Merlin: Computer-Aided Oligonucleotide Design for Large Scale Genome Engineering with MAGE.

Science.gov (United States)

Quintin, Michael; Ma, Natalie J; Ahmed, Samir; Bhatia, Swapnil; Lewis, Aaron; Isaacs, Farren J; Densmore, Douglas

2016-06-17

Genome engineering technologies now enable precise manipulation of organism genotype, but can be limited in scalability by their design requirements. Here we describe Merlin ( http://merlincad.org ), an open-source web-based tool to assist biologists in designing experiments using multiplex automated genome engineering (MAGE). Merlin provides methods to generate pools of single-stranded DNA oligonucleotides (oligos) for MAGE experiments by performing free energy calculation and BLAST scoring on a sliding window spanning the targeted site. These oligos are designed not only to improve recombination efficiency, but also to minimize off-target interactions. The application further assists experiment planning by reporting predicted allelic replacement rates after multiple MAGE cycles, and enables rapid result validation by generating primer sequences for multiplexed allele-specific colony PCR. Here we describe the Merlin oligo and primer design procedures and validate their functionality compared to OptMAGE by eliminating seven AvrII restriction sites from the Escherichia coli genome.

Bayesian models: A statistical primer for ecologists

Science.gov (United States)

Hobbs, N. Thompson; Hooten, Mevin B.

2015-01-01

Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

Inhibition of non-templated nucleotide addition by DNA polymerases in primer extension using twisted intercalating nucleic acid modified templates

Czech Academy of Sciences Publication Activity Database

Güixens-Gallardo, Pedro; Hocek, Michal; Perlíková, Pavla

2016-01-01

Roč. 26, č. 2 (2016), s. 288-291 ISSN 0960-894X R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : DNA polymerases * nucleotide addition * primer extension * oligonucleotides * twisted intercalating nucleic acid Subject RIV: CC - Organic Chemistry Impact factor: 2.454, year: 2016

The Medicinal Chemistry of Therapeutic Oligonucleotides.

Science.gov (United States)

Wan, W Brad; Seth, Punit P

2016-11-10

Oligonucleotide-based therapeutics have made rapid progress in the clinic for treatment of a variety of disease indications. Unmodified oligonucleotides are polyanionic macromolecules with poor drug-like properties. Over the past two decades, medicinal chemists have identified a number of chemical modification and conjugation strategies which can improve the nuclease stability, RNA-binding affinity, and pharmacokinetic properties of oligonucleotides for therapeutic applications. In this perspective, we present a summary of the most commonly used nucleobase, sugar and backbone modification, and conjugation strategies used in oligonucleotide medicinal chemistry.

Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

Directory of Open Access Journals (Sweden)

Wang Zhen

2011-11-01

Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

Template-Directed Ligation of Peptides to Oligonucleotides

Science.gov (United States)

Bruick, Richard K.; Dawson, Philip E.; Kent, Stephen BH; Usman, Nassim; Joyce, Gerald F.

1996-01-01

Synthetic oligonucleotides and peptides have enjoyed a wide range of applications in both biology and chemistry. As a consequence, oligonucleotide-peptide conjugates have received considerable attention, most notably in the development of antisense constructs with improved pharmacological properties. In addition, oligonucleotide-peptide conjugates have been used as molecular tags, in the assembly of supramolecular arrays and in the construction of encoded combinatorial libraries. To make these chimeric molecules more accessible for a broad range of investigations, we sought to develop a facile method for joining fully deprotected oligonucleotides and peptides through a stable amide bond linkage. Furthermore, we wished to make this ligation reaction addressable, enabling one to direct the ligation of specific oligonucleotide and peptide components.To confer specificity and accelerate the rate of the reaction, the ligation process was designed to be dependent on the presence of a complementary oligonucleotide template.

MethPrimer: designing primers for methylation PCRs.

Science.gov (United States)

Li, Long-Cheng; Dahiya, Rajvir

2002-11-01

DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides.

Science.gov (United States)

Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M; Högberg, Björn

2013-07-01

Single-stranded oligonucleotides are important as research tools, as diagnostic probes, in gene therapy and in DNA nanotechnology. Oligonucleotides are typically produced via solid-phase synthesis, using polymer chemistries that are limited relative to what biological systems produce. The number of errors in synthetic DNA increases with oligonucleotide length, and the resulting diversity of sequences can be a problem. Here we present the 'monoclonal stoichiometric' (MOSIC) method for enzyme-mediated production of DNA oligonucleotides. We amplified oligonucleotides from clonal templates derived from single bacterial colonies and then digested cutter hairpins in the products, which released pools of oligonucleotides with precisely controlled relative stoichiometric ratios. We prepared 14-378-nucleotide MOSIC oligonucleotides either by in vitro rolling-circle amplification or by amplification of phagemid DNA in Escherichia coli. Analyses of the formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides.

Electronic Structures of LNA Phosphorothioate Oligonucleotides

DEFF Research Database (Denmark)

Bohr, Henrik G.; Shim, Irene; Stein, Cy

2017-01-01

Important oligonucleotides in anti-sense research have been investigated in silico and experimentally. This involves quantum mechanical (QM) calculations and chromatography experiments on locked nucleic acid (LNA) phosphorothioate (PS) oligonucleotides. iso-potential electrostatic surfaces...

Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides

Science.gov (United States)

Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M.; Högberg, Björn

2013-01-01

Single-stranded oligonucleotides are important as research tools as probes for diagnostics and gene therapy. Today, production of oligonucleotides is done via solid-phase synthesis. However, the capabilities of current polymer chemistry are limited in comparison to what can be produced in biological systems. The errors in synthetic DNA increases with oligonucleotide length, and sequence diversity can often be a problem. Here, we present the Monoclonal Stoichiometric (MOSIC) method for enzymatic DNA oligonucleotide production. Using this method, we amplify oligonucleotides from clonal templates followed by digestion of a cutter-hairpin, resulting in pools of monoclonal oligonucleotides with precisely controlled relative stoichiometric ratios. We present data where MOSIC oligonucleotides, 14–378 nt long, were prepared either by in vitro rolling-circle amplification, or by amplification in Escherichia coli in the form of phagemid DNA. The formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides. PMID:23727986

Photochemical immobilization of anthraquinone conjugated oligonucleotides and PCR amplicons on solid surfaces

DEFF Research Database (Denmark)

Koch, T.; Jacobsen, N.; Fensholdt, J.

2000-01-01

Ligand immobilization on solid surfaces is an essential step in fields such as diagnostics, bio sensor manufacturing, and new material sciences in general. In this paper a photochemical approach based on anthraquinone as the chromophore is presented. Photochemical procedures offer special...... advantages as they are able to generate highly reactive species in an orientation specific manner. As presented here, anthraquinone (AQ) mediated covalent DNA immobilization appears to be superior to currently known procedures. A synthetic procedure providing AQ-phosphoramidites is presented. These reagents...... facilitate AQ conjugation during routine DNA synthesis, thus enabling the AQ-oligonucleotides to be immobilized in a very convenient and efficient manner. AQ-conjugated PCR primers can be used directly in PCR. When the PCR is performed in solution, the amplicons can be immobilized after the PCR. Moreover...

Radio-marking and in vivo imagery of oligonucleotides

International Nuclear Information System (INIS)

Kuehnast, Bertrand

2000-01-01

This research thesis is part of activities aimed at the development of new molecules like oligonucleotides. Its first objective was the development and validation of a marking method with fluorine-18 of oligonucleotides for their in-vivo pharmacological assessment with positron emission tomography (PET). Further investigations addressed the use of iodine-125 for oligonucleotide marking purpose. This radio-marking, and in vivo and ex vivo imagery techniques are described, and their potential is highlighted for the pharmacological assessment of different oligonucleotides

Technical aspects of typing for HLA-DP alleles using allele-specific DNA in vitro amplification and sequence-specific oligonucleotide probes. Detection of single base mismatches

DEFF Research Database (Denmark)

Fugger, L; Morling, N; Ryder, L P

1990-01-01

The polymerase chain reaction (PCR) is an effective method for in vitro DNA amplification which combined with probing with synthetic oligonucleotides can be used for, e.g., HLA-typing. We have studied the technical aspects of HLA-DP typing with the technique. DNA from mononuclear nucleated cells...... was extracted with either a simple salting out method or phenol/chloroform. Both DNAs could be readily used for PCR. The MgC2 concentration of the PCR buffer and the annealing temperature of the thermal cycle of the PCR were the two most important variables. The MgCl2 concentration and the temperature must...... be carefully titrated for each primer pair in the PCR. The influence of mismatches between the primer and the DNA template were studied and we found that, by using primers differing only from each other at the 3' end, cross-amplification of closely homologous alleles could be avoided. Thus, single base...

Peptide-LNA oligonucleotide conjugates

DEFF Research Database (Denmark)

Astakhova, I Kira; Hansen, Lykke Haastrup; Vester, Birte

2013-01-01

properties, peptides were introduced into oligonucleotides via a 2'-alkyne-2'-amino-LNA scaffold. Derivatives of methionine- and leucine-enkephalins were chosen as model peptides of mixed amino acid content, which were singly and doubly incorporated into LNA/DNA strands using highly efficient copper......(i)-catalyzed azide-alkyne cycloaddition (CuAAC) "click" chemistry. DNA/RNA target binding affinity and selectivity of the resulting POCs were improved in comparison to LNA/DNA mixmers and unmodified DNA controls. This clearly demonstrates that internal attachment of peptides to oligonucleotides can significantly...

Oligonucleotide-based theranostic nanoparticles in cancer therapy

Science.gov (United States)

Shahbazi, Reza; Ozpolat, Bulent; Ulubayram, Kezban

2016-01-01

Theranostic approaches, combining the functionality of both therapy and imaging, have shown potential in cancer nanomedicine. Oligonucleotides such as small interfering RNA and microRNA, which are powerful therapeutic agents, have been effectively employed in theranostic systems against various cancers. Nanoparticles are used to deliver oligonucleotides into tumors by passive or active targeting while protecting the oligonucleotides from nucleases in the extracellular environment. The use of quantum dots, iron oxide nanoparticles and gold nanoparticles and tagging with contrast agents, like fluorescent dyes, optical or magnetic agents and various radioisotopes, has facilitated early detection of tumors and evaluation of therapeutic efficacy. In this article, we review the advantages of theranostic applications in cancer therapy and imaging, with special attention to oligonucleotide-based therapeutics. PMID:27102380

Hierarchically assembled DNA origami tubules with reconfigurable chirality

International Nuclear Information System (INIS)

Chen, Haorong; Cha, Tae-Gon; Pan, Jing; Choi, Jong Hyun

2013-01-01

The dynamic reconfiguration of a hierarchically assembled tubular structure is demonstrated using the DNA origami technique. Short cylindrical DNA origami monomers are synthesized and linked into elongated tubules, which can then be disassembled via toehold-mediated strand displacement. The disassembled subunits are subsequently linked into tubules of a different chirality. The reconfiguration is performed with the subunits carrying dumbbell hairpin DNA oligonucleotides or gold nanoparticles (AuNPs). The reconfiguration of higher order origami structures presented here is useful for constructing dynamic nanostructures that exceed the size limit of single DNA origami and may facilitate the study of molecular or particle interactions by tuning their relative distance and organization. (paper)

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

Energy Technology Data Exchange (ETDEWEB)

Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

2013-06-28

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

International Nuclear Information System (INIS)

Jothikumar, N.; Hill, Vincent R.

2013-01-01

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

Regulation of Gene Expression with Double-Stranded Phosphorothioate Oligonucleotides

Science.gov (United States)

Bielinska, Anna; Shivdasani, Ramesh A.; Zhang, Liquan; Nabel, Gary J.

1990-11-01

Alteration of gene transcription by inhibition of specific transcriptional regulatory proteins is necessary for determining how these factors participate in cellular differentiation. The functions of these proteins can be antagonized by several methods, each with specific limitations. Inhibition of sequence-specific DNA-binding proteins was achieved with double-stranded (ds) phosphorothioate oligonucleotides that contained octamer or kappaB consensus sequences. The phosphorothioate oligonucleotides specifically bound either octamer transcription factor or nuclear factor (NF)-kappaB. The modified oligonucleotides accumulated in cells more effectively than standard ds oligonucleotides and modulated gene expression in a specific manner. Octamer-dependent activation of a reporter plasmid or NF-kappaB-dependent activation of the human immunodeficiency virus (HIV) enhancer was inhibited when the appropriate phosphorothioate oligonucleotide was added to a transiently transfected B cell line. Addition of phosphorothioate oligonucleotides that contained the octamer consensus to Jurkat T leukemia cells inhibited interleukin-2 (IL-2) secretion to a degree similar to that observed with a mutated octamer site in the IL-2 enhancer. The ds phosphorothioate oligonucleotides probably compete for binding of specific transcription factors and may provide anti-viral, immunosuppressive, or other therapeutic effects.

Electronic Structures of LNA Phosphorothioate Oligonucleotides

Directory of Open Access Journals (Sweden)

Henrik G. Bohr

2017-09-01

Full Text Available Important oligonucleotides in anti-sense research have been investigated in silico and experimentally. This involves quantum mechanical (QM calculations and chromatography experiments on locked nucleic acid (LNA phosphorothioate (PS oligonucleotides. iso-potential electrostatic surfaces are essential in this study and have been calculated from the wave functions derived from the QM calculations that provide binding information and other properties of these molecules. The QM calculations give details of the electronic structures in terms of e.g., energy and bonding, which make them distinguish or differentiate between the individual PS diastereoisomers determined by the position of sulfur atoms. Rules are derived from the electronic calculations of these molecules and include the effects of the phosphorothioate chirality and formation of electrostatic potential surfaces. Physical and electrochemical descriptors of the PS oligonucleotides are compared to the experiments in which chiral states on these molecules can be distinguished. The calculations demonstrate that electronic structure, electrostatic potential, and topology are highly sensitive to single PS configuration changes and can give a lead to understanding the activity of the molecules. Keywords: LNA phosphorothioate, DNA/LNA oligonucleotide, diastereoisomers, Hartree-Fock calculations, iso-potential surface, anion chromatograms

Detection and genotyping of Entamoeba histolytica, Entamoeba dispar, Giardia lamblia, and Cryptosporidium parvum by oligonucleotide microarray.

Science.gov (United States)

Wang, Zheng; Vora, Gary J; Stenger, David A

2004-07-01

Entamoeba histolytica, Giardia lamblia, and Cryptosporidium parvum are the most frequently identified protozoan parasites causing waterborne disease outbreaks. The morbidity and mortality associated with these intestinal parasitic infections warrant the development of rapid and accurate detection and genotyping methods to aid public health efforts aimed at preventing and controlling outbreaks. In this study, we describe the development of an oligonucleotide microarray capable of detecting and discriminating between E. histolytica, Entamoeba dispar, G. lamblia assemblages A and B, and C. parvum types 1 and 2 in a single assay. Unique hybridization patterns for each selected protozoan were generated by amplifying six to eight diagnostic sequences/organism by multiplex PCR; fluorescent labeling of the amplicons via primer extension; and subsequent hybridization to a set of genus-, species-, and subtype-specific covalently immobilized oligonucleotide probes. The profile-based specificity of this methodology not only permitted for the unequivocal identification of the six targeted species and subtypes, but also demonstrated its potential in identifying related species such as Cryptosporidium meleagridis and Cryptosporidium muris. In addition, sensitivity assays demonstrated lower detection limits of five trophozoites of G. lamblia. Taken together, the specificity and sensitivity of the microarray-based approach suggest that this methodology may provide a promising tool to detect and genotype protozoa from clinical and environmental samples.

Sequence-dependent theory of oligonucleotide hybridization kinetics

International Nuclear Information System (INIS)

Marimuthu, Karthikeyan; Chakrabarti, Raj

2014-01-01

A theoretical approach to the prediction of the sequence and temperature-dependent rate constants for oligonucleotide hybridization reactions has been developed based on the theory of relaxation kinetics. One-sided and two-sided melting reaction mechanisms for oligonucleotide hybridization reactions have been considered, analyzed, modified, and compared to select a physically consistent as well as robust model for prediction of the relaxation times of DNA hybridization reactions that agrees with the experimental evidence. The temperature- and sequence-dependent parameters of the proposed model have been estimated using available experimental data. The relaxation time model that we developed has been combined with the nearest neighbor model of hybridization thermodynamics to estimate the temperature- and sequence-dependent rate constants of an oligonucleotide hybridization reaction. The model-predicted rate constants are compared to experimentally determined rate constants for the same oligonucleotide hybridization reactions. Finally, we consider a few important applications of kinetically controlled DNA hybridization reactions

Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides.

Directory of Open Access Journals (Sweden)

Takao Ito

Full Text Available Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.

indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

Science.gov (United States)

Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

2017-01-01

Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

Silver and Cyanine Staining of Oligonucleotides in Polyacrylamide Gel.

Science.gov (United States)

Tang, Weizhong; Zhou, Huafu; Li, Wei

2015-01-01

To explore why some oligonucleotides in denaturing polyacrylamide gel could not be silver-stained, 134 different oligonucleotides were analyzed using denaturing polyacrylamide gel electrophoresis stained with silver and asymmetric cyanine. As a result, we found that the sensitivity of oligos (dA), (dC), (dG) and (dT) to silver staining could be ranged as (dA) > (dG) > (dC) > (dT) from high to low. It was unexpected that oligo (dT) was hard to be silver-stained. Moreover, the silver staining of an oligonucleotide containing base T could be partially or completely inhibited by base T. The inhibition of silver staining by base T was a competitive inhibition which could be affected by the amounts of the argyrophil nucleobase and base T, the cis-distance between the argyrophil nucleobase and base T, and the gel concentration. The changes of the intensity of an oligonucleotide band caused by the changes of DNA base composition were diverse and interesting. The intensity of some oligonucleotide bands would significantly change when the changes of DNA base composition accumulated to a certain extent (usually ≥ 4 nt). The sensitivity of cyanine staining of ≤ 11-nt long oligonucleotides could be enhanced about 250-fold by fixing the gels with methanol fixing solution.

Primer3_masker: integrating masking of template sequence with primer design software.

Science.gov (United States)

Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

2018-06-01

Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

A comparative analysis of measles virus RNA by oligonucleotide fingerprinting

International Nuclear Information System (INIS)

Stephenson, J.R.; Meulen, V. ter

1982-01-01

Isolates from two cases of acute measles, one case of acute measles encephalitis and three patients with subacute sclerosing panencephalitis were compared. This comparison was based upon the electrophoretic analysis of T 1 oligonucleotides from single-stranded, full-length RNA isolated from cytoplasmic nucleocapsids. Although all viruses have oligonucleotides in common, each isolate generated a unique pattern of oligonucleotides. However, no group of oligonucleotides was observed which would allow differentiation between viruses isolated from acute infections and those isolated from CNS diseases; indicating that probably all measles viruses differ in their nucleotide sequence, regardless of origin. (Author)

Amplification of marine methanotrophic enrichment DNA with 16S rDNA PCR primers for type II alpha proteobacteria methanotrophs.

Science.gov (United States)

Rockne, Karl J; Strand, Stuart E

2003-09-01

Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.

Oligonucleotide Therapy for Obstructive and Restrictive Respiratory Diseases

Directory of Open Access Journals (Sweden)

Wupeng Liao

2017-01-01

Full Text Available Inhaled oligonucleotide is an emerging therapeutic modality for various common respiratory diseases, including obstructive airway diseases like asthma and chronic obstructive pulmonary disease (COPD and restrictive airway diseases like idiopathic pulmonary fibrosis (IPF. The advantage of direct accessibility for oligonucleotide molecules to the lung target sites, bypassing systemic administration, makes this therapeutic approach promising with minimized potential systemic side effects. Asthma, COPD, and IPF are common chronic respiratory diseases, characterized by persistent airway inflammation and dysregulated tissue repair and remodeling, although each individual disease has its unique etiology. Corticosteroids have been widely prescribed for the treatment of asthma, COPD, and IPF. However, the effectiveness of corticosteroids as an anti-inflammatory drug is limited by steroid resistance in severe asthma, the majority of COPD cases, and pulmonary fibrosis. There is an urgent medical need to develop target-specific drugs for the treatment of these respiratory conditions. Oligonucleotide therapies, including antisense oligonucleotide (ASO, small interfering RNA (siRNA, and microRNA (miRNA are now being evaluated both pre-clinically and clinically as potential therapeutics. The mechanisms of action of ASO and siRNA are highly target mRNA specific, ultimately leading to target protein knockdown. miRNA has both biomarker and therapeutic values, and its knockdown by a miRNA antagonist (antagomir has a broader but potentially more non-specific biological outcome. This review will compile the current findings of oligonucleotide therapeutic targets, verified in various respiratory disease models and in clinical trials, and evaluate different chemical modification approaches to improve the stability and potency of oligonucleotides for the treatment of respiratory diseases.

Therapeutic Oligonucleotides Targeting Liver Disease: TTR Amyloidosis

Directory of Open Access Journals (Sweden)

Christoph Niemietz

2015-09-01

Full Text Available The liver has become an increasingly interesting target for oligonucleotide therapy. Mutations of the gene encoding transthyretin (TTR, expressed in vast amounts by the liver, result in a complex degenerative disease, termed familial amyloid polyneuropathy (FAP. Misfolded variants of TTR are linked to the establishment of extracellular protein deposition in various tissues, including the heart and the peripheral nervous system. Recent progress in the chemistry and formulation of antisense (ASO and small interfering RNA (siRNA designed for a knockdown of TTR mRNA in the liver has allowed to address the issue of gene-specific molecular therapy in a clinical setting of FAP. The two therapeutic oligonucleotides bind to RNA in a sequence specific manner but exploit different mechanisms. Here we describe major developments that have led to the advent of therapeutic oligonucleotides for treatment of TTR-related disease.

UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

Directory of Open Access Journals (Sweden)

Nomin Batnyam

2012-01-01

Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

Modern methods for the synthesis of peptide-oligonucleotide conjugates

International Nuclear Information System (INIS)

Zubin, Evgenii M; Oretskaya, Tat'yana S; Romanova, Elena A

2002-01-01

The published data on the methods of chemical solution and solid-phase synthesis of peptide-oligonucleotide conjugates are reviewed. The known methods are systematised and their advantages and disadvantages are considered. The approaches to the solution synthesis of peptide-oligonucleotide conjugates are systematised according to the type of chemical bonds between the fragments, whereas those to the solid-phase synthesis are classified according to the procedure used for the preparation of conjugates, viz., stepwise elongation of oligonucleotide and peptide chains on the same polymeric support or solid-phase condensation of two presynthesised fragments. The bibliography includes 141 references.

Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

Science.gov (United States)

Yofe, Ido; Schuldiner, Maya

2014-02-01

The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

Fluorescent quenching-based quantitative detection of specific DNA/RNA using a BODIPY® FL-labeled probe or primer

Science.gov (United States)

Kurata, Shinya; Kanagawa, Takahiro; Yamada, Kazutaka; Torimura, Masaki; Yokomaku, Toyokazu; Kamagata, Yoichi; Kurane, Ryuichiro

2001-01-01

We have developed a simple method for the quantitative detection of specific DNA or RNA molecules based on the finding that BODIPY® FL fluorescence was quenched by its interaction with a uniquely positioned guanine. This approach makes use of an oligonucleotide probe or primer containing a BODIPY® FL-modified cytosine at its 5′-end. When such a probe was hybridized with a target DNA, its fluorescence was quenched by the guanine in the target, complementary to the modified cytosine, and the quench rate was proportional to the amount of target DNA. This widely applicable technique will be used directly with larger samples or in conjunction with the polymerase chain reaction to quantify small DNA samples. PMID:11239011

Optical Characterization of Oligonucleotide DNA Influenced by Magnetic Fields

Directory of Open Access Journals (Sweden)

Seyedeh Maryam Banihashemian

2013-09-01

Full Text Available UV-VIS spectroscopic analysis of oligonucleotide DNA exposed to different magnetic fields was performed in order to investigate the relationship between DNA extinction coefficients and optical parameters according to magnetic-field strength. The results with the oligonucleotides adenine-thymine 100 mer (AT-100 DNA and cytosine-guanine 100 mer (CG-100 DNA indicate that the magnetic field influences DNA molar extinction coefficients and refractive indexes. The imaginary parts of the refractive index and molar extinction coefficients of the AT-100 and CG-100 DNA decreased after exposure to a magnetic field of 750 mT due to cleavage of the DNA oligonucleotides into smaller segments.

Fully automated parallel oligonucleotide synthesizer

Czech Academy of Sciences Publication Activity Database

Lebl, M.; Burger, Ch.; Ellman, B.; Heiner, D.; Ibrahim, G.; Jones, A.; Nibbe, M.; Thompson, J.; Mudra, Petr; Pokorný, Vít; Poncar, Pavel; Ženíšek, Karel

2001-01-01

Roč. 66, č. 8 (2001), s. 1299-1314 ISSN 0010-0765 Institutional research plan: CEZ:AV0Z4055905 Keywords : automated oligonucleotide synthesizer Subject RIV: CC - Organic Chemistry Impact factor: 0.778, year: 2001

Synthesis of 3'-, or 5'-, or internal methacrylamido-modified oligonucleotides

Science.gov (United States)

Golova, Julia B.; Chernov, Boris K.

2010-04-27

New modifiers were synthesized for incorporation of a methacrylic function in 3'-, 5'- and internal positions of oligonucleotides during solid phase synthesis. A modifier was used for synthesis of 5'-methacrylated oligonucleotides for preparation of microarrays by a co-polymerization method.

Effects of Atelocollagen Formulation Containing Oligonucleotide on Endothelial Permeability

Directory of Open Access Journals (Sweden)

Koji Hanai

2012-01-01

Full Text Available Atelocollagen is a major animal protein that is used as a highly biocompatible biomaterial. To date, atelocollagen has been used as an effective drug delivery technology to sustain the release of antitumor proteins and to enhance the antitumor activity of oligonucleotides in in vivo models. However, the biological effects of this technology are not fully understood. In the present study, we investigated the effects of atelocollagen on endothelial paracellular barrier function. An atelocollagen formulation containing oligonucleotides specifically increased the permeability of two types of endothelial cells, and the change was dependent on the molecular size, structure of the oligonucleotides used and the concentrations of the oligonucleotide and atelocollagen in the formulation. An immunohistochemical examination revealed that the formulation had effects on the cellular skeleton and intercellular structure although it did not affect the expression of adherens junction or tight junction proteins. These changes were induced through p38 MAP kinase signaling. It is important to elucidate the biological functions of atelocollagen in order to be able to exploit its drug delivery properties.

Degradation product characterization of therapeutic oligonucleotides using liquid chromatography mass spectrometry.

Science.gov (United States)

Elzahar, N M; Magdy, N; El-Kosasy, Amira M; Bartlett, Michael G

2018-05-01

Synthetic antisense phosphorothioate oligonucleotides (PS) have undergone rapid development as novel therapeutic agents. The increasing significance of this class of drugs requires significant investment in the development of quality control methods. The determination of the many degradation pathways of such complex molecules presents a significant challenge. However, an understanding of the potential impurities that may arise is necessary to continue to advance these powerful new therapeutics. In this study, four different antisense oligonucleotides representing several generations of oligonucleotide therapeutic agents were evaluated under various stress conditions (pH, thermal, and oxidative stress) using ion-pairing reversed-phase liquid chromatography tandem mass spectrometry (IP-RPLC-MS/MS) to provide in-depth characterization and identification of the degradation products. The oligonucleotide samples were stressed under different pH values at 45 and 90 °C. The main degradation products were observed to be losses of nucleotide moieties from the 3'- and 5'-terminus, depurination, formation of terminal phosphorothioates, and production of ribose, ribophosphorothioates (Rp), and phosphoribophosphorothioates (pRp). Moreover, the effects of different concentrations of hydrogen peroxide were studied resulting in primarily extensive desulfurization and subsequent oxidation of the phosphorothioate linkage to produce the corresponding phosphodiester. The reaction kinetics for the degradation of the oligonucleotides under the different stress conditions were studied and were found to follow pseudo-first-order kinetics. Differences in rates exist even for oligonucleotides of similar length but consisting of different sequences. Graphical abstract Identification of degradation products across several generations of oligonucleotide therapeutics using LC-MS.

Polymerase-endonuclease amplification reaction (PEAR for large-scale enzymatic production of antisense oligonucleotides.

Directory of Open Access Journals (Sweden)

Xiaolong Wang

Full Text Available Antisense oligonucleotides targeting microRNAs or their mRNA targets prove to be powerful tools for molecular biology research and may eventually emerge as new therapeutic agents. Synthetic oligonucleotides are often contaminated with highly homologous failure sequences. Synthesis of a certain oligonucleotide is difficult to scale up because it requires expensive equipment, hazardous chemicals and a tedious purification process. Here we report a novel thermocyclic reaction, polymerase-endonuclease amplification reaction (PEAR, for the amplification of oligonucleotides. A target oligonucleotide and a tandem repeated antisense probe are subjected to repeated cycles of denaturing, annealing, elongation and cleaving, in which thermostable DNA polymerase elongation and strand slipping generate duplex tandem repeats, and thermostable endonuclease (PspGI cleavage releases monomeric duplex oligonucleotides. Each round of PEAR achieves over 100-fold amplification. The product can be used in one more round of PEAR directly, and the process can be further repeated. In addition to avoiding dangerous materials and improved product purity, this reaction is easy to scale up and amenable to full automation. PEAR has the potential to be a useful tool for large-scale production of antisense oligonucleotide drugs.

Single-tube multiplex PCR using type-specific E6/E7 primers and capillary electrophoresis genotypes 21 human papillomaviruses in neoplasia

Directory of Open Access Journals (Sweden)

Warenholt Janina

2011-01-01

Full Text Available Abstract Background Human papillomavirus (HPV E6/E7 type-specific oncogenes are required for cervical carcinogenesis. Current PCR protocols for genotyping high-risk HPV in cervical screening are not standardized and usually use consensus primers targeting HPV capsid genes, which are often deleted in neoplasia. PCR fragments are detected using specialized equipment and extra steps, including probe hybridization or primer extension. In published papers, analytical sensitivity is typically compared with a different protocol on the same sample set. A single-tube multiplex PCR containing type-specific primers was developed to target the E6/E7 genes of two low-risk and 19 high-risk genotypes (HPV6, 11 and 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68, 70, 73 and 82 and the resulting short fragments were directly genotyped by high-resolution fluorescence capillary electrophoresis. Results The method was validated using long oligonucleotide templates, plasmid clones and 207 clinical samples of DNA from liquid-based cytology, fresh and formalin-fixed specimens and FTA Microcards® imprinted with cut tumor surfaces, swabbed cervical cancers or ejected aspirates from nodal metastases of head and neck carcinomas. Between one and five long oligonucleotide targets per sample were detected without false calls. Each of the 21 genotypes was detected in the clinical sample set with up to five types simultaneously detected in individual specimens. All 101 significant cervical neoplasias (CIN 2 and above, except one adenocarcinoma, contained E6/E7 genes. The resulting genotype distribution accorded with the national pattern with HPV16 and 18 accounting for 69% of tumors. Rare HPV types 70 and 73 were present as the sole genotype in one carcinoma each. One cervical SCC contained DNA from HPV6 and 11 only. Six of twelve oropharyngeal cancer metastases and three neck metastases of unknown origin bore E6/E7 DNA; all but one were HPV16. One neck

Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.

Directory of Open Access Journals (Sweden)

Indhu Kanakaraj

Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.

Biominetic High Density Lipoproteins for the Delivery of Therapeutic Oligonucleotides

Science.gov (United States)

Tripathy, Sushant

Advances in nanotechnology have brought about novel inorganic and hybrid nanoparticles with unique physico-chemical properties that make them suitable for a broad range of applications---from nano-circuitry to drug delivery. A significant part of those advancements have led to ground-breaking discoveries that have changed the approaches to formulation of therapeutics against diseases, such as cancer. Now-a-days the focus does not lie solely on finding a candidate small-molecule therapeutic with minimal adverse effects, but researchers are looking up to nanoparticles to improve biodistribution and biocompatibility profile of clinically proven therapeutics. The plethora of conjugation chemistries offered by currently extant inorganic nanoparticles have, in recent years, led to great leaps in the field of biomimicry---a modality that promises high biocompatibility. Further, in the pursuit of highly specific therapeutic molecules, researchers have turned to silencing oligonucleotides and some have already brought together the strengths of nanoparticles and silencing oligonucleotides in search of an efficacious therapy for cancer with minimal adverse effects. This dissertation work focuses on such a biomimetic platform---a gold nanoparticle based high density lipoprotein biomimetic (HDL NP), for the delivery of therapeutic oligonucleotides. The first chapter of this body of work introduces the molecular target of the silencing oligonucleotides---VEGFR2, and its role in the progression of solid tumor cancers. The background information also covers important aspects of natural high density lipoproteins (HDL), especially their innate capacity to bind and deliver exogenous and endogenous silencing oligonucleotides to tissues that express their high affinity receptor SRB1. We subsequently describe the synthesis of the biomimetic HDL NP and its oligonucleotide conjugates, and establish their biocompatibility. Further on, experimental data demonstrate the efficacy of silencing

Oligonucleotide-based biosensors for in vitro diagnostics and environmental hazard detection.

Science.gov (United States)

Jung, Il Young; Lee, Eun Hee; Suh, Ah Young; Lee, Seung Jin; Lee, Hyukjin

2016-04-01

Oligonucleotide-based biosensors have drawn much attention because of their broad applications in in vitro diagnostics and environmental hazard detection. They are particularly of interest to many researchers because of their high specificity as well as excellent sensitivity. Recently, oligonucleotide-based biosensors have been used to achieve not only genetic detection of targets but also the detection of small molecules, peptides, and proteins. This has further broadened the applications of these sensors in the medical and health care industry. In this review, we highlight various examples of oligonucleotide-based biosensors for the detection of diseases, drugs, and environmentally hazardous chemicals. Each example is provided with detailed schematics of the detection mechanism in addition to the supporting experimental results. Furthermore, future perspectives and new challenges in oligonucleotide-based biosensors are discussed.

Functionalization of PVC membrane with ss oligonucleotides for a potentiometric biosensor.

Science.gov (United States)

Shishkanova, T V; Volf, R; Krondak, M; Král, V

2007-05-15

A novel application of a single stranded (ss) oligonucleotide as an active component of polymeric membrane in an ion-selective electrode (ISE) is described. The original oligonucleotides, oligo(dA)(15), modified by cholesterol, triphenylmethyl and hexadecyl derivatives, were immobilized into poly(vinyl chloride) (PVC) membrane using extraction protocol. In parallel, the adsorption protocol was used to immobilize unmodified oligo(dA)(15) on the PVC membrane based on tridodecylmethyammonium chloride (TDDMA(+)Cl(-)). Immobilization of ss oligonucleotide probe through spacer was more effective for the potentiometric detection of the hybridization between complementary oligonucleotides. It was found that cholesterol-oligo(dA)(15) modified membranes were sensitive toward complementary oligo(dT)(15) in the concentration range 2-80 nM at pH 7. An explanation for the detection mechanism is proposed.

Polyacid macromolecule primers

Science.gov (United States)

Sugama, Toshifumi.

1989-12-26

Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products

Science.gov (United States)

Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam

2013-11-01

This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.

Genome-wide identification of specific oligonucleotides using artificial neural network and computational genomic analysis

Directory of Open Access Journals (Sweden)

Chen Jiun-Ching

2007-05-01

Full Text Available Abstract Background Genome-wide identification of specific oligonucleotides (oligos is a computationally-intensive task and is a requirement for designing microarray probes, primers, and siRNAs. An artificial neural network (ANN is a machine learning technique that can effectively process complex and high noise data. Here, ANNs are applied to process the unique subsequence distribution for prediction of specific oligos. Results We present a novel and efficient algorithm, named the integration of ANN and BLAST (IAB algorithm, to identify specific oligos. We establish the unique marker database for human and rat gene index databases using the hash table algorithm. We then create the input vectors, via the unique marker database, to train and test the ANN. The trained ANN predicted the specific oligos with high efficiency, and these oligos were subsequently verified by BLAST. To improve the prediction performance, the ANN over-fitting issue was avoided by early stopping with the best observed error and a k-fold validation was also applied. The performance of the IAB algorithm was about 5.2, 7.1, and 6.7 times faster than the BLAST search without ANN for experimental results of 70-mer, 50-mer, and 25-mer specific oligos, respectively. In addition, the results of polymerase chain reactions showed that the primers predicted by the IAB algorithm could specifically amplify the corresponding genes. The IAB algorithm has been integrated into a previously published comprehensive web server to support microarray analysis and genome-wide iterative enrichment analysis, through which users can identify a group of desired genes and then discover the specific oligos of these genes. Conclusion The IAB algorithm has been developed to construct SpecificDB, a web server that provides a specific and valid oligo database of the probe, siRNA, and primer design for the human genome. We also demonstrate the ability of the IAB algorithm to predict specific oligos through

Synthetic Method for Oligonucleotide Block by Using Alkyl-Chain-Soluble Support.

Science.gov (United States)

Matsuno, Yuki; Shoji, Takao; Kim, Shokaku; Chiba, Kazuhiro

2016-02-19

A straightforward method for the synthesis of oligonucleotide blocks using a Cbz-type alkyl-chain-soluble support (Z-ACSS) attached to the 3'-OH group of 3'-terminal nucleosides was developed. The Z-ACSS allowed for the preparation of fully protected deoxyribo- and ribo-oligonucleotides without chromatographic purification and released dimer- to tetramer-size oligonucleotide blocks via hydrogenation using a Pd/C catalyst without significant loss or migration of protective groups such as 5'-end 4,4'-dimethoxtrityl, 2-cyanoethyl on internucleotide bonds, or 2'-TBS.

Design of oligonucleotides for microarrays and perspectives for design of multi-transcriptome arrays

DEFF Research Database (Denmark)

Nielsen, Henrik Bjørn; Wernersson, Rasmus; Knudsen, Steen

2003-01-01

with an overview of these parameters. We present here a flexible tool named OligoWiz for designing oligonucleotides for multiple purposes. OligoWiz presents a set of parameter scores in a graphical interface to facilitate an overview for the user. Additional custom parameter scores can easily be added......Optimal design of oligonucleotides for microarrays involves tedious and laborious work evaluating potential oligonucleotides relative to a series of parameters. The currently available tools for this purpose are limited in their flexibility and do not present the oligonucleotide designer...... to the program to extend the default parameters: homology, DeltaTm, low-complexity, position and GATC-only. Furthermore we present an analysis of the limitations in designing oligonucleotide sets that can detect transcripts from multiple organisms. OligoWiz is available at www.cbs.dtu.dk/services/OligoWiz/....

Thermodynamics of Oligonucleotide Duplex Melting

Science.gov (United States)

Schreiber-Gosche, Sherrie; Edwards, Robert A.

2009-01-01

Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply…

Antisense Oligonucleotides Internally Labeled with Peptides Show Improved Target Recognition and Stability to Enzymatic Degradation

DEFF Research Database (Denmark)

Taskova, Maria; Madsen, Charlotte S.; Jensen, Knud J.

2017-01-01

Specific target binding and stability in diverse biological media is of crucial importance for applications of synthetic oligonucleotides as diagnostic and therapeutic tools. So far, these issues have been addressed by chemical modification of oligonucleotides and by conjugation with a peptide, m...... and makes internally labeled POCs an exciting object of study, i.e., showing high target specificity and simultaneous stability in biological media.......Specific target binding and stability in diverse biological media is of crucial importance for applications of synthetic oligonucleotides as diagnostic and therapeutic tools. So far, these issues have been addressed by chemical modification of oligonucleotides and by conjugation with a peptide......, most often at the terminal position of the oligonucleotide. Herein, we for the first time systematically investigate the influence of internally attached short peptides on the properties of antisense oligonucleotides. We report the synthesis and internal double labeling of 21-mer oligonucleotides...

PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

DEFF Research Database (Denmark)

Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

2011-01-01

containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

Static magnetic field reduced exogenous oligonucleotide uptake by spermatozoa using magnetic nanoparticle gene delivery system

International Nuclear Information System (INIS)

Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran

2016-01-01

Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer. - Highlights: • Core/shell type Iron oxide nanoparticles were used as a novel and efficient method. • This method increases exogenous DNA uptake by rooster spermatozoa. • Static magnetic field decreased DNA uptake by rooster spermatozoa.

Static magnetic field reduced exogenous oligonucleotide uptake by spermatozoa using magnetic nanoparticle gene delivery system

Energy Technology Data Exchange (ETDEWEB)

Katebi, Samira; Esmaeili, Abolghasem, E-mail: aesmaeili@sci.ui.ac.ir; Ghaedi, Kamran

2016-03-15

Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer. - Highlights: • Core/shell type Iron oxide nanoparticles were used as a novel and efficient method. • This method increases exogenous DNA uptake by rooster spermatozoa. • Static magnetic field decreased DNA uptake by rooster spermatozoa.

VizPrimer: a web server for visualized PCR primer design based on known gene structure.

Science.gov (United States)

Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

2011-12-15

The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

Oligonucleotide-based pharmaceuticals: Non-clinical and clinical safety signals and non-clinical testing strategies.

Science.gov (United States)

Mustonen, Enni-Kaisa; Palomäki, Tiina; Pasanen, Markku

2017-11-01

Antisense oligonucleotides, short interfering RNAs (siRNAs) and aptamers are oligonucleotide-based pharmaceuticals with a promising role in targeted therapies. Currently, five oligonucleotide-based pharmaceuticals have achieved marketing authorization in Europe or USA and many more are undergoing clinical testing. However, several safety concerns have been raised in non-clinical and clinical studies. Oligonucleotides share properties with both chemical and biological pharmaceuticals and therefore they pose challenges also from the regulatory point of view. We have analyzed the safety data of oligonucleotides and evaluated the applicability of current non-clinical toxicological guidelines for assessing the safety of oligonucleotide-based pharmaceuticals. Oligonucleotide-based pharmaceuticals display a similar toxicological profile, exerting adverse effects on liver and kidney, evoking hematological alterations, as well as causing immunostimulation and prolonging the coagulation time. It is possible to extrapolate some of these effects from non-clinical studies to humans. However, evaluation strategies for genotoxicity testing of "non-natural" oligonucleotides should be revised. Additionally, the selective use of surrogates and prediction of clinical endpoints for non-clinically observed immunostimulation is complicated by its multiple potential manifestations, demanding improvements in the testing strategies. Utilizing more relevant and mechanistic-based approaches and taking better account of species differences, could possibly improve the prediction of relevant immunological/proinflammatory effects in humans. Copyright © 2017 Elsevier Inc. All rights reserved.

Static magnetic field reduced exogenous oligonucleotide uptake by spermatozoa using magnetic nanoparticle gene delivery system

Science.gov (United States)

Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran

2016-03-01

Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (Prooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer.

Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

International Nuclear Information System (INIS)

Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong

2008-01-01

A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

Folding Topology of a Short Coiled-Coil Peptide Structure Templated by an Oligonucleotide Triplex

DEFF Research Database (Denmark)

Lou, Chenguang; Christensen, Niels Johan; Martos Maldonado, Manuel Cristo

2017-01-01

by oligonucleotide duplex and triplex formation. POC synthesis was achieved by copper-free alkyne-azide cycloaddition between three oligonucleotides and a 23-mer peptide, which by itself exhibited multiple oligomeric states in solution. The oligonucleotide domain was designed to furnish a stable parallel triplex......, small-angle X-ray scattering (SAXS), and molecular modeling. Stabilizing cooperativity was observed between the trimeric peptide and the oligonucleotide triplex domains, and the overall molecular size (ca. 12nm) in solution was revealed to be independent of concentration. The topological folding...

Thermal Stability of Modified i-Motif Oligonucleotides with Naphthalimide Intercalating Nucleic Acids

DEFF Research Database (Denmark)

El-Sayed, Ahmed Ali; Pedersen, Erik B.; Khaireldin, Nahid Y.

2016-01-01

In continuation of our investigation of characteristics and thermodynamic properties of the i-motif 5′-d[(CCCTAA)3CCCT)] upon insertion of intercalating nucleotides into the cytosine-rich oligonucleotide, this article evaluates the stabilities of i-motif oligonucleotides upon insertion of naphtha......In continuation of our investigation of characteristics and thermodynamic properties of the i-motif 5′-d[(CCCTAA)3CCCT)] upon insertion of intercalating nucleotides into the cytosine-rich oligonucleotide, this article evaluates the stabilities of i-motif oligonucleotides upon insertion...... of naphthalimide (1H-benzo[de]isoquinoline-1,3(2H)-dione) as the intercalating nucleic acid. The stabilities of i-motif structures with inserted naphthalimide intercalating nucleotides were studied using UV melting temperatures (Tm) and circular dichroism spectra at different pH values and conditions (crowding...

Cellular Internalization of Therapeutic Oligonucleotides by Peptide Amphiphile Nanofibers and Nanospheres.

Science.gov (United States)

Mumcuoglu, Didem; Sardan Ekiz, Melis; Gunay, Gokhan; Tekinay, Turgay; Tekinay, Ayse B; Guler, Mustafa O

2016-05-11

Oligonucleotides are promising drug candidates due to the exceptionally high specificity they exhibit toward their target DNA and RNA sequences. However, their poor pharmacokinetic and pharmacodynamic properties, in conjunction with problems associated with their internalization by cells, necessitates their delivery through specialized carrier systems for efficient therapy. Here, we investigate the effects of carrier morphology on the cellular internalization mechanisms of oligonucleotides by using self-assembled fibrous or spherical peptide nanostructures. Size and geometry were both found to be important parameters for the oligonucleotide internalization process; direct penetration was determined to be the major mechanism for the internalization of nanosphere carriers, whereas nanofibers were internalized by clathrin- and dynamin-dependent endocytosis pathways. We further showed that glucose conjugation to carrier nanosystems improved cellular internalization in cancer cells due to the enhanced glucose metabolism associated with oncogenesis, and the internalization of the glucose-conjugated peptide/oligonucleotide complexes was found to be dependent on glucose transporters present on the surface of the cell membrane.

Stereospecificity of oligonucleotide interactions revisited: no evidence for heterochiral hybridization and ribozyme/DNAzyme activity.

Directory of Open Access Journals (Sweden)

Kai Hoehlig

Full Text Available A major challenge for the application of RNA- or DNA-oligonucleotides in biotechnology and molecular medicine is their susceptibility to abundant nucleases. One intriguing possibility to tackle this problem is the use of mirror-image (l-oligonucleotides. For aptamers, this concept has successfully been applied to even develop therapeutic agents, so-called Spiegelmers. However, for technologies depending on RNA/RNA or RNA/DNA hybridization, like antisense or RNA interference, it has not been possible to use mirror-image oligonucleotides because Watson-Crick base pairing of complementary strands is (thought to be stereospecific. Many scientists consider this a general principle if not a dogma. A recent publication proposing heterochiral Watson-Crick base pairing and sequence-specific hydrolysis of natural RNA by mirror-image ribozymes or DNAzymes (and vice versa prompted us to systematically revisit the stereospecificity of oligonucleotides hybridization and catalytic activity. Using hyperchromicity measurements we demonstrate that hybridization only occurs among homochiral anti-parallel complementary oligonucleotide strands. As expected, achiral PNA hybridizes to RNA and DNA irrespective of their chirality. In functional assays we could not confirm an alleged heterochiral hydrolytic activity of ribozymes or DNAzymes. Our results confirm a strict stereospecificity of oligonucleotide hybridization and clearly argue against the possibility to use mirror-image oligonucleotides for gene silencing or antisense applications.

Rapid and accurate synthesis of TALE genes from synthetic oligonucleotides.

Science.gov (United States)

Wang, Fenghua; Zhang, Hefei; Gao, Jingxia; Chen, Fengjiao; Chen, Sijie; Zhang, Cuizhen; Peng, Gang

2016-01-01

Custom synthesis of transcription activator-like effector (TALE) genes has relied upon plasmid libraries of pre-fabricated TALE-repeat monomers or oligomers. Here we describe a novel synthesis method that directly incorporates annealed synthetic oligonucleotides into the TALE-repeat units. Our approach utilizes iterative sets of oligonucleotides and a translational frame check strategy to ensure the high efficiency and accuracy of TALE-gene synthesis. TALE arrays of more than 20 repeats can be constructed, and the majority of the synthesized constructs have perfect sequences. In addition, this novel oligonucleotide-based method can readily accommodate design changes to the TALE repeats. We demonstrated an increased gene targeting efficiency against a genomic site containing a potentially methylated cytosine by incorporating non-conventional repeat variable di-residue (RVD) sequences.

Oligonucleotide assisted light-emitting Alq3 microrods: energy transfer effect with fluorescent dyes.

Science.gov (United States)

Cui, Chunzhi; Park, Dong Hyuk; Kim, Jeongyong; Joo, Jinsoo; Ahn, Dong June

2013-06-14

Oligonucleotide assisted tri(8-hydroxyquinoline) aluminium (Alq3) microrods were prepared for the first time. When hybridized with oligonucleotide labeled by Cy3 fluorescent dye, a significant photoluminescence variation of the Alq3 microrods was observed due to Förster resonance energy transfer, unlike when Cy5-oligonucleotide was used. Versatile nucleotide manipulation would open up wider applications of Alq3-based materials, based on this fundamental observation.

MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

Science.gov (United States)

Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

2016-01-01

Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

Dielectric properties of DNA oligonucleotides on the surface of silicon nanostructures

Energy Technology Data Exchange (ETDEWEB)

Bagraev, N. T., E-mail: bagraev@mail.ioffe.ru [St. Petersburg Polytechnic University (Russian Federation); Chernev, A. L. [Russian Academy of Sciences, St. Petersburg Academic University—Nanotechnology Research and Education Center (Russian Federation); Klyachkin, L. E. [St. Petersburg Polytechnic University (Russian Federation); Malyarenko, A. M. [Russian Academy of Sciences, Ioffe Physical–Technical Institute (Russian Federation); Emel’yanov, A. K.; Dubina, M. V. [Russian Academy of Sciences, St. Petersburg Academic University—Nanotechnology Research and Education Center (Russian Federation)

2016-10-15

Planar silicon nanostructures that are formed as a very narrow silicon quantum well confined by δ barriers heavily doped with boron are used to study the dielectric properties of DNA oligonucleotides deposited onto the surface of the nanostructures. The capacitance characteristics of the silicon nanostructures with oligonucleotides deposited onto their surface are determined by recording the local tunneling current–voltage characteristics by means of scanning tunneling microscopy. The results show the possibility of identifying the local dielectric properties of DNA oligonucleotide segments consisting of repeating G–C pairs. These properties apparently give grounds to correlate the segments with polymer molecules exhibiting the properties of multiferroics.

Identifying of meat species using polymerase chain reaction (PCR)

International Nuclear Information System (INIS)

Foong, Chow Ming; Sani, Norrakiah Abdullah

2013-01-01

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

Identifying of meat species using polymerase chain reaction (PCR)

Energy Technology Data Exchange (ETDEWEB)

Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)

2013-11-27

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

Low-copy nuclear primers and ycf1 primers in Cactaceae.

Science.gov (United States)

Franck, Alan R; Cochrane, Bruce J; Garey, James R

2012-10-01

To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

Challenges to oligonucleotides-based therapeutics for Duchenne muscular dystrophy

Directory of Open Access Journals (Sweden)

Goyenvalle Aurélie

2011-02-01

Full Text Available Abstract Antisense oligonucleotides are short nucleic acids designed to bind to specific messenger RNAs in order to modulate splicing patterns or inhibit protein translation. As such, they represent promising therapeutic tools for many disorders and have been actively developed for more than 20 years as a form of molecular medicine. Although significant progress has been made in developing these agents as drugs, they are yet not recognized as effective therapeutics and several hurdles remain to be overcome. Within the last few years, however, the prospect of successful oligonucleotides-based therapies has moved a step closer, in particular for Duchenne muscular dystrophy. Clinical trials have recently been conducted for this myopathy, where exon skipping is being used to achieve therapeutic outcomes. In this review, the recent developments and clinical trials using antisense oligonucleotides for Duchenne muscular dystrophy are discussed, with emphasis on the challenges ahead for this type of therapy, especially with regards to delivery and regulatory issues.

Isolation and characterization of human glycophorin A cDNAs using a synthetic oligonucleotide approach: nucleotide sequence, mRNA structure and regulation by 12-O-tetradecanoylphorbol 13-acetate (TPA)

International Nuclear Information System (INIS)

Siebert, P.D.; Fukuda, M.

1986-01-01

The authors have previously shown that treatment of human erythroleukemic K562 cells with the tumor-promoting phorbol ester, TPA, results in a diminished expression of glycophorin A at the level of protein biosynthesis and in vitro mRNA translation activity. To further examine the structure, relationships and expression of human glycophorins they have successfully isolated and sequenced several glycophorin A specific cDNA clones derived from K562 cells, by making extensive use of mixed and exact synthetic oligonucleotides as primers and radioactively labeled probes. The nucleotide sequence obtained from the largest glycophorin A cDNA suggests the presence of a hydrophobic leader-like peptide of at least 19 amino acids. Northern gel analysis using both whole cDNA-plasmid and synthetic oligonucleotide probes revealed the existence of multiple mRNAs, three of which they believe to be glycophorin A-specific, whereas a fourth and smaller mRNA appears to be glycophorin B-specific. Furthermore, the abundance of all four glycophorin mRNAs were found to be extensively reduced following treatment of K562 cells with TPA suggesting coordinate regulation, possibly at the level of gene transcription

G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

Science.gov (United States)

Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

2015-09-22

Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

[Oligonucleotide derivatives in the nucleic acid hybridization analysis. III. Synthesis and investigation of properties of oligonucleotides, bearing bifunctional non-nucleotide insert].

Science.gov (United States)

Kupriushkin, M S; Pyshnyĭ, D V

2012-01-01

Non-nucleotide phosporamidites were synthetized, having branched backbone with different position of functional groups. Obtained phosphoramidite monomers contain intercalator moiety--6-chloro-2-methoxyacridine, and additional hydroxyl residue protected with dimethoxytrityl group or with tert-butyldimethylsilyl group for post-synthetic modification. Synthesized oligothymidilates contain one or more modified units in different positions of sequence. Melting temperature and thermodynamic parameters of formation of complementary duplexes formed by modified oligonucleotides was defined (change in enthalpy and entropy). The introduction of intercalating residue causes a significant stabilization of DNA duplexes. It is shown that the efficiency of the fluorescence of acridine residue in the oligonucleotide conjugate significantly changes upon hybridization with DNA.

Triplex-forming ability of modified oligonucleotides

DEFF Research Database (Denmark)

Højland, Torben; Babu, Bolle Ravindra; Bryld, Torsten

2007-01-01

We present our studies on the ability of several different nucleotide analogs as triplex-forming oligonucleotides. The modifications tested include 4'-C-hydroxymethyl, LNA, 2'-amino-LNA and N2'-functionalized 2'-amino-LNA. Triplexes containing monomers of N2'-glycyl-functionalized 2'-amino-LNA ar...

Systematic validation and atomic force microscopy of non-covalent short oligonucleotide barcode microarrays.

Directory of Open Access Journals (Sweden)

Michael A Cook

Full Text Available BACKGROUND: Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20-60 base unique sequence tags, or "barcodes", associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. METHODOLOGY/PRINCIPAL FINDINGS: Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5'-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM, we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. CONCLUSIONS/SIGNIFICANCE: These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis.

Binding of Dumbbell Oligonucleotides to MoMuLV Reverse Transcriptase: Inhibitory Properties of RNase H Activity

Directory of Open Access Journals (Sweden)

Ajay Kumar

2010-01-01

Full Text Available Dumbbell oligonucleotides with loops of various chemistry were synthesized. Incubation of dumbbell oligonucleotides containing phosphorothioate bonds or trimethylene phosphate linkages in loops with S1 nuclease did not result in significant cleavage under conditions which led to the degradation of dumbbell oligonucleotide containing phophodiester bonds in the loops. The binding of reverse transcriptase of Moloney Murine Leukemia Virus (MoMuLV was evaluated with all the five oligonucleotides. The protein binds to all the dumbbell oligonucleotides with similar affinity. The dissociation constants evaluated using PAGE band mobility shift assays were of the order of 10-7. The inhibitory properties of the retroviral RNase H activity was evaluated using 3H –UTP-labeled RNA:RNA-DNA hybrid. It was found that the best dumbbell oligonucleotide, inhibitor contained phosphorothioate residues in both the loops. Our value studies demonstrated that this particularly designed oligonucleotide displays an IC50 of 18 nM in its inhibition on the reverse transcriptase RNase H activity, a magnitude lower than that of first nucleotide reverse transcriptase of HIV-1, tenofovir, introduced by Gilead Science in the market.

Associating Oligonucleotides with Positively Charged Liposomes

Czech Academy of Sciences Publication Activity Database

Jurkiewicz, P.; Okruszek, A.; Hof, Martin; Langner, M.

2003-01-01

Roč. 8, č. 1 (2003), s. 77-84 ISSN 1425-8153 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : oligonucleotides * fluorescence correlation spectroscopy * DOTAP Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 0.455, year: 2003

THERAPEUTIC ANTISENSE OLIGONUCLEOTIDES AGAINST CANCER: HURDLING TO THE CLINIC

Directory of Open Access Journals (Sweden)

Pedro Miguel Duarte Moreno

2014-10-01

Full Text Available Under clinical development since the early 90’s and with two successfully approved drugs (Fomivirsen and Mipomersen, oligonucleotide-based therapeutics have not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given towards a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field.

Peroxide-mediated desulfurization of phosphorothioate oligonucleotides and its prevention.

Science.gov (United States)

Krotz, Achim H; Mehta, Rahul C; Hardee, Gregory E

2005-02-01

Desulfurization at the internucleotide phosphorothioate linkage of antisense oligonucleotides (ASOs) in dermatological formulations has been investigated using strong ion exchange chromatography and mass spectroscopy. The formation of phosphate diester linkages appeared to arise from a reaction between the phosphorothioate oligonucleotide and a potent oxidizing agent. Screening of excipients used in the formulation indicated that the cause of desulfurization was related to the presence of polyethylene glycol-derived nonionic surfactants MYRJ 52 or BRIJ 58. Autoxidation of the polyethylene glycol chain is suggested as the probable origin for the observed incompatibility. The ability of various antioxidants to prevent oxidative degradation of ASO-1 in simple test systems and in oil-in-water emulsions is described. It is found that in test systems both lipophilic and hydrophilic antioxidants are effective. However, in cream formulation (oil-in-water emulsions) of ASO-1 the addition of hydrophilic antioxidants L-cysteine or DL-alpha-lipoic acid has been shown to be superior in protecting the oligonucleotide from desulfurization upon storage. Copyright 2004 Wiley-Liss, Inc.

A Kinetic Model Explains Why Shorter and Less Affine Enzyme-recruiting Oligonucleotides Can Be More Potent

Directory of Open Access Journals (Sweden)

Lykke Pedersen

2014-01-01

Full Text Available Antisense oligonucleotides complementary to RNA targets promise generality and ease of drug design. The first systemically administered antisense drug was recently approved for treatment and others are in clinical development. Chemical modifications that increase the hybridization affinity of oligonucleotides are reasoned to confer higher potency, i.e., modified oligonucleotides can be dosed at lower concentrations to achieve the same effect. Surprisingly, shorter and less affine oligonucleotides sometimes display increased potency. To explain this apparent contradiction, increased uptake or decreased propensity to form structures have been suggested as possible mechanisms. Here, we provide an alternative explanation that invokes only the kinetics behind oligonucleotide-mediated cleavage of RNA targets. A model based on the law of mass action predicts, and experiments support, the existence of an optimal binding affinity. Exaggerated affinity, and not length per se, is detrimental to potency. This finding clarifies how to optimally apply high-affinity modifications in the discovery of potent antisense oligonucleotide drugs.

Versatile functionalization of nanoelectrodes by oligonucleotides via pyrrole electrochemistry.

Science.gov (United States)

Descamps, Emeline; Nguyen, Khoa; Bouchain-Gautier, Christelle; Filoramo, Arianna; Goux-Capes, Laurence; Goffman, Marcello; Bourgoin, Jean-Philippe; Mailley, Pascal; Livache, Thierry

2010-11-15

Surface modification at the nanometer scale is a challenge for the future of molecular electronics. In particular, the precise anchoring and electrical addressing of biological scaffolds such as complex DNA nanonetworks is of importance for generating bio-directed assemblies of nano-objects for nanocircuit purposes. Herein, we consider the individual modification of nanoelectrodes with different oligonucleotide sequences by an electrochemically driven co-polymerization process of pyrrole and modified oligonucleotide sequences bearing pyrrole monomers. We demonstrate that this one-step technique presents the advantages of simplicity, localization of surface modification, mechanical, biological and chemical stability of the coatings, and high lateral resolution.

Review on investigations of antisense oligonucleotides with the use of mass spectrometry.

Science.gov (United States)

Studzińska, Sylwia

2018-01-01

Antisense oligonucleotides have been investigated as potential drugs for years. They inhibit target gene or protein expression. The present review summarizes their modifications, modes of action, and applications of liquid chromatography coupled with mass spectrometry for qualitative and quantitative analysis of these compounds. The most recent reports on a given topic were given prominence, while some early studies were reviewed in order to provide a theoretical background. The present review covers the issues of using ion-exchange chromatography, ion-pair reversed-phase high performance liquid chromatography and hydrophilic interaction chromatography for the separation of antisense oligonucleotides. The application of mass spectrometry was described with regard to the ionization type used for the determination of these potential therapeutics. Moreover, the current approaches and applications of mass spectrometry for quantitative analysis of antisense oligonucleotides and their metabolites as well as their impurities during in vitro and in vivo studies were discussed. Finally, certain conclusions and perspectives on the determination of therapeutic oligonucleotides in various samples were briefly described. Copyright © 2017 Elsevier B.V. All rights reserved.

Detection of DNA oligonucleotides with base mutations by terahertz spectroscopy and microstructures.

Directory of Open Access Journals (Sweden)

Mingjie Tang

Full Text Available DNA oligonucleotides with a 5-base mutation at the 3'-terminus were investigated by terahertz (THz spectroscopy in a marker-free manner. The four single-stranded oligonucleotides with 17nt have been detected with specificity on a microfluidic chip, and corroborated by spectral measurements with split-ring resonators. The number of hydrogen bonds formed between the oligonucleotide and its surrounding water molecules, deemed a key contribution to the THz absorption of biological solutions, was explored by molecular dynamics simulations to explain the experimental findings. Our work underlies the feasibility of THz spectroscopy combined with microstructures for marker-free detection of DNA, which may form the basis of a prospective diagnostic tool for studying genic mutation.

CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

Science.gov (United States)

Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

2015-07-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

Science.gov (United States)

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A-T phosphoramidite building blocks.

Science.gov (United States)

Schmidtgall, Boris; Höbartner, Claudia; Ducho, Christian

2015-01-01

Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T-T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X-T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A-T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues.

Nucleobase-modified antisense oligonucleotides containing 5-(phenyltriazol)-2′-deoxyuridine nucleotides induce exon-skipping

DEFF Research Database (Denmark)

Le, Bao T.; Hornum, Mick; Sharma, Pawan K.

2017-01-01

Chemically-modified antisense oligonucleotide-mediated exon-skipping has been validated as a therapeutic strategy for tackling several disease pathologies, particularly duchenne muscular dystrophy. To date, only sugar-modified and internucleotide linkage-modified oligonucleotide chemistries have...

Syntheses of prodrug-type phosphotriester oligonucleotides responsive to intracellular reducing environment for improvement of cell membrane permeability and nuclease resistance.

Science.gov (United States)

Hayashi, Junsuke; Samezawa, Yusuke; Ochi, Yosuke; Wada, Shun-Ichi; Urata, Hidehito

2017-07-15

We synthesized prodrug-type phosphotriester (PTE) oligonucleotides containing the six-membered cyclic disulfide moiety by using phosphoramidite chemistry. Prodrug-type oligonucleotides named "Reducing-Environment-Dependent Uncatalyzed Chemical Transforming (REDUCT) PTE oligonucleotides" were converted into natural oligonucleotides under cytosol-mimetic reductive condition. Furthermore, the REDUCT PTE oligonucleotides were robust to nuclease digestion and exhibited good cell membrane permeability. Copyright © 2017 Elsevier Ltd. All rights reserved.

Functional regulation of RNA-induced silencing complex by photoreactive oligonucleotides.

Science.gov (United States)

Matsuyama, Yohei; Yamayoshi, Asako; Kobori, Akio; Murakami, Akira

2014-02-01

We developed a novel method for regulation of RISC function by photoreactive oligonucleotides (Ps-Oligo) containing 2'-O-psoralenylmethoxyethyl adenosine (Aps). We observed that inhibitory effects of Ps-Oligos on RISC function were enhanced by UV-irradiation compared with 2'-O-methyl-oligonucleotide without Aps. These results suggest Ps-Oligo inhibited RISC function by cross-linking effect, and we propose that the concept described in this report may be promising and applicable one to regulate the small RNA-mediated post-transcriptional regulation. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Bioinformatic tools for PCR Primer design

African Journals Online (AJOL)

ES

reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

Short G-rich oligonucleotides as a potential therapeutic for Huntington's Disease

Directory of Open Access Journals (Sweden)

Parekh-Olmedo Hetal

2006-10-01

Full Text Available Abstract Background Huntington's Disease (HD is an inherited autosomal dominant genetic disorder in which neuronal tissue degenerates. The pathogenesis of the disease appears to center on the development of protein aggregates that arise initially from the misfolding of the mutant HD protein. Mutant huntingtin (Htt is produced by HD genes that contain an increased number of glutamine codons within the first exon and this expansion leads to the production of a protein that misfolds. Recent studies suggest that mutant Htt can nucleate protein aggregation and interfere with a multitude of normal cellular functions. Results As such, efforts to find a therapy for HD have focused on agents that disrupt or block the mutant Htt aggregation pathway. Here, we report that short guanosine monotonic oligonucleotides capable of adopting a G-quartet structure, are effective inhibitors of aggregation. By utilizing a biochemical/immunoblotting assay as an initial screen, we identified a 20-mer, all G-oligonucleotide (HDG as an active molecule. Subsequent testing in a cell-based assay revealed that HDG was an effective inhibitor of aggregation of a fusion protein, comprised of a mutant Htt fragment and green fluorescent protein (eGFP. Taken together, our results suggest that a monotonic G-oligonucleotide, capable of adopting a G-quartet conformation is an effective inhibitor of aggregation. This oligonucleotide can also enable cell survival in PC12 cells overexpressing a mutant Htt fragment fusion gene. Conclusion Single-stranded DNA oligonucleotides capable of forming stable G-quartets can inhibit aggregation of the mutant Htt fragment protein. This activity maybe an important part of the pathogenecity of Huntington's Disease. Our results reveal a new class of agents that could be developed as a therapeutic approach for Huntington's Disease.

30 CFR 56.6304 - Primer protection.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

Modulation of 5' splice site selection using tailed oligonucleotides carrying splicing signals

Directory of Open Access Journals (Sweden)

Elela Sherif

2006-01-01

Full Text Available Abstract Background We previously described the use of tailed oligonucleotides as a means of reprogramming alternative pre-mRNA splicing in vitro and in vivo. The tailed oligonucleotides that were used interfere with splicing because they contain a portion complementary to sequences immediately upstream of the target 5' splice site combined with a non-hybridizing 5' tail carrying binding sites for the hnRNP A1/A2 proteins. In the present study, we have tested the inhibitory activity of RNA oligonucleotides carrying different tail structures. Results We show that an oligonucleotide with a 5' tail containing the human β-globin branch site sequence inhibits the use of the 5' splice site of Bcl-xL, albeit less efficiently than a tail containing binding sites for the hnRNP A1/A2 proteins. A branch site-containing tail positioned at the 3' end of the oligonucleotide also elicited splicing inhibition but not as efficiently as a 5' tail. The interfering activity of a 3' tail was improved by adding a 5' splice site sequence next to the branch site sequence. A 3' tail carrying a Y-shaped branch structure promoted similar splicing interference. The inclusion of branch site or 5' splice site sequences in the Y-shaped 3' tail further improved splicing inhibition. Conclusion Our in vitro results indicate that a variety of tail architectures can be used to elicit splicing interference at low nanomolar concentrations, thereby broadening the scope and the potential impact of this antisense technology.

Selective Detection of Peptide-Oligonucleotide Heteroconjugates Utilizing Capillary HPLC-ICPMS

Science.gov (United States)

Catron, Brittany; Caruso, Joseph A.; Limbach, Patrick A.

2012-06-01

A method for the selective detection and quantification of peptide:oligonucleotide heteroconjugates, such as those generated by protein:nucleic acid cross-links, using capillary reversed-phase high performance liquid chromatography (cap-RPHPLC) coupled with inductively coupled plasma mass spectrometry detection (ICPMS) is described. The selective detection of phosphorus as 31P+, the only natural isotope, in peptide-oligonucleotide heteroconjugates is enabled by the elemental detection capabilities of the ICPMS. Mobile phase conditions that allow separation of heteroconjugates while maintaining ICPMS compatibility were investigated. We found that trifluoroacetic acid (TFA) mobile phases, used in conventional peptide separations, and hexafluoroisopropanol/triethylamine (HFIP/TEA) mobile phases, used in conventional oligonucleotide separations, both are compatible with ICPMS and enable heteroconjugate separation. The TFA-based separations yielded limits of detection (LOD) of ~40 ppb phosphorus, which is nearly seven times lower than the LOD for HFIP/TEA-based separations. Using the TFA mobile phase, 1-2 pmol of a model heteroconjugate were routinely separated and detected by this optimized capLC-ICPMS method.

i-Genome: A database to summarize oligonucleotide data in genomes

Directory of Open Access Journals (Sweden)

Chang Yu-Chung

2004-10-01

Full Text Available Abstract Background Information on the occurrence of sequence features in genomes is crucial to comparative genomics, evolutionary analysis, the analyses of regulatory sequences and the quantitative evaluation of sequences. Computing the frequencies and the occurrences of a pattern in complete genomes is time-consuming. Results The proposed database provides information about sequence features generated by exhaustively computing the sequences of the complete genome. The repetitive elements in the eukaryotic genomes, such as LINEs, SINEs, Alu and LTR, are obtained from Repbase. The database supports various complete genomes including human, yeast, worm, and 128 microbial genomes. Conclusions This investigation presents and implements an efficiently computational approach to accumulate the occurrences of the oligonucleotides or patterns in complete genomes. A database is established to maintain the information of the sequence features, including the distributions of oligonucleotide, the gene distribution, the distribution of repetitive elements in genomes and the occurrences of the oligonucleotides. The database can provide more effective and efficient way to access the repetitive features in genomes.

KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

International Nuclear Information System (INIS)

Bowman, Stephen M.

2008-01-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

Solid-phase synthesis of 2{sup '}-O-methoxyethyl oligonucleotides using dimeric phosphoramidate blocks

Energy Technology Data Exchange (ETDEWEB)

Yu, Gi Weon; Kang, Yong Han [Dept. of Applied Chemistry, Hanyang University, Ansan (Korea, Republic of)

2016-11-15

This research focused on the method of using dimeric phosphoramidite blocks to synthesize oligonucleotides for development as oligonucleotide drugs. A 16-mer oligonucleotide with the randomly selected sequence of C*C*T*C*G*C *T*C*T*C*G*C*C* C*G*C was synthesized using CC, GC, and TC dimers, a combination of monomers and dimers, or only monomers as building blocks. Using dimer blocks in this synthetic method provided a significant decrease in critical impurities that had similar properties to the main product, which was confirmed by LC-MS and HPLC analysis.

Photodynamic antisense regulation of mRNA having a point mutation with psoralen-conjugated oligonucleotide.

Science.gov (United States)

Higuchi, Maiko; Yamayoshi, Asako; Kobori, Akio; Murakami, Akira

2008-01-01

Nucleic acid-based drugs, such as antisense oligonucleotide, ribozyme, and small interfering RNA, are specific compounds that inhibit gene expression at the post-transcriptional level. To develop more effective nucleic acid-based drugs, we focused on photo-reactive antisense oligonucleotides. We have optimized the structure of psoralen-conjugated oligonucleotide to improve their sequence selectivity and photo-crosslinking efficiency. Previously, we reported that photo reactive oligonucleotides containing 2'-O-psoralenyl-methoxyethyl adenosine (2'-Ps-eom) showed drastic photo-reactivity with a strictly sequence specific manner in vitro. In this report, we evaluated the binding ability toward intracellular target mRNA. The 2'-Ps-eom selectively photo-cross-linked to the target mRNA extracted from cells. The 2'-Ps-eom also cross-linked to target mRNA in cells. Furthermore, 2'-Ps-eom did not cross-link to mRNA having a mismatch base. These results suggest that 2'-Ps-eom is a powerful antisense molecule to inhibit the expression of mRNA having a point mutation.

Surface modification of plasmonic nanostructured materials with thiolated oligonucleotides in 10 seconds using selective microwave heating

International Nuclear Information System (INIS)

Abel, B.; Aslan, K.

2012-01-01

This study demonstrates the proof-of-principle of rapid surface modification of plasmonic nanostructured materials with oligonucleotides using low power microwave heating. Due to their interesting optical and electronic properties, silver nanoparticle films (SNFs, 2 nm thick) deposited onto glass slides were used as the model plasmonic nanostructured materials. Rapid surface modification of SNFs with oligonucleotides was carried out using two strategies (1) Strategy 1: for ss-oligonucleotides, surface hybridization and (2) Strategy 2: for ds-oligonucleotides, solution hybridization, where the samples were exposed to 10, 15, 30 and 60 seconds microwave heating. To assess the efficacy of our new rapid surface modification technique, identical experiments carried out without the microwave heating (i.e., conventional method), which requires 24 hours for the completion of the identical steps. It was found that SNFs can be modified with ss- and ds-oligonucleotides in 10 seconds, which typically requires several hours of incubation time for the chemisorption of thiol groups on to the planar metal surface using conventional techniques. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

The Los Alamos primer

CERN Document Server

Serber, Robert

2018-01-01

Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

18F-labelling of oligonucleotides using succinimido 4-[18F]fluorobenzoat

International Nuclear Information System (INIS)

Hedberg, Elisabeth; Laangstroem, Bengt

1998-01-01

A general method for the labelling of oligodeoxynucleotide and oligonucleoside phosphorothioates in the 5'-position with the positron-emitting radionuclide 18 F (t 1/2 = 110 min) is described. The label was incorporated by the reaction of succinimido 4 -[ 18 F]fluorobenzoate 4 with oligonucleotides (18- and 20-mers) modified in the 5'-position with a hexylamine linker. Oligodeoxynucleotides 5'-GCT,AAG,CGA,TGC,CTC,CGT-3' (MTCa) and 5'-GAA,CCT,CTG,AGA,GTT,CAT,CT-3' (CROa) were labelled in 20±3 % (MTCa) and 13±3 % (CROa) radiochemical yields (non-isolated, decay-corrected and based on 4). Oligonucleoside phosphorotioates MTCa (S-MTCa) and CROa (S-CROa) were labelled in 9 and 7% isolated radiochemical yield, respectively (decay-corrected and based on 4). Labelled oligonucleotides and phosphorothioate analogues were separated from their unlabelled counterparts using reversed-phase perfusion chromatography. The molecular mass of a labelled oligonucleotide CROa was determined by ESI-MS after a mixed 18 F/ 19 F fluorobenzoate labelling experiment and corresponded with the expected structure. (au)

Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

DEFF Research Database (Denmark)

Lund, Anders Henrik; Duch, M; Lovmand, J

1997-01-01

, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

Nanotechnology: A Policy Primer

Science.gov (United States)

2013-06-24

savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

MPprimer: a program for reliable multiplex PCR primer design

Directory of Open Access Journals (Sweden)

Wang Xiaolei

2010-03-01

Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

16S rRNA gene-based phylogenetic microarray for simultaneous identification of members of the genus Burkholderia.

Science.gov (United States)

Schönmann, Susan; Loy, Alexander; Wimmersberger, Céline; Sobek, Jens; Aquino, Catharine; Vandamme, Peter; Frey, Beat; Rehrauer, Hubert; Eberl, Leo

2009-04-01

For cultivation-independent and highly parallel analysis of members of the genus Burkholderia, an oligonucleotide microarray (phylochip) consisting of 131 hierarchically nested 16S rRNA gene-targeted oligonucleotide probes was developed. A novel primer pair was designed for selective amplification of a 1.3 kb 16S rRNA gene fragment of Burkholderia species prior to microarray analysis. The diagnostic performance of the microarray for identification and differentiation of Burkholderia species was tested with 44 reference strains of the genera Burkholderia, Pandoraea, Ralstonia and Limnobacter. Hybridization patterns based on presence/absence of probe signals were interpreted semi-automatically using the novel likelihood-based strategy of the web-tool Phylo- Detect. Eighty-eight per cent of the reference strains were correctly identified at the species level. The evaluated microarray was applied to investigate shifts in the Burkholderia community structure in acidic forest soil upon addition of cadmium, a condition that selected for Burkholderia species. The microarray results were in agreement with those obtained from phylogenetic analysis of Burkholderia 16S rRNA gene sequences recovered from the same cadmiumcontaminated soil, demonstrating the value of the Burkholderia phylochip for determinative and environmental studies.

Synthesis and Biophysical Investigations of Oligonucleotides Containing Galactose-Modified DNA, LNA and 2'-Amino-LNA Monomers

DEFF Research Database (Denmark)

Ries, Annika; Kumar, Rajesh; Lou, Chenguang

2016-01-01

Galactose-modified thymidine, LNA-T and 2'-amino-LNA-T nucleosides were synthesized, converted into the corresponding phosphoramidite derivatives and introduced into short oligonucleotides. Compared to the unmodified control strands, the galactose-modified oligonucleotides in general, and the N2'...

Predictive maintenance primer

International Nuclear Information System (INIS)

Flude, J.W.; Nicholas, J.R.

1991-04-01

This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

China Energy Primer

Energy Technology Data Exchange (ETDEWEB)

Ni, Chun Chun

2009-11-16

Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

Hierarchical ordering with partial pairwise hierarchical relationships on the macaque brain data sets.

Directory of Open Access Journals (Sweden)

Woosang Lim

Full Text Available Hierarchical organizations of information processing in the brain networks have been known to exist and widely studied. To find proper hierarchical structures in the macaque brain, the traditional methods need the entire pairwise hierarchical relationships between cortical areas. In this paper, we present a new method that discovers hierarchical structures of macaque brain networks by using partial information of pairwise hierarchical relationships. Our method uses a graph-based manifold learning to exploit inherent relationship, and computes pseudo distances of hierarchical levels for every pair of cortical areas. Then, we compute hierarchy levels of all cortical areas by minimizing the sum of squared hierarchical distance errors with the hierarchical information of few cortical areas. We evaluate our method on the macaque brain data sets whose true hierarchical levels are known as the FV91 model. The experimental results show that hierarchy levels computed by our method are similar to the FV91 model, and its errors are much smaller than the errors of hierarchical clustering approaches.

The Dynamics of Compound, Transcript, and Protein Effects After Treatment With 2OMePS Antisense Oligonucleotides in mdx Mice

Directory of Open Access Journals (Sweden)

Ingrid E C Verhaart

2014-01-01

Full Text Available Antisense-mediated exon skipping is currently in clinical development for Duchenne muscular dystrophy (DMD to amend the consequences of the underlying genetic defect and restore dystrophin expression. Due to turnover of compound, transcript, and protein, chronic treatment with effector molecules (antisense oligonucleotides will be required. To investigate the dynamics and persistence of antisense 2′-O-methyl phosphorothioate oligonucleotides, exon skipping, and dystrophin expression after dosing was concluded, mdx mice were treated subcutaneously for 8 weeks with 100 mg/kg oligonucleotides twice weekly. Thereafter, mice were sacrificed at different time points after the final injection (36 hours–24 weeks. Oligonucleotide half-life was longer in heart (~65 days compared with that in skeletal muscle, liver, and kidney (~35 days. Exon skipping half-lives varied between 33 and 53 days, whereas dystrophin protein showed a long half-life (>100 days. Oligonucleotide and exon-skipping levels peaked in the first week and declined thereafter. By contrast, dystrophin expression peaked after 3–8 weeks and then slowly declined, remaining detectable after 24 weeks. Concordance between levels of oligonucleotides, exon skipping, and proteins was observed, except in heart, wherein high oligonucleotide levels but low exon skipping and dystrophin expression were seen. Overall, these results enhance our understanding of the pharmacokinetics and pharmacodynamics of 2′-O-methyl phosphorothioate oligos used for the treatment of DMD.

Streptavidin-coated gold nanoparticles: critical role of oligonucleotides on stability and fractal aggregation

Directory of Open Access Journals (Sweden)

Roberta D'Agata

2017-01-01

Full Text Available Gold nanoparticles (AuNPs exhibit unique properties that can be modulated through a tailored surface functionalization, enabling their targeted use in biochemical sensing and medical diagnostics. In particular, streptavidin-modified AuNPs are increasingly used for biosensing purposes. We report here a study of AuNPs surface-functionalized with streptavidin-biotinylated oligonucleotide, focussing on the role played by the oligonucleotide probes in the stabilization/destabilization of the functionalized nanoparticle dispersion. The behaviour of the modified AuNP dispersion as a consequence of the competitive displacement of the biotinylated oligonucleotide has been investigated and the critical role of displaced oligonucletides in triggering the quasi one-dimensional aggregation of nanoparticles is demonstrated for the first time. The thorough understanding of the fundamental properties of bioconjugated AuNPs is of great importance for the design of highly sensitive and reliable functionalized AuNP-based assays.

The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization

Science.gov (United States)

2013-01-01

Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545

MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

Directory of Open Access Journals (Sweden)

Kitchen James L

2012-11-01

Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

Science.gov (United States)

Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

2012-11-05

Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

DETECTING LOW-LEVEL SYNTHESIS IMPURITIES IN MODIFIED PHOSPHOROTHIOATE OLIGONUCLEOTIDES USING LIQUID CHROMATOGRAPHY – HIGH RESOLUTION MASS SPECTROMETRY

Science.gov (United States)

Nikcevic, Irena; Wyrzykiewicz, Tadeusz K.; Limbach, Patrick A.

2010-01-01

Summary An LC-MS method based on the use of high resolution Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS) for profiling oligonucleotides synthesis impurities is described. Oligonucleotide phosphorothioatediesters (phosphorothioate oligonucleotides), in which one of the non-bridging oxygen atoms at each phosphorus center is replaced by a sulfur atom, are now one of the most popular oligonucleotide modifications due to their ease of chemical synthesis and advantageous pharmacokinetic properties. Despite significant progress in the solid-phase oligomerization chemistry used in the manufacturing of these oligonucleotides, multiple classes of low-level impurities always accompany synthetic oligonucleotides. Liquid chromatography-mass spectrometry has emerged as a powerful technique for the identification of these synthesis impurities. However, impurity profiling, where the entire complement of low-level synthetic impurities is identified in a single analysis, is more challenging. Here we present an LC-MS method based the use of high resolution-mass spectrometry, specifically Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS or FTMS). The optimal LC-FTMS conditions, including the stationary phase and mobile phases for the separation and identification of phosphorothioate oligonucleotides, were found. The characteristics of FTMS enable charge state determination from single m/z values of low-level impurities. Charge state information then enables more accurate modeling of the detected isotopic distribution for identification of the chemical composition of the detected impurity. Using this approach, a number of phosphorothioate impurities can be detected by LC-FTMS including failure sequences carrying 3′-terminal phosphate monoester and 3′-terminal phosphorothioate monoester, incomplete backbone sulfurization and desulfurization products, high molecular weight impurities, and chloral, isobutyryl, and N3 (2-cyanoethyl) adducts

Structural properties of oligonucleotide monolayers on gold surfaces probed by fluorescence investigations.

Science.gov (United States)

Rant, Ulrich; Arinaga, Kenji; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard; Tornow, Marc

2004-11-09

We present optical investigations on the conformation of oligonucleotide layers on Au surfaces. Our studies concentrate on the effect of varying surface coverage densities on the structural properties of layers of 12- and 24mer single-stranded DNA, tethered to the Au surface at one end while being labeled with a fluorescent marker at the opposing end. The distance-dependent energy transfer from the marker dye to the metal surface, which causes quenching of the observed fluorescence, is used to provide information on the orientation of the DNA strands relative to the surface. Variations in the oligonucleotide coverage density, as determined from electrochemical quantification, over 2 orders of magnitude are achieved by employing different preparation conditions. The observed enhancement in fluorescence intensity with increasing DNA coverage can be related to a model involving mutual steric interactions of oligonucleotides on the surface, as well as fluorescence quenching theory. Finally, the applicability of the presented concepts for investigations of heterogeneous monolayers is demonstrated by means of studying the coadsorption of mercaptohexanol onto DNA-modified Au surfaces.

Factor XI Antisense Oligonucleotide for Prevention of Venous Thrombosis

NARCIS (Netherlands)

Büller, Harry R.; Bethune, Claudette; Bhanot, Sanjay; Gailani, David; Monia, Brett P.; Raskob, Gary E.; Segers, Annelise; Verhamme, Peter; Weitz, Jeffrey I.; Weitz, Jeffrey; Prins, Martin; Beenen, Ludo; Otten, Hans-Martin; Roos, Yvo; Slagboom, Ton; Vandenbriele, Christophe; Vanassche, Thomas; Dani, Vidhi; Schulz, Dan; Shapiro, Cara; Kwoh, Katherine; Jung, Bill; Gawinek-Samelczak, Agata; Kaemmer, Christina; Angelov, S.; Stavrev, V.; Kinov, P.; Dessouki, E.; Abuzgaya, F.; Baurovskis, A.; Peredistijs, A.; Petronis, S.; Danilyak, V.; Driagin, V.; Kuropatkin, G.; Parfeev, S.; Safronov, A.; Ankin, M.; Korzh, M.; Olinichenko, G.; Polivoda, A.; Shevchenko, V.; Sulyma, V.

2015-01-01

Background Experimental data indicate that reducing factor XI levels attenuates thrombosis without causing bleeding, but the role of factor XI in the prevention of postoperative venous thrombosis in humans is unknown. FXI-ASO (ISIS 416858) is a second-generation antisense oligonucleotide that

[Oligonucleotide derivatives in the nucleic acid hybridization analysis. I. Covalent immobilization of oligonucleotide probes onto the nylon].

Science.gov (United States)

Dmitrienko, E V; Pyshnaia, I A; Pyshnyĭ, D V

2010-01-01

The features of UV-induced immobilization of oligonucleotides on a nylon membranes and the effectiveness of enzymatic labeling of immobilized probes at heterophase detection of nucleic acids are studied. Short terminal oligothymidilate (up to 10 nt) sequences are suggested to attach to the probe via a flexible ethylene glycol based linker. The presence of such fragment enhances the intensity of immobilization and reduces UV-dependent degradation of the targeted (sequence-specific) part of the probe by reducing the dose needed for the immobilization of DNA. The optimum dose of UV-irradiation is determined to be ~0.4 J/cm(2) at the wavelength 254 nm. This dose provides high level of hybridization signal for immobilized probes with various nucleotide composition of the sequence specific moiety. The amide groups of the polyamide are shown to play the key role in the photoinduced immobilization of nucleic acids, whereas the primary amino groups in the structure of PA is not the center responsible for the covalent binding of DNA by UV-irradiation, as previously believed. Various additives in the soaking solution during the membrane of UV-dependent immobilization of probes are shown to influence its effectiveness. The use of alternative to UV-irradiation system of radical generation are shown to provide the immobilization of oligonucleotides onto the nylon membrane.

High-speed measurement of firearm primer blast waves

OpenAIRE

Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

2012-01-01

This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

Oligonucleotide Aptamers: New Tools for Targeted Cancer Therapy

Directory of Open Access Journals (Sweden)

Hongguang Sun

2014-01-01

Full Text Available Aptamers are a class of small nucleic acid ligands that are composed of RNA or single-stranded DNA oligonucleotides and have high specificity and affinity for their targets. Similar to antibodies, aptamers interact with their targets by recognizing a specific three-dimensional structure and are thus termed “chemical antibodies.” In contrast to protein antibodies, aptamers offer unique chemical and biological characteristics based on their oligonucleotide properties. Hence, they are more suitable for the development of novel clinical applications. Aptamer technology has been widely investigated in various biomedical fields for biomarker discovery, in vitro diagnosis, in vivo imaging, and targeted therapy. This review will discuss the potential applications of aptamer technology as a new tool for targeted cancer therapy with emphasis on the development of aptamers that are able to specifically target cell surface biomarkers. Additionally, we will describe several approaches for the use of aptamers in targeted therapeutics, including aptamer-drug conjugation, aptamer-nanoparticle conjugation, aptamer-mediated targeted gene therapy, aptamer-mediated immunotherapy, and aptamer-mediated biotherapy.

Detection of mutations in genes by specific LNA primers

DEFF Research Database (Denmark)

2001-01-01

acid (LNA). LNA oligomers obey the Watson-Crick base-pairing rules and form duplexes that are significantly more stable than similar duplexes formed by DNA. The "allele-specific" LNA-containing oligonucleotides wherein the LNA nucleotide(s) are found at the 3' position can be extended by means......The present invention relates to a method of detecting variant nucleic acid whose nucleotide sequence differs from one another at a single (or more) position(s). The method uses a set of chimeric oligonucleotides containing DNA monomers and monomers of a novel class of DNA analogues, locked nucleic...

Identifying members of the domain Archaea with rRNA-targeted oligonucleotide probes.

Science.gov (United States)

Burggraf, S; Mayer, T; Amann, R; Schadhauser, S; Woese, C R; Stetter, K O

1994-09-01

Two 16S rRNA-targeted oligonucleotide probes were designed for the archaeal kingdoms Euryachaeota and Crenarchaeota. Probe specificities were evaluated by nonradioactive dot blot hybridization against selected reference organisms. The successful application of fluorescent-probe derivatives for whole-cell hybridization required organism-specific optimizations of fixation and hybridization conditions to assure probe penetration and morphological integrity of the cells. The probes allowed preliminary grouping of three new hyperthermophilic isolates. Together with other group-specific rRNA-targeted oligonucleotide probes, these probes will facilitate rapid in situ monitoring of the populations present in hydrothermal systems and support cultivation attempts.

LNA-modified oligonucleotides mediate specific inhibition of microRNA function

DEFF Research Database (Denmark)

Ørom, Ulf Andersson; Kauppinen, Sakari; Lund, Anders H

2006-01-01

microRNAs are short, endogenous non-coding RNAs that act as post-transcriptional modulators of gene expression. Important functions for microRNAs have been found in the regulation of development, cellular proliferation and differentiation, while perturbed miRNA expression patterns have been...... observed in many human cancers. Here we present a method for specific inhibition of miRNA function through interaction with LNA-modified antisense oligonucleotides and report the specificity of this application. We show that LNA-modified oligonucleotides can inhibit exogenously introduced miRNAs with high...... specificity using a heterologous reporter assay, and furthermore demonstrate their ability to inhibit an endogenous miRNA in Drosophila melanogaster cells, leading to up-regulation of the cognate target protein. The method shows stoichiometric and reliable inhibition of the targeted miRNA and can thus...

Reliability and applications of statistical methods based on oligonucleotide frequencies in bacterial and archaeal genomes

DEFF Research Database (Denmark)

Bohlin, J; Skjerve, E; Ussery, David

2008-01-01

with here are mainly used to examine similarities between archaeal and bacterial DNA from different genomes. These methods compare observed genomic frequencies of fixed-sized oligonucleotides with expected values, which can be determined by genomic nucleotide content, smaller oligonucleotide frequencies......, or be based on specific statistical distributions. Advantages with these statistical methods include measurements of phylogenetic relationship with relatively small pieces of DNA sampled from almost anywhere within genomes, detection of foreign/conserved DNA, and homology searches. Our aim was to explore...... the reliability and best suited applications for some popular methods, which include relative oligonucleotide frequencies (ROF), di- to hexanucleotide zero'th order Markov methods (ZOM) and 2.order Markov chain Method (MCM). Tests were performed on distant homology searches with large DNA sequences, detection...

Characterization of rat brain NCAM mRNA using DNA oligonucleotide probes

DEFF Research Database (Denmark)

Andersson, A M; Gaardsvoll, H; Giladi, E

1990-01-01

A number of different isoforms of the neural cell adhesion molecule (NCAM) have been identified. The difference between these is due to alternative splicing of a single NCAM gene. In rat brain NCAM mRNAs with sizes of 7.4, 6.7, 5.2, 4.3 and 2.9 kb have been reported. We have synthesized six DNA...... oligonucleotides, that hybridize to different exons in the NCAM gene. Furthermore we have constructed three oligonucleotides, that exclusively hybridize to mRNAs lacking certain exons, by letting them consist of sequences adjacent to both sides of the splice sites. By means of these probes we have characterized...... the five NCAM mRNAs in rat brain....

Development, characterization and experimental validation of a cultivated sunflower (Helianthus annuus L.) gene expression oligonucleotide microarray.

Science.gov (United States)

Fernandez, Paula; Soria, Marcelo; Blesa, David; DiRienzo, Julio; Moschen, Sebastian; Rivarola, Maximo; Clavijo, Bernardo Jose; Gonzalez, Sergio; Peluffo, Lucila; Príncipi, Dario; Dosio, Guillermo; Aguirrezabal, Luis; García-García, Francisco; Conesa, Ana; Hopp, Esteban; Dopazo, Joaquín; Heinz, Ruth Amelia; Paniego, Norma

2012-01-01

Oligonucleotide-based microarrays with accurate gene coverage represent a key strategy for transcriptional studies in orphan species such as sunflower, H. annuus L., which lacks full genome sequences. The goal of this study was the development and functional annotation of a comprehensive sunflower unigene collection and the design and validation of a custom sunflower oligonucleotide-based microarray. A large scale EST (>130,000 ESTs) curation, assembly and sequence annotation was performed using Blast2GO (www.blast2go.de). The EST assembly comprises 41,013 putative transcripts (12,924 contigs and 28,089 singletons). The resulting Sunflower Unigen Resource (SUR version 1.0) was used to design an oligonucleotide-based Agilent microarray for cultivated sunflower. This microarray includes a total of 42,326 features: 1,417 Agilent controls, 74 control probes for sunflower replicated 10 times (740 controls) and 40,169 different non-control probes. Microarray performance was validated using a model experiment examining the induction of senescence by water deficit. Pre-processing and differential expression analysis of Agilent microarrays was performed using the Bioconductor limma package. The analyses based on p-values calculated by eBayes (psunflower unigene collection, and a custom, validated sunflower oligonucleotide-based microarray using Agilent technology. Both the curated unigene collection and the validated oligonucleotide microarray provide key resources for sunflower genome analysis, transcriptional studies, and molecular breeding for crop improvement.

N-terminal domains of human DNA polymerase lambda promote primer realignment during translesion DNA synthesis

Science.gov (United States)

Taggart, David J.; Dayeh, Daniel M.; Fredrickson, Saul W.; Suo, Zucai

2014-01-01

The X-family DNA polymerases λ (Polλ) and β (Polβ) possess similar 5′-2-deoxyribose-5-phosphatelyase (dRPase) and polymerase domains. Besides these domains, Polλ also possesses a BRCA1 C-terminal (BRCT) domain and a proline-rich domain at its N terminus. However, it is unclear how these non-enzymatic domains contribute to the unique biological functions of Polλ. Here, we used primer extension assays and a newly developed high-throughput short oligonucleotide sequencing assay (HT-SOSA) to compare the efficiency of lesion bypass and fidelity of human Polβ, Polλ and two N-terminal deletion constructs of Polλ during the bypass of either an abasic site or a 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodG) lesion. We demonstrate that the BRCT domain of Polλ enhances the efficiency of abasic site bypass by approximately 1.6-fold. In contrast, deletion of the N-terminal domains of Polλ did not affect the efficiency of 8-oxodG bypass relative to nucleotide incorporations opposite undamaged dG. HT-SOSA analysis demonstrated that Polλ and Polβ preferentially generated −1 or −2 frameshift mutations when bypassing an abasic site and the single or double base deletion frequency was highly sequence dependent. Interestingly, the BRCT and proline-rich domains of Polλ cooperatively promoted the generation of −2 frameshift mutations when the abasic site was situated within a sequence context that was susceptible to homology-driven primer realignment. Furthermore, both N-terminal domains of Polλ increased the generation of −1 frameshift mutations during 8-oxodG bypass and influenced the frequency of substitution mutations produced by Polλ opposite the 8-oxodG lesion. Overall, our data support a model wherein the BRCT and proline-rich domains of Polλ act cooperatively to promote primer/template realignment between DNA strands of limited sequence homology. This function of the N-terminal domains may facilitate the role of Polλ as a gap-filling polymerase

Hexavalent Chromium IV-Free Primer Development

Science.gov (United States)

Alldredge, Michael J.; Buck, Amy L.

2015-01-01

Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

Development of Multiexon Skipping Antisense Oligonucleotide Therapy for Duchenne Muscular Dystrophy

Science.gov (United States)

Yokota, Toshifumi; Wood, Matthew J. A.

2013-01-01

Duchenne muscular dystrophy (DMD) is an incurable, X-linked progressive muscle degenerative disorder that results from the absence of dystrophin protein and leads to premature death in affected individuals due to respiratory and/or cardiac failure typically by age of 30. Very recently the exciting prospect of an effective oligonucleotide therapy has emerged which restores dystrophin protein expression to affected tissues in DMD patients with highly promising data from a series of clinical trials. This therapeutic approach is highly mutation specific and thus is personalised. Therefore DMD has emerged as a model genetic disorder for understanding and overcoming of the challenges of developing personalised genetic medicines. One of the greatest weaknesses of the current oligonucleotide approach is that it is a mutation-specific therapy. To address this limitation, we have recently demonstrated that exons 45–55 skipping therapy has the potential to treat clusters of mutations that cause DMD, which could significantly reduce the number of compounds that would need to be developed in order to successfully treat all DMD patients. Here we discuss and review the latest preclinical work in this area as well as a variety of accompanying issues, including efficacy and potential toxicity of antisense oligonucleotides, prior to human clinical trials. PMID:23984357

A one-step reaction for the rapid identification of Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti using oligonucleotide primers designed from the 16S-23S rRNA intergenic sequences.

Science.gov (United States)

Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X

2008-06-01

Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.

Lipid-modified G4-decoy oligonucleotide anchored to nanoparticles

DEFF Research Database (Denmark)

Cogoi, S; Jakobsen, U; Pedersen, E B

2016-01-01

KRAS is mutated in >90% of pancreatic ductal adenocarcinomas. As its inactivation leads to tumour regression, mutant KRAS is considered an attractive target for anticancer drugs. In this study we report a new delivery strategy for a G4-decoy oligonucleotide that sequesters MAZ, a transcription fa...

Multiplexing Short Primers for Viral Family PCR

Energy Technology Data Exchange (ETDEWEB)

Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

2008-06-26

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

International Nuclear Information System (INIS)

Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

2013-01-01

To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

Assessing the Interplay between the Physicochemical Parameters of Ion-Pairing Reagents and the Analyte Sequence on the Electrospray Desorption Process for Oligonucleotides

Science.gov (United States)

Basiri, Babak; Murph, Mandi M.; Bartlett, Michael G.

2017-08-01

Alkylamines are widely used as ion-pairing agents during LC-MS of oligonucleotides. In addition to a better chromatographic separation, they also assist with the desorption of oligonucleotide ions into the gas phase, cause charge state reduction, and decrease cation adduction. However, the choice of such ion-pairing agents has considerable influence on the MS signal intensity of oligonucleotides as they can also cause significant ion suppression. Interestingly, optimal ion-pairing agents should be selected on a case by case basis as their choice is strongly influenced by the sequence of the oligonucleotide under investigation. Despite imposing major practical difficulties to analytical method development, such a highly variable system that responds very strongly to the nuances of the electrospray composition provides an excellent opportunity for a fundamental study of the electrospray ionization process. Our investigations using this system quantitatively revealed the major factors that influenced the ESI ionization efficiency of oligonucleotides. Parameters such as boiling point, proton affinity, partition coefficient, water solubility, and Henry's law constants for the ion-pairing reagents and the hydrophobic thymine content of the oligonucleotides were found to be the most significant contributors. Identification of these parameters also allowed for the development of a statistical predictive algorithm that can assist with the choice of an optimum IP agent for each particular oligonucleotide sequence. We believe that research in the field of oligonucleotide bioanalysis will significantly benefit from this algorithm (included in Supplementary Material) as it advocates for the use of lesser-known but more suitable ion-pair alternatives to TEA for many oligonucleotide sequences.

A simple RT-PCR-based strategy for screening connexin identity

Directory of Open Access Journals (Sweden)

M. Urban

1999-08-01

Full Text Available Vertebrate gap junctions are aggregates of transmembrane channels which are composed of connexin (Cx proteins encoded by at least fourteen distinct genes in mammals. Since the same Cx type can be expressed in different tissues and more than one Cx type can be expressed by the same cell, the thorough identification of which connexin is in which cell type and how connexin expression changes after experimental manipulation has become quite laborious. Here we describe an efficient, rapid and simple method by which connexin type(s can be identified in mammalian tissue and cultured cells using endonuclease cleavage of RT-PCR products generated from "multi primers" (sense primer, degenerate oligonucleotide corresponding to a region of the first extracellular domain; antisense primer, degenerate oligonucleotide complementary to the second extracellular domain that amplify the cytoplasmic loop regions of all known connexins except Cx36. In addition, we provide sequence information on RT-PCR primers used in our laboratory to screen individual connexins and predictions of extension of the "multi primer" method to several human connexins.

KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

International Nuclear Information System (INIS)

Busch, R.D.

2003-01-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

Primer on spontaneous heating and pyrophoricity

Energy Technology Data Exchange (ETDEWEB)

1994-12-01

This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

30 CFR 57.6304 - Primer protection.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

Phage annealing proteins promote oligonucleotide-directed mutagenesis in Escherichia coli and mouse ES cells

Directory of Open Access Journals (Sweden)

Muyrers Joep PP

2003-01-01

Full Text Available Abstract Background The phage protein pairs, RecE/RecT from Rac or Redα/Redβ from λ, initiate efficient double strand break repair (DSBR in Escherichia coli that has proven very useful for DNA engineering. These phage pairs initiate DSBR either by annealing or by another mechanism that is not defined. Results Here we report that these proteins also mediate single strand oligonucleotide repair (ssOR at high efficiencies. The ssOR activity, unlike DSBR, does not require a phage exonuclease (RecE or Redα but only requires a phage annealing protein (RecT or Redβ. Notably, the P22 phage annealing protein Erf, which does not mediate the same DSBR reactions, also delivers ssOR activity. By altering aspects of the oligonucleotides, we document length and design parameters that affect ssOR efficiency to show a simple relationship to homologies either side of the repair site. Notably, ssOR shows strand bias. Oligonucleotides that can prime lagging strand replication deliver more ssOR than their leading complements. This suggests a model in which the annealing proteins hybridize the oligonucleotides to single stranded regions near the replication fork. We also show that ssOR is a highly efficient way to engineer BACs and can be detected in a eukaryotic cell upon expression of a phage annealing protein. Conclusion Phage annealing proteins can initiate the recombination of single stranded oligonucleotides into endogenous targets in Escherichia coli at very high efficiencies. This expands the repertoire of useful DNA engineering strategies, shows promise for applications in eukaryotic cells, and has implications for the unanswered questions regarding DSBR mediated by RecE/RecT and Redα/Redβ.

Ultramild protein-mediated click chemistry creates efficient oligonucleotide probes for targeting and detecting nucleic acids

DEFF Research Database (Denmark)

Nåbo, Lina J.; Madsen, Charlotte S.; Jensen, Knud J.

2015-01-01

Functionalized synthetic oligonucleotides are finding growing applications in research, clinical studies, and therapy. However, it is not easy to prepare them in a biocompatible and highly efficient manner. We report a new strategy to synthesize oligonucleotides with promising nucleic acid...... targeting and detection properties. We focus in particular on the pH sensitivity of these new probes and their high target specificity. For the first time, human copper(I)-binding chaperon Cox17 was applied to effectively catalyze click labeling of oligonucleotides. This was performed under ultramild...... conditions with fluorophore, peptide, and carbohydrate azide derivatives. In thermal denaturation studies, the modified probes showed specific binding to complementary DNA and RNA targets. Finally, we demonstrated the pH sensitivity of the new rhodamine-based fluorescent probes in vitro and rationalize our...

Oligonucleotide aptamers against tyrosine kinase receptors: Prospect for anticancer applications.

Science.gov (United States)

Camorani, Simona; Crescenzi, Elvira; Fedele, Monica; Cerchia, Laura

2018-04-01

Transmembrane receptor tyrosine kinases (RTKs) play crucial roles in cancer cell proliferation, survival, migration and differentiation. Area of intense research is searching for effective anticancer therapies targeting these receptors and, to date, several monoclonal antibodies and small-molecule tyrosine kinase inhibitors have entered the clinic. However, some of these drugs show limited efficacy and give rise to acquired resistance. Emerging highly selective compounds for anticancer therapy are oligonucleotide aptamers that interact with their targets by recognizing a specific three-dimensional structure. Because of their nucleic acid nature, the rational design of advanced strategies to manipulate aptamers for both diagnostic and therapeutic applications is greatly simplified over antibodies. In this manuscript, we will provide a comprehensive overview of oligonucleotide aptamers as next generation strategies to efficiently target RTKs in human cancers. Copyright © 2018 Elsevier B.V. All rights reserved.

Resolving prokaryotic taxonomy without rRNA: longer oligonucleotide word lengths improve genome and metagenome taxonomic classification.

Science.gov (United States)

Alsop, Eric B; Raymond, Jason

2013-01-01

Oligonucleotide signatures, especially tetranucleotide signatures, have been used as method for homology binning by exploiting an organism's inherent biases towards the use of specific oligonucleotide words. Tetranucleotide signatures have been especially useful in environmental metagenomics samples as many of these samples contain organisms from poorly classified phyla which cannot be easily identified using traditional homology methods, including NCBI BLAST. This study examines oligonucleotide signatures across 1,424 completed genomes from across the tree of life, substantially expanding upon previous work. A comprehensive analysis of mononucleotide through nonanucleotide word lengths suggests that longer word lengths substantially improve the classification of DNA fragments across a range of sizes of relevance to high throughput sequencing. We find that, at present, heptanucleotide signatures represent an optimal balance between prediction accuracy and computational time for resolving taxonomy using both genomic and metagenomic fragments. We directly compare the ability of tetranucleotide and heptanucleotide world lengths (tetranucleotide signatures are the current standard for oligonucleotide word usage analyses) for taxonomic binning of metagenome reads. We present evidence that heptanucleotide word lengths consistently provide more taxonomic resolving power, particularly in distinguishing between closely related organisms that are often present in metagenomic samples. This implies that longer oligonucleotide word lengths should replace tetranucleotide signatures for most analyses. Finally, we show that the application of longer word lengths to metagenomic datasets leads to more accurate taxonomic binning of DNA scaffolds and have the potential to substantially improve taxonomic assignment and assembly of metagenomic data.

Resolving prokaryotic taxonomy without rRNA: longer oligonucleotide word lengths improve genome and metagenome taxonomic classification.

Directory of Open Access Journals (Sweden)

Eric B Alsop

Full Text Available Oligonucleotide signatures, especially tetranucleotide signatures, have been used as method for homology binning by exploiting an organism's inherent biases towards the use of specific oligonucleotide words. Tetranucleotide signatures have been especially useful in environmental metagenomics samples as many of these samples contain organisms from poorly classified phyla which cannot be easily identified using traditional homology methods, including NCBI BLAST. This study examines oligonucleotide signatures across 1,424 completed genomes from across the tree of life, substantially expanding upon previous work. A comprehensive analysis of mononucleotide through nonanucleotide word lengths suggests that longer word lengths substantially improve the classification of DNA fragments across a range of sizes of relevance to high throughput sequencing. We find that, at present, heptanucleotide signatures represent an optimal balance between prediction accuracy and computational time for resolving taxonomy using both genomic and metagenomic fragments. We directly compare the ability of tetranucleotide and heptanucleotide world lengths (tetranucleotide signatures are the current standard for oligonucleotide word usage analyses for taxonomic binning of metagenome reads. We present evidence that heptanucleotide word lengths consistently provide more taxonomic resolving power, particularly in distinguishing between closely related organisms that are often present in metagenomic samples. This implies that longer oligonucleotide word lengths should replace tetranucleotide signatures for most analyses. Finally, we show that the application of longer word lengths to metagenomic datasets leads to more accurate taxonomic binning of DNA scaffolds and have the potential to substantially improve taxonomic assignment and assembly of metagenomic data.

Pharmacokinetics on a microscale: visualizing Cy5-labeled oligonucleotide release from poly(n-butylcyanoacrylate nanocapsules in cells

Directory of Open Access Journals (Sweden)

Tomcin S

2014-11-01

Full Text Available Stephanie Tomcin,1 Grit Baier,1 Katharina Landfester,1 Volker Mailänder1,21Max Planck Institute for Polymer Research, 2University Medical Center of the Johannes Gutenberg University, III Medical Clinic, Mainz, GermanyAbstract: For successful design of a nanoparticulate drug delivery system, the fate of the carrier and cargo need to be followed. In this work, we fluorescently labeled poly(n-butylcyanoacrylate (PBCA nanocapsules as a shell and separately an oligonucleotide (20 mer as a payload. The nanocapsules were formed by interfacial anionic polymerization on aqueous droplets generated by an inverse miniemulsion process. After uptake, the PBCA capsules were shown to be round-shaped, endosomal structures and the payload was successfully released. Cy5-labeled oligonucleotides accumulated at the mitochondrial membrane due to a combination of the high mitochondrial membrane potential and the specific molecular structure of Cy5. The specificity of this accumulation at the mitochondria was shown as the uncoupler dinitrophenol rapidly diminished the accumulation of the Cy5-labeled oligonucleotide. Importantly, a fluorescence resonance energy transfer investigation showed that the dye-labeled cargo (Cy3/Cy5-labeled oligonucleotides reached its target site without degradation during escape from an endosomal compartment to the cytoplasm. The time course of accumulation of fluorescent signals at the mitochondria was determined by evaluating the colocalization of Cy5-labeled oligonucleotides and mitochondrial markers for up to 48 hours. As oligonucleotides are an ideal model system for small interfering RNA PBCA nanocapsules demonstrate to be a versatile delivery platform for small interfering RNA to treat a variety of diseases.Keywords: drug delivery, mitochondria, miniemulsion, colocalization

Identification and DNA fingerprinting of Legionella strains by randomly amplified polymorphic DNA analysis.

OpenAIRE

Bansal, N S; McDonell, F

1997-01-01

The randomly amplified polymorphic DNA (RAPD) technique was used in the development of a fingerprinting (typing) and identification protocol for Legionella strains. Twenty decamer random oligonucleotide primers were screened for their discriminatory abilities. Two candidate primers were selected. By using a combination of these primers, RAPD analysis allowed for the differentiation between all different species, between the serogroups, and further differentiation between subtypes of the same ...

Spatially Defined Oligonucleotide Arrays. Technical Report for Phase II; FINAL

International Nuclear Information System (INIS)

None

2000-01-01

The goal of the Human Genome Project is to sequence all 3 billion base pairs of the human genome. Progress in this has been rapid; GenBank(reg s ign) finished 1994 with 286 million bases of sequence and grew by 2470 in the first quarter of 1995. The challenge to the scientific community is to understand the biological relevance of this genetic information. In most cases the sequence being generated for any single region of the genome represents the genotype of a single individual. A complete understanding of the function of specific genes and other regions of the genome and their role in human disease and development will only become apparent when the sequence of many more individuals is known. Access to genetic information is ultimately limited by the ability to screen DNA sequence. Although the pioneering sequencing methods of Sanger et al. (15) and Maxam and Gilbert (11) have become standard in virtually all molecular biology laboratories, the basic protocols remain largely unchanged. The throughput of this sequencing technology is now becoming the rate-limiting step in both large-scale sequencing projects such as the Human Genome Project and the subsequent efforts to understand genetic diversity. This has inspired the development of advanced DNA sequencing technologies (9), Incremental improvements to Sanger sequencing have been made in DNA labeling and detection. High-speed electrophoresis methods using ultrathin gels or capillary arrays are now being more widely employed. However, these methods are throughput-limited by their sequential nature and the speed and resolution of separations. This limitation will become more pronounced as the need to rapidly screen newly discovered genes for biologically relevant polymorphisms increases. An alternative to gel-based sequencing is to use high-density oligonucleotide probe arrays. Oligonucleotide probe arrays display specific oligonucleotide probes at precise locations in a high density, information-rich format (5

Rust transformation/rust compatible primers

Science.gov (United States)

Emeric, Dario A.; Miller, Christopher E.

1993-01-01

Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

An oral oligonucleotide delivery system based on a thiolated polymer: Development and in vitro evaluation.

Science.gov (United States)

Martien, Ronny; Hoyer, Herbert; Perera, Glen; Schnürch, Andreas Bernkop

2011-08-01

The purpose of this study was to develop and evaluate an oral oligonucleotide delivery system based on a thiolated polymer/reduced glutathione (GSH) system providing a protective effect toward nucleases and permeation enhancement. A polycarbophil-cysteine conjugate (PCP-Cys) was synthesized. Enzymatic degradation of a model oligonucleotide by DNase I and within freshly collected intestinal fluid was investigated in the absence and presence of PCP-Cys. Permeation studies with PCP-Cys/GSH versus control were performed in vitro on Caco-2 cell monolayers and ex vivo on rat intestinal mucosa. PCP-Cys displayed 223 ± 13.8 μmol thiol groups per gram polymer. After 4h, 61% of the free oligonucleotides were degraded by DNase I and 80% within intestinal fluid. In contrast, less than 41% (DNase I) and 60% (intestinal fluid) were degraded in the presence of 0.02% (m/v) PCP-Cys. Permeation studies revealed an 8-fold (Caco-2) and 10-fold (intestinal mucosa) increase in apparent permeability compared to buffer control. Hence, this PCP-Cys/GSH system might be a promising tool for the oral administration of oligonucleotides as it allows a significant protection toward degrading enzymes and facilitates their transport across intestinal membranes. Copyright © 2011 Elsevier B.V. All rights reserved.

Advances in Antisense Oligonucleotide Development for Target Identification, Validation, and as Novel Therapeutics

Directory of Open Access Journals (Sweden)

Moizza Mansoor

2008-01-01

Full Text Available Antisense oligonucleotides (As-ODNs are single stranded, synthetically prepared strands of deoxynucleotide sequences, usually 18–21 nucleotides in length, complementary to the mRNA sequence of the target gene. As-ODNs are able to selectively bind cognate mRNA sequences by sequence-specific hybridization. This results in cleavage or disablement of the mRNA and, thus, inhibits the expression of the target gene. The specificity of the As approach is based on the probability that, in the human genome, any sequence longer than a minimal number of nucleotides (nt, 13 for RNA and 17 for DNA, normally occurs only once. The potential applications of As-ODNs are numerous because mRNA is ubiquitous and is more accessible to manipulation than DNA. With the publication of the human genome sequence, it has become theoretically possible to inhibit mRNA of almost any gene by As-ODNs, in order to get a better understanding of gene function, investigate its role in disease pathology and to study novel therapeutic targets for the diseases caused by dysregulated gene expression. The conceptual simplicity, the availability of gene sequence information from the human genome, the inexpensive availability of synthetic oligonucleotides and the possibility of rational drug design makes As-ODNs powerful tools for target identification, validation and therapeutic intervention. In this review we discuss the latest developments in antisense oligonucleotide design, delivery, pharmacokinetics and potential side effects, as well as its uses in target identification and validation, and finally focus on the current developments of antisense oligonucleotides in therapeutic intervention in various diseases.

Sequence-Dependent Mechanism of DNA Oligonucleotide Dehybridization Resolved through Infrared Spectroscopy.

Science.gov (United States)

Sanstead, Paul J; Stevenson, Paul; Tokmakoff, Andrei

2016-09-14

Despite its important role in biology and nanotechnology, many questions remain regarding the molecular mechanism and dynamics by which oligonucleotides recognize and hybridize to their complementary sequence. The thermodynamics and kinetics of DNA oligonucleotide hybridization and dehybridization are often assumed to involve an all-or-nothing two-state dissociation pathway, but deviations from this behavior can be considerable even for short sequences. We introduce a new strategy to characterize the base-pair-specific thermal dissociation mechanism of DNA oligonucleotides through steady-state and time-resolved infrared spectroscopy. Experiments are interpreted with a lattice model to provide a structure-specific interpretation. This method is applied to a model set of self-complementary 10-base-pair sequences in which the placement of GC base pairs is varied in an otherwise AT strand. Through a combination of Fourier transform infrared and two-dimensional infrared spectroscopy, experiments reveal varying degrees of deviation from simple two-state behavior. As the temperature is increased, duplexes dissociate through a path in which the terminal bases fray, without any significant contribution from loop configurations. Transient temperature jump experiments reveal time scales of 70-100 ns for fraying and 10-30 μs for complete dissociation near the melting temperature. Whether or not frayed states are metastable intermediates or short-lived configurations during the full dissociation of the duplex is dictated by the nucleobase sequence.

An iterative method for selecting degenerate multiplex PCR primers.

Science.gov (United States)

Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

2007-01-01

Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

Directory of Open Access Journals (Sweden)

Dunn Sade N

2008-06-01

Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

Isothermal Amplification and Lateral-Flow Assay for Detecting Crown-Gall-Causing Agrobacterium spp.

Science.gov (United States)

Fuller, Skylar L; Savory, Elizabeth A; Weisberg, Alexandra J; Buser, Jessica Z; Gordon, Michael I; Putnam, Melodie L; Chang, Jeff H

2017-09-01

Agrobacterium is a genus of soilborne gram-negative bacteria. Members carrying oncogenic plasmids can cause crown gall disease, which has significant economic costs, especially for the orchard and nursery industries. Early and rapid detection of pathogenic Agrobacterium spp. is key to the management of crown gall disease. To this end, we designed oligonucleotide primers and probes to target virD2 for use in a molecular diagnostic tool that relies on isothermal amplification and lateral-flow-based detection. The oligonucleotide tools were tested in the assay and evaluated for detection limit and specificity in detecting alleles of virD2. One set of primers that successfully amplified virD2 when used with an isothermal recombinase was selected. Both tested probes had detection limits in picogram amounts of DNA. Probe 1 could detect all tested pathogenic isolates that represented most of the diversity of virD2. Finally, the coupling of lateral-flow detection to the use of these oligonucleotide primers in isothermal amplification helped to reduce the onerousness of the process, and alleviated reliance on specialized tools necessary for molecular diagnostics. The assay is an advancement for the rapid molecular detection of pathogenic Agrobacterium spp.

Bioinformatic tools and guideline for PCR primer design | Abd ...

African Journals Online (AJOL)

Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

Oral tongue cancer gene expression profiling: Identification of novel potential prognosticators by oligonucleotide microarray analysis

International Nuclear Information System (INIS)

Estilo, Cherry L; Boyle, Jay O; Kraus, Dennis H; Patel, Snehal; Shaha, Ashok R; Wong, Richard J; Huryn, Joseph M; Shah, Jatin P; Singh, Bhuvanesh; O-charoenrat, Pornchai; Talbot, Simon; Socci, Nicholas D; Carlson, Diane L; Ghossein, Ronald; Williams, Tijaana; Yonekawa, Yoshihiro; Ramanathan, Yegnanarayana

2009-01-01

The present study is aimed at identifying potential candidate genes as prognostic markers in human oral tongue squamous cell carcinoma (SCC) by large scale gene expression profiling. The gene expression profile of patients (n=37) with oral tongue SCC were analyzed using Affymetrix HG-U95Av2 high-density oligonucleotide arrays. Patients (n=20) from which there were available tumor and matched normal mucosa were grouped into stage (early vs. late) and nodal disease (node positive vs. node negative) subgroups and genes differentially expressed in tumor vs. normal and between the subgroups were identified. Three genes, GLUT3, HSAL2, and PACE4, were selected for their potential biological significance in a larger cohort of 49 patients via quantitative real-time RT-PCR. Hierarchical clustering analyses failed to show significant segregation of patients. In patients (n=20) with available tumor and matched normal mucosa, 77 genes were found to be differentially expressed (P< 0.05) in the tongue tumor samples compared to their matched normal controls. Among the 45 over-expressed genes, MMP-1 encoding interstitial collagenase showed the highest level of increase (average: 34.18 folds). Using the criterion of two-fold or greater as overexpression, 30.6%, 24.5% and 26.5% of patients showed high levels of GLUT3, HSAL2 and PACE4, respectively. Univariate analyses demonstrated that GLUT3 over-expression correlated with depth of invasion (P<0.0001), tumor size (P=0.024), pathological stage (P=0.009) and recurrence (P=0.038). HSAL2 was positively associated with depth of invasion (P=0.015) and advanced T stage (P=0.047). In survival studies, only GLUT3 showed a prognostic value with disease-free (P=0.049), relapse-free (P=0.002) and overall survival (P=0.003). PACE4 mRNA expression failed to show correlation with any of the relevant parameters. The characterization of genes identified to be significant predictors of prognosis by oligonucleotide microarray and further validation by

Hydration-dependent dynamics of human telomeric oligonucleotides in the picosecond timescale: A neutron scattering study

Energy Technology Data Exchange (ETDEWEB)

Sebastiani, F.; Comez, L.; Sacchetti, F. [Dipartimento di Fisica e Geologia, Università degli Studi di Perugia, Via A. Pascoli, 06123 Perugia (Italy); CNR, Istituto Officina dei Materiali, Unità di Perugia, c/o Dipartimento di Fisica e Geologia, Università di Perugia, 06123 Perugia (Italy); Longo, M. [Dipartimento di Fisica e Geologia, Università degli Studi di Perugia, Via A. Pascoli, 06123 Perugia (Italy); Elettra—Sincrotrone Trieste, 34149 Basovizza, Trieste (Italy); Orecchini, A.; Petrillo, C.; Paciaroni, A., E-mail: alessandro.paciaroni@fisica.unipg.it [Dipartimento di Fisica e Geologia, Università degli Studi di Perugia, Via A. Pascoli, 06123 Perugia (Italy); De Francesco, A. [CNR-IOM OGG c/o Institut Laue-Langevin, 71 Avenue des Martyrs, CS20156, 38042 Grenoble Cedex 9 (France); Muthmann, M. [Jülich Centre for Neutron Science, Forschungszentrum Jülich GmbH, Outstation at Heinz Maier-Leibnitz Zentrum, Lichtenbergstrasse 1, 85747 Garching (Germany); Teixeira, S. C. M. [EPSAM, Keele University, Staffordshire ST5 5BG (United Kingdom); Institut Laue–Langevin, 71 Avenue des Martyrs, CS20156, 38042 Grenoble Cedex 9 (France)

2015-07-07

The dynamics of the human oligonucleotide AG{sub 3}(T{sub 2}AG{sub 3}){sub 3} has been investigated by incoherent neutron scattering in the sub-nanosecond timescale. A hydration-dependent dynamical activation of thermal fluctuations in weakly hydrated samples was found, similar to that of protein powders. The amplitudes of such thermal fluctuations were evaluated in two different exchanged wave-vector ranges, so as to single out the different contributions from intra- and inter-nucleotide dynamics. The activation energy was calculated from the temperature-dependent characteristic times of the corresponding dynamical processes. The trends of both amplitudes and activation energies support a picture where oligonucleotides possess a larger conformational flexibility than long DNA sequences. This additional flexibility, which likely results from a significant relative chain-end contribution to the average chain dynamics, could be related to the strong structural polymorphism of the investigated oligonucleotides.

Polynucleotides. XXXII. Further studies on the synthesis of oligonucleotides containing 8,2'-S-cycloadenosine.

Science.gov (United States)

Ikehara, M; Tezuka, T

1975-01-01

A dinucleoside monophosphate, 8,2'-anhydro-8-mercapto-9-beta-D-arabinofuranosyladenine phosphoryl-(3'-5')-inosine (AspI) was synthesized by the condensation of protected 8-mercapto-adenosine 2',3'-cyclic phosphate and 2',3'-isopropylideneinosine with diphenylphosphorochloridate. 8-Mercaptoadenosine 2',3'-cyclic phosphate was polymerized by using tetraphenyl pyrophosphate as the condensing reagent. As oligonucleotides, thus obtained, contained some uncyclized 8-mercaptoadenosine residues and were cleaved at these sites with 0.3N KOH. As 5'-phosphate was synthesized and polymerized with DCC to give oligonucleotides with chain lengths 2 to 9. PMID:170595

Medium Caliber Lead-Free Electric Primer. Version 2

Science.gov (United States)

2012-09-01

2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

Immobilization of oligonucleotide probes on silicon surfaces using biotin–streptavidin system examined with microscopic and spectroscopic techniques

Energy Technology Data Exchange (ETDEWEB)

Awsiuk, K., E-mail: kamil.awsiuk@uj.edu.pl [M. Smoluchowski Institute of Physics, Jagiellonian University, Reymonta 4, Kraków 30-059 (Poland); Rysz, J. [M. Smoluchowski Institute of Physics, Jagiellonian University, Reymonta 4, Kraków 30-059 (Poland); Petrou, P. [Institute of Nuclear and Radiological Sciences and Technology, Energy and Safety, NCSR “Demokritos”, End Patriarchou Gregoriou Str., Aghia Paraskevi 15310 (Greece); Budkowski, A. [M. Smoluchowski Institute of Physics, Jagiellonian University, Reymonta 4, Kraków 30-059 (Poland); Bernasik, A. [Faculty of Physics and Applied Computer Science, AGH-University of Science and Technology, Al. Mickiewicza 30, Kraków 30-059 (Poland); Kakabakos, S. [Institute of Nuclear and Radiological Sciences and Technology, Energy and Safety, NCSR “Demokritos”, End Patriarchou Gregoriou Str., Aghia Paraskevi 15310 (Greece); Marzec, M.M. [Faculty of Physics and Applied Computer Science, AGH-University of Science and Technology, Al. Mickiewicza 30, Kraków 30-059 (Poland); Raptis, I. [Institute for Advanced Materials, Physicochemical Processes, Nanotechnology and Microsystems, NCSR “Demokritos”, End Patriarchou Gregoriou Str., Aghia Paraskevi 15310 (Greece)

2014-01-30

To immobilize effectively oligonucleotide probes on SiO{sub 2} modified with (3-aminopropyl)triethoxysilane, four procedures based on streptavidin–biotin system are compared with Atomic Force Microscopy, Angle-Resolved X-ray Photoelectron Spectroscopy and Time-of-Flight Secondary Ion Mass Spectrometry. The first approach involves: adsorption of biotinylated Bovine Serum Albumin, blocking free surface sites with BSA, binding of streptavidin and biotinylated oligonucleotide (b-oligo). Final steps are exchanged in the second procedure with immobilization of preformed streptavidin–b-oligo conjugate. The third approach consists of streptavidin adsorption, blocking with BSA and b-oligo binding. Finally, streptavidin–b-oligo conjugate is immobilized directly within the fourth method. Surface coverage with biomolecules, determined from ARXPS, accords with average AFM height, and is anti-correlated with the intensity of Si+ ions. Higher biomolecular coverage was achieved during the last steps of the first (2.45(±0.38) mg/m{sup 2}) and second (1.31(±0.22) mg/m{sup 2}) approach, as compared to lower surface density resulting from the third (0.58(±0.20) mg/m{sup 2}) and fourth (0.41(±0.11) mg/m{sup 2}) method. Phosphorus atomic concentration indicates effectiveness of oligonucleotide immobilization. Secondary ions intensities, characteristic for oligonucleotides, streptavidin, BSA, and proteins, allow additional insight into overlayer composition. These measurements verify the ARXPS results and show the superiority of the first two immobilization approaches in terms of streptavidin and oligonucleotide density achieved onto the surface.

Immobilization of oligonucleotide probes on silicon surfaces using biotin–streptavidin system examined with microscopic and spectroscopic techniques

International Nuclear Information System (INIS)

Awsiuk, K.; Rysz, J.; Petrou, P.; Budkowski, A.; Bernasik, A.; Kakabakos, S.; Marzec, M.M.; Raptis, I.

2014-01-01

To immobilize effectively oligonucleotide probes on SiO 2 modified with (3-aminopropyl)triethoxysilane, four procedures based on streptavidin–biotin system are compared with Atomic Force Microscopy, Angle-Resolved X-ray Photoelectron Spectroscopy and Time-of-Flight Secondary Ion Mass Spectrometry. The first approach involves: adsorption of biotinylated Bovine Serum Albumin, blocking free surface sites with BSA, binding of streptavidin and biotinylated oligonucleotide (b-oligo). Final steps are exchanged in the second procedure with immobilization of preformed streptavidin–b-oligo conjugate. The third approach consists of streptavidin adsorption, blocking with BSA and b-oligo binding. Finally, streptavidin–b-oligo conjugate is immobilized directly within the fourth method. Surface coverage with biomolecules, determined from ARXPS, accords with average AFM height, and is anti-correlated with the intensity of Si+ ions. Higher biomolecular coverage was achieved during the last steps of the first (2.45(±0.38) mg/m 2 ) and second (1.31(±0.22) mg/m 2 ) approach, as compared to lower surface density resulting from the third (0.58(±0.20) mg/m 2 ) and fourth (0.41(±0.11) mg/m 2 ) method. Phosphorus atomic concentration indicates effectiveness of oligonucleotide immobilization. Secondary ions intensities, characteristic for oligonucleotides, streptavidin, BSA, and proteins, allow additional insight into overlayer composition. These measurements verify the ARXPS results and show the superiority of the first two immobilization approaches in terms of streptavidin and oligonucleotide density achieved onto the surface.

Tandem Oligonucleotide Probe Annealing and Elongation To Discriminate Viral Sequence

DEFF Research Database (Denmark)

Taskova, Maria; Uhd, Jesper; Miotke, Laura

2017-01-01

opportunities in transcriptome analysis, virology, and other fields. Herein, we report for the first time a "click" chemistry approach to oligonucleotide probe elongation as a novel approach to specifically detect a viral sequence. We hybridized a library of short, terminally labeled probes to Ebola virus RNA...

Genome dynamics of short oligonucleotides: the example of bacterial DNA uptake enhancing sequences.

Directory of Open Access Journals (Sweden)

Mohammed Bakkali

Full Text Available Among the many bacteria naturally competent for transformation by DNA uptake-a phenomenon with significant clinical and financial implications- Pasteurellaceae and Neisseriaceae species preferentially take up DNA containing specific short sequences. The genomic overrepresentation of these DNA uptake enhancing sequences (DUES causes preferential uptake of conspecific DNA, but the function(s behind this overrepresentation and its evolution are still a matter for discovery. Here I analyze DUES genome dynamics and evolution and test the validity of the results to other selectively constrained oligonucleotides. I use statistical methods and computer simulations to examine DUESs accumulation in Haemophilus influenzae and Neisseria gonorrhoeae genomes. I analyze DUESs sequence and nucleotide frequencies, as well as those of all their mismatched forms, and prove the dependence of DUESs genomic overrepresentation on their preferential uptake by quantifying and correlating both characteristics. I then argue that mutation, uptake bias, and weak selection against DUESs in less constrained parts of the genome combined are sufficient enough to cause DUESs accumulation in susceptible parts of the genome with no need for other DUES function. The distribution of overrepresentation values across sequences with different mismatch loads compared to the DUES suggests a gradual yet not linear molecular drive of DNA sequences depending on their similarity to the DUES. Other genomically overrepresented sequences, both pro- and eukaryotic, show similar distribution of frequencies suggesting that the molecular drive reported above applies to other frequent oligonucleotides. Rare oligonucleotides, however, seem to be gradually drawn to genomic underrepresentation, thus, suggesting a molecular drag. To my knowledge this work provides the first clear evidence of the gradual evolution of selectively constrained oligonucleotides, including repeated, palindromic and protein

Simple sequence repeat marker loci discovery using SSR primer.

Science.gov (United States)

Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

2004-06-12

Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

Value for money assessment for public-private partnerships : a primer.

Science.gov (United States)

2015-01-01

This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

Evaluation of the conserve flavin reductase gene from three ...

African Journals Online (AJOL)

STORAGESEVER

2009-12-15

Dec 15, 2009 ... means of PCR technique. The nucleic acid sequences of the PCR primers were designed using conserved nucleic acid sequences of the flavin reductase enzyme from. Rhodococcus sp. strain IGTS8. The oligonucleotide primers were as follows: 5'-GAA TTC ATG TCT GAC. AAG CCG AAT GCC-3' (forward) ...

Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

Science.gov (United States)

Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

2006-03-01

Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

Single-Labeled Oligonucleotides Showing Fluorescence Changes upon Hybridization with Target Nucleic Acids

Directory of Open Access Journals (Sweden)

Gil Tae Hwang

2018-01-01

Full Text Available Sequence-specific detection of nucleic acids has been intensively studied in the field of molecular diagnostics. In particular, the detection and analysis of single-nucleotide polymorphisms (SNPs is crucial for the identification of disease-causing genes and diagnosis of diseases. Sequence-specific hybridization probes, such as molecular beacons bearing the fluorophore and quencher at both ends of the stem, have been developed to enable DNA mutation detection. Interestingly, DNA mutations can be detected using fluorescently labeled oligonucleotide probes with only one fluorophore. This review summarizes recent research on single-labeled oligonucleotide probes that exhibit fluorescence changes after encountering target nucleic acids, such as guanine-quenching probes, cyanine-containing probes, probes containing a fluorophore-labeled base, and microenvironment-sensitive probes.

Development, characterization and experimental validation of a cultivated sunflower (Helianthus annuus L. gene expression oligonucleotide microarray.

Directory of Open Access Journals (Sweden)

Paula Fernandez

Full Text Available Oligonucleotide-based microarrays with accurate gene coverage represent a key strategy for transcriptional studies in orphan species such as sunflower, H. annuus L., which lacks full genome sequences. The goal of this study was the development and functional annotation of a comprehensive sunflower unigene collection and the design and validation of a custom sunflower oligonucleotide-based microarray. A large scale EST (>130,000 ESTs curation, assembly and sequence annotation was performed using Blast2GO (www.blast2go.de. The EST assembly comprises 41,013 putative transcripts (12,924 contigs and 28,089 singletons. The resulting Sunflower Unigen Resource (SUR version 1.0 was used to design an oligonucleotide-based Agilent microarray for cultivated sunflower. This microarray includes a total of 42,326 features: 1,417 Agilent controls, 74 control probes for sunflower replicated 10 times (740 controls and 40,169 different non-control probes. Microarray performance was validated using a model experiment examining the induction of senescence by water deficit. Pre-processing and differential expression analysis of Agilent microarrays was performed using the Bioconductor limma package. The analyses based on p-values calculated by eBayes (p<0.01 allowed the detection of 558 differentially expressed genes between water stress and control conditions; from these, ten genes were further validated by qPCR. Over-represented ontologies were identified using FatiScan in the Babelomics suite. This work generated a curated and trustable sunflower unigene collection, and a custom, validated sunflower oligonucleotide-based microarray using Agilent technology. Both the curated unigene collection and the validated oligonucleotide microarray provide key resources for sunflower genome analysis, transcriptional studies, and molecular breeding for crop improvement.

Hierarchical Network Design

DEFF Research Database (Denmark)

Thomadsen, Tommy

2005-01-01

Communication networks are immensely important today, since both companies and individuals use numerous services that rely on them. This thesis considers the design of hierarchical (communication) networks. Hierarchical networks consist of layers of networks and are well-suited for coping...... with changing and increasing demands. Two-layer networks consist of one backbone network, which interconnects cluster networks. The clusters consist of nodes and links, which connect the nodes. One node in each cluster is a hub node, and the backbone interconnects the hub nodes of each cluster and thus...... the clusters. The design of hierarchical networks involves clustering of nodes, hub selection, and network design, i.e. selection of links and routing of ows. Hierarchical networks have been in use for decades, but integrated design of these networks has only been considered for very special types of networks...

Correlating In Vitro Splice Switching Activity With Systemic In Vivo Delivery Using Novel ZEN-modified Oligonucleotides

Directory of Open Access Journals (Sweden)

Suzan M Hammond

2014-01-01

Full Text Available Splice switching oligonucleotides (SSOs induce alternative splicing of pre-mRNA and typically employ chemical modifications to increase nuclease resistance and binding affinity to target pre-mRNA. Here we describe a new SSO non-base modifier (a naphthyl-azo group, “ZEN™” to direct exon exclusion in mutant dystrophin pre-mRNA to generate functional dystrophin protein. The ZEN modifier is placed near the ends of a 2′-O-methyl (2′OMe oligonucleotide, increasing melting temperature and potency over unmodified 2′OMe oligonucleotides. In cultured H2K cells, a ZEN-modified 2′OMe phosphorothioate (PS oligonucleotide delivered by lipid transfection greatly enhanced dystrophin exon skipping over the same 2′OMePS SSO lacking ZEN. However, when tested using free gymnotic uptake in vitro and following systemic delivery in vivo in dystrophin deficient mdx mice, the same ZEN-modified SSO failed to enhance potency. Importantly, we show for the first time that in vivo activity of anionic SSOs is modelled in vitro only when using gymnotic delivery. ZEN is thus a novel modifier that enhances activity of SSOs in vitro but will require improved delivery methods before its in vivo clinical potential can be realized.

Development of Medical Technology for Contingency Response to Marrow Toxic Agents

Science.gov (United States)

2014-05-06

Specific Oligonucleotides SSP Sequence Specific Primers SSOP Sequence Specific Oligonucleotide Probes STAR ® Search, Tracking and Registry TBI Total... white paper detailing recommendations/guidelines for the assessment of new assays (potency or other assays) relevant to cord blood banking and/or...Irradiation - Marcel van den Brink (Memorial Sloan Kettering Cancer Center) 5. Organ Toxicity: h. Pulmonary Toxicity - Zeljko Vujaskovic (Duke) i

Spectroscopic (UV/VIS, Raman) and Electrophoresis Study of Cytosine-Guanine Oligonucleotide DNA Influenced by Magnetic Field.

Science.gov (United States)

Banihashemian, Seyedeh Maryam; Periasamy, Vengadesh; Boon Tong, Goh; Abdul Rahman, Saadah

2016-01-01

Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100), is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT). As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds' vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field.

Characterization of peptide-oligonucleotide heteroconjugates by mass spectrometry.

OpenAIRE

Jensen, O N; Kulkarni, S; Aldrich, J V; Barofsky, D F

1996-01-01

Two peptide-oligothymidylic acids, prepared by joining an 11 residue synthetic peptide containing one internal carboxyl group (Asp side chain) to amino-linker-5'pdT6 and amino-linker-5'pdT10 oligonucleotides, were analyzed by matrix-assisted laser desorption/ionization (MALDI) on a linear time-of-flight mass spectrometer and by electrospray ionization (ESI) on a triple-quadrupole system. These synthetic compounds model peptide-nucleic acid heteroconjugates encountered in antisense research an...

Direct Mutagenesis of Thousands of Genomic Targets using Microarray-derived Oligonucleotides

DEFF Research Database (Denmark)

Bonde, Mads; Kosuri, Sriram; Genee, Hans Jasper

2015-01-01

Multiplex Automated Genome Engineering (MAGE) allows simultaneous mutagenesis of multiple target sites in bacterial genomes using short oligonucleotides. However, large-scale mutagenesis requires hundreds to thousands of unique oligos, which are costly to synthesize and impossible to scale-up by ...

Rapid Induction of Protective Immunity Against Biothreat Agents Using CPG-Based Oligonucleotides

National Research Council Canada - National Science Library

Klinman, Dennis

2003-01-01

This research project examines the ability of synthetic oligonucleotides (ODN) containing immunostimulatory "CpG motifs' to trigger the innate immune system, thereby improving the host's ability to survive infection by biowarfare agents...

Short locked nucleic acid antisense oligonucleotides potently reduce apolipoprotein B mRNA and serum cholesterol in mice and non-human primates

DEFF Research Database (Denmark)

Straarup, Ellen Marie; Fisker, Niels; Hedtjärn, Maj

2010-01-01

-life as longer oligonucleotides. Pharmacology studies in both mice and non-human primates were conducted with a 13-mer LNA oligonucleotide against apoB, and the data showed that repeated dosing of the 13-mer at 1-2 mg/kg/week was sufficient to provide a significant and long lasting lowering of non...... using the LNA chemistry. Conclusively, we present a 13-mer LNA oligonucleotide with therapeutic potential that produce beneficial cholesterol lowering effect in non-human primates....

Technetium-99m labeled antisense oligonucleotide-noninvasive tumor imaging in mice

International Nuclear Information System (INIS)

Qin, G.M.; Zhang, Y.X.; An, R.; Gao, Z.R.; Cao, W.; Cao, G.X.; Hnatowich, D.J.

2002-01-01

Single-stranded RNA and DNA oligonucleotides may be useful as radiopharmaceuticals for antisense and other in vivo applications if convenient methods for stably attaching radionuclides such as 99m Tc can be developed. The c-myc oncogene works in cooperation with other oncogenes in a variety of malignant tumors. The concentration of c-myc messenger RNA increases rapidly 30 to 50 fold during DNA synthesis, thus making it a suitable target for following the progression of malignancy by noninvasive imaging with radiolabeled antisense oligonucleotide probes. Methods: 1 Oligonucleotide Conjugation: A solution of single stranded amine-derivatized DNA (100-1000μg) was prepared at a concentration of 2 mg/ml in 0.25M sodium bicarbonate, 1 M sodium chloride, 1mM EDTA, pH8.5. 2 Oligonucleotide Labeling: A fresh 50mg/ml solution of sodium tartrate was prepared in sterile 0.5 M ammonium The ability of the labeled DNA to hybridize to its complement was analyzed by Sep-Pak column chromatography before and after the addition of the complementary DNA. 3 Biodistribution and Tumor Imaging Studies: A colony of KM mice (15-20g) were inoculated with 1x10 6 Ehrlich carcinoma tumor cells in the right thigh, and the tumors were allowed to grow for 6-7 days to a size of 1.0-1.5 cm in diameter. Biodistribution studies were performed in 32 KM mice after 50 μCi per mouse of 99m Tc-labeled oncogene probes were injected intravenously. A total of 8 mice were injected intravenously in the tail vein with 1-2 mCi of 99m Tc-labeled sense or antisense probes, immobilized with ketamine hydrochloride and imaged periodically from 0.5hr to 24hr with a gamma camera. Results: Essentially complete conjugation was achieved by reverse-phase Sep-Pak C18 chromatography analysis. The labeled antisense DNA still remained the ability to hybridize with its complementary DNA. The highest accumulation of label was in the liver first, with the kidney and small bowel next. The injected activity localized in the lesion

Novel approaches to study low-energy electron-induced damage to DNA oligonucleotides

International Nuclear Information System (INIS)

Rackwitz, Jenny; Bald, Ilko; Ranković, Miloš Lj; Milosavljević, Aleksandar R

2015-01-01

The novel approach of DNA origami structures as templates for precise quantification of various well- defined oligonucleotides provides the opportunity to determine the sensitivity of complex DNA sequences towards low-energy electrons. (paper)

Synthesis of modified oligonucleotides for repair and replication studies of single and double radio-induced DNA lesions

International Nuclear Information System (INIS)

Muller, E.

2002-01-01

Several oxidative processes induce the formation of DNA lesions. In order to evaluate the biological and structural significance of such damage, several DNA lesions were inserted into synthetic oligonucleotides at defined sites. The research work aimed at describing the preparation of oligonucleotides t hat contained DNA damage and the evaluation of the biological properties of the lesions. A first part described the incorporation of radiation-induced lesions, namely (5'S,6S)-5',6-cyclo-5,6-dihydro-2'-deoxyuridine and (5'S,5S,6S)-5',6-cyclo-5-hydroxy-5,6-dihydro-2'-desoxyuridine into oligonucleotides. The modified DNA fragments were characterised by several spectroscopic and biochemical analyses including ESI MS, MALDI-TOF MS, CLHP and enzymatic digestions. During in vitro DNA synthesis by Taq DNA polymerase and Klenow exo fragment, the pyrimidine cyclo-nucleosides were found to block the progression of the enzymes. Then, repair studies by ADN N glycosylases, operating in the base excision repair pathway, have shown that the anhydro-nucleoside lesions were not recognised nor excised by Fpg, endo III, endo VIII, yNtg1 yNtg2 and yOgg1. Interestingly, the Latococcus lactis Fpg protein recognises (formation of a non covalent complex) but do not excise the damage. The incorporation into oligonucleotides of the (5R*) and (5S*) diastereoisomers of 1-[2-deoxy-β-D-erythro-pentofuranosyl]-5-hydroxy-hydantoin, generated by several oxidative processes was then described. In vitro DNA replication assays using modified oligonucleotides matrix showed a lethal potential of the latter base damage. Repair studies by ADN N-glycosylases showed that the damage was substrate for Fpg, endo III, endo VIII, Ntg1, Ntg2 and Fpg-L1. The rates of excision as inferred from the determination of the Michaelis kinetics constants were found to be affected by the presence of the damage. MALDI-TOF MS was used in order to gain insights into mechanistic aspects of oligonucleotides cleavage by the

Economics : pricing, demand, and economic efficiency : a primer.

Science.gov (United States)

2008-11-01

The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

Semantic Web Primer

NARCIS (Netherlands)

Antoniou, Grigoris; Harmelen, Frank van

2004-01-01

The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

Automated synthesis of an {sup 18}F-labelled pyridine-based alkylating agent for high yield oligonucleotide conjugation

Energy Technology Data Exchange (ETDEWEB)

Guggenberg, Elisabeth von; Sader, Jayden A.; Wilson, John S.; Shahhosseini, Soraya; Koslowsky, Ingrid; Wuest, Frank [Edmonton PET Centre, Division of Oncologic Imaging, Department of Oncology, Cross Cancer Institute, 11560 University Ave, Edmonton, AB, T6G 1Z2 (Canada); Mercer, John R. [Edmonton PET Centre, Division of Oncologic Imaging, Department of Oncology, Cross Cancer Institute, 11560 University Ave, Edmonton, AB, T6G 1Z2 (Canada)], E-mail: johnmerc@cancerboard.ab.ca

2009-09-15

Alkylating agents have been shown to be very promising for the radiolabelling of oligonucleotides with fluorine-18. In this report we describe the fully automated synthesis of 2-bromo-N-[3-(2-[{sup 18}F]fluoropyridin-3-yloxy)propyl]acetamide ([{sup 18}F]FPyBrA) utilizing a modular synthesis unit. Reaction conditions for the coupling of this pyridine-based alkylating agent at the 5' end of a fully phosphorothioated random 20-mer DNA sequence were optimized to achieve very high radiochemical yields (>90%) and a maximum specific activity of 5-6 GBq/{mu}moL. The potential for rapid purification by solid phase extraction without need of chromatographic isolation of the radiolabelled oligonucleotide presents an overall benefit for the application of oligonucleotides in preclinical studies and potential clinical applications.

Fluorescent oligonucleotides containing a novel perylene 2′-amino-α-L-LNA monomer: Synthesis and analytical potential

DEFF Research Database (Denmark)

Astakhova, Irina; Kumar, Santhosh T.; Wengel, Jesper

2011-01-01

efficiency of the resulting perylene-2'-amino-alpha-L-LNA monomer (T*) into synthetic oligonucleotides was significantly improved by replacement of the typically used 1H-tetrazole activator with pyridine hydrochloride. Generally, oligonucleotides containing monomer T* showed high binding affinity towards...... incorporations of monomers T* was quenched (quantum yield Phi(F) = 0.21) relative to duplexes of this probe with complementary DNA and RNA (Phi(F) = 0.42 and 0.35, respectively). On the contrary, a strong fluorescence quenching upon target binding was demonstrated by two short oligonucleotides of analogues...... sequences containing monomers T* at 5'- and 3'-terminal positions. We explain the hybridization-induced light-up effect observed for double-labeled probe by a reduction of fluorescence quenching due to precise positioning of the fluorophores within the double-stranded complexes. Furthermore, we propose...

Spectroscopic (UV/VIS, Raman and Electrophoresis Study of Cytosine-Guanine Oligonucleotide DNA Influenced by Magnetic Field.

Directory of Open Access Journals (Sweden)

Seyedeh Maryam Banihashemian

Full Text Available Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100, is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT. As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds' vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field.

Coal Bed Methane Primer

Energy Technology Data Exchange (ETDEWEB)

Dan Arthur; Bruce Langhus; Jon Seekins

2005-05-25

During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

Detecting Hierarchical Structure in Networks

DEFF Research Database (Denmark)

Herlau, Tue; Mørup, Morten; Schmidt, Mikkel Nørgaard

2012-01-01

Many real-world networks exhibit hierarchical organization. Previous models of hierarchies within relational data has focused on binary trees; however, for many networks it is unknown whether there is hierarchical structure, and if there is, a binary tree might not account well for it. We propose...... a generative Bayesian model that is able to infer whether hierarchies are present or not from a hypothesis space encompassing all types of hierarchical tree structures. For efficient inference we propose a collapsed Gibbs sampling procedure that jointly infers a partition and its hierarchical structure....... On synthetic and real data we demonstrate that our model can detect hierarchical structure leading to better link-prediction than competing models. Our model can be used to detect if a network exhibits hierarchical structure, thereby leading to a better comprehension and statistical account the network....

Splice-correcting oligonucleotides restore BTK function in X-linked agammaglobulinemia model

DEFF Research Database (Denmark)

Bestas, Burcu; Moreno, Pedro M D; Blomberg, K Emelie M

2014-01-01

, splice-correcting oligonucleotides (SCOs) targeting mutated BTK transcripts for treating XLA. Both the SCO structural design and chemical properties were optimized using 2'-O-methyl, locked nucleic acid, or phosphorodiamidate morpholino backbones. In order to have access to an animal model of XLA, we...

Quick spacecraft charging primer

International Nuclear Information System (INIS)

Larsen, Brian Arthur

2014-01-01

This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

Functional annotation of hierarchical modularity.

Directory of Open Access Journals (Sweden)

Kanchana Padmanabhan

Full Text Available In biological networks of molecular interactions in a cell, network motifs that are biologically relevant are also functionally coherent, or form functional modules. These functionally coherent modules combine in a hierarchical manner into larger, less cohesive subsystems, thus revealing one of the essential design principles of system-level cellular organization and function-hierarchical modularity. Arguably, hierarchical modularity has not been explicitly taken into consideration by most, if not all, functional annotation systems. As a result, the existing methods would often fail to assign a statistically significant functional coherence score to biologically relevant molecular machines. We developed a methodology for hierarchical functional annotation. Given the hierarchical taxonomy of functional concepts (e.g., Gene Ontology and the association of individual genes or proteins with these concepts (e.g., GO terms, our method will assign a Hierarchical Modularity Score (HMS to each node in the hierarchy of functional modules; the HMS score and its p-value measure functional coherence of each module in the hierarchy. While existing methods annotate each module with a set of "enriched" functional terms in a bag of genes, our complementary method provides the hierarchical functional annotation of the modules and their hierarchically organized components. A hierarchical organization of functional modules often comes as a bi-product of cluster analysis of gene expression data or protein interaction data. Otherwise, our method will automatically build such a hierarchy by directly incorporating the functional taxonomy information into the hierarchy search process and by allowing multi-functional genes to be part of more than one component in the hierarchy. In addition, its underlying HMS scoring metric ensures that functional specificity of the terms across different levels of the hierarchical taxonomy is properly treated. We have evaluated our

Climate Change, Health, and Communication: A Primer.

Science.gov (United States)

Chadwick, Amy E

2016-01-01

Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

Diamond cubic phase of monoolein and water as an amphiphilic matrix for electrophoresis of oligonucleotides.

Science.gov (United States)

Carlsson, Nils; Winge, Ann-Sofie; Engström, Sven; Akerman, Björn

2005-10-06

We used a cubic liquid crystal formed by the nonionic monoglyceride monoolein and water as a porous matrix for the electrophoresis of oligonucleotides. The diamond cubic phase is thermodynamically stable when in contact with a water-rich phase, which we exploit to run the electrophoresis in the useful submarine mode. Oligonucleotides are separated according to size and secondary structure by migration through the space-filling aqueous nanometer pores of the regular liquid crystal, but the comparatively slow migration means the cubic phase will not be a replacement for the conventional DNA gels. However, our demonstration that the cubic phase can be used in submarine electrophoresis opens up the possibility for a new matrix for electrophoresis of amphiphilic molecules. From this perspective, the results on the oligonucleotides show that water-soluble particles of nanometer size, typical for the hydrophilic parts of membrane-bound proteins, may be a useful separation motif. A charged contamination in the commercial sample of monoolein, most likely oleic acid that arises from its hydrolysis, restricts useful buffer conditions to a pH below 5.6.

Marketing Information Products and Services : A Primer for ...

International Development Research Centre (IDRC) Digital Library (Canada)

Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

Accurate and rapid modeling of iron-bleomycin-induced DNA damage using tethered duplex oligonucleotides and electrospray ionization ion trap mass spectrometric analysis.

Science.gov (United States)

Harsch, A; Marzilli, L A; Bunt, R C; Stubbe, J; Vouros, P

2000-05-01

Bleomycin B(2)(BLM) in the presence of iron [Fe(II)] and O(2)catalyzes single-stranded (ss) and double-stranded (ds) cleavage of DNA. Electrospray ionization ion trap mass spectrometry was used to monitor these cleavage processes. Two duplex oligonucleotides containing an ethylene oxide tether between both strands were used in this investigation, allowing facile monitoring of all ss and ds cleavage events. A sequence for site-specific binding and cleavage by Fe-BLM was incorporated into each analyte. One of these core sequences, GTAC, is a known hot-spot for ds cleavage, while the other sequence, GGCC, is a hot-spot for ss cleavage. Incubation of each oligo-nucleotide under anaerobic conditions with Fe(II)-BLM allowed detection of the non-covalent ternary Fe-BLM/oligonucleotide complex in the gas phase. Cleavage studies were then performed utilizing O(2)-activated Fe(II)-BLM. No work-up or separation steps were required and direct MS and MS/MS analyses of the crude reaction mixtures confirmed sequence-specific Fe-BLM-induced cleavage. Comparison of the cleavage patterns for both oligonucleotides revealed sequence-dependent preferences for ss and ds cleavages in accordance with previously established gel electrophoresis analysis of hairpin oligonucleotides. This novel methodology allowed direct, rapid and accurate determination of cleavage profiles of model duplex oligonucleotides after exposure to activated Fe-BLM.

Catalysis with hierarchical zeolites

DEFF Research Database (Denmark)

Holm, Martin Spangsberg; Taarning, Esben; Egeblad, Kresten

2011-01-01

Hierarchical (or mesoporous) zeolites have attracted significant attention during the first decade of the 21st century, and so far this interest continues to increase. There have already been several reviews giving detailed accounts of the developments emphasizing different aspects of this research...... topic. Until now, the main reason for developing hierarchical zeolites has been to achieve heterogeneous catalysts with improved performance but this particular facet has not yet been reviewed in detail. Thus, the present paper summaries and categorizes the catalytic studies utilizing hierarchical...... zeolites that have been reported hitherto. Prototypical examples from some of the different categories of catalytic reactions that have been studied using hierarchical zeolite catalysts are highlighted. This clearly illustrates the different ways that improved performance can be achieved with this family...

A facile one-step fluorescence method for the quantitation of low-content single base deamination impurity in synthetic oligonucleotides.

Science.gov (United States)

Su, Xiaoye; Liang, Ruiting; Stolee, Jessica A

2018-06-05

Oligonucleotides are being researched and developed as potential drug candidates for the treatment of a broad spectrum of diseases. The characterization of antisense oligonucleotide (ASO) impurities caused by base mutations (e.g. deamination) which are closely related to the target ASO is a significant analytical challenge. Herein, we describe a novel one-step method, utilizing a strategy that combines fluorescence-ON detection with competitive hybridization, to achieve single base mutation quantitation in extensively modified synthetic ASOs. Given that this method is highly specific and sensitive (LoQ = 4 nM), we envision that it will find utility for screening other impurities as well as sequencing modified oligonucleotides. Copyright © 2018 Elsevier B.V. All rights reserved.

An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

Energy Technology Data Exchange (ETDEWEB)

Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

2011-01-15

Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

Microsatellite primers for fungus-growing ants

DEFF Research Database (Denmark)

Villesen, Palle; Gertsch, P J; Boomsma, JJ

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

Microsatellite Primers for Fungus-Growing Ants

DEFF Research Database (Denmark)

Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

Parallel hierarchical radiosity rendering

Energy Technology Data Exchange (ETDEWEB)

Carter, Michael [Iowa State Univ., Ames, IA (United States)

1993-07-01

In this dissertation, the step-by-step development of a scalable parallel hierarchical radiosity renderer is documented. First, a new look is taken at the traditional radiosity equation, and a new form is presented in which the matrix of linear system coefficients is transformed into a symmetric matrix, thereby simplifying the problem and enabling a new solution technique to be applied. Next, the state-of-the-art hierarchical radiosity methods are examined for their suitability to parallel implementation, and scalability. Significant enhancements are also discovered which both improve their theoretical foundations and improve the images they generate. The resultant hierarchical radiosity algorithm is then examined for sources of parallelism, and for an architectural mapping. Several architectural mappings are discussed. A few key algorithmic changes are suggested during the process of making the algorithm parallel. Next, the performance, efficiency, and scalability of the algorithm are analyzed. The dissertation closes with a discussion of several ideas which have the potential to further enhance the hierarchical radiosity method, or provide an entirely new forum for the application of hierarchical methods.

Hierarchical prisoner’s dilemma in hierarchical game for resource competition

Science.gov (United States)

Fujimoto, Yuma; Sagawa, Takahiro; Kaneko, Kunihiko

2017-07-01

Dilemmas in cooperation are one of the major concerns in game theory. In a public goods game, each individual cooperates by paying a cost or defecting without paying it, and receives a reward from the group out of the collected cost. Thus, defecting is beneficial for each individual, while cooperation is beneficial for the group. Now, groups (say, countries) consisting of individuals also play games. To study such a multi-level game, we introduce a hierarchical game in which multiple groups compete for limited resources by utilizing the collected cost in each group, where the power to appropriate resources increases with the population of the group. Analyzing this hierarchical game, we found a hierarchical prisoner’s dilemma, in which groups choose the defecting policy (say, armament) as a Nash strategy to optimize each group’s benefit, while cooperation optimizes the total benefit. On the other hand, for each individual, refusing to pay the cost (say, tax) is a Nash strategy, which turns out to be a cooperation policy for the group, thus leading to a hierarchical dilemma. Here the group reward increases with the group size. However, we find that there exists an optimal group size that maximizes the individual payoff. Furthermore, when the population asymmetry between two groups is large, the smaller group will choose a cooperation policy (say, disarmament) to avoid excessive response from the larger group, and the prisoner’s dilemma between the groups is resolved. Accordingly, the relevance of this hierarchical game on policy selection in society and the optimal size of human or animal groups are discussed.

Effective intracellular delivery of oligonucleotides in order to make sense of antisense

NARCIS (Netherlands)

Shi, FX; Hoekstra, D

2004-01-01

For more than two decades, antisense oligonucleotides (ODNs) have been used to modulate gene expression for the purpose of applications in cell biology and for development of novel sophisticated medical therapeutics. Conceptually, the antisense approach represents an elegant strategy, involving the

Specificity tests of an oligonucleotide probe against food-outbreak salmonella for biosensor detection

Science.gov (United States)

Chen, I.-H.; Horikawa, S.; Xi, J.; Wikle, H. C.; Barbaree, J. M.; Chin, B. A.

2017-05-01

Phage based magneto-elastic (ME) biosensors have been shown to be able to rapidly detect Salmonella in various food systems to serve food pathogen monitoring purposes. In this ME biosensor platform, the free-standing strip-shaped magneto-elastic sensor is the transducer and the phage probe that recognizes Salmonella in food serves as the bio-recognition element. According to Sorokulova et al. at 2005, a developed oligonucleotide probe E2 was reported to have high specificity to Salmonella enterica Typhimurium. In the report, the specificity tests were focused in most of Enterobacterace groups outside of Salmonella family. Here, to understand the specificity of phage E2 to different Salmonella enterica serotypes within Salmonella Family, we further tested the specificity of the phage probe to thirty-two Salmonella serotypes that were present in the major foodborne outbreaks during the past ten years (according to Centers for Disease Control and Prevention). The tests were conducted through an Enzyme linked Immunosorbent Assay (ELISA) format. This assay can mimic probe immobilized conditions on the magnetoelastic biosensor platform and also enable to study the binding specificity of oligonucleotide probes toward different Salmonella while avoiding phage/ sensor lot variations. Test results confirmed that this oligonucleotide probe E2 was high specific to Salmonella Typhimurium cells but showed cross reactivity to Salmonella Tennessee and four other serotypes among the thirty-two tested Salmonella serotypes.

Ultrasensitive Detection of Ebola Virus Oligonucleotide Based on Upconversion Nanoprobe/Nanoporous Membrane System.

Science.gov (United States)

Tsang, Ming-Kiu; Ye, WeiWei; Wang, Guojing; Li, Jingming; Yang, Mo; Hao, Jianhua

2016-01-26

Ebola outbreaks are currently of great concern, and therefore, development of effective diagnosis methods is urgently needed. The key for lethal virus detection is high sensitivity, since early-stage detection of virus may increase the probability of survival. Here, we propose a luminescence scheme of assay consisting of BaGdF5:Yb/Er upconversion nanoparticles (UCNPs) conjugated with oligonucleotide probe and gold nanoparticles (AuNPs) linked with target Ebola virus oligonucleotide. As a proof of concept, a homogeneous assay was fabricated and tested, yielding a detection limit at picomolar level. The luminescence resonance energy transfer is ascribed to the spectral overlapping of upconversion luminescence and the absorption characteristics of AuNPs. Moreover, we anchored the UCNPs and AuNPs on a nanoporous alumina (NAAO) membrane to form a heterogeneous assay. Importantly, the detection limit was greatly improved, exhibiting a remarkable value at the femtomolar level. The enhancement is attributed to the increased light-matter interaction throughout the nanopore walls of the NAAO membrane. The specificity test suggested that the nanoprobes were specific to Ebola virus oligonucleotides. The strategy combining UCNPs, AuNPs, and NAAO membrane provides new insight into low-cost, rapid, and ultrasensitive detection of different diseases. Furthermore, we explored the feasibility of clinical application by using inactivated Ebola virus samples. The detection results showed great potential of our heterogeneous design for practical application.

Intrinsically Labeled Fluorescent Oligonucleotide Probes on Quantum Dots for Transduction of Nucleic Acid Hybridization.

Science.gov (United States)

Shahmuradyan, Anna; Krull, Ulrich J

2016-03-15

Quantum dots (QDs) have been widely used in chemical and biosensing due to their unique photoelectrical properties and are well suited as donors in fluorescence resonance energy transfer (FRET). Selective hybridization interactions of oligonucleotides on QDs have been determined by FRET. Typically, the QD-FRET constructs have made use of labeled targets or have implemented labeled sandwich format assays to introduce dyes in proximity to the QDs for the FRET process. The intention of this new work is to explore a method to incorporate the acceptor dye into the probe molecule. Thiazole orange (TO) derivatives are fluorescent intercalating dyes that have been used for detection of double-stranded nucleic acids. One such dye system has been reported in which single-stranded oligonucleotide probes were doubly labeled with adjacent thiazole orange derivatives. In the absence of the fully complementary (FC) oligonucleotide target, the dyes form an H-aggregate, which results in quenching of fluorescence emission due to excitonic interactions between the dyes. The hybridization of the FC target to the probe provides for dissociation of the aggregate as the dyes intercalate into the double stranded duplex, resulting in increased fluorescence. This work reports investigation of the dependence of the ratiometric signal on the type of linkage used to conjugate the dyes to the probe, the location of the dye along the length of the probe, and the distance between adjacent dye molecules. The limit of detection for 34mer and 90mer targets was found to be identical and was 10 nM (2 pmol), similar to analogous QD-FRET using labeled oligonucleotide target. The detection system could discriminate a one base pair mismatch (1BPM) target and was functional without substantial compromise of the signal in 75% serum. The 1BPM was found to reduce background signal, indicating that the structure of the mismatch affected the environment of the intercalating dyes.

The use of oligonucleotide probes for meningococcal serotype characterization

Directory of Open Access Journals (Sweden)

SACCHI Claudio Tavares

1998-01-01

Full Text Available In the present study we examine the potential use of oligonucleotide probes to characterize Neisseria meningitidis serotypes without the use of monoclonal antibodies (MAbs. Antigenic diversity on PorB protein forms the bases of serotyping method. However, the current panel of MAbs underestimated, by at least 50% the PorB variability, presumably because reagents for several PorB variable regions (VRs are lacking, or because a number of VR variants are not recognized by serotype-defining MAbs12. We analyzed the use of oligonucleotide probes to characterize serotype 10 and serotype 19 of N. meningitidis. The porB gene sequence for the prototype strain of serotype 10 was determined, aligned with 7 other porB sequences from different serotypes, and analysis of individual VRs were performed. The results of DNA probes 21U (VR1-A and 615U (VR3-B used against 72 N. meningitidis strains confirm that VR1 type A and VR3 type B encode epitopes for serotype-defined MAbs 19 and 10, respectively. The use of probes for characterizing serotypes possible can type 100% of the PorB VR diversity. It is a simple and rapid method specially useful for analysis of large number of samples.

Micromechanics of hierarchical materials

DEFF Research Database (Denmark)

Mishnaevsky, Leon, Jr.

2012-01-01

A short overview of micromechanical models of hierarchical materials (hybrid composites, biomaterials, fractal materials, etc.) is given. Several examples of the modeling of strength and damage in hierarchical materials are summarized, among them, 3D FE model of hybrid composites...... with nanoengineered matrix, fiber bundle model of UD composites with hierarchically clustered fibers and 3D multilevel model of wood considered as a gradient, cellular material with layered composite cell walls. The main areas of research in micromechanics of hierarchical materials are identified, among them......, the investigations of the effects of load redistribution between reinforcing elements at different scale levels, of the possibilities to control different material properties and to ensure synergy of strengthening effects at different scale levels and using the nanoreinforcement effects. The main future directions...

A physicists guide to The Los Alamos Primer

International Nuclear Information System (INIS)

Reed, B Cameron

2016-01-01

In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

Orotidine-Containing RNA: Implications for the Hierarchical Selection (Systems Chemistry Emergence) of RNA.

Science.gov (United States)

Kim, Eun-Kyong; Martin, Vincent; Krishnamurthy, Ramanarayanan

2017-09-12

The prebiotic synthesis of canonical nucleobases from HCN is a cornerstone for the RNA world hypothesis. However, their role in the primordial pathways to RNA is still debated. The very same process starting from HCN also gives rise to orotic acid, which (via orotidine) plays a crucial role in extant biology in the de novo synthesis of uridine and cytidine, the informational base-pairs in RNA. However, orotidine itself is absent in RNA. Given the prebiotic and biological relevance of orotic acid vis-à-vis uracil, we investigated orotidine-containing RNA oligonucleotides and show that they have severely compromised base-pairing properties. While not unexpected, these results suggest that the emergence of extant RNA cannot just be a consequence of the plausible prebiotic formation of its chemical constituents/building blocks. In combination with other investigations on alternative prebiotic nucleobases, sugars, and linkers, these findings imply that the selection of the components of extant RNA occurred at a higher hierarchical level of an oligomer/polymer based on its functional properties-pointing to a systems chemistry emergence of RNA from a library of precursors. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Hetero-oligonucleotide Nanoscale Tiles Capable of Two-Dimensional Lattice Formation as Testbeds for a Rapid, Affordable Purification Methodology

Science.gov (United States)

2013-01-01

devices; however, DNA is not the only polymer that can take advantage of the specicity of the Watson – Crick base-pair to achieve these goals. Central to...14. ABSTRACT 16. SECURITY CLASSIFICATION OF: New nanoscale hetero-oligonucleotide tiles are assembled from DNA , RNA and morpholino oligos and...purified using size exclusion filtration. Homo-oligonucleotide tiles assembled from RP-cartridge processed DNA oligos are purified by nondenaturing gel

Thermoplastic polymers surfaces for Dip-Pen Nanolithography of oligonucleotides

International Nuclear Information System (INIS)

Suriano, Raffaella; Biella, Serena; Cesura, Federico; Levi, Marinella; Turri, Stefano

2013-01-01

Different thermoplastic polymers were spin-coated to prepare smooth surfaces for the direct deposition of end-group modified oligonucleotides by Dip-Pen Nanolithography. A study of the diffusion process was done in order to investigate the dependence of calibration coefficient and quality of deposited features on environmental parameters (temperature, relative humidity) and ink's molecular weight and functionality. The optimization of the process parameters led to the realization of high quality and density nanoarrays on plastics.

Drop drying on surfaces determines chemical reactivity - the specific case of immobilization of oligonucleotides on microarrays

Science.gov (United States)

2013-01-01

Background Drop drying is a key factor in a wide range of technical applications, including spotted microarrays. The applied nL liquid volume provides specific reaction conditions for the immobilization of probe molecules to a chemically modified surface. Results We investigated the influence of nL and μL liquid drop volumes on the process of probe immobilization and compare the results obtained to the situation in liquid solution. In our data, we observe a strong relationship between drop drying effects on immobilization and surface chemistry. In this work, we present results on the immobilization of dye labeled 20mer oligonucleotides with and without an activating 5′-aminoheptyl linker onto a 2D epoxysilane and a 3D NHS activated hydrogel surface. Conclusions Our experiments identified two basic processes determining immobilization. First, the rate of drop drying that depends on the drop volume and the ambient relative humidity. Oligonucleotides in a dried spot react unspecifically with the surface and long reaction times are needed. 3D hydrogel surfaces allow for immobilization in a liquid environment under diffusive conditions. Here, oligonucleotide immobilization is much faster and a specific reaction with the reactive linker group is observed. Second, the effect of increasing probe concentration as a result of drop drying. On a 3D hydrogel, the increasing concentration of probe molecules in nL spotting volumes accelerates immobilization dramatically. In case of μL volumes, immobilization depends on whether the drop is allowed to dry completely. At non-drying conditions, very limited immobilization is observed due to the low oligonucleotide concentration used in microarray spotting solutions. The results of our study provide a general guideline for microarray assay development. They allow for the initial definition and further optimization of reaction conditions for the immobilization of oligonucleotides and other probe molecule classes to different

Detection and identification of intestinal pathogenic bacteria by hybridization to oligonucleotide microarrays

Science.gov (United States)

Jin, Lian-Qun; Li, Jun-Wen; Wang, Sheng-Qi; Chao, Fu-Huan; Wang, Xin-Wei; Yuan, Zheng-Quan

2005-01-01

AIM: To detect the common intestinal pathogenic bacteria quickly and accurately. METHODS: A rapid (<3 h) experimental procedure was set up based upon the gene chip technology. Target genes were amplified and hybridized by oligonucleotide microarrays. RESULTS: One hundred and seventy strains of bacteria in pure culture belonging to 11 genera were successfully discriminated under comparatively same conditions, and a series of specific hybridization maps corresponding to each kind of bacteria were obtained. When this method was applied to 26 divided cultures, 25 (96.2%) were identified. CONCLUSION: Salmonella sp., Escherichia coli, Shigella sp., Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, Proteus sp., Bacillus cereus, Vibrio cholerae, Enterococcus faecalis, Yersinia enterocolitica, and Campylobacter jejuni can be detected and identified by our microarrays. The accuracy, range, and discrimination power of this assay can be continually improved by adding further oligonucleotides to the arrays without any significant increase of complexity or cost. PMID:16437687

How hierarchical is language use?

Science.gov (United States)

Frank, Stefan L.; Bod, Rens; Christiansen, Morten H.

2012-01-01

It is generally assumed that hierarchical phrase structure plays a central role in human language. However, considerations of simplicity and evolutionary continuity suggest that hierarchical structure should not be invoked too hastily. Indeed, recent neurophysiological, behavioural and computational studies show that sequential sentence structure has considerable explanatory power and that hierarchical processing is often not involved. In this paper, we review evidence from the recent literature supporting the hypothesis that sequential structure may be fundamental to the comprehension, production and acquisition of human language. Moreover, we provide a preliminary sketch outlining a non-hierarchical model of language use and discuss its implications and testable predictions. If linguistic phenomena can be explained by sequential rather than hierarchical structure, this will have considerable impact in a wide range of fields, such as linguistics, ethology, cognitive neuroscience, psychology and computer science. PMID:22977157

Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

OpenAIRE

Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

2001-01-01

Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

Membrane-based oligonucleotide array developed from multiple markers for the detection of many Phytophthora species.

Science.gov (United States)

Chen, Wen; Djama, Zeinab Robleh; Coffey, Michael D; Martin, Frank N; Bilodeau, Guillaume J; Radmer, Lorien; Denton, Geoff; Lévesque, C André

2013-01-01

Most Phytophthora spp. are destructive plant pathogens; therefore, effective monitoring and accurate early detection are important means of preventing potential epidemics and outbreaks of diseases. In the current study, a membrane-based oligonucleotide array was developed that can detect Phytophthora spp. reliably using three DNA regions; namely, the internal transcribed spacer (ITS), the 5' end of cytochrome c oxidase 1 gene (cox1), and the intergenic region between cytochrome c oxidase 2 gene (cox2) and cox1 (cox2-1 spacer). Each sequence data set contained ≈250 sequences representing 98 described and 15 undescribed species of Phytophthora. The array was validated with 143 pure cultures and 35 field samples. Together, nonrejected oligonucleotides from all three markers have the ability to reliably detect 82 described and 8 undescribed Phytophthora spp., including several quarantine or regulated pathogens such as Phytophthora ramorum. Our results showed that a DNA array containing signature oligonucleotides designed from multiple genomic regions provided robustness and redundancy for the detection and differentiation of closely related taxon groups. This array has the potential to be used as a routine diagnostic tool for Phytophthora spp. from complex environmental samples without the need for extensive growth of cultures.

RUCS: Rapid identification of PCR primers for unique core sequences

DEFF Research Database (Denmark)

Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

2017-01-01

Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

Do we need primer for orthodontic bonding? A randomized controlled trial.

Science.gov (United States)

Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

2015-04-01

To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

High-frequency genome editing using ssDNA oligonucleotides with zinc-finger nucleases

DEFF Research Database (Denmark)

Chen, Fuqiang; Pruett-Miller, Shondra M; Huang, Yuping

2011-01-01

Zinc-finger nucleases (ZFNs) have enabled highly efficient gene targeting in multiple cell types and organisms. Here we describe methods for using simple ssDNA oligonucleotides in tandem with ZFNs to efficiently produce human cell lines with three distinct genetic outcomes: (i) targeted point...

Primer on consumer marketing research : procedures, methods, and tools

Science.gov (United States)

1994-03-01

The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

Hierarchical architecture of active knits

International Nuclear Information System (INIS)

Abel, Julianna; Luntz, Jonathan; Brei, Diann

2013-01-01

Nature eloquently utilizes hierarchical structures to form the world around us. Applying the hierarchical architecture paradigm to smart materials can provide a basis for a new genre of actuators which produce complex actuation motions. One promising example of cellular architecture—active knits—provides complex three-dimensional distributed actuation motions with expanded operational performance through a hierarchically organized structure. The hierarchical structure arranges a single fiber of active material, such as shape memory alloys (SMAs), into a cellular network of interlacing adjacent loops according to a knitting grid. This paper defines a four-level hierarchical classification of knit structures: the basic knit loop, knit patterns, grid patterns, and restructured grids. Each level of the hierarchy provides increased architectural complexity, resulting in expanded kinematic actuation motions of active knits. The range of kinematic actuation motions are displayed through experimental examples of different SMA active knits. The results from this paper illustrate and classify the ways in which each level of the hierarchical knit architecture leverages the performance of the base smart material to generate unique actuation motions, providing necessary insight to best exploit this new actuation paradigm. (paper)

Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

Directory of Open Access Journals (Sweden)

Ma Xiaoying

2017-02-01

Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

Nested and Hierarchical Archimax copulas

KAUST Repository

Hofert, Marius

2017-07-03

The class of Archimax copulas is generalized to nested and hierarchical Archimax copulas in several ways. First, nested extreme-value copulas or nested stable tail dependence functions are introduced to construct nested Archimax copulas based on a single frailty variable. Second, a hierarchical construction of d-norm generators is presented to construct hierarchical stable tail dependence functions and thus hierarchical extreme-value copulas. Moreover, one can, by itself or additionally, introduce nested frailties to extend Archimax copulas to nested Archimax copulas in a similar way as nested Archimedean copulas extend Archimedean copulas. Further results include a general formula for the density of Archimax copulas.

Nested and Hierarchical Archimax copulas

KAUST Repository

Hofert, Marius; Huser, Raphaë l; Prasad, Avinash

2017-01-01

The class of Archimax copulas is generalized to nested and hierarchical Archimax copulas in several ways. First, nested extreme-value copulas or nested stable tail dependence functions are introduced to construct nested Archimax copulas based on a single frailty variable. Second, a hierarchical construction of d-norm generators is presented to construct hierarchical stable tail dependence functions and thus hierarchical extreme-value copulas. Moreover, one can, by itself or additionally, introduce nested frailties to extend Archimax copulas to nested Archimax copulas in a similar way as nested Archimedean copulas extend Archimedean copulas. Further results include a general formula for the density of Archimax copulas.

Analysis of oligonucleotide array experiments with repeated measures using mixed models

Directory of Open Access Journals (Sweden)

Getchell Thomas V

2004-12-01

Full Text Available Abstract Background Two or more factor mixed factorial experiments are becoming increasingly common in microarray data analysis. In this case study, the two factors are presence (Patients with Alzheimer's disease or absence (Control of the disease, and brain regions including olfactory bulb (OB or cerebellum (CER. In the design considered in this manuscript, OB and CER are repeated measurements from the same subject and, hence, are correlated. It is critical to identify sources of variability in the analysis of oligonucleotide array experiments with repeated measures and correlations among data points have to be considered. In addition, multiple testing problems are more complicated in experiments with multi-level treatments or treatment combinations. Results In this study we adopted a linear mixed model to analyze oligonucleotide array experiments with repeated measures. We first construct a generalized F test to select differentially expressed genes. The Benjamini and Hochberg (BH procedure of controlling false discovery rate (FDR at 5% was applied to the P values of the generalized F test. For those genes with significant generalized F test, we then categorize them based on whether the interaction terms were significant or not at the α-level (αnew = 0.0033 determined by the FDR procedure. Since simple effects may be examined for the genes with significant interaction effect, we adopt the protected Fisher's least significant difference test (LSD procedure at the level of αnew to control the family-wise error rate (FWER for each gene examined. Conclusions A linear mixed model is appropriate for analysis of oligonucleotide array experiments with repeated measures. We constructed a generalized F test to select differentially expressed genes, and then applied a specific sequence of tests to identify factorial effects. This sequence of tests applied was designed to control for gene based FWER.

Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

Directory of Open Access Journals (Sweden)

Andrea Fuso

Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

Thermoplastic polymers surfaces for Dip-Pen Nanolithography of oligonucleotides

Energy Technology Data Exchange (ETDEWEB)

Suriano, Raffaella [Dipartimento di Chimica, Materiali e Ingegneria Chimica “Giulio Natta”, Politecnico di Milano, Piazza Leonardo da Vinci 32, 20133 Milano (Italy); Biella, Serena, E-mail: serena.biella@polimi.it [Dipartimento di Chimica, Materiali e Ingegneria Chimica “Giulio Natta”, Politecnico di Milano, Piazza Leonardo da Vinci 32, 20133 Milano (Italy); Cesura, Federico; Levi, Marinella; Turri, Stefano [Dipartimento di Chimica, Materiali e Ingegneria Chimica “Giulio Natta”, Politecnico di Milano, Piazza Leonardo da Vinci 32, 20133 Milano (Italy)

2013-05-15

Different thermoplastic polymers were spin-coated to prepare smooth surfaces for the direct deposition of end-group modified oligonucleotides by Dip-Pen Nanolithography. A study of the diffusion process was done in order to investigate the dependence of calibration coefficient and quality of deposited features on environmental parameters (temperature, relative humidity) and ink's molecular weight and functionality. The optimization of the process parameters led to the realization of high quality and density nanoarrays on plastics.

Criticality calculations with MCNP trademark: A primer

International Nuclear Information System (INIS)

Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

1994-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

UniPrime2: a web service providing easier Universal Primer design.

Science.gov (United States)

Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

2009-07-01

The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

Science.gov (United States)

Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

2018-03-01

Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

Science.gov (United States)

Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

2018-03-01

We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

Nucleoside-O-Methyl-(H)-Phosphinates: Novel Monomers for the Synthesis of Methylphosphonate Oligonucleotides Using H-Phosphonate Chemistry.

Science.gov (United States)

Kostov, Ondřej; Páv, Ondřej; Rosenberg, Ivan

2017-09-18

This unit comprises the straightforward synthesis of protected 2'-deoxyribonucleoside-O-methyl-(H)-phosphinates in both 3'- and 5'-series. These compounds represent a new class of monomers compatible with the solid-phase synthesis of oligonucleotides using H-phosphonate chemistry and are suitable for the preparation of both 3'- and 5'-O-methylphosphonate oligonucleotides. The synthesis of 4-toluenesulfonyloxymethyl-(H)-phosphinic acid as a new reagent for the preparation of O-methyl-(H)-phosphinic acid derivatives is described. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

A new achiral reagent for the incorporation of multiple amino groups into oligonucleotides

DEFF Research Database (Denmark)

Behrens, Carsten; Petersen, Kenneth H.; Egholm, Michael

1995-01-01

The synthesis of a new functionalized achiral linker reagent (10) for the incorporation of multiple primary amino groups into oligonucleotides is described. The linker reagent is compatible with conventional DNA-synthesis following the phosphoramidite methodology, and the linker can be incorporated...

Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

DEFF Research Database (Denmark)

Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

2014-01-01

, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

A database of PCR primers for the chloroplast genomes of higher plants

Science.gov (United States)

Heinze, Berthold

2007-01-01

Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

A database of PCR primers for the chloroplast genomes of higher plants

Directory of Open Access Journals (Sweden)

Heinze Berthold

2007-02-01

Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

Chemically modified oligonucleotides with efficient RNase H response

DEFF Research Database (Denmark)

Vester, Birte; Boel, Anne Marie; Lobedanz, Sune

2008-01-01

Ten different chemically modified nucleosides were incorporated into short DNA strands (chimeric oligonucleotides ON3-ON12 and ON15-ON24) and then tested for their capacity to mediate RNAse H cleavage of the complementary RNA strand. The modifications were placed at two central positions directly...... in the RNase H cleaving region. The RNA strand of duplexes with ON3, ON5 and ON12 were cleaved more efficiently than the RNA strand of the DNA:RNA control duplex. There seems to be no correlation between the thermal stability between the duplexes and RNase H cleavage....

Dose-Dependent Lowering of Mutant Huntingtin Using Antisense Oligonucleotides in Huntington Disease Patients.

Science.gov (United States)

van Roon-Mom, Willeke M C; Roos, Raymund A C; de Bot, Susanne T

2018-04-01

On December 11 of 2017, Ionis Pharmaceuticals published a press release announcing dose-dependent reductions of mutant huntingtin protein in their HTTRx Phase 1/2a study in Huntington disease (HD) patients. The results from this Ionis trial have gained much attention from the patient community and the oligonucleotide therapeutics field, since it is the first trial targeting the cause of HD, namely the mutant huntingtin protein, using antisense oligonucleotides (ASOs). The press release also states that the primary endpoints of the study (safety and tolerability) were met, but does not contain data. This news follows the approval of another therapeutic ASO nusinersen (trade name Spinraza) for a neurological disease, spinal muscular atrophy, by the U.S. Food and Drug Administration and European Medicines Agency, in 2016 and 2017, respectively. Combined, this offers hope for the development of the HTTRx therapy for HD patients.

Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

Directory of Open Access Journals (Sweden)

Puntipar Sonthiphand

Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

Oligonucleotide arrays vs. metaphase-comparative genomic hybridisation and BAC arrays for single-cell analysis: first applications to preimplantation genetic diagnosis for Robertsonian translocation carriers.

Science.gov (United States)

Ramos, Laia; del Rey, Javier; Daina, Gemma; García-Aragonés, Manel; Armengol, Lluís; Fernandez-Encinas, Alba; Parriego, Mònica; Boada, Montserrat; Martinez-Passarell, Olga; Martorell, Maria Rosa; Casagran, Oriol; Benet, Jordi; Navarro, Joaquima

2014-01-01

Comprehensive chromosome analysis techniques such as metaphase-Comparative Genomic Hybridisation (CGH) and array-CGH are available for single-cell analysis. However, while metaphase-CGH and BAC array-CGH have been widely used for Preimplantation Genetic Diagnosis, oligonucleotide array-CGH has not been used in an extensive way. A comparison between oligonucleotide array-CGH and metaphase-CGH has been performed analysing 15 single fibroblasts from aneuploid cell-lines and 18 single blastomeres from human cleavage-stage embryos. Afterwards, oligonucleotide array-CGH and BAC array-CGH were also compared analysing 16 single blastomeres from human cleavage-stage embryos. All three comprehensive analysis techniques provided broadly similar cytogenetic profiles; however, non-identical profiles appeared when extensive aneuploidies were present in a cell. Both array techniques provided an optimised analysis procedure and a higher resolution than metaphase-CGH. Moreover, oligonucleotide array-CGH was able to define extra segmental imbalances in 14.7% of the blastomeres and it better determined the specific unbalanced chromosome regions due to a higher resolution of the technique (≈ 20 kb). Applicability of oligonucleotide array-CGH for Preimplantation Genetic Diagnosis has been demonstrated in two cases of Robertsonian translocation carriers 45,XY,der(13;14)(q10;q10). Transfer of euploid embryos was performed in both cases and pregnancy was achieved by one of the couples. This is the first time that an oligonucleotide array-CGH approach has been successfully applied to Preimplantation Genetic Diagnosis for balanced chromosome rearrangement carriers.

Oligonucleotide arrays vs. metaphase-comparative genomic hybridisation and BAC arrays for single-cell analysis: first applications to preimplantation genetic diagnosis for Robertsonian translocation carriers.

Directory of Open Access Journals (Sweden)

Laia Ramos

Full Text Available Comprehensive chromosome analysis techniques such as metaphase-Comparative Genomic Hybridisation (CGH and array-CGH are available for single-cell analysis. However, while metaphase-CGH and BAC array-CGH have been widely used for Preimplantation Genetic Diagnosis, oligonucleotide array-CGH has not been used in an extensive way. A comparison between oligonucleotide array-CGH and metaphase-CGH has been performed analysing 15 single fibroblasts from aneuploid cell-lines and 18 single blastomeres from human cleavage-stage embryos. Afterwards, oligonucleotide array-CGH and BAC array-CGH were also compared analysing 16 single blastomeres from human cleavage-stage embryos. All three comprehensive analysis techniques provided broadly similar cytogenetic profiles; however, non-identical profiles appeared when extensive aneuploidies were present in a cell. Both array techniques provided an optimised analysis procedure and a higher resolution than metaphase-CGH. Moreover, oligonucleotide array-CGH was able to define extra segmental imbalances in 14.7% of the blastomeres and it better determined the specific unbalanced chromosome regions due to a higher resolution of the technique (≈ 20 kb. Applicability of oligonucleotide array-CGH for Preimplantation Genetic Diagnosis has been demonstrated in two cases of Robertsonian translocation carriers 45,XY,der(13;14(q10;q10. Transfer of euploid embryos was performed in both cases and pregnancy was achieved by one of the couples. This is the first time that an oligonucleotide array-CGH approach has been successfully applied to Preimplantation Genetic Diagnosis for balanced chromosome rearrangement carriers.

Oligonucleotide Arrays vs. Metaphase-Comparative Genomic Hybridisation and BAC Arrays for Single-Cell Analysis: First Applications to Preimplantation Genetic Diagnosis for Robertsonian Translocation Carriers

Science.gov (United States)

Ramos, Laia; del Rey, Javier; Daina, Gemma; García-Aragonés, Manel; Armengol, Lluís; Fernandez-Encinas, Alba; Parriego, Mònica; Boada, Montserrat; Martinez-Passarell, Olga; Martorell, Maria Rosa; Casagran, Oriol; Benet, Jordi; Navarro, Joaquima

2014-01-01

Comprehensive chromosome analysis techniques such as metaphase-Comparative Genomic Hybridisation (CGH) and array-CGH are available for single-cell analysis. However, while metaphase-CGH and BAC array-CGH have been widely used for Preimplantation Genetic Diagnosis, oligonucleotide array-CGH has not been used in an extensive way. A comparison between oligonucleotide array-CGH and metaphase-CGH has been performed analysing 15 single fibroblasts from aneuploid cell-lines and 18 single blastomeres from human cleavage-stage embryos. Afterwards, oligonucleotide array-CGH and BAC array-CGH were also compared analysing 16 single blastomeres from human cleavage-stage embryos. All three comprehensive analysis techniques provided broadly similar cytogenetic profiles; however, non-identical profiles appeared when extensive aneuploidies were present in a cell. Both array techniques provided an optimised analysis procedure and a higher resolution than metaphase-CGH. Moreover, oligonucleotide array-CGH was able to define extra segmental imbalances in 14.7% of the blastomeres and it better determined the specific unbalanced chromosome regions due to a higher resolution of the technique (≈20 kb). Applicability of oligonucleotide array-CGH for Preimplantation Genetic Diagnosis has been demonstrated in two cases of Robertsonian translocation carriers 45,XY,der(13;14)(q10;q10). Transfer of euploid embryos was performed in both cases and pregnancy was achieved by one of the couples. This is the first time that an oligonucleotide array-CGH approach has been successfully applied to Preimplantation Genetic Diagnosis for balanced chromosome rearrangement carriers. PMID:25415307

The ability of T2/B4 primers to detect Leishmania infantum among ...

African Journals Online (AJOL)

SERVER

2008-04-03

Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

CTG repeat-targeting oligonucleotides for down-regulating Huntingtin expression

DEFF Research Database (Denmark)

Zaghloul, Eman M; Gissberg, Olof; Moreno, Pedro M D

2017-01-01

Huntington's disease (HD) is a fatal, neurodegenerative disorder in which patients suffer from mobility, psychological and cognitive impairments. Existing therapeutics are only symptomatic and do not significantly alter the disease progression or increase life expectancy. HD is caused by expansion....... Thus, reduction of both muHTT mRNA and protein levels would ideally be the most useful therapeutic option. We herein present a novel strategy for HD treatment using oligonucleotides (ONs) directly targeting the HTT trinucleotide repeat DNA. A partial, but significant and potentially long-term, HTT...

Mismatch oligonucleotides in human and yeast: guidelines for probe design on tiling microarrays

Directory of Open Access Journals (Sweden)

Jee Justin

2008-12-01

Full Text Available Abstract Background Mismatched oligonucleotides are widely used on microarrays to differentiate specific from nonspecific hybridization. While many experiments rely on such oligos, the hybridization behavior of various degrees of mismatch (MM structure has not been extensively studied. Here, we present the results of two large-scale microarray experiments on S. cerevisiae and H. sapiens genomic DNA, to explore MM oligonucleotide behavior with real sample mixtures under tiling-array conditions. Results We examined all possible nucleotide substitutions at the central position of 36-nucleotide probes, and found that nonspecific binding by MM oligos depends upon the individual nucleotide substitutions they incorporate: C→A, C→G and T→A (yielding purine-purine mispairs are most disruptive, whereas A→X were least disruptive. We also quantify a marked GC skew effect: substitutions raising probe GC content exhibit higher intensity (and vice versa. This skew is small in highly-expressed regions (± 0.5% of total intensity range and large (± 2% or more elsewhere. Multiple mismatches per oligo are largely additive in effect: each MM added in a distributed fashion causes an additional 21% intensity drop relative to PM, three-fold more disruptive than adding adjacent mispairs (7% drop per MM. Conclusion We investigate several parameters for oligonucleotide design, including the effects of each central nucleotide substitution on array signal intensity and of multiple MM per oligo. To avoid GC skew, individual substitutions should not alter probe GC content. RNA sample mixture complexity may increase the amount of nonspecific hybridization, magnify GC skew and boost the intensity of MM oligos at all levels.

Universal primers that amplify RNA from all three flavivirus subgroups

Directory of Open Access Journals (Sweden)

Barnard Ross T

2008-01-01

Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

Multi-gene detection and identification of mosquito-borne RNA viruses using an oligonucleotide microarray.

Directory of Open Access Journals (Sweden)

Nathan D Grubaugh

Full Text Available BACKGROUND: Arthropod-borne viruses are important emerging pathogens world-wide. Viruses transmitted by mosquitoes, such as dengue, yellow fever, and Japanese encephalitis viruses, infect hundreds of millions of people and animals each year. Global surveillance of these viruses in mosquito vectors using molecular based assays is critical for prevention and control of the associated diseases. Here, we report an oligonucleotide DNA microarray design, termed ArboChip5.1, for multi-gene detection and identification of mosquito-borne RNA viruses from the genera Flavivirus (family Flaviviridae, Alphavirus (Togaviridae, Orthobunyavirus (Bunyaviridae, and Phlebovirus (Bunyaviridae. METHODOLOGY/PRINCIPAL FINDINGS: The assay utilizes targeted PCR amplification of three genes from each virus genus for electrochemical detection on a portable, field-tested microarray platform. Fifty-two viruses propagated in cell-culture were used to evaluate the specificity of the PCR primer sets and the ArboChip5.1 microarray capture probes. The microarray detected all of the tested viruses and differentiated between many closely related viruses such as members of the dengue, Japanese encephalitis, and Semliki Forest virus clades. Laboratory infected mosquitoes were used to simulate field samples and to determine the limits of detection. Additionally, we identified dengue virus type 3, Japanese encephalitis virus, Tembusu virus, Culex flavivirus, and a Quang Binh-like virus from mosquitoes collected in Thailand in 2011 and 2012. CONCLUSIONS/SIGNIFICANCE: We demonstrated that the described assay can be utilized in a comprehensive field surveillance program by the broad-range amplification and specific identification of arboviruses from infected mosquitoes. Furthermore, the microarray platform can be deployed in the field and viral RNA extraction to data analysis can occur in as little as 12 h. The information derived from the ArboChip5.1 microarray can help to establish

Synthetic Nucleic Acid Analogues in Gene Therapy: An Update for Peptide–Oligonucleotide Conjugates

DEFF Research Database (Denmark)

Taskova, Maria; Mantsiou, Anna; Astakhova, Kira

2017-01-01

The main objective of this work is to provide an update on synthetic nucleic acid analogues and nanoassemblies as tools in gene therapy. In particular, the synthesis and properties of peptide–oligonucleotide conjugates (POCs), which have high potential in research and as therapeutics, are described...

Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

Science.gov (United States)

Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

2013-09-01

New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

Directory of Open Access Journals (Sweden)

Ni Luh Putu Indi Dharmayanti

2016-07-01

Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

Design of a Percussion and Electric Primer Gun Firing Power Supply

Science.gov (United States)

2014-07-01

solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

Science.gov (United States)

Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

2013-06-06

Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

Molecular imaging of atherosclerotic plaques with technetium-99m-labelled antisense oligonucleotides

International Nuclear Information System (INIS)

Qin Guangming; Zhang Yongxue; Cao Wei; An Rui; Gao Zairong; Xu Wendai; Zhang Kaijun; Li Guiling; Li Shuren

2005-01-01

The purpose of this study was to visualise experimental atherosclerotic lesions using radiolabelled antisense oligonucleotides (ASONs). Atherosclerosis was induced in New Zealand White rabbits fed 1% cholesterol for approximately 60 days. In vivo and ex vivo imaging was performed in atherosclerotic rabbits and normal control rabbits after i.v. injection of 92.5±18.5 MBq 99m Tc-labelled ASON or 99m Tc-labelled sense oligonucleotides. Immediately after the in vivo imaging, the animals were sacrificed and ex vivo imaging of the aortic specimens was performed. Biodistribution of radiolabelled c-mycASON was evaluated in vivo in atherosclerotic rabbits. Planar imaging revealed accumulation of 99m Tc-labelled c-mycASON in atherosclerotic lesions along the artery wall. Ex vivo imaging further demonstrated that the area of activity accumulation matched the area of atherosclerotic lesions. In contrast, no atherosclerotic lesions were found in the vessel wall and no positive imaging results were obtained in animals of the control group. This molecular imaging approach has potential for non-invasive imaging of atherosclerotic plaques at an early stage. (orig.)

Neutrosophic Hierarchical Clustering Algoritms

Directory of Open Access Journals (Sweden)

Rıdvan Şahin

2014-03-01

Full Text Available Interval neutrosophic set (INS is a generalization of interval valued intuitionistic fuzzy set (IVIFS, whose the membership and non-membership values of elements consist of fuzzy range, while single valued neutrosophic set (SVNS is regarded as extension of intuitionistic fuzzy set (IFS. In this paper, we extend the hierarchical clustering techniques proposed for IFSs and IVIFSs to SVNSs and INSs respectively. Based on the traditional hierarchical clustering procedure, the single valued neutrosophic aggregation operator, and the basic distance measures between SVNSs, we define a single valued neutrosophic hierarchical clustering algorithm for clustering SVNSs. Then we extend the algorithm to classify an interval neutrosophic data. Finally, we present some numerical examples in order to show the effectiveness and availability of the developed clustering algorithms.

Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

Science.gov (United States)

Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

2015-07-01

The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

Bioinformatic tools for PCR Primer design

African Journals Online (AJOL)

ES

Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

The Hierarchical Perspective

Directory of Open Access Journals (Sweden)

Daniel Sofron

2015-05-01

Full Text Available This paper is focused on the hierarchical perspective, one of the methods for representing space that was used before the discovery of the Renaissance linear perspective. The hierarchical perspective has a more or less pronounced scientific character and its study offers us a clear image of the way the representatives of the cultures that developed it used to perceive the sensitive reality. This type of perspective is an original method of representing three-dimensional space on a flat surface, which characterises the art of Ancient Egypt and much of the art of the Middle Ages, being identified in the Eastern European Byzantine art, as well as in the Western European Pre-Romanesque and Romanesque art. At the same time, the hierarchical perspective is also present in naive painting and infantile drawing. Reminiscences of this method can be recognised also in the works of some precursors of the Italian Renaissance. The hierarchical perspective can be viewed as a subjective ranking criterion, according to which the elements are visually represented by taking into account their relevance within the image while perception is ignored. This paper aims to show how the main objective of the artists of those times was not to faithfully represent the objective reality, but rather to emphasize the essence of the world and its perennial aspects. This may represent a possible explanation for the refusal of perspective in the Egyptian, Romanesque and Byzantine painting, characterised by a marked two-dimensionality.

Comparisons of Flow Patterns over a Hierarchical and a Non-hierarchical Surface in Relation to Biofouling Control

Directory of Open Access Journals (Sweden)

Bin Ahmad Fawzan Mohammed Ridha

2018-01-01

Full Text Available Biofouling can be defined as unwanted deposition and development of organisms on submerged surfaces. It is a major problem as it causes water contamination, infrastructures damage and increase in maintenance and operational cost especially in the shipping industry. There are a few methods that can prevent this problem. One of the most effective methods which is using chemicals particularly Tributyltin has been banned due to adverse effects on the environment. One of the non-toxic methods found to be effective is surface modification which involves altering the surface topography so that it becomes a low-fouling or a non-stick surface to biofouling organisms. Current literature suggested that non-hierarchical topographies has lower antifouling performance compared to hierarchical topographies. It is still unclear if the effects of the flow on these topographies could have aided in their antifouling properties. This research will use Computational Fluid Dynamics (CFD simulations to study the flow on these two topographies which also involves comparison study of the topographies used. According to the results obtained, it is shown that hierarchical topography has higher antifouling performance compared to non-hierarchical topography. This is because the fluid characteristics at the hierarchical topography is more favorable in controlling biofouling. In addition, hierarchical topography has higher wall shear stress distribution compared to non-hierarchical topography

A novel setup for the determination of absolute cross sections for low-energy electron induced strand breaks in oligonucleotides - The effect of the radiosensitizer 5-fluorouracil

International Nuclear Information System (INIS)

Rackwitz, J.; Rankovic, M.L.; Milosavljevic, A.R.; Bald, I.

2017-01-01

Low-energy electrons (LEEs) play an important role in DNA radiation damage. Here we present a method to quantify LEE induced strand breakage in well-defined oligonucleotide single strands in terms of absolute cross sections. An LEE irradiation setup covering electron energies <500 eV is constructed and optimized to irradiate DNA origami triangles carrying well-defined oligonucleotide target strands. Measurements are presented for 10.0 and 5.5 eV for different oligonucleotide targets. The determination of absolute strand break cross sections is performed by atomic force microscopy analysis. An accurate fluence determination ensures small margins of error of the determined absolute single strand break cross sections σ SSB . In this way, the influence of sequence modification with the radiosensitive 5-Fluorouracil ( 5F U) is studied using an absolute and relative data analysis. We demonstrate an increase in the strand break yields of 5F U containing oligonucleotides by a factor of 1.5 to 1.6 compared with non-modified oligonucleotide sequences when irradiated with 10 eV electrons. (authors)

Effect of mosaic virus diseases on dry matter content and starch ...

African Journals Online (AJOL)

hp

2013-06-28

Jun 28, 2013 ... each of forward and reverse primers and 2.0 µl of template DNA. Oligonucleotide ... weighed and milled using a mill (Hormeku Engineering Company. Ltd., Ghana) .... cassava varieties exhibit tolerance to CMD, it is important.

Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

Directory of Open Access Journals (Sweden)

Alexandre R. Zuntini

2013-08-01

Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

Real-time PCR (qPCR) primer design using free online software.

Science.gov (United States)

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

A Hearing Aid Primer 1

Science.gov (United States)

Yetter, Carol J.

2009-01-01

This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

DNA Extraction and Primer Selection

DEFF Research Database (Denmark)

Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

A classical primer for QCD

International Nuclear Information System (INIS)

Moriyasu, K.

1981-01-01

A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

Adaptive hierarchical multi-agent organizations

NARCIS (Netherlands)

Ghijsen, M.; Jansweijer, W.N.H.; Wielinga, B.J.; Babuška, R.; Groen, F.C.A.

2010-01-01

In this chapter, we discuss the design of adaptive hierarchical organizations for multi-agent systems (MAS). Hierarchical organizations have a number of advantages such as their ability to handle complex problems and their scalability to large organizations. By introducing adaptivity in the

Optical properties and electronic transitions of DNA oligonucleotides as a function of composition and stacking sequence.

Science.gov (United States)

Schimelman, Jacob B; Dryden, Daniel M; Poudel, Lokendra; Krawiec, Katherine E; Ma, Yingfang; Podgornik, Rudolf; Parsegian, V Adrian; Denoyer, Linda K; Ching, Wai-Yim; Steinmetz, Nicole F; French, Roger H

2015-02-14

The role of base pair composition and stacking sequence in the optical properties and electronic transitions of DNA is of fundamental interest. We present and compare the optical properties of DNA oligonucleotides (AT)10, (AT)5(GC)5, and (AT-GC)5 using both ab initio methods and UV-vis molar absorbance measurements. Our data indicate a strong dependence of both the position and intensity of UV absorbance features on oligonucleotide composition and stacking sequence. The partial densities of states for each oligonucleotide indicate that the valence band edge arises from a feature associated with the PO4(3-) complex anion, and the conduction band edge arises from anti-bonding states in DNA base pairs. The results show a strong correspondence between the ab initio and experimentally determined optical properties. These results highlight the benefit of full spectral analysis of DNA, as opposed to reductive methods that consider only the 260 nm absorbance (A260) or simple purity ratios, such as A260/A230 or A260/A280, and suggest that the slope of the absorption edge onset may provide a useful metric for the degree of base pair stacking in DNA. These insights may prove useful for applications in biology, bioelectronics, and mesoscale self-assembly.

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

Science.gov (United States)

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

Tools for Ultraspecific Probe/Primer Design

National Research Council Canada - National Science Library

Fofanov, Yurly

2006-01-01

.... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

Diversity of internal structures in inhibited epoxy primers

Directory of Open Access Journals (Sweden)

Anthony E. Hughes

2015-10-01

Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

Directory of Open Access Journals (Sweden)

El-Sayed Negim

2016-01-01

Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

Bond strength of compomers to dentin using acidic primers.

Science.gov (United States)

Tate, W H; You, C; Powers, J M

1999-10-01

To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

Genetic divergence between two clinostomatid fish endoparasites ...

African Journals Online (AJOL)

1998-11-16

. To identify usable oligonucleotide prim- ers, a trial study was conducted using parasite DNA and six different 10-mer primers. For amplification, we used a mix- ture including 0.125 ~I DNA polymerase (Takara Taq), 2.5 ~I.

Chemosensitization of Human Renal Cell Cancer Using Antisense Oligonucleotides Targeting the Antiapoptotic Gene Clusterin

Directory of Open Access Journals (Sweden)

Tobias Zellweger

2001-01-01

Full Text Available BACKGROUND: Renal cell cancer (RCC is a chemoresistant disease with no active chemotherapeutic agent achieving objective response rates higher than 15%. Clusterin is a cell survival gene that increases in human renal tubular epithelial cells after various states of injury and disease. Downregulation of clusterin, using antisense oligonucleotides (ASO, has recently been shown to increase chemosensitivity in several prostate cancer models. The objectives in this study were to evaluate clusterin expression levels in human RCC and normal kidney tissue, and to test whether clusterin ASO could also enhance chemosensitivity in human RCC Caki-2 cells both in vitro and in vivo. METHODS: Immunohistochemical staining was used to characterize clusterin expression in 67 RCC and normal kidney tissues obtained from radical nephrectomy specimens. Northern blot analysis was used to assess changes in clusterin mRNA expression after ASO and paclitaxel treatment. The effects of combined clusterin ASO and paclitaxel treatment on Caki-2 cell growth was examined using an MTT assay. Athymic mice bearing Caki-2 tumors were treated with clusterin ASO alone, clusterin ASO plus paclitaxel, and mismatch control oligonucleotides plus paclitaxel, over a period of 28 days with measurement of tumor volumes once weekly over 8 weeks. RESULTS: Immunohistochemistry of normal and malignant kidney tissue sections of 67 patients demonstrated positive clusterin staining for almost all RCC (98% and an overexpression, compared to normal tissue, in a majority of RCC (69%. Clusterin ASO, but not mismatch control oligonucleotides, decreased clusterin mRNA expression in Caki-2 cells in a dosedependent and sequence-specific manner. Pretreatment of Caki-2 cells with clusterin ASO significantly enhanced chemosensitivity to paclitaxel in vitro. Characteristic apoptotic DNA laddering was observed after combined treatment with ASO plus paclitaxel, but not with either agent alone. In vivo

Hierarchical video summarization

Science.gov (United States)

Ratakonda, Krishna; Sezan, M. Ibrahim; Crinon, Regis J.

1998-12-01

We address the problem of key-frame summarization of vide in the absence of any a priori information about its content. This is a common problem that is encountered in home videos. We propose a hierarchical key-frame summarization algorithm where a coarse-to-fine key-frame summary is generated. A hierarchical key-frame summary facilitates multi-level browsing where the user can quickly discover the content of the video by accessing its coarsest but most compact summary and then view a desired segment of the video with increasingly more detail. At the finest level, the summary is generated on the basis of color features of video frames, using an extension of a recently proposed key-frame extraction algorithm. The finest level key-frames are recursively clustered using a novel pairwise K-means clustering approach with temporal consecutiveness constraint. We also address summarization of MPEG-2 compressed video without fully decoding the bitstream. We also propose efficient mechanisms that facilitate decoding the video when the hierarchical summary is utilized in browsing and playback of video segments starting at selected key-frames.

Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

OpenAIRE

Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

2014-01-01

Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

Directory of Open Access Journals (Sweden)

Francesco Dal Grande

2013-03-01

Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

40 CFR 63.745 - Standards: Primer and topcoat application operations.

Science.gov (United States)

2010-07-01

... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

Simplified Paper Format for Detecting HIV Drug Resistance in Clinical Specimens by Oligonucleotide Ligation

Science.gov (United States)

Panpradist, Nuttada; Beck, Ingrid A.; Chung, Michael H.; Kiarie, James N.; Frenkel, Lisa M.; Lutz, Barry R.

2016-01-01

Human immunodeficiency virus (HIV) is a chronic infection that can be managed by antiretroviral treatment (ART). However, periods of suboptimal viral suppression during lifelong ART can select for HIV drug resistant (DR) variants. Transmission of drug resistant virus can lessen or abrogate ART efficacy. Therefore, testing of individuals for drug resistance prior to initiation of treatment is recommended to ensure effective ART. Sensitive and inexpensive HIV genotyping methods are needed in low-resource settings where most HIV infections occur. The oligonucleotide ligation assay (OLA) is a sensitive point mutation assay for detection of drug resistance mutations in HIV pol. The current OLA involves four main steps from sample to analysis: (1) lysis and/or nucleic acid extraction, (2) amplification of HIV RNA or DNA, (3) ligation of oligonucleotide probes designed to detect single nucleotide mutations that confer HIV drug resistance, and (4) analysis via oligonucleotide surface capture, denaturation, and detection (CDD). The relative complexity of these steps has limited its adoption in resource-limited laboratories. Here we describe a simplification of the 2.5-hour plate-format CDD to a 45-minute paper-format CDD that eliminates the need for a plate reader. Analysis of mutations at four HIV-1 DR codons (K103N, Y181C, M184V, and G190A) in 26 blood specimens showed a strong correlation of the ratios of mutant signal to total signal between the paper CDD and the plate CDD. The assay described makes the OLA easier to perform in low resource laboratories. PMID:26751207

Dissecting the hybridization of oligonucleotides to structured complementary sequences.

Science.gov (United States)

Peracchi, Alessio

2016-06-01

When oligonucleotides hybridize to long target molecules, the process is slowed by the secondary structure in the targets. The phenomenon has been analyzed in several previous studies, but many details remain poorly understood. I used a spectrofluorometric strategy, focusing on the formation/breaking of individual base pairs, to study the kinetics of association between a DNA hairpin and >20 complementary oligonucleotides ('antisenses'). Hybridization rates differed by over three orders of magnitude. Association was toehold-mediated, both for antisenses binding to the target's ends and for those designed to interact with the loop. Binding of these latter, besides being consistently slower, was affected to variable, non-uniform extents by the asymmetric loop structure. Divalent metal ions accelerated hybridization, more pronouncedly when nucleation occurred at the loop. Incorporation of locked nucleic acid (LNA) residues in the antisenses substantially improved the kinetics only when LNAs participated to the earliest hybridization steps. The effects of individual LNAs placed along the antisense indicated that the reaction transition state occurred after invading at least the first base pair of the stem. The experimental approach helps dissect hybridization reactions involving structured nucleic acids. Toehold-dependent, nucleation-invasion models appear fully appropriate for describing such reactions. Estimating the stability of nucleation complexes formed at internal toeholds is the major hurdle for the quantitative prediction of hybridization rates. While analyzing the mechanisms of a fundamental biochemical process (hybridization), this work also provides suggestions for the improvement of technologies that rely on such process. Copyright © 2016 Elsevier B.V. All rights reserved.

The detection and differentiation of canine respiratory pathogens using oligonucleotide microarrays.

Science.gov (United States)

Wang, Lih-Chiann; Kuo, Ya-Ting; Chueh, Ling-Ling; Huang, Dean; Lin, Jiunn-Horng

2017-05-01

Canine respiratory diseases are commonly seen in dogs along with co-infections with multiple respiratory pathogens, including viruses and bacteria. Virus infections in even vaccinated dogs were also reported. The clinical signs caused by different respiratory etiological agents are similar, which makes differential diagnosis imperative. An oligonucleotide microarray system was developed in this study. The wild type and vaccine strains of canine distemper virus (CDV), influenza virus, canine herpesvirus (CHV), Bordetella bronchiseptica and Mycoplasma cynos were detected and differentiated simultaneously on a microarray chip. The detection limit is 10, 10, 100, 50 and 50 copy numbers for CDV, influenza virus, CHV, B. bronchiseptica and M. cynos, respectively. The clinical test results of nasal swab samples showed that the microarray had remarkably better efficacy than the multiplex PCR-agarose gel method. The positive detection rate of microarray and agarose gel was 59.0% (n=33) and 41.1% (n=23) among the 56 samples, respectively. CDV vaccine strain and pathogen co-infections were further demonstrated by the microarray but not by the multiplex PCR-agarose gel. The oligonucleotide microarray provides a highly efficient diagnosis alternative that could be applied to clinical usage, greatly assisting in disease therapy and control. Copyright © 2017 Elsevier B.V. All rights reserved.

Direct microcontact printing of oligonucleotides for biochip applications

Directory of Open Access Journals (Sweden)

Trévisiol E

2005-07-01

Full Text Available Abstract Background A critical step in the fabrication of biochips is the controlled placement of probes molecules on solid surfaces. This is currently performed by sequential deposition of probes on a target surface with split or solid pins. In this article, we present a cost-effective procedure namely microcontact printing using stamps, for a parallel deposition of probes applicable for manufacturing biochips. Results Contrary to a previous work, we showed that the stamps tailored with an elastomeric poly(dimethylsiloxane material did not require any surface modification to be able to adsorb oligonucleotides or PCR products. The adsorbed DNA molecules are subsequently printed efficiently on a target surface with high sub-micron resolution. Secondly, we showed that successive stamping is characterized by an exponential decay of the amount of transferred DNA molecules to the surface up the 4th print, then followed by a second regime of transfer that was dependent on the contact time and which resulted in reduced quality of the features. Thus, while consecutive stamping was possible, this procedure turned out to be less reproducible and more time consuming than simply re-inking the stamps between each print. Thirdly, we showed that the hybridization signals on arrays made by microcontact printing were 5 to 10-times higher than those made by conventional spotting methods. Finally, we demonstrated the validity of this microcontact printing method in manufacturing oligonucleotides arrays for mutations recognition in a yeast gene. Conclusion The microcontact printing can be considered as a new potential technology platform to pattern DNA microarrays that may have significant advantages over the conventional spotting technologies as it is easy to implement, it uses low cost material to make the stamp, and the arrays made by this technology are 10-times more sensitive in term of hybridization signals than those manufactured by conventional spotting

N-Branched acyclic nucleoside phosphonates as monomers for the synthesis of modified oligonucleotides

Czech Academy of Sciences Publication Activity Database

Hocková, Dana; Rosenbergová, Šárka; Ménová, Petra; Páv, Ondřej; Pohl, Radek; Novák, Pavel; Rosenberg, Ivan

2015-01-01

Roč. 13, č. 15 (2015), s. 4449-4458 ISSN 1477-0520 R&D Projects: GA ČR GAP207/11/0108; GA ČR GA13-26526S Institutional support: RVO:61388963 Keywords : acyclic nucleoside phosphonates * oligonucleotides * solid phase synthesis Subject RIV: CC - Organic Chemistry Impact factor: 3.559, year: 2015

Evaluation of fluorine-18-labeled alkylating agents as potential synthons for the labeling of oligonucleotides

NARCIS (Netherlands)

de Vries, EFJ; Vroegh, J; Elsinga, PH; Vaalburg, W

Six fluorine-18-labeled alkylating agents were selected as potentially suitable synthons for the labeling of antisense oligonucleotides. The selected synthons were evaluated in a model reaction with the monomer adenosine 5'-O-thiomonophosphate. Of these synthons,

Combination of vascular endothelial growth factor antisense oligonucleotide therapy and radiotherapy increases the curative effects against maxillofacial VX2 tumors in rabbits

Energy Technology Data Exchange (ETDEWEB)

Zheng Linfeng, E-mail: zhenglinfeng04@yahoo.com.cn [Department of Radiology, Shanghai First People' s Hospital, Medical College, Shanghai Jiaotong University, Hanning Road, 100, 200080 Shanghai (China); Li Yujie, E-mail: yujieli01@yahoo.com.cn [Department of Radiology, Shanghai First People' s Hospital, Medical College, Shanghai Jiaotong University, Hanning Road, 100, 200080 Shanghai (China); Wang Han, E-mail: bingowh@hotmail.com [Department of Radiology, Shanghai First People' s Hospital, Medical College, Shanghai Jiaotong University, Hanning Road, 100, 200080 Shanghai (China); Zhao Jinglong, E-mail: jinglongz@yahoo.com [Department of Radiology, Shanghai First People' s Hospital, Medical College, Shanghai Jiaotong University, Hanning Road, 100, 200080 Shanghai (China); Wang Xifu, E-mail: wangxiechen001@163.com [Department of Radiology, Shanghai First People' s Hospital, Medical College, Shanghai Jiaotong University, Hanning Road, 100, 200080 Shanghai (China); Hu Yunsheng, E-mail: springmorninghu@163.com [Department of Radiology, Shanghai First People' s Hospital, Medical College, Shanghai Jiaotong University, Hanning Road, 100, 200080 Shanghai (China); Zhang Guixiang, E-mail: guixiangzhang@sina.com [Department of Radiology, Shanghai First People' s Hospital, Medical College, Shanghai Jiaotong University, Hanning Road, 100, 200080 Shanghai (China)

2011-05-15

Purpose: To study the effects of combination of vascular endothelial growth factor (VEGF) antisense oligonucleotide therapy and radiotherapy on maxillofacial VX2 tumors in rabbits. Methods: We used 24 New Zealand white rabbits as a model to induce maxillofacial VX2 tumor. The rabbits were randomly divided into the following 4 groups: radiotherapy group (group A), treated with 16 Gy of radiotherapy; VEGF antisense oligonucleotide treatment group (group B), treated with an injection of 150 {mu}g of VEGF antisense oligonucleotide into the local tumor; VEGF antisense oligonucleotide combined with radiotherapy group (group C), treated with an injection of 150 {mu}g of VEGF antisense oligonucleotide into the local tumor immediately after 16 Gy of radiotherapy; and control group (group D), treated with an injection of 300 {mu}l 5% aqueous glucose solution into the local tumor. On days 3 and 14 after treatment, dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI) was performed to calculate maximal enhancement ratio (MER), slope of enhancement (SLE), and tumor volume change. Rabbits were killed on day 14 to obtain samples for pathological examination and immunohistochemical staining for VEGF. Results: In group C, tumor volume was significantly reduced on day 14 after treatment, and the difference was statistically different as compared to that before treatment, on day 3 after treatment and other groups (P < 0.01). Values of both MER and SLE after treatment were significantly lower than the values before treatment (P < 0.05). Pathological specimen revealed tumor cell edema, bleeding, necrosis, vascular wall thickening and occlusion, and decreased VEGF expression. The immunohistochemical score (IHS) of group C was significantly different from groups A and D respectively (P < 0.05). Conclusion: Injecting the tumor with VEGF antisense oligonucleotide immediately after radiotherapy can enhance the curative effect on rabbit maxillofacial VX2 tumor, and DCE-MRI can serve

Oligonucleotides with 1,4-dioxane-based nucleotide monomers

DEFF Research Database (Denmark)

Madsen, Andreas S; Wengel, Jesper

2012-01-01

An epimeric mixture of H-phosphonates 5R and 5S has been synthesized in three steps from known secouridine 1. Separation of the epimers has been accomplished by RP-HPLC, allowing full characterization and incorporation of monomers X and Y into 9-mer oligonucleotides using H-phosphonates building...... blocks 5R and 5S, respectively. A single incorporation of either monomer X or monomer Y in the central position of a DNA 9-mer results in decreased thermal affinity toward both DNA and RNA complements (ΔT(m) = -3.5 °C/-3.5 °C for monomer X and ΔT(m) = -11.0 °C/-6.5 °C for monomer Y). CD measurements do...

Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

Science.gov (United States)

Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

2016-11-01

It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

Science.gov (United States)

Cheng, Yu-Huei

2014-12-01

Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

Screening and characterization a RAPD marker of tobacco brown ...

African Journals Online (AJOL)

RAPD) methods were used to analyze F2 individuals of 82-3041 × Yunyan 84 to screen and characterize the molecular marker linked to brown-spot resistant gene. A total of 800 arbitrary decamer oligonucleotide primers were used for RAPD ...

The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

Science.gov (United States)

Zellweger, Polle T.; Mackinlay, Jock D.

A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

Evaluating Hierarchical Structure in Music Annotations.

Science.gov (United States)

McFee, Brian; Nieto, Oriol; Farbood, Morwaread M; Bello, Juan Pablo

2017-01-01

Music exhibits structure at multiple scales, ranging from motifs to large-scale functional components. When inferring the structure of a piece, different listeners may attend to different temporal scales, which can result in disagreements when they describe the same piece. In the field of music informatics research (MIR), it is common to use corpora annotated with structural boundaries at different levels. By quantifying disagreements between multiple annotators, previous research has yielded several insights relevant to the study of music cognition. First, annotators tend to agree when structural boundaries are ambiguous. Second, this ambiguity seems to depend on musical features, time scale, and genre. Furthermore, it is possible to tune current annotation evaluation metrics to better align with these perceptual differences. However, previous work has not directly analyzed the effects of hierarchical structure because the existing methods for comparing structural annotations are designed for "flat" descriptions, and do not readily generalize to hierarchical annotations. In this paper, we extend and generalize previous work on the evaluation of hierarchical descriptions of musical structure. We derive an evaluation metric which can compare hierarchical annotations holistically across multiple levels. sing this metric, we investigate inter-annotator agreement on the multilevel annotations of two different music corpora, investigate the influence of acoustic properties on hierarchical annotations, and evaluate existing hierarchical segmentation algorithms against the distribution of inter-annotator agreement.

Evaluating Hierarchical Structure in Music Annotations

Directory of Open Access Journals (Sweden)

Brian McFee

2017-08-01

Full Text Available Music exhibits structure at multiple scales, ranging from motifs to large-scale functional components. When inferring the structure of a piece, different listeners may attend to different temporal scales, which can result in disagreements when they describe the same piece. In the field of music informatics research (MIR, it is common to use corpora annotated with structural boundaries at different levels. By quantifying disagreements between multiple annotators, previous research has yielded several insights relevant to the study of music cognition. First, annotators tend to agree when structural boundaries are ambiguous. Second, this ambiguity seems to depend on musical features, time scale, and genre. Furthermore, it is possible to tune current annotation evaluation metrics to better align with these perceptual differences. However, previous work has not directly analyzed the effects of hierarchical structure because the existing methods for comparing structural annotations are designed for “flat” descriptions, and do not readily generalize to hierarchical annotations. In this paper, we extend and generalize previous work on the evaluation of hierarchical descriptions of musical structure. We derive an evaluation metric which can compare hierarchical annotations holistically across multiple levels. sing this metric, we investigate inter-annotator agreement on the multilevel annotations of two different music corpora, investigate the influence of acoustic properties on hierarchical annotations, and evaluate existing hierarchical segmentation algorithms against the distribution of inter-annotator agreement.

Targeted reduction of highly abundant transcripts using pseudo-random primers.

Science.gov (United States)

Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

2016-04-01

Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

Ultrasensitive electrochemical biosensor based on the oligonucleotide self-assembled monolayer-mediated immunosensing interface

Energy Technology Data Exchange (ETDEWEB)

Liu, Dengyou; Luo, Qimei [Science College of Hunan Agricultural University, Changsha 410128 (China); Deng, Fawen [The Fourth Hospital of Chansha, Changsha 410006 (China); Li, Zhen [Science College of Hunan Agricultural University, Changsha 410128 (China); Li, Benxiang, E-mail: 172170960@qq.com [Science College of Hunan Agricultural University, Changsha 410128 (China); Shen, Zhifa, E-mail: shenzhifa@wmu.edu.cn [Key Laboratory of Laboratory Medicine, Ministry of Education, Zhejiang Provincial Key Laboratory of Medical Genetics, College of Laboratory Medicine and Life Sciences, Wenzhou Medical University, Wenzhou 325035 (China)

2017-06-08

Highly sensitive and selective quantitation of a variety of proteins over a wide concentration range is highly desirable for increased accuracy of biomarker detection or for multidisease diagnostics. In the present contribution, using human immunoglobulin G (HIgG) as the model target protein, an electrochemical ultrasensitive immunosensing platform was developed based on the oligonucleotide self-assembled monolayer-mediated (OSAM) sensing interface. For this immunosensor, the “signal-on” signaling mechanism and enzymatic signal amplification effect were integrated into one sensing architecture. Moreover, the thiolated flexible single-stranded DNAs immobilized onto gold electrode surface not only performs the wobbling motion to facilitate the electron transfer between the electrode surface and biosensing layer but also fundamentally prohibiting the direct interaction of proteins with gold substrate. Thus, the electrochemical signal could be efficiently enhanced and the unspecific adsorption or cross-reaction might be eliminated. As a result, utilizing the newly-proposed immunosensor, the HIgG can be detected down to 0.5 ng/mL, and the high detection specificity is offered. The successful design of OSAM and the highly desirable detection capability of new immunosensor are expected to provide a perspective for fabricating new robust immunosensing platform and for promising potential of oligonucleotide probe in biological research and biomedical diagnosis. - Highlights: • An electrochemical ultrasensitive immunosensing platform was developed based on the oligonucleotide self-assembled monolayer (OASM). • OASM severs as a flexible monolayer to promote electron transfer and prohibits the direct interaction of proteins with gold substrate. • The electrochemical signal is efficiently enhanced and the unspecific adsorption or cross-reaction is eliminated. • Target protein can be detected down to 0.5 ng/mL, and the high detection specificity can be obtained. �

Defense Primer: DOD Contractors

Science.gov (United States)

2017-02-10

functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

Synthesis and Excellent Duplex Stability of Oligonucleotides Containing 2'-Amino-LNA Functionalized with Galactose Units

DEFF Research Database (Denmark)

Kumar, Rajesh; Ries, Annika; Wengel, Jesper

2017-01-01

A convenient method for the preparation of oligonucleotides containing internally-attached galactose and triantennary galactose units has been developed based on click chemistry between 2'-N-alkyne 2'-amino-LNA nucleosides and azido-functionalized galactosyl building blocks. The synthesized...

Detection of tmRNA molecules on microarrays at low temperatures using helper oligonucleotides

Directory of Open Access Journals (Sweden)

Palta Priit

2010-04-01

Full Text Available Abstract Background The hybridization of synthetic Streptococcus pneumoniae tmRNA on a detection microarray is slow at 34°C resulting in low signal intensities. Results We demonstrate that adding specific DNA helper oligonucleotides (chaperones to the hybridization buffer increases the signal strength at a given temperature and thus makes the specific detection of Streptococcus pneumoniae tmRNA more sensitive. No loss of specificity was observed at low temperatures compared to hybridization at 46°C. The effect of the chaperones can be explained by disruption of the strong secondary and tertiary structure of the target RNA by the selective hybridization of helper molecules. The amplification of the hybridization signal strength by chaperones is not necessarily local; we observed increased signal intensities in both local and distant regions of the target molecule. Conclusions The sensitivity of the detection of tmRNA at low temperature can be increased by chaperone oligonucleotides. Due to the complexity of RNA secondary and tertiary structures the effect of any individual chaperone is currently not predictable.

Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

Directory of Open Access Journals (Sweden)

Li Kelvin

2012-11-01

Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

Freshwater Wetlands: A Citizen's Primer.

Science.gov (United States)

Catskill Center for Conservation and Development, Inc., Hobart, NY.

The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

Identifying members of the domain Archaea with rRNA-targeted oligonucleotide probes.

OpenAIRE

Burggraf, S; Mayer, T; Amann, R; Schadhauser, S; Woese, C R; Stetter, K O

1994-01-01

Two 16S rRNA-targeted oligonucleotide probes were designed for the archaeal kingdoms Euryachaeota and Crenarchaeota. Probe specificities were evaluated by nonradioactive dot blot hybridization against selected reference organisms. The successful application of fluorescent-probe derivatives for whole-cell hybridization required organism-specific optimizations of fixation and hybridization conditions to assure probe penetration and morphological integrity of the cells. The probes allowed prelim...

Quantitative Microbial Risk Assessment Tutorial - Primer

Science.gov (United States)

This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

DEFF Research Database (Denmark)

Busk, Peter Kamp

2014-01-01

of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

Short Oligonucleotides Aligned in Stretched Humid Matrix: Secondary DNA Structure in Poly(vinyl alcohol) Environment

KAUST Repository

Hanczyc, Piotr; Å kerman, Bjö rn; Nordé n, Bengt

2012-01-01

) spectroscopy. Oligonucleotides of lengths varying between 10 (3.4 nm) and 60 bases (20.4 nm) were investigated with respect to structural properties in the gel-like polymer environment. The DNA conformation as a function of relative humidity reveals a strong

Hierarchically Nanostructured Materials for Sustainable Environmental Applications

Directory of Open Access Journals (Sweden)

Zheng eRen

2013-11-01

Full Text Available This article presents a comprehensive overview of the hierarchical nanostructured materials with either geometry or composition complexity in environmental applications. The hierarchical nanostructures offer advantages of high surface area, synergistic interactions and multiple functionalities towards water remediation, environmental gas sensing and monitoring as well as catalytic gas treatment. Recent advances in synthetic strategies for various hierarchical morphologies such as hollow spheres and urchin-shaped architectures have been reviewed. In addition to the chemical synthesis, the physical mechanisms associated with the materials design and device fabrication have been discussed for each specific application. The development and application of hierarchical complex perovskite oxide nanostructures have also been introduced in photocatalytic water remediation, gas sensing and catalytic converter. Hierarchical nanostructures will open up many possibilities for materials design and device fabrication in environmental chemistry and technology.

Hierarchically structured, nitrogen-doped carbon membranes

KAUST Repository

Wang, Hong; Wu, Tao

2017-01-01

The present invention is a structure, method of making and method of use for a novel macroscopic hierarchically structured, nitrogen-doped, nano-porous carbon membrane (HNDCMs) with asymmetric and hierarchical pore architecture that can be produced

Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

Science.gov (United States)

Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

2014-08-01

Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

Sensory reception of the primer pheromone ethyl oleate

Science.gov (United States)

Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

2012-05-01

Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

Hierarchically organized layout for visualization of biochemical pathways.

Science.gov (United States)

Tsay, Jyh-Jong; Wu, Bo-Liang; Jeng, Yu-Sen

2010-01-01

Many complex pathways are described as hierarchical structures in which a pathway is recursively partitioned into several sub-pathways, and organized hierarchically as a tree. The hierarchical structure provides a natural way to visualize the global structure of a complex pathway. However, none of the previous research on pathway visualization explores the hierarchical structures provided by many complex pathways. In this paper, we aim to develop algorithms that can take advantages of hierarchical structures, and give layouts that explore the global structures as well as local structures of pathways. We present a new hierarchically organized layout algorithm to produce layouts for hierarchically organized pathways. Our algorithm first decomposes a complex pathway into sub-pathway groups along the hierarchical organization, and then partition each sub-pathway group into basic components. It then applies conventional layout algorithms, such as hierarchical layout and force-directed layout, to compute the layout of each basic component. Finally, component layouts are joined to form a final layout of the pathway. Our main contribution is the development of algorithms for decomposing pathways and joining layouts. Experiment shows that our algorithm is able to give comprehensible visualization for pathways with hierarchies, cycles as well as complex structures. It clearly renders the global component structures as well as the local structure in each component. In addition, it runs very fast, and gives better visualization for many examples from previous related research. 2009 Elsevier B.V. All rights reserved.

The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

Science.gov (United States)

Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

1995-01-01

The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

Hierarchical screening for multiple mental disorders.

Science.gov (United States)

Batterham, Philip J; Calear, Alison L; Sunderland, Matthew; Carragher, Natacha; Christensen, Helen; Mackinnon, Andrew J

2013-10-01

There is a need for brief, accurate screening when assessing multiple mental disorders. Two-stage hierarchical screening, consisting of brief pre-screening followed by a battery of disorder-specific scales for those who meet diagnostic criteria, may increase the efficiency of screening without sacrificing precision. This study tested whether more efficient screening could be gained using two-stage hierarchical screening than by administering multiple separate tests. Two Australian adult samples (N=1990) with high rates of psychopathology were recruited using Facebook advertising to examine four methods of hierarchical screening for four mental disorders: major depressive disorder, generalised anxiety disorder, panic disorder and social phobia. Using K6 scores to determine whether full screening was required did not increase screening efficiency. However, pre-screening based on two decision tree approaches or item gating led to considerable reductions in the mean number of items presented per disorder screened, with estimated item reductions of up to 54%. The sensitivity of these hierarchical methods approached 100% relative to the full screening battery. Further testing of the hierarchical screening approach based on clinical criteria and in other samples is warranted. The results demonstrate that a two-phase hierarchical approach to screening multiple mental disorders leads to considerable increases efficiency gains without reducing accuracy. Screening programs should take advantage of prescreeners based on gating items or decision trees to reduce the burden on respondents. © 2013 Elsevier B.V. All rights reserved.

Table 1 Oligonucleotide primers used for SNP verification by Sanger ...

Indian Academy of Sciences (India)

charissa

1 Ao W, Aldous S, Woodruf E, Hicke B, Rea L, Kreiswirth B, Jenison R. Rapid detection of rpoB gene mutations conferring rifampin resistance in Mycobacterium tuberculosis. J Clin Microbiol. 2012; 50: 2433-2440. 2 Bakuła Z, Napiórkowska A, Bielecki J et al. Mutations in the embB gene and their association with ethambutol ...

PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

Science.gov (United States)

Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

2015-01-01

Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

Self-assembled biomimetic superhydrophobic hierarchical arrays.

Science.gov (United States)

Yang, Hongta; Dou, Xuan; Fang, Yin; Jiang, Peng

2013-09-01

Here, we report a simple and inexpensive bottom-up technology for fabricating superhydrophobic coatings with hierarchical micro-/nano-structures, which are inspired by the binary periodic structure found on the superhydrophobic compound eyes of some insects (e.g., mosquitoes and moths). Binary colloidal arrays consisting of exemplary large (4 and 30 μm) and small (300 nm) silica spheres are first assembled by a scalable Langmuir-Blodgett (LB) technology in a layer-by-layer manner. After surface modification with fluorosilanes, the self-assembled hierarchical particle arrays become superhydrophobic with an apparent water contact angle (CA) larger than 150°. The throughput of the resulting superhydrophobic coatings with hierarchical structures can be significantly improved by templating the binary periodic structures of the LB-assembled colloidal arrays into UV-curable fluoropolymers by a soft lithography approach. Superhydrophobic perfluoroether acrylate hierarchical arrays with large CAs and small CA hysteresis can be faithfully replicated onto various substrates. Both experiments and theoretical calculations based on the Cassie's dewetting model demonstrate the importance of the hierarchical structure in achieving the final superhydrophobic surface states. Copyright © 2013 Elsevier Inc. All rights reserved.

Characterization of Light and Nitrogen Regulated Gene Expression Pathways in Marine Diatoms

Science.gov (United States)

1992-12-31

DNA and cDNA from the seagrass Zostera marina and marine unicellular chlorophyte Dunaliella tertiolecta, using oligonucleotide primers based on...availability of carbon skeletons from photosynthesis may also function in the modulation of gene expression in diatoms. FCP abundance did not exhibit any

GST-PRIME: an algorithm for genome-wide primer design.

Science.gov (United States)

Leister, Dario; Varotto, Claudio

2007-01-01

The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

Design and analysis of effects of triplet repeat oligonucleotides in cell models for myotonic dystrophy

NARCIS (Netherlands)

Gonzalez-Barriga, A.; Mulders, S.A.M.; Giessen, J. van der; Hooijer, J.D.; Bijl, S.; Kessel, I.D.G. van; Beers, J. van; Deutekom, J.C. van; Fransen, J.A.M.; Wieringa, B.; Wansink, D.G.

2013-01-01

Myotonic dystrophy type 1 (DM1) is caused by DM protein kinase (DMPK) transcripts containing an expanded (CUG)n repeat. Antisense oligonucleotide (AON)-mediated suppression of these mutant RNAs is considered a promising therapeutic strategy for this severe disorder. Earlier, we identified a

Synthesis of modified oligonucleotides that contain purine and pyrimidine radio-induced base lesions

International Nuclear Information System (INIS)

Romieu, Anthony

1999-01-01

Different factors as oxidizing or carcinogenesis agents, UV and ionizing radiations,.... can generate a wide, spectrum of DNA base damages. In order to study the biochemical and structural features of these DNA damages, it is important to prepare short DNA fragments (20 to 50 bases long) bearing a single or several modifications at specific sites in their sequences. The chemical synthesis is a powerful tool to prepare such modified DNA fragments. This work focusses on the chemical incorporation of several modified nucleosides formed in DNA by ionizing radiations or by photo-sensitization. The first part of this study describes the preparation of a phosphoramidite synthon of 5-hydroxy-2'-deoxyuridine and its subsequent incorporation into synthetic oligonucleotides ranging from 14 to 33 bases long. In a second part (chapters Ill and IV), the synthesis and incorporation of original radiation-induced tandem lesions: the carbon-bridged cyclo-nucleosides are presented. Both (5'R)- and (5'S) diastereomers of 5',8-cyclo-2'-deoxyadenosine and 5',8-cyclo-2'-deoxyguanosine have been individually inserted into various different oligonucleotides (3 to 22 bases long) by using the standard phosphoramidite chemistry. The chemical incorporation of a pyrimidine analogue: (5'S, 6S)-5',6-cyclo-5,6-dihydro-thymidine has been also achieved. The loss of aromaticity of this modified nucleoside and its poor reactivity required the development of a synthetic strategy entirely different from that used for the preparation and subsequent incorporation of the phosphoramidite synthons of 5',8-cyclo-purine-2'-deoxyribo-nucleosides. The third part of this study deals with the synthesis of a phosphoramidite synthon of 4-hydroxy-8-oxo-4,8-dihydro-2'-deoxyguanosine. The two (4R)- and (4S)- diastereomers of this oxidized purine have been separated and individually inserted in several synthetic DNA fragments. No epimerization of C-4 position was observed during the solid-phase synthesis and during the

Hierarchically structured, nitrogen-doped carbon membranes

KAUST Repository

Wang, Hong

2017-08-03

The present invention is a structure, method of making and method of use for a novel macroscopic hierarchically structured, nitrogen-doped, nano-porous carbon membrane (HNDCMs) with asymmetric and hierarchical pore architecture that can be produced on a large-scale approach. The unique HNDCM holds great promise as components in separation and advanced carbon devices because they could offer unconventional fluidic transport phenomena on the nanoscale. Overall, the invention set forth herein covers a hierarchically structured, nitrogen-doped carbon membranes and methods of making and using such a membranes.

Hierarchical Rhetorical Sentence Categorization for Scientific Papers

Science.gov (United States)

Rachman, G. H.; Khodra, M. L.; Widyantoro, D. H.

2018-03-01

Important information in scientific papers can be composed of rhetorical sentences that is structured from certain categories. To get this information, text categorization should be conducted. Actually, some works in this task have been completed by employing word frequency, semantic similarity words, hierarchical classification, and the others. Therefore, this paper aims to present the rhetorical sentence categorization from scientific paper by employing TF-IDF and Word2Vec to capture word frequency and semantic similarity words and employing hierarchical classification. Every experiment is tested in two classifiers, namely Naïve Bayes and SVM Linear. This paper shows that hierarchical classifier is better than flat classifier employing either TF-IDF or Word2Vec, although it increases only almost 2% from 27.82% when using flat classifier until 29.61% when using hierarchical classifier. It shows also different learning model for child-category can be built by hierarchical classifier.

Hierarchical Recurrent Neural Hashing for Image Retrieval With Hierarchical Convolutional Features.

Science.gov (United States)

Lu, Xiaoqiang; Chen, Yaxiong; Li, Xuelong

Hashing has been an important and effective technology in image retrieval due to its computational efficiency and fast search speed. The traditional hashing methods usually learn hash functions to obtain binary codes by exploiting hand-crafted features, which cannot optimally represent the information of the sample. Recently, deep learning methods can achieve better performance, since deep learning architectures can learn more effective image representation features. However, these methods only use semantic features to generate hash codes by shallow projection but ignore texture details. In this paper, we proposed a novel hashing method, namely hierarchical recurrent neural hashing (HRNH), to exploit hierarchical recurrent neural network to generate effective hash codes. There are three contributions of this paper. First, a deep hashing method is proposed to extensively exploit both spatial details and semantic information, in which, we leverage hierarchical convolutional features to construct image pyramid representation. Second, our proposed deep network can exploit directly convolutional feature maps as input to preserve the spatial structure of convolutional feature maps. Finally, we propose a new loss function that considers the quantization error of binarizing the continuous embeddings into the discrete binary codes, and simultaneously maintains the semantic similarity and balanceable property of hash codes. Experimental results on four widely used data sets demonstrate that the proposed HRNH can achieve superior performance over other state-of-the-art hashing methods.Hashing has been an important and effective technology in image retrieval due to its computational efficiency and fast search speed. The traditional hashing methods usually learn hash functions to obtain binary codes by exploiting hand-crafted features, which cannot optimally represent the information of the sample. Recently, deep learning methods can achieve better performance, since deep

Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

DEFF Research Database (Denmark)

Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

2015-01-01

) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

Science.gov (United States)

Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

2018-01-17

In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

Directory of Open Access Journals (Sweden)

Helen Hencida Thangamony

2018-01-01

Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

The R primer

CERN Document Server

Ekstrom, Claus Thorn

2011-01-01

Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

Science.gov (United States)

Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

2008-08-29

Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

Directory of Open Access Journals (Sweden)

Prima Ditahardiyani

2008-01-01

Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

Zeolitic materials with hierarchical porous structures.

Science.gov (United States)

Lopez-Orozco, Sofia; Inayat, Amer; Schwab, Andreas; Selvam, Thangaraj; Schwieger, Wilhelm

2011-06-17

During the past several years, different kinds of hierarchical structured zeolitic materials have been synthesized due to their highly attractive properties, such as superior mass/heat transfer characteristics, lower restriction of the diffusion of reactants in the mesopores, and low pressure drop. Our contribution provides general information regarding types and preparation methods of hierarchical zeolitic materials and their relative advantages and disadvantages. Thereafter, recent advances in the preparation and characterization of hierarchical zeolitic structures within the crystallites by post-synthetic treatment methods, such as dealumination or desilication; and structured devices by in situ and ex situ zeolite coatings on open-cellular ceramic foams as (non-reactive as well as reactive) supports are highlighted. Specific advantages of using hierarchical zeolitic catalysts/structures in selected catalytic reactions, such as benzene to phenol (BTOP) and methanol to olefins (MTO) are presented. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Processing of hierarchical syntactic structure in music.

Science.gov (United States)

Koelsch, Stefan; Rohrmeier, Martin; Torrecuso, Renzo; Jentschke, Sebastian

2013-09-17

Hierarchical structure with nested nonlocal dependencies is a key feature of human language and can be identified theoretically in most pieces of tonal music. However, previous studies have argued against the perception of such structures in music. Here, we show processing of nonlocal dependencies in music. We presented chorales by J. S. Bach and modified versions in which the hierarchical structure was rendered irregular whereas the local structure was kept intact. Brain electric responses differed between regular and irregular hierarchical structures, in both musicians and nonmusicians. This finding indicates that, when listening to music, humans apply cognitive processes that are capable of dealing with long-distance dependencies resulting from hierarchically organized syntactic structures. Our results reveal that a brain mechanism fundamental for syntactic processing is engaged during the perception of music, indicating that processing of hierarchical structure with nested nonlocal dependencies is not just a key component of human language, but a multidomain capacity of human cognition.

Hierarchical Nanoceramics for Industrial Process Sensors

Energy Technology Data Exchange (ETDEWEB)

Ruud, James, A.; Brosnan, Kristen, H.; Striker, Todd; Ramaswamy, Vidya; Aceto, Steven, C.; Gao, Yan; Willson, Patrick, D.; Manoharan, Mohan; Armstrong, Eric, N., Wachsman, Eric, D.; Kao, Chi-Chang

2011-07-15

This project developed a robust, tunable, hierarchical nanoceramics materials platform for industrial process sensors in harsh-environments. Control of material structure at multiple length scales from nano to macro increased the sensing response of the materials to combustion gases. These materials operated at relatively high temperatures, enabling detection close to the source of combustion. It is anticipated that these materials can form the basis for a new class of sensors enabling widespread use of efficient combustion processes with closed loop feedback control in the energy-intensive industries. The first phase of the project focused on materials selection and process development, leading to hierarchical nanoceramics that were evaluated for sensing performance. The second phase focused on optimizing the materials processes and microstructures, followed by validation of performance of a prototype sensor in a laboratory combustion environment. The objectives of this project were achieved by: (1) synthesizing and optimizing hierarchical nanostructures; (2) synthesizing and optimizing sensing nanomaterials; (3) integrating sensing functionality into hierarchical nanostructures; (4) demonstrating material performance in a sensing element; and (5) validating material performance in a simulated service environment. The project developed hierarchical nanoceramic electrodes for mixed potential zirconia gas sensors with increased surface area and demonstrated tailored electrocatalytic activity operable at high temperatures enabling detection of products of combustion such as NOx close to the source of combustion. Methods were developed for synthesis of hierarchical nanostructures with high, stable surface area, integrated catalytic functionality within the structures for gas sensing, and demonstrated materials performance in harsh lab and combustion gas environments.

Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

Science.gov (United States)

Galkiewicz, Julia P; Kellogg, Christina A

2008-12-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

OpenAIRE

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

The Case for a Hierarchical Cosmology

Science.gov (United States)

Vaucouleurs, G. de

1970-01-01

The development of modern theoretical cosmology is presented and some questionable assumptions of orthodox cosmology are pointed out. Suggests that recent observations indicate that hierarchical clustering is a basic factor in cosmology. The implications of hierarchical models of the universe are considered. Bibliography. (LC)

Reliable Assessment and Quantification of the Fluorescence-Labeled Antisense Oligonucleotides In Vivo

Directory of Open Access Journals (Sweden)

Maria Chiara Munisso

2014-01-01

Full Text Available The availability of fluorescent dyes and the advances in the optical systems for in vivo imaging have stimulated an increasing interest in developing new methodologies to study and quantify the biodistribution of labeled agents. However, despite these great achievements, we are facing significant challenges in determining if the observed fluorescence does correspond to the quantity of the dye in the tissues. In fact, although the far-red and near-infrared lights can propagate through several centimetres of tissue, they diffuse within a few millimetres as consequence of the elastic scattering of photons. In addition, when dye-labeled oligonucleotides form stable complex with cationic carriers, a large change in the fluorescence intensity of the dye is observed. Therefore, the measured fluorescence intensity is altered by the tissue heterogeneity and by the fluctuation of dye intensity. Hence, in this study a quantification strategy for fluorescence-labeled oligonucleotides was developed to solve these disadvantageous effects. Our results proved that upon efficient homogenization and dilution with chaotropic agents, such as guanidinium thiocyanate, it is possible to achieve a complete fluorescence intensity recovery. Furthermore, we demonstrated that this method has the advantage of good sensitivity and reproducibility, as well as easy handling of the tissue samples.

Template-Independent Enzymatic Oligonucleotide Synthesis (TiEOS): Its History, Prospects, and Challenges.

Science.gov (United States)

Jensen, Michael A; Davis, Ronald W

2018-03-27

There is a growing demand for sustainable methods in research and development, where instead of hazardous chemicals, an aqueous medium is chosen to perform biological reactions. In this Perspective, we examine the history and current methodology of using enzymes to generate artificial single-stranded DNA. By using traditional solid-phase phosphoramidite chemistry as a metric, we also explore criteria for the method of template-independent enzymatic oligonucleotide synthesis (TiEOS). As its key component, we delve into the biology of one of the most enigmatic enzymes, terminal deoxynucleotidyl transferase (TdT). As TdT is found to exponentially increase antigen receptor diversity in the vertebrate immune system by adding nucleotides in a template-free manner, researchers have exploited this function as an alternative to the phosphoramidite synthesis method. Though TdT is currently the preferred enzyme for TiEOS, its random nucleotide incorporation presents a barrier in synthesis automation. Taking a closer look at the TiEOS cycle, particularly the coupling step, we find it is comprised of additions > n+1 and deletions. By tapping into the physical and biochemical properties of TdT, we strive to further elucidate its mercurial behavior and offer ways to better optimize TiEOS for production-grade oligonucleotide synthesis.

Classification using Hierarchical Naive Bayes models

DEFF Research Database (Denmark)

Langseth, Helge; Dyhre Nielsen, Thomas

2006-01-01

Classification problems have a long history in the machine learning literature. One of the simplest, and yet most consistently well-performing set of classifiers is the Naïve Bayes models. However, an inherent problem with these classifiers is the assumption that all attributes used to describe......, termed Hierarchical Naïve Bayes models. Hierarchical Naïve Bayes models extend the modeling flexibility of Naïve Bayes models by introducing latent variables to relax some of the independence statements in these models. We propose a simple algorithm for learning Hierarchical Naïve Bayes models...

Functionalization of silicon oxide using supercritical fluid deposition of 3,4-epoxybutyltrimethoxysilane for the immobilization of amino-modified oligonucleotide

Energy Technology Data Exchange (ETDEWEB)

Rull, Jordi [Université Grenoble Alpes, Grenoble F38000 (France); CEA, LETI, MINATEC Campus, Grenoble Cedex 9 F38054 (France); CEA, iRTSV, LCBM, Grenoble 38054 (France); CNRS, UMR 5249, Grenoble (France); Nonglaton, Guillaume, E-mail: guillaume.nonglaton@cea.fr [Université Grenoble Alpes, Grenoble F38000 (France); CEA, LETI, MINATEC Campus, Grenoble Cedex 9 F38054 (France); Costa, Guillaume; Fontelaye, Caroline [Université Grenoble Alpes, Grenoble F38000 (France); CEA, LETI, MINATEC Campus, Grenoble Cedex 9 F38054 (France); Marchi-Delapierre, Caroline; Ménage, Stéphane [Université Grenoble Alpes, Grenoble F38000 (France); CEA, iRTSV, LCBM, Grenoble 38054 (France); CNRS, UMR 5249, Grenoble (France); Marchand, Gilles [Université Grenoble Alpes, Grenoble F38000 (France); CEA, LETI, MINATEC Campus, Grenoble Cedex 9 F38054 (France)

2015-11-01

Graphical abstract: - Highlights: • First example of grafting of 3,4-epoxybutyltrimethoxysilane (EBTMOS) onto silicon oxide by supercritical fluid deposition. • Extraordinary efficiency of the supercritical fluid deposition for the grafting of the EBTMOS compared with the conventional solution or vapor phase methodologies. • Demonstration of the efficiency of this functionalization process for the immobilization of amino-modified oligonucleotides. - Abstract: The functionalization of silicon oxide based substrates using silanes is generally performed through liquid phase methodologies. These processes involve a huge quantity of potentially toxic solvents and present some important disadvantages for the functionalization of microdevices or porous materials, for example the low diffusion. To overcome this drawback, solvent-free methodologies like molecular vapor deposition (MVD) or supercritical fluid deposition (SFD) have been developed. In this paper, the deposition process of 3,4-epoxybutyltrimethoxysilane (EBTMOS) on silicon oxide using supercritical carbon dioxide (scCO{sub 2}) as a solvent is studied for the first time. The oxirane ring of epoxy silanes readily reacts with amine group and is of particular interest for the grafting of amino-modified oligonucleotides or antibodies for diagnostic application. Then the ability of this specific EBTMOS layer to react with amine functions has been evaluated using the immobilization of amino-modified oligonucleotide probes. The presence of the probes is revealed by fluorescence using hybridization with a fluorescent target oligonucleotide. The performances of SFD of EBTMOS have been optimized and then compared with the dip coating and molecular vapor deposition methods, evidencing a better grafting efficiency and homogeneity, a lower reaction time in addition to the eco-friendly properties of the supercritical carbon dioxide. The epoxysilane layers have been characterized by surface enhanced ellipsometric

Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

Directory of Open Access Journals (Sweden)

Tatyana V Matveeva

2008-09-01

Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

Improved Adhesion and Compliancy of Hierarchical Fibrillar Adhesives.

Science.gov (United States)

Li, Yasong; Gates, Byron D; Menon, Carlo

2015-08-05

The gecko relies on van der Waals forces to cling onto surfaces with a variety of topography and composition. The hierarchical fibrillar structures on their climbing feet, ranging from mesoscale to nanoscale, are hypothesized to be key elements for the animal to conquer both smooth and rough surfaces. An epoxy-based artificial hierarchical fibrillar adhesive was prepared to study the influence of the hierarchical structures on the properties of a dry adhesive. The presented experiments highlight the advantages of a hierarchical structure despite a reduction of overall density and aspect ratio of nanofibrils. In contrast to an adhesive containing only nanometer-size fibrils, the hierarchical fibrillar adhesives exhibited a higher adhesion force and better compliancy when tested on an identical substrate.

Supplementary data:

Indian Academy of Sciences (India)

charissa

Supplementary data: Table 1. Oligonucleotide primers used for SNP verification by Sanger sequencing. Oligo. 5' – 3' sequence. Product size (bp). Annealing temperature (°C). katG_L gccggtcaagaagaagtacg. 591. 67. katG_R ctcttcgtcagctcccactc. rpoB_La ctgatccaaaaccagatccg. 440. 64. rpoB_Ra tacacgatctcgtcgctaac.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

Science.gov (United States)

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

Science.gov (United States)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

El primer virreinato americano

Directory of Open Access Journals (Sweden)

Cassá, Roberto

2006-12-01

Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

TIA-1 RRM23 binding and recognition of target oligonucleotides.

Science.gov (United States)

Waris, Saboora; García-Mauriño, Sofía M; Sivakumaran, Andrew; Beckham, Simone A; Loughlin, Fionna E; Gorospe, Myriam; Díaz-Moreno, Irene; Wilce, Matthew C J; Wilce, Jacqueline A

2017-05-05

TIA-1 (T-cell restricted intracellular antigen-1) is an RNA-binding protein involved in splicing and translational repression. It mainly interacts with RNA via its second and third RNA recognition motifs (RRMs), with specificity for U-rich sequences directed by RRM2. It has recently been shown that RRM3 also contributes to binding, with preferential binding for C-rich sequences. Here we designed UC-rich and CU-rich 10-nt sequences for engagement of both RRM2 and RRM3 and demonstrated that the TIA-1 RRM23 construct preferentially binds the UC-rich RNA ligand (5΄-UUUUUACUCC-3΄). Interestingly, this binding depends on the presence of Lys274 that is C-terminal to RRM3 and binding to equivalent DNA sequences occurs with similar affinity. Small-angle X-ray scattering was used to demonstrate that, upon complex formation with target RNA or DNA, TIA-1 RRM23 adopts a compact structure, showing that both RRMs engage with the target 10-nt sequences to form the complex. We also report the crystal structure of TIA-1 RRM2 in complex with DNA to 2.3 Å resolution providing the first atomic resolution structure of any TIA protein RRM in complex with oligonucleotide. Together our data support a specific mode of TIA-1 RRM23 interaction with target oligonucleotides consistent with the role of TIA-1 in binding RNA to regulate gene expression. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Structure Activity Relationships of α-L-LNA Modified Phosphorothioate Gapmer Antisense Oligonucleotides in Animals

Directory of Open Access Journals (Sweden)

Punit P Seth

2012-01-01

Full Text Available We report the structure activity relationships of short 14-mer phosphorothioate gapmer antisense oligonucleotides (ASOs modified with α-L-locked nucleic acid (LNA and related modifications targeting phosphatase and tensin homologue (PTEN messenger RNA in mice. α-L-LNA represents the α-anomer of enantio-LNA and modified oligonucleotides show LNA like binding affinity for complementary RNA. In contrast to sequence matched LNA gapmer ASOs which showed elevations in plasma alanine aminotransferase (ALT levels indicative of hepatotoxicity, gapmer ASOs modified with α-L-LNA and related analogs in the flanks showed potent downregulation of PTEN messenger RNA in liver tissue without producing elevations in plasma ALT levels. However, the α-L-LNA ASO showed a moderate dose-dependent increase in liver and spleen weights suggesting a higher propensity for immune stimulation. Interestingly, replacing α-L-LNA nucleotides in the 3′- and 5′-flanks with R-5′-Me-α-L-LNA but not R-6′-Me- or 3′-Me-α-L-LNA nucleotides, reversed the drug induced increase in organ weights. Examination of structural models of dinucleotide units suggested that the 5′-Me group increases steric bulk in close proximity to the phosphorothioate backbone or produces subtle changes in the backbone conformation which could interfere with recognition of the ASO by putative immune receptors. Our data suggests that introducing steric bulk at the 5′-position of the sugar-phosphate backbone could be a general strategy to mitigate the immunostimulatory profile of oligonucleotide drugs. In a clinical setting, proinflammatory effects manifest themselves as injection site reactions and flu-like symptoms. Thus, a mitigation of these effects could increase patient comfort and compliance when treated with ASOs.

Development and production of an oligonucleotide MuscleChip: use for validation of ambiguous ESTs

Directory of Open Access Journals (Sweden)

Lanfranchi Gerolamo

2002-10-01

Full Text Available Abstract Background We describe the development, validation, and use of a highly redundant 120,000 oligonucleotide microarray (MuscleChip containing 4,601 probe sets representing 1,150 known genes expressed in muscle and 2,075 EST clusters from a non-normalized subtracted muscle EST sequencing project (28,074 EST sequences. This set included 369 novel EST clusters showing no match to previously characterized proteins in any database. Each probe set was designed to contain 20–32 25 mer oligonucleotides (10–16 paired perfect match and mismatch probe pairs per gene, with each probe evaluated for hybridization kinetics (Tm and similarity to other sequences. The 120,000 oligonucleotides were synthesized by photolithography and light-activated chemistry on each microarray. Results Hybridization of human muscle cRNAs to this MuscleChip (33 samples showed a correlation of 0.6 between the number of ESTs sequenced in each cluster and hybridization intensity. Out of 369 novel EST clusters not showing any similarity to previously characterized proteins, we focused on 250 EST clusters that were represented by robust probe sets on the MuscleChip fulfilling all stringent rules. 102 (41% were found to be consistently "present" by analysis of hybridization to human muscle RNA, of which 40 ESTs (39% could be genome anchored to potential transcription units in the human genome sequence. 19 ESTs of the 40 ESTs were furthermore computer-predicted as exons by one or more than three gene identification algorithms. Conclusion Our analysis found 40 transcriptionally validated, genome-anchored novel EST clusters to be expressed in human muscle. As most of these ESTs were low copy clusters (duplex and triplex in the original 28,000 EST project, the identification of these as significantly expressed is a robust validation of the transcript units that permits subsequent focus on the novel proteins encoded by these genes.

Sediment transport primer: estimating bed-material transport in gravel-bed rivers

Science.gov (United States)

Peter Wilcock; John Pitlick; Yantao Cui

2009-01-01

This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

Contribution of the first K-homology domain of poly(C)-binding protein 1 to its affinity and specificity for C-rich oligonucleotides.

Science.gov (United States)

Yoga, Yano M K; Traore, Daouda A K; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R; Barker, Andrew; Leedman, Peter J; Wilce, Jacqueline A; Wilce, Matthew C J

2012-06-01

Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5'-CCCTCCCT-3' DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5'-ACCCCA-3' DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad.

Antiproliferation effects of an androgen receptor triple-helix forming oligonucleotide on prostate cancer cells

International Nuclear Information System (INIS)

Zhang Yong; Chen Weizhen; Xie Yao; Gao Jinhui

2005-01-01

Objective: To provide experimental basis for antigene radiation therapy through exploring the effects of antigene strategy on androgen receptor (AR) expression and proliferation of prostate cancer cells. Methods: The triple-helix forming oligonucleotide (TFO) targeting 2447-2461nt of AR cDNA was designed and transfected LNCaP prostate cancer cells with liposome. 24-72 h after transfection, the cellular proliferation was detected by 3 H-thymidine (TdR) incorporation test, the expression of AR gene was examined by reverse transcription-polymerase chain reaction (RT-PCR) and expression of AR protein was performed by radioligand binding assay. The results of TFO were compared with antisense oligonucleotide (ASON). Results: At all time points, the AR expression levels in TFO group were markedly lower than that of ASON group (P<0.05). The inhibitory rate of TFO for cellular proliferation was significantly higher than that of ASON (P<0.05). Conclusion: The TFO was a potent inhibitor for AR expression and cell proliferation of LNCaP cells , and could be used in antigene radiotherapy. (authors)

Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

Science.gov (United States)

Caetano-Anollés, G; Gresshoff, P M

1996-06-01

DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

Directory of Open Access Journals (Sweden)

Andrew L. Krohn

2013-07-01

Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

In vivo effect of a self-etching primer on dentin.

Science.gov (United States)

Milia, E; Lallai, M R; García-Godoy, F

1999-08-01

To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.

Characteristics of the population employed in primer sector in Turkey

Directory of Open Access Journals (Sweden)

Bayar Rüya

2006-01-01

Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

Science.gov (United States)

Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

2012-01-01

Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

Distribution of Sulfate-Reducing Bacteria, O2, and H2s in Photosynthetic Biofilms Determined by Oligonucleotide Probes and Microelectrodes Rid A-1977-2009

DEFF Research Database (Denmark)

RAMSING, NB; KUHL, M.; JØRGENSEN, BB

1993-01-01

The vertical distribution of sulfate-reducing bacteria (SRB) in photosynthetic biofilms from the trickling filter of a sewage treatment plant was investigated with oligonucleotide probes binding to 16S rRNA. To demonstrate the effect of daylight and photosynthesis and thereby of increased oxygen....... Fluorescent-dye-conjugated oligonucleotides were used as ''phylogenetic'' probes to identify single cells in the slices. Oligonucleotide sequences were selected which were complementary to short sequence elements (16 to 20 nucleotides) within the 16S rRNA of sulfate-reducing bacteria. The probes were labeled...... with fluorescein or rhodamine derivatives for subsequent visualization by epifluorescence microscopy. Five probes were synthesized for eukaryotes, eubacteria, SRB (including most species of the delta group of purple bacteria), Desulfobacter spp., and a nonhybridizing control. The SRB were unevenly distributed...

Menopause 101: A Primer for the Perimenopausal

Science.gov (United States)

... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

Leadership styles across hierarchical levels in nursing departments.

Science.gov (United States)

Stordeur, S; Vandenberghe, C; D'hoore, W

2000-01-01

Some researchers have reported on the cascading effect of transformational leadership across hierarchical levels. One study examined this effect in nursing, but it was limited to a single hospital. To examine the cascading effect of leadership styles across hierarchical levels in a sample of nursing departments and to investigate the effect of hierarchical level on the relationships between leadership styles and various work outcomes. Based on a sample of eight hospitals, the cascading effect was tested using correlation analysis. The main sources of variation among leadership scores were determined with analyses of variance (ANOVA), and the interaction effect of hierarchical level and leadership styles on criterion variables was tested with moderated regression analysis. No support was found for a cascading effect of leadership across hierarchical levels. Rather, the variation of leadership scores was explained primarily by the organizational context. Transformational leadership had a stronger impact on criterion variables than transactional leadership. Interaction effects between leadership styles and hierarchical level were observed only for perceived unit effectiveness. The hospital's structure and culture are major determinants of leadership styles.

Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

Directory of Open Access Journals (Sweden)

Martin Beránek

2012-01-01

Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

Primer sets for cloning the human repertoire of T cell Receptor Variable regions

Directory of Open Access Journals (Sweden)

Santoro Claudio

2008-08-01

Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

Genus-Specific Primers for Study of Fusarium Communities in Field Samples

Science.gov (United States)

Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

2015-01-01

Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

Learning with hierarchical-deep models.

Science.gov (United States)

Salakhutdinov, Ruslan; Tenenbaum, Joshua B; Torralba, Antonio

2013-08-01

We introduce HD (or “Hierarchical-Deep”) models, a new compositional learning architecture that integrates deep learning models with structured hierarchical Bayesian (HB) models. Specifically, we show how we can learn a hierarchical Dirichlet process (HDP) prior over the activities of the top-level features in a deep Boltzmann machine (DBM). This compound HDP-DBM model learns to learn novel concepts from very few training example by learning low-level generic features, high-level features that capture correlations among low-level features, and a category hierarchy for sharing priors over the high-level features that are typical of different kinds of concepts. We present efficient learning and inference algorithms for the HDP-DBM model and show that it is able to learn new concepts from very few examples on CIFAR-100 object recognition, handwritten character recognition, and human motion capture datasets.

Journal of Genetics | Indian Academy of Sciences

Indian Academy of Sciences (India)

pp 107-116 Research Article. Highly conserved D-loop-like nuclear mitochondrial sequences (Numts) in tiger (Panthera tigris) · Wenping Zhang Zhihe Zhang Fujun Shen Rong Hou Xiaoping Lv Bisong Yue · More Details Abstract Fulltext PDF. Using oligonucleotide primers designed to match hypervariable segments I ...

Relationship between genetic similarity and some productive traits ...

African Journals Online (AJOL)

Admin

Random amplified polymorphic DNA (RAPD) technique was applied to detect genetic similarity between five local chicken strains that have been selected for eggs and meat production in Egypt. Based on six oligonucleotide primers, the genetic similarity between the egg-producing strains (Anshas, Silver. Montazah and ...

Utilidad en la combinación de oligonucleótidos universales para la detección del virus del papiloma humano en cáncer cervicouterino y lesiones premalignas Usefulness of combining universal oligonucleotides in detecting human papillomavirus in cervical cancer and premalignant lesions

Directory of Open Access Journals (Sweden)

Adela Carrillo

2004-02-01

juegos de oligonucleótidos universales que reconocen la región L1 del VPH. Con una adecuada toma de muestra, el análisis para detección de ADN en exudado cérvico-vaginal es una buena alternativa de diagnóstico del VPH.OBJECTIVE: To determine the prevalence of human papillomavirus (HPV infection at different stages of the natural history of cervical cancer. Also, to optimize its detection by means of different sets of general primers. MATERIAL AND METHODS: A descriptive, cross-sectional study was conducted between January and December 1999. Samples were processed and analyzed at the Instituto Nacional de Cancerología (National Cancerology Institute in Mexico City. A comparative analysis was performed using Student's t for continuous values and the chi-squared test for proportions. A contingency analysis was made between biopsy and cervical exudates with the Kappa statistic. HPV detection was done by PCR with general primers which recognize different regions of the L1 gene (MY09/11; GP5/6; L1C1/2 and with HPV16- and HPV18- specific primers, as well as direct sequencing of PCR products. RESULTS: In total, 154 samples were analyzed: 65 (42.2% of them showed normal cytology; 45 (29.2% high and low grade lesions; and 44 (28.6% invasive cervical cancer. HPV was detected in 95.5% of invasive cervical cancers, in 91.6% of high grade lesions, in 66.7% of low grade lesions, and in 23.1% of normal smears, by PCR with at least one set of oligonucleotide primers. HPV detection was more efficient in biopsy specimens than in cervical scrapes. The total percentage of HPV detection us ing only one set of universal oligonucleotides (37.6%increased to 60.4% when the other two sets of universal oligonucleotides were used. CONCLUSIONS:The frequency of high risk HPV is high even in women with reported normal cytology. HPV detection improves when different sets of general primers directed to the L1 region are used. HPV DNA screening in cervical scrapes may be a good alternative HPV

Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

Science.gov (United States)

Galkiewicz, J.P.; Kellogg, C.A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

Math primer for engineers

CERN Document Server

Cryer, CW

2014-01-01

Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

A Quantum Groups Primer

Science.gov (United States)

Majid, Shahn

2002-05-01

Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

Directory of Open Access Journals (Sweden)

Wang Xiaowei

2008-12-01

Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

Hole hopping rates in single strand oligonucleotides

Energy Technology Data Exchange (ETDEWEB)

Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

2014-08-31

Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

Hierarchical analysis of acceptable use policies

Directory of Open Access Journals (Sweden)

P. A. Laughton

2008-01-01

Full Text Available Acceptable use policies (AUPs are vital tools for organizations to protect themselves and their employees from misuse of computer facilities provided. A well structured, thorough AUP is essential for any organization. It is impossible for an effective AUP to deal with every clause and remain readable. For this reason, some sections of an AUP carry more weight than others, denoting importance. The methodology used to develop the hierarchical analysis is a literature review, where various sources were consulted. This hierarchical approach to AUP analysis attempts to highlight important sections and clauses dealt with in an AUP. The emphasis of the hierarchal analysis is to prioritize the objectives of an AUP.

Peptide-oligonucleotide conjugates as nanoscale building blocks for assembly of an artificial three-helix protein mimic

DEFF Research Database (Denmark)

Lou, Chenguang; Martos-Maldonado, Manuel C.; Madsen, Charlotte Stahl

2016-01-01

Peptide-based structures can be designed to yield artificial proteins with specific folding patterns and functions. Template-based assembly of peptide units is one design option, but the use of two orthogonal self-assembly principles, oligonucleotide triple helix and a coiled coil protein domain ...

Scrimer: designing primers from transcriptome data

Czech Academy of Sciences Publication Activity Database

Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

2015-01-01

Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

Science.gov (United States)

Prunier, Rachel; Latimer, Andrew

2010-01-01

Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

Virtual timers in hierarchical real-time systems

NARCIS (Netherlands)

Heuvel, van den M.M.H.P.; Holenderski, M.J.; Cools, W.A.; Bril, R.J.; Lukkien, J.J.; Zhu, D.

2009-01-01

Hierarchical scheduling frameworks (HSFs) provide means for composing complex real-time systems from welldefined subsystems. This paper describes an approach to provide hierarchically scheduled real-time applications with virtual event timers, motivated by the need for integrating priority

Intravitreal Injection of Splice-switching Oligonucleotides to Manipulate Splicing in Retinal Cells

Directory of Open Access Journals (Sweden)

Xavier Gérard

2015-01-01

Full Text Available Leber congenital amaurosis is a severe hereditary retinal dystrophy responsible for neonatal blindness. The most common disease-causing mutation (c.2991+1655A>G; 10–15% creates a strong splice donor site that leads to insertion of a cryptic exon encoding a premature stop codon. Recently, we reported that splice-switching oligonucleotides (SSO allow skipping of the mutant cryptic exon and the restoration of ciliation in fibroblasts of affected patients, supporting the feasibility of a SSO-mediated exon skipping strategy to correct the aberrant splicing. Here, we present data in the wild-type mouse, which demonstrate that intravitreal administration of 2’-OMePS-SSO allows selective alteration of Cep290 splicing in retinal cells, including photoreceptors as shown by successful alteration of Abca4 splicing using the same approach. We show that both SSOs and Cep290 skipped mRNA were detectable for at least 1 month and that intravitreal administration of oligonucleotides did not provoke any serious adverse event. These data suggest that intravitreal injections of SSO should be considered to bypass protein truncation resulting from the c.2991+1655A>G mutation as well as other truncating mutations in genes which like CEP290 or ABCA4 have a mRNA size that exceed cargo capacities of US Food and Drug Administration (FDA-approved adeno-associated virus (AAV-vectors, thus hampering gene augmentation therapy.

Profitability primer: a guide to profitability analysis in the electric power industry

International Nuclear Information System (INIS)

Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

1996-06-01

As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

Label-Free Electrochemical Detection of the Specific Oligonucleotide Sequence of Dengue Virus Type 1 on Pencil Graphite Electrodes

Science.gov (United States)

Souza, Elaine; Nascimento, Gustavo; Santana, Nataly; Ferreira, Danielly; Lima, Manoel; Natividade, Edna; Martins, Danyelly; Lima-Filho, José

2011-01-01

A biosensor that relies on the adsorption immobilization of the 18-mer single-stranded nucleic acid related to dengue virus gene 1 on activated pencil graphite was developed. Hybridization between the probe and its complementary oligonucleotides (the target) was investigated by monitoring guanine oxidation by differential pulse voltammetry (DPV). The pencil graphite electrode was made of ordinary pencil lead (type 4B). The polished surface of the working electrode was activated by applying a potential of 1.8 V for 5 min. Afterward, the dengue oligonucleotides probe was immobilized on the activated electrode by applying 0.5 V to the electrode in 0.5 M acetate buffer (pH 5.0) for 5 min. The hybridization process was carried out by incubating at the annealing temperature of the oligonucleotides. A time of five minutes and concentration of 1 μM were found to be the optimal conditions for probe immobilization. The electrochemical detection of annealing between the DNA probe (TS-1P) immobilized on the modified electrode, and the target (TS-1T) was achieved. The target could be quantified in a range from 1 to 40 nM with good linearity and a detection limit of 0.92 nM. The specificity of the electrochemical biosensor was tested using non-complementary sequences of dengue virus 2 and 3. PMID:22163916

Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

International Nuclear Information System (INIS)

Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

1986-01-01

The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

Pd0-Catalyzed Methyl Transfer on Nucleosides and Oligonucleotides, Envisaged as a PET Tracer

Directory of Open Access Journals (Sweden)

Eric Fouquet

2013-11-01

Full Text Available The methyl transfer reaction from activated monomethyltin, via a modified Stille coupling reaction, was studied under “ligandless” conditions on fully deprotected 5'-modified nucleosides and one dinucleotide. The reaction was optimized to proceed in a few minutes and quantitative yield, even under dilute conditions, thus affording a rapid and efficient new method for oligonucleotide labelling with carbon-11.

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

Science.gov (United States)

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

Hierarchical modeling and analysis for spatial data

CERN Document Server

Banerjee, Sudipto; Gelfand, Alan E

2003-01-01

Among the many uses of hierarchical modeling, their application to the statistical analysis of spatial and spatio-temporal data from areas such as epidemiology And environmental science has proven particularly fruitful. Yet to date, the few books that address the subject have been either too narrowly focused on specific aspects of spatial analysis, or written at a level often inaccessible to those lacking a strong background in mathematical statistics.Hierarchical Modeling and Analysis for Spatial Data is the first accessible, self-contained treatment of hierarchical methods, modeling, and dat

Temas de Física para Ingeniería: Primer principio de la termodinámica

OpenAIRE

Beléndez Vázquez, Augusto

1992-01-01

Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

A primer on motor vehicle air pollution.

Science.gov (United States)

1973-01-01

This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

Carborane-linked 2'-deoxyuridine 5'-O-triphosphate as building block for polymerase synthesis of carborane-modified DNA.

Science.gov (United States)

Balintová, Jana; Simonova, Anna; Białek-Pietras, Magdalena; Olejniczak, Agnieszka; Lesnikowski, Zbigniew J; Hocek, Michal

2017-11-01

5-[(p-Carborane-2-yl)ethynyl]-2'-deoxyuridine 5'-O-triphosphate was synthesized and used as a good substrate in enzymatic construction of carborane-modified DNA or oligonucleotides containing up to 21 carborane moieties in primer extension reactions by DNA polymerases. Copyright © 2017 Elsevier Ltd. All rights reserved.

Hierarchical organization versus self-organization

OpenAIRE

Busseniers, Evo

2014-01-01

In this paper we try to define the difference between hierarchical organization and self-organization. Organization is defined as a structure with a function. So we can define the difference between hierarchical organization and self-organization both on the structure as on the function. In the next two chapters these two definitions are given. For the structure we will use some existing definitions in graph theory, for the function we will use existing theory on (self-)organization. In the t...

Oligonucleotide fishing for STAT6: cross-talk between IL-4 and chemokines

DEFF Research Database (Denmark)

Eriksen, K W; Nielsen, M; Kaltoft, K

2001-01-01

Signal transducer and activator of transcription 6 (STAT6) is essential for the biological activities of interleukin-4 (IL-4) and the development of allergic responses in mice. Here we report on a sensitive and specific assay for STAT6 activation in response to IL-4. We took advantage of double-s...... activation, whereas other chemokines and cytokines do not. In conclusion, our data show that oligonucleotide fishing is a supplementary tool for studying cytokine cross-talk at a genomic level....

Primer on CDM programme of activities

Energy Technology Data Exchange (ETDEWEB)

Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

2009-07-01

As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

Importance of length and sequence order on magnesium binding to surface-bound oligonucleotides studied by second harmonic generation and atomic force microscopy.

Science.gov (United States)

Holland, Joseph G; Geiger, Franz M

2012-06-07

The binding of magnesium ions to surface-bound single-stranded oligonucleotides was studied under aqueous conditions using second harmonic generation (SHG) and atomic force microscopy (AFM). The effect of strand length on the number of Mg(II) ions bound and their free binding energy was examined for 5-, 10-, 15-, and 20-mers of adenine and guanine at pH 7, 298 K, and 10 mM NaCl. The binding free energies for adenine and guanine sequences were calculated to be -32.1(4) and -35.6(2) kJ/mol, respectively, and invariant with strand length. Furthermore, the ion density for adenine oligonucleotides did not change as strand length increased, with an average value of 2(1) ions/strand. In sharp contrast, guanine oligonucleotides displayed a linear relationship between strand length and ion density, suggesting that cooperativity is important. This data gives predictive capabilities for mixed strands of various lengths, which we exploit for 20-mers of adenines and guanines. In addition, the role sequence order plays in strands of hetero-oligonucleotides was examined for 5'-A(10)G(10)-3', 5'-(AG)(10)-3', and 5'-G(10)A(10)-3' (here the -3' end is chemically modified to bind to the surface). Although the free energy of binding is the same for these three strands (averaged to be -33.3(4) kJ/mol), the total ion density increases when several guanine residues are close to the 3' end (and thus close to the solid support substrate). To further understand these results, we analyzed the height profiles of the functionalized surfaces with tapping-mode atomic force microscopy (AFM). When comparing the average surface height profiles of the oligonucleotide surfaces pre- and post- Mg(II) binding, a positive correlation was found between ion density and the subsequent height decrease following Mg(II) binding, which we attribute to reductions in Coulomb repulsion and strand collapse once a critical number of Mg(II) ions are bound to the strand.

Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

Energy Technology Data Exchange (ETDEWEB)

Park, Serk In, E-mail: serkin@korea.edu [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); The BK21 Plus Program for Biomedical Sciences, Korea University College of Medicine, Seoul (Korea, Republic of); Department of Medicine and Center for Bone Biology, Vanderbilt University School of Medicine, Nashville, TN (United States); Park, Sung-Jun [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Laboratory of Obesity and Aging Research, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD (United States); Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Park, Yun Gyu, E-mail: parkyg@korea.ac.kr [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of)

2016-01-15

The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

International Nuclear Information System (INIS)

Park, Serk In; Park, Sung-Jun; Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won; Park, Yun Gyu

2016-01-01

The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

Labelling of nucleosides and oligonucleotides by solvatochromic 4-aminophthalimide fluorophore for studying DNA–protein interactions

Czech Academy of Sciences Publication Activity Database

Riedl, Jan; Pohl, Radek; Ernsting, N. P.; Orság, Petr; Fojta, Miroslav; Hocek, Michal

2012-01-01

Roč. 3, č. 9 (2012), s. 2797-2806 ISSN 2041-6520 R&D Projects: GA ČR GA203/09/0317; GA ČR GBP206/12/G151 Institutional support: RVO:61388963 ; RVO:68081707 Keywords : DNA * oligonucleotides * polymerase * phthalimide * nucleotides * fluorescent labeling Subject RIV: CC - Organic Chemistry Impact factor: 8.314, year: 2012

Short Oligonucleotides Aligned in Stretched Humid Matrix: Secondary DNA Structure in Poly(vinyl alcohol) Environment

KAUST Repository

Hanczyc, Piotr

2012-04-24

We report that short, synthetic, double- as well as single-stranded DNA can be aligned in stretched humid poly(vinyl alcohol) (PVA) matrix, and the secondary structure (nucleobase orientation) can be characterized with linear dichroism (LD) spectroscopy. Oligonucleotides of lengths varying between 10 (3.4 nm) and 60 bases (20.4 nm) were investigated with respect to structural properties in the gel-like polymer environment. The DNA conformation as a function of relative humidity reveals a strong dependence of helical structure of DNA on PVA hydration level, results of relevance for nanotechnical studies of DNA-based supramolecular systems. Also, the PVA gel could provide possibilities to test models for nucleic acid interactions and distribution in cell contexts, including structural stability of genetic material in the cell and PVA-packaging for gene delivery. A method by which duplex oligonucleotides, with sequences designed to provide specific binding sites, become amenable to polarized-light spectroscopy opens up new possibilities for studying structure in DNA complexes with small adduct molecules as well as proteins. © 2012 American Chemical Society.

Functionalized bioengineered spider silk spheres improve nuclease resistance and activity of oligonucleotide therapeutics providing a strategy for cancer treatment.

Science.gov (United States)

Kozlowska, Anna Karolina; Florczak, Anna; Smialek, Maciej; Dondajewska, Ewelina; Mackiewicz, Andrzej; Kortylewski, Marcin; Dams-Kozlowska, Hanna

2017-09-01

Cell-selective delivery and sensitivity to serum nucleases remain major hurdles to the clinical application of RNA-based oligonucleotide therapeutics, such as siRNA. Spider silk shows great potential as a biomaterial due to its biocompatibility and biodegradability. Self-assembling properties of silk proteins allow for processing into several different morphologies such as fibers, scaffolds, films, hydrogels, capsules and spheres. Moreover, bioengineering of spider silk protein sequences can functionalize silk by adding peptide moieties with specific features including binding or cell recognition domains. We demonstrated that modification of silk protein by adding the nucleic acid binding domain enabled the development of a novel oligonucleotide delivery system that can be utilized to improve pharmacokinetics of RNA-based therapeutics, such as CpG-siRNA. The MS2 bioengineered silk was functionalized with poly-lysine domain (KN) to generate hybrid silk MS2KN. CpG-siRNA efficiently bound to MS2KN in contrary to control MS2. Both MS2KN complexes and spheres protected CpG-siRNA from degradation by serum nucleases. CpG-siRNA molecules encapsulated into MS2KN spheres were efficiently internalized and processed by TLR9-positive macrophages. Importantly, CpG-STAT3siRNA loaded in silk spheres showed delayed and extended target gene silencing compared to naked oligonucleotides. The prolonged Stat3 silencing resulted in the more pronounced downregulation of interleukin 6 (IL-6), a proinflammatory cytokine and upstream activator of STAT3, which limits the efficacy of TLR9 immunostimulation. Our results demonstrate the feasibility of using spider silk spheres as a carrier of therapeutic nucleic acids. Moreover, the modified kinetic and activity of the CpG-STAT3siRNA embedded into silk spheres is likely to improve immunotherapeutic effects in vivo. We demonstrated that modification of silk protein by adding the nucleic acid binding domain enabled the development of a novel

Forest Interpreter's Primer on Fire Management.

Science.gov (United States)

Zelker, Thomas M.

Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

Designing for transportation management and operations : a primer.

Science.gov (United States)

2013-02-01

This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

Evaluation of genetic diversity in open pollinated guava by iPBS primers

International Nuclear Information System (INIS)

Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

2013-01-01

DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

The UVM primer a step-by-step introduction to the universal verification methodology

CERN Document Server

Salemi, Ray

2013-01-01

The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

Genome-wide comparison of paired fresh frozen and formalin-fixed paraffin-embedded gliomas by custom BAC and oligonucleotide array comparative genomic hybridization: facilitating analysis of archival gliomas.

Science.gov (United States)

Mohapatra, Gayatry; Engler, David A; Starbuck, Kristen D; Kim, James C; Bernay, Derek C; Scangas, George A; Rousseau, Audrey; Batchelor, Tracy T; Betensky, Rebecca A; Louis, David N

2011-04-01

Array comparative genomic hybridization (aCGH) is a powerful tool for detecting DNA copy number alterations (CNA). Because diffuse malignant gliomas are often sampled by small biopsies, formalin-fixed paraffin-embedded (FFPE) blocks are often the only tissue available for genetic analysis; FFPE tissues are also needed to study the intratumoral heterogeneity that characterizes these neoplasms. In this paper, we present a combination of evaluations and technical advances that provide strong support for the ready use of oligonucleotide aCGH on FFPE diffuse gliomas. We first compared aCGH using bacterial artificial chromosome (BAC) arrays in 45 paired frozen and FFPE gliomas, and demonstrate a high concordance rate between FFPE and frozen DNA in an individual clone-level analysis of sensitivity and specificity, assuring that under certain array conditions, frozen and FFPE DNA can perform nearly identically. However, because oligonucleotide arrays offer advantages to BAC arrays in genomic coverage and practical availability, we next developed a method of labeling DNA from FFPE tissue that allows efficient hybridization to oligonucleotide arrays. To demonstrate utility in FFPE tissues, we applied this approach to biphasic anaplastic oligoastrocytomas and demonstrate CNA differences between DNA obtained from the two components. Therefore, BAC and oligonucleotide aCGH can be sensitive and specific tools for detecting CNAs in FFPE DNA, and novel labeling techniques enable the routine use of oligonucleotide arrays for FFPE DNA. In combination, these advances should facilitate genome-wide analysis of rare, small and/or histologically heterogeneous gliomas from FFPE tissues.

Deliberate change without hierarchical influence?

DEFF Research Database (Denmark)

Nørskov, Sladjana; Kesting, Peter; Ulhøi, John Parm

2017-01-01

reveals that deliberate change is indeed achievable in a non-hierarchical collaborative OSS community context. However, it presupposes the presence and active involvement of informal change agents. The paper identifies and specifies four key drivers for change agents’ influence. Originality....../value The findings contribute to organisational analysis by providing a deeper understanding of the importance of leadership in making deliberate change possible in non-hierarchical settings. It points to the importance of “change-by-conviction”, essentially based on voluntary behaviour. This can open the door...

Multiparty hierarchical quantum-information splitting

International Nuclear Information System (INIS)

Wang Xinwen; Zhang Dengyu; Tang Shiqing; Xie Lijun

2011-01-01

We propose a scheme for multiparty hierarchical quantum-information splitting (QIS) with a multipartite entangled state, where a boss distributes a secret quantum state to two grades of agents asymmetrically. The agents who belong to different grades have different authorities for recovering the boss's secret. Except for the boss's Bell-state measurement, no nonlocal operation is involved. The presented scheme is also shown to be secure against eavesdropping. Such a hierarchical QIS is expected to find useful applications in the field of modern multipartite quantum cryptography.

Development of bis-locked nucleic acid (bisLNA) oligonucleotides for efficient invasion of supercoiled duplex DNA

DEFF Research Database (Denmark)

Moreno, Pedro M D; Geny, Sylvain; Pabon, Y Vladimir

2013-01-01

In spite of the many developments in synthetic oligonucleotide (ON) chemistry and design, invasion into double-stranded DNA (DSI) under physiological salt and pH conditions remains a challenge. In this work, we provide a new ON tool based on locked nucleic acids (LNAs), designed for strand invasi...

Biased trapping issue on weighted hierarchical networks

Indian Academy of Sciences (India)

archical networks which are based on the classic scale-free hierarchical networks. ... Weighted hierarchical networks; weight-dependent walks; mean first passage ..... The weighted networks can mimic some real-world natural and social systems to ... the Priority Academic Program Development of Jiangsu Higher Education ...

Anti-hierarchical evolution of the active galactic nucleus space density in a hierarchical universe

International Nuclear Information System (INIS)

Enoki, Motohiro; Ishiyama, Tomoaki; Kobayashi, Masakazu A. R.; Nagashima, Masahiro

2014-01-01

Recent observations show that the space density of luminous active galactic nuclei (AGNs) peaks at higher redshifts than that of faint AGNs. This downsizing trend in the AGN evolution seems to be contradictory to the hierarchical structure formation scenario. In this study, we present the AGN space density evolution predicted by a semi-analytic model of galaxy and AGN formation based on the hierarchical structure formation scenario. We demonstrate that our model can reproduce the downsizing trend of the AGN space density evolution. The reason for the downsizing trend in our model is a combination of the cold gas depletion as a consequence of star formation, the gas cooling suppression in massive halos, and the AGN lifetime scaling with the dynamical timescale. We assume that a major merger of galaxies causes a starburst, spheroid formation, and cold gas accretion onto a supermassive black hole (SMBH). We also assume that this cold gas accretion triggers AGN activity. Since the cold gas is mainly depleted by star formation and gas cooling is suppressed in massive dark halos, the amount of cold gas accreted onto SMBHs decreases with cosmic time. Moreover, AGN lifetime increases with cosmic time. Thus, at low redshifts, major mergers do not always lead to luminous AGNs. Because the luminosity of AGNs is correlated with the mass of accreted gas onto SMBHs, the space density of luminous AGNs decreases more quickly than that of faint AGNs. We conclude that the anti-hierarchical evolution of the AGN space density is not contradictory to the hierarchical structure formation scenario.

Anti-hierarchical evolution of the active galactic nucleus space density in a hierarchical universe

Energy Technology Data Exchange (ETDEWEB)

Enoki, Motohiro [Faculty of Business Administration, Tokyo Keizai University, Kokubunji, Tokyo 185-8502 (Japan); Ishiyama, Tomoaki [Center for Computational Sciences, University of Tsukuba, Tsukuba, Ibaraki 305-8577 (Japan); Kobayashi, Masakazu A. R. [Research Center for Space and Cosmic Evolution, Ehime University, Matsuyama, Ehime 790-8577 (Japan); Nagashima, Masahiro, E-mail: enokimt@tku.ac.jp [Faculty of Education, Nagasaki University, Nagasaki, Nagasaki 852-8521 (Japan)

2014-10-10

Recent observations show that the space density of luminous active galactic nuclei (AGNs) peaks at higher redshifts than that of faint AGNs. This downsizing trend in the AGN evolution seems to be contradictory to the hierarchical structure formation scenario. In this study, we present the AGN space density evolution predicted by a semi-analytic model of galaxy and AGN formation based on the hierarchical structure formation scenario. We demonstrate that our model can reproduce the downsizing trend of the AGN space density evolution. The reason for the downsizing trend in our model is a combination of the cold gas depletion as a consequence of star formation, the gas cooling suppression in massive halos, and the AGN lifetime scaling with the dynamical timescale. We assume that a major merger of galaxies causes a starburst, spheroid formation, and cold gas accretion onto a supermassive black hole (SMBH). We also assume that this cold gas accretion triggers AGN activity. Since the cold gas is mainly depleted by star formation and gas cooling is suppressed in massive dark halos, the amount of cold gas accreted onto SMBHs decreases with cosmic time. Moreover, AGN lifetime increases with cosmic time. Thus, at low redshifts, major mergers do not always lead to luminous AGNs. Because the luminosity of AGNs is correlated with the mass of accreted gas onto SMBHs, the space density of luminous AGNs decreases more quickly than that of faint AGNs. We conclude that the anti-hierarchical evolution of the AGN space density is not contradictory to the hierarchical structure formation scenario.

A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

Energy Technology Data Exchange (ETDEWEB)

Warwick, William M.

2002-06-03

This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

Development of specific oligonucleotide probes for the identification and in situ detection of hydrocarbon-degrading Alcanivorax strains.

Science.gov (United States)

Syutsubo, K; Kishira, H; Harayama, S

2001-06-01

The genus Alcanivorax comprises diverse hydrocarbon-degrading marine bacteria. Novel 16S rRNA-targeted oligonucleotide DNA probes (ALV735 and ALV735-b) were developed to quantify two subgroups of the Alcanivorax/Fundibacter group by fluorescence in situ hybridization (FISH), and the conditions for the single-mismatch discrimination of the probes were optimized. The specificity of the probes was improved further using a singly mismatched oligonucleotide as a competitor. The growth of Alcanivorax cells in crude oil-contaminated sea water under the biostimulation condition was investigated by FISH with the probe ALV735, which targeted the main cluster of the Alcanivorax/Fundibacter group. The size of the Alcanivorax population increased with increasing incubation time and accounted for 91% of the 4',6-diamidino-2-phenylindole (DAPI) count after incubation for 2 weeks. The probes developed in this study are useful for detecting Alcanivorax populations in petroleum hydrocarbon-degrading microbial consortia.

Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

Science.gov (United States)

Françoso, E; Arias, M C

2013-09-01

Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

Discovering hierarchical structure in normal relational data

DEFF Research Database (Denmark)

Schmidt, Mikkel Nørgaard; Herlau, Tue; Mørup, Morten

2014-01-01

-parametric generative model for hierarchical clustering of similarity based on multifurcating Gibbs fragmentation trees. This allows us to infer and display the posterior distribution of hierarchical structures that comply with the data. We demonstrate the utility of our method on synthetic data and data of functional...

Initiation, elongation, and realignment during influenza virus mRNA synthesis

NARCIS (Netherlands)

Velthuis, te Aartjan J.W.; Oymans, Judith

2018-01-01

The RNA-dependent RNA polymerase (RdRp) of the influenza A virus replicates and transcribes the viral genome segments in the nucleus of the host cell. To transcribe these viral genome segments, the RdRp "snatches" capped RNA oligonucleotides from nascent host cell mRNAs and aligns these primers to

A regenerated electrochemical biosensor for label-free detection of glucose and urea based on conformational switch of i-motif oligonucleotide probe

Energy Technology Data Exchange (ETDEWEB)

Gao, Zhong Feng; Chen, Dong Mei [Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China); Lei, Jing Lei [School of Chemistry and Chemical Engineering, Chongqing University, Chongqing 400044 (China); Luo, Hong Qun, E-mail: luohq@swu.edu.cn [Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China); Li, Nian Bing, E-mail: linb@swu.edu.cn [Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China)

2015-10-15

Improving the reproducibility of electrochemical signal remains a great challenge over the past decades. In this work, i-motif oligonucleotide probe-based electrochemical DNA (E-DNA) sensor is introduced for the first time as a regenerated sensing platform, which enhances the reproducibility of electrochemical signal, for label-free detection of glucose and urea. The addition of glucose or urea is able to activate glucose oxidase-catalyzed or urease-catalyzed reaction, inducing or destroying the formation of i-motif oligonucleotide probe. The conformational switch of oligonucleotide probe can be recorded by electrochemical impedance spectroscopy. Thus, the difference of electron transfer resistance is utilized for the quantitative determination of glucose and urea. We further demonstrate that the E-DNA sensor exhibits high selectivity, excellent stability, and remarkable regenerated ability. The human serum analysis indicates that this simple and regenerated strategy holds promising potential in future biosensing applications. - Highlights: • Conformational switch of i-motif is used for the detection of glucose and urea. • The sensor can be regenerated. • The proposed method is successfully applied in real sample assay. • Our method is label-free and inexpensive.

Pharmacokinetic Profiling of Conjugated Therapeutic Oligonucleotides: A High-Throughput Method Based Upon Serial Blood Microsampling Coupled to Peptide Nucleic Acid Hybridization Assay.

Science.gov (United States)

Godinho, Bruno M D C; Gilbert, James W; Haraszti, Reka A; Coles, Andrew H; Biscans, Annabelle; Roux, Loic; Nikan, Mehran; Echeverria, Dimas; Hassler, Matthew; Khvorova, Anastasia

2017-12-01

Therapeutic oligonucleotides, such as small interfering RNAs (siRNAs), hold great promise for the treatment of incurable genetically defined disorders by targeting cognate toxic gene products for degradation. To achieve meaningful tissue distribution and efficacy in vivo, siRNAs must be conjugated or formulated. Clear understanding of the pharmacokinetic (PK)/pharmacodynamic behavior of these compounds is necessary to optimize and characterize the performance of therapeutic oligonucleotides in vivo. In this study, we describe a simple and reproducible methodology for the evaluation of in vivo blood/plasma PK profiles and tissue distribution of oligonucleotides. The method is based on serial blood microsampling from the saphenous vein, coupled to peptide nucleic acid hybridization assay for quantification of guide strands. Performed with minimal number of animals, this method allowed unequivocal detection and sensitive quantification without the need for amplification, or further modification of the oligonucleotides. Using this methodology, we compared plasma clearances and tissue distribution profiles of two different hydrophobically modified siRNAs (hsiRNAs). Notably, cholesterol-hsiRNA presented slow plasma clearances and mainly accumulated in the liver, whereas, phosphocholine-docosahexaenoic acid-hsiRNA was rapidly cleared from the plasma and preferably accumulated in the kidney. These data suggest that the PK/biodistribution profiles of modified hsiRNAs are determined by the chemical nature of the conjugate. Importantly, the method described in this study constitutes a simple platform to conduct pilot assessments of the basic clearance and tissue distribution profiles, which can be broadly applied for evaluation of new chemical variants of siRNAs and micro-RNAs.

Road Network Selection Based on Road Hierarchical Structure Control

Directory of Open Access Journals (Sweden)

HE Haiwei

2015-04-01

Full Text Available A new road network selection method based on hierarchical structure is studied. Firstly, road network is built as strokes which are then classified into hierarchical collections according to the criteria of betweenness centrality value (BC value. Secondly, the hierarchical structure of the strokes is enhanced using structural characteristic identification technique. Thirdly, the importance calculation model was established according to the relationships among the hierarchical structure of the strokes. Finally, the importance values of strokes are got supported with the model's hierarchical calculation, and with which the road network is selected. Tests are done to verify the advantage of this method by comparing it with other common stroke-oriented methods using three kinds of typical road network data. Comparision of the results show that this method had few need to semantic data, and could eliminate the negative influence of edge strokes caused by the criteria of BC value well. So, it is better to maintain the global hierarchical structure of road network, and suitable to meet with the selection of various kinds of road network at the same time.

Hierarchically Structured Electrospun Fibers

Directory of Open Access Journals (Sweden)

Nicole E. Zander

2013-01-01

Full Text Available Traditional electrospun nanofibers have a myriad of applications ranging from scaffolds for tissue engineering to components of biosensors and energy harvesting devices. The generally smooth one-dimensional structure of the fibers has stood as a limitation to several interesting novel applications. Control of fiber diameter, porosity and collector geometry will be briefly discussed, as will more traditional methods for controlling fiber morphology and fiber mat architecture. The remainder of the review will focus on new techniques to prepare hierarchically structured fibers. Fibers with hierarchical primary structures—including helical, buckled, and beads-on-a-string fibers, as well as fibers with secondary structures, such as nanopores, nanopillars, nanorods, and internally structured fibers and their applications—will be discussed. These new materials with helical/buckled morphology are expected to possess unique optical and mechanical properties with possible applications for negative refractive index materials, highly stretchable/high-tensile-strength materials, and components in microelectromechanical devices. Core-shell type fibers enable a much wider variety of materials to be electrospun and are expected to be widely applied in the sensing, drug delivery/controlled release fields, and in the encapsulation of live cells for biological applications. Materials with a hierarchical secondary structure are expected to provide new superhydrophobic and self-cleaning materials.

Hierarchical control of electron-transfer

DEFF Research Database (Denmark)

Westerhoff, Hans V.; Jensen, Peter Ruhdal; Egger, Louis

1997-01-01

In this chapter the role of electron transfer in determining the behaviour of the ATP synthesising enzyme in E. coli is analysed. It is concluded that the latter enzyme lacks control because of special properties of the electron transfer components. These properties range from absence of a strong...... back pressure by the protonmotive force on the rate of electron transfer to hierarchical regulation of the expression of the gens that encode the electron transfer proteins as a response to changes in the bioenergetic properties of the cell.The discussion uses Hierarchical Control Analysis...

Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

OpenAIRE

Castillo Canales, Braulio

2017-01-01

En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

Energy Technology Data Exchange (ETDEWEB)

Lucas, D.S.

2004-10-03

This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

Móvil remisión de V. cinta del primer móvil.

OpenAIRE

2011-01-01

[ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

Combining gene expression data from different generations of oligonucleotide arrays

Directory of Open Access Journals (Sweden)

Kong Sek

2004-10-01

Full Text Available Abstract Background One of the important challenges in microarray analysis is to take full advantage of previously accumulated data, both from one's own laboratory and from public repositories. Through a comparative analysis on a variety of datasets, a more comprehensive view of the underlying mechanism or structure can be obtained. However, as we discover in this work, continual changes in genomic sequence annotations and probe design criteria make it difficult to compare gene expression data even from different generations of the same microarray platform. Results We first describe the extent of discordance between the results derived from two generations of Affymetrix oligonucleotide arrays, as revealed in cluster analysis and in identification of differentially expressed genes. We then propose a method for increasing comparability. The dataset we use consists of a set of 14 human muscle biopsy samples from patients with inflammatory myopathies that were hybridized on both HG-U95Av2 and HG-U133A human arrays. We find that the use of the probe set matching table for comparative analysis provided by Affymetrix produces better results than matching by UniGene or LocusLink identifiers but still remains inadequate. Rescaling of expression values for each gene across samples and data filtering by expression values enhance comparability but only for few specific analyses. As a generic method for improving comparability, we select a subset of probes with overlapping sequence segments in the two array types and recalculate expression values based only on the selected probes. We show that this filtering of probes significantly improves the comparability while retaining a sufficient number of probe sets for further analysis. Conclusions Compatibility between high-density oligonucleotide arrays is significantly affected by probe-level sequence information. With a careful filtering of the probes based on their sequence overlaps, data from different

Electrical manipulation of oligonucleotides grafted to charged surfaces.

Science.gov (United States)

Rant, Ulrich; Arinaga, Kenji; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard; Tornow, Marc

2006-09-21

The electrical manipulation of short DNA molecules on surfaces offers novel functionalities with fascinating possibilities in the field of bio-interfaces. Here we present systematic investigations of the electrical interactions which govern the structure of oligonucleotides on charged gold surfaces. Successively, we address influences of the applied field strength, the role of DC electrode potentials, in particular for polycrystalline surfaces, as well as screening effects of the surrounding electrolyte solution. Data obtained for single and double stranded DNA exhibit differences which can be attributed to the dissimilar flexibility of the different molecular conformations. A comparison of the experimental results with a basic model shows how the alignment of the molecules adjusts according to a balance between electrically induced ordering and stochastic thermal motions. The presented conclusions are expected to be of general relevance for the behaviour of polyelectrolytes exposed to localized electric fields at interfaces.

A primer on water

Science.gov (United States)

Leopold, Luna Bergere; Langbein, Walter Basil

1960-01-01

When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

Multi-objective hierarchical genetic algorithms for multilevel redundancy allocation optimization

Energy Technology Data Exchange (ETDEWEB)

Kumar, Ranjan [Department of Aeronautics and Astronautics, Kyoto University, Yoshida-honmachi, Sakyo-ku, Kyoto 606-8501 (Japan)], E-mail: ranjan.k@ks3.ecs.kyoto-u.ac.jp; Izui, Kazuhiro [Department of Aeronautics and Astronautics, Kyoto University, Yoshida-honmachi, Sakyo-ku, Kyoto 606-8501 (Japan)], E-mail: izui@prec.kyoto-u.ac.jp; Yoshimura, Masataka [Department of Aeronautics and Astronautics, Kyoto University, Yoshida-honmachi, Sakyo-ku, Kyoto 606-8501 (Japan)], E-mail: yoshimura@prec.kyoto-u.ac.jp; Nishiwaki, Shinji [Department of Aeronautics and Astronautics, Kyoto University, Yoshida-honmachi, Sakyo-ku, Kyoto 606-8501 (Japan)], E-mail: shinji@prec.kyoto-u.ac.jp

2009-04-15

Multilevel redundancy allocation optimization problems (MRAOPs) occur frequently when attempting to maximize the system reliability of a hierarchical system, and almost all complex engineering systems are hierarchical. Despite their practical significance, limited research has been done concerning the solving of simple MRAOPs. These problems are not only NP hard but also involve hierarchical design variables. Genetic algorithms (GAs) have been applied in solving MRAOPs, since they are computationally efficient in solving such problems, unlike exact methods, but their applications has been confined to single-objective formulation of MRAOPs. This paper proposes a multi-objective formulation of MRAOPs and a methodology for solving such problems. In this methodology, a hierarchical GA framework for multi-objective optimization is proposed by introducing hierarchical genotype encoding for design variables. In addition, we implement the proposed approach by integrating the hierarchical genotype encoding scheme with two popular multi-objective genetic algorithms (MOGAs)-the strength Pareto evolutionary genetic algorithm (SPEA2) and the non-dominated sorting genetic algorithm (NSGA-II). In the provided numerical examples, the proposed multi-objective hierarchical approach is applied to solve two hierarchical MRAOPs, a 4- and a 3-level problems. The proposed method is compared with a single-objective optimization method that uses a hierarchical genetic algorithm (HGA), also applied to solve the 3- and 4-level problems. The results show that a multi-objective hierarchical GA (MOHGA) that includes elitism and mechanism for diversity preserving performed better than a single-objective GA that only uses elitism, when solving large-scale MRAOPs. Additionally, the experimental results show that the proposed method with NSGA-II outperformed the proposed method with SPEA2 in finding useful Pareto optimal solution sets.

Multi-objective hierarchical genetic algorithms for multilevel redundancy allocation optimization

International Nuclear Information System (INIS)

Kumar, Ranjan; Izui, Kazuhiro; Yoshimura, Masataka; Nishiwaki, Shinji

2009-01-01

Multilevel redundancy allocation optimization problems (MRAOPs) occur frequently when attempting to maximize the system reliability of a hierarchical system, and almost all complex engineering systems are hierarchical. Despite their practical significance, limited research has been done concerning the solving of simple MRAOPs. These problems are not only NP hard but also involve hierarchical design variables. Genetic algorithms (GAs) have been applied in solving MRAOPs, since they are computationally efficient in solving such problems, unlike exact methods, but their applications has been confined to single-objective formulation of MRAOPs. This paper proposes a multi-objective formulation of MRAOPs and a methodology for solving such problems. In this methodology, a hierarchical GA framework for multi-objective optimization is proposed by introducing hierarchical genotype encoding for design variables. In addition, we implement the proposed approach by integrating the hierarchical genotype encoding scheme with two popular multi-objective genetic algorithms (MOGAs)-the strength Pareto evolutionary genetic algorithm (SPEA2) and the non-dominated sorting genetic algorithm (NSGA-II). In the provided numerical examples, the proposed multi-objective hierarchical approach is applied to solve two hierarchical MRAOPs, a 4- and a 3-level problems. The proposed method is compared with a single-objective optimization method that uses a hierarchical genetic algorithm (HGA), also applied to solve the 3- and 4-level problems. The results show that a multi-objective hierarchical GA (MOHGA) that includes elitism and mechanism for diversity preserving performed better than a single-objective GA that only uses elitism, when solving large-scale MRAOPs. Additionally, the experimental results show that the proposed method with NSGA-II outperformed the proposed method with SPEA2 in finding useful Pareto optimal solution sets

Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

Energy Technology Data Exchange (ETDEWEB)

Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

2015-04-01

A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Hierarchical Neural Regression Models for Customer Churn Prediction

Directory of Open Access Journals (Sweden)

Golshan Mohammadi

2013-01-01

Full Text Available As customers are the main assets of each industry, customer churn prediction is becoming a major task for companies to remain in competition with competitors. In the literature, the better applicability and efficiency of hierarchical data mining techniques has been reported. This paper considers three hierarchical models by combining four different data mining techniques for churn prediction, which are backpropagation artificial neural networks (ANN, self-organizing maps (SOM, alpha-cut fuzzy c-means (α-FCM, and Cox proportional hazards regression model. The hierarchical models are ANN + ANN + Cox, SOM + ANN + Cox, and α-FCM + ANN + Cox. In particular, the first component of the models aims to cluster data in two churner and nonchurner groups and also filter out unrepresentative data or outliers. Then, the clustered data as the outputs are used to assign customers to churner and nonchurner groups by the second technique. Finally, the correctly classified data are used to create Cox proportional hazards model. To evaluate the performance of the hierarchical models, an Iranian mobile dataset is considered. The experimental results show that the hierarchical models outperform the single Cox regression baseline model in terms of prediction accuracy, Types I and II errors, RMSE, and MAD metrics. In addition, the α-FCM + ANN + Cox model significantly performs better than the two other hierarchical models.

Hierarchical Traces for Reduced NSM Memory Requirements

Science.gov (United States)

Dahl, Torbjørn S.

This paper presents work on using hierarchical long term memory to reduce the memory requirements of nearest sequence memory (NSM) learning, a previously published, instance-based reinforcement learning algorithm. A hierarchical memory representation reduces the memory requirements by allowing traces to share common sub-sequences. We present moderated mechanisms for estimating discounted future rewards and for dealing with hidden state using hierarchical memory. We also present an experimental analysis of how the sub-sequence length affects the memory compression achieved and show that the reduced memory requirements do not effect the speed of learning. Finally, we analyse and discuss the persistence of the sub-sequences independent of specific trace instances.

Hierarchical subtask discovery with non-negative matrix factorization

CSIR Research Space (South Africa)

Earle, AC

2018-04-01

Full Text Available Hierarchical reinforcement learning methods offer a powerful means of planning flexible behavior in complicated domains. However, learning an appropriate hierarchical decomposition of a domain into subtasks remains a substantial challenge. We...

Hierarchical subtask discovery with non-negative matrix factorization

CSIR Research Space (South Africa)

Earle, AC

2017-08-01

Full Text Available Hierarchical reinforcement learning methods offer a powerful means of planning flexible behavior in complicated domains. However, learning an appropriate hierarchical decomposition of a domain into subtasks remains a substantial challenge. We...

Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

Directory of Open Access Journals (Sweden)

Christopher Ryan Penton

2013-09-01

Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

Directory of Open Access Journals (Sweden)

Aleksić Jelena M.

2016-01-01

Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

Statistical Significance for Hierarchical Clustering

Science.gov (United States)

Kimes, Patrick K.; Liu, Yufeng; Hayes, D. Neil; Marron, J. S.

2017-01-01

Summary Cluster analysis has proved to be an invaluable tool for the exploratory and unsupervised analysis of high dimensional datasets. Among methods for clustering, hierarchical approaches have enjoyed substantial popularity in genomics and other fields for their ability to simultaneously uncover multiple layers of clustering structure. A critical and challenging question in cluster analysis is whether the identified clusters represent important underlying structure or are artifacts of natural sampling variation. Few approaches have been proposed for addressing this problem in the context of hierarchical clustering, for which the problem is further complicated by the natural tree structure of the partition, and the multiplicity of tests required to parse the layers of nested clusters. In this paper, we propose a Monte Carlo based approach for testing statistical significance in hierarchical clustering which addresses these issues. The approach is implemented as a sequential testing procedure guaranteeing control of the family-wise error rate. Theoretical justification is provided for our approach, and its power to detect true clustering structure is illustrated through several simulation studies and applications to two cancer gene expression datasets. PMID:28099990

Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

Science.gov (United States)

D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

2018-02-01

Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

Energy Technology Data Exchange (ETDEWEB)

Lech, L.M. [DuPont, Parkersburg, WV (United States)

1999-11-01

Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

Hierarchically Nanoporous Bioactive Glasses for High Efficiency Immobilization of Enzymes

DEFF Research Database (Denmark)

He, W.; Min, D.D.; Zhang, X.D.

2014-01-01

Bioactive glasses with hierarchical nanoporosity and structures have been heavily involved in immobilization of enzymes. Because of meticulous design and ingenious hierarchical nanostructuration of porosities from yeast cell biotemplates, hierarchically nanostructured porous bioactive glasses can...... and products of catalytic reactions can freely diffuse through open mesopores (2–40 nm). The formation mechanism of hierarchically structured porous bioactive glasses, the immobilization mechanism of enzyme and the catalysis mechanism of immobilized enzyme are then discussed. The novel nanostructure...

A Primer to Slow Light

OpenAIRE

Leonhardt, U.

2001-01-01

Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

Three Ways to Link Merge with Hierarchical Concept-Combination

Directory of Open Access Journals (Sweden)

Chris Thornton

2016-11-01

Full Text Available In the Minimalist Program, language competence is seen to stem from a fundamental ability to construct hierarchical structure, an operation dubbed ‘Merge’. This raises the problem of how to view hierarchical concept-combination. This is a conceptual operation which also builds hierarchical structure. We can conceive of a garden that consists of a lawn and a flower-bed, for example, or a salad consisting of lettuce, fennel and rocket, or a crew consisting of a pilot and engineer. In such cases, concepts are put together in a way that makes one the accommodating element with respect to the others taken in combination. The accommodating element becomes the root of a hierarchical unit. Since this unit is itself a concept, the operation is inherently recursive. Does this mean the mind has two independent systems of hierarchical construction? Or is some form of integration more likely? Following a detailed examination of the operations involved, this paper shows there are three main ways in which Merge might be linked to hierarchical concept-combination. Also examined are the architectural implications that arise in each case.

Hierarchical modeling and its numerical implementation for layered thin elastic structures

Energy Technology Data Exchange (ETDEWEB)

Cho, Jin-Rae [Hongik University, Sejong (Korea, Republic of)

2017-05-15

Thin elastic structures such as beam- and plate-like structures and laminates are characterized by the small thickness, which lead to classical plate and laminate theories in which the displacement fields through the thickness are assumed linear or higher-order polynomials. These classical theories are either insufficient to represent the complex stress variation through the thickness or may encounter the accuracy-computational cost dilemma. In order to overcome the inherent problem of classical theories, the concept of hierarchical modeling has been emerged. In the hierarchical modeling, the hierarchical models with different model levels are selected and combined within a structure domain, in order to make the modeling error be distributed as uniformly as possible throughout the problem domain. The purpose of current study is to explore the potential of hierarchical modeling for the effective numerical analysis of layered structures such as laminated composite. For this goal, the hierarchical models are constructed and the hierarchical modeling is implemented by selectively adjusting the level of hierarchical models. As well, the major characteristics of hierarchical models are investigated through the numerical experiments.

Pretreatment of Mice with Oligonucleotide prop5 Protects Them from Influenza Virus Infections

Directory of Open Access Journals (Sweden)

Kang Li

2014-02-01

Full Text Available Influenza A virus is a successful parasite and requires host factors to complete its life cycle. Prop5 is an antisense oligonucleotide, targeting programmed cell death protein 5 (PDCD5. In this study, we tested the antiviral activity of prop5 against mouse-adapted A/FM/1/47 strain of influenza A virus in a mouse model. Prop5 intranasally administered the mice at dosages of 10 and 20 mg/kg/d at 24 h and 30 min before infection, provided 80% and 100% survival rates and prolonged mean survival days in comparison with influenza virus-infected mice (both p < 0.01. Moreover, viral titres in mice pretreated with prop5, at dose of 10 and 20 mg/kg/d, had declined significantly on day two, four, and six post-infection compared with the yields in infected mice (p < 0.05 or p < 0.01; lung index in mice pretreated with prop5 (20 mg/kg/d had been inhibited on day six post-infection (p < 0.05. Western blotting and immunohistochemistry showed that prop5 could down-regulate the PDCD5 protein expression levels in lung tissues of infected mice. These data indicate that antisense oligonucleotide prop5 is a promising drug for prophylaxis and control influenza virus infections and provides an insight into the host-pathogen interaction.

Sequence diversity within the HA-1 gene as detected by melting temperature assay without oligonucleotide probes

Directory of Open Access Journals (Sweden)

Mattiuz Pier

2005-10-01

Full Text Available Abstract Background The minor histocompatibility antigens (mHags are self-peptides derived from common cellular proteins and presented by MHC class I and II molecules. Disparities in mHags are a potential risk for the development of graft-versus-host disease (GvHD in the recipients of bone marrow from HLA-identical donors. Two alleles have been identified in the mHag HA-1. The correlation between mismatches of the mHag HA-1 and GvHD has been suggested and methods to facilitate large-scale testing were afterwards developed. Methods We used sequence specific primer (SSP PCR and direct sequencing to detect HA-1 gene polymorphisms in a sample of 131 unrelated Italian subjects. We then set up a novel melting temperature (Tm assay that may help identification of HA-1 alleles without oligonucleotide probes. Results We report the frequencies of HA-1 alleles in the Italian population and the presence of an intronic 5 base-pair deletion associated with the immunogeneic allele HA-1H. We also detected novel variable sites with respect to the consensus sequence of HA-1 locus. Even though recombination/gene conversion events are documented, there is considerable linkage disequilibrium in the data. The gametic associations between HA-1R/H alleles and the intronic 5-bp ins/del polymorphism prompted us to try the Tm analysis with SYBR® Green I. We show that the addition of dimethylsulfoxide (DMSO during the assay yields distinct patterns when amplicons from HA-1H homozygotes, HA-1R homozygotes, and heterozygotes are analysed. Conclusion The possibility to use SYBR® Green I to detect Tm differences between allelic variants is attractive but requires great caution. We succeeded in allele discrimination of the HA-1 locus using a relatively short (101 bp amplicon, only in the presence of DMSO. We believe that, at least in certain assets, Tm assays may benefit by the addition of DMSO or other agents affecting DNA strand conformation and stability.

Development of a general methodology for labelling peptide-morpholino oligonucleotide conjugates using alkyne-azide click chemistry.

Science.gov (United States)

Shabanpoor, Fazel; Gait, Michael J

2013-11-11

We describe a general methodology for fluorescent labelling of peptide conjugates of phosphorodiamidate morpholino oligonucleotides (PMOs) by alkyne functionalization of peptides, subsequent conjugation to PMOs and labelling with a fluorescent compound (Cy5-azide). Two peptide-PMO (PPMO) examples are shown. No detrimental effect of such labelled PMOs was seen in a biological assay.

Hierarchical surfaces for enhanced self-cleaning applications

Science.gov (United States)

Fernández, Ariadna; Francone, Achille; Thamdrup, Lasse H.; Johansson, Alicia; Bilenberg, Brian; Nielsen, Theodor; Guttmann, Markus; Sotomayor Torres, Clivia M.; Kehagias, Nikolaos

2017-04-01

In this study we present a flexible and adaptable fabrication method to create complex hierarchical structures over inherently hydrophobic resist materials. We have tested these surfaces for their superhydrophobic behaviour and successfully verified their self-cleaning properties. The followed approach allow us to design and produce superhydrophobic surfaces in a reproducible manner. We have analysed different combination of hierarchical micro-nanostructures for their application to self-cleaning surfaces. A static contact angle value of 170° with a hysteresis of 4° was achieved without the need of any additional chemical treatment on the fabricated hierarchical structures. Dynamic effects were analysed on these surfaces, obtaining a remarkable self-cleaning effect as well as a good robustness over impacting droplets.

Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

DEFF Research Database (Denmark)

Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

2011-01-01

BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

Energy Technology Data Exchange (ETDEWEB)

Lu Xiangyu [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zuo Yu, E-mail: zuoy@mail.buct.edu.c [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zhao Xuhui; Tang Yuming; Feng Xingguo [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China)

2011-01-15

Research highlights: {yields} A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. {yields} The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. {yields} EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R{sub ct} at the magnesium particle/coating interface decreased and the double-layer capacitance Q{sub dl} increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH){sub 2} in the coating also provided some degree of barrier protection.

The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

International Nuclear Information System (INIS)

Lu Xiangyu; Zuo Yu; Zhao Xuhui; Tang Yuming; Feng Xingguo

2011-01-01

Research highlights: → A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. → The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. → EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R ct at the magnesium particle/coating interface decreased and the double-layer capacitance Q dl increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH) 2 in the coating also provided some degree of barrier protection.

Metabolomics: A Primer.

Science.gov (United States)

Liu, Xiaojing; Locasale, Jason W

2017-04-01

Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

Polymerase chain reaction: Theory, practice and application: A review

Directory of Open Access Journals (Sweden)

S E Atawodi

2010-01-01

Full Text Available Polymerase Chain Reaction (PCR is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension of the annealed primers by DNA polymerase, result in the exponential accumulation of a specific fragment whose termini are defined by 5′ end of the primers. The primer extension products synthesized in one cycle can serve as a template in the next. Hence the number of target DNA copies approximately doubles at every cycle. Since its inception, PCR has had an enormous impact in both basic and diagnostic aspects of molecular biology. Like the PCR itself, the number of applications has been accumulating exponentially. It is therefore recommended that relevant scientists and laboratories in developing countries like Nigeria should acquire this simple and relatively inexpensive, but rather robust technology.

Detection of chromogranins A and B in endocrine tissues with radioactive and biotinylated oligonucleotide probes

International Nuclear Information System (INIS)

Lloyd, R.V.; Jin, L.; Fields, K.

1990-01-01

We analyzed the distribution of chromogranins A and B in normal and neoplastic endocrine tissues with secretory granules using 35 S-labeled and biotin-labeled oligonucleotide probes by in situ hybridization (ISH). Both radioactive and nonradioactive probes detected messenger RNAs (mRNAs) in frozen and paraffin tissue sections. Endocrine tissues with variable immunoreactivities for chromogranin A protein, such as small-cell lung carcinomas, neuroblastomas, insulinomas, and parathyroid adenomas, expressed the mRNA for chromogranins A and B in most cells. Some technical problems with the biotinylated probes included nonspecific nuclear staining and endogenous alkaline phosphatase, which was not completely abolished by levamisole pretreatment. A differential distribution of chromogranins A and B was seen in pituitary prolactinomas, which expressed abundant chromogranin B but not chromogranin A mRNAs, and in parathyroid adenomas, which expressed abundant chromogranin A but only small amounts of chromogranin B mRNAs. These results indicate that ISH can be used to detect chromogranins A and B in endocrine tissues with radioactive and biotinylated oligonucleotide probes and that the mRNAs for chromogranin A and B are demonstrable in some tumors even when the chromogranin proteins cannot be detected by immunohistochemistry

Detection of chromogranins A and B in endocrine tissues with radioactive and biotinylated oligonucleotide probes

Energy Technology Data Exchange (ETDEWEB)

Lloyd, R.V.; Jin, L.; Fields, K. (Univ. of Michigan, Ann Arbor (USA))

1990-01-01

We analyzed the distribution of chromogranins A and B in normal and neoplastic endocrine tissues with secretory granules using {sup 35}S-labeled and biotin-labeled oligonucleotide probes by in situ hybridization (ISH). Both radioactive and nonradioactive probes detected messenger RNAs (mRNAs) in frozen and paraffin tissue sections. Endocrine tissues with variable immunoreactivities for chromogranin A protein, such as small-cell lung carcinomas, neuroblastomas, insulinomas, and parathyroid adenomas, expressed the mRNA for chromogranins A and B in most cells. Some technical problems with the biotinylated probes included nonspecific nuclear staining and endogenous alkaline phosphatase, which was not completely abolished by levamisole pretreatment. A differential distribution of chromogranins A and B was seen in pituitary prolactinomas, which expressed abundant chromogranin B but not chromogranin A mRNAs, and in parathyroid adenomas, which expressed abundant chromogranin A but only small amounts of chromogranin B mRNAs. These results indicate that ISH can be used to detect chromogranins A and B in endocrine tissues with radioactive and biotinylated oligonucleotide probes and that the mRNAs for chromogranin A and B are demonstrable in some tumors even when the chromogranin proteins cannot be detected by immunohistochemistry.

Oligonucleotide Length-Dependent Formation of Virus-Like Particles.

Science.gov (United States)

Maassen, Stan J; de Ruiter, Mark V; Lindhoud, Saskia; Cornelissen, Jeroen J L M

2018-05-23

Understanding the assembly pathway of viruses can contribute to creating monodisperse virus-based materials. In this study, the cowpea chlorotic mottle virus (CCMV) is used to determine the interactions between the capsid proteins of viruses and their cargo. The assembly of the capsid proteins in the presence of different lengths of short, single-stranded (ss) DNA is studied at neutral pH, at which the protein-protein interactions are weak. Chromatography, electrophoresis, microscopy, and light scattering data show that the assembly efficiency and speed of the particles increase with increasing length of oligonucleotides. The minimal length required for assembly under the conditions used herein is 14 nucleotides. Assembly of particles containing such short strands of ssDNA can take almost a month. This slow assembly process enabled the study of intermediate states, which confirmed a low cooperative assembly for CCMV and allowed for further expansion of current assembly theories. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Hierarchical Micro-Nano Coatings by Painting

Science.gov (United States)

Kirveslahti, Anna; Korhonen, Tuulia; Suvanto, Mika; Pakkanen, Tapani A.

2016-03-01

In this paper, the wettability properties of coatings with hierarchical surface structures and low surface energy were studied. Hierarchically structured coatings were produced by using hydrophobic fumed silica nanoparticles and polytetrafluoroethylene (PTFE) microparticles as additives in polyester (PES) and polyvinyldifluoride (PVDF). These particles created hierarchical micro-nano structures on the paint surfaces and lowered or supported the already low surface energy of the paint. Two standard application techniques for paint application were employed and the presented coatings are suitable for mass production and use in large surface areas. By regulating the particle concentrations, it was possible to modify wettability properties gradually. Highly hydrophobic surfaces were achieved with the highest contact angle of 165∘. Dynamic contact angle measurements were carried out for a set of selected samples and low hysteresis was obtained. Produced coatings possessed long lasting durability in the air and in underwater conditions.

Primer on Health Surveys

Directory of Open Access Journals (Sweden)

David L Nordstrom

2012-06-01

Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

Hierarchical virtual screening approaches in small molecule drug discovery.

Science.gov (United States)

Kumar, Ashutosh; Zhang, Kam Y J

2015-01-01

Virtual screening has played a significant role in the discovery of small molecule inhibitors of therapeutic targets in last two decades. Various ligand and structure-based virtual screening approaches are employed to identify small molecule ligands for proteins of interest. These approaches are often combined in either hierarchical or parallel manner to take advantage of the strength and avoid the limitations associated with individual methods. Hierarchical combination of ligand and structure-based virtual screening approaches has received noteworthy success in numerous drug discovery campaigns. In hierarchical virtual screening, several filters using ligand and structure-based approaches are sequentially applied to reduce a large screening library to a number small enough for experimental testing. In this review, we focus on different hierarchical virtual screening strategies and their application in the discovery of small molecule modulators of important drug targets. Several virtual screening studies are discussed to demonstrate the successful application of hierarchical virtual screening in small molecule drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.

Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

Directory of Open Access Journals (Sweden)

Diana Sari

2015-05-01

Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

Information Limited Oligonucleotide Amplification Assay for Affinity-Based, Parallel Detection Studies.

Directory of Open Access Journals (Sweden)

Harish Bokkasam

Full Text Available Molecular communication systems encounter similar constraints as telecommunications. In either case, channel crosstalk at the receiver end will result in information loss that statistical analysis cannot compensate. This is because in any communication channel there is a physical limit to the amount of information that can be transmitted. We present a novel and simple modified end amplification (MEA technique to generate reduced and defined amounts of specific information in form of short fragments from an oligonucleotide source that also contains unrelated and redundant information. Our method can be a valuable tool to investigate information overflow and channel capacity in biomolecular recognition systems.

Detection of autoimmune antibodies in localized scleroderma by synthetic oligonucleotide antigens

DEFF Research Database (Denmark)

Samuelsen, Simone; Jørgensen, Christian Damsgaard; Mellins, Elizabeth D

2018-01-01

In this study, we developed a series of synthetic oligonucleotides that allowed us to investigate the details on the antigen recognition by autoimmune antibodies in localized scleroderma subjects. Besides dramatically improved analytical specificity of the assay, our data suggests a potential...... linking for antibodies to DNA to the biological status of disease state in localized scleroderma. Moreover, introducing chemical modifications into short synthetic deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) molecules completely changed the binding titers of corresponding antibodies...... and their clinical relevance. The strongest observed effect was registered for the localized scleroderma skin damage index (LoSDI) on the IgG antibodies to TC dinucleotide-rich double-stranded antigen (p

Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

Science.gov (United States)

2011-08-17

system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

Science.gov (United States)

Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

2001-04-01

Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

Single primer amplification reaction methods reveal exotic and ...

Indian Academy of Sciences (India)

Unknown

mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

Science.gov (United States)

Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

1996-01-01

Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

PRINS and in situ PCR protocols

National Research Council Canada - National Science Library

Gosden, John R

1997-01-01

... mapping of DNA sequences on chromosomes and location of gene expression followed the invention and refinement of in situ hybridization. Among the most recent technical developments has been the use of oligonucleotide primers to detect and amplify or extend complementary sequences in situ, and it is to this novel field that PRINS and In S...

Introduction into Hierarchical Matrices

KAUST Repository

Litvinenko, Alexander

2013-01-01

Hierarchical matrices allow us to reduce computational storage and cost from cubic to almost linear. This technique can be applied for solving PDEs, integral equations, matrix equations and approximation of large covariance and precision matrices.

Introduction into Hierarchical Matrices

KAUST Repository

Litvinenko, Alexander

2013-12-05

Hierarchical matrices allow us to reduce computational storage and cost from cubic to almost linear. This technique can be applied for solving PDEs, integral equations, matrix equations and approximation of large covariance and precision matrices.

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

Energy Technology Data Exchange (ETDEWEB)

Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

2000-09-27

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

Energy Technology Data Exchange (ETDEWEB)

A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

1998-12-10

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

Summary of the primer on tumor immunology and the biological therapy of cancer

Directory of Open Access Journals (Sweden)

Margolin Kim

2009-01-01

Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

Directory of Open Access Journals (Sweden)

Melissa Agsalda

2009-01-01

Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

Science.gov (United States)

Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

2009-01-01

Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

Hierarchical surfaces for enhanced self-cleaning applications

International Nuclear Information System (INIS)

Fernández, Ariadna; Francone, Achille; Sotomayor Torres, Clivia M; Kehagias, Nikolaos; Thamdrup, Lasse H; Johansson, Alicia; Bilenberg, Brian; Nielsen, Theodor; Guttmann, Markus

2017-01-01

In this study we present a flexible and adaptable fabrication method to create complex hierarchical structures over inherently hydrophobic resist materials. We have tested these surfaces for their superhydrophobic behaviour and successfully verified their self-cleaning properties. The followed approach allow us to design and produce superhydrophobic surfaces in a reproducible manner. We have analysed different combination of hierarchical micro-nanostructures for their application to self-cleaning surfaces. A static contact angle value of 170° with a hysteresis of 4° was achieved without the need of any additional chemical treatment on the fabricated hierarchical structures. Dynamic effects were analysed on these surfaces, obtaining a remarkable self-cleaning effect as well as a good robustness over impacting droplets. (paper)

Hierarchical processing in the prefrontal cortex in a variety of cognitive domains

Directory of Open Access Journals (Sweden)

Hyeon-Ae eJeon

2014-11-01

Full Text Available This review scrutinizes several findings on human hierarchical processing within the prefrontal cortex (PFC in diverse cognitive domains. Converging evidence from previous studies has shown that the PFC, specifically Brodmann area (BA 44, may function as the essential region for hierarchical processing across the domains. In language fMRI studies, BA 44 was significantly activated for the hierarchical processing of center-embedded sentences and this pattern of activations was also observed in artificial grammar. The same pattern was observed in the visuo-spatial domain where BA44 was actively involved in the processing of hierarchy for the visual symbol. Musical syntax, which is the rule-based arrangement of musical sets, has also been construed as hierarchical processing as in the language domain such that the activation in BA44 was observed in a chord sequence paradigm. P600 ERP was also engendered during the processing of musical hierarchy. Along with a longstanding idea that a human’s number faculty is developed as a by-product of language faculty, BA44 was closely involved in hierarchical processing in mental arithmetic. This review extended its discussion of hierarchical processing to hierarchical behavior, that is, human action which has been referred to as being hierarchically composed. Several lesion and TMS studies supported the involvement of BA44 for hierarchical processing in the action domain. Lastly, the hierarchical organization of cognitive controls was discussed within the PFC, forming a cascade of top-down hierarchical processes operating along a posterior-to-anterior axis of the lateral PFC including BA44 within the network. It is proposed that PFC is actively involved in different forms of hierarchical processing and specifically BA44 may play an integral role in the process. Taking levels of proficiency and subcortical areas into consideration may provide further insight into the functional role of BA44 for hierarchical

Hierarchical Ag mesostructures for single particle SERS substrate

Energy Technology Data Exchange (ETDEWEB)

Xu, Minwei, E-mail: xuminwei@xjtu.edu.cn; Zhang, Yin

2017-01-30

Highlights: • Hierarchical Ag mesostructures with the size of 250, 360 and 500 nm are synthesized via a seed-mediated approach. • The Ag mesostructures present the tailorable size and highly roughened surfaces. • The average enhancement factors for individual Ag mesostructures were estimated to be as high as 10{sup 6}. - Abstract: Hierarchical Ag mesostructures with highly rough surface morphology have been synthesized at room temperature through a simple seed-mediated approach. Electron microscopy characterizations indicate that the obtained Ag mesostructures exhibit a textured surface morphology with the flower-like architecture. Moreover, the particle size can be tailored easily in the range of 250–500 nm. For the growth process of the hierarchical Ag mesostructures, it is believed that the self-assembly mechanism is more reasonable rather than the epitaxial overgrowth of Ag seed. The oriented attachment of nanoparticles is revealed during the formation of Ag mesostructures. Single particle surface enhanced Raman spectra (sp-SERS) of crystal violet adsorbed on the hierarchical Ag mesostructures were measured. Results reveal that the hierarchical Ag mesostructures can be highly sensitive sp-SERS substrates with good reproducibility. The average enhancement factors for individual Ag mesostructures are estimated to be about 10{sup 6}.

MRI Primer

International Nuclear Information System (INIS)

Oldendorf, W.; Oldendorf, W. Jr.

1991-01-01

Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

A primer of multivariate statistics

CERN Document Server

Harris, Richard J

2014-01-01

Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

International Nuclear Information System (INIS)

Zhan Fangfang; Zhou Xiaoming; Xing Da

2013-01-01

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

A Primer on Basic Effect Size Concepts.

Science.gov (United States)

Elmore, Patricia B.; Rotou, Ourania

The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

Analysis hierarchical model for discrete event systems

Science.gov (United States)

Ciortea, E. M.

2015-11-01

The This paper presents the hierarchical model based on discrete event network for robotic systems. Based on the hierarchical approach, Petri network is analysed as a network of the highest conceptual level and the lowest level of local control. For modelling and control of complex robotic systems using extended Petri nets. Such a system is structured, controlled and analysed in this paper by using Visual Object Net ++ package that is relatively simple and easy to use, and the results are shown as representations easy to interpret. The hierarchical structure of the robotic system is implemented on computers analysed using specialized programs. Implementation of hierarchical model discrete event systems, as a real-time operating system on a computer network connected via a serial bus is possible, where each computer is dedicated to local and Petri model of a subsystem global robotic system. Since Petri models are simplified to apply general computers, analysis, modelling, complex manufacturing systems control can be achieved using Petri nets. Discrete event systems is a pragmatic tool for modelling industrial systems. For system modelling using Petri nets because we have our system where discrete event. To highlight the auxiliary time Petri model using transport stream divided into hierarchical levels and sections are analysed successively. Proposed robotic system simulation using timed Petri, offers the opportunity to view the robotic time. Application of goods or robotic and transmission times obtained by measuring spot is obtained graphics showing the average time for transport activity, using the parameters sets of finished products. individually.

Hierarchical effects on target detection and conflict monitoring

Science.gov (United States)

Cao, Bihua; Gao, Feng; Ren, Maofang; Li, Fuhong

2016-01-01

Previous neuroimaging studies have demonstrated a hierarchical functional structure of the frontal cortices of the human brain, but the temporal course and the electrophysiological signature of the hierarchical representation remains unaddressed. In the present study, twenty-one volunteers were asked to perform a nested cue-target task, while their scalp potentials were recorded. The results showed that: (1) in comparison with the lower-level hierarchical targets, the higher-level targets elicited a larger N2 component (220–350 ms) at the frontal sites, and a smaller P3 component (350–500 ms) across the frontal and parietal sites; (2) conflict-related negativity (non-target minus target) was greater for the lower-level hierarchy than the higher-level, reflecting a more intensive process of conflict monitoring at the final step of target detection. These results imply that decision making, context updating, and conflict monitoring differ among different hierarchical levels of abstraction. PMID:27561989

Programming with Hierarchical Maps

DEFF Research Database (Denmark)

Ørbæk, Peter

This report desribes the hierarchical maps used as a central data structure in the Corundum framework. We describe its most prominent features, ague for its usefulness and briefly describe some of the software prototypes implemented using the technology....

PNA-COMBO-FISH: From combinatorial probe design in silico to vitality compatible, specific labelling of gene targets in cell nuclei

Energy Technology Data Exchange (ETDEWEB)

Müller, Patrick; Rößler, Jens; Schwarz-Finsterle, Jutta [University of Heidelberg, Kirchhoff Institute for Physics, Im Neuenheimer Feld 227, D-69120 Heidelberg (Germany); Schmitt, Eberhard, E-mail: eschmitt@kip.uni-heidelberg.de [University of Heidelberg, Kirchhoff Institute for Physics, Im Neuenheimer Feld 227, D-69120 Heidelberg (Germany); University of Göttingen, Institute for Numerical and Applied Mathematics, Lotzestraße 16-18, D-37083 Göttingen (Germany); Hausmann, Michael, E-mail: hausmann@kip.uni-heidelberg.de [University of Heidelberg, Kirchhoff Institute for Physics, Im Neuenheimer Feld 227, D-69120 Heidelberg (Germany)

2016-07-01

Recently, advantages concerning targeting specificity of PCR constructed oligonucleotide FISH probes in contrast to established FISH probes, e.g. BAC clones, have been demonstrated. These techniques, however, are still using labelling protocols with DNA denaturing steps applying harsh heat treatment with or without further denaturing chemical agents. COMBO-FISH (COMBinatorial Oligonucleotide FISH) allows the design of specific oligonucleotide probe combinations in silico. Thus, being independent from primer libraries or PCR laboratory conditions, the probe sequences extracted by computer sequence data base search can also be synthesized as single stranded PNA-probes (Peptide Nucleic Acid probes). Gene targets can be specifically labelled with at least about 20 PNA-probes obtaining visibly background free specimens. By using appropriately designed triplex forming oligonucleotides, the denaturing procedures can completely be omitted. These results reveal a significant step towards oligonucleotide-FISH maintaining the 3D-nanostructure and even the viability of the cell target. The method is demonstrated with the detection of Her2/neu and GRB7 genes, which are indicators in breast cancer diagnosis and therapy. - Highlights: • Denaturation free protocols preserve 3D architecture of chromosomes and nuclei. • Labelling sets are determined in silico for duplex and triplex binding. • Probes are produced chemically with freely chosen backbones and base variants. • Peptide nucleic acid backbones reduce hindering charge interactions. • Intercalating side chains stabilize binding of short oligonucleotides.

PNA-COMBO-FISH: From combinatorial probe design in silico to vitality compatible, specific labelling of gene targets in cell nuclei

International Nuclear Information System (INIS)

Müller, Patrick; Rößler, Jens; Schwarz-Finsterle, Jutta; Schmitt, Eberhard; Hausmann, Michael

2016-01-01

Recently, advantages concerning targeting specificity of PCR constructed oligonucleotide FISH probes in contrast to established FISH probes, e.g. BAC clones, have been demonstrated. These techniques, however, are still using labelling protocols with DNA denaturing steps applying harsh heat treatment with or without further denaturing chemical agents. COMBO-FISH (COMBinatorial Oligonucleotide FISH) allows the design of specific oligonucleotide probe combinations in silico. Thus, being independent from primer libraries or PCR laboratory conditions, the probe sequences extracted by computer sequence data base search can also be synthesized as single stranded PNA-probes (Peptide Nucleic Acid probes). Gene targets can be specifically labelled with at least about 20 PNA-probes obtaining visibly background free specimens. By using appropriately designed triplex forming oligonucleotides, the denaturing procedures can completely be omitted. These results reveal a significant step towards oligonucleotide-FISH maintaining the 3D-nanostructure and even the viability of the cell target. The method is demonstrated with the detection of Her2/neu and GRB7 genes, which are indicators in breast cancer diagnosis and therapy. - Highlights: • Denaturation free protocols preserve 3D architecture of chromosomes and nuclei. • Labelling sets are determined in silico for duplex and triplex binding. • Probes are produced chemically with freely chosen backbones and base variants. • Peptide nucleic acid backbones reduce hindering charge interactions. • Intercalating side chains stabilize binding of short oligonucleotides.