier we observed similar phenomena in natural karstic caves connected to the surface with vertical shafts only. This suggests that relatively large volume of pore space of the embedding rock communicates with the volume of the cellar induced by the variation of the atmospheric pressure

Margus Pärn : turuliidri koht on Maximale jõukohane 4-5 aastaga / Margus Pärn ; interv. Viljar Rääsk

Index Scriptorium Estoniae

Pärn, Margus

2008-01-01

Leedu jaekaubandusketi Maxima Eesti juht Margus Pärn vastab küsimustele, mis puudutavad Eesti jaekaubandusturgu ja Maxima positsiooni selles, ettevõtte laienemist ning turuliidri rolli saavutamise võimalust. Lisa: Margus Pärn. Tabel: Maxima

222Rn and 14CO2 concentrations in the surface layer of the atmosphere

International Nuclear Information System (INIS)

Holy, K.; Chudy, M.; Sivo, A.; Richtarikova, M.; Boehm, R.; Polaskova, A.; Vojtyla, P.; Bosa, I.; Hola, O.

2002-01-01

Long-term monitoring of the Δ 14 C in the atmospheric near-ground CO 2 has been realized in Bratislava and Zlkovce, situated near the nuclear power plant Jaslovske Bohunice. Until 1993, the monthly mean Δ 14 C values showed a high variability. The annual means of Δ 14 C were about 30 per mille higher at Zlkovce than in highly industrialised Bratislava. An important change in the behaviour of the 14 C data has occurred since 1993. The records from both stations show the similar course, mainly due to the fact that there do not occur deep winter minima in Bratislava. This behaviour corresponds to the lower values of the total fossil fuel CO 2 emissions in the years after 1993 when compared to the previous years. At present, both sets of data show that the 14 C concentration is about 10% above the natural level. Since 1987 also the 222 Rn concentration in the surface layer of the atmosphere has been measured in Bratislava. These measurements provided an extensive set of the 222 Rn data characteristic for the inland environment with high level of atmospheric pollution. The seasonal and daily variations of the 222 Rn concentration were observed. The investigation of the relation between the monthly mean diurnal courses of the 222 Rn concentration and the atmospheric stability proved a high correlation between them. The 222 Rn data were used to interpret the anomalous Δ 14 C values in the surface layer of the atmosphere. (author)

Leukotrienes in Exhaled Breath Condensate and Fractional Exhaled Nitric Oxide in Workers Exposed to TiO2 Nanoparticles.

Czech Academy of Sciences Publication Activity Database

Pelclová, D.; Ždímal, Vladimír; Kačer, P.; Felclová, Z.; Vlčková, Š.; Komarc, M.; Navrátil, Tomáš; Schwarz, Jaroslav; Zíková, Naděžda; Makeš, Otakar; Syslová, K.; Běláček, J.; Zakharov, S.

2016-01-01

Roč. 10, č. 3 (2016), s. 036004 ISSN 1752-7155 Institutional support: RVO:67985858 ; RVO:61388955 Keywords : nanoparticles * TiO2 * exhaled breath condensate Subject RIV: CF - Physical ; Theoretical Chemistry; CG - Electrochemistry (UFCH-W) Impact factor: 4.318, year: 2016

Factors influencing indoor concentrations of radon and daughter products

International Nuclear Information System (INIS)

Wang Hengde

1985-01-01

The correlation between indoor concentrations of 222 Rn and its daughters and some influencing factors is discussed and expressions of concentrations are derived with relation to radon exhalation rate from indoor surfaces, air exchange rate and daughter deposition velocities on indoor surfaces. Experimental methods for determining radon exhalation rate, air exchange rate and daughter deposition velocities are also mentioned

Non-asthmatic patients show increased exhaled nitric oxide concentrations

Directory of Open Access Journals (Sweden)

Beatriz M. Saraiva-Romanholo

2009-01-01

Full Text Available OBJECTIVE: Evaluate whether exhaled nitric oxide may serve as a marker of intraoperative bronchospasm. INTRODUCTION: Intraoperative bronchospasm remains a challenging event during anesthesia. Previous studies in asthmatic patients suggest that exhaled nitric oxide may represent a noninvasive measure of airway inflammation. METHODS: A total of 146,358 anesthesia information forms, which were received during the period from 1999 to 2004, were reviewed. Bronchospasm was registered on 863 forms. From those, three groups were identified: 9 non-asthmatic patients (Bronchospasm group, 12 asthmatics (Asthma group and 10 subjects with no previous airway disease or symptoms (Control group. All subjects were submitted to exhaled nitric oxide measurements (parts/billion, spirometry and the induced sputum test. The data was compared by ANOVA followed by the Tukey test and Kruskal-Wallis followed by Dunn's test. RESULTS: The normal lung function test results for the Bronchospasm group were different from those of the asthma group (p <0.05. The median percentage of eosinophils in induced sputum was higher for the Asthma [2.46 (0.45-6.83] compared with either the Bronchospasm [0.55 (0-1.26] or the Control group [0.0 (0] (p <0.05; exhaled nitric oxide followed a similar pattern for the Asthma [81.55 (57.6-86.85], Bronchospasm [46.2 (42.0 -62.6] and Control group [18.7 (16.0-24.7] (p< 0.05. CONCLUSIONS: Non-asthmatic patients with intraoperative bronchospasm detected during anesthesia and endotracheal intubation showed increased expired nitric oxide.

A case study of radon-thoron concentrations in dwellings around uranium deposit sites in Meghalaya

International Nuclear Information System (INIS)

Shaikh, A.N.; Ramachandran, T.V.; Eappen, K.P.; Mayya, Y.S.; Khan, A.H.; Puranik, V.D.; Hoda, S.Q.

2004-01-01

Measurement of 222 Rn and 220 Rn were carried out in a few houses of different construction types selected at 21 locations around uranium deposit sites at Meghalaya using Solid State Nuclear Track Detector (SSNTD) based dosimeter developed at the Bhabha Atomic Research Centre (BARC). It comprises of two cylindrical cups with slots for placing the detector films. The cups are designed for 222 Rn and 220 Rn gas estimations. Detector film used is 12 mm thick cellulose nitrate (LR -115 Type -II), of Kodak pathe. 222 Rn levels in these dwellings varied from 4.6 to 117.0 Bq m -3 with a GM of 19.4 Bq. m -3 (GSD 4.5), while 220 Rn varied from 5.0 to 123.0 Bq. m -3 with al GM of 16.6 Bqm -3 (GSD 2.0). The higher values were observed in building housing geological laboratories. (author)

Extraction and purification of {sup 227}Ac and development of solid {sup 219}Rn source

Energy Technology Data Exchange (ETDEWEB)

Tang, Quan; Qiu, Shoukang; Xiao, Detao; Zhou, Yaohui; An, Xiaogang [University of South China, Hengyang (China). Radon Key Laboratory of Hunan Province/School of Nuclear Science and Technology

2014-04-01

The method of {sup 227}Ac extraction and purification from high-grade uranium ore and the test results of solid {sup 219}Rn source made from {sup 227}Ac are reported in this paper. With five years of follow-up monitoring, radiochemical purity of {sup 227}Ac and the emanation power of solid {sup 219}Rn source has been checked by emanation method and γ-spectrometry, the results showed that {sup 228}Th, {sup 231}Pa and {sup 226}Ra have been effectively removed and the emanation power of {sup 219}Rn source is about 80%. The long-term test results also showed that the {sup 219}Rn emanation rate remains stable in a wide air humidity range (40% ∝ 90%). Though the {sup 219}Rn source has not been accurately calibrated yet, it has been applied in the research for delay coincidence measurement of {sup 223}Ra. (orig.)

Thoron Mitigation System based on charcoal bed for applications in thorium fuel cycle facilities (part 2): Development, characterization, and performance evaluation.

Science.gov (United States)

Sudeep Kumara, K; Sahoo, B K; Gaware, J J; Sapra, B K; Mayya, Y S; Karunakara, N

2017-06-01

Exposure due to thoron ( 220 Rn) gas and its decay products in a thorium fuel cycle facility handling thorium or 232 U/ 233 U mixture compounds is an important issue of radiological concern requiring control and mitigation. Adsorption in a flow-through charcoal bed offers an excellent method of alleviating the release of 220 Rn into occupational and public domain. In this paper, we present the design, development, and characterization of a Thoron Mitigation System (TMS) for industrial application. Systematic experiments were conducted in the TMS for examining the 220 Rn mitigation characteristics with respect to a host of parameters such as flow rate, pressure drop, charcoal grain size, charcoal mass and bed depth, water content, and heat of the carrier gas. An analysis of the experimental data shows that 220 Rn attenuation in a flow through charcoal bed is not exponential with respect to the residence time, L/U a (L: bed depth; U a : superficial velocity), but follows a power law behaviour, which can be attributed to the occurrence of large voids due to wall channeling in a flow through bed. The study demonstrates the regeneration of charcoal adsorption capacity degraded due to moisture adsorption, by hot air blowing technique. It is found that the mitigation factor (MF), which is the ratio of the inlet 220 Rn concentration (C in ) to the outlet 220 Rn concentration (C out ), of more than 10 4 for the TMS is easily achievable during continuous operation (>1000 h) at a flow rate of 40 L min -1 with negligible (evaluated for its long-term performance and overall effectiveness in mitigating 220 Rn levels in the workplace. Copyright © 2017 Elsevier Ltd. All rights reserved.

Trends and reduction scenarios for Rn 222 concentrations in dwellings

International Nuclear Information System (INIS)

Blaauboer, R.O.; Heling, R.

1993-07-01

In the title study the effects of possible measures on the average radon concentration in Dutch dwellings is evaluated. Attention is paid to the trends in building methods, the use of building materials and using the trends as a reference development (scenario 0). A total of seven scenarios has been evaluated. The model that was used was kept rather simple, because most of the parameter values are average values. The measures studied were selected on the basis of cost-effectiveness. All measures are based on reducing the infiltration of radon from the crawl space under the house to the living quarters and reducing the exhalation rates of building materials. The evaluation shows a rather good match with earlier measurements and projections as far as the average radon concentration is concerned. The trend, i.e. the development without taking measures directed at reducing the radon concentration, predicts a slow increase of about 15% until approximately the year 2025. The scenario that is directed at using concrete with low Ra-226 concentrations in new houses projects an end to this trend. Other scenarios reveal that taking measures solely in the existing housing stock would give a substantial decrease in radon concentrations in the near future. The spread sheet model that was developed to evaluate the consequences of the different scenarios projects a possible reduction of the average radon concentration in dwellings with 25% by the year 2025, compared to 1991, if measures, directed at Rn-reduction are applied. If in addition to that concrete with low Ra-226 concentrations is used in new buildings, a reduction of the average radon concentration is projected of about 30%. This would result in an average radon concentration in dwellings of about 23 Bq.m -3 in the future. These reduction percentages have to be handled with some care however, because the effect of the obviously occurring uncertainties in several parameters used, are not yet quite clear. Trends in and the

Exposure of burrowing mammals to {sup 222}Rn

Energy Technology Data Exchange (ETDEWEB)

Beresford, N.A., E-mail: nab@ceh.ac.uk [NERC Centre for Ecology and Hydrology, Lancaster Environment Centre, Library Av. Bailrigg, Lancaster LA1 4AP (United Kingdom); Barnett, C.L. [NERC Centre for Ecology and Hydrology, Lancaster Environment Centre, Library Av. Bailrigg, Lancaster LA1 4AP (United Kingdom); Vives i Batlle, J. [Belgian Nuclear Research Centre (SCK-CEN), Boeretang 200, 2400 Mol (Belgium); Potter, E.D. [NERC Centre for Ecology and Hydrology, Lancaster Environment Centre, Library Av. Bailrigg, Lancaster LA1 4AP (United Kingdom); Ibrahimi, Z.-F. [Health Protection Agency, Centre for Radiation, Chemical and Environmental Hazards, Chilton, Didcot OX11 0RQ (United Kingdom); Barlow, T.S.; Schieb, C.; Jones, D.G. [British Geological Survey, Environmental Science Centre, Keyworth, Nottingham NG12 5GG (United Kingdom); Copplestone, D. [School of Natural Sciences, University of Stirling, Stirling FK9 4LA (United Kingdom)

2012-08-01

Estimates of absorbed dose rates to wildlife from exposure to natural background radionuclides are required to put estimates of dose rates arising from regulated releases of radioactivity and proposed benchmarks into context. Recent review papers have estimated dose rates to wildlife from {sup 40}K, and {sup 238}U and {sup 232}Th series radionuclides. However, only one study previous has considered the potential dose rates to burrowing animals from inhaled {sup 222}Rn and its daughter products. In this paper we describe a study conducted at seven sites in northwest England. Passive track etch detectors were used to measure the {sup 222}Rn concentrations in artificial burrows over a period of approximately one year. Results suggest that absorbed dose rates to burrowing mammals as a consequence of exposure to {sup 222}Rn are likely to be at least an order of magnitude higher than those suggested in previous evaluations of natural background exposure rates which had omitted this radionuclide and exposure pathway. Dose rates in some areas of Great Britain will be considerably in excess of incremental no-effects benchmark dose rates suggested for use as screening levels. Such advised benchmark dose rates need to be better put into context with background dose rates, including exposure to {sup 222}Rn, to ensure credibility; although the context will be determined by the purpose of the benchmark and the assessment level. - Highlights: Black-Right-Pointing-Pointer Determined {sup 222}Rn concentrations in artificial burrows. Black-Right-Pointing-Pointer Estimated dose rates to burrowing mammals from inhaled {sup 222}Rn and daughter products. Black-Right-Pointing-Pointer {sup 222}Rn likely to dominate exposure of burrowing mammals due to natural radionuclides.

Detection of 222Rn and 226Ra in environmental samples by scintillation method

International Nuclear Information System (INIS)

Zafimanjato, J.L.R.; Raoelina Andriambololona; Mobius, S.

2009-01-01

222 Rn is considered as the major source of radiological exposure of natural radiations to the population. It represents about the half of exposures of natural radiation sources in the world (UNSCEAR, 1993). 222 Rn gets into human body with inhaled air and sometimes with drinking water. Then, the objective of this work is to know the 222 Rn concentrations in water and in indoor atmosphere, and the risk in order to set up a method of monitoring and to identify high radon level areas. A specific method of detection using liquid scintillation with special emphasis on α/β discrimination, the use of solvent extractive and enrichment of radionuclides have been developed for the determination of both 222 Rn and 226 Ra in water. The method is simple, rapid and sensitive. It was shown that the proposed method was suitable for a large scale monitoring and routine analysis. Considerable concentrations of 222 Rn were found in water and air samples from Vinaninkarena - Antsirabe. 222 Rn concentrations obtained by in situ and in laboratory measurements have been compared to the results of an international intercomparison campaigns organised by the German Society for Liquid Scintillation Spectrometry in 2001. An assesment model of the dose due to ingestion and liberation of radon from water is presented and compared with other models especially to the Crawford Brown's model.

Determination of the characteristic limits and responses of nuclear track detectors in mixed radon and thoron atmospheres

International Nuclear Information System (INIS)

Röttger, Annette; Honig, Anja; Schrammel, Dieter; Strauss, Heinrich F.

2016-01-01

Closed nuclear track detectors are widely used for the determination of Rn-222 exposures. There are also partial open systems available, which are specially designed for the determination of the exposure to Rn-220, which is a relevant exposure in special workplaces or in specific regions of the world. This paper presents data and a detail analysis of how to determine the cross-correlation by calibration in pure Rn-222 and pure Rn-220 atm. By these means calibration coefficients for the analysis of real mixed atmospheres can be obtained. The respective decision threshold, detection limit and limits of the confidence interval were determined according to ISO 11929 (ISO 11929:2010, 2010). The exposure of detectors was performed at the radon reference chamber and the thoron progeny chamber of the Physikalisch-Technische Bundesanstalt (PTB). The analysis of track response was done at Parc RGM, while the analytical routines were developed in the Leibniz University Hanover, Institute Radioökologie und Strahlenschutz IRS at the working Group AK SIGMA (Arbeitskreis Nachweisgrenzen). - Highlights: • Analysis of exposure in reference atmospheres according ISO 11929. • Calibration of nuclear track detectors for 222 Rn and 220 Rn. • Calculation of cross-correlation by calibration in pure 222 Rn and 220 Rn atmospheres. • Thoron activity concentration should not be omitted in radon exposure determinations.

A Concise Synthesis of Three Branches Derived from Polysaccharide RN1 and Anti-Pancreatic Cancer Activity Study

Directory of Open Access Journals (Sweden)

Deqin Cai

2017-10-01

Full Text Available RN1, a polysaccharide from flowers of Panax pseudo-ginsieng Wall. Var. notoginseng (Burkill Hoo & Tseng, is a potential multi-targeting drug candidate for pancreatic cancer treatment. However, the active targeting domain of RN1 is still unknown. Herein, three RN1 derived branches were synthesized via [3+2] or [2+2] strategies, efficiently. Two pentasaccharides, 18 and 27, showed similar inhibition effect on pancreatic cancer BxPC-3 cells to that of RN1 at same concentration. Interestingly, tetrasaccharide 21 potently inhibited gemcitabineresistant cell line Panc-1 at high concentration. These suggest that the branches of RN1 might be the active targeting domain and tetrasaccharide 21 might be a potential leading compound for pancreatic cancer with gemcitabine resistance.

Measurement of 222Rn in soil concentrations in interstitial air

International Nuclear Information System (INIS)

Duenas, C.; Fernandez, M.C.; Carretero, J.; Liger, E.

1996-01-01

Measurements of 222 Rn soil concentrations were made by inserting stainless-steel sampling tubes into the soil. The samples of the soil interstitial air were taken in to pre-evacuated 1 L glass flasks. The glass flasks are cylindrical and coated with a film of ZnS(Ag). 222 Rn was measured by counting the alpha particles emitted by 222 Rn and its daughter products, 218 Po and 214 Bi, when they reached radioactive equilibrium. Measurements of 222 Rn gas concentrations in the soil air interstices by the method at different depths were used to calculate the diffusion coefficient of the 222 Rn in the soil air. This study has been carried out for diverse soils. (Author)

Distribution of Exhaled Contaminants and Personal Exposure in a Room using Three Different Air Distribution Strategies

DEFF Research Database (Denmark)

Olmedo, Inés; Nielsen, Peter V.; Adana, M. Ruiz de

2012-01-01

The level of exposure to human exhaled contaminants in a room depends not only on the air distribution system but also on people’s different positions, the distance between them, people’s activity level and height, direction of exhalation, and the surrounding temperature and temperature gradient...... between the manikins are changed to study the influence on the level of exposure. The results show that the air exhaled by a manikin flows a longer distance with a higher concentration in case of displacement ventilation than in the other two cases, indicating a significant exposure to the contaminants....... Human exhalation is studied in detail for different distribution systems: displacement and mixing ventilation as well as a system without mechanical ventilation. Two thermal manikins breathing through the mouth are used to simulate the exposure to human exhaled contaminants. The position and distance...

Exhaled volatile substances mirror clinical conditions in pediatric chronic kidney disease.

Directory of Open Access Journals (Sweden)

Juliane Obermeier

Full Text Available Monitoring metabolic adaptation to chronic kidney disease (CKD early in the time course of the disease is challenging. As a non-invasive technique, analysis of exhaled breath profiles is especially attractive in children. Up to now, no reports on breath profiles in this patient cohort are available. 116 pediatric subjects suffering from mild-to-moderate CKD (n = 48 or having a functional renal transplant KTx (n = 8 and healthy controls (n = 60 matched for age and sex were investigated. Non-invasive quantitative analysis of exhaled breath profiles by means of a highly sensitive online mass spectrometric technique (PTR-ToF was used. CKD stage, the underlying renal disease (HUS; glomerular diseases; abnormalities of kidney and urinary tract or polycystic kidney disease and the presence of a functional renal transplant were considered as classifiers. Exhaled volatile organic compound (VOC patterns differed between CKD/ KTx patients and healthy children. Amounts of ammonia, ethanol, isoprene, pentanal and heptanal were higher in patients compared to healthy controls (556, 146, 70.5, 9.3, and 5.4 ppbV vs. 284, 82.4, 49.6, 5.30, and 2.78 ppbV. Methylamine concentrations were lower in the patient group (6.5 vs 10.1 ppbV. These concentration differences were most pronounced in HUS and kidney transplanted patients. When patients were grouped with respect to degree of renal failure these differences could still be detected. Ammonia accumulated already in CKD stage 1, whereas alterations of isoprene (linked to cholesterol metabolism, pentanal and heptanal (linked to oxidative stress concentrations were detectable in the breath of patients with CKD stage 2 to 4. Only weak associations between serum creatinine and exhaled VOCs were noted. Non-invasive breath testing may help to understand basic mechanisms and metabolic adaptation accompanying progression of CKD. Our results support the current notion that metabolic adaptation occurs early during the time

Jørn Utzon’s Maritime Origins

DEFF Research Database (Denmark)

Jaeger, Thomas Arvid

2014-01-01

Article about Jørn Utzons and the influence on his architecture comming from his early years with sailing, and learning about boat construction and the design principles from his father - the yacht designer Aage Utzon.......Article about Jørn Utzons and the influence on his architecture comming from his early years with sailing, and learning about boat construction and the design principles from his father - the yacht designer Aage Utzon....

Mineral water 222 Rn activity decrease due to consumption habits

International Nuclear Information System (INIS)

Cipriani, Moacir; Taddei, Maria Helena Tirollo; Silva, Nivaldo Carlos da

2001-01-01

Mineral waters from the Pocos de Caldas Plateau springs, an elevated region with high natural radioactivity, in the State of Minas Gerais, Brazil, have significant 222 Rn concentration on site. The highest concentration in the waters are from: Fonte Villela - Aguas da Prata (∼ 1000 Bql -1 ); Fonte Grande Hotel - Pocinhos do Rio Verde (∼ 400 Brq -1 ) and Fonte CNEN Lab - Pocos de Caldas (∼ 290 Bql -1 ). These waters are used by the population as drinking water and due to consumption habits, can lead to internal doses above accepted limits for the public. This work deals with the decrease of 222 Rn activity in mineral waters fro two different popular consumption habits, and with the adult effective dose equivalent reduction due to water consumption habits. It has been found that the estimated dose based on the biokinetic Crawford-Brown model, can be one fourth of dose based on 222 Rn activity on site. (author)

Improvement of CT-based treatment-planning models of abdominal targets using static exhale imaging

International Nuclear Information System (INIS)

Balter, James M.; Lam, Kwok L.; McGinn, Cornealeus J.; Lawrence, Theodore S.; Haken, Randall K. ten

1998-01-01

Purpose: CT-based models of the patient that do not account for the motion of ventilation may not accurately predict the shape and position of critical abdominal structures. Respiratory gating technology for imaging and treatment is not yet widely available. The purpose of the current study is to explore an intermediate step to improve the veracity of the patient model and reduce the treated volume by acquiring the CT data with the patients holding their breath at normal exhale. Methods and Materials: The ventilatory time courses of diaphragm movement for 15 patients (with no special breathing instructions) were measured using digitized movies from the fluoroscope during simulation. A subsequent clinical protocol was developed for treatment based on exhale CT models. CT scans (typically 3.5-mm slice thickness) were acquired at normal exhale using a spiral scanner. The scan volume was divided into two to three segments, to allow the patient to breathe in between. Margins were placed about intrahepatic target volumes based on the ventilatory excursion inferior to the target, and on only the reproducibility of exhale position superior to the target. Results: The average patient's diaphragm remained within 25% of the range of ventilatory excursion from the average exhale position for 42% of the typical breathing cycle, and within 25% of the range from the average inhale position for 15% of the cycle. The reproducibility of exhale position over multiple breathing cycles was 0.9 mm (2σ), as opposed to 2.6 mm for inhale. Combining the variation of exhale position and the uncertainty in diaphragm position from CT slices led to typical margins of 10 mm superior to the target, and 19 mm inferior to the target, compared to margins of 19 mm in both directions under our prior protocol of margins based on free-breathing CT studies. For a typical intrahepatic target, these smaller volumes resulted in a 3.6% reduction in V eff for the liver. Analysis of portal films shows proper

New method for single-breath fraction of exhaled nitric oxide measurement with improved feasibility in preschool children with asthma.

Science.gov (United States)

Heijkenskjöld-Rentzhog, Charlotte; Kalm-Stephens, Pia; Nordvall, Lennart; Malinovschi, Andrei; Alving, Kjell

2015-11-01

Respiratory societies recommend use of standardized methodologies for fraction of exhaled nitric oxide (FeNO) measurements in adults and children, but in preschoolers, feasibility remains a problem. The exhalation time needed to obtain steady-state FeNO is unclear. Our primary aim was to study the feasibility of an adapted single-breath FeNO method with age-adjusted exhalation times. We also studied the association between time to steady-state NO level and height, as well as FeNO in relation to asthma and current treatment with inhaled corticosteroids (ICS). Sixty-three children aged 3-10 years performed FeNO measurements with a hand-held electrochemical device with a newly developed flow-control unit. Exhalation times were pre-adapted to age. Exhaled air was simultaneously sampled to a chemiluminescence analyzer to measure time to steady-state NO level. Eighty-one percent of the children achieved at least one approved measurement. From 4 years upwards, success rate was high (96%). Time to steady-state [NO] (median and interquartile range) was 2.5 s (2.4-3.5) at the age of 3-4 years and 3.5 s (2.7-3.8) at the age of 5-6 years. Height was associated with time to steady state (r(2) = 0.13, p = 0.02). FeNO (geometric mean [95% CI]) was higher in ICS-naïve asthmatic children (n = 19): 15.9 p.p.b. (12.2-20.9), than in both healthy controls (n = 8) 9.1 p.p.b. (6.6-12.4) and asthmatic subjects on treatment (n = 24) 11.5 p.p.b. (9.7-13.6). We found this adapted single-breath method with age-adjusted exhalation times highly feasible for children aged 4-10 years. ICS-naïve asthmatic children had FeNO levels under the current guideline cutoff level (20 p.p.b.), highlighting the importance of taking age into account when setting reference values. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Ontologies in a project by Jørn Utzon

DEFF Research Database (Denmark)

Jørgensen, Lars Botin

2003-01-01

The paper has an overall theoretical and philosophical view on the actual topic: the architecture of Jørn Utzon, whereas Utzon himself often has stated that theories and hermeneutic approaches does not interest him at all. It is the aim of this paper to inscribe Jørn Utzon in a theoretical...... tradition where nature and the real is in the core of everything and furthermore to throw a light on the paradoxical non-modern and non-Cartesian aspect of the architectural practice of Jørn Utzon....

Theoretical study of the diffusion 222Rn gas on activated charcoal

International Nuclear Information System (INIS)

Lopez, Fabio O.; Canoba, Analia C.

2001-01-01

The 222 Rn adsorption coefficient is the fundamental parameter characterizing activated carbon's ability to adsorb 222 Rn . In this work, it has been determined the 222 Rn coefficient adsorption for 222 Rn activated carbon detectors. Scintillation vials were used as detectors. The measurement of the 222 Rn activity adsorbed in activated carbon was made by a liquid scintillation measurement of its alpha-beta progeny decay. On the other hand, in this work a diffusion and adsorption model has been developed for the transport of 222 Rn in an activated carbon porous bed. The equation that describes these processes is a partial differential equation, of the second order with respect to axial coordinate, and the first order with respect to time. The equation was numerically solved using a finites differences method. With this model the 222 Rn activity adsorbed in the detector, for several situations, was calculated. The results were tested with the data obtained from series of experiences made in our laboratories. (author)

IL1RN and KRT13 Expression in Bladder Cancer: Association with Pathologic Characteristics and Smoking Status

Directory of Open Access Journals (Sweden)

Thomas S. Worst

2014-01-01

Full Text Available Purpose. To validate microarray data on cytokeratin 13 (KRT13 and interleukin-1 receptor antagonist (IL1RN expression in urothelial carcinoma of the urinary bladder (UCB and to correlate our findings with pathologic characteristics and tobacco smoking. Methods. UCB tissue samples (n=109 and control samples (n=14 were obtained from transurethral resection and radical cystectomy specimens. Immunohistochemical staining of KRT13 and IL1RN was performed and semiquantitative expression scores were assessed. Smoking status was evaluated using a standardized questionnaire. Expression scores were correlated with pathologic characteristics (tumor stage and grade and with smoking status. Results. Loss of KRT13 and IL1RN expression was observed in UCB tissue samples when compared to controls (P=0.007, P=0.008 in which KRT13 and IL1RN expression were high. IL1RN expression was significantly reduced in muscle-invasive tumors (P=0.003. In tissue samples of current smokers, a significant downregulation of IL1RN was found when compared to never smokers (P=0.013. Conclusion. Decreased expressions of KRT13 and IL1RN are common features of UCB and are associated with aggressive disease. Tobacco smoking may enhance the loss of IL1RN, indicating an overweight of proinflammatory mediators involved in UCB progression. Further validation of the influence of smoking on IL1RN expression is warranted.

A Matérn model of the spatial covariance structure of point rain rates

KAUST Repository

Sun, Ying; Bowman, Kenneth P.; Genton, Marc G.; Tokay, Ali

2014-01-01

It is challenging to model a precipitation field due to its intermittent and highly scale-dependent nature. Many models of point rain rates or areal rainfall observations have been proposed and studied for different time scales. Among them, the spectral model based on a stochastic dynamical equation for the instantaneous point rain rate field is attractive, since it naturally leads to a consistent space–time model. In this paper, we note that the spatial covariance structure of the spectral model is equivalent to the well-known Matérn covariance model. Using high-quality rain gauge data, we estimate the parameters of the Matérn model for different time scales and demonstrate that the Matérn model is superior to an exponential model, particularly at short time scales.

A Matérn model of the spatial covariance structure of point rain rates

KAUST Repository

Sun, Ying

2014-07-15

It is challenging to model a precipitation field due to its intermittent and highly scale-dependent nature. Many models of point rain rates or areal rainfall observations have been proposed and studied for different time scales. Among them, the spectral model based on a stochastic dynamical equation for the instantaneous point rain rate field is attractive, since it naturally leads to a consistent space–time model. In this paper, we note that the spatial covariance structure of the spectral model is equivalent to the well-known Matérn covariance model. Using high-quality rain gauge data, we estimate the parameters of the Matérn model for different time scales and demonstrate that the Matérn model is superior to an exponential model, particularly at short time scales.

Impact of structural parameters on the radon exhalation of building materials: Preliminary study

International Nuclear Information System (INIS)

Roelofs, L.M.M.

1993-01-01

Samples of mortar and sand-lime pieces with different percentages of fly ash are hardened at different relative humidities. The porosity distribution, the moisture and the radon exhalation of these samples are determined. Based on the data of the above-mentioned analyses, the thickness of the adsorbed water layer in the water-filled pores is estimated. The correlation between the structural parameters and the radon exhalation is investigated. If the radon exhalation process can be modelled, the radiation risk of applying fly ash in building materials can be controlled or reduced. The results do not yet show a clear indication. The applied methods have to be considered in more detail

Extremal RN/CFT in both hands revisited

International Nuclear Information System (INIS)

Kuo, En-Jui; Yang, Yi

2016-01-01

We study RN/CFT correspondence for four dimensional extremal Reissner–Nordstrom black hole. We uplift the 4d RN black hole to a 5d rotating black hole and make a geometric regularization of the 5d space–time. Both hands central charges are obtained correctly at the same time by Brown–Henneaux technique.

Measurements of 222Rn and 226Ra Levels in environmental samples by using liquid scintillation counter

International Nuclear Information System (INIS)

Moustafa, A.S.

2004-01-01

The advantageous of liquid scintillation counting technique for 6 Ra determination compared with other methods are the high counting efficiency and the easier sample preparation, with no need for sample pre-concentration. In this work, liquid scintillation counting system was used to measure 222 Rn and 226 Ra levels in environmental samples. The liquid scintillation cocktail was prepared in the laboratory and was found efficient for measuring 222 Rn. Soil, sediment and TENORM samples were dried, grind, sieved and added to hydrochloric acid, in a standard scintillation vial, preloaded with the liquid scintillation cocktail. By measuring 222 Rn levels in the prepared vials, at different intervals of time after preparation, 222 Rn and 226 Ra levels were determined

On the 221 Rn → 221 Fr decay scheme

International Nuclear Information System (INIS)

Gromov, K.Ya.; Norseev, Yu.V.; Samatov, Zh.K.; Fominykh, V.I.; Chumin, V.G.; Kudrya, S.A.; Sergienko, V.A.

2002-01-01

The results of investigating the 221 Rnβ - - decay and the 225 Ac α-decay are compared. It is shown that 221 Fr levels at 145.9 and 393.2 keV are excited at the 221 Rn decay. Intensities and reduced probabilities of the β - - decay to the 221 Fr levels are determined. A conclusion is drawn that the parity of the 221 Rn ground state is positive

Improvement of CT-based treatment planning models of abdominal targets using static exhale imaging

International Nuclear Information System (INIS)

Ten Haken, R.K.; Balter, J.M.; Lam, K.L.; McGinn, C.J.; Lawrence, T.S.

1996-01-01

PURPOSE: CT based models of the patient that do not account for the motion of ventilation may not accurately predict the shape and position of critical abdominal structures. Without knowledge of the patient's ventilatory status during the CT scan, a planning target volume margin for the entire range of ventilation is required both inferior and superior to abdominal target volumes to ensure coverage. Also, dose-volume histograms and normal tissue complication probability (NTCP) estimates may be uncertain. Respiratory gating technology for imaging and treatment is not yet widely available. The purpose of the current study is to explore an intermediate step to improve the veracity of the patient model and reduce the treated volume by acquiring the CT data with the patients holding their breath at normal exhale. MATERIALS AND METHODS: The ventilatory time courses of diaphragm movement for 15 patients (with no special breathing instructions) were measured using digitized movies from the fluoroscope during simulation. On repeat simulations, the reproducibility of the diaphragm position at exhale was determined. A clinical protocol was developed for treatment based on exhale CT models. CT scans were acquired at normal exhale using a spiral scanner. Typical volumes were acquired using 5 mm slice thickness and a 1:1 pitch. The scan volume was divided into 2-3 segments, to allow the patient to breathe in between. Margins were placed about intrahepatic target volumes based on the ventilatory excursion inferior to the target, and on only the reproducibility of exhale position superior to the target. RESULTS: The average patient's diaphragm was located within 2 mm of the average exhale position for 50% of the typical ventilatory cycle. For inhale, this value was reduced to 10%, and for mid ventilation, 15%. The reproducibility of exhale position over multiple breathing cycles was 2 mm (2σ), as opposed to 4 mm for inhale. Combining the variation of exhale position and the

The establishment of a portable high sensitivity exhaled thoron activity measurement system

International Nuclear Information System (INIS)

Chen, Xing-an; Cheng, Yong-e

2008-01-01

A portable system, using electrostatic collection, for the measurement of exhaled thoron activity in humans is described, together with the basic theory, equipment, calibration procedures, measurement and the preliminary use. The portable system built on experience at the Argonne National Laboratory to achieve a reduction in measurement time from 30 hours to 200 minutes, and to increase the total efficiency of the system from 50%(ANL) to 55% with a minimum detection limit decreased to 0.007 Bq (zero activity± σ). The total standard error of this system is 47% for a thorium lung burden of 0.22 Bq. The average background of this scintillation detector was 0.003 counts/min. (author)

A novel design of a personal nuclear track detector for ambient Rn

International Nuclear Information System (INIS)

Margaliot, M.; Even, O.; Herman, R.

1997-01-01

In some occupations, workers spend a part of their time underground, in closed and unventilated spaces, while most of their time is spent in the open air. The case in hand is a group of the 'Bezek' telephone technicians, whose work includes spending a few hours daily in small, coarsely finished and unventilated tunnels in which telephone branching boxes are located. The rest of their time they work outdoors, and a small part of it is spent in offices. The Rn levels in a few telephone branching tunnels were measured and were found to be rather high (levels of 3000 - 5000 Bq/m 3 are common). The average exposure of the workers is however much lower, due to short time spent in the tunnels, versus the longer time spent outdoors, and the low Rn level there. To obtain a well founded estimation of their actual commutative Rn exposure, a new integrative Rn detector was designed, which is attached to the workers clothing during the whole working day, and serves as a personal Rn detector, rather than as the a conventional area monitor. The detector element itself consists of a Nuclear Track Detector made of dosimetry grade CR-39. The function of the detector is how ever dependent mainly on the geometrical design of the housing of the detector. The properties of these detectors are, however, highly dependent on the design of the detectors housing.The design itself, it's theoretical efficiency, it's actual calibration process and it's calibration factor are presented. Mechanical reliability has been established in some 3 years of operation both as a fixed area monitor and as a personal portable detector. (authors)

High-spin isomers in 212Rn in the region of triple neutron core-excitations

Science.gov (United States)

Dracoulis, G. D.; Lane, G. J.; Byrne, A. P.; Davidson, P. M.; Kibédi, T.; Nieminen, P.; Watanabe, H.; Wilson, A. N.

2008-04-01

The level scheme of 212Rn has been extended to spins of ∼ 38 ℏ and excitation energies of about 13 MeV using the 204Hg(13C, 5n)212Rn reaction and γ-ray spectroscopy. Time correlated techniques have been used to obtain sensitivity to weak transitions and channel selectivity. The excitation energy of the 22+ core-excited isomer has been established at 6174 keV. Two isomers with τ = 25 (2) ns and τ = 12 (2) ns are identified at 12211 and 12548 keV, respectively. These are the highest-spin nuclear isomers now known, and are attributed to configurations involving triple neutron core-excitations coupled to the aligned valence protons. Semi-empirical shell-model calculations can account for most states observed, but with significant energy discrepancies for some configurations.

High-spin isomers in 212Rn in the region of triple neutron core-excitations

International Nuclear Information System (INIS)

Dracoulis, G.D.; Lane, G.J.; Byrne, A.P.; Davidson, P.M.; Kibedi, T.; Nieminen, P.; Watanabe, H.; Wilson, A.N.

2008-01-01

The level scheme of 212 Rn has been extended to spins of ∼38h and excitation energies of about 13 MeV using the 204 Hg( 13 C, 5n) 212 Rn reaction and γ-ray spectroscopy. Time correlated techniques have been used to obtain sensitivity to weak transitions and channel selectivity. The excitation energy of the 22 + core-excited isomer has been established at 6174 keV. Two isomers with τ=25(2) ns and τ=12(2) ns are identified at 12211 and 12548 keV, respectively. These are the highest-spin nuclear isomers now known, and are attributed to configurations involving triple neutron core-excitations coupled to the aligned valence protons. Semi-empirical shell-model calculations can account for most states observed, but with significant energy discrepancies for some configurations

CONTINUOUS EXHALED BREATH ANALYSIS ON THE ICU

International Nuclear Information System (INIS)

Bos, Lieuwe D. J.; Sterk, Peter J.; Schultz, Marcus J.

2011-01-01

During admittance to the ICU, critically ill patients frequently develop secondary infections and/or multiple organ failure. Continuous monitoring of biological markers is very much needed. This study describes a new method to continuously monitor biomarkers in exhaled breath with an electronic nose.

Natural radioactivity and radon exhalation rate of soil in southern Egypt

International Nuclear Information System (INIS)

Sroor, A.; El-Bahi, S.M.; Ahmed, F.; Abdel-Haleem, A.S.

2001-01-01

The level of natural radioactivity in soil of 30 mining samples collected from six locations in southern Egypt was measured. Concentrations of radionuclides in samples were determined by γ-ray spectrometer using HPGe detector with a specially designed shield. The obtained results of uranium and thorium series as well as potassium (K-40) are discussed. The present data were compared with data obtained from different areas in Egypt. Also, a solid state nuclear track detector SSNTD (Cr-39) was used to measure the radon concentration as well as exhalation rate for these samples. The radon concentrations were found to vary from 1.54 to 5.37 Bq/kg. The exhalation rates were found to vary from 338.81 to 1426.47 Bq/m 2 d. The values of the radon exhalation rate are found to correspond with the uranium concentration values measured by the germanium detector in the corresponding soil samples

Børn af veteraner

DEFF Research Database (Denmark)

Frederiksen, Signe; Lausten, Mette

Siden starten af 1990’erne har Danmark sendt over 30.000 soldater og andet personel på internationale missioner – langt de fleste til Eks-Jugoslavien, Afghanistan og Irak. Denne undersøgelse handler om de børn, hvis fædre har været udsendt på militære missioner i udlandet. For hvordan håndterer...... spørgsmål er fokus for undersøgelsen. Undersøgelsen bygger på en spørgeskemaundersøgelse blandt børn af veteraner på henholdsvis 7, 11 og 15 år. Undersøgelsen er gennemført for og i samarbejde med Veterancentrets Videncenter, som er en del af Forsvarsministeriets Personalestyrelse....

Development of model DTY-104 radon measuring meter

International Nuclear Information System (INIS)

Shi Zhixia; Zhang Aiming; Li Yachun; Wang Qingheng

2000-01-01

Model DTY-104 radon measuring meter is an improvement on Model DTY-103. 'Difference value method' is used, which has been strictly developed and makes the radon exhalation rate more accurate, instead of using 'simplified difference value method'. The electronic circuit is redesigned and 80C31 single chip processor is used, which makes the operation more convenient and the function strengthened. In a more reasonable manner, the humidity sensor is mounted in the collection chamber. The collection efficiency can be automatically corrected. The technique of exchanging the collection mylar reduces the waiting time and improves work efficiency. The apparatus is applied to the measurement of the radon concentration in the environment and the radon exhalation from the surface of the building materials, walls and ground. The lower detection limit is about 4Bq/m 3 for 222 Rn concentration and 5 x 10 -5 Bq/s/m 2 for 222 Rn exhalation rate

EXHALED AND PLASMA NITRITE: a comparative study among healthy, cirrhotic and liver transplant patients

Directory of Open Access Journals (Sweden)

Viviane S AUGUSTO

2014-03-01

Full Text Available Context There is a relative lack of studies about exhaled nitrite (NO2- concentrations in cirrhotic and transplanted patients. Objective Verify possible differences and correlations between the levels of NO2-, measured in plasma and exhaled breath condensate collected from patients with cirrhosis and liver transplant. Method Sixty adult male patients, aged between 27 and 67 years, were subdivided into three groups: a control group comprised of 15 healthy volunteers, a cirrhosis group composed of 15 volunteers, and a transplant group comprised of 30 volunteers. The NO2- concentrations were measured by chemiluminescence. Results 1 The analysis of plasma NO2- held among the three groups showed no statistical significance. 2 The comparison between cirrhotic and control groups, control and transplanted and cirrhotic and transplanted was not statistically significant. 3 The measurements performed on of NO2- exhaled breath condensate among the three groups showed no statistical difference. 4 When comparing the control group samples and cirrhotic, control and transplanted and cirrhotic and transplanted, there was no significant changes in the concentrations of NO2-. Conclusion No correlations were found between plasma and exhaled NO2-, suggesting that the exhaled NO2- is more reflective of local respiratory NO release than the systemic circulation.

DEC VT220

CERN Multimedia

1983-01-01

The DEC (Digital Equipment Corporation) VT220 is a text terminal which uses an redesigned keyboard(LK201). The VT220 improved on the earlier VT100 series of terminals with much smaller physical packaging and and a much faster microprocessor.

New method for determination of trihalomethanes in exhaled breath: Applications to swimming pool and bath environments

International Nuclear Information System (INIS)

Lourencetti, Carolina; Ballester, Clara; Fernandez, Pilar; Marco, Esther; Prado, Celia; Periago, Juan F.; Grimalt, Joan O.

2010-01-01

A method for the estimation of the human intake of trihalomethanes (THMs), namely chloroform, bromodichloromethane, dibromochloromethane and bromoform, during showering and bathing is reported. The method is based on the determination of these compounds in exhaled breath that is collected by solid adsorption on Tenax using a device specifically designed for this purpose. Instrumental measurements were performed by automatic thermal desorption coupled to gas chromatography with electron capture detection. THMs in exhaled breath samples were determined during showering and swimming pool attendance. The levels of these compounds in indoor air and water were also determined as reference for interpretation of the exhaled breath results. The THM concentrations in exhaled breath of the volunteers measured before the exposure experiments showed a close correspondence with the THMs levels in indoor air where the sampler was located. Limits of detection in exhaled breath were dependent on THM analytes and experimental sites. They ranged between 170 and 710 ng m -3 in the swimming pool studies and between 97 and 460 ng m -3 in the showering studies. Application of this method to THMs determination during showering and swimming pool activities revealed statistically significant increases in THMs concentrations when comparing exhaled breath before and after exposure.

Development of a preclinical 211Rn/211At generator system for targeted alpha therapy research with 211At.

Science.gov (United States)

Crawford, Jason R; Yang, Hua; Kunz, Peter; Wilbur, D Scott; Schaffer, Paul; Ruth, Thomas J

2017-05-01

The availability of 211 At for targeted alpha therapy research can be increased by the 211 Rn/ 211 At generator system, whereby 211 At is produced by 211 Rn electron capture decay. This study demonstrated the feasibility of using generator-produced 211 At to label monoclonal antibody (BC8, anti-human CD45) for preclinical use, following isolation from the 207 Po contamination also produced by these generators (by 211 Rn α-decay). 211 Rn was produced by 211 Fr electron capture decay following mass separated ion beam implantation and chemically isolated in liquid alkane hydrocarbon (dodecane). 211 At produced by the resulting 211 Rn source was extracted in strong base (2N NaOH) and purified by granular Te columns. BC8-B10 (antibody conjugated with closo-decaborate(2-)) was labeled with generator-produced 211 At and purified by PD-10 columns. Aqueous solutions extracted from the generator were found to contain 211 At and 207 Po, isolated from 211 Rn. High radionuclidic purity was obtained for 211 At eluted from Te columns, from which BC8-B10 monoclonal antibody was successfully labeled. If not removed, 207 Po was found to significantly contaminate the final 211 At-BC8-B10 product. High yield efficiencies (decay-corrected, n=3) were achieved for 211 At extraction from the generator (86%±7%), Te column purification (70%±10%), and antibody labeling (76%±2%). The experimental 211 Rn/ 211 At generator was shown to be well-suited for preclinical 211 At-based research. We believe that these experiments have furthered the knowledge-base for expanding accessibility to 211 At using the 211 Rn/ 211 At generator system. As established by this work, the 211 Rn/ 211 At generator has the capability of facilitating preclinical evaluations of 211 At-based therapies. Copyright © 2017 Elsevier Inc. All rights reserved.

Jørn Utzon -Influences and Reinterpretation

DEFF Research Database (Denmark)

Carter, Adrian

2012-01-01

The Paper presents a study of Jørn Utzon's architecture, in terms of its response to both local context and transcultural influences. The paper shows Utzon to have been a precursor and direct influence upon subsequent developments within contemporary regional architecture.......The Paper presents a study of Jørn Utzon's architecture, in terms of its response to both local context and transcultural influences. The paper shows Utzon to have been a precursor and direct influence upon subsequent developments within contemporary regional architecture....

Exhaled nitric oxide in a population-based study of asthma and allergy in schoolchildren.

Science.gov (United States)

Nordvall, S L; Janson, C; Kalm-Stephens, P; Foucard, T; Torén, K; Alving, K

2005-04-01

Exhaled nitric oxide (NO) reflects inflammation in the lower airways and is well adapted for use in children. The aims of this study were to investigate the distribution of the fraction of expired NO (FENO) in school children and to compare FENO and spirometry in relation to the International Study of Asthma and Allergies in Childhood questionnaire. The study was performed in 959 randomly selected 13-14-year-old school children in Uppsala, Sweden. Exhaled NO was measured at an inhalation rate of 0.1 l/s (FENO0.1) and a spirometric test was performed and data from these measurements were related to questionnaire data. Exhaled NO was measured according to American Thoracic Society recommendations, except the use of a mouth wash and an exhalation flow rate of 0.1 l/s. The distribution of the mean FENO0.1 values was skewed, with a preponderance of very low levels and a widespread tail of values ranging up to 102 parts per billion (ppb). Boys exhibited significantly higher mean FENO0.1 values than girls, 5.2 (4.7-5.7) vs 4.4 (4.0-4.8) ppb (geometric mean and 95% CI), P <0.01). Children who reported wheezing in the last year had higher FENO0.1 values than children that had not, 8.5 (7.1-10.2) vs 4.3 (4.0-4.6) ppb, P <0.001). The same association was found to most symptoms indicating hay fever and eczema. In contrast to this, only weak or inconsistent associations were found between asthma and spirometric indices. Exhaled NO levels were found to be independently related to male gender, wheeze and rhinoconjuctivitis but not to current eczema. In conclusion, exhaled NO was closely associated with reported asthma and allergy symptoms whereas spirometric indices such as percent predicted forced expiratory volume in 1 s were not. As most asthma cases in a population are mild, the findings suggest that exhaled NO is a sensitive marker of asthma and allergy.

Analysis of human exhaled breath in a population of young volunteers

Directory of Open Access Journals (Sweden)

Zarić Božidarka

2014-01-01

Full Text Available Analysis of volatile organic compounds (VOCs in human breath can provide information about the current physiological state of an individual, such as clinical conditions and exposure to exogenous pollutants. The blood-borne VOCs present in exhaled breath offer the possibility of exploring physiological and pathological processes in a noninvasive way. However, the field of exhaled breath analysis is still in its infancy. We undertook this study in order to define interindividual variation and common compounds in breath VOCs of 48 young human volunteers. Alveolar breath samples were analyzed by automated thermal desorption, gas chromatography with flame ionization detector (FID and electron capture detector (ECD using SUPELCO standards with 66 compounds. Predominant compounds in the alveolar breath of analyzed subjects are ethylbenzene, 1-ethyl-4-methylbenzene, 1,2,4-trimethylbenzene and 1,3,5-trimethylbenzene (over 50% of the subjects. Isopropyl alcohol, propylene, acetone, ethanol were found as well. We detected substituted compounds in exhaled breath. [Projekat Ministarstva nauke Republike Srbije, br. 172001

Analysis of Exhaled Breath for Disease Detection

Science.gov (United States)

Amann, Anton; Miekisch, Wolfram; Schubert, Jochen; Buszewski, Bogusław; Ligor, Tomasz; Jezierski, Tadeusz; Pleil, Joachim; Risby, Terence

2014-06-01

Breath analysis is a young field of research with great clinical potential. As a result of this interest, researchers have developed new analytical techniques that permit real-time analysis of exhaled breath with breath-to-breath resolution in addition to the conventional central laboratory methods using gas chromatography-mass spectrometry. Breath tests are based on endogenously produced volatiles, metabolites of ingested precursors, metabolites produced by bacteria in the gut or the airways, or volatiles appearing after environmental exposure. The composition of exhaled breath may contain valuable information for patients presenting with asthma, renal and liver diseases, lung cancer, chronic obstructive pulmonary disease, inflammatory lung disease, or metabolic disorders. In addition, oxidative stress status may be monitored via volatile products of lipid peroxidation. Measurement of enzyme activity provides phenotypic information important in personalized medicine, whereas breath measurements provide insight into perturbations of the human exposome and can be interpreted as preclinical signals of adverse outcome pathways.

Vibrations in the urban environment controlling 222Rn migration in soils

International Nuclear Information System (INIS)

Wiegand, J.

1998-01-01

Comparable to investigations looking for a connection of 222 Rn and earthquakes, this study shows the influence of subsurface vibrations on the 222 Rn concentration of the soil-gas in urban environments. Generally, the 222 Rn concentration increases through vibrations induced by trains, street-traffic and activities at project sites. The spatial radius of the 222 Rn increase due to vibrations reach highest values at project sites where piled foundations or metal panels are rammed into the ground (> 60 m). Along railway tracks the radius is wider (> 30 m) than along heavy traffic roads ( 222 Rn concentrations in soil-gas due to vibrations is the highest at project sites (53%). Along heavy traffic roads the increase of 222 Rn concentrations by motor vehicle traffic is higher (37%) than that by railway traffic (11.5%). The maximum increase of 400% was observed in a distance of 1 m from a railway track. In the vicinity of railway tracks a difference of the vibration influence according to unconsolidated rock (11.1%) or solid rock (11.8%) was not noticed. Beside this vibration effect, the overall 222 Rn level decreases with increasing distance to the vibration source, but only at locations laying above solid rocks. The observation of the increase of 222 Rn concentrations can be explained by a 'pump effect': the mechanical vibration of soil and mineral particles leads to an upward motion of the whole volume of soil-gas. Therefore, 222 Rn is pumped out of the soil to the atmosphere and as a result the upward transport is increased. (author)

Quantifying Aerosol Delivery in Simulated Spontaneously Breathing Patients With Tracheostomy Using Different Humidification Systems With or Without Exhaled Humidity.

Science.gov (United States)

Ari, Arzu; Harwood, Robert; Sheard, Meryl; Alquaimi, Maher Mubarak; Alhamad, Bshayer; Fink, James B

2016-05-01

Aerosol and humidification therapy are used in long-term airway management of critically ill patients with a tracheostomy. The purpose of this study was to determine delivery efficiency of jet and mesh nebulizers combined with different humidification systems in a model of a spontaneously breathing tracheotomized adult with or without exhaled heated humidity. An in vitro model was constructed to simulate a spontaneously breathing adult (tidal volume, 400 mL; breathing frequency, 20 breaths/min; inspiratory-expiratory ratio, 1:2) with a tracheostomy using a teaching manikin attached to a test lung through a collecting filter (Vital Signs Respirgard II). Exhaled heat and humidity were simulated using a cascade humidifier set to deliver 37°C and >95% relative humidity. Albuterol sulfate (2.5 mg/3 mL) was administered with a jet nebulizer (AirLife Misty Max) operated at 10 L/min and a mesh nebulizer (Aeroneb Solo) using a heated pass-over humidifier, unheated large volume humidifier both at 40 L/min output and heat-and-moisture exchanger. Inhaled drug eluted from the filter was analyzed via spectrophotometry (276 nm). Delivery efficiency of the jet nebulizer was less than that of the mesh nebulizer under all conditions (P < .05). Aerosol delivery with each nebulizer was greatest on room air and lowest when heated humidifiers with higher flows were used. Exhaled humidity decreased drug delivery up to 44%. The jet nebulizer was less efficient than the mesh nebulizer in all conditions tested in this study. Aerosol deposition with each nebulizer was lowest with the heated humidifier with high flow. Exhaled humidity reduced inhaled dose of drug compared with a standard model with nonheated/nonhumidified exhalation. Further clinical research is warranted to understand the impact of exhaled humidity on aerosol drug delivery in spontaneously breathing patients with tracheostomy using different types of humidifiers. Copyright © 2016 by Daedalus Enterprises.

Distribution Log Normal of 222 Rn in the state of Zacatecas, Mexico

International Nuclear Information System (INIS)

Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Rios, C.; Pinedo, J.L.

2006-01-01

In this work the evaluation of the concentration of 222 Rn in air for Zacatecas is shown. The Solid State Nuclear Track Detectors were used as the technique for the realization of the measurements in large scale with cellulose nitrate LR-115, type 2, in open chambers of 222 Rn. The measurements were carried out during three months in different times of the year. In the results it is presented the log normal distribution, arithmetic mean and geometric media for the concentration at indoor and outdoor of residence constructions, the concentration at indoor of occupational constructions and in the 57 municipal heads of the state of Zacatecas. The statistics of the values in the concentration showed variation according to the time of the year, obtaining high quantities in winter seasons for both cases. The distribution of the concentration of 222 Rn is presented in the state map for each one of the municipalities, representing the measurement places in the entire state of Zacatecas. Finally the places where the values in the concentration of 222 Rn in air are near to the one limit settled down by the EPA of 148 Bq/m 3 are presented. (Author)

Submarines, spacecraft and exhaled breath.

Science.gov (United States)

Pleil, Joachim D; Hansel, Armin

2012-03-01

Foreword The International Association of Breath Research (IABR) meetings are an eclectic gathering of researchers in the medical, environmental and instrumentation fields; our focus is on human health as assessed by the measurement and interpretation of trace chemicals in human exhaled breath. What may have escaped our notice is a complementary field of research that explores the creation and maintenance of artificial atmospheres practised by the submarine air monitoring and air purification (SAMAP) community. SAMAP is comprised of manufacturers, researchers and medical professionals dealing with the engineering and instrumentation to support human life in submarines and spacecraft (including shuttlecraft and manned rockets, high-altitude aircraft, and the International Space Station (ISS)). Here, the immediate concerns are short-term survival and long-term health in fairly confined environments where one cannot simply 'open the window' for fresh air. As such, one of the main concerns is air monitoring and the main sources of contamination are CO(2) and other constituents of human exhaled breath. Since the inaugural meeting in 1994 in Adelaide, Australia, SAMAP meetings have been held every two or three years alternating between the North American and European continents. The meetings are organized by Dr Wally Mazurek (a member of IABR) of the Defense Systems Technology Organization (DSTO) of Australia, and individual meetings are co-hosted by the navies of the countries in which they are held. An overriding focus at SAMAP is life support (oxygen availability and carbon dioxide removal). Certainly, other air constituents are also important; for example, the closed environment of a submarine or the ISS can build up contaminants from consumer products, cooking, refrigeration, accidental fires, propulsion and atmosphere maintenance. However, the most immediate concern is sustaining human metabolism: removing exhaled CO(2) and replacing metabolized O(2). Another

An application of 222Rn alpha particle's tracks to uranium exploration

International Nuclear Information System (INIS)

Aguilar H, F.

1981-01-01

The uranium exploration method is based on the register of 222 Rn alpha particles; 222 Rn gas is generated in the chain 238 U desintegration. The detection of alpha particles was performed with cellulose nitrate films (NTC), located in a grid at the region in study. The alpha particles produce latent tracks in the NTC films; these tracks may be enlarged by chemical etching and are observed with an ordinary optic microscope, ninety seven NTC films were used, these were distributed in an area of approximately seventeen square kilometers, located in the municipalities of Granados and Huasabas in Sonora Mexico, the detectors remain in the ground for a thirty days mean period. The results obtained show an area with high 222 Rn concentration, this can be related with an underground uranium ore deposit. The more important conclusion is that the results obtained in this work can be used as preliminary results for other prospection methods in this particular area. (author)

Characteristics of the Nursing Practice Environment Associated With Lower Unit-Level RN Turnover.

Science.gov (United States)

Nelson-Brantley, Heather V; Park, Shin Hye; Bergquist-Beringer, Sandra

2018-01-01

The aim of this study is to examine characteristics of the nursing practice environment associated with lower RN turnover. Identifying characteristics of the practice environment that contribute to lower RN turnover is important for meeting the national quality strategy priority of reducing healthcare costs. Data from 1002 adult care units in 162 National Database of Nursing Quality Indicators participating hospitals were analyzed using multivariate linear regression. The Practice Environment Scale of the Nursing Work Index was used to measure practice environment characteristics. RN turnover was measured at the unit level. Nursing units with higher overall ratings of the nursing practice environment had lower rates of RN turnover. Units with higher RN perceived staffing and resource adequacy experienced significantly lower RN turnover. Unit managers and hospital administrators should consider RN perception of staffing and resource adequacy and the overall practice environment when developing targeted strategies for decreasing RN turnover.

Systematic Review: Bridging the Gap in RPN-to-RN Transitions.

Science.gov (United States)

Suva, Grace; Sager, Shelley; Mina, Elaine Santa; Sinclair, Nancy; Lloyd, Monique; Bajnok, Irmajean; Xiao, Sarah

2015-07-01

To review the evidence examining the influences of successful education and professional role transition for registered practical nurses (RPNs) pursuing a baccalaureate degree in nursing (BScN) and registered nurse (RN) licensure through RPN-to-RN bridging programs. Systematic review of papers published between 1995 and 2014 that evaluated students' education and professional role transitions from RPN to RN. Thirty-nine papers were selected that observed or studied the change or transition in designation from RPN to RN, or its equivalent, through bridging programs and analyzed thematically according to Meleis, Sawyer, Im, Hilfinger Messias, and Schumacher's transition model. Personal, community, and social conditions related to preparation for entry, program enrolment, and postgraduate clinical integration influence successful education and professional role transitions for RPN-to-RN bridging students. Providing key transition supports may enhance the potential for successful student transition into and throughout a bridging program, but further research is necessary to enhance this understanding and to recommend best practices for optimizing students' success. The evidence from this review identifies facilitators and barriers to successful education and professional role transition for RPN-to-RN bridging students, and identifies important considerations for future research. © 2015 Sigma Theta Tau International.

Radon exhalation from samples of Danish soils, subsoils and sedimentary rocks

International Nuclear Information System (INIS)

Korsbech, U.

1985-01-01

For some years it has been known that the ground below a house could be the major source of radon and radon daughters in the indoor air. Th amount of radon penetrating into buildings from the ground depends on several factors e.g. the amount of radon produced in the ground, the amount of cracks and holes in the foundation of buildings, and the pressure difference between the air in the ground (sol air) and the indoor air. As a first step in determining the influence of the ground below Danish buildings 60 samples of soils, subsoils, and sedimentary rocks have been measured for their exhalation rates of radon i.e. the amount of radon escaping the sample per mass unit and per second (Bq.kg -1 .s -1 or radon atoms per kg and per sec.). The results of the measurements of the radon exhalation are presented and commented, and a conclusion concerning the methods for finding geological deposits with a high radon halation rate is presented. (author)

Direct determination of 222Rn gas using the electret to remove daughters at formation

International Nuclear Information System (INIS)

Harley, N.H.

1981-01-01

Five compact, portable, continuous 222 Rn monitors have been constructed inhouse. Printed data can be obtained from intervals ranging from 10 minutes to 990 minutes. One hour count interval provides a lower limit of detection of 0.03 pCi 222 Rn/l -1 which is sufficient for measurement of any environmental level encountered. Calibration of the units was accomplished in the EML radon calibration room and the typical calibration factor is 165 counts per hour per pCi 222 Rn/l. The units are now being field tested. Two indoor/outdoor pairs are located in a single family dwelling and in a high rise apartment. One unit is being used for special studies

Determination of exhalation rate of radon from walls and indoor radon by CR-39 detectors

International Nuclear Information System (INIS)

Vasidov, A.; Tillaev, T.S.

2007-01-01

Full text: The knowledge of true value exhalation rate of radon gas from building materials represents scientific and practical interest in environmental radiation protection. This point of view in the paper exhalation rate of radon gas from building materials and a surface of walls with different constructions were determined by detectors CR-39. The values of the exhalation rate of radon per unit area of the granite, concrete, fired and unfired bricks, sand, cement, alabaster varied 0.091 - 0.1 Bq·m -2 ·h -1 . The surface of walls of dwellings constructed from different building materials the exhalation rate of radon are within in limits of 0.083-1.12 Bq·m -2 ·h -1 . Were measurements with CR-39 detectors a level of radon within 50-520 Bq/m 3 in air of rooms constructed of the different building materials

Investigation on natural radioactivity levels indoor in Hengyang and Xiangtan in Hunan province

International Nuclear Information System (INIS)

Xiao Yongjun; Xiao Detao; Tang Lingzhi

2011-01-01

Investigation showed the level of 222 Rn and 220 Rn in urban houses in the 1950s was less than in the 1960s. Rural houses were built mainly with red brick, shale brick and adobe. The level of 222 Rn are (41±14) Bq·m -3 , (48±18) Bq·m -3 and (52±4) Bq·m -3 respectively. The level of 220 Rn are (58±36) Bq·m -3 , (26±12) Bq·m -3 and (406±24) Bqm -3 respectively. The mean of gamma dose rates in houses in Hengyang is (0.12±0.05) μGy·h -1 in urban area, (0.23±0.02) μGy·h -1 in rural area, and (0.15±0.04) μGy·h -1 in Qingshanqiao town, Xiangtan County. Under a natural ventilation condition, since the 1950s-1960s, the level of 222 Rn and 220 Rn in houses is decreasing. There is no large difference in radon levels between houses in urban and rural area. The level of 222 Rn has significant difference in different houses, varying with materials. (authors)

Preliminary experiences with 222Rn gas in Arizona homes

International Nuclear Information System (INIS)

Kearfott, K.J.

1989-01-01

Results of a survey of 222Rn gas using four-day charcoal canister tests in 759 Arizona homes are reported. Although the study was not random with respect to population or land area, it was useful in identifying areas at risk and locating several homes having elevated indoor 222Rn air concentrations. Approximately 18% of the homes tested exceeded 150 Bq m-3 (4 pCi L-1), with 7% exceeding 300 Bq m-3 (8 pCi L-1). Several Arizona cities had larger fractions of homes exceeding 150 Bq m-3 (4 pCi L-1), such as Carefree and Cave Creek (23%), Paradise Valley (30%), Payson (33%), and Prescott (31%). The Granite Dells and Groom Creek areas of Prescott had in excess of 40-60% of the houses tested exceeding 150 Bq m-3 (4 pCi L-1). Elevated 222Rn concentrations were measured for a variety of home types having different construction materials. Private well water was identified as a potentially significant source of 222Rn gas in Prescott homes, with water from one well testing over 3.5 MBq m-3 (94,000 pCi L-1). A 222Rn concentration in air exceeding 410,000 Bq m-3 (11,000 pCi L-1) was measured using a four-day charcoal canister test in a house in Prescott which had a well opening into a living space. Additional measurements in this 150-m3 dwelling revealed a strikingly heterogeneous 222Rn concentration. The excessive 222Rn level in the dwelling was reduced to less than 190 Bq m-3 (5.2 pCi L-1) by sealing the well head with caulking and providing passive ventilation through a pipe

Study of different factors which can explain the radon exhalation potential of soils

International Nuclear Information System (INIS)

Demongeot, St.

1997-01-01

Radon is a natural radioactive gas belonging to the Uranium-238 chain, which is present in the earth crust and produced by the disintegration of radium-226. It is considered as the major source of radiological exposure of man to natural radiation because it can accumulate in indoor atmosphere. So, this health risk must be take into account.The aim of this study is to find some tools in order to identify high radon level area. The first part of this study has consisted in measurement of radon emission from different not sufficient for the estimation of the radon exhalation potential in a given area. In the second part of this work, we have studied the variations of in situ radon concentration as a function of different geological and pedologic parameters of the site. With the results obtained, we have determined the data which have to be considered, and the methodology to be applied for the determination of the radon exhalation of a given area. Furthermore, by the mean of numerical simulations (TRACH Model), it was possible to know the scale of radon flux variation in a given point versus the hydric state of the ground and thus the permeability: these parameters are not easy to measure because of their variabilities with time. The methodology ESPERAS (EStimation du Potential d'Exhalation en Radon des Sols) developed during this work was applied first, at a local scale and then to greater area. The values estimated by this way are in a good agreement with the results of measurements. So, we can determine the areas which are affected by high radon levels. (author)

Exhaled nitric oxide in diagnosis and management of respiratory diseases

Directory of Open Access Journals (Sweden)

Abba Abdullah

2009-01-01

Full Text Available The analysis of biomarkers in exhaled breath constituents has recently become of great interest in the diagnosis, treatment and monitoring of many respiratory conditions. Of particular interest is the measurement of fractional exhaled nitric oxide (FENO in breath. Its measurement is noninvasive, easy and reproducible. The technique has recently been standardized by both American Thoracic Society and European Respiratory Society. The availability of cheap, portable and reliable equipment has made the assay possible in clinics by general physicians and, in the near future, at home by patients. The concentration of exhaled nitric oxide is markedly elevated in bronchial asthma and is positively related to the degree of esinophilic inflammation. Its measurement can be used in the diagnosis of bronchial asthma and titration of dose of steroids as well as to identify steroid responsive patients in chronic obstructive pulmonary disease. In primary ciliary dyskinesia, nasal NO is diagnostically low and of considerable value in diagnosis. Among lung transplant recipients, FENO can be of great value in the early detection of infection, bronchioloitis obliterans syndrome and rejection. This review discusses the biology, factors affecting measurement, and clinical application of FENO in the diagnosis and management of respiratory diseases.

Locating karst depressed columns by means of Rn measurement on the surface

International Nuclear Information System (INIS)

Tang Daimao; Liu Hongfu; Duan Hongjie; Duan Lindi; Sui Haichen

1999-01-01

The coal mining and the related surface projects are extremely harassed by the underground karst depressed columns. The author discussed the surface Rn concentration's abnormality caused by the karst depressed columns. It is concluded that different kinds of karst depressed column can cause different Rn concentration's abnormality. The α-cup Rn measuring instrument was used for detecting Rn abnormality on the surface in order to locate the underground karst depressed columns

Phosphogypsum recycling in the building materials industry: assessment of the radon exhalation rate.

Science.gov (United States)

Campos, M P; Costa, L J P; Nisti, M B; Mazzilli, B P

2017-06-01

Phosphogypsum can be classified as a Naturally Occurring Radioactive Material (NORM) residue of the phosphate fertilizer industry. One of the main environmental concerns of its use as building material is the radon exhalation. The aim of this study is to measure the radon exhalation rate from plates and bricks manufactured with phosphogypsum from three installations of the main Brazilian producer, Vale Fertilizantes, in order to evaluate the additional health risk to dwellers. A simple and reliable accumulator method involving a PVC pipe sealed with a PVC pipe cover commercially available with CR-39 radon detector into a diffusion chamber was used for measuring radon exhalation rate from phosphogypsum made plates and bricks. The radon exhalation rate from plates varied from 0.19 ± 0.06 Bq m -2 h -1 , for phosphogypsum from Bunge Fertilizers, from 1.3 ± 0.3 Bq m -2 h -1 , for phosphogypsum from Ultrafertil. As for the bricks, the results ranged from 0.11 ± 0.01 Bq m -2 h -1 , for phosphogypsum from Bunge Fertilizers, to 1.2 ± 0.3 Bq m -2 h -1 , for phosphogypsum from Ultrafertil. The results obtained in this study for the radon exhalation rate from phosphogypsum plates and bricks are of the same order of magnitude than those from ordinary building materials. So, it can be concluded that the recycling of phosphogypsum as building material is a safe practice, since no additional health risk is expected from the radiological point of view. Copyright © 2017 Elsevier Ltd. All rights reserved.

Aspergillus spp. colonization in exhaled breath condensate of lung cancer patients from Puglia Region of Italy.

Science.gov (United States)

Carpagnano, Giovanna E; Lacedonia, Donato; Palladino, Grazia Pia; Logrieco, Giuseppe; Crisetti, Elisabetta; Susca, Antonia; Logrieco, Antonio; Foschino-Barbaro, Maria P

2014-02-18

Airways of lung cancer patients are often colonized by fungi. Some of these colonizing fungi, under particular conditions, produce cancerogenic mycotoxins. Given the recent interest in the infective origin of lung cancer, with this preliminary study we aim to give our small contribution to this field of research by analysing the fungal microbiome of the exhaled breath condensate of lung cancer patients from Puglia, a region of Italy. We enrolled 43 lung cancer patients and 21 healthy subjects that underwent exhaled breath condensate and bronchial brushing collection. The fungal incidence and nature of sample collected were analysed by using a selected media for Aspergillus species. For the first time we were able to analyse the fungal microbioma of the exhaled breath condensate. 27.9% of lung cancer patients showed a presence of Aspergillus niger, or A. ochraceus or Penicillium ssp. while none of the healthy subjects did so. The results confirmed the high percentage of fungal colonization of the airways of lung cancer patients from Puglia, suggesting the need to conduct further analyses in this field in order to evaluate the exact pathogenetic role of these fungi in lung cancer as well as to propose efficient, empirical therapy.

Dicty_cDB: SLH220 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH220 (Link to dictyBase) - - - Contig-U15409-1 SLH220F (Link to Original site) SLH2...20F 510 - - - - - - Show SLH220 Library SL (Link to library) Clone ID SLH220 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-A/SLH220Q.Seq.d/ Representative seq. ID SLH22...0F (Link to Original site) Representative DNA sequence >SLH220 (SLH220Q) /CSM/SL/SLH2-A/SLH220Q.Seq.d/ GAAGA...gnificant alignments: (bits) Value SLH220 (SLH220Q) /CSM/SL/SLH2-A/SLH220Q.Seq.d/

7 CFR 1280.220 - Collections.

Science.gov (United States)

2010-01-01

... 7 Agriculture 10 2010-01-01 2010-01-01 false Collections. 1280.220 Section 1280.220 Agriculture... INFORMATION ORDER Lamb Promotion, Research, and Information Order Assessments § 1280.220 Collections. (a) Each first handler and each exporter responsible for the collection of assessments under this subpart shall...

Cellular lung dosimetry for inhaled thoron progeny: comparison with radon progeny

International Nuclear Information System (INIS)

Abd El-Hady, M.; Hofmann, W.; Balashazy, I.

1998-01-01

Recently an analytical method was developed to compute radiation doses deposited by 222 Rn progeny alpha particles in 1 μm spheres located at different depths in bronchial epithelium. The same method was now applied to alpha particles emitted from 220 Rn progeny deposited in bronchial airway surfaces. Results of the computations are presented in graphs. The mean cellular doses imparted by 220 Rn progeny to basal and secretory cell nuclei were compared with those produced by 222 Rn progeny; due to differences in alpha energies, radon progeny doses were found to be generally higher than those for thoron progeny. (A.K.)

Natural radioactivity and radon exhalation rate in Brazilian igneous rocks

Energy Technology Data Exchange (ETDEWEB)

Moura, C.L.; Artur, A.C. [Departamento de Petrologia e Metalogenia, Instituto de Geociencias e Ciencias Exatas, Universidade Estadual Paulista (UNESP), Av. 24-A No. 1515, C.P. 178, CEP 13506-900, Rio Claro, Sao Paulo (Brazil); Bonotto, D.M., E-mail: danielbonotto@yahoo.com.b [Departamento de Petrologia e Metalogenia, Instituto de Geociencias e Ciencias Exatas, Universidade Estadual Paulista (UNESP), Av. 24-A No. 1515, C.P. 178, CEP 13506-900, Rio Claro, Sao Paulo (Brazil); Guedes, S. [Departamento de Cronologia e Raios Cosmicos, Instituto de Fisica Gleb Wataghin, Universidade Estadual de Campinas (UNICAMP), Rua Sergio Buarque de Holanda No. 777, CEP 13083-859, Campinas, Sao Paulo (Brazil); Martinelli, C.D. [Departamento de Petrologia e Metalogenia, Instituto de Geociencias e Ciencias Exatas, Universidade Estadual Paulista (UNESP), Av. 24-A No. 1515, C.P. 178, CEP 13506-900, Rio Claro, Sao Paulo (Brazil)

2011-07-15

This paper reports the natural radioactivity of Brazilian igneous rocks that are used as dimension stones, following the trend of other studies on the evaluation of the risks to the human health caused by the rocks radioactivity as a consequence of their use as cover indoors. Gamma-ray spectrometry has been utilized to determine the {sup 40}K, {sup 226}Ra and {sup 232}Th activity concentrations in 14 rock types collected at different quarries. The following activity concentration range was found: 12.18-251.90 Bq/kg for {sup 226}Ra, 9.55-347.47 Bq/kg for {sup 232}Th and 407.5-1615.0 Bq/kg for {sup 40}K. Such data were used to estimate Ra{sub eq}, H{sub ex} and I{sub {gamma}}, which were compared with the threshold limit values recommended in literature. They have been exceeded for Ra{sub eq} and H{sub ex} in five samples, where the highest indices corresponded to a rock that suffered a process of ductile-brittle deformation that caused it a microbrecciated shape. The exhalation rate of Rn and daughters has also been determined in slabs consisting of rock pieces {approx}10 cm-long, 5 cm-wide and 3 cm-thick. It ranged from 0.24 to 3.93 Bq/m{sup 2}/h and exhibited significant correlation with eU (={sup 226}Ra), as expected. The results indicated that most of the studied rocks did not present risk to human health and may be used indoors, even with low ventilation. On the other hand, igneous rocks that yielded indices above the threshold limit values recommended in literature may be used outdoors without any restriction or indoors with ample ventilation.

Wearable Personal Exhaust Ventilation, WPEV: Improved Indoor Air Quality and Reduced Exposure to Air Exhaled from a Sick Doctor

DEFF Research Database (Denmark)

Bolashikov, Zhecho D.; Barova, Maria; Melikov, Arsen K.

2015-01-01

pause) and a tidal flow rate of 6 L/min. A second thermal manikin and heated dummy were used to resemble lying patients. Exhaled air by the doctor was mixed with tracer gas to mimic pathogens. The wearable personal exhaust unit was positioned frontally by the mouth of the doctor at three distances: 0.......02, 0.04, and 0.06 m. It was operated at 0.25 or 0.50 L/s under mixing background ventilation at three air changes per hour. The effect of the wearable exhaust unit geometry by modifying the exhaust surface, as well as the posture of the doctor, standing or seated, was also studied. The use...... of the wearable personal exhaust resulted in cleaner air in the room compared to mixing alone at 12 air changes per hour, reducing the exposure of the two patients. The nozzle geometry and posture of the doctor affected the indoor exposure to exhaled air. The high potential to capture exhaled air makes the device...

Estimating Rn-induced lung cancer in the United States

International Nuclear Information System (INIS)

Lubin, J.H.; Boice, J.D. Jr.

1989-01-01

The proportion of lung cancer deaths attributable to Rn among residents of single-family homes in the U.S. (approximately 70% of the housing stock) is estimated using the log-normal distribution of Rn concentrations proposed by Nero et al. (1986) and the risk model developed by the National Academy of Sciences' BEIR IV Committee. The risk model, together with the exposure distribution, predicts that approximately 14% of lung cancer deaths among such residents (about 13,300 deaths per year, or 10% of all U.S. lung cancer deaths) may be due to indoor Rn exposure. The 95% confidence interval is 7%-25%, or approximately 6600 to 24,000 lung cancer deaths. These estimated attributable risks due to Rn are similar for males and females and for smokers and nonsmokers, but higher baseline risks of lung cancer result in much larger absolute numbers of Rn-attributable cancers among males (approximately 9000) and among smokers (approximately 11,000). Because of the apparent skewness of the exposure distribution, most of the contribution to the attributable risks arises from exposure rates below 148 Bq m-3 (4 pCi L-1), i.e., below the EPA action level. As a result, if all exposure rates that exceed 148 Bq m-3 (approximately 8% of homes) were eliminated, the models predict that the total annual lung cancer burden in the U.S. would drop by 4-5%, or by about 3800 lung cancer deaths, in contrast to a maximum reduction of 14% if all indoor Rn exposure above the 1st percentile were eliminated

Effects of acute hypoventilation and hyperventilation on exhaled carbon monoxide measurement in healthy volunteers

Directory of Open Access Journals (Sweden)

Di Donato Michele

2009-12-01

Full Text Available Abstract Background High levels of exhaled carbon monoxide (eCO are a marker of airway or lung inflammation. We investigated whether hypo- or hyperventilation can affect measured values. Methods Ten healthy volunteers were trained to achieve sustained end-tidal CO2 (etCO2 concentrations of 30 (hyperventilation, 40 (normoventilation, and 50 mmHg (hypoventilation. As soon as target etCO2 values were achieved for 120 sec, exhaled breath was analyzed for eCO with a photoacoustic spectrometer. At etCO2 values of 30 and 40 mmHg exhaled breath was sampled both after a deep inspiration and after a normal one. All measurements were performed in two different environmental conditions: A ambient CO concentration = 0.8 ppm and B ambient CO concentration = 1.7 ppm. Results During normoventilation, eCO mean (standard deviation was 11.5 (0.8 ppm; it decreased to 10.3 (0.8 ppm during hyperventilation (p 2 changes (hyperventilation: 10% Vs 25% decrease; hypoventilation 3% Vs 25% increase. Taking a deep inspiration before breath sampling was associated with lower eCO values (p Conclusions eCO measurements should not be performed during marked acute hyperventilation, like that induced in this study, but the influence of less pronounced hyperventilation or of hypoventilation is probably negligible in clinical practice

Optimization of sampling parameters for standardized exhaled breath sampling.

Science.gov (United States)

Doran, Sophie; Romano, Andrea; Hanna, George B

2017-09-05

The lack of standardization of breath sampling is a major contributing factor to the poor repeatability of results and hence represents a barrier to the adoption of breath tests in clinical practice. On-line and bag breath sampling have advantages but do not suit multicentre clinical studies whereas storage and robust transport are essential for the conduct of wide-scale studies. Several devices have been developed to control sampling parameters and to concentrate volatile organic compounds (VOCs) onto thermal desorption (TD) tubes and subsequently transport those tubes for laboratory analysis. We conducted three experiments to investigate (i) the fraction of breath sampled (whole vs. lower expiratory exhaled breath); (ii) breath sample volume (125, 250, 500 and 1000ml) and (iii) breath sample flow rate (400, 200, 100 and 50 ml/min). The target VOCs were acetone and potential volatile biomarkers for oesophago-gastric cancer belonging to the aldehyde, fatty acids and phenol chemical classes. We also examined the collection execution time and the impact of environmental contamination. The experiments showed that the use of exhaled breath-sampling devices requires the selection of optimum sampling parameters. The increase in sample volume has improved the levels of VOCs detected. However, the influence of the fraction of exhaled breath and the flow rate depends on the target VOCs measured. The concentration of potential volatile biomarkers for oesophago-gastric cancer was not significantly different between the whole and lower airway exhaled breath. While the recovery of phenols and acetone from TD tubes was lower when breath sampling was performed at a higher flow rate, other VOCs were not affected. A dedicated 'clean air supply' overcomes the contamination from ambient air, but the breath collection device itself can be a source of contaminants. In clinical studies using VOCs to diagnose gastro-oesophageal cancer, the optimum parameters are 500mls sample volume

Relationship between 222Rn concentration in soil water and degree of saturation

International Nuclear Information System (INIS)

Hamada, Hiromasa; Komae, Takami

1996-01-01

The object of the researches an analyzing downward flow to groundwater using 222 Rn concentration in water as an indicator has been saturated flow. However, when groundwater table is low, downward flow from surface is unsaturated flow. In this paper, the authors represented the relationship between 222 Rn concentration in soil water and degree of saturation, and measured the vertical distributions of 222 Rn concentrations in groundwater and 222 Rn concentration in water table in the fields. As the results, it was found that 222 Rn concentrations in the vicinity of groundwater table decreased by unsaturated downward flow. Moreover, from the variation of 222 Rn concentrations in groundwater table, it was possible to show the occurrence of the unsaturated downward flow by paddy fields irrigation, i.e., the downward flow of the soil water pushed out by irrigation water, the unsaturated percolation in the irrigation period, and the redistribution of the soil water after the release of ponding water. The degree of saturation in downward flow was calculated to be about 50% from 222 Rn concentrations in the irrigation period and in the non-irrigation period. It was deduced that the value was within reasonable range considering the difference of the hydraulic conductivities between of the upper layer and of the lower layer. These results proved that the relationship between 222 Rn concentrations in soil water and degree of saturation represented by the authors was reasonable and that the analytical method using 222 Rn concentrations in groundwater table as an indicator was useful 10 analyze the actual stale of unsaturated downward flow. (author)

Regularity of random attractors for fractional stochastic reaction-diffusion equations on Rn

Science.gov (United States)

Gu, Anhui; Li, Dingshi; Wang, Bixiang; Yang, Han

2018-06-01

We investigate the regularity of random attractors for the non-autonomous non-local fractional stochastic reaction-diffusion equations in Hs (Rn) with s ∈ (0 , 1). We prove the existence and uniqueness of the tempered random attractor that is compact in Hs (Rn) and attracts all tempered random subsets of L2 (Rn) with respect to the norm of Hs (Rn). The main difficulty is to show the pullback asymptotic compactness of solutions in Hs (Rn) due to the noncompactness of Sobolev embeddings on unbounded domains and the almost sure nondifferentiability of the sample paths of the Wiener process. We establish such compactness by the ideas of uniform tail-estimates and the spectral decomposition of solutions in bounded domains.

A simple trapping method of exhaled water using an ice-cooled tube to monitor the tritium level in human body

International Nuclear Information System (INIS)

Nogawa, Norio; Makide, Yoshihiro

1994-01-01

A convenient and efficient method is developed for the trapping of water in exhaled air. A bent-V-shaped glass sampling tube was immersed in iced water and exhaled air was introduced into the tube through a plastic straw. The trapping efficiency of exhaled water was equivalent to those with more complex and troublesome methods. Using anywhere available ice, the water in exhaled air can be rapidly collected with this method and the tritium level in the body will be quickly obtained. (author)

Use of 222Rn for estimation of greenhouse gases emissions at Russian territory

Science.gov (United States)

Berezina, E. V.; Elansky, N. F.

2009-04-01

It is well known that 222Rn is widely used as a tracer for studying different atmospheric processes including estimations of greenhouse gases emissions. Calculation of 222Rn fluxes from the soil into the atmosphere allows quantitative estimation of greenhouse gases emissions having the soil origin or sources of which are located near the surface. For accurate estimation of 222Rn fluxes detailed investigations of spatial and temporal variations of its concentrations are necessary. 222Rn concentrations data in the atmospheric surface layer over continental Russia from Moscow to Vladivostok obtained during the six TROICA (Transcontinental Observations Into the Chemistry of the Atmosphere) expeditions of the mobile laboratory along the Trans-Siberian railroad are analyzed. Spatial distribution, diurnal and seasonal variations of surface 222Rn concentrations along the Trans-Siberian railroad are investigated. According to the obtained data surface 222Rn concentration values above continental Russia vary from 0.5 to 75 Bq/m3 depending on meteorological conditions and geological features of the territory with the average value being 8.42 ± 0.10 Bq/m3. The average 222Rn concentration is maximum in the autumn expedition and minimum in the spring one. The factors mostly influencing 222Rn concentration variations are studied: surface temperature inversions, geological features of the territory, precipitations. 222Rn accumulation features in the atmospheric surface layer during night temperature inversions are analyzed. It was noted that during night temperature inversions the surface 222Rn concentration is 7 - 8 times more than the one during the nights without temperature inversions. Since atmospheric stratification determines accumulation and diurnal variations of many atmospheric pollutants as well as greenhouse gases its features are analyzed in detail. Surface temperature inversions were mainly observed from 18:00-19:00 to 06:00-07:00 in the warm season and from 16

14 CFR 13.220 - Discovery.

Science.gov (United States)

2010-01-01

... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Discovery. 13.220 Section 13.220... INVESTIGATIVE AND ENFORCEMENT PROCEDURES Rules of Practice in FAA Civil Penalty Actions § 13.220 Discovery. (a) Initiation of discovery. Any party may initiate discovery described in this section, without the consent or...

7 CFR 220.3 - Administration.

Science.gov (United States)

2010-01-01

... 7 Agriculture 4 2010-01-01 2010-01-01 false Administration. 220.3 Section 220.3 Agriculture... CHILD NUTRITION PROGRAMS SCHOOL BREAKFAST PROGRAM § 220.3 Administration. (a) Within the Department, FNS shall act on behalf of the Department in the administration of the Program covered by this part. Within...

Intercomparison of Rn-222 determination from groundwater

DEFF Research Database (Denmark)

Vesterbacka, P.; Pettersson, H.; Hanste, U.-M.

2010-01-01

An intercomparison exercise on Rn-222 determination in groundwater was organized between eight Nordic laboratories. The individual laboratory results were in most cases within 20% of the median value and within reported uncertainties. Considering the particular difficulties in preparing, transpor......An intercomparison exercise on Rn-222 determination in groundwater was organized between eight Nordic laboratories. The individual laboratory results were in most cases within 20% of the median value and within reported uncertainties. Considering the particular difficulties in preparing...

Natural radioactivity content and radon exhalation from materials used for construction and decoration

International Nuclear Information System (INIS)

Ngachin, M.; Garavaglia, M.; Giovani, C.; Scruzzi, E.; Kwato Njock, M.G.; Nourreddine, A.

2007-02-01

The present work deals with the measurement of radioactivity and radon exhalation rate from geological samples manufactured in Douala city and used as building materials. Nine types of building materials were surveyed for their natural radioactivity content using a hyper purity germanium (HPGe) detector. The absorbed dose rate in the samples investigated ranged from 28.5 to 66.6 nGy h -1 for brick samples, from 32.4 to 63.1 nGy h -1 for roofing tiles and was 30.3 nGy h -1 for concrete. External and internal hazard indexes were also estimated as defined by the European Commission. The study of radon exhalation rate from building materials is important for well understanding the individual contribution of each material to the total indoor radon exposure. Solid state nuclear track detectors, CR-39 were used for measuring the radon concentration from different materials. Samples were hermetically closed in glass vessels and the radon growth was followed as a function of time. Exploring the one-dimension radon transport equation, we derived the radon exhalation rate from the experimental measurement of α-track densities. The radon exhalation varied from (5.77±0.06) x 10 -5 to (7.61±0.07) x 10 -5 Bq cm -2 h -1 in bricks, from (5.79±0.05) x 10 -5 to (11.6±0.12) x 10 -5 in tiles and was (6.95±0.03) x 10 -5 Bq cm -2 h -1 in concrete. A positive correlation was found between uranium concentration measured with HPGe detector radon exhalation rate and radium content obtained using nuclear track detectors. (author)

Radon-222 exhalation from Danish building materials: H + H Industri A/S results

International Nuclear Information System (INIS)

Andersen, C.E.

1999-08-01

This report describes a closed-chamber method for laboratory measurements of the rate at which radon-222 degasses (exhales) from small building material samples. The chamber is 55 L in volume and the main sample geometry is a slab of dimensions 5x30x30 cm 3 . Numerical modelling is used to assess (and partly remove) the bias of the method relative to an ideal measurement of the free exhalation rate. Experimental results obtained with the method are found to be in agreement with the results of an open-chamber method (which is subject to different sources of error). Results of radon-222 exhalation rate measurements for 10 samples of Danish building materials are reported. Samples include ordinary concrete, lightweight aggregate concrete, autoclaved aerated concrete, bricks, and gypsum board. The maximum mass-specific exhalation rate is about 20 mBq h -1 kg -1 . Under consideration of the specific applications of the investigated building materials, the contribution to the indoor radon-222 concentration in a single-family reference house is calculated. Numerical modelling is used to help extrapolate the laboratory measurements on small samples to full scale walls. Application of typical materials will increase the indoor concentration by less than 10 Bq m -3 . (au)

49 CFR 220.7 - Penalty.

Science.gov (United States)

2010-10-01

..., or has caused death or injury, a penalty not to exceed $100,000 per violation may be assessed; and... 49 Transportation 4 2010-10-01 2010-10-01 false Penalty. 220.7 Section 220.7 Transportation Other... TRANSPORTATION RAILROAD COMMUNICATIONS General § 220.7 Penalty. Any person (including but not limited to a...

9 CFR 354.220 - Buildings.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Buildings. 354.220 Section 354.220... CERTIFICATION VOLUNTARY INSPECTION OF RABBITS AND EDIBLE PRODUCTS THEREOF Buildings and Plant Facilities § 354.220 Buildings. The buildings shall be of sound construction and kept in good repair, and shall be of...

30 CFR 220.032 - Inventories.

Science.gov (United States)

2010-07-01

... operations. The accumulation of surplus stocks shall be avoided by proper materiel control, inventory and... physical inventory that has not been credited to NPSL operations under § 220.015(a)(2) shall be credited to... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Inventories. 220.032 Section 220.032 Mineral...

Integration of electronic nose technology with spirometry: validation of a new approach for exhaled breath analysis.

Science.gov (United States)

de Vries, R; Brinkman, P; van der Schee, M P; Fens, N; Dijkers, E; Bootsma, S K; de Jongh, F H C; Sterk, P J

2015-10-15

New 'omics'-technologies have the potential to better define airway disease in terms of pathophysiological and clinical phenotyping. The integration of electronic nose (eNose) technology with existing diagnostic tests, such as routine spirometry, can bring this technology to 'point-of-care'. We aimed to determine and optimize the technical performance and diagnostic accuracy of exhaled breath analysis linked to routine spirometry. Exhaled breath was collected in triplicate in healthy subjects by an eNose (SpiroNose) based on five identical metal oxide semiconductor sensor arrays (three arrays monitoring exhaled breath and two reference arrays monitoring ambient air) at the rear end of a pneumotachograph. First, the influence of flow, volume, humidity, temperature, environment, etc, was assessed. Secondly, a two-centre case-control study was performed using diagnostic and monitoring visits in day-to-day clinical care in patients with a (differential) diagnosis of asthma, chronic obstructive pulmonary disease (COPD) or lung cancer. Breathprint analysis involved signal processing, environment correction based on alveolar gradients and statistics based on principal component (PC) analysis, followed by discriminant analysis (Matlab2014/SPSS20). Expiratory flow showed a significant linear correlation with raw sensor deflections (R(2)  =  0.84) in 60 healthy subjects (age 43  ±  11 years). No correlation was found between sensor readings and exhaled volume, humidity and temperature. Exhaled data after environment correction were highly reproducible for each sensor array (Cohen's Kappa 0.81-0.94). Thirty-seven asthmatics (41  ±  14.2 years), 31 COPD patients (66  ±  8.4 years), 31 lung cancer patients (63  ±  10.8 years) and 45 healthy controls (41  ±  12.5 years) entered the cross-sectional study. SpiroNose could adequately distinguish between controls, asthma, COPD and lung cancer patients with cross-validation values

Uranium, radium and radon exhalation study in some soil samples using track etch technique

International Nuclear Information System (INIS)

Harmanjit, Singh; Joga, Singh; Surinder, Singh; Bajwa, B.S.

2006-01-01

Full text of publication follows: Uranium, radium concentration and radon exhalation rates have been determined in the soil samples collected from some areas of Punjab using the L.R.-115 nuclear track detectors. Radium concentration in these samples has been found to be varying from 0.80 to 5.34 Bq Kg-1. The radon exhalation rate in these samples has been found to be varying from 0.99 to 6.60 mBq Kg -1 h -1 (32.82 to 218.49 mBqm -2 h -1 ). A good correlation has been observed between radon exhalation rate and radium concentration observed in the soil samples. The uranium concentration in all these samples is being carried out and the other correlations will also be established. (authors)

Determination and assessment of Rn in mineral springs of Shandong province

International Nuclear Information System (INIS)

Xu Jia'ang; Li Fusheng; Chen Yingmin; Chen Yue; Deng Daping; Yuan Ming; Song Gang; Zhang Lianping

2002-01-01

Objective: The concentrations and its changes of 222 Rn in mineral springs of Shandong were determined in order to evaluate the committed equivalent dose for people drinking the water. Methods: Scintillation flask method is used for the measurement of 222 Rn concentrations in mineral springs. Results: The concentrations of 222 Rn in mineral springs of Shandong ranged from 0.51 Bq·L -1 to 807.20 Bq·L -1 , the geometric average of it was 22.09 Bq·L -1 . The relationship between the ratios of 222 Rn remains in the water under the natural conditions (P) and the period of time exposed in air (T) was discovered, which is fits for the following function relation: P = 46.666 T -0.517 (0.117 h≤T≤9 h). The committed equivalent dose resulting from 222 Rn concentrations was estimated to be 9.68 x 10 -2 mSv·a -1 , Which is due to drinking the water. Conclusion: The analyses of data indicate that there is no over-burden dose from 222 Rn for people who drink the water of mineral springs of Shandong

Control of exposure to exhaled air from sick occupant with wearable personal exhaust unit

DEFF Research Database (Denmark)

Bolashikov, Zhecho Dimitrov; Melikov, Arsen Krikor; Barova, Maria I.

2014-01-01

of the doctor at three different distances. It was operated at 0.25 or 0.50 L/s under mixing background ventilation at 3 ACH. The use of wearable personal exhaust resulted in cleaner air in the room compared to mixing alone at 12 ACH. The high potential to capture exhaled air makes the device efficient against...

A sub-nationwide survey of outdoor and indoor 222Rn concentrations in China by passive method

International Nuclear Information System (INIS)

Jin Yihe; Ikebe, Y.; Iida, T.

1996-01-01

From Nov. 1988 to Mar. 1993, cooperated by China and Japan, a survey of outdoor and indoor 222 Rn concentrations in 10 cities which were highly populated in China was carried out by means of passive method. the annual mean of outdoor 222 Rn concentration in 10 cities was 8.8 Bq·m -3 . The highest of 13.5 Bq·m -3 was in Wuhan, the lowest of 3.3 Bq·m -3 was in Chongming Island of Shanghai; and there were no significant differences among the different years in the same areas. During the northwest wind seasons, about 50% of outdoor 222 Rn concentration in Taiwan was contributed by the airflow from the mainland. Typical apartment houses and offices built of brick and concrete were also surveyed for indoor 222 Rn concentration. The annual mean of indoor 222 Rn concentration in the 10 cities was 19.5 Bq·m - 3. The highest of 33.9 Bq·m -3 was observed in Guiyang, the lowest of 9.0 Bq·m -3 was observed in Chongming Island of Shanghai. The outdoor and indoor 222 Rn concentrations showed a clear seasonal pattern with the minimum in summer and the maximum in winter. And they also showed a clear geographic distribution tendency; they were higher in inland than in seashores, and higher in the south than in the north. The ratios of indoor to outdoor 222 Rn concentrations were from 1.1 to 4.6. The annual effective dose equivalents resulting from outdoor and indoor 222 Rn concentrations amounted to about 0.64 mSv·a -1 . The highest was in Guiyang, and the lowest was in Nantong, being 1.12 and 0.39 mSv·a -1 , respectively

Design of the exhale airway stents for emphysema (EASE) trial : an endoscopic procedure for reducing hyperinflation

NARCIS (Netherlands)

Shah, Pallav L.; Slebos, Dirk-Jan; Cardoso, Paulo F. G.; Cetti, Edward J.; Sybrecht, Gerhard W.; Cooper, Joel D.

2011-01-01

Background: Airway Bypass is a catheter-based, bronchoscopic procedure in which new passageways are created that bypass the collapsed airways, enabling trapped air to exit the lungs. The Exhale Airway Stents for Emphysema (EASE) Trial was designed to investigate whether Exhale (R) Drug-Eluting

Analysis of international intercomparisons results organized by Japan for integrating 222Rn-220Rn detectors

International Nuclear Information System (INIS)

Wu Yunyun; Cui Hongxing; Zhang Qingzhao; Shang Bing; Su Xu

2012-01-01

Objective: To guarantee the quality of measurements with the radon-thoron discriminative detectors of our laboratory. Methods: LD-P radon-thoron discriminative detector participated in the international intercomparison for integrating radon/thoron detectors organized by National Institute of Radiological Science (NIRS, Japan). Detectors were sent to NIRS for exposure. Radon intercomparison was conducted with radon chamber providing three levels of exposure: low, medium and high levels. Thoron intercomparison was carried out at thoron chamber, which also provided three levels of exposure: low, medium and high levels. Detectors were posted back to our laboratory for etching and analysis after exposure. Then the measured values were submitted to NIRS. Finally the reference values were informed of us. Results: The relative percent difference (RPD) between the measured value and the reference value for radon was -13.8%, -14.4% and -17.1% at low, medium and high levels respectively, and that of thoron were -14.4%, 8.9% and -3.2% at three levels respectively. Conclusions: Both radon and thoron measurement of our detectors rank as 'Category Ⅰ' in the 4th international intercomparisons for integrating radon/thoron detectors with the NIRS radon/thoron chambers. (authors)

Evaluation of a new simple collection device for sampling of microparticles in exhaled breath.

Science.gov (United States)

Seferaj, Sabina; Ullah, Shahid; Tinglev, Åsa; Carlsson, Sten; Winberg, Jesper; Stambeck, Peter; Beck, Olof

2018-03-12

The microparticle fraction of exhaled breath is of interest for developing clinical biomarkers. Exhaled particles may contain non-volatile components from all parts of the airway system, formed during normal breathing. This study aimed to evaluate a new, simple sampling device, based on impaction, for collecting microparticles from exhaled breath. Performance of the new device was compared with that of the existing SensAbues membrane filter device. The analytical work used liquid chromatography-tandem mass spectrometry methods. The new device collected three subsamples and these were separately analysed from eight individuals. No difference was observed between the centre position (0.91 ng/sample) and the side positions (1.01 ng/sample) using major phosphatidylcholine (PC) 16:0/16:0 as the analyte. Exhaled breath was collected from eight patients on methadone maintenance treatment. The intra-individual variability in measured methadone concentration between the three collectors was 8.7%. In another experiment using patients on methadone maintenance treatment, the sampling efficiency was compared with an established filter device. Compared to the existing device, the efficiency of the new device was 121% greater for methadone and 1450% greater for DPPC. The data from lipid analysis also indicated that a larger fraction of the collected material was from the distal parts. Finally, a study using an optical particle counter indicated that the device preferentially collects the larger particle fraction. In conclusion, this study demonstrates the usefulness of the new device for collecting non-volatile components from exhaled breath. The performance of the device was superior to the filter device in several aspects.

Technique and clinical applications of full-inflation and end-exhalation controlled-ventilation chest CT in infants and young children

International Nuclear Information System (INIS)

Long, F.R.; Castile, R.G.

2001-01-01

Background. The inability of young children to cooperate with breath holding limits the usefulness of chest CT. Objective. To describe the technique and utility of a non-invasive method called controlled-ventilation CT (CVCT) for obtaining motion-free full-inflation and end-exhalation images of the lung in infants and young children. Materials and methods. Eighty-seven children (ages 1 week to 5 years, mean 2 years) underwent CVCT of the chest during suspended respiration at full-lung inflation and end-exhalation for a variety of clinical indications. Respiratory pauses were produced using conscious sedation and positive-pressure face-mask ventilation. Forty-one of 87 children had recordings of respiratory motion during CVCT. Results. Respiratory pause lengths increased with age (P < 0.003), were highly reproducible (r = 0.85), and lasted sufficiently long to be practical for full-inflation (24 ± 9 s) and end-exhalation (12 ± 5 s) CT scanning. Full-inflation CVCT was useful in evaluating tracheal and bronchial stenosis, bronchial wall thickening, early bronchiectasis, bronchial fistula, extent of interstitial fibrosis, and lung nodules. End-exhalation CVCT was useful in evaluating tracheomalacia and air trapping. Conclusion. Controlled-ventilation chest CT is a practical and reliable technique that promises to be clinically useful for a number of clinical indications in infants and young children. (orig.)

Absolute measurement of the activity of 222Rn using a proportional counter

International Nuclear Information System (INIS)

Busch, Ingo; Greupner, Heinz; Keyser, Uwe

2002-01-01

A measuring set-up comprising a proportional counter of calculable 222 Rn efficiency and quantifiable active volume (δ V 222 Rn efficiency is determined by computer simulation of the measured α-spectra. The procedures necessary for absolute measurements by means of the counter are described, and the suitability of the counter for absolute measurements of the 222 Rn activity is proved by experiments. Thus, a new method for the realization of the unit of activity of 222 Rn is obtained, which is independent of the unit of activity of 226 Ra

Effect of Air Stability on the Dispersal of Exhaled Contaminant in Rooms

DEFF Research Database (Denmark)

Xu, Chunwen; Gong, Guangcai; Nielsen, Peter V.

2013-01-01

the manikin, indicating that the person who exhales the contaminant may not be polluted by himself as the protective effect of the thermal boundary layer around the body, especially in stable condition with two concentration zones and clean air drawn from the inlets. However, other persons facing......Experiments are conducted in a full-scale chamber equipped with whole floor and whole ceiling supply or exhaust to form approximately zero and larger temperature gradients corresponding to unstable and stable air conditions. It can be observed that the air with smoke exhaled from a life...

Exhaled and nasal nitric oxide in chronic rhinosinusitis patients with nasal polyps in primary care

DEFF Research Database (Denmark)

Frendø, M; Håkansson, K; Schwer, S

2018-01-01

BACKGROUND: Chronic rhinosinusitis with nasal polyps (CRSwNP) is a common inflammatory disorder associated with lower airway disease. However, only few studies of CRSwNP from outside secondary/tertiary care centres have been published. We recently reported an asthma frequency of 44% and 65...... patients. Compared with controls, a high level of exhaled NO was significantly more prevalent in CRSwNP irrespective of asthma-status. Nasal NO was significantly lower in patients with CRSwNP compared with controls. CONCLUSION: Subclinical eosinophilic lower airway inflammation is common in CRSwNP......% in primary and secondary care patients respectively. Therefore, we hypothesise that inflammation of the lower airways could be present in all CRSwNP patients, even without asthma. Here, we assessed the degree of lower and upper airway inflammation using exhaled and nasal nitric oxide (NO) in primary care...

A hydrogen peroxide sensor for exhaled breath measurement

NARCIS (Netherlands)

Dam, T.V.A.; Olthuis, Wouter; Bergveld, Piet; van den Berg, Albert

2004-01-01

An increase in produced hydrogen peroxide concentration in exhaled breath (EB) of patients, who suffer from some diseases related to lung function, has been observed and considered as a reliable indicator of lung diseases. In the EB of these patients, hydrogen peroxide is present in the vapour phase

A hydrogen peroxide sensor for exhaled breath measurement

NARCIS (Netherlands)

Dam, T.V.A.; Olthuis, Wouter; Bergveld, Piet

2005-01-01

An increase in hydrogen peroxide concentration in exhaled breath (EB) of patients, who suffer from some diseases related to the lung function, has been observed and considered as a reliable indicator of lung diseases. In the EB of these patients, hydrogen peroxide is present in the vapour phase

Variability in the exhalation rate of radon

International Nuclear Information System (INIS)

Rundo, J.; Markun, F.; Sha, J.Y.; Cameron, P.

1976-01-01

In a day-long study, twenty-eight 10-min samples of breath were collected from a former radium dial painter and were analyzed for radon. The radon exhalation rate showed good short-term reproducibility, but there was a dramatic short-lived increase in the first samples collected after lunch and a slow but steady increase during the course of the day

Ole Bjørn Kraft 1893-1980

DEFF Research Database (Denmark)

Skov, Christian Houlberg

2010-01-01

Ole Bjørn Kraft (1893-1980) var en central konservativ politiker i årene før og efter anden verdenskrig. Han markerede sig som udpræget idépolitiker og opnåede ad flere omgange at blive minister.......Ole Bjørn Kraft (1893-1980) var en central konservativ politiker i årene før og efter anden verdenskrig. Han markerede sig som udpræget idépolitiker og opnåede ad flere omgange at blive minister....

Standards, calibration and quality assurance of 222Rn measurements in Sweden

International Nuclear Information System (INIS)

Falk, R.; Hagberg, N.; Mjoenes, L.; Moere, H.; Nyblom, L.; Swedjemark, G.A.

1994-01-01

Inhaled decay products of 222 Rn are the dominant components of the natural radiation exposure to the general population. Limits have been introduced in Sweden, and recommendations were made in 1980 for decreasing indoor 222 Rn concentration. The need for the coordinated calibration of measuring instruments as well as for quality assurance was obvious for both health and economic reasons. 222 Rn measurements in Sweden are based on standards traceable to the National Institute of Standard and Technology (NIST) through the use of standard reference material 226 Ra. Standards for both 222 Rn and short-lived 222 Rn progeny are described together with the reference instrument adopted for these studies. The calibration of field instruments was performed in a ''radon room'', a climate chamber in which it is possible to vary and monitor the concentration of 222 Rn as well as other characteristics of the indoor air such as temperature, humidity, ventilation rate and aerosol concentration. The rules and regulations for field measurements imply a calibration of the instruments yearly, as well as accreditation and training for the companies that carry out the measurements. Examples are given of the official measurement protocols used for the different types of instruments. (orig.)

Radon and lung cancer in Bangalore Metropolitan, India

International Nuclear Information System (INIS)

Sathish, L.A.; Nethravathi, K.S.; Ramachandran, T.V.

2012-01-01

Radon is a radioactive gas released from the normal decay of 238 U in rocks and soil. It is an invisible, odorless, tasteless gas that seeps up through the ground and diffuses into the air. In a few areas, depending on local geology, radon dissolves into ground water and can be released into the air when the water is used. Radon gas usually exists at very low levels outdoors. However, in areas without adequate ventilation, such as underground mines, radon can accumulate to levels that substantially increase the risk of lung cancer. Radon decays quickly, giving off tiny radioactive particles. When inhaled, these radioactive particles can damage the cells that line the lung. Long-term exposure to radon can lead to lung cancer, the only cancer proven to be associated with inhaling radon. Public interest in radon has been occasionally piqued by articles in the general press. Considerable attention has been given to the high radon levels that were uncovered in the Reading Prong region of Pennsylvania, following the discovery in late 1984 of extremely high levels in one home. Several epidemiological study programmes in different countries are in progress to estimate the population exposures due to natural radiation with a view to obtain the radiation risk coefficients at low dose rate levels. In this regard, radiation surveys in high background areas (HBRAs) can provide excellent settings for epidemiological studies relating to the effects of low doses of radiation. In view of these, a comprehensive estimate of the natural inhalation dose requires both 222 Rn and 220 Rn levels in the indoor atmosphere. In this outlook an attempt is made to investigate the 222 Rn and 220 Rn levels in dwellings of Bangalore Metropolitan, India. Three year results shows that the activity concentrations of 226 Ra, 232 Th, radon in ground water, the concentrations 222 Rn and 220 Rn and the dose rate (mSvy -1 ) are at alarming levels for the environment of Bangalore Metropolitan, India. The

Effect of humidity on thoron adsorption in activated charcoal bed

International Nuclear Information System (INIS)

Sudeep Kumara, K.; Karunakara, N.; Yashodhara, I.; Sapra, B.K.; Sahoo, B.K.; Gaware, J.J.; Kanse, S.D.; Mayya, Y.S.

2014-01-01

Activated charcoal is a well-known adsorber of 222 Rn and 220 Rn gases. This property can be effectively used for remediation of these gases in the workplaces of uranium and thorium processing facilities. However, the adsorption on charcoal is sensitive to variation in temperature and humidity. The successful designing and characterization of adsorption systems require an adequate understanding of these sensitivities. The study has been carried out towards this end, to delineate the effect of relative humidity on the efficacy of 220 Rn mitigations in a charcoal bed. Air carrying 220 Rn from a Pylon source was passed through a column filled with coconut shell-based granular activated charcoal. The relative humidity of the air was controlled, and the transmission characteristics were examined at relative humidity varying from 45% to 60%. The mitigation factor was found to decrease significantly with an increase of humidity in the air. (author)

Factors affecting radon removal from Rn-222 enriched water

International Nuclear Information System (INIS)

Abulfaraj, W.H.; Mamoon, A.

1994-01-01

Continued use of potable well water that has elevated levels of Rn-222 is harmful to human health. activated carbon, aeration and heating can remove radon from treated water. Water artificially enriched with Rn-222 using a pitchblende source was studied in a laboratory scale model under controlled conditions. (author), 3 figs., 3 refs

Radon in houses - identification of sources and pathways of transfer

International Nuclear Information System (INIS)

Robe, M.C.; Rannou, A.; Le Bronec, J.

1992-01-01

The Institut de Protection et de Surete Nucleaire (IPSN) is studying the remedial actions to reduce high concentration of radon in houses. The first step to know how to modify houses is to identify radon sources and pathways of transfer to upper floors. A pilot study in Brittany was designed to develop a simple method of diagnosis. This investigation was based on indoor and outdoor measurements of 222 Rn activity concentration in the air and 222 Rn area exhalation rate from the soils and walls, measurements of the potential alpha energy concentration of 222 Rn daughters and the ventilation rate. The structural characteristics of houses and the influence of the life style of the inhabitants were examined. Analysis of the results showed that a limited number of parameters can be selected for use in a rapid radon diagnosis. (author)

Measurement of radon exhalation rate in various building materials and soil samples

Science.gov (United States)

Bala, Pankaj; Kumar, Vinod; Mehra, Rohit

2017-03-01

Indoor radon is considered as one of the potential dangerous radioactive elements. Common building materials and soil are the major source of this radon gas in the indoor environment. In the present study, the measurement of radon exhalation rate in the soil and building material samples of Una and Hamirpur districts of Himachal Pradesh has been done with solid state alpha track detectors, LR-115 type-II plastic track detectors. The radon exhalation rate for the soil samples varies from 39.1 to 91.2 mBq kg-1 h-1 with a mean value 59.7 mBq kg-1 h-1. Also the radium concentration of the studied area is found and it varies from 30.6 to 51.9 Bq kg-1 with a mean value 41.6 Bq kg-1. The exhalation rate for the building material samples varies from 40.72 (sandstone) to 81.40 mBq kg-1 h-1 (granite) with a mean value of 59.94 mBq kg-1 h-1.

The measurement of 222Rn in drinking water by low-level liquid scintillation counting

International Nuclear Information System (INIS)

Barnett, J.M.; McKlveen, J.W.

1992-01-01

Radon-222 (Rn) has universally been found in well water. Non-stagnant ground water is collected at the well head while the well is pumping. The water is adjusted to a slow, non-aerated, steady flow through a clear tube, and a 500 ml glass bottle is filled. The sample is tightly capped after a high meniscus has developed. In the laboratory, standard 22 ml glass vials are filled with 10 ml of a toluene based mineral oil LS cocktail. Then, two 5 ml sample aliquots are pipetted into the vial. Vials are capped tightly, shaken vigorously, and placed in the liquid scintillation (LS) counter. Secular equilibrium is established in approximately 4 hours, after which samples are counted for 100 minutes each. The counting efficiency for Rn and progeny ranges between 315 to 345 percent depending on the chosen spectral window. The average background is about 6 cpm. A total of 28 wells were tested for Rn in the Carefree-Cave Creek, Arizone, USA area. The area's geometric average Rn concentration was found to be 46.5 Bq*1 -1 . The associated estimated lung dose is 0.51 mSv*y -1 . (author) 8 refs.; 1 fig.; 1 tab

Dicty_cDB: VHK220 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHK220 (Link to dictyBase) - - - - - (Link to Original site) VHK2...20F 530 - - - - - - Show VHK220 Library VH (Link to library) Clone ID VHK220 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-A/VHK2...20Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >VHK2...20 (VHK220Q) /CSM/VH/VHK2-A/VHK220Q.Seq.d/ AACTCTCGAGTGCAAAAAAAGTAAAGTACAAAATGGTTAATTTCA

Til julefrokost med Bjørn & Okay

DEFF Research Database (Denmark)

Smith-Sivertsen, Henrik

2012-01-01

I denne artikel vises med udgangspunkt i en beskrivelse af et specifikt arrangement med det danske danseorkester Bjørn & Okay, hvordan man optræder inden for denne særlige musiktradition. Bjørn & Okays performative udgangspunkt er, at de, trods en status som landskendt orkester med mange hits, i ...... the audience and constantly telling them what to do. At the same time he and the other musicians actively bond with the audience, both onstage and offstage, which helps building the spirit of community, which is the clear goal of the musical performance....

Rn 222 in the Black Sea waters

International Nuclear Information System (INIS)

Arbuzova, A.P.; Batrakov, G.F.; Eremeev, V.N.; Zemlyanoj, A.D.; Ivanova, T.M.

1988-01-01

Results of Rn 222 concentration measurements in the Black Sea waters obtained in the summer of 1986 during the expedition of the Akademik Vernadskij research ship are presented. It is ascertained that the intensity of vertical turbulent exchange produces the main effect on Rn 222 distribution in the sea surface waters. The vertical distribution in a 200 m layer is characterized by the growth of concentration with depth, which is caused by the presence of Ra 226 increased concentration region, that coincides with the boundary layer between oxygen and hydrogen sulfide

Calibration of track detectors and measurement of radon exhalation rate from solid samples

International Nuclear Information System (INIS)

Singh, Ajay Kumar; Jojo, P.J.; Prasad, Rajendra; Khan, A.J.; Ramachandran, T.V.

1997-01-01

CR-39 and LR-115 type II track detectors to be used for radon exhalation measurements have been calibrated. The configurations fitted with detectors in Can technique in the open cup mode are cylindrical plastic cup (PC) and conical plastic cup (CPC). The experiment was performed in radon exposure chamber having monodisperse aerosols of 0.2 μm size, to find the relationship between track density and the radon concentration. The calibration factors for PC and CPC type dosimeters with LR-115 type II detector were found to be 0.056 and 0.083 tracks cm -2 d -1 (Bqm -3 ) -1 respectively, while with CR-39 detector the values were 0.149 and 0.150 tracks cm -2 d -1 (Bq m -3 ) -1 . Employing the Can technique, measurements of exhalation rates from solid samples used as construction materials, are undertaken. Radon exhalation rate is found to be minimum in cement samples while in fly ash it is not enhanced as compared to coal samples. (author)

Investigation of the Radon exhalation potential in the PACA region. Phase II: case of high potential exhalation areas in Medium Champsaur (05) and South Esterel (83). Final report

International Nuclear Information System (INIS)

2009-01-01

After having recalled the results of the first phase of the study and the objectives of the second phase, the authors present the methodology: uranium and thorium analysis on rock, radon-222 activity measurement in soil gases, and gamma radiation measurement. They discuss the influence of rock uranium content on radon exhalation (natural contextual and physical phenomena governing radon transport, radon properties, uranium geochemistry). They report the results obtained in the two considered areas (meteorological conditions, radon 222 content in soils, uranium and thorium contents in geological formations, influence of geological formation type and distribution on radon activity)

49 CFR 220.2 - Preemptive effect.

Science.gov (United States)

2010-10-01

... 49 Transportation 4 2010-10-01 2010-10-01 false Preemptive effect. 220.2 Section 220.2 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAILROAD COMMUNICATIONS General § 220.2 Preemptive effect. Link to an amendment...

Spirometry effects on conventional and multiple flow exhaled nitric oxide in children.

Science.gov (United States)

Eckel, Sandrah P; Linn, William S; Salam, Muhammad T; Bastain, Theresa M; Zhang, Yue; Rappaport, Edward B; Liu, Meng; Berhane, Kiros

2015-03-01

Clinical and research settings often require sequencing multiple respiratory tests in a brief visit. Guidelines recommend measuring the concentration of exhaled nitric oxide (FeNO) before spirometry, but evidence for a spirometry carryover effect on FeNO is mixed. Only one study has investigated spirometry carryover effects on multiple flow FeNO analysis. The objective of this study was to evaluate evidence for carryover effects of recent spirometry on three exhaled NO summary measures: FeNO at 50 ml/s, airway wall NO flux [J'awNO] and alveolar NO concentration [CANO] in a population-based sample of schoolchildren. Participants were 1146 children (191 with asthma), ages 12-15, from the Southern California Children's Health Study who performed spirometry and multiple flow FeNO on the same day. Approximately, half the children performed spirometry first. Multiple linear regression was used to estimate differences in exhaled NO summary measures associated with recent spirometry testing, adjusting for potential confounders. In the population-based sample, we found no evidence of spirometry carryover effects. However, for children with asthma, there was a suggestion that exhaled NO summary measures assessed ≤6 min after spirometry were lower (FeNO: 25.8% lower, 95% CI: -6.2%, 48.2%; J'awNO: 15.1% lower 95% CI: -26.5%, 43.0%; and CANO 0.43 parts per billion lower, 95% CI: -0.12, 0.98). In clinical settings, it is prudent to assess multiple flow FeNO before spirometry. In studies of healthy subjects, it may not be necessary to assess FeNO first.

46 CFR 129.220 - Basic safety.

Science.gov (United States)

2010-10-01

... 46 Shipping 4 2010-10-01 2010-10-01 false Basic safety. 129.220 Section 129.220 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS ELECTRICAL INSTALLATIONS General Requirements § 129.220 Basic safety. (a) Electrical equipment and installations must be suitable...

From Vulnerability to Dignity: The RN Declaration of Self-Esteem.

Science.gov (United States)

Janzen, Katherine J; Mitchell, Maureen; Renton, Lesley J; Currie, Genevieve; Nordstrom, Pamela M

2015-11-04

Registered nurses (RNs) experience vulnerability from a variety of sources in today's healthcare organizations. While RN vulnerability can be associated with positive outcomes with patients and clients, vulnerability can also be dangerous to RNs as they struggle with outside forces that many feel they have no control over. The study aims to maintain and enhance the dignity of RNs and provide a beacon to RNs who may have become wounded in the healthcare setting and/or their own profession. The study was conducted in a conference entitled "Advancing Nursing Practice Through Change, Innovation and Creativity" held at a midsized university in western Canada. The participants were 115 administrators, members of RN regulatory bodies, nursing faculty, nurse educators, and staff nurses. An activity entitled "Wild Thinking" gave participants an opportunity to reflect upon the conference and their personal experiences of change, innovation, and creativity they wished to see within the workplace. All responses were collected at the end of the activity, transcribed verbatim, and analyzed for themes. Arising from 16 themes, the RN Declaration of Self-Esteem was created. The RN Declaration of Self-Esteem may be helpful in promoting empowerment at the individual RN level as well as in the collective professional level. © 2015 Wiley Periodicals, Inc.

Exhaled breath profiling using broadband quantum cascade laser-based spectroscopy in healthy children and children with asthma and cystic fibrosis.

Science.gov (United States)

van Mastrigt, E; Reyes-Reyes, A; Brand, K; Bhattacharya, N; Urbach, H P; Stubbs, A P; de Jongste, J C; Pijnenburg, M W

2016-04-08

Exhaled breath analysis is a potential non-invasive tool for diagnosing and monitoring airway diseases. Gas chromatography-mass spectrometry and electrochemical sensor arrays are the main techniques to detect volatile organic compounds (VOC) in exhaled breath. We developed a broadband quantum cascade laser spectroscopy technique for VOC detection and identification. The objective of this study was to assess the repeatability of exhaled breath profiling with broadband quantum cascade laser-based spectroscopy and to explore the clinical applicability by comparing exhaled breath samples from healthy children with those from children with asthma or cystic fibrosis (CF). Healthy children and children with stable asthma or stable CF, aged 6-18 years, were included. Two to four exhaled breath samples were collected in Tedlar bags and analyzed by quantum cascade laser spectroscopy to detect VOCs with an absorption profile in the wavenumber region between 832 and 1262.55 cm(-1). We included 35 healthy children, 39 children with asthma and 15 with CF. Exhaled breath VOC profiles showed poor repeatability (Spearman's rho  =  0.36 to 0.46) and agreement of the complete profiles. However, we were able to discriminate healthy children from children with stable asthma or stable CF and identified VOCs that were responsible for this discrimination. Broadband quantum cascade laser-based spectroscopy detected differences in VOC profiles in exhaled breath samples between healthy children and children with asthma or CF. The combination of a relatively easy and fast method and the possibility of molecule identification makes broadband quantum cascade laser-based spectroscopy attractive to investigate the diagnostic and prognostic potential of volatiles in exhaled breath.

Performance of a new hand-held device for exhaled nitric oxide measurement in adults and children

Directory of Open Access Journals (Sweden)

Janson C

2006-04-01

Full Text Available Abstract Background Exhaled nitric oxide (NO measurement has been shown to be a valuable tool in the management of patients with asthma. Up to now, most measurements have been done with stationary, chemiluminescence-based NO analysers, which are not suitable for the primary health care setting. A hand-held NO analyser which simplifies the measurement would be of value both in specialized and primary health care. In this study, the performance of a new electrochemical hand-held device for exhaled NO measurements (NIOX MINO was compared with a standard stationary chemiluminescence unit (NIOX. Methods A total of 71 subjects (6–60 years; 36 males, both healthy controls and atopic patients with and without asthma were included. The mean of three approved exhalations (50 ml/s in each device, and the first approved measurement in the hand-held device, were compared with regard to NO readings (Bland-Altman plots, measurement feasibility (success rate with 6 attempts and repeatability (intrasubject SD. Results Success rate was high (≥ 84% in both devices for both adults and children. The subjects represented a FENO range of 8–147 parts per billion (ppb. When comparing the mean of three measurements (n = 61, the median of the intrasubject difference in exhaled NO for the two devices was -1.2 ppb; thus generally the hand-held device gave slightly higher readings. The Bland-Altman plot shows that the 95% limits of agreement were -9.8 and 8.0 ppb. The intrasubject median difference between the NIOX and the first approved measurement in the NIOX MINO was -2.0 ppb, and limits of agreement were -13.2 and 10.2 ppb. The median repeatability for NIOX and NIOX MINO were 1.1 and 1.2 ppb, respectively. Conclusion The hand-held device (NIOX MINO and the stationary system (NIOX are in clinically acceptable agreement both when the mean of three measurements and the first approved measurement (NIOX MINO is used. The hand-held device shows good repeatability, and it

Performance of a new hand-held device for exhaled nitric oxide measurement in adults and children.

Science.gov (United States)

Alving, K; Janson, C; Nordvall, L

2006-04-20

Exhaled nitric oxide (NO) measurement has been shown to be a valuable tool in the management of patients with asthma. Up to now, most measurements have been done with stationary, chemiluminescence-based NO analysers, which are not suitable for the primary health care setting. A hand-held NO analyser which simplifies the measurement would be of value both in specialized and primary health care. In this study, the performance of a new electrochemical hand-held device for exhaled NO measurements (NIOX MINO) was compared with a standard stationary chemiluminescence unit (NIOX). A total of 71 subjects (6-60 years; 36 males), both healthy controls and atopic patients with and without asthma were included. The mean of three approved exhalations (50 ml/s) in each device, and the first approved measurement in the hand-held device, were compared with regard to NO readings (Bland-Altman plots), measurement feasibility (success rate with 6 attempts) and repeatability (intrasubject SD). Success rate was high (> or = 84%) in both devices for both adults and children. The subjects represented a FENO range of 8-147 parts per billion (ppb). When comparing the mean of three measurements (n = 61), the median of the intrasubject difference in exhaled NO for the two devices was -1.2 ppb; thus generally the hand-held device gave slightly higher readings. The Bland-Altman plot shows that the 95% limits of agreement were -9.8 and 8.0 ppb. The intrasubject median difference between the NIOX and the first approved measurement in the NIOX MINO was -2.0 ppb, and limits of agreement were -13.2 and 10.2 ppb. The median repeatability for NIOX and NIOX MINO were 1.1 and 1.2 ppb, respectively. The hand-held device (NIOX MINO) and the stationary system (NIOX) are in clinically acceptable agreement both when the mean of three measurements and the first approved measurement (NIOX MINO) is used. The hand-held device shows good repeatability, and it can be used successfully on adults and most children

Factors controlling temporal variability of near-ground atmospheric 222Rn concentration over central Europe

Science.gov (United States)

Zimnoch, M.; Wach, P.; Chmura, L.; Gorczyca, Z.; Rozanski, K.; Godlowska, J.; Mazur, J.; Kozak, K.; Jeričević, A.

2014-09-01

Concentration of radon (222Rn) in the near-ground atmosphere has been measured quasi-continuously from January 2005 to December 2009 at two continental sites in Europe: Heidelberg (south-west Germany) and Krakow (southern Poland). The atmosphere was sampled at ca. 30 and 20 m above the local ground. Both stations were equipped with identical instruments. Regular observations of 222Rn were supplemented by measurements of surface fluxes of this gas in the Krakow urban area, using two different approaches. The measured concentrations of 222Rn varied at both sites in a wide range, from less than 2.0 Bq m-3 to approximately 40 Bq m-3 in Krakow and 35 Bq m-3 in Heidelberg. The mean 222Rn content in Krakow, when averaged over the entire observation period, was 30% higher than in Heidelberg (5.86 ± 0.09 and 4.50 ± 0.07 Bq m-3, respectively). Distinct seasonality of 222Rn signal is visible in the obtained time series of 222Rn concentration, with higher values recorded generally during late summer and autumn. The surface 222Rn fluxes measured in Krakow also revealed a distinct seasonality, with broad maximum observed during summer and early autumn and minimum during the winter. When averaged over a 5-year observation period, the night-time surface 222Rn flux was equal to 46.8 ± 2.4 Bq m-2 h-1. Although the atmospheric 222Rn levels at Heidelberg and Krakow appeared to be controlled primarily by local factors, it was possible to evaluate the "continental effect" in atmospheric 222Rn content between both sites, related to gradual build-up of 222Rn concentration in the air masses travelling between Heidelberg and Krakow. The mean value of this build-up was equal to 0.78 ± 0.12 Bq m-3. The measured minimum 222Rn concentrations at both sites and the difference between them was interpreted in the framework of a simple box model coupled with HYSPLIT (Hybrid Single Particle Lagrangian Integrated Trajectory) analysis of air mass trajectories. The best fit of experimental data was

36 CFR 223.220 - Quantity determination.

Science.gov (United States)

2010-07-01

... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Quantity determination. 223.220 Section 223.220 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE SALE AND DISPOSAL OF NATIONAL FOREST SYSTEM TIMBER Special Forest Products § 223.220 Quantity determination...

Rn-222 release to the environment: comparison between different granite sources

International Nuclear Information System (INIS)

Mamoon, M.; Kamal, S.M.

2005-01-01

In this work three different types of granites were studied, namely: pure granite, alkali granite and altered (hydrated) alkali granite. General radioactivity of the granites was studied along with the potential for 222 Rn emanation. The study indicated that altered alkali granite releases, relatively, the highest 222 Rn emanation to the surrounding air while alkali granite emits the more intense gamma radiation of the three granites. Hence, altered alkali granite can be used as a laboratory source for 222 Rn.

Near-IR laser-based spectrophotometer for comparative analysis of isotope content of CO2 in exhale air samples

International Nuclear Information System (INIS)

Stepanov, E V; Glushko, A N; Kasoev, S G; Koval', A V; Lapshin, D A

2011-01-01

We present a laser spectrophotometer aimed at high-accuracy comparative analysis of content of 12 CO 2 and 13 CO 2 isotope modifications in the exhale air samples and based on a tunable near-IR diode laser (2.05 μm). The two-channel optical scheme of the spectrophotometer and the special digital system for its control are described. An algorithm of spectral data processing aimed at determining the difference in the isotope composition of gas mixtures is proposed. A few spectral regions (near 4880 cm -1 ) are determined to be optimal for analysis of relative content of 12 CO 2 and 13 CO 2 in the exhale air. The use of the proposed spectrophotometer scheme and the developed algorithm makes the results of the analysis less susceptible to the influence of the interference in optical elements, to the absorption in the open atmosphere, to the slow drift of the laser pulse envelope, and to the offset of optical channels. The sensitivity of the comparative analysis of the isotope content of CO 2 in exhale air samples, achieved using the proposed scheme, is estimated to be nearly 0.1‰.

222Rn activity concentration differences in groundwaters of three Variscan granitoid massifs in the Sudetes (NE Bohemian Massif, SW Poland)

International Nuclear Information System (INIS)

Przylibski, Tadeusz A.; Gorecka, Joanna

2014-01-01

Based on research conducted in three Variscan granitoid massifs located within the crystalline Bohemian Massif, the authors confirmed that the higher the degree of their erosional dissection, the smaller the concentration of 222 Rn in groundwaters circulating in these massifs. This notion implies that radon waters and high-radon waters, from which at least some of the dissolved radon should be removed before feeding them as drinking water to the water-supply system, could be expected in granitoid massifs which have been poorly exposed by erosion. At the same time, such massifs must be taken into account as the areas of possible occurrence of radon medicinal waters, which in some countries can be used for balneotherapy in health resorts. Slightly eroded granitoid massifs should be also regarded as very probable radon prone areas or areas of high radon potential. - Highlights: • The concentration of 222 Rn in groundwater depends on the zone of the granitoid massif which is exposed on the ground surface. • The highest 222 Rn concentrations occur in the least eroded granitoid massifs, the lowest in massifs with exposed root parts. • The stronger the erosional dissection of a granitoid massif, the lower 222 Rn concentration in groundwaters in this massif. • Not all granitoid massifs are areas with groundwaters containing high concentrations of 222 Rn. • The least eroded granitoid massifs are radon prone areas with the occurrence of high-radon and radon groundwaters

Increased exhaled nitric oxide predicts new-onset rhinitis and persistent rhinitis in adolescents without allergic symptoms.

Science.gov (United States)

Malinovschi, A; Alving, K; Kalm-Stephens, P; Janson, C; Nordvall, L

2012-03-01

The fraction of nitric oxide in exhaled air (FE(NO)) is increased in rhinitis and asthma. We have previously suggested that elevated FE(NO) levels in the absence of asthma symptoms may be a sign of 'early asthma'. In the present study, we hypothesize that elevated exhaled NO levels may also precede rhinitis symptoms. To investigate in a cohort of adolescents whether or not increased exhaled NO levels at the age of 13-14 years predicted new-onset or persistent rhinitis within a 4-year period. A total of 959 randomly selected adolescents (13-14 years) completed a questionnaire on respiratory symptoms at baseline and follow-up, 4 years later. Exhaled NO was measured at baseline. After exclusion of subjects with asthma diagnosis or asthma symptoms at baseline, 657 participants were eligible for the present study. Higher FE(NO) levels at baseline were associated with increased risk for new-onset (P = 0.009) and persistent rhinitis (P = 0.03) within a 4-year period. The risk of new-onset rhinitis was 2.32 (1.23, 4.37) [OR (95% CI)] times higher if FE(NO) > 90th percentile of the group without rhinitis at baseline. This increased risk for new-onset rhinitis was significant [2.49 (1.24, 5.01)] after excluding subjects with allergic symptoms. The risk of persistent rhinitis was 5.11 (1.34, 19.57) times higher if FE(NO) > 90th percentile of the group without rhinitis at baseline. Elevated exhaled nitric oxide levels predicted incident and persistent rhinitis in this population-based study of adolescents. Moreover, these findings were consistent after excluding subjects with allergic symptoms. Thus, it appears that elevation of exhaled NO precedes airway symptoms and predicts development of rhinitis in subjects without allergic symptoms or family history of allergic disease. © 2011 Blackwell Publishing Ltd.

Dicty_cDB: SFL220 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available 0Z (Link to Original site) Representative DNA sequence >SFL220 (SFL220Q) /CSM/SF/SFL2-A/SFL220Q.Seq.d/ XXXXXXXXXXGTCCANATTTCCATANA...end seq. - 3' end seq. ID SFL220Z 3' end seq. >SFL220Z.Seq ----------GTCCANATTTCCATANATGTGTTTAAAAACGTGGNGGNA

Reducing RN Vacancy Rate: A Nursing Recruitment Office Process Improvement Project.

Science.gov (United States)

Hisgen, Stephanie A; Page, Nancy E; Thornlow, Deirdre K; Merwin, Elizabeth I

2018-06-01

The aim of this study was to reduce the RN vacancy rate at an academic medical center by improving the hiring process in the Nursing Recruitment Office. Inability to fill RN positions can lead to higher vacancy rates and negatively impact staff and patient satisfaction, quality outcomes, and the organization's bottom line. The Model for Improvement was used to design and implement a process improvement project to improve the hiring process from time of interview through the position being filled. Number of days to interview and check references decreased significantly, but no change in overall time to hire and time to fill positions was noted. RN vacancy rate also decreased significantly. Nurse manager satisfaction with the hiring process increased significantly. Redesigning the recruitment process supported operational efficiencies of the organization related to RN recruitment.

46 CFR 184.220 - Cooking equipment.

Science.gov (United States)

2010-10-01

... 46 Shipping 7 2010-10-01 2010-10-01 false Cooking equipment. 184.220 Section 184.220 Shipping...) VESSEL CONTROL AND MISCELLANEOUS SYSTEMS AND EQUIPMENT Cooking and Heating § 184.220 Cooking equipment. (a) Doors on a cooking appliance must be provided with hinges and locking devices to prevent...

Sensitive Spectroscopic Analysis of Biomarkers in Exhaled Breath

Science.gov (United States)

Bicer, A.; Bounds, J.; Zhu, F.; Kolomenskii, A. A.; Kaya, N.; Aluauee, E.; Amani, M.; Schuessler, H. A.

2018-06-01

We have developed a novel optical setup which is based on a high finesse cavity and absorption laser spectroscopy in the near-IR spectral region. In pilot experiments, spectrally resolved absorption measurements of biomarkers in exhaled breath, such as methane and acetone, were carried out using cavity ring-down spectroscopy (CRDS). With a 172-cm-long cavity, an efficient optical path of 132 km was achieved. The CRDS technique is well suited for such measurements due to its high sensitivity and good spectral resolution. The detection limits for methane of 8 ppbv and acetone of 2.1 ppbv with spectral sampling of 0.005 cm-1 were achieved, which allowed to analyze multicomponent gas mixtures and to observe absorption peaks of 12CH4 and 13CH4. Further improvements of the technique have the potential to realize diagnostics of health conditions based on a multicomponent analysis of breath samples.

Correlation between radon exhalation and radium content in granite samples used as construction material in Saudi Arabia

Energy Technology Data Exchange (ETDEWEB)

Al-Jarallah, M.I. [Department of Physics, King Fahd University of Petroleum and Minerals, Dhahran 31261 (Saudi Arabia)]. E-mail: mibrahim@kfupm.edu.sa; Fazal-ur-Rehman [Department of Physics, King Fahd University of Petroleum and Minerals, Dhahran 31261 (Saudi Arabia); Musazay, M.S. [Department of Physics, King Fahd University of Petroleum and Minerals, Dhahran 31261 (Saudi Arabia); Aksoy, A. [Department of Physics, King Fahd University of Petroleum and Minerals, Dhahran 31261 (Saudi Arabia)

2005-11-15

Measurements of radon exhalation for a total of 205 selected samples of construction materials used in Saudi Arabia were carried out using an active radon gas analyzer with an emanation container. It was found that granite samples were the main source of radon exhalation. The radon exhalation rates per unit area from these granite samples varied from below the minimum detection limit up to 13.1Bqm{sup -2}h{sup -1} with an average of 1.5 +/-1.9(1{sigma})Bqm{sup -2}h{sup -1}. The radium contents of 27 granite samples were measured using an HPGe-based {gamma} spectroscopy setup. The {sup 226}Ra content of the granites varied from below the minimum detection limit up to 297Bqkg{sup -1}, with an average of 83+/-73(1{sigma})Bqkg{sup -1}. The linear correlation coefficient between exhaled radon and radium content was found to be 0.90.

45 CFR 148.220 - Excepted benefits.

Science.gov (United States)

2010-10-01

... 45 Public Welfare 1 2010-10-01 2010-10-01 false Excepted benefits. 148.220 Section 148.220 Public... FOR THE INDIVIDUAL HEALTH INSURANCE MARKET Preemption; Excepted Benefits § 148.220 Excepted benefits... provision of the benefits described in paragraphs (a) and (b) of this section (or any combination of the...

Børn på YouTube – nydelse og nørderi

DEFF Research Database (Denmark)

Johansen, Stine Liv

2017-01-01

Mange børn og unge bruger dagligt adskillige timer på videodelingsplatformen YouTube. Her kan de dyrke deres individuelle interesser, deres ’guilty pleasures’ og følge med i youtuberes dagligliv. For mange børn og unge er muligheden for selv at producere indhold ligeledes en relevant del af...... attraktionen ved YouTube. På baggrund af en igangværende, kvalitativ undersøgelse præsenteres i denne artikel en række relevante perspektiver ved børn og unges brug af YouTube. Et væsentligt aspekt er, at voksne sjældent involverer sig i børn og unges brug af YouTube. Men hvis man ønsker at tage aktivt del...... børn og unges (digitale) dannelsesprocesser kan det godt betale sig at holde øje med, hvad de laver på YouTube – og forsøge at forstå, hvad de får ud af det....

49 CFR 179.220-10 - Welding.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Welding. 179.220-10 Section 179.220-10... Specifications for Non-Pressure Tank Car Tanks (Classes DOT-111AW and 115AW) § 179.220-10 Welding. (a) All joints... of this subchapter). Welding procedures, welders, and fabricators shall be approved. (b) Radioscopy...

7 CFR 58.220 - Drying systems.

Science.gov (United States)

2010-01-01

... 7 Agriculture 3 2010-01-01 2010-01-01 false Drying systems. 58.220 Section 58.220 Agriculture....220 Drying systems. (a) Spray dryers. Spray dryers shall be of a continuous discharge type and all... filter system shall comply with the applicable requirements of the 3-A Accepted Practices for Milk and...

Sources and transport of indoor radon

International Nuclear Information System (INIS)

Aldenkamp, F.J.; Stoop, P.

1994-01-01

An approach in the investigation was to use a multi-compartment model of a home describing the processes that determine how radon concentrations in dwellings are established. Because the model describes Rn-222 concentrations in terms of airflows and sources, the experimental research was focused on the measurement of these three quantities. Development, calibration and assessment of the instrumentation played a major role. The experiments involved measurements of Rn-222 exhalation of buildings materials and the soil underneath the house, Rn-222 concentrations in air and airflows between various parts of the house and between the inside and outside of the house. (DG)

Matérn-based nonstationary cross-covariance models for global processes

KAUST Repository

Jun, Mikyoung

2014-01-01

-covariance models, based on the Matérn covariance model class, that are suitable for describing prominent nonstationary characteristics of the global processes. In particular, we seek nonstationary versions of Matérn covariance models whose smoothness parameters

46 CFR 121.220 - Cooking equipment.

Science.gov (United States)

2010-10-01

... 46 Shipping 4 2010-10-01 2010-10-01 false Cooking equipment. 121.220 Section 121.220 Shipping... SYSTEMS AND EQUIPMENT Cooking and Heating § 121.220 Cooking equipment. (a) Doors on a cooking appliance... cooking appliance must be installed to prevent movement in heavy seas. (c) For a grill or similar type of...

(222)Rn activity in groundwater of the St. Lawrence Lowlands, Quebec, eastern Canada: relation with local geology and health hazard.

Science.gov (United States)

Pinti, Daniele L; Retailleau, Sophie; Barnetche, Diogo; Moreira, Floriane; Moritz, Anja M; Larocque, Marie; Gélinas, Yves; Lefebvre, René; Hélie, Jean-François; Valadez, Arisai

2014-10-01

One hundred ninety-eight groundwater wells were sampled to measure the (222)Rn activity in the region between Montreal and Quebec City, eastern Canada. The aim of this study was to relate the spatial distribution of (222)Rn activity to the geology and the hydrogeology of the study area and to estimate the potential health risks associated with (222)Rn in the most populated area of the Province of Quebec. Most of the groundwater samples show low (222)Rn activities with a median value of 8.6 Bq/L. Ninety percent of samples show (222)Rn activity lower than 100 Bq/L, the exposure limit in groundwater recommended by the World Health Organization. A few higher (222)Rn activities (up to 310 Bq/L) have been measured in wells from the Appalachian Mountains and from the magmatic intrusion of Mont-Saint-Hilaire, known for its high level of indoor radon. The spatial distribution of (222)Rn activity seems to be related mainly to lithology differences between U-richer metasediments of the Appalachian Mountains and magmatic intrusions and the carbonaceous silty shales of the St. Lawrence Platform. Radon is slightly enriched in sodium-chlorine waters that evolved at contact with clay-rich formations. (226)Ra, the parent element of (222)Rn could be easily adsorbed on clays, creating a favorable environment for the production and release of (222)Rn into groundwater. The contribution of groundwater radon to indoor radon or by ingestion is minimal except for specific areas near Mont-Saint-Hilaire or in the Appalachian Mountains where this contribution could reach 45% of the total radioactive annual dose. Copyright © 2014 Elsevier Ltd. All rights reserved.

Exhaled Breath Condensate: Technical and Diagnostic Aspects.

Science.gov (United States)

Konstantinidi, Efstathia M; Lappas, Andreas S; Tzortzi, Anna S; Behrakis, Panagiotis K

2015-01-01

The aim of this study was to evaluate the 30-year progress of research on exhaled breath condensate in a disease-based approach. We searched PubMed/Medline, ScienceDirect, and Google Scholar using the following keywords: exhaled breath condensate (EBC), biomarkers, pH, asthma, gastroesophageal reflux (GERD), smoking, COPD, lung cancer, NSCLC, mechanical ventilation, cystic fibrosis, pulmonary arterial hypertension (PAH), idiopathic pulmonary fibrosis, interstitial lung diseases, obstructive sleep apnea (OSA), and drugs. We found 12600 related articles in total in Google Scholar, 1807 in ScienceDirect, and 1081 in PubMed/Medline, published from 1980 to October 2014. 228 original investigation and review articles were eligible. There is rapidly increasing number of innovative articles, covering all the areas of modern respiratory medicine and expanding EBC potential clinical applications to other fields of internal medicine. However, the majority of published papers represent the results of small-scale studies and thus current knowledge must be further evaluated in large cohorts. In regard to the potential clinical use of EBC-analysis, several limitations must be pointed out, including poor reproducibility of biomarkers and absence of large surveys towards determination of reference-normal values. In conclusion, contemporary EBC-analysis is an intriguing achievement, but still in early stage when it comes to its application in clinical practice.

21 CFR 189.220 - Flectol H.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Flectol H. 189.220 Section 189.220 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... Addition to Human Food Through Food-Contact Surfaces § 189.220 Flectol H. (a) Flectol H is the chemical 1,2...

Perfect simulation and moment properties for the Matérn type III process

DEFF Research Database (Denmark)

Møller, Jesper; Huber, Mark L.; Wolpert, Robert L.

2010-01-01

In a seminal work, Bertil Matérn introduced several types of processes for modeling repulsive point processes. In this paper an algorithm is presented for the perfect simulation of the Matérn III process within a bounded window in , fully accounting for edge effects. A simple upper bound on the m......In a seminal work, Bertil Matérn introduced several types of processes for modeling repulsive point processes. In this paper an algorithm is presented for the perfect simulation of the Matérn III process within a bounded window in , fully accounting for edge effects. A simple upper bound...

Evaluation of oxidative stress using exhaled breath 8-isoprostane ...

African Journals Online (AJOL)

Background: There have been limited numbers of studies on patients with chronic kidney disease (CKD) to determine oxidative stress in exhaled breath condensate (EBC). Those two studies have been carried out on hemodialysis patients, and hydrogen peroxide and nitric oxide have been studied in order to show ...

Diet-derived changes by sourdough-fermented rye bread in exhaled breath aspiration ion mobility spectrometry profiles in individuals with mild gastrointestinal symptoms.

Science.gov (United States)

Raninen, Kaisa; Lappi, Jenni; Kolehmainen, Mikko; Kolehmainen, Marjukka; Mykkänen, Hannu; Poutanen, Kaisa; Raatikainen, Olavi

2017-12-01

The potential of utilising exhaled breath volatile organic compound (VOC) profiles in studying diet-derived metabolic changes was examined. After a four-week initial diet period with white wheat bread (WW), seven participants received in randomised order high-fibre diets containing sourdough whole grain rye bread (WGR) or white wheat bread enriched with bioprocessed rye bran (WW + BRB), both for 4 weeks. Alveolar exhaled breath samples were analysed with ChemPro ® 100i analyser (Environics OY, Mikkeli, Finland) at the end of each diet period in fasting state and after a standardised meal. The AIMS signal intensities in fasting state were different after the WGR diet as compared to other diets. The result suggests that WGR has metabolic effects not completely explained by the rye fibre content of the diet. This study encourages to utilise the exhaled breath VOC profile analysis as an early screening tool in studying physiological functionality of foods.

Eksklusion og inklusion af minoritetsdanske børn i dagtilbud

DEFF Research Database (Denmark)

Tireli, Üzeyir

2014-01-01

Med udgangspunkt i minoritetsdanske børn som case, beskæftiger artiklen sig med inklusions- og eksklusionsprocesserne i dagtilbud. Den diskursive konstruktion af "os" og "dem" synes at være en af hovedårsagerne til eksklusion af disse børn. Forfatteren kommer med bud på og ideer til hvordan disse...

Design issues in epidemiologic studies of indoor exposure to Rn and risk of lung cancer

International Nuclear Information System (INIS)

Lubin, J.H.; Samet, J.M.; Weinberg, C.

1990-01-01

Recent data on indoor air quality have indicated that Rn (222Rn) and its decay products are frequently present in domestic environments. Their presence in indoor air raises concerns about an increase in lung cancer risk for the general population. To directly evaluate lung cancer risk from domestic exposure to Rn and its decay products, as well as to evaluate risk assessments derived from studies of Rn-exposed underground miners, several epidemiologic studies of indoor Rn exposure have been initiated or are planned. This paper calculates sample sizes required for a hypothetical case-control study to address several important hypotheses and shows the impact of difficult problems associated with estimating a subject's Rn exposure. We consider the effects of subject mobility, choice of the exposure response trend which is used to characterize an alternative hypothesis, and errors in the estimation of exposure. Imprecise estimation of Rn exposure arises from errors in the measurement device, exposure to Rn decay products from sources outside the home, inability to measure exposures over time in current as well as previous residences, and the unknown relationship between measured concentration and lung dose of alpha energy from the decay of Rn and its progeny. These methodological problems can result in large discrepancies between computed and actual study power. Failure to anticipate these problems in the design of a study can result in inaccurate estimates of power. We conclude that case-control studies of indoor Rn and lung cancer may require substantial numbers of subjects in order to address the many questions of importance that burden current risk assessments with uncertainty. We suggest pooling data from studies with the largest numbers of cases and with the most precise estimates of Rn exposure as the best approach for meeting present research needs

Nurses' impact on quality of care: lessons from RN4CAST

Directory of Open Access Journals (Sweden)

Walter Sermeus

2015-12-01

Full Text Available Introduction: The RN4CAST - study (acronym for Nurse Forecasting in Europe was launched in 2009 and ended in 2011 under the European Union's Seventh Framework Programme. The aim of the RN4CAST-study was to study how features of work environments and qualifications of the nurse workforce impact nurse retention, burnout among nurses and patient outcomes. Methods: The study was conducted in twelve European countries and was conducting a cross-sectional survey in 500 hospitals in which more than 33,000 nurses and more than 11,000 patients were involved. These data were linked to patient outcome data from administrative databases. Results: The study showed that patient outcomes such as patient mortality and patient satisfaction is highly related to nurse staffing characteristics such as patient-to-nurse ratios, nurse qualification and nursing work environment. Also nurse outcomes such as burnout, intention-to-leave, job satisfaction are related to staffing adequacy and nursing work environment. Discussion and conclusion: The RN4CAST study generated a large evidence base of nurse workforce issues across European health systems which is quite unique in terms of the number and qualification of nursing staff, the quality of working environments, burnout rates, job satisfaction rates, intention-to-leave rates that can be used for policy making.

Determination of 222Rn in water samples from wells and springs in Tokyo by a modified integral counting method

International Nuclear Information System (INIS)

Homma, Y.; Murase, Y.; Handa, K.; Murakami, I.

1997-01-01

222 Rn in 2L-water samples was extracted with 30 mL toluene, and 21 mL of the toluene solution was transferred into a liquid scintillation vial, in which PPO - 2,5-diphenyloxazole was placed in advance. The total activity of 222 Rn in the water sample was calculated based on the Ostwald's coefficient of solubilities of 222 Rn in toluene and water at the temperature of the sample water and the volume of water and toluene. About 40% of 222 Rn dissolved in 2L-water sample can be collected. After allowing to stand for 3.5 h, the equilibrium mixture of 222 Rn and its daughters was measured with an Aloka liquid scintillation spectrometer using a modified integral counting method which extrapolates the integral counting curve not to the zero pulse-height, but to the zero detection threshold, an average energy required to produce a measurable pulse, of the liquid scintillation spectrometer. The general method which agitates water sample (usually about 10 mL) with a liquid scintillation cocktail is practical when the activity of 222 Rn is high. By adding 10 mL of water sample, however, it is possible also to add variable amounts of quencher. In some cases water sample is preserved with nitric acid. The slope of the integral counting rate curve increases as quench level of the sample increases. Therefore, it is clear that the modified integral counting method gives more accurate 222 Rn concentrations for water samples of strong quench than the conventional integral counting method. 222 Rn sample of 0.2 Bq/L can be determined within an overall uncertainty of 3.1%

Environmental variables and levels of exhaled carbon monoxide and carboxyhemoglobin in elderly people taking exercise.

Science.gov (United States)

Salicio, Marcos Adriano; Mana, Viviane Aparecida Martins; Fett, Waléria Christiane Rezende; Gomes, Luciano Teixeira; Botelho, Clovis

2016-04-01

This article aims to analyze levels of exhaled carbon monoxide, carboxyhemoglobinand cardiopulmonary variables in old people practicing exercise in external environments, and correlate them with climate and pollution factors. Temporal ecological study with118 active elderly people in the city of Cuiabá, in the state of Mato Grosso, Brazil. Data were obtained on use of medication, smoking, anthropometric measurements, spirometry, peak flow, oxygen saturation, heart rate, exhaled carbon monoxide, carboxyhemoglobin, climate, number of farm fires and pollution. Correlations were found between on the one hand environmental temperature, relative humidity of the air and number of farmers' fires, and on the other hand levels of carbon monoxide exhaled and carboxyhemoglobin (p carboxyhemoglobin and heart rate. There is thus a need for these to be monitored during exercise. The use of a carbon monoxide monitor to evaluate exposure to pollutants is suggested.

Exhaled breath condensate metabolome clusters for endotype discovery in asthma

NARCIS (Netherlands)

Sinha, Anirban; Desiraju, Koundinya; Aggarwal, Kunal; Kutum, Rintu; Roy, Siddhartha; Lodha, Rakesh; Kabra, S. K.; Ghosh, Balaram; Sethi, Tavpritesh; Agrawal, Anurag

2017-01-01

Asthma is a complex, heterogeneous disorder with similar presenting symptoms but with varying underlying pathologies. Exhaled breath condensate (EBC) is a relatively unexplored matrix which reflects the signatures of respiratory epithelium, but is difficult to normalize for dilution. Here we

Estimation of the radon dose in buildings by measuring the exhalation rate from building materials

International Nuclear Information System (INIS)

Steiner, V.; Kovler, K.; Perevalov, A.; Kelm, H.

2004-01-01

We review the accumulator technique using active (CRM) and passive detectors (activated charcoal and electret). We describe the ERS2 detector, an electrostatic radon sampler followed by alpha spectrometry, with improved algorithm and adapted to measure the exhalation rate from walls. The technique produces accurate results over a broad range of materials: concrete, Pumice, ceramics, tiles, granite, etc. The measured exhalation rate is the same, within errors, as measured by the standard detectors

2 CFR 801.220 - What contracts and subcontracts, in addition to those listed in 2 CFR 180.220, are covered...

Science.gov (United States)

2010-01-01

... 2 Grants and Agreements 1 2010-01-01 2010-01-01 false What contracts and subcontracts, in addition to those listed in 2 CFR 180.220, are covered transactions? 801.220 Section 801.220 Grants and... DEBARMENT AND SUSPENSION Covered Transactions § 801.220 What contracts and subcontracts, in addition to...

The analysis of volatile organic compounds in exhaled breath and biomarkers in exhaled breath condensate in children - clinical tools or scientific toys?

Science.gov (United States)

van Mastrigt, E; de Jongste, J C; Pijnenburg, M W

2015-07-01

Current monitoring strategies for respiratory diseases are mainly based on clinical features, lung function and imaging. As airway inflammation is the hallmark of many respiratory diseases in childhood, noninvasive methods to assess the presence and severity of airway inflammation might be helpful in both diagnosing and monitoring paediatric respiratory diseases. At present, the measurement of fractional exhaled nitric oxide is the only noninvasive method available to assess eosinophilic airway inflammation in clinical practice. We aimed to evaluate whether the analysis of volatile organic compounds (VOCs) in exhaled breath (EB) and biomarkers in exhaled breath condensate (EBC) is helpful in diagnosing and monitoring respiratory diseases in children. An extensive literature search was conducted in Medline, Embase and PubMed on the analysis and applications of VOCs in EB and EBC in children. We retrieved 1165 papers, of which nine contained original data on VOCs in EB and 84 on biomarkers in EBC. These were included in this review. We give an overview of the clinical applications in childhood and summarize the methodological issues. Several VOCs in EB and biomarkers in EBC have the potential to distinguish patients from healthy controls and to monitor treatment responses. Lack of standardization of collection methods and analysis techniques hampers the introduction in clinical practice. The measurement of metabolomic profiles may have important advantages over detecting single markers. There is a lack of longitudinal studies and external validation to reveal whether EB and EBC analysis have added value in the diagnostic process and follow-up of children with respiratory diseases. In conclusion, the use of VOCs in EB and biomarkers in EBC as markers of inflammatory airway diseases in children is still a research tool and not validated for clinical use. © 2014 John Wiley & Sons Ltd.

Development Of Protocols For Simultaneous Measurements Of Rn, Tn Using Nuclear Track Detectors And Trial Application In Mining Areas Of Vietnam

International Nuclear Information System (INIS)

Bui Dac Dung; Trinh Van Giap; Le Dinh Cuong; Tran Khanh Minh; Nguyen Huu Quyet; Nguyen Van Khanh; Tran Ngoc Toan

2013-01-01

Radioactive gases Radon (Rn) and Thoron (Tn) contribute of more than 50% of natural radiation dose. However, separate measurements of Rn and Tn have not been paid enough attention. An Intergovernmental Cooperation Project was conducted at the Institute for Nuclear Science and Technology with the help from Hungarian experts. The main tasks of the project were to finalize 02 protocols for simultaneous measurements of Rn and Tn using nuclear track detectors and to test these protocols in investigating the concentrations of Rn and Tn, calculating the natural dose due to Rn and Tn, and evaluating the increased radiation dose and radiation safety due to mining activities. Main results of the project include 02 protocols for simultaneous measurements of Rn and Tn and the test results in the mining areas. Rn and Tn concentrations inside the coal mining tunnels are in the average level of Vietnam and the world. Tn concentration inside the factory for separating Zircon at the Ha Tinh Zircon Processing Plant was found to be very high, up to 2931 Bq/m 3 . Based on annual effective dose calculation, workers inside the factory for separating Zircon at the Ha Tinh Zircon Processing Plant could receive an annual effective dose due to Rn and Tn of 4.890 mSv/year, and the increasing dose of 4.710 mSv/year is for higher than 1 mSv/year recommended by the IAEA. (author)

Characterization of the natural radioactivity of materials used in civil construction or the Curitiba, Parana state, Brazil, metropolitan region

International Nuclear Information System (INIS)

Perna, Allan F.N.; Martins, Patricia; Paschuk, Sergei A.; Correa, Janine N.; Claro, Flavia Del; Rocha, Zildete; Santos, Talita O.

2011-01-01

This paper performs an analysis of the natural radioactivity of construction materials (mainly the 222 Rn) which are present in human environment. The main objective of the study is to characterize different building materials which come from the metropolitan region of the Curitiba related to the exhalation of 222 Rn. The applied methodology analyse the samples of ceramic brick, plaster mortar, and fine lime from the concentration measurements of radon using CR-39 type detectors, and gamma spectrometry analysis

Evaluation of {sup 222}Rn concentration of the internal and external environments of residences at Monte Alegre municipality, Para, Brazil; Avaliacao da concentracao do {sup 222}Rn nos ambientes internos e externos de residencias do municipio de Monte Alegre, PA

Energy Technology Data Exchange (ETDEWEB)

Melo, Vicente de Paula

1999-07-01

The human being is constantly exposed to the natural radioactivity in the environment where he lives. This radioactivity comes mainly from materials present in the terrestrial crust that possess in their constitution chemical elements belonging to the radioactive families of uranium and thorium. The use of such materials for the construction of houses constitutes an important exposure form to the natural radiation, above all to the radioactive gas {sup 222}Rn, that it is exhaled from them. The Brazilian soil is composed, among other, of minerals that contain appreciable concentrations of these elements. The inhabitants of Monte Alegre town in Para, located at 2 deg 00' 24,9 'S ; 54 deg 04 ' 13,5 {sup W}, used in the construction of their houses stones obtained from an area 20 km distant of Monte Alegre, denominated Ingles de Souza, located at 01 deg 56' 4 0,1 S; 54 deg 12 149,7 W, where a small residential village, denominated National Agricultural Colony of Para (CANP), is located. The objective of this work was to evaluate the indoor concentration of {sup 222}Rn in the residences of Monte Alegre and CANP. Determinations of the {sup 238}U and {sup 226}Ra concentrations, measurements of the radon flux in samples of stones and soils of the two regions, as well as measurements to the gamma dose close of the soil and inside the residences, were also carried out. The average results of the radon concentration in the air of the investigated residences did not exceed the limits of 200 Bq. m{sup 3} (action level) and 600 Bq. m{sup 3} (intervention level) recommended by the International Commission on Radiological Protection (ICRP). The concentrations of natural radionuclides and the radon flux determined at the village showed values 17 times higher than those found at the urban area of Monte Alegre, while the average indoor gamma dose rate in the village residences was 0.86 mSv/a. (author)

Evaluation of {sup 222}Rn concentration of the internal and external environments of residences at Monte Alegre municipality, Para, Brazil; Avaliacao da concentracao do {sup 222}Rn nos ambientes internos e externos de residencias do municipio de Monte Alegre, PA

Energy Technology Data Exchange (ETDEWEB)

Melo, Vicente de Paula

1999-07-01

The human being is constantly exposed to the natural radioactivity in the environment where he lives. This radioactivity comes mainly from materials present in the terrestrial crust that possess in their constitution chemical elements belonging to the radioactive families of uranium and thorium. The use of such materials for the construction of houses constitutes an important exposure form to the natural radiation, above all to the radioactive gas {sup 222}Rn, that it is exhaled from them. The Brazilian soil is composed, among other, of minerals that contain appreciable concentrations of these elements. The inhabitants of Monte Alegre town in Para, located at 2 deg 00' 24,9 'S ; 54 deg 04 ' 13,5 {sup W}, used in the construction of their houses stones obtained from an area 20 km distant of Monte Alegre, denominated Ingles de Souza, located at 01 deg 56' 4 0,1 S; 54 deg 12 149,7 W, where a small residential village, denominated National Agricultural Colony of Para (CANP), is located. The objective of this work was to evaluate the indoor concentration of {sup 222}Rn in the residences of Monte Alegre and CANP. Determinations of the {sup 238}U and {sup 226}Ra concentrations, measurements of the radon flux in samples of stones and soils of the two regions, as well as measurements to the gamma dose close of the soil and inside the residences, were also carried out. The average results of the radon concentration in the air of the investigated residences did not exceed the limits of 200 Bq. m{sup 3} (action level) and 600 Bq. m{sup 3} (intervention level) recommended by the International Commission on Radiological Protection (ICRP). The concentrations of natural radionuclides and the radon flux determined at the village showed values 17 times higher than those found at the urban area of Monte Alegre, while the average indoor gamma dose rate in the village residences was 0.86 mSv/a. (author)

Indoor Airflow Patterns, Dispersion of Human Exhalation Flow and Risk of Airborne Cross-infection between People in a Room

DEFF Research Database (Denmark)

Olmedo, Inés

In recent years, an interest in understanding the mechanisms of cross-infection between people in the same room has increased significantly. The SARS (Severe Acute Respiratory Syndrome) outbreak occurred in Asia in 2003 reopened the study of the airborne disease transmission as one of the most...... in the air. These tiny particles or droplet nuclei can follow the air flow pattern in the room and produce high contaminant concentration in different areas of the indoor environment. This fact can provoke a high exposure to exhaled contaminants and a risk of cross-infection to a susceptible person situated...... in the same room. Abundant evidence shows that the air flow distribution systems play a crucial role in the dispersion of these human exhaled contaminants. However, there are many parameters that influence the cross-infection risk between people situated close to each other in a ventilated room, such as...

Indoor Airflow Patterns, Dispersion of Human Exhalation Flow and Risk of Airborne Cross-Infection between People in a Room

DEFF Research Database (Denmark)

Olmedo, Inés

In recent years, an interest in understanding the mechanisms of cross-infection between people in the same room has increased significantly. The SARS (Severe Acute Respiratory Syndrome) outbreak occurred in Asia in 2003 reopened the study of the airborne disease transmission as one of the most...... in the air. These tiny particles or droplet nuclei can follow the air flow pattern in the room and produce high contaminant concentration in different areas of the indoor environment. This fact can provoke a high exposure to exhaled contaminants and a risk of cross-infection to a susceptible person situated...... in the same room. Abundant evidence shows that the air flow distribution systems play a crucial role in the dispersion of these human exhaled contaminants. However, there are many parameters that influence the cross-infection risk between people situated close to each other in a ventilated room, such as...

Investigations into the long-distance atmospheric transport in Central Europe using Rn-222

International Nuclear Information System (INIS)

Volpp, H.J.

1984-01-01

An measuring network was used to determine the atmospheric Rn-222 content in Central Europe (Northern and Southern Germany, Poland). Rn-222 is to serve as tracer for the long-distance atmospheric transport in central Europe. For several areas, an average Rn-222 flux density was found. The radon source 'continent' and the soil as radon source have been taken into account. (DG) [de

Detection system for continuous 222Rn monitoring in waters

International Nuclear Information System (INIS)

Holy, K.; Patschova, E.; Bosa, I.; Polaskova, A.; Hola, O.

2001-01-01

This contribution presents one of the high-sensitive systems of continuous radon monitoring in waters. The device can be used for the continual control of 222 Rn activity concentration in water sources, for a study of the daily and seasonal variations of radon activity concentration in water systems, for the determination of the infiltration time of surface water into the ground water and for the next untraditional applications. (authors)

Measurement of Radon Exhalation Rate in Sand Samples from Gopalpur and Rushikulya Beach Orissa, Eastern India

Science.gov (United States)

Mahur, Ajay Kumar; Sharma, Anil; Sonkawade, R. G.; Sengupta, D.; Sharma, A. C.; Prasad, Rajendra

Natural radioactivity is wide spread in the earth's environment and exists in various geological formations like soils, rocks, water and sand etc. The measurement of activities of naturally occurring radionuclides 226Ra, 232Th and 40K is important for the estimation of radiation risk and has been the subject of interest of research scientists all over the world. Building construction materials and soil beneath the house are the main sources of radon inside the dwellings. Radon exhalation rate from building materials like, cement, sand and concrete etc. is a major source of radiation to the habitants. In the present studies radon exhalation rates in sand samples collected from Gopalpur and Rushikulya beach placer deposit in Orissa are measured by using "Sealed Can technique" with LR-115 type II nuclear track detectors. In Samples from Rushikulya beach show radon activities varying from 389 ± 24 to 997 ± 38 Bq m-3 with an average value of 549 ±28 Bq m-3. Surface exhalation rates in these samples are found to vary from 140 ± 9 to 359 ± 14 mBq m-2 h-1with an average value of 197 ±10 mBq m-2 h-1, whereas, mass exhalation rates vary from 5 ± 0.3 to 14 ± 0.5 mBq kg-1 h-1 with an average value of 8 ± 0.4 mBq kg-1 h-1. Samples from Gopalpur radon activities are found to vary from 371 ± 23 to 800 ± 34 Bq m-3 with an average value of 549 ± 28 Bq m-3. Surface exhalation rates in these samples are found to vary from 133 ± 8 to 288 ± 12 mBq m-2h-1 with an average value of 197 ± 10 mBq m-2 h-1, whereas, mass exhalation rates vary from 5 ± 0.3 to 11 ± 1 mBq kg-1 h-1 with an average value of 8 ± 0.4 mBq kg-1 h-1.

Effects of condensate in the exhalation limb of neonatal circuits on airway pressure during bubble CPAP.

Science.gov (United States)

Youngquist, Tiffany M; Richardson, C Peter; Diblasi, Robert M

2013-11-01

Bubble CPAP is frequently used in spontaneously breathing infants with lung disease. Often bubble CPAP systems lack pressure alarms and pressure-release valves. We observed a large volume of condensate in the exhalation limb of a patient circuit and conducted a series of experiments to test the hypothesis that accumulated condensate could affect delivered pressures. An anatomically accurate nasal airway model of a preterm infant was attached to a spontaneously breathing lung model. A bubble CPAP system was attached to the nasal airway with bi-nasal short prongs, and the rate of fluid condensation was measured. Next, tracheal pressures were monitored digitally to detect changes in airway pressure related to condensate accumulation. Measurements were obtained with volumes of 0, 5, 10, 15, and 20 mL of water in the exhalation limb, at flows of 4, 6, 8, and 10 L/min. Measurements with 20 mL in the exhalation limb were recorded with and without a pressure-relief valve in the circuit. The rate of condensate accumulation was 3.8 mL/h. At volumes of ≥ 10 mL, noticeable alterations in the airway pressure waveforms and significant increases in mean tracheal pressure were observed. The pressure-relief valve effectively attenuated peak tracheal pressure, but only decreased mean pressure by 0.5-1.5 cm H2O. Condensate in the exhalation limb of the patient circuit during bubble CPAP can significantly increase pressure delivered to the patient. The back and forth movement of this fluid causes oscillations in airway pressure that are much greater than the oscillations created by gas bubbling out the exhalation tube into the water bath. We recommend continuously monitoring pressure at the nasal airway interface, placing an adjustable pressure-relief valve in the circuit, set to 5 cm H2O above the desired mean pressure, and emptying fluid from the exhalation limb every 2-3 hours.

The Central and Eastern European Earthquake Research Network - CE3RN

Science.gov (United States)

Bragato, Pier Luigi; Costa, Giovanni; Gallo, Antonella; Gosar, Andrej; Horn, Nikolaus; Lenhardt, Wolfgang; Mucciarelli, Marco; Pesaresi, Damiano; Steiner, Rudolf; Suhadolc, Peter; Tiberi, Lara; Živčić, Mladen; Zoppé, Giuliana

2014-05-01

The region of the Central and Eastern Europe is an area characterised by a relatively high seismicity. The active seismogenic structures and the related potentially destructive events are located in the proximity of the political boundaries between several countries existing in the area. An example is the seismic region between the NE Italy (FVG, Trentino-Alto Adige and Veneto), Austria (Tyrol, Carinthia) and Slovenia. So when a destructive earthquake occurs in the area, all the three countries are involved. In the year 2001 the Agencija Republike Slovenije za Okolje (ARSO) in Slovenia, the Department of Mathematics and Geoscience of the University of Trieste (DMG), the OGS (Istituto Nazionale di Oceanografia e di Geofisica Sperimentale) in Italy and the Zentralanstalt für Meteorologie und Geodynamik (ZAMG) in Austria signed an agreement for the real-time seismological data exchange in the Southeastern Alps region. Soon after the Interreg IIIa Italia-Austria projects "Trans-National Seismological Networks in the South-Eastern Alps" and "FASTLINK" started. The main goal of these projects was the creation of a transfrontier network for the common seismic monitoring of the region for scientific and civil defense purposes. During these years the high quality data recorded by the transfrontier network has been used, by the involved institutions, for their scientific research, for institutional activities and for the civil defense services. Several common international projects have been realized with success. The instrumentation has been continuously upgraded, the installations quality improved as well as the data transmission efficiency. In the 2013 ARSO, DMG, OGS and ZAMG decided to name the cooperative network "Central and Eastern European Earthquake Research Network - CE3RN". The national/regional seismic networks actually involved in the CE3RN network are: • Austrian national BB network (ZAMG - OE) • Friuli Veneto SP network (OGS - FV) • Friuli VG

Exhaled breath analysis discriminates phenotypes of acute lung injury (ALI)

NARCIS (Netherlands)

Bos, L.D.J.; Hemmes, S.N.T.; Nijsen, T.M.E.; Sterk, P.J; Schultz, M.J.

2012-01-01

Introduction It has been postulated that the pathophysiology and clinical presentation of ALI based on pulmonary and non-pulmonary etiology represent different phenotypes1. Until now, little biological evidence on the molecular level has been presented to support this hypothesis. Exhaled air

Recent Experimental Advances to Determine (noble) Gases in Waters

Science.gov (United States)

Kipfer, R.; Brennwald, M. S.; Huxol, S.; Mächler, L.; Maden, C.; Vogel, N.; Tomonaga, Y.

2013-12-01

In aquatic systems noble gases, radon, and bio-geochemically conservative transient trace gases (SF6, CFCs) are frequently applied to determine water residence times and to reconstruct past environmental and climatic conditions. Recent experimental breakthroughs now enable ● to apply the well-established concepts of terrestrial noble gas geochemistry in waters to the minute water amounts stored in sediment pore space and in fluid inclusions (A), ● to determine gas exchange processes on the bio-geochemical relevant time scales of minutes - hours (B), and ● to separate diffusive and advective gas transport in soil air (C). A. Noble-gas analysis in water samples (transport in the pore space and identifying the origin of bio- and geogenic fluids in (un) consolidated sediments [1]. Advanced techniques that combine crushing and sieving speleothem samples in ultra-high-vacuum to a specific grain size allow to separate air and water-bearing fluid inclusions and thus enables noble-gas-based reconstruction of environmental conditions from water masses as small as 1mg [2]. B. The coupling of noble gas analysis with approaches of gas chromatography permits combined analysis of noble gases and other gases species (e.g., SF6, CFCs, O2, N2) from a single water sample. The new method substantially improves ground water dating by SF6 and CFCs as excess air is quantified from the same sample and hence can adequately be corrected for [3]. Portable membrane-inlet mass spectrometers enable the quasi-continuous and real-time analysis of noble gases and other dissolved gases directly in the field, allowing, for instance, quantification of O2 turnover rates on small time scales [4]. C. New technical developments perfect 222Rn analysis in water by the synchronous the determination of the short-lived 220Rn. The combined 220,222Rn analysis sheds light on the emanation behaviour of radon by identifying soil water content to be the crucial control of 220Rn occurrence in the environment

49 CFR 220.3 - Application.

Science.gov (United States)

2010-10-01

... general railroad system of transportation; or (2) Rapid transit operations in an urban area that are not... 49 Transportation 4 2010-10-01 2010-10-01 false Application. 220.3 Section 220.3 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF...

Toward a hydrogen peroxide sensor for exhaled breath analysis

NARCIS (Netherlands)

Wiedemair, Justyna; van Dorp, Henriëtte; Olthuis, Wouter; van den Berg, Albert

2011-01-01

In this contribution a chip-integrated amperometric sensor for the detection of H2O2 in exhaled breath condensate (EBC) is reported. The electrode chip is characterized, and detection of H2O2 in an aqueous phase is shown by means of cyclic voltammetry (CV) and amperometry. Variation of conditions

Tracing submarine groundwater discharge in the NE Gulf of Mexico by 222Rn

International Nuclear Information System (INIS)

Young, J.E.; Burnett, W.C.; Chanton, J.P.; Cable, P.H.; Corbett, D.R.

1993-01-01

Inputs of freshwater and dissolved components to the ocean by submarine groundwater discharge (SGD) have been largely neglected as source functions for biogeochemical budgets. In order to locate and quantify groundwater inputs, a tracing technique has been developed using 222 Rn, a member of the natural 238 U decay-series. Because 222 Rn has a short half-life (t 1/2 = 3.84 days), is an inert gas, is relatively easy to measure at low concentrations, and has concentrations in groundwater several orders of magnitude greater than seawater, it should make an excellent tracer. Excess 222 Rn concentrations far above ''normal'' ocean values were found in the bottom waters of the northeastern Gulf of Mexico, which suggests this region has significant groundwater discharge. After measuring high water column inventories of excess 222 Rn in this region, an advection/diffusion model was applied to evaluate potential benthic sources of radon. The model is designed to account for sediment diffusion of radon and includes a groundwater term for advective flow into the overlying water. Flow rates and concentrations are adjusted in the model to balance the large difference in the measured water column inventories and the inventory predicted by sediment diffusion alone. The vertical diffusive/advective transport determines the shape of the concentration gradient and fluxes at the sediment-water interface are calculate based on these terms. The authors work shows that SGD could account for as much as 95% of the radon inventory in these offshore waters

Exhaled ethane: an in vivo biomarker of lipid peroxidation in interstitial lung diseases.

Science.gov (United States)

Kanoh, Soichiro; Kobayashi, Hideo; Motoyoshi, Kazuo

2005-10-01

Oxidative stress plays a role in the pathogenesis and progression of interstitial lung disease (ILD). Exhaled ethane is a product of lipid peroxidation that has been proposed as a biomarker of oxidative stress in vivo. To determine whether the exhaled ethane level is elevated in patients with ILD and to compare it with other clinical parameters. Breath samples were collected from 34 patients with ILD, including 13 with idiopathic pulmonary fibrosis (IPF), 9 patients with cryptogenic organizing pneumonia, 6 patients with collagen vascular disease-associated interstitial pneumonia, and 6 patients with pulmonary sarcoidosis. Gas samples were obtained at hospital admission and after 3 weeks. After each expired sample was concentrated using a trap-and-purge procedure, the ethane level was analyzed by gas chromatography. Exhaled ethane levels were elevated in ILD patients (n = 34, mean +/- SD, 8.5 +/- 8.0 pmol/dL) compared with healthy volunteers (n = 16, 2.9 +/- 1.0 pmol/dL; p ethane levels were largely consistent with the clinical course. Four patients with IPF who had persistently high ethane levels died or deteriorated, whereas those with ethane levels ethane concentrations were positively correlated with levels of lactate dehydrogenase (Spearman rank correlation coefficient [rs], 0.28, p = 0.026) and C-reactive protein (rs, 0.38, p = 0.025) and were inversely correlated with Pa(O2) (rs, - 0.40, p = 0.0026). Patients showing increased uptake on (67)Ga scintigraphy demonstrated higher ethane levels (n = 19, 7.5 +/- 5.7 pmol/dL) compared with those who did not show increased uptake on scintigraphy (n = 10, 3.0 +/- 2.4 pmol/dL; p ethane is elevated in patients with ILD and is correlated with the clinical outcome, suggesting that it provides useful information about ongoing oxidative stress, and thereby disease activity and severity in ILD.

Discussion on the formula of electrostatic collection radon exhalation rate monitor

International Nuclear Information System (INIS)

Gou Quanlu; Zhang Zhihui

1998-01-01

The formula for calculating radon exhalation rate from the surface of materials are deduced based the theory of radioactivity decay by considering factors which effect the change of radon and its decay products. The selection of value of Z in the formula are also discussed and some problems that exist in the available formula used to calculate the radon exhalation rate are explicated. The practical formula are deduced by adopting the effective decay constant λ e of radon in the collector. The fraction of α particles emitted by radon which effects the measurement results and the contribution of radon decay products left in the former measurement to the next measurement are also considered, and the correction factors are given respectively. The method is more complete and more practical

Multiplication on Rn -A ...

Indian Academy of Sciences (India)

topology can be used to prove the results in the first article. While the discussion ... {O}) x (JRn \\ {O}) ~ JRn \\ {O} with an element e E ]Rn \\ {O} such that m(e, ... in 1966, using sophisticated methods from topology. To state this ... If G is a finite group then G is a ... (Topology on Sn is of course the induced topology from. JRn+1.) ...

Eighty percent by 2020: the present and future of RN-to-BSN education.

Science.gov (United States)

McEwen, Melanie; Pullis, Bridgette R; White, Mary Joe; Krawtz, Susan

2013-10-01

More than 600 RN-to-BSN programs currently exist in the United States, and the numbers of programs and students are growing rapidly. This unprecedented growth is a result of several factors, including the Institute of Medicine's recommendation that 80% of RNs be BSN prepared by 2020. This survey was undertaken to explore key ideas and issues related to RN-to-BSN education to gather information on how RN-to-BSN programs are changing and to uncover concerns posited by program directors. The survey indicated that lack of standardization has resulted in significant variability in expectations and requirements among RN-to-BSN programs. Further, numerous questions need to be answered and concerns addressed to develop strategies to maintain growth, improve access, and remove barriers without sacrificing quality. Findings can be used to ensure that RN-to-BSN education prepares graduates for the future health care system and that the outcome is not just a piece of paper. Copyright 2013, SLACK Incorporated.

38 CFR 52.220 - Transportation.

Science.gov (United States)

2010-07-01

... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Transportation. 52.220... FOR ADULT DAY HEALTH CARE OF VETERANS IN STATE HOMES Standards § 52.220 Transportation. Transportation... management must provide or contract for transportation to enable participants, including persons with...

49 CFR 220.38 - Communication equipment failure.

Science.gov (United States)

2010-10-01

... 49 Transportation 4 2010-10-01 2010-10-01 false Communication equipment failure. 220.38 Section 220.38 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD... § 220.38 Communication equipment failure. (a) Any radio or wireless communication device found not to be...

24 CFR 220.801 - Initial insurance endorsement.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Initial insurance endorsement. 220.801 Section 220.801 Housing and Urban Development Regulations Relating to Housing and Urban... AREAS Contract Rights and Obligations-Projects Insured Project Improvement Loans § 220.801 Initial...

Retrospective look at Rn-induced lung cancer mortality from the viewpoint of a relative risk model

International Nuclear Information System (INIS)

Puskin, J.S.; Yang, Y.

1988-01-01

The potential contribution to U.S. lung cancer deaths from 1930 to 1987 from indoor 222 Rn exposures is investigated from the standpoint of a constant relative risk model. Based on this model, which assumes a Rn risk proportional to the baseline lung cancer risk from other causes, the rate of Rn-induced lung cancer mortality has been increasing sharply since 1930. However, the estimated proportion of lung cancer deaths attributable to Rn has remained fairly constant. Applying the range of coefficients the U.S. Environmental Protection Agency employs in assessing the risk from indoor Rn, it is estimated that 8-25% of all current lung cancer deaths are attributable to past Rn exposures. The major sources of uncertainty in the estimates are discussed

Measurement of Rn-222 concentration in underground water in Osaka stratum group in Sennan area

International Nuclear Information System (INIS)

Fukui, Masami; Katsurayama, Kosuke

1977-01-01

The Rn-222 concentration in underground water is reported as follows, which is the result obtained when the ground inspection was carried out in the Research Reactor Institute of Kyoto University located at Kumatori area in Osaka stratum group. Underground water, at different depth, well water and rain water were taken, and the contained Rn-222 was extracted with toluene to measure by liquid scintillation technique. Rn-222 concentration in rain water was 3.5 - 8.0 pCi/l, while the concentration in well water was 130 - 250 pCi/l, and that in underground water was 240 - 313 pCi/l. The seasonal change, geographical difference and variation according to depth of Rn-222 concentration were examined. Rn-222 behavior in soil should be investigated more in detail in reference to Rn-222 dispersion, transport and equilibrium problems in soil-water system in the future. (Kobatake, H.)

Radon exhalation and its dependence on moisture content from samples of soil and building materials

International Nuclear Information System (INIS)

Faheem, Munazza; Matiullah

2008-01-01

Indoor radon has long been recognized as a potential health hazard for mankind. Building materials are considered as one of the major sources of radon in the indoor environment. To study radon exhalation rate and its dependence on moisture content, samples of soil and some common types of building materials (sand, cement, bricks and marble) were collected from Gujranwala, Gujrat, Hafizabad, Sialkot, Mandibahauddin and Narowal districts of the Punjab province (Pakistan). After processing, samples of 200 g each were placed in plastic vessels. CR-39 based NRPB detector were placed at the top of these vessels and were then hermetically sealed. After exposing to radon for 30 days within the closed vessels, the CR-39 detectors were processed. Radon exhalation rate was found to vary from 122±19 to 681±10mBqm -2 h -1 with an average of 376±147mBqm -2 h -1 in the soil samples whereas an average of 212±34, 195±25, 231±30 and 292±35mBqm -2 h -1 was observed in bricks, sand, cement and marble samples, respectively. Dependence of exhalation on moisture content has also been studied. Radon exhalation rate was found to increase with an increase in moisture, reached its maximum value and then decreased with further increase in the water content

Estimates of the radiation dose from phospho-gypsum plaster-board if used in domestic buildings

International Nuclear Information System (INIS)

O'Brien, R.S.; Peggie, J.R.; Leith, I.S.

1991-02-01

This report presents the results of a study carried out to estimate the annual effective dose equivalent contribution from phospho-gypsum plaster-board if it were used as an internal lining in buildings. The study considered four sources of radiation exposure that would arise in such use, such as inhalation of 222 Rn and its daughters, inhalation of phospho-gypsum dust and exposure to beta and gamma radiation. Measurements of the 22 6Ra content and 222 Rn exhalation rate were made for a number of samples of phospho-gypsum plaster-board, and the behaviour of 222 Rn and its daughters in a typical building was modelled. The results of the study suggest that, for building ventilation rates greater than approximately 0.5 air changes per hour, the contribution to the total annual effective dose equivalent from inhalation of radon ( 222 Rn) and its daughters ( 218 Po, 214 Pb, 214 Po) exhaled from the phospho-gypsum plaster-board should be well below the recommended limit of 1 milli-Sievert for members of the public. The total annual effective dose equivalent from all these sources should be less than 0.6 milli-Sieverts, provided reasonable work practices are observed during installation of the phospho-gypsum plaster-board and the ventilation rate is kept above approximately 0.5 air changes per hour. 31 refs., 12 tabs., 5 figs

49 CFR 220.301 - Purpose and application.

Science.gov (United States)

2010-10-01

... being distracted by the inappropriate use of electronic devices, such as mobile telephones (cell phones... 49 Transportation 4 2010-10-01 2010-10-01 false Purpose and application. 220.301 Section 220.301..., DEPARTMENT OF TRANSPORTATION RAILROAD COMMUNICATIONS Electronic Devices § 220.301 Purpose and application. (a...

20 CFR 220.63 - Conflict of interest.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Conflict of interest. 220.63 Section 220.63 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT DETERMINING DISABILITY Consultative Examinations § 220.63 Conflict of interest. All implications of possible conflict of...

Radioelement (U,Th,Rn) concentrations in Norwegian bedrock groundwaters

International Nuclear Information System (INIS)

Banks, D.; Roeyset, O.; Strand, T.; Skarphagen, H.

1993-12-01

Samples of groundwater from bedrock boreholes in three Norwegian geological provinces have been analysed for content of 222 Rn, U and Th. Median values of 290 Bq/l, 7.6 μg/l and 0.02 μg/l were obtained for Rn, U and Th, respectively, while maximum values were 8500 Bq/l, 170 μg/l and 2.2 μg/l. Commonly suggested drinking water limits range from 8 to 1000 Bq/l for radon and 14 to 160 μg/l for uranium. Radioelement content was closely related to lithology, the lowest concentrations being derived from the largely Caledonian rocks of the Troendelag area, and the highest from the Precambrian Iddefjord Granite of South East Norway where median values of 2500 Bq/l, 15 μg/l and 0.38 μg/l, respectively, were obtained. The Iddefjord Granite is not believed to be unique in Norway yielding high dissolved radionuclide contents in groundwaters, and several other granitic aquifers warrant further investigation in this respect. 63 refs., 13 figs., 8 tabs

Exhaled Breath Condensate: Technical and Diagnostic Aspects

Directory of Open Access Journals (Sweden)

Efstathia M. Konstantinidi

2015-01-01

Full Text Available Purpose. The aim of this study was to evaluate the 30-year progress of research on exhaled breath condensate in a disease-based approach. Methods. We searched PubMed/Medline, ScienceDirect, and Google Scholar using the following keywords: exhaled breath condensate (EBC, biomarkers, pH, asthma, gastroesophageal reflux (GERD, smoking, COPD, lung cancer, NSCLC, mechanical ventilation, cystic fibrosis, pulmonary arterial hypertension (PAH, idiopathic pulmonary fibrosis, interstitial lung diseases, obstructive sleep apnea (OSA, and drugs. Results. We found 12600 related articles in total in Google Scholar, 1807 in ScienceDirect, and 1081 in PubMed/Medline, published from 1980 to October 2014. 228 original investigation and review articles were eligible. Conclusions. There is rapidly increasing number of innovative articles, covering all the areas of modern respiratory medicine and expanding EBC potential clinical applications to other fields of internal medicine. However, the majority of published papers represent the results of small-scale studies and thus current knowledge must be further evaluated in large cohorts. In regard to the potential clinical use of EBC-analysis, several limitations must be pointed out, including poor reproducibility of biomarkers and absence of large surveys towards determination of reference-normal values. In conclusion, contemporary EBC-analysis is an intriguing achievement, but still in early stage when it comes to its application in clinical practice.

Assessing urban air quality and its relation with radon (222Rn)

International Nuclear Information System (INIS)

Zoran, Maria; Savastru, Dan; Dida, Adrian

2016-01-01

This paper focuses on the assessment of air quality and its relation with radon ( 222 Rn) for Bucharest metropolitan area in Romania. Specifically, daily mean concentrations of particle matter (PM2.5, PM10), ozone (O 3 ), nitrogen dioxide (NO 2 ), sulphur dioxide (SO 2 ) and global air quality indices have been analyzed in relation with radon ( 222 Rn) concentrations measured in the air near the ground with AlphaGUARD Radon Monitoring System and CR-39 SSNTDs during 2012 year. Such new information is required by atmospheric sciences to prove suitability of 222 Rn as a tracer for atmospheric dynamics analysis as well as by epidemiological and radiological protection studies. (author)

Indsats for forældre til børn med ADHD

DEFF Research Database (Denmark)

Neubert, Katja

2012-01-01

Et nyt review, udarbejdet af forskergruppen omkring Morris Zwi, undersøger om interventionsprogrammer til forældre til børn med ADHD er effektive, når det gælder reducering af børnenes ADHD-relaterede adfærd og associerede problemer som eksempelvis indlæringsproblemer. Reviewet peger på, at en...... indsats til forældre til børn med ADHD kan have en gavnlig effekt på børnenes adfærd. Interventionen kan også være med til at sænke stressniveauet hos forældre til disse børn, og forbedre forældrenes selvtillid....

Optimizing measurement sensitivity to facilitate monitoring environmental levels of Rn-daughter concentrations

International Nuclear Information System (INIS)

Keefe, D.J.; McDowell, W.P.; Groer, P.G.; Witek, R.T.

1977-01-01

In the measurement of environmental levels of radioactivity, the primary problem is the accumulation of a statistically meaningful number of counts within a reasonable period of time. In the case of measurements of airborne 222 Rn-daughter concentrations, the problem is further complicated by the particularly short half-life, 3.05 minutes, of RaA (Po 218 ). Since the Rn-daughters, (RaA, RaB [Pb 214 ] and RaC [Bi 214 ]) are of interest, the equations interrelating these Rn-daughter concentrations were derived from the laws of radioactive-series decay. These equations, although straightforward, are cumbersome to solve. To facilitate the efficient use of these equations, a computer program has been written which permits the calculation of Rn-daughter concentrations or expected counts for a given set of measurement parameters (flow rate and detector efficiencies). A subroutine then calculates the optimum pumping and counting times required to provide the number of counts necessary for acceptable statistics at environmental levels of 222 Rn-daughter concentrations. This subroutine contains a set of parameters, flow rate and efficiencies, that are fixed using realistic restrictions. The use of these optimized pumping and counting times results in maximum measurement sensitivity under realistic constraints

RN students need to tell their stories.

Science.gov (United States)

Blecke, J; Flatt, M M

1993-04-01

Finally, what is it about RN students' experiences in the transition process in nursing education that makes their stories need to be told? Actually this question is asked from both the side of the RN students who are the learners and need to tell the stories, and the side of the educator/advisor who needs to have the stories told. In short, the answer to both is that these stories reveal very graphically and meaningfully what is happening in the learning and professional development processes and, simultaneously, they facilitate the progression of those processes. The RN students seem to have an innate sense about what telling their stories will do for them in relation to their learning and professional development processes. They require very little encouragement to prompt their story telling. For the educators/advisors, no other strategy is as adaptable and achieves as much in relation to facilitating the learning and development processes. For both parties, the graphic revelations in stories paint a picture of how past, present, and future blend together to form a meaningful, coherent view of a position in the world. According to Antonovsky's (1979) work on stress and coping, such a view is necessary if stress is to be resisted and health maintained.(ABSTRACT TRUNCATED AT 400 WORDS)

7 CFR 3052.220 - Frequency of audits.

Science.gov (United States)

2010-01-01

... 7 Agriculture 15 2010-01-01 2010-01-01 false Frequency of audits. 3052.220 Section 3052.220 Agriculture Regulations of the Department of Agriculture (Continued) OFFICE OF THE CHIEF FINANCIAL OFFICER, DEPARTMENT OF AGRICULTURE AUDITS OF STATES, LOCAL GOVERNMENTS, AND NON-PROFIT ORGANIZATIONS Audits § 3052.220...

12 CFR 19.220 - Scope.

Science.gov (United States)

2010-01-01

... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Scope. 19.220 Section 19.220 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY RULES OF PRACTICE AND PROCEDURE Procedures for... the OCC pursuant to section 38 of the Federal Deposit Insurance Act and this part. ...

20 CFR 220.35 - Introduction.

Science.gov (United States)