Limiting effects in double EEX beamline

Science.gov (United States)

Ha, G.; Power, J. G.; Conde, M.; Doran, D. S.; Gai, W.

2017-07-01

The double emittance exchange (EEX) beamline is suggested to overcome the large horizontal emittance and transverse jitter issues associated with the single EEX beamline while preserving its powerful phase-space manipulation capability. However, the double EEX beamline also has potential limitations due to coherent synchrotron radiation (CSR) and transverse jitter. The former limitation arises because double EEX uses twice as many bending magnets as single EEX which means stronger CSR effects degrading the beam quality. The latter limitation arises because a longitudinal jitter in front of the first EEX beamline is converted into a transverse jitter in the middle section (between the EEX beamlines) which can cause beam loss or beam degradation. In this paper, we numerically explore the effects of these two limitations on the emittance and beam transport.

Limiting effects in double EEX beamline

International Nuclear Information System (INIS)

Ha, G; Power, J G; Conde, M; Doran, D S; Gai, W

2017-01-01

The double emittance exchange (EEX) beamline is suggested to overcome the large horizontal emittance and transverse jitter issues associated with the single EEX beamline while preserving its powerful phase-space manipulation capability. However, the double EEX beamline also has potential limitations due to coherent synchrotron radiation (CSR) and transverse jitter. The former limitation arises because double EEX uses twice as many bending magnets as single EEX which means stronger CSR effects degrading the beam quality. The latter limitation arises because a longitudinal jitter in front of the first EEX beamline is converted into a transverse jitter in the middle section (between the EEX beamlines) which can cause beam loss or beam degradation. In this paper, we numerically explore the effects of these two limitations on the emittance and beam transport. (paper)

Single-electron tunneling in double-barrier nanostructures

International Nuclear Information System (INIS)

Goldman, V.J.; Su, B.; Cunningham, J.E.

1992-01-01

In this paper, the authors review experimental study of charge transport in nanometer double-barrier resonant tunneling devices. Heterostructure material is asymmetric: one barrier is substantially less transparent than the other. Resonant tunneling through size-quantized well states and single-electron charging of the well are thus largely separated in the two bias polarities. When the emitter barrier is more transparent than the collector barrier, electrons accumulate in the well; incremental electron occupation of the well is accompanied by Coulomb blockade leading to sharp steps of the tunneling current. When the emitter barrier is less transparent, the current reflects resonant tunneling of just one electron at a time through size-quantized well states; the current peaks and/or steps (depending on experimental parameters) appear in current-voltage characteristics. Magnetic field and temperature effects are also reviewed. Good agreement is achieved in comparison of many features of experimental data with simple theoretical models

Origins of transverse emittance blow-up during the LHC energy tramp

CERN Document Server

Kuhn, M; Arduini, G; Kain, V; Schaumann, M; Tomas, R

2014-01-01

During LHC Run 1 about 30 % of the potential peak performance was lost due to transverse emittance blow-up through the LHC cycle. Measurements indicated that the majority of the blow-up occurred during the energy ramp. Until the end of LHC Run 1 this emittance blow-up could not be eliminated. In this paper the measurements and observations of emittance growth through the ramp are summarized. Simulation results for growth due to Intra Beam Scattering will be shown and compared to measurements. A summary of investigations of other possible sources will be given and backed up with simulations where possible. Requirements for commissioning the LHC with beam in 2015 after Long Shutdown 1 to understand and control emittance blow-up will be listed.

Hidden worlds in quantum physics

CERN Document Server

Gouesbet, Gérard

2014-01-01

The past decade has witnessed a resurgence in research and interest in the areas of quantum computation and entanglement. This new book addresses the hidden worlds or variables of quantum physics. Author Gérard Gouesbet studied and worked with a former student of Louis de Broglie, a pioneer of quantum physics. His presentation emphasizes the history and philosophical foundations of physics, areas that will interest lay readers as well as professionals and advanced undergraduate and graduate students of quantum physics. The introduction is succeeded by chapters offering background on relevant concepts in classical and quantum mechanics, a brief history of causal theories, and examinations of the double solution, pilot wave, and other hidden-variables theories. Additional topics include proofs of possibility and impossibility, contextuality, non-locality, classification of hidden-variables theories, and stochastic quantum mechanics. The final section discusses how to gain a genuine understanding of quantum mec...

Performance test of Spectran-F and Spectran-III computer programs for resolving the 137Cs-110Ag double peak in gamma-ray spectrometric analysis

International Nuclear Information System (INIS)

Terada, H.; Malinowski, J.; Blick, H.

1981-09-01

The performance of the computer programs (Spectran F and Spectran-III) in resolving the 137 Cs-sup(110m)Ag double peak at 661.6-657.7 keV in the gamma-ray spectrum was investigated. In the experiments, the intensity ratios of both lines in the double peak were varied from 0.1 to 60. The results obtained show, that both programs have almost the same performance in resolving the double peak investigated, with slight superiority of Spectran-F. If accuracy better than 5% is desired, the peak intensity ratio in the dublet must be kept below 10. (orig.)

Asymmetrical field emitter

Science.gov (United States)

Fleming, J.G.; Smith, B.K.

1995-10-10

A method is disclosed for providing a field emitter with an asymmetrical emitter structure having a very sharp tip in close proximity to its gate. One preferred embodiment of the present invention includes an asymmetrical emitter and a gate. The emitter having a tip and a side is coupled to a substrate. The gate is connected to a step in the substrate. The step has a top surface and a side wall that is substantially parallel to the side of the emitter. The tip of the emitter is in close proximity to the gate. The emitter is at an emitter potential, and the gate is at a gate potential such that with the two potentials at appropriate values, electrons are emitted from the emitter. In one embodiment, the gate is separated from the emitter by an oxide layer, and the emitter is etched anisotropically to form its tip and its asymmetrical structure. 17 figs.

Emittance preservation

Energy Technology Data Exchange (ETDEWEB)

Kain, V; Arduini, G; Goddard, B; Holzer, B J; Jowett, J M; Meddahi, M; Mertens, T; Roncarolo, F; Schaumann, M; Versteegen, R; Wenninger, J [European Organization for Nuclear Research, Geneva (Switzerland)

2012-07-01

Emittance measurements during the LHC proton run 2011 indicated a blow-up of 20 % to 30 % from LHC injection to collisions. This presentation will show the emittance preservation throughout the different parts of the LHC cycle and discuss the current limitations on emittance determination. An overview of emittance preservation through the injector complex as function of bunch intensity will also be given. Possible sources for the observed blow-up and required tests in 2012 will be presented. Possible improvements of emittance diagnostics and analysis tools for 2012 will be shown.

Internal dynamics and emittance growth in space-charge-dominated beams

International Nuclear Information System (INIS)

Anderson, O.A.

1987-01-01

Previous analytical studies have related transverse rms emittance growth in nonuniform beams to changes in the beam density profile, but the time evolution of the process has not been analyzed. Our new approach analyzes the internal motion of the beam and from this obtains the explicit time dependence of the rms emittance. It is shown to reach its peak value explosively in about one quarter of a plasma period. The subsequent behavior depends on the uniformity of the initial density profile. We derive a uniformity criterion that determines whether or not the emittance oscillates periodically and present examples of density profiles for which the emittance returns to its initial value and then continues to oscillate. We discuss a class of continuous initial profiles that lead to discontinuous shocklike behavior (with partial irreversibility of the oscillations) and a class of segmented profiles for which the emittance jumps to its maximum value in one fourth of a plasma period and remains at that value with essentially no further change. (author)

Ultra-low emittance electron beam generation using ionization injection in a plasma beatwave accelerator

Science.gov (United States)

Schroeder, Carl; Benedetti, Carlo; Esarey, Eric; Leemans, Wim

2017-10-01

Ultra-low emittance beams can be generated using ionization injection of electrons into a wakefield excited by a plasma beatwave accelerator. This all-optical method of electron beam generation uses three laser pulses of different colors. Two long-wavelength laser pulses, with frequency difference equal to the plasma frequency, resonantly drive a plasma wave without fully ionizing a gas. A short-wavelength injection laser pulse (with a small ponderomotive force and large peak electric field), co-propagating and delayed with respect to the beating long-wavelength lasers, ionizes a fraction of the remaining bound electrons at a trapped wake phase, generating an electron beam that is accelerated in the wakefield. Using the beating of long-wavelength pulses to generate the wakefield enables atomically-bound electrons to remain at low ionization potentials, reducing the required amplitude of the ionization pulse, and, hence, the initial transverse momentum and emittance of the injected electrons. An example is presented using two lines of a CO2 laser to form a plasma beatwave accelerator to drive the wake and a frequency-doubled Ti:Al2O3 laser for ionization injection. Supported by the U.S. Department of Energy under Contract No. DE-AC02-05CH11231.

Low-intensity interference effects and hidden-variable theories

Energy Technology Data Exchange (ETDEWEB)

Buonomano, V [Universidade Estadual de Campinas (Brazil). Inst. de Matematica

1978-05-11

The double-slit interference experiment and other similar experiments in the low-intensity limit (that is, one photon in the apparatus at a time) are examined in the spirit of Bell's work from the point of view of hidden-variable theories. It is found that there exists a class of hidden-variable theories which disagrees with quantum mechanics for a certain type of interference experiment. A manufactured conceptualization of this class, which is a particle view of interference, is described. An experiment, which appears to be feasible, is proposed to examine this disagreement.

Measurements of emittance growth through the achromatic bend at the BNL Accelerator Test Facility

International Nuclear Information System (INIS)

Wang, X.J.; Kehne, D.

1997-07-01

Measurements of emittance growth in a high peak current beam as it passes through an achromatic double bend are summarized. Experiments were performed using the ATF at Brookhaven National Laboratory by X.J. Wang and D. Kehne as a collaboration resulting from the proposal attached at the end of the document. The ATF consists off an RF gun (1 MeV), two sections of linac (40-75 MeV), a diagnostic section immediately following the linac, a 20 degree bend magnet, a variable aperture slit at a high dispersion point, 5 quadrupoles, then another 20 degree bend followed by another diagnostic section. The TRANSPORT deck describing the region from the end of the linac to the end of the diagnostic line following the achromatic bends is attached to the end of this document. Printouts of the control screens are also attached

Double-peaked Emission Lines Due to a Radio Outflow in KISSR 1219

Energy Technology Data Exchange (ETDEWEB)

Kharb, P.; Vaddi, S. [National Centre for Radio Astrophysics—Tata Institute of Fundamental Research, Postbag 3, Ganeshkhind, Pune 411007 (India); Subramanian, S. [Kavli Institute for Astronomy and Astrophysics, Peking University, 5 Yiheyuan Road, Haidian District, Beijing 100871 (China); Das, M. [Indian Institute of Astrophysics, II Block, Koramangala, Bangalore 560034 (India); Paragi, Z., E-mail: kharb@ncra.tifr.res.in [Joint Institute for VLBI in Europe, Postbus 2, 7990 AA Dwingeloo (Netherlands)

2017-09-01

We present the results from 1.5 and 5 GHz phase-referenced VLBA and 1.5 GHz Karl G. Jansky Very Large Array (VLA) observations of the Seyfert 2 galaxy KISSR 1219, which exhibits double-peaked emission lines in its optical spectrum. The VLA and VLBA data reveal a one-sided core-jet structure at roughly the same position angles, providing evidence of an active galactic nucleus outflow. The absence of dual parsec-scale radio cores puts the binary black-hole picture in doubt for the case of KISSR 1219. The high brightness temperatures of the parsec-scale core and jet components (>10{sup 6} K) are consistent with this interpretation. Doppler boosting with jet speeds of ≳0.55 c to ≳0.25 c , going from parsec to kiloparsec scales, at a jet inclination ≳50° can explain the jet one-sidedness in this Seyfert 2 galaxy. A blueshifted broad emission line component in [O iii] is also indicative of an outflow in the emission line gas at a velocity of ∼350 km s{sup −1}, while the [O i] doublet lines suggest the presence of shock-heated gas. A detailed line ratio study using the MAPPINGS III code further suggests that a shock+precursor model can explain the line ionization data well. Overall, our data suggest that the radio outflow in KISSR 1219 is pushing the emission line clouds, both ahead of the jet and in a lateral direction, giving rise to the double peak emission line spectra.

Field Emitter Arrays for a Free Electron Laser Application

CERN Document Server

Shing-Bruce-Li, Kevin; Ganter, Romain; Gobrecht, Jens; Raguin, Jean Yves; Rivkin, Leonid; Wrulich, Albin F

2004-01-01

The development of a new electron gun with the lowest possible emittance would help reducing the total length and cost of a free electron laser. Field emitter arrays (FEAs) are an attractive technology for electron sources of ultra high brightness. Indeed, several thousands of microscopic tips can be deposited on a 1 mm diameter area. Electrons are then extracted by applying voltage to a first grid layer close to the tip apexes, the so called gate layer, and focused by a second grid layer one micrometer above the tips. The typical aperture diameter of the gate and the focusing layer is in the range of one micrometer. One challenge for such cathodes is to produce peak currents in the ampere range since the usual applications of FEAs require less than milliampere. Encouraging peak current performances have been obtained by applying voltage pulses at low frequency between gate and tips. In this paper we report on different tip materials available on the market: diamond FEAs from Extreme Devices Inc., ZrC single ...

Nonlinear electrostatic emittance compensation in kA, fs electron bunches

International Nuclear Information System (INIS)

Geer, S.B. van der; Loos, M.J. de; Botman, J.I.M.; Luiten, O.J.; Wiel, M.J. van der

2002-01-01

Nonlinear space-charge effects play an important role in emittance growth in the production of kA electron bunches with a bunch length much smaller than the bunch diameter. We propose a scheme employing the radial third-order component of an electrostatic acceleration field, to fully compensate the nonlinear space-charge effects. This results in minimal transverse root-mean-square emittance. The principle is demonstrated using our design simulations of a device for the production of high-quality, high-current, subpicosecond electron bunches using electrostatic acceleration in a 1 GV/m field. Simulations using the GPT code produce a bunch of 100 pC and 73 fs full width at half maximum pulse width, resulting in a peak current of about 1.2 kA at an energy of 2 MeV. The compensation scheme reduces the root-mean-square emittance by 34% to 0.4π mm mrad

Low-emittance Storage Rings

CERN Document Server

Wolski, Andrzej

2014-01-01

The effects of synchrotron radiation on particle motion in storage rings are discussed. In the absence of radiation, particle motion is symplectic, and the beam emittances are conserved. The inclusion of radiation effects in a classical approximation leads to emittance damping: expressions for the damping times are derived. Then, it is shown that quantum radiation effects lead to excitation of the beam emittances. General expressions for the equilibrium longitudinal and horizontal (natural) emittances are derived. The impact of lattice design on the natural emittance is discussed, with particular attention to the special cases of FODO-, achromat- and theoretical-minimum-emittance-style lattices. Finally, the effects of betatron coupling and vertical dispersion (generated by magnet alignment and lattice tuning errors) on the vertical emittance are considered.

Hidden gauge structure of supersymmetric free differential algebras

Energy Technology Data Exchange (ETDEWEB)

Andrianopoli, Laura [DISAT, Politecnico di Torino,Corso Duca degli Abruzzi 24, I-10129 Turin (Italy); INFN - Sezione di Torino,Torino (Italy); D’Auria, Riccardo [DISAT, Politecnico di Torino,Corso Duca degli Abruzzi 24, I-10129 Turin (Italy); Ravera, Lucrezia [DISAT, Politecnico di Torino,Corso Duca degli Abruzzi 24, I-10129 Turin (Italy); INFN - Sezione di Torino,Torino (Italy)

2016-08-16

The aim of this paper is to clarify the role of the nilpotent fermionic generator Q{sup ′} introduced in http://dx.doi.org/10.1016/0550-3213(82)90376-5 and appearing in the hidden supergroup underlying the free differential algebra (FDA) of D=11 supergravity. We give a physical explanation of its role by looking at the gauge properties of the theory. We find that its presence is necessary, in order that the extra 1-forms of the hidden supergroup give rise to the correct gauge transformations of the p-forms of the FDA. This interpretation is actually valid for any supergravity containing antisymmetric tensor fields, and any supersymmetric FDA can always be traded for a hidden Lie superalgebra containing extra fermionic nilpotent generators. As an interesting example we construct the hidden superalgebra associated with the FDA of N=2, D=7 supergravity. In this case we are able to parametrize the mutually non local 2- and 3-form B{sup (2)} and B{sup (3)} in terms of hidden 1-forms and find that supersymmetry and gauge invariance require in general the presence of two nilpotent fermionic generators in the hidden algebra. We propose that our approach, where all the invariances of the FDA are expressed as Lie derivatives of the p-forms in the hidden supergroup manifold, could be an appropriate framework to discuss theories defined in enlarged versions of superspace recently considered in the literature, such us double field theory and its generalizations.

A RADIAL VELOCITY TEST FOR SUPERMASSIVE BLACK HOLE BINARIES AS AN EXPLANATION FOR BROAD, DOUBLE-PEAKED EMISSION LINES IN ACTIVE GALACTIC NUCLEI

Energy Technology Data Exchange (ETDEWEB)

Liu, Jia; Halpern, Jules P. [Astronomy Department, Columbia University, 550 West 120th Street, New York, NY 10027 (United States); Eracleous, Michael [Department of Astronomy and Institute for Gravitation and The Cosmos, The Pennsylvania State University, 525 Davey Lab, University Park, PA 16802 (United States)

2016-01-20

One of the proposed explanations for the broad, double-peaked Balmer emission lines observed in the spectra of some active galactic nuclei (AGNs) is that they are associated with sub-parsec supermassive black hole (SMBH) binaries. Here, we test the binary broad-line region hypothesis through several decades of monitoring of the velocity structure of double-peaked Hα emission lines in 13 low-redshift, mostly radio-loud AGNs. This is a much larger set of objects compared to an earlier test by Eracleous et al. and we use much longer time series for the three objects studied in that paper. Although systematic changes in radial velocity can be traced in many of their lines, they are demonstrably not like those of a spectroscopic binary in a circular orbit. Any spectroscopic binary period must therefore be much longer than the span of the monitoring (assuming a circular orbit), which in turn would require black hole masses that exceed by 1–2 orders of magnitude the values obtained for these objects using techniques such as reverberation mapping and stellar velocity dispersion. Moreover, the response of the double-peaked Balmer line profiles to fluctuations of the ionizing continuum and the shape of the Lyα profiles are incompatible with an SMBH binary. The binary broad-line region hypothesis is therefore disfavored. Other processes evidently shape these line profiles and cause the long-term velocity variations of the double peaks.

Rare Earth Garnet Selective Emitter

Science.gov (United States)

Lowe, Roland A.; Chubb, Donald L.; Farmer, Serene C.; Good, Brian S.

1994-01-01

Thin film Ho-YAG and Er-YAG emitters with a platinum substrate exhibit high spectral emittance in the emission band (epsilon(sub lambda) approx. = 0.75, sup 4)|(sub 15/2) - (sup 4)|(sub 13/2),for Er-YAG and epsilon(sub lambda) approx. = 0.65, (sup 5)|(sub 7) - (sup 5)|(sub 8) for Ho-YAG) at 1500 K. In addition, low out-of-band spectral emittance, epsilon(sub lambda) less than 0.2, suggest these materials would be excellent candidates for high efficiency selective emitters in thermophotovoltaic (TPV) systems operating at moderate temperatures (1200-1500 K). Spectral emittance measurements of the thin films were made (1.2 less than lambda less than 3.0 microns) and compared to the theoretical emittances calculated using measured values of the spectral extinction coefficient. In this paper we present the results for a new class of rare earth ion selective emitters. These emitters are thin sections (less than 1 mm) of yttrium aluminum garnet (YAG) single crystal with a rare earth substitutional impurity. Selective emitters in the near IR are of special interest for thermophotovoltaic (TPV) energy conversion. The most promising solid selective emitters for use in a TPV system are rare earth oxides. Early spectral emittance work on rare earth oxides showed strong emission bands in the infrared (0.9 - 3 microns). However, the emittance outside the emission band was also significant and the efficiency of these emitters was low. Recent improvements in efficiency have been made with emitters fabricated from fine (5 - 10 microns) rare earth oxide fibers similar to the Welsbach mantle used in gas lanterns. However, the rare earth garnet emitters are more rugged than the mantle type emitters. A thin film selective emitter on a low emissivity substrate such as gold, platinum etc., is rugged and easily adapted to a wide variety of thermal sources. The garnet structure and its many subgroups have been successfully used as hosts for rare earth ions, introduced as substitutional

The emittance of high current heavy ion beams

International Nuclear Information System (INIS)

White, N.R.; Devaney, A.S.

1989-01-01

Ion implantation is the main application for high current heavy ion beams. Transfer ratio is defined as the ratio of the total ion current leaving the ion source to the current delivered to the endstation. This ratio is monitored and logged and its importance is explained. It is also affected by other factors, such as the isotopic and molecular composition of the total ion beam. The transfer ratio reveals the fraction of ions which are intercepted by parts of the beamline system. The effects of these ions are discussed in two categories: processing purity and reliability. In discussing the emittance of ribbon beams, the two orthogonal planes are usually considered separately. Longitudinal emittance is determined by slot length and by plasma ion temperature. It has already been revealed that the longitudinal divergence of the beams from BF3 is perhaps double that of the beam from arsenic vapour or argon, at the same total perveance from the ion source. This poses the question: why is the ion temperature higher for BF3 than for As or Ar? The transverse emittance is in practical terms dominated by the divergence. It is the most fruitful area for improvement in most real-world systems. There is an intrinsic divergence arising from initial ion energies within the plasma, and there is emittance growth that can occur as a result of aberration in the beam extraction optics. (N.K.)

Analysis of collector-emitter offset voltage of InGaP/GaAs composite collector double heterojunction bipolar transistor

Science.gov (United States)

Lew, K. L.; Yoon, S. F.

2002-04-01

The Ebers-Moll-like terminal current expressions of a composite collector double heterojunction bipolar transistor (DHBT), which takes the recombination effect into account, have been formulated and an expression for collector-emitter offset voltage [VCE(offset)] has been derived. Factors affecting the VCE(offset) of a composite collector DHBT are investigated and good agreement between the calculated and reported experimental results is shown. Analytical results showed that the transmission coefficient of the base-collector (B-C) junction does not have a considerable effect on the VCE(offset), provided that the B-C junction is of good quality. Thus, despite its asymmetric structure, the VCE(offset) of an optimally designed composite collector DHBT could be as low as that of a conventional DHBT. Hence a composite collector DHBT with low saturation voltage and negligible VCE(offset) is possible if the two conditions: (i) good quality B-C junction, (ii) base transport factor, α≈1, are fulfilled.

A background free double beta decay experiment

International Nuclear Information System (INIS)

Giomataris, I

2011-01-01

We present a new detection scheme for rejecting backgrounds in neutrino-less double beta decay experiments. It relies on the detection of Cherenkov light emitted by electrons in the MeV region. The momentum threshold is tuned to reach a good discrimination between background and good events. We consider many detector concepts and a range of target materials. The most promising is the high-pressure 136 Xe emitter where the required energy threshold is easily adjusted. Combination of this concept and a high pressure Time Projection Chamber could provide an optimal solution. A simple and low cost effective solution is the use of the Spherical Proportional Counter that provides, using a single read-out channel, two delayed signals from ionization and Cherenkov light. In solid-state double beta decay emitters, because of its higher density, the considered process is out of energy range. An escape will be the fabrication of double decay emitters having lower density by using for instance the aerogel technique. It is surprising that a technology used for particle identification in high-energy physics becomes a powerful tool for rejecting backgrounds in such low-energy experiments.

High-Average, High-Peak Current Injector Design

CERN Document Server

Biedron, S G; Virgo, M

2005-01-01

There is increasing interest in high-average-power (>100 kW), um-range FELs. These machines require high peak current (~1 kA), modest transverse emittance, and beam energies of ~100 MeV. High average currents (~1 A) place additional constraints on the design of the injector. We present a design for an injector intended to produce the required peak currents at the injector, eliminating the need for magnetic compression within the linac. This reduces the potential for beam quality degradation due to CSR and space charge effects within magnetic chicanes.

Research on Double Price Regulations and Peak Shaving Reserve Mechanism in Coal-Electricity Supply Chain

Directory of Open Access Journals (Sweden)

Hongjun Peng

2013-01-01

Full Text Available The game models were used to study the mechanism of coal-electricity price conflict under conditions of double price regulations of coal and electricity. Based on this, the peak shaving reserve mechanism was designed to probe into the countermeasures against the coal-electricity price conflicts. The study revealed that in the boom seasons of coal demand, the initiatives of the coal enterprises to supply thermal coal and the electricity enterprises to order thermal coal are reduced under conditions of double price regulations. However, under the circumstances of coal price marketization, in the boom seasons of coal demand the thermal coal price may go up obviously, the initiatives of the coal enterprises to supply thermal coal are increased, and meanwhile the initiatives of the power enterprises to order thermal coal are decreased dramatically. The transportation capacity constraint of coal supply leads to the evident decrease of the initiatives of coal enterprises for the thermal coal supply. The mechanism of peak shaving reserve of thermal coal may not only reduce the price of coal market but also increase the enthusiasm of the power enterprises to order more thermal coal and the initiatives of the coal enterprises to supply more thermal coal.

The origin of double peak electric field distribution in heavily irradiated silicon detectors

CERN Document Server

Eremin, V; Li, Z

2002-01-01

The first observation of double peak (DP) electric field distribution in heavily neutron irradiated (>10 sup 1 sup 4 n/cm sup 2) semiconductor detectors has been published about 6 yr ago. However, this effect was not quantitatively analyzed up to now. The explanation of the DP electric field distribution presented in this paper is based on the properties of radiation induced deep levels in silicon, which act as deep traps, and on the distribution of the thermally generated free carrier concentration in the detector bulk. In the frame of this model, the earlier published considerations on the so-called 'double junction (DJ) effect' are discussed as well. The comparison of the calculated electric field profiles at different temperatures with the experimental ones allows one to determine a set of deep levels. This set of deep levels, and their charge filling status are essential to the value and the distribution of space charge in the space charge region in the range of 305-240 K, which is actual temperature ran...

Modeling and optimization of a double-well double-barrier GaN/AlGaN/GaN/AlGaN resonant tunneling diode

Science.gov (United States)

Liu, Yang; Gao, Bo; Gong, Min; Shi, Ruiying

2017-06-01

The influence of a GaN layer as a sub-quantum well for an AlGaN/GaN/AlGaN double barrier resonant tunneling diode (RTD) on device performance has been investigated by means of numerical simulation. The introduction of the GaN layer as the sub-quantum well turns the dominant transport mechanism of RTD from the 3D-2D model to the 2D-2D model and increases the energy difference between tunneling energy levels. It can also lower the effective height of the emitter barrier. Consequently, the peak current and peak-to-valley current difference of RTD have been increased. The optimal GaN sub-quantum well parameters are found through analyzing the electrical performance, energy band, and transmission coefficient of RTD with different widths and depths of the GaN sub-quantum well. The most pronounced electrical parameters, a peak current density of 5800 KA/cm2, a peak-to-valley current difference of 1.466 A, and a peak-to-valley current ratio of 6.35, could be achieved by designing RTD with the active region structure of GaN/Al0.2Ga0.8 N/GaN/Al0.2Ga0.8 N (3 nm/1.5 nm/1.5 nm/1.5 nm).

PTF11mnb: First analog of supernova 2005bf. Long-rising, double-peaked supernova Ic from a massive progenitor

Science.gov (United States)

Taddia, F.; Sollerman, J.; Fremling, C.; Karamehmetoglu, E.; Quimby, R. M.; Gal-Yam, A.; Yaron, O.; Kasliwal, M. M.; Kulkarni, S. R.; Nugent, P. E.; Smadja, G.; Tao, C.

2018-01-01

Aims: We study PTF11mnb, a He-poor supernova (SN) whose light curves resemble those of SN 2005bf, a peculiar double-peaked stripped-envelope (SE) SN, until the declining phase after the main peak. We investigate the mechanism powering its light curve and the nature of its progenitor star. Methods: Optical photometry and spectroscopy of PTF11mnb are presented. We compared light curves, colors and spectral properties to those of SN 2005bf and normal SE SNe. We built a bolometric light curve and modeled this light curve with the SuperNova Explosion Code (SNEC) hydrodynamical code explosion of a MESA progenitor star and semi-analytic models. Results: The light curve of PTF11mnb turns out to be similar to that of SN 2005bf until 50 d when the main (secondary) peaks occur at -18.5 mag. The early peak occurs at 20 d and is about 1.0 mag fainter. After the main peak, the decline rate of PTF11mnb is remarkably slower than what was observed in SN 2005bf, and it traces well the 56Co decay rate. The spectra of PTF11mnb reveal a SN Ic and have no traces of He unlike in the case of SN Ib 2005bf, although they have velocities comparable to those of SN 2005bf. The whole evolution of the bolometric light curve is well reproduced by the explosion of a massive (Mej = 7.8 M⊙), He-poor star characterized by a double-peaked 56Ni distribution, a total 56Ni mass of 0.59 M⊙, and an explosion energy of 2.2 × 1051 erg. Alternatively, a normal SN Ib/c explosion (M(56Ni) = 0.11 M⊙, EK = 0.2 × 1051 erg, Mej = 1 M⊙) can power the first peak while a magnetar, with a magnetic field characterized by B = 5.0 × 1014 G, and a rotation period of P = 18.1 ms, provides energy for the main peak. The early g-band light curve can be fit with a shock-breakout cooling tail or an extended envelope model from which a radius of at least 30 R⊙ is obtained. Conclusions: We presented a scenario where PTF11mnb was the explosion of a massive, He-poor star, characterized by a double-peaked 56Ni

Shielding in ungated field emitter arrays

Energy Technology Data Exchange (ETDEWEB)

Harris, J. R. [U.S. Navy Reserve, Navy Operational Support Center New Orleans, New Orleans, Louisiana 70143 (United States); Jensen, K. L. [Code 6854, Naval Research Laboratory, Washington, D.C. 20375 (United States); Shiffler, D. A. [Directed Energy Directorate, Air Force Research Laboratory, Albuquerque, New Mexico 87117 (United States); Petillo, J. J. [Leidos, Billerica, Massachusetts 01821 (United States)

2015-05-18

Cathodes consisting of arrays of high aspect ratio field emitters are of great interest as sources of electron beams for vacuum electronic devices. The desire for high currents and current densities drives the cathode designer towards a denser array, but for ungated emitters, denser arrays also lead to increased shielding, in which the field enhancement factor β of each emitter is reduced due to the presence of the other emitters in the array. To facilitate the study of these arrays, we have developed a method for modeling high aspect ratio emitters using tapered dipole line charges. This method can be used to investigate proximity effects from similar emitters an arbitrary distance away and is much less computationally demanding than competing simulation approaches. Here, we introduce this method and use it to study shielding as a function of array geometry. Emitters with aspect ratios of 10{sup 2}–10{sup 4} are modeled, and the shielding-induced reduction in β is considered as a function of tip-to-tip spacing for emitter pairs and for large arrays with triangular and square unit cells. Shielding is found to be negligible when the emitter spacing is greater than the emitter height for the two-emitter array, or about 2.5 times the emitter height in the large arrays, in agreement with previously published results. Because the onset of shielding occurs at virtually the same emitter spacing in the square and triangular arrays, the triangular array is preferred for its higher emitter density at a given emitter spacing. The primary contribution to shielding in large arrays is found to come from emitters within a distance of three times the unit cell spacing for both square and triangular arrays.

Hidden Liquidity

OpenAIRE

Cebiroglu, Gökhan; Horst, Ulrich

2012-01-01

We cross-sectionally analyze the presence of aggregated hidden depth and trade volume in the S&P 500 and identify its key determinants. We find that the spread is the main predictor for a stock’s hidden dimension, both in terms of traded and posted liquidity. Our findings moreover suggest that large hidden orders are associated with larger transaction costs, higher price impact and increased volatility. In particular, as large hidden orders fail to attract (latent) liquidity to the market, hi...

Loss of Landau Damping for Inductive Impedance in a Double RF System

CERN Document Server

Argyropoulos, T; Burov, A

2013-01-01

In this paper the thresholds of the loss of Landau damping due to the presence of inductive impedance in a single and double harmonic RF systems are determined, both from calculations and particle simulations. A high harmonic RF system, operating in bunch lengthening mode is used in many accelerators with space charge or inductive impedance to reduce the peak line density or stabilize the beam. An analytical approach, based on emerging of the discrete Van Kampen modes, shows that improved stability in a double RF system can be achieved only below some critical value of longitudinal emittance. Above this threshold, a phase shift of more than 15 degrees between the two RF components is proven necessary to stabilize the bunch. These results, confirmed also by particle simulations, now are able to explain observations during the pp operation of the SPS. The thresholds in bunch shortening mode as well as in a single RF case are compared with this regime.

A high-DC-voltage GaAs photoemission gun: Transverse emittance and momentum spread measurements

International Nuclear Information System (INIS)

Engwall, D.; Bohn, C.; Cardman, L.

1997-01-01

We have built a high-DC-voltage photoemission gun and a diagnostic beamline permitting us to measure rms transverse emittance (ε x ) and rms momentum spread (δ) of short-duration electron pulses produced by illuminating the cathode with light from a mode-locked, frequency-doubled Nd:YLF laser. The electron gun is a GaAs photocathode source designed to operate at 500kV. We have measured ε x and δ for conditions ranging from emittance-dominated to space-charge-dominated. We report these measurements as functions of microbunch charge for different beam radii, pulse lengths, and voltages/field gradients at the cathode, and compare them with PARMELA calculations

Mechanism of Pseudogap Detected by Electronic Raman Scattering: Phase Fluctuation or Hidden Order?

International Nuclear Information System (INIS)

Hong-Yan, Lu; Yuan, Wan; Xiang-Mei, He; Qiang-Hua, Wang

2009-01-01

We study the electronic Raman scattering in the cuprates to distinguish the two possible scenarios of the pseudo-gap normal state. In one scenario, the pseudogap is assumed to be caused by phase fluctuations of the preformed Cooper pairs. We find that pair-breaking peaks appear in both the B 1g and B 2g Raman channels, and they are smeared and tend to shift to the same energy with the increasing strength of phase fluctuations. Thus both channels reflect the same pairing energy scale, irrespectively of the doping level. In another scenario, the pseudogap is assumed to be caused by a hidden order that competes with the superconducting order. As an example, we assume that the hidden order is the d-density-wave (DDW) order. We find analytically and numerically that in the DDW normal state there is no Raman peak in the B 2g channel in a tight-binding model up to the second nearest-neighbor hopping, while the Raman peak in the B 1g channel reflects the energy gap caused by the DDW order. This behavior is in agreement with experiments in the pseudogap normal state. To gain further insights, we also calculate the Raman spectra in the DDW+SC state. We study the doping and temperature dependence of the peak energy in both channels and find a two-gap behavior, which is in agreement with recent Raman experiments. Therefore, our results shed light on the hidden order scenario for the pseudogap

Monolithic multinozzle emitters for nanoelectrospray mass spectrometry

Science.gov (United States)

Wang, Daojing [Daly City, CA; Yang, Peidong [Kensington, CA; Kim, Woong [Seoul, KR; Fan, Rong [Pasadena, CA

2011-09-20

Novel and significantly simplified procedures for fabrication of fully integrated nanoelectrospray emitters have been described. For nanofabricated monolithic multinozzle emitters (NM.sup.2 emitters), a bottom up approach using silicon nanowires on a silicon sliver is used. For microfabricated monolithic multinozzle emitters (M.sup.3 emitters), a top down approach using MEMS techniques on silicon wafers is used. The emitters have performance comparable to that of commercially-available silica capillary emitters for nanoelectrospray mass spectrometry.

Overview of laserwire beam profile and emittance measurements for high power proton accelerators

CERN Document Server

Gibson, S M; Bosco, A; Gabor, C; Pozimski, J; Savage, P; Hofmann, T

2013-01-01

Laserwires were originally developed to measure micron-sized electron beams via Compton scattering, where traditional wire scanners are at the limit of their resolution. Laserwires have since been applied to larger beamsize, high power H$^-$ ion beams, where the non-invasive method can probe beam densities that would damage traditional diagnostics. While photo-detachment of H$^-$ ions is now routine to measure beam profiles, extending the technique to transverse and longitudinal emittance measurements is a key aim of the laserwire emittance scanner under construction at the Front End Test Stand (FETS) at the RAL. A pulsed, 30 kHz, 8kW peak power laser is fibrecoupled to motorized collimating optics, which controls the position and thickness of the laserwire delivered to the H- interaction chamber. The laserwire slices out a beamlet of neutralized particles, which propagate to a downstream scintillator and camera. The emittance is reconstructed from 2D images as the laserwire position is scanned. Results from ...

Study of the time and space distribution of β+ emitters from 80MeV/u carbon ion beam irradiation on PMMA

International Nuclear Information System (INIS)

Agodi, C.; Bellini, F.; Cirrone, G.A.P.; Collamati, F.; Cuttone, G.; De Lucia, E.; De Napoli, M.; Di Domenico, A.; Faccini, R.; Ferroni, F.; Fiore, S.; Gauzzi, P.; Iarocci, E.; Marafini, M.; Mattei, I.; Paoloni, A.

2012-01-01

Proton and carbon ion therapy is an emerging technique used for the treatment of solid cancers. The monitoring of the dose delivered during such treatments and the on-line knowledge of the Bragg peak position is still a matter of research. A possible technique exploits the collinear 511keV photons produced by positrons annihilation from β + emitters created by the beam. This paper reports rate measurements of the 511keV photons emitted after the interactions of a 80MeV/u fully stripped carbon ion beam at the Laboratori Nazionali del Sud (LNS) of INFN, with a poly-methyl methacrylate target. The time evolution of the β + rate was parametrized and the dominance of 11 C emitters over the other species ( 13 N, 15 O, 14 O) was observed, measuring the fraction of carbon ions activating β + emitters to be (10.3±0.7)×10 -3 . The average depth in the PMMA of the positron annihilation from β + emitters was also measured, D β + =5.3±1.1mm, to be compared to the expected Bragg peak depth D Bragg =11.0±0.5mm obtained from simulations.

FACET Emittance Growth

Energy Technology Data Exchange (ETDEWEB)

Frederico, J; Hogan, M.J.; Nosochkov, Y.; Litos, M.D.; Raubenheimer, T.; /SLAC

2011-04-05

FACET, the Facility for Advanced Accelerator and Experimental Tests, is a new facility being constructed in sector 20 of the SLAC linac primarily to study beam driven plasma wakefield acceleration. The FACET beamline consists of a chicane and final focus system to compress the 23 GeV, 3.2 nC electron bunches to {approx}20 {micro}m long and {approx}10 {micro}m wide. Simulations of the FACET beamline indicate the short-duration and large, 1.5% rms energy spread beams may suffer a factor of four emittance growth from a combination of chromaticity, incoherent synchrotron radiation (ISR), and coherent synchrotron radiation (CSR). Emittance growth is directly correlated to head erosion in plasma wakefield acceleration and is a limiting factor in single stage performance. Studies of the geometric, CSR, and ISR components are presented. Numerical calculation of the rms emittance can be overwhelmed by long tails in the simulated phase space distributions; more useful definitions of emittance are given. A complete simulation of the beamline is presented as well, which agrees with design specifications.

FACET Emittance Growth

International Nuclear Information System (INIS)

Frederico, Joel

2011-01-01

FACET, the Facility for Advanced Accelerator and Experimental Tests, is a new facility being constructed in sector 20 of the SLAC linac primarily to study beam driven plasma wakefield acceleration. The FACET beamline consists of a chicane and final focus system to compress the 23 GeV, 3.2 nC electron bunches to ∼20 (micro)m long and ∼10 (micro)m wide. Simulations of the FACET beamline indicate the short-duration and large, 1.5% rms energy spread beams may suffer a factor of four emittance growth from a combination of chromaticity, incoherent synchrotron radiation (ISR), and coherent synchrotron radiation (CSR). Emittance growth is directly correlated to head erosion in plasma wakefield acceleration and is a limiting factor in single stage performance. Studies of the geometric, CSR, and ISR components are presented. Numerical calculation of the rms emittance can be overwhelmed by long tails in the simulated phase space distributions; more useful definitions of emittance are given. A complete simulation of the beamline is presented as well, which agrees with design specifications.

The relation of double peaks, observed in quartz hydride atomizers, to the fate of free analyte atoms in the determination of arsenic and selenium by atomic absorption spectrometry

International Nuclear Information System (INIS)

D'Ulivo, Alessandro; Dedina, Jiri

2002-01-01

The mechanism at the origin of double peaks formation in quartz hydride atomizers were investigated by continuous flow hydride generation atomic absorption spectrometry. Arsenic and selenium were used as model analytes. The effect of atomization mode (flame-in-gas-shield (FIGS), miniature diffusion flame and double flame (DF)) and some experimental parameters as oxygen supply rate for microflame and the distance from atomization to free atoms detection point, were investigated on the shape of both analytical signals and calibration graphs. Rollover of calibration graphs and double peak formation are strictly related each to the other and could be observed only in FIGS atomizer mode under some particular conditions. A mechanism based on incomplete atomization of hydrides cannot explain the collected experimental evidences because the microflame of FIGS is able to produce quantitative atomization of large amount of hydrides even at supply rate of oxygen close to extinction threshold of microflame. The heterogeneous gas-solid reactions between finely dispersed particles, formed by free atom recombination, and the free atoms in the gaseous phase are at the origin of double peak formation

Proposal for a race-track microtron with high peak current

NARCIS (Netherlands)

Ernst, G.J.; Haselhoff, E.H.; Witteman, W.J.; Botman, J.I.M.; van Genderen, W.; Hagedoorn, H.L.; van der Heide, J.A.; Kleeven, W.J.G.M.

1989-01-01

In order to obtain high gain in a free electron laser a high-quality electron beam with high peak current is required. It is well-known that a microtron is able to produce a high-quality beam having low emittance and small energy spread (1%). Because a circular microtron has a limited high-current

Facility Location with Double-peaked Preferences

DEFF Research Database (Denmark)

Filos-Ratsikas, Aris; Li, Minming; Zhang, Jie

2015-01-01

; this makes the problem essentially more challenging. As our main contribution, we present a simple truthful-in-expectation mechanism that achieves an approximation ratio of 1+b=c for both the social and the maximum, cost, where b is the distance of the agent from the peak and c is the minimum cost...

Calculation of the detection limits for radionuclides identified in gamma-ray spectra based on post-processing peak analysis results.

Science.gov (United States)

Korun, M; Vodenik, B; Zorko, B

2018-03-01

A new method for calculating the detection limits of gamma-ray spectrometry measurements is presented. The method is applicable for gamma-ray emitters, irrespective of the influences of the peaked background, the origin of the background and the overlap with other peaks. It offers the opportunity for multi-gamma-ray emitters to calculate the common detection limit, corresponding to more peaks. The detection limit is calculated by approximating the dependence of the uncertainty in the indication on its value with a second-order polynomial. In this approach the relation between the input quantities and the detection limit are described by an explicit expression and can be easy investigated. The detection limit is calculated from the data usually provided by the reports of peak-analyzing programs: the peak areas and their uncertainties. As a result, the need to use individual channel contents for calculating the detection limit is bypassed. Copyright © 2017 Elsevier Ltd. All rights reserved.

Transverse emittance-preserving arc compressor for high-brightness electron beam-based light sources and colliders

Science.gov (United States)

Di Mitri, S.; Cornacchia, M.

2015-03-01

Bunch length magnetic compression is used in high-brightness linacs driving free-electron lasers (FELs) and particle colliders to increase the peak current of the injected beam. To date, it is performed in dedicated insertions made of few degrees bending magnets and the compression factor is limited by the degradation of the beam transverse emittance owing to emission of coherent synchrotron radiation (CSR). We reformulate the known concept of CSR-driven optics balance for the general case of varying bunch length and demonstrate, through analytical and numerical results, that a 500 pC charge beam can be time-compressed in a periodic 180 deg arc at 2.4 GeV beam energy and lower, by a factor of up to 45, reaching peak currents of up to 2 kA and with a normalized emittance growth at the 0.1 μ \\text{m} rad level. The proposed solution offers new schemes of beam longitudinal gymnastics; an application to an energy recovery linac driving FEL is discussed.

Low emittance photoinjectors

International Nuclear Information System (INIS)

Ferrario, Massimo

2001-01-01

Photon colliders require high charge polarized electron beams with very low normalized emittances, possibly lower than the actual damping rings design goals. Recent analytical and numerical efforts in understanding beam dynamics in RF photoinjectors have raised again the question as to whether the performances of an RF electron gun based injector could be competitive with respect to a damping ring. As a matter of discussion we report in this paper the most recent results concerning low emittance photoinjector designs: the production of polarized electron beams by DC and/or RF guns is illustrated together with space charge compensation techniques and thermal emittance effects. New ideas concerning multi-gun injection system and generation of flat beams by RF gun are also discussed

An asymmetric emittance electron source for the GALAXIE dielectric-laser accelerator injector

Energy Technology Data Exchange (ETDEWEB)

Valloni, A.; Cahill, A.; Fukusawa, A.; Musumeci, P.; Spataro, B.; Yakub, A.; Rosenzweig, J. B. [Dept. of Physics and Astronomy, University of California, Los Angeles, 405 Hilgard Ave., Los Angeles, CA 90034 (United States); Accelerator Division, Laboratori Nazionali di Frascati (INFN-LNF), Via E. Fermi 40, Frascati (RM) 00044 (Italy); Dept. of Physics and Astronomy, University of California, Los Angeles, 405 Hilgard Ave., Los Angeles, CA 90034 (United States)

2012-12-21

The GALAXIE project is a program to develop an all-optical, very high field accelerator and undulator integrated SASE FEL system based on dielectric laser-excited structures that support >GV/m fields. These structures are very wide in one direction to allow adequate charge given beam loading considerations, but also having small (subwavelength) apertures in the narrow direction. Such small vertical dimensions yield strict restrictions on the emittance in this direction, while no such constraint exists in the wide transverse direction. However, the overall beam brightness is restricted by the performance requirements on the FEL. To meet these demands, we are studying a very high field gun with a magnetized cathode, yielding a beam with angular momentum content. This beam is then subject to a skew-quad triplet that splits the emittances; this process is reversed to give a round beam after acceleration. This symmetric emittance beam avoids gain-degrading multiple-transverse-mode operation of the FEL, which also demands that the effects of the angular momentum in the beam be mitigated. In this paper we discuss the RF design of an X-band gun to be operated at {approx}200 MV/m peak field giving a 1 pC magnetized beam with unprecedented brightness. We examine the design of the focusing and skew-quad systems, investigating the associated beam dynamics and efficacy of emittance splitting.

A Design Report of the Baseline for PEP-X: an Ultra-Low Emittance Storage Ring

Energy Technology Data Exchange (ETDEWEB)

Bane, Karl; Bertsche, Kirk; Cai, Yunhai; Chao, Alex; Corbett, Willian; Fox, John; Hettel, Robert; Huang, Xiaobiao; Huang, Zhirong; Ng, Cho-Kuen; Nosochkov, Yuri; Novokhatski, Sasha; Radedeau, Thomas; Raubenheimer, Tor; Rivetta, Claudio; Safranek, James; Seeman, John; Stohr, Joachim; Stupakov, Gennady; Wang, Lanfa; Wang, Min-Huey; /SLAC

2010-06-02

Over the past year, we have worked out a baseline design for PEP-X, as an ultra-low emittance storage ring that could reside in the existing 2.2-km PEPII tunnel. The design features a hybrid lattice with double bend achromat (DBA) cells in two arcs and theoretical minimum emittance (TME) cells in the remaining four arcs. Damping wigglers are used to reduce the horizontal emittance to 86 pm-rad at zero current for a 4.5 GeV electron beam. At a design current of 1.5 A, the horizontal emittance increases, due to intrabeam scattering, to 164 pm-rad when the vertical emittance is maintained at a diffraction limited 8 pm-rad. The baseline design will produce photon beams achieving a brightness of 10{sup 22} (ph/s/mm{sup 2}/mrad{sup 2}/0.1% BW) at 10 keV in a 3.5-m conventional planar undulator. Our study shows that an optimized lattice has adequate dynamic aperture, while accommodating a conventional off-axis injection system. In this report, we present the results of study, including the lattice properties, nonlinear dynamics, intra-beam scattering and Touschek lifetime, RF system, and collective instabilities. Finally, we discuss the possibility of partial lasing at soft X-ray wavelengths using a long undulator in a straight section.

Sociology of Hidden Curriculum

Directory of Open Access Journals (Sweden)

Alireza Moradi

2017-06-01

Full Text Available This paper reviews the concept of hidden curriculum in the sociological theories and wants to explain sociological aspects of formation of hidden curriculum. The main question concentrates on the theoretical approaches in which hidden curriculum is explained sociologically.For this purpose it was applied qualitative research methodology. The relevant data include various sociological concepts and theories of hidden curriculum collected by the documentary method. The study showed a set of rules, procedures, relationships and social structure of education have decisive role in the formation of hidden curriculum. A hidden curriculum reinforces by existed inequalities among learners (based on their social classes or statues. There is, in fact, a balance between the learner's "knowledge receptions" with their "inequality proportion".The hidden curriculum studies from different major sociological theories such as Functionalism, Marxism and critical theory, Symbolic internationalism and Feminism. According to the functionalist perspective a hidden curriculum has a social function because it transmits social values. Marxists and critical thinkers correlate between hidden curriculum and the totality of social structure. They depicts that curriculum prepares learners for the exploitation in the work markets. Symbolic internationalism rejects absolute hegemony of hidden curriculum on education and looks to the socialization as a result of interaction between learner and instructor. Feminism theory also considers hidden curriculum as a vehicle which legitimates gender stereotypes.

Hidden measurements, hidden variables and the volume representation of transition probabilities

OpenAIRE

Oliynyk, Todd A.

2005-01-01

We construct, for any finite dimension $n$, a new hidden measurement model for quantum mechanics based on representing quantum transition probabilities by the volume of regions in projective Hilbert space. For $n=2$ our model is equivalent to the Aerts sphere model and serves as a generalization of it for dimensions $n \\geq 3$. We also show how to construct a hidden variables scheme based on hidden measurements and we discuss how joint distributions arise in our hidden variables scheme and th...

High brightness fiber laser pump sources based on single emitters and multiple single emitters

Science.gov (United States)

Scheller, Torsten; Wagner, Lars; Wolf, Jürgen; Bonati, Guido; Dörfel, Falk; Gabler, Thomas

2008-02-01

Driven by the potential of the fiber laser market, the development of high brightness pump sources has been pushed during the last years. The main approaches to reach the targets of this market had been the direct coupling of single emitters (SE) on the one hand and the beam shaping of bars and stacks on the other hand, which often causes higher cost per watt. Meanwhile the power of single emitters with 100μm emitter size for direct coupling increased dramatically, which also pushed a new generation of wide stripe emitters or multi emitters (ME) of up to 1000μm emitter size respectively "minibars" with apertures of 3 to 5mm. The advantage of this emitter type compared to traditional bars is it's scalability to power levels of 40W to 60W combined with a small aperture which gives advantages when coupling into a fiber. We show concepts using this multiple single emitters for fiber coupled systems of 25W up to 40W out of a 100μm fiber NA 0.22 with a reasonable optical efficiency. Taking into account a further efficiency optimization and an increase in power of these devices in the near future, the EUR/W ratio pushed by the fiber laser manufacturer will further decrease. Results will be shown as well for higher power pump sources. Additional state of the art tapered fiber bundles for photonic crystal fibers are used to combine 7 (19) pump sources to output powers of 100W (370W) out of a 130μm (250μm) fiber NA 0.6 with nominal 20W per port. Improving those TFB's in the near future and utilizing 40W per pump leg, an output power of even 750W out of 250μm fiber NA 0.6 will be possible. Combined Counter- and Co-Propagated pumping of the fiber will then lead to the first 1kW fiber laser oscillator.

Hybrid white organic light-emitting devices based on phosphorescent iridium–benzotriazole orange–red and fluorescent blue emitters

International Nuclear Information System (INIS)

Xia, Zhen-Yuan; Su, Jian-Hua; Chang, Chi-Sheng; Chen, Chin H.

2013-01-01

We demonstrate that high color purity or efficiency hybrid white organic light-emitting devices (OLEDs) can be generated by integrating a phosphorescent orange–red emitter, bis[4-(2H-benzotriazol-2-yl)-N,N-diphenyl-aniline-N 1 ,C 3 ] iridium acetylacetonate, Ir(TBT) 2 (acac) with fluorescent blue emitters in two different emissive layers. The device based on deep blue fluorescent material diphenyl-[4-(2-[1,1′;4′,1″]terphenyl-4-yl-vinyl)-phenyl]-amine BpSAB and Ir(TBT) 2 (acac) shows pure white color with the Commission Internationale de L'Eclairage (CIE) coordinates of (0.33,0.30). When using sky-blue fluorescent dopant N,N′-(4,4′-(1E,1′E)-2,2′-(1,4-phenylene)bis(ethene-2,1-diyl) bis(4,1-phenylene))bis(2-ethyl-6-methyl-N-phenylaniline) (BUBD-1) and orange–red phosphor with a color-tuning phosphorescent material fac-tris(2-phenylpyridine) iridium (Ir(ppy) 3 ), it exhibits peak luminance yield and power efficiency of 17.4 cd/A and 10.7 lm/W, respectively with yellow-white color and CIE color rendering index (CRI) value of 73. - Highlights: ► An iridium-based orange–red phosphor Ir(TBT) 2 (acac) was applied in hybrid white OLEDs. ► Duel- and tri-emitter WOLEDs were achieved with either high color purity or efficiency performance. ► Peak luminance yield of tri-emitter WOLEDs was 17.4 cd/A with yellow-white color and color rendering index (CRI) value of 73.

International Standardization of Pure Beta Emitters

International Nuclear Information System (INIS)

Los Arcos, Jose Maria; Rodriguez, Leonor

2006-01-01

The paper describes the traditional methods of standardization of Pure Beta Emitters, their principal characteristics, advantage and drawbacks. It does comparisons between two metrological LSC methods: Triple to double coincidence ratio (TDCR) method and the CIEMAT/NIST method and presents the result obtained with several Key Comparisons serving as practical test of both methods. Both of them represent the siferrit of methods of standardization of pure (and mixed decay) radionuclides. ESIR WG of CCRI(II) is to implement a reference exchange system for the permanent equivalence of β, α and electron capture nuclides, similar to traditional SIR gamma. ESIR project is currently testing a new XAN scintillator and operational tests of the whole system at BIPM are expected by the end of 2006 (test restricted to ESIR NMI members)

Low emittance electron storage rings

Science.gov (United States)

Levichev, E. B.

2018-01-01

Low-emittance electron (positron) beams are essential for synchrotron light sources, linear collider damping rings, and circular Crab Waist colliders. In this review, the principles and methods of emittance minimization are discussed, prospects for developing relativistic electron storage rings with small beam phase volume are assessed, and problems related to emittance minimization are examined together with their possible solutions. The special features and engineering implementation aspects of various facilities are briefly reviewed.

Development of a Laser-based Emittance Monitor for Negative Hydrogen Beams

CERN Document Server

AUTHOR|(CDS)2078368; Schmauss, Bernhard; Gibson, Stephen; Boorman, Gary; Bosco, Alessio

High energy particle accelerators are designed to collide charged particle beams and thus study the collision products. Maximising the collision rate, to generate sufficient statistics for precise measurements of rare processes, is one of the key parameters for optimising the overall collider performance. The CERN Large Hadron Collider (LHC) Injectors Upgrade (LIU) includes the construction of LINAC4, a completely new machine working as a first linear acceleration stage for the LHC beam. By accelerating a negative hydrogen beam (H-) instead of protons, it aims to double the beam brightness via a more efficient transfer to the first circular accelerator and subsequently boost the LHC collision rate. To achieve this, a precise knowledge of the transverse beam characteristics in terms of beam emittance is essential. This thesis work covers the development of a laser-based monitor meant to measure non-destructively the LINAC4 beam transverse profile and emittance. This included the implementation of dif...

Study of the time and space distribution of {beta}{sup +} emitters from 80MeV/u carbon ion beam irradiation on PMMA

Energy Technology Data Exchange (ETDEWEB)

Agodi, C. [Laboratori Nazionali del Sud dell' INFN, Catania (Italy); Bellini, F. [Dipartimento di Fisica, Sapienza Universita di Roma, Roma (Italy); INFN Sezione di Roma, Roma (Italy); Cirrone, G.A.P. [Laboratori Nazionali del Sud dell' INFN, Catania (Italy); Collamati, F. [Dipartimento di Fisica, Sapienza Universita di Roma, Roma (Italy); INFN Sezione di Roma, Roma (Italy); Cuttone, G. [Laboratori Nazionali del Sud dell' INFN, Catania (Italy); De Lucia, E. [Laboratori Nazionali di Frascati dell' INFN, Frascati (Italy); De Napoli, M. [Laboratori Nazionali del Sud dell' INFN, Catania (Italy); Di Domenico, A.; Faccini, R.; Ferroni, F. [Dipartimento di Fisica, Sapienza Universita di Roma, Roma (Italy); INFN Sezione di Roma, Roma (Italy); Fiore, S. [Dipartimento di Fisica, Sapienza Universita di Roma, Roma (Italy); Gauzzi, P. [Dipartimento di Fisica, Sapienza Universita di Roma, Roma (Italy); INFN Sezione di Roma, Roma (Italy); Iarocci, E. [Laboratori Nazionali di Frascati dell' INFN, Frascati (Italy); Dipartimento di Scienze di Base e Applicate per l' Ingegneria, Sapienza Universita di Roma, Roma (Italy); Marafini, M., E-mail: michela.marafini@roma1.infn.it [Museo Storico della Fisica e Centro Studi e Ricerche ' E. Fermi' , Roma (Italy); Mattei, I. [Dipartimento di Fisica, Roma Tre Universita di Roma, Roma (Italy); Laboratori Nazionali di Frascati dell' INFN, Frascati (Italy); Paoloni, A. [Laboratori Nazionali di Frascati dell' INFN, Frascati (Italy); and others

2012-07-15

Proton and carbon ion therapy is an emerging technique used for the treatment of solid cancers. The monitoring of the dose delivered during such treatments and the on-line knowledge of the Bragg peak position is still a matter of research. A possible technique exploits the collinear 511keV photons produced by positrons annihilation from {beta}{sup +} emitters created by the beam. This paper reports rate measurements of the 511keV photons emitted after the interactions of a 80MeV/u fully stripped carbon ion beam at the Laboratori Nazionali del Sud (LNS) of INFN, with a poly-methyl methacrylate target. The time evolution of the {beta}{sup +} rate was parametrized and the dominance of {sup 11}C emitters over the other species ({sup 13}N, {sup 15}O, {sup 14}O) was observed, measuring the fraction of carbon ions activating {beta}{sup +} emitters to be (10.3{+-}0.7) Multiplication-Sign 10{sup -3}. The average depth in the PMMA of the positron annihilation from {beta}{sup +} emitters was also measured, D{sub {beta}{sup +}}=5.3{+-}1.1mm, to be compared to the expected Bragg peak depth D{sub Bragg}=11.0{+-}0.5mm obtained from simulations.

Modified theoretical minimum emittance lattice for an electron storage ring with extreme-low emittance

Directory of Open Access Journals (Sweden)

Yi Jiao

2011-05-01

Full Text Available In the continuing efforts to reduce the beam emittance of an electron storage ring composed of theoretical minimum emittance (TME lattice, down to a level of several tens of picometers, nonlinear dynamics grows to be a great challenge to the performance of the storage ring because of the strong sextupoles needed to compensate for its large global natural chomaticities coupled with its small average dispersion function. To help in dealing with the challenge of nonlinear optimization, we propose a novel variation of theoretical minimum emittance (TME lattice, named as “modified-TME” lattice, with minimal emittance about 3 times of the exact theoretical minimum, while with more compact layout, lower phase advance per cell, smaller natural chromaticities, and more relaxed optical functions than that in a TME cell, by using horizontally defocusing quadrupole closer to the dipole or simply combined-function dipole with horizontally defocusing gradient. We present approximate scaling formulas to describe the relationships of the design parameters in a modified-TME cell. The applications of modified-TME lattice in the PEP-X storage ring design are illustrated and the proposed lattice appears a good candidate for synchrotron radiation light source with extremely low emittance.

A device for electron gun emittance measurement

International Nuclear Information System (INIS)

Aune, B.; Corveller, P.; Jablonka, M.; Joly, J.M.

1985-05-01

In order to improve the final emittance of the beam delivered by the ALS electron linac a new gun is going to be installed. To measure its emittance and evaluate the contribution of different factors to emittance growth we have developed an emittance measurement device. We describe the experimental and mathematical procedure we have followed, and give some results of measurements

An analytical study of double bend achromat lattice

Energy Technology Data Exchange (ETDEWEB)

Fakhri, Ali Akbar, E-mail: fakhri@rrcat.gov.in; Kant, Pradeep; Singh, Gurnam; Ghodke, A. D. [Raja Ramanna Centre for Advanced Technology, Indore 452 013 (India)

2015-03-15

In a double bend achromat, Chasman-Green (CG) lattice represents the basic structure for low emittance synchrotron radiation sources. In the basic structure of CG lattice single focussing quadrupole (QF) magnet is used to form an achromat. In this paper, this CG lattice is discussed and an analytical relation is presented, showing the limitation of basic CG lattice to provide the theoretical minimum beam emittance in achromatic condition. To satisfy theoretical minimum beam emittance parameters, achromat having two, three, and four quadrupole structures is presented. In this structure, different arrangements of QF and defocusing quadruple (QD) are used. An analytical approach assuming quadrupoles as thin lenses has been followed for studying these structures. A study of Indus-2 lattice in which QF-QD-QF configuration in the achromat part has been adopted is also presented.

An analytical study of double bend achromat lattice.

Science.gov (United States)

Fakhri, Ali Akbar; Kant, Pradeep; Singh, Gurnam; Ghodke, A D

2015-03-01

In a double bend achromat, Chasman-Green (CG) lattice represents the basic structure for low emittance synchrotron radiation sources. In the basic structure of CG lattice single focussing quadrupole (QF) magnet is used to form an achromat. In this paper, this CG lattice is discussed and an analytical relation is presented, showing the limitation of basic CG lattice to provide the theoretical minimum beam emittance in achromatic condition. To satisfy theoretical minimum beam emittance parameters, achromat having two, three, and four quadrupole structures is presented. In this structure, different arrangements of QF and defocusing quadruple (QD) are used. An analytical approach assuming quadrupoles as thin lenses has been followed for studying these structures. A study of Indus-2 lattice in which QF-QD-QF configuration in the achromat part has been adopted is also presented.

An analytical study of double bend achromat lattice

International Nuclear Information System (INIS)

Fakhri, Ali Akbar; Kant, Pradeep; Singh, Gurnam; Ghodke, A. D.

2015-01-01

In a double bend achromat, Chasman-Green (CG) lattice represents the basic structure for low emittance synchrotron radiation sources. In the basic structure of CG lattice single focussing quadrupole (QF) magnet is used to form an achromat. In this paper, this CG lattice is discussed and an analytical relation is presented, showing the limitation of basic CG lattice to provide the theoretical minimum beam emittance in achromatic condition. To satisfy theoretical minimum beam emittance parameters, achromat having two, three, and four quadrupole structures is presented. In this structure, different arrangements of QF and defocusing quadruple (QD) are used. An analytical approach assuming quadrupoles as thin lenses has been followed for studying these structures. A study of Indus-2 lattice in which QF-QD-QF configuration in the achromat part has been adopted is also presented

Investigating proton emitters at the limits of stability with radioactive beams from the Oak Ridge facility

Energy Technology Data Exchange (ETDEWEB)

Toth, K.S. [Oak Ridge National Lab., TN (United States); Batchelder, J.C.; Zganjar, E.F. [Louisiana State Univ., Baton Rouge, LA (United States); Bingham, C.R.; Wauters, J. [Tennessee Univ., Knoxville, TN (United States); Davinson, T.; MacKenzie, J.A.; Woods, P.J. [Edinburgh Univ. (United Kingdom)

1996-10-01

By using beams from the Holifield Radioactive Ion Beam Facility at ORNL, it should be possible to identify many new ground-state proton emitters in the mass region from Sn to Pb. In these investigations nuclei produced in fusion-evaporation reactions will be separated from incident ions and dispersed in mass/charge with a recoil mass separator and then implanted into a double-sided Si strip detector for study of proton (and {alpha}-particle) radioactivity. This paper summarizes data presently extant on proton emitters and then focuses on tests and initial experiments that will be carried out with stable beams and with radioactive ions as they are developed at the Oak Ridge facility.

Double resonance capacitance spectroscopy (DORCAS): A new experimental technique for assignment of X-ray absorption peaks to surface sites of semiconductor

CERN Document Server

Ishii, M

2003-01-01

As a new microspectroscopy for semiconductor surface analysis using an X-ray beam, double resonance capacitance spectroscopy (DORCAS) is proposed. For a microscopic X-ray absorption measurement, a local capacitance change owing to X-ray induced emission of localized electrons is detected by a microprobe. The applied bias voltage V sub b dependence of the capacitance also provides information on the surface density of state. The resonance of the Fermi energy with a surface level by V sub b control makes possible the selection of the observable surface site in the X-ray absorption measurements, i.e. site-specific spectroscopy. The double resonance of the surface site selection (V sub b resonance) and the resonant X-ray absorption of the selected site (photon energy h nu resonance) enhances the capacitance signal. The DORCAS measurement of the GaAs surface shows correlation peaks at h nu=10.402 keV and V sub b =-0.4 V and h nu=10.429 keV and V sub b =+0.1 V, indicating that these resonant X-ray absorption peaks ...

Design of a control system for stepper motors with micro-metric precision employed in the beam emittance measurement of the Linac4 at CERN

CERN Document Server

AUTHOR|(CDS)2207212; Dueñas Díaz, José Antonio

A new linear accelerator (Linac4) is being designed to replace its predecessor (Linac2) at CERN. The new Linac4 will double the initial intensity giving an injection energy of up to 160 MeV. It will be an essential component of the LHC (Large Hadron Collider). To assess the quality of the beam, monitoring systems are placed along the beam pipe, being one of them devoted to measure its emittance, the so-called emittance scanner. The measurement of the emittance is important since it constitutes one of the two main parameters that limits the overall LHC performance, being the other parameter the energy of the beam. While the energy level of the beam can be modified during different phases at CERN, the beam emittance cannot; it is determined by the first source that produces the beam. The beam emittance directly influences the amount of particles colliding. For this purpose, the Linac4 emittance scanner will be placed on the very first step of the whole CERN accelerator complex right after the particles sour...

Emitter signal separation method based on multi-level digital channelization

Science.gov (United States)

Han, Xun; Ping, Yifan; Wang, Sujun; Feng, Ying; Kuang, Yin; Yang, Xinquan

2018-02-01

To solve the problem of emitter separation under complex electromagnetic environment, a signal separation method based on multi-level digital channelization is proposed in this paper. A two-level structure which can divide signal into different channel is designed first, after that, the peaks of different channels are tracked using the track filter and the coincident signals in time domain are separated in time-frequency domain. Finally, the time domain waveforms of different signals are acquired by reverse transformation. The validness of the proposed method is proved by experiment.

Diamond-based single-photon emitters

International Nuclear Information System (INIS)

Aharonovich, I; Castelletto, S; Simpson, D A; Su, C-H; Greentree, A D; Prawer, S

2011-01-01

The exploitation of emerging quantum technologies requires efficient fabrication of key building blocks. Sources of single photons are extremely important across many applications as they can serve as vectors for quantum information-thereby allowing long-range (perhaps even global-scale) quantum states to be made and manipulated for tasks such as quantum communication or distributed quantum computation. At the single-emitter level, quantum sources also afford new possibilities in terms of nanoscopy and bio-marking. Color centers in diamond are prominent candidates to generate and manipulate quantum states of light, as they are a photostable solid-state source of single photons at room temperature. In this review, we discuss the state of the art of diamond-based single-photon emitters and highlight their fabrication methodologies. We present the experimental techniques used to characterize the quantum emitters and discuss their photophysical properties. We outline a number of applications including quantum key distribution, bio-marking and sub-diffraction imaging, where diamond-based single emitters are playing a crucial role. We conclude with a discussion of the main challenges and perspectives for employing diamond emitters in quantum information processing.

Emittance compensation of CW DC-gun photoinjector

International Nuclear Information System (INIS)

Li Peng; Wu Dai; Xu Zhou; Li Ming; Yang Xingfan

2011-01-01

Emittance growth induced by space charge effect is very important, especially for CW DC-gun photoinjector. In this work, the linear space charge force and its effect on electron beam transverse emittance are studied, and the principle and properties of emittance compensation by solenoid are analyzed. The CAEP DC-gun photoinjector with a solenoid is also simulated by code Parmela. Simulated results indicate that the normalized transverse emittance of an 80 pC bunch at the 350 keV DC-gun ex-it is 5.14 mm · mrad. And after compensated by a solenoid, it becomes 1.27 mm · mrad. The emittance of beam is well compensated. (authors)

A low-emittance lattice for SPEAR

International Nuclear Information System (INIS)

Safranek, J.; Wiedemann, H.

1992-01-01

The design and implementation of a low emittance lattice for the SPEAR storage ring including measurements of the performance of the lattice are presented (J. Safranek, Ph. D. thesis, Stanford University, 1991). The low emittance lattice is designed to optimize the performance of SPEAR as a synchrotron radiation source while keeping SPEAR hardware changes at a minimum. The horizontal emittance of the electron beam in the low emittance lattice is reduced by a factor of 4 from the previous lattice. This reduces the typical horizontal source size and divergence of the photon beams by a factor of 2 each and increases the photon beam brightness. At 3 GeV the horizontal emittance is 129 π nm rad, which makes the low emittance lattice the lowest emittance, runnning synchroton radiation source in the world in the 1.5 to 4.0 GeV energy range for the emittance scaled to 3 GeV. The measured vertical emittance was reduced to half that typically seen at SPEAR in the past. The brightness of the photon beams was further incrased by reducing β y at the insertion devices to 1.1 m and reducing the energy dispersion at the insertion devices by more than a factor of 2 on average. The horizontal despersion at the rf cavities was reduced by a factor of nearly 4 which gives much less problems with synchrobetatron resonances. The dynamic and physical apertures of the lattice are large, giving long beam lifetimes and easy injection of electrons. The measurements of the linear optics and intensity dependent phenomena gave resonable agreement with the design . The overall performance of the machine was very good. Injection rates of 10 to 20 mA/min and larger were achieved routinely, and 100 mA total current was stored. Repeated ramping of stored beam from the injection energy of 2.3 GeV to the running energy of 3.0 GeV was achieved with very little beam loss. This low emittance configuration is expected to be the operating configuration for SPEAR starting in January 1992. (orig.)

Radiation emitter-detector package

International Nuclear Information System (INIS)

O'Brien, J.T.; Limm, A.C.; Nyul, P.; Tassia, V.S. Jr.

1978-01-01

Mounted on the metallic base of a radiation emitter-detector is a mounting block is a first projection, and a second projection. A radiation detector is on the first projection and a semiconductor electroluminescent device, i.e., a radiation emitter, is on the second projection such that the plane of the recombination region of the electroluminescent device is perpendicular to the radiation incident surface of the radiation detector. The electroluminescent device has a primary emission and a secondary emission in a direction different from the primary emission. A radiation emitter-detector package as described is ideally suited to those applications wherein the secondary radiation of the electroluminescent device is fed into a feedback circuit regulating the biasing current of the electroluminescent device

Emittance investigation of RF photo-injector

CERN Document Server

Yang Mao Rong; Li Zheng; Li Ming; Xu Zhou

2002-01-01

A high-power laser beam illuminates a photocathode surface placed on an end wall of an RF cavity. The emitted electrons are accelerated immediately to a relativistic energy by the strong RF find in the cavity. But space charge effect induces beam emittance growth especially near the cathode where the electrons are still nonrelativistic. The author analyzes the factors which lead the transverse emittance growth and method how to resolve this problem. After introducing solenoidal focusing near the photocathode, the beam emittance growth is suppressed dramatically. The beam emittance is given also after compensation and simulation results. The measurements show these results are coincident

Criteria for emittance compensation in high-brightness photoinjectors

Directory of Open Access Journals (Sweden)

Chun-xi Wang

2007-10-01

Full Text Available A critical process in high-brightness photoinjectors is emittance compensation, which brings under control the correlated transverse emittance growth due to the linear space-charge force. Although emittance compensation has been used and studied for almost two decades, the exact criteria to achieve emittance compensation is not as clear as it should be. In this paper, a perturbative analysis of slice envelopes and emittance evolution close to any reference envelope is developed, via which space-charge and chromatic effects are investigated. A new criterion for emittance compensation is found, which is complementary to the well-known matching condition for the invariant envelope and agrees very well with simulations.

A double-voiced reading of Romans 13:1–7 in light of the imperial cult

Directory of Open Access Journals (Sweden)

Sung U. Lim

2015-03-01

Full Text Available Drawing on Mikhail Bakhtin’s theory of double-voicedness and James Scott’s theory of public and hidden transcripts, this essay investigates the colonial context of Romans 13:1–7 with particular attention to the Roman imperial cult. It is my contention that Paul attempts to persuade the audience to resist the imperial cult, whilst negotiating colonial power and authority. It is assumed that colonial discourse is, by nature, a double-voiced discourse in that the public transcript of the dominant and the hidden transcript of the suppressed coexist in a continued state of internal tension and conflict. Seen in this light, Paul as a colonised subject parodies the public transcript of the elites in his own hidden transcript. However, Paul’s doubled-voiced discourse finally turns out to be subversive against the dominant culture by suggesting that ultimate honour, fear, and authority should not be due to the rulers of the Roman Empire but to God.

Small horizontal emittance in the TESLA damping ring

International Nuclear Information System (INIS)

Decking, W.

2001-01-01

The present TESLA damping ring is designed for a normalized horizontal emittance of 8x10 -6 m. γ-γ collisions at the TESLA linear collider will benefit from a further decrease of the horizontal emittance. This paper reviews the processes which limit the horizontal emittance in the damping ring. Preliminary estimates on the smallest horizontal emittance for the present TESLA damping ring design as well as an ultimate limit of the emittance reachable with the TESLA damping ring concept will be given

Beam diagnostics using an emittance measurement device

International Nuclear Information System (INIS)

Sarstedt, M.; Becker, R.; Klein, H.; Maaser, A.; Mueller, J.; Thomae, R.; Weber, M.

1995-01-01

For beam diagnostics aside from Faraday cups for current measurements and analysing magnets for the determination of beam composition and energy the most important tool is an emittance measurement device. With such a system the distribution of the beam particles in phase-space can be determined. This yields information not only on the position of the particles but also on their angle with respect to the beam axis. There are different kinds of emittance measurement devices using either circular holes or slits for separation of part of the beam. The second method (slit-slit measurement), though important for the determination of the rms-emittance, has the disadvantage of integrating over the y- and y'-coordinate (measurement in xx'-plane assumed). This leads to different emittance diagrams than point-point measurements, since in xx'-plane for each two corresponding points of rr'-plane there exists a connecting line. With regard to beam aberrations this makes xx'-emittances harder to interpret. In this paper the two kinds of emittance diagrams are discussed. Additionally the influence of the slit height on the xx'-emittance is considered. The analytical results are compared to experimental measurements in rr'-, rx'- and xx'-phase-space. (orig.)

Nonintercepting emittance monitor

International Nuclear Information System (INIS)

Miller, R.H.; Clendenin, J.E.; James, M.B.; Sheppard, J.C.

1983-08-01

A nonintercepting emittance monitor is a helpful device for measuring and improving particle beams in accelerators and storage rings as it allows continuous monitoring of the beam's distribution in phase space, and perhaps closed loop computer control of the distributions. Stripline position monitors are being investigated for use as nonintercepting emittance monitors for a beam focused by a FODO array in the first 100 meters of our linear accelerator. The technique described here uses the signal from the four stripline probes of a single position monitor to measure the quadrupole mode of the wall current in the beam pipe. This current is a function of the quadrupole moment of the beam, sigma 2 /sub x/ - sigma 2 /sub y/. In general, six independent measurements of the quadrupole moment are necessary to determine the beam emittance. This technique is dependent on the characteristically large variations of sigma 2 /sub x/ - sigma 2 /sub y/ in a FODO array. It will not work in a focusing system where the beam is round at each focusing element

Low emittance configuration for spear

International Nuclear Information System (INIS)

Blumberg, L.N.; Harris, J.; Stege, R.; Cerino, J.; Hettel, R.; Hofmann, A.; Liu, R.Z.; Wiedemann, H.; Winick, H.

1985-01-01

The quality of synchrotron radiation beams from SPEAR, in particular the brilliance of undulator radiation, can be improved significantly by reducing the emittance of the stored electron beam. A reduction of the horizontal emittance by a factor of 3.5 to a value of 130 nanometer-radians (nm-r) at 3 GeV has been achieved by using stronger focussing, mainly in the horizontal plane. The low emittance configuration also reduces the dispersion and vertical beta functions in the straight sections, making them more suitable for wigglers. The higher betatron tunes lead to a larger phase advance between the two kickers, which has to be corrected during injection by shunting current from some quadrupoles. The configuration was optimized within SPEAR hardware limitations and tested for dynamic aperture with the tracking program PATRICIA. After implementation of this scheme, beam was successfully injected and accumulated. The measured emittance of the stored beam was in agreement with calculations. Presently the configuration is being made operational

Emittance measurements by variable quadrupole method

International Nuclear Information System (INIS)

Toprek, D.

2005-01-01

The beam emittance is a measure of both the beam size and beam divergence, we cannot directly measure its value. If the beam size is measured at different locations or under different focusing conditions such that different parts of the phase space ellipse will be probed by the beam size monitor, the beam emittance can be determined. An emittance measurement can be performed by different methods. Here we will consider the varying quadrupole setting method.

Multinozzle emitter arrays for ultrahigh-throughput nanoelectrospray mass spectrometry

Science.gov (United States)

Wang, Daojing; Mao, Pan; Wang, Hung-Ta; Yang, Peidong

2017-10-17

The present invention provides for a structure comprising a plurality of emitters, wherein a first nozzle of a first emitter and a second nozzle of a second emitter emit in two directions that are not or essentially not in the same direction; wherein the walls of the nozzles and the emitters form a monolithic whole. The present invention also provides for a structure comprising an emitter with a sharpened end from which the emitter emits; wherein the emitters forms a monolithic whole. The present invention also provides for a fully integrated separation of proteins and small molecules on a silicon chip before the electrospray mass spectrometry analysis.

Hybrid emitter all back contact solar cell

Science.gov (United States)

Loscutoff, Paul; Rim, Seung

2016-04-12

An all back contact solar cell has a hybrid emitter design. The solar cell has a thin dielectric layer formed on a backside surface of a single crystalline silicon substrate. One emitter of the solar cell is made of doped polycrystalline silicon that is formed on the thin dielectric layer. The other emitter of the solar cell is formed in the single crystalline silicon substrate and is made of doped single crystalline silicon. The solar cell includes contact holes that allow metal contacts to connect to corresponding emitters.

Automatic fitting of Gaussian peaks using abductive machine learning

Science.gov (United States)

Abdel-Aal, R. E.

1998-02-01

Analytical techniques have been used for many years for fitting Gaussian peaks in nuclear spectroscopy. However, the complexity of the approach warrants looking for machine-learning alternatives where intensive computations are required only once (during training), while actual analysis on individual spectra is greatly simplified and quickened. This should allow the use of simple portable systems for fast and automated analysis of large numbers of spectra, particularly in situations where accuracy may be traded for speed and simplicity. This paper proposes the use of abductive networks machine learning for this purpose. The Abductory Induction Mechanism (AIM) tool was used to build models for analyzing both single and double Gaussian peaks in the presence of noise depicting statistical uncertainties in collected spectra. AIM networks were synthesized by training on 1000 representative simulated spectra and evaluated on 500 new spectra. A classifier network determines the multiplicity of single/double peaks with an accuracy of 5.8%. With statistical uncertainties corresponding to a peak count of 100, average percentage absolute errors for the height, position, and width of single peaks are 4.9, 2.9, and 4.2%, respectively. For double peaks, these average errors are within 7.0, 3.1, and 5.9%, respectively. Models have been developed which account for the effect of a linear background on a single peak. Performance is compared with a neural network application and with an analytical curve-fitting routine, and the new technique is applied to actual data of an alpha spectrum.

Automatic fitting of Gaussian peaks using abductive machine learning

International Nuclear Information System (INIS)

Abdel-Aal, R.E.

1998-01-01

Analytical techniques have been used for many years for fitting Gaussian peaks in nuclear spectroscopy. However, the complexity of the approach warrants looking for machine-learning alternatives where intensive computations are required only once (during training), while actual analysis on individual spectra is greatly simplified and quickened. This should allow the use of simple portable systems for fast and automated analysis of large numbers of spectra, particularly in situations where accuracy may be traded for speed and simplicity. This paper proposes the use of abductive networks machine learning for this purpose. The Abductory Induction Mechanism (AIM) tool was used to build models for analyzing both single and double Gaussian peaks in the presence of noise depicting statistical uncertainties in collected spectra. AIM networks were synthesized by training on 1,000 representative simulated spectra and evaluated on 500 new spectra. A classifier network determines the multiplicity of single/double peaks with an accuracy of 98%. With statistical uncertainties corresponding to a peak count of 100, average percentage absolute errors for the height, position, and width of single peaks are 4.9, 2.9, and 4.2%, respectively. For double peaks, these average errors are within 7.0, 3.1, and 5.9%, respectively. Models have been developed which account for the effect of a linear background on a single peak. Performance is compared with a neural network application and with an analytical curve-fitting routine, and the new technique is applied to actual data of an alpha spectrum

Characterization of electron bunches from field emitter array cathodes for use in next-generation x-ray free electron lasers

International Nuclear Information System (INIS)

Leemann, S. C.

2007-01-01

PSI is interested in developing an x-ray free electron laser (X-FEL) as a companion radiation source to the existing Swiss Light Source. In order to achieve radiation wavelengths as low as 1 Α, the X-FEL requires excellent electron beam quality and high beam energy. The energy requirements and thus the size and cost of the project can be reduced considerably if an ultra-low emittance electron source is developed. Therefore PSI has started the Low Emittance Gun Project with the aim to design a novel type of electron source that will deliver an electron beam with unprecedented emittance at high peak currents to the linear accelerator of the proposed X-FEL. A source candidate for such a gun is field emission from cold cathodes. In order to gain first experience with field emission guns, investigate the dynamics of space charge dominated electron beams and to develop diagnostics capable of resolving ultra-low emittances, it was decided to build a 100 keV DC gun test stand. In the scope of this thesis, the test stand has been designed, assembled and commissioned. For the first time, transverse phase space measurements of bunches emitted by field emitter arrays in pulsed DC accelerating fields have been performed. (author)

A peculiar low-luminosity short gamma-ray burst from a double neutron star merger progenitor.

Science.gov (United States)

Zhang, B-B; Zhang, B; Sun, H; Lei, W-H; Gao, H; Li, Y; Shao, L; Zhao, Y; Hu, Y-D; Lü, H-J; Wu, X-F; Fan, X-L; Wang, G; Castro-Tirado, A J; Zhang, S; Yu, B-Y; Cao, Y-Y; Liang, E-W

2018-01-31

Double neutron star (DNS) merger events are promising candidates of short gamma-ray burst (sGRB) progenitors as well as high-frequency gravitational wave (GW) emitters. On August 17, 2017, such a coinciding event was detected by both the LIGO-Virgo gravitational wave detector network as GW170817 and Gamma-Ray Monitor on board NASA's Fermi Space Telescope as GRB 170817A. Here, we show that the fluence and spectral peak energy of this sGRB fall into the lower portion of the distributions of known sGRBs. Its peak isotropic luminosity is abnormally low. The estimated event rate density above this luminosity is at least [Formula: see text] Gpc -3  yr -1 , which is close to but still below the DNS merger event rate density. This event likely originates from a structured jet viewed from a large viewing angle. There are similar faint soft GRBs in the Fermi archival data, a small fraction of which might belong to this new population of nearby, low-luminosity sGRBs.

2-D emittance equation with acceleration and compression

International Nuclear Information System (INIS)

Hahn, K.D.; Smith, L.

1988-10-01

Since both acceleration and compression are required for an Inertial Fusion Driver, the understanding of their effect on the beam quality, emittance, is important. This report attempts to generalize the usual emittance formula for the drifting beam to include these effects. The derivation of the 2-D emittance equation is carried out and a comparison with the particle code results is given. The 2-D emittance at a given axial location is reasonable to consider for a long beam, particularly with velocity tilt; transverse emittance averaged over the entire bunch is not a useful quantity. 6 refs., 2 figs., 1 tab

Emittance growth in rf linacs

International Nuclear Information System (INIS)

Jameson, R.A.

1979-01-01

As the space-charge limit is approached, the current that can be accelerated in an rf linac and the output emittance that can be expected are discussed. The role of the envelope equations to estimate limits is outlined. The results of numerical experiments to explore general properties of emittance growth are given

Production of alpha emitters for therapy

International Nuclear Information System (INIS)

Vucina, J.; Orlic, M.; Lukic, D.

2006-01-01

The basis for the introduction of alpha emitters into nuclear medical practice are their radiobiological properties. High LET values and short ranges in biological tissues are advantageous in comparison with nowadays most often used beta emitters, primarily 90 Y and 131 I. Given are the most important criteria for the introduction of a given radionuclide in the routine use. Shown are the procedures for the production of the most important alpha emitters 211 At, 212 Bi and 213 Bi. (author)

Minimum emittance in TBA and MBA lattices

Science.gov (United States)

Xu, Gang; Peng, Yue-Mei

2015-03-01

For reaching a small emittance in a modern light source, triple bend achromats (TBA), theoretical minimum emittance (TME) and even multiple bend achromats (MBA) have been considered. This paper derived the necessary condition for achieving minimum emittance in TBA and MBA theoretically, where the bending angle of inner dipoles has a factor of 31/3 bigger than that of the outer dipoles. Here, we also calculated the conditions attaining the minimum emittance of TBA related to phase advance in some special cases with a pure mathematics method. These results may give some directions on lattice design.

Minimum emittance in TBA and MBA lattices

International Nuclear Information System (INIS)

Xu Gang; Peng Yuemei

2015-01-01

For reaching a small emittance in a modern light source, triple bend achromats (TBA), theoretical minimum emittance (TME) and even multiple bend achromats (MBA) have been considered. This paper derived the necessary condition for achieving minimum emittance in TBA and MBA theoretically, where the bending angle of inner dipoles has a factor of 3 1/3 bigger than that of the outer dipoles. Here, we also calculated the conditions attaining the minimum emittance of TBA related to phase advance in some special cases with a pure mathematics method. These results may give some directions on lattice design. (authors)

Cancer from internal emitters

International Nuclear Information System (INIS)

Boecker, B.B.; Griffith, W.C. Jr.

1995-01-01

Irradiation from internal emitters, or internally deposited radionuclides, is an important component of radiation exposures encountered in the workplace, home, or general environment. Long-term studies of human populations exposed to various internal emitters by different routes of exposure are producing critical information for the protection of workers and members of the general public. The purpose of this report is to examine recent developments and discuss their potential importance for understanding lifetime cancer risks from internal emitters. The major populations of persons being studied for lifetime health effects from internally deposited radionuclides are well known: Lung cancer in underground miners who inhaled Rn progeny, liver cancer from persons injected with the Th-containing radiographic contrast medium Thorotrast, bone cancer from occupational or medical intakes of 226 Ra or medical injections of 224 Ra, and thyroid cancer from exposures to iodine radionuclides in the environment or for medical purposes

Nitrogen incorporated ultrananocrystalline diamond based field emitter array for a flat-panel x-ray source

International Nuclear Information System (INIS)

Posada, Chrystian M.; Grant, Edwin J.; Lee, Hyoung K.; Castaño, Carlos H.; Divan, Ralu; Sumant, Anirudha V.; Rosenmann, Daniel; Stan, Liliana

2014-01-01

A field emission based flat-panel transmission x-ray source is being developed as an alternative for medical and industrial imaging. A field emitter array (FEA) prototype based on nitrogen incorporated ultrananocrystalline diamond film has been fabricated to be used as the electron source of this flat panel x-ray source. The FEA prototype was developed using conventional microfabrication techniques. The field emission characteristics of the FEA prototype were evaluated. Results indicated that emission current densities of the order of 6 mA/cm 2 could be obtained at electric fields as low as 10 V/μm to 20 V/μm. During the prototype microfabrication process, issues such as delamination of the extraction gate and poor etching of the SiO 2 insulating layer located between the emitters and the extraction layer were encountered. Consequently, alternative FEA designs were investigated. Experimental and simulation data from the first FEA prototype were compared and the results were used to evaluate the performance of alternative single and double gate designs that would yield better field emission characteristics compared to the first FEA prototype. The best simulation results are obtained for the double gate FEA design, when the diameter of the collimator gate is around 2.6 times the diameter of the extraction gate

Development of Emittance Analysis Software for Ion Beam Characterization

International Nuclear Information System (INIS)

Padilla, M.J.; Liu, Yuan

2007-01-01

Transverse beam emittance is a crucial property of charged particle beams that describes their angular and spatial spread. It is a figure of merit frequently used to determine the quality of ion beams, the compatibility of an ion beam with a given beam transport system, and the ability to suppress neighboring isotopes at on-line mass separator facilities. Generally, a high-quality beam is characterized by a small emittance. In order to determine and improve the quality of ion beams used at the Holifield Radioactive Ion Beam Facility (HRIBF) for nuclear physics and nuclear astrophysics research, the emittances of the ion beams are measured at the off-line Ion Source Test Facilities. In this project, emittance analysis software was developed to perform various data processing tasks for noise reduction, to evaluate root-mean-square emittance, Twiss parameters, and area emittance of different beam fractions. The software also provides 2D and 3D graphical views of the emittance data, beam profiles, emittance contours, and RMS. Noise exclusion is essential for accurate determination of beam emittance values. A Self-Consistent, Unbiased Elliptical Exclusion (SCUBEEx) method is employed. Numerical data analysis techniques such as interpolation and nonlinear fitting are also incorporated into the software. The software will provide a simplified, fast tool for comprehensive emittance analysis. The main functions of the software package have been completed. In preliminary tests with experimental emittance data, the analysis results using the software were shown to be accurate

DEVELOPMENT OF EMITTANCE ANALYSIS SOFTWARE FOR ION BEAM CHARACTERIZATION

Energy Technology Data Exchange (ETDEWEB)

Padilla, M. J.; Liu, Y.

2007-01-01

Transverse beam emittance is a crucial property of charged particle beams that describes their angular and spatial spread. It is a fi gure of merit frequently used to determine the quality of ion beams, the compatibility of an ion beam with a given beam transport system, and the ability to suppress neighboring isotopes at on-line mass separator facilities. Generally a high quality beam is characterized by a small emittance. In order to determine and improve the quality of ion beams used at the Holifi eld Radioactive Ion beam Facility (HRIBF) for nuclear physics and nuclear astrophysics research, the emittances of the ion beams are measured at the off-line Ion Source Test Facilities. In this project, emittance analysis software was developed to perform various data processing tasks for noise reduction, to evaluate root-mean-square emittance, Twiss parameters, and area emittance of different beam fractions. The software also provides 2D and 3D graphical views of the emittance data, beam profi les, emittance contours, and RMS. Noise exclusion is essential for accurate determination of beam emittance values. A Self-Consistent, Unbiased Elliptical Exclusion (SCUBEEx) method is employed. Numerical data analysis techniques such as interpolation and nonlinear fi tting are also incorporated into the software. The software will provide a simplifi ed, fast tool for comprehensive emittance analysis. The main functions of the software package have been completed. In preliminary tests with experimental emittance data, the analysis results using the software were shown to be accurate.

Hidden gauge symmetry

International Nuclear Information System (INIS)

O'Raifeartaigh, L.

1979-01-01

This review describes the principles of hidden gauge symmetry and of its application to the fundamental interactions. The emphasis is on the structure of the theory rather than on the technical details and, in order to emphasise the structure, gauge symmetry and hidden symmetry are first treated as independent phenomena before being combined into a single (hidden gauge symmetric) theory. The main application of the theory is to the weak and electromagnetic interactions of the elementary particles, and although models are used for comparison with experiment and for illustration, emphasis is placed on those features of the application which are model-independent. (author)

Variational Infinite Hidden Conditional Random Fields

NARCIS (Netherlands)

Bousmalis, Konstantinos; Zafeiriou, Stefanos; Morency, Louis-Philippe; Pantic, Maja; Ghahramani, Zoubin

2015-01-01

Hidden conditional random fields (HCRFs) are discriminative latent variable models which have been shown to successfully learn the hidden structure of a given classification problem. An Infinite hidden conditional random field is a hidden conditional random field with a countably infinite number of

Hidden charged dark matter

International Nuclear Information System (INIS)

Feng, Jonathan L.; Kaplinghat, Manoj; Tu, Huitzu; Yu, Hai-Bo

2009-01-01

Can dark matter be stabilized by charge conservation, just as the electron is in the standard model? We examine the possibility that dark matter is hidden, that is, neutral under all standard model gauge interactions, but charged under an exact (\\rm U)(1) gauge symmetry of the hidden sector. Such candidates are predicted in WIMPless models, supersymmetric models in which hidden dark matter has the desired thermal relic density for a wide range of masses. Hidden charged dark matter has many novel properties not shared by neutral dark matter: (1) bound state formation and Sommerfeld-enhanced annihilation after chemical freeze out may reduce its relic density, (2) similar effects greatly enhance dark matter annihilation in protohalos at redshifts of z ∼ 30, (3) Compton scattering off hidden photons delays kinetic decoupling, suppressing small scale structure, and (4) Rutherford scattering makes such dark matter self-interacting and collisional, potentially impacting properties of the Bullet Cluster and the observed morphology of galactic halos. We analyze all of these effects in a WIMPless model in which the hidden sector is a simplified version of the minimal supersymmetric standard model and the dark matter is a hidden sector stau. We find that charged hidden dark matter is viable and consistent with the correct relic density for reasonable model parameters and dark matter masses in the range 1 GeV ∼ X ∼< 10 TeV. At the same time, in the preferred range of parameters, this model predicts cores in the dark matter halos of small galaxies and other halo properties that may be within the reach of future observations. These models therefore provide a viable and well-motivated framework for collisional dark matter with Sommerfeld enhancement, with novel implications for astrophysics and dark matter searches

A new automatic fixed peak technology of microcontroller

International Nuclear Information System (INIS)

Huang Liguo; Wang Dequan; Zhang Damin; Li Jun; Liu Yuwen; Guo Qingxue; Wang Guifeng

1999-01-01

The microcontroller automatic fixed peak technology which differs from fashion half channel fixed peak is described. It bases on the principles of selecting double single channel and readjusting the voltage of power source. This technology is suitable to the industrial isotope instruments with various radioactive sources

Quantum efficiency and thermal emittance of metal photocathodes

Directory of Open Access Journals (Sweden)

David H. Dowell

2009-07-01

Full Text Available Modern electron beams have demonstrated the brilliance needed to drive free electron lasers at x-ray wavelengths with major advances occurring since the invention of the photocathode gun and the realization of emittance compensation. These state-of-the-art electron beams are now becoming limited by the intrinsic thermal emittance of the cathode. In both dc and rf photocathode guns details of the cathode emission physics strongly influence the quantum efficiency and the thermal emittance. Therefore improving cathode performance is essential to increasing the brightness of beams. It is especially important to understand the fundamentals of cathode quantum efficiency and thermal emittance. This paper investigates the relationship between the quantum efficiency and the thermal emittance for metal cathodes using the Fermi-Dirac model for the electron distribution. We use a consistent theory to derive the quantum efficiency and thermal emittance, and compare our results to those of others.

Localization of hidden Chua's attractors

International Nuclear Information System (INIS)

Leonov, G.A.; Kuznetsov, N.V.; Vagaitsev, V.I.

2011-01-01

The classical attractors of Lorenz, Rossler, Chua, Chen, and other widely-known attractors are those excited from unstable equilibria. From computational point of view this allows one to use numerical method, in which after transient process a trajectory, started from a point of unstable manifold in the neighborhood of equilibrium, reaches an attractor and identifies it. However there are attractors of another type: hidden attractors, a basin of attraction of which does not contain neighborhoods of equilibria. In the present Letter for localization of hidden attractors of Chua's circuit it is suggested to use a special analytical-numerical algorithm. -- Highlights: → There are hidden attractors: basin doesn't contain neighborhoods of equilibria. → Hidden attractors cannot be reached by trajectory from neighborhoods of equilibria. → We suggested special procedure for localization of hidden attractors. → We discovered hidden attractor in Chua's system, L. Chua in his work didn't expect this.

Beam phase space and emittance

International Nuclear Information System (INIS)

Buon, J.

1990-12-01

The classical and elementary results for canonical phase space, the Liouville theorem and the beam emittance are reviewed. Then, the importance of phase portraits to obtain a geometrical description of motion is emphasized, with examples in accelerator physics. Finally, a statistical point of view is used to define beam emittance, to study its law of approximate conservation and to treat two particular examples

Market impact and trading profile of hidden orders in stock markets.

Science.gov (United States)

Moro, Esteban; Vicente, Javier; Moyano, Luis G; Gerig, Austin; Farmer, J Doyne; Vaglica, Gabriella; Lillo, Fabrizio; Mantegna, Rosario N

2009-12-01

We empirically study the market impact of trading orders. We are specifically interested in large trading orders that are executed incrementally, which we call hidden orders. These are statistically reconstructed based on information about market member codes using data from the Spanish Stock Market and the London Stock Exchange. We find that market impact is strongly concave, approximately increasing as the square root of order size. Furthermore, as a given order is executed, the impact grows in time according to a power law; after the order is finished, it reverts to a level of about 0.5-0.7 of its value at its peak. We observe that hidden orders are executed at a rate that more or less matches trading in the overall market, except for small deviations at the beginning and end of the order.

Hidden Liquidity: Determinants and Impact

OpenAIRE

Gökhan Cebiroglu; Ulrich Horst

2012-01-01

We cross-sectionally analyze the presence of aggregated hidden depth and trade volume in the S&P 500 and identify its key determinants. We find that the spread is the main predictor for a stock’s hidden dimension, both in terms of traded and posted liquidity. Our findings moreover suggest that large hidden orders are associated with larger transaction costs, higher price impact and increased volatility. In particular, as large hidden orders fail to attract (latent) liquidity to the market, ...

Generalized superradiant assembly for nanophotonic thermal emitters

Science.gov (United States)

Mallawaarachchi, Sudaraka; Gunapala, Sarath D.; Stockman, Mark I.; Premaratne, Malin

2018-03-01

Superradiance explains the collective enhancement of emission, observed when nanophotonic emitters are arranged within subwavelength proximity and perfect symmetry. Thermal superradiant emitter assemblies with variable photon far-field coupling rates are known to be capable of outperforming their conventional, nonsuperradiant counterparts. However, due to the inability to account for assemblies comprising emitters with various materials and dimensional configurations, existing thermal superradiant models are inadequate and incongruent. In this paper, a generalized thermal superradiant assembly for nanophotonic emitters is developed from first principles. Spectral analysis shows that not only does the proposed model outperform existing models in power delivery, but also portrays unforeseen and startling characteristics during emission. These electromagnetically induced transparency like (EIT-like) and superscattering-like characteristics are reported here for a superradiant assembly, and the effects escalate as the emitters become increasingly disparate. The fact that the EIT-like characteristics are in close agreement with a recent experimental observation involving the superradiant decay of qubits strongly bolsters the validity of the proposed model.

Internal emitter research and standard setting

International Nuclear Information System (INIS)

Stannard, J.N.

1981-01-01

The history of the use of data from internal emitter research in the derivation of safety standards is reviewed. At first, observed biological effects were correlated with body burdens or exposure levels. This direct approach is illustrated by detailed accounts of the cases of uranium and plutonium. In the 1950's, when it was decided to provide standards for over 200 isotopes, the direct approach was replaced by a system of calculations. This necessitated changes in internal emitter research programs to provide metabolic data, and the development of models such as Reference Man and the Lung and Gastrointestinal Tract models. The continuing contribution of internal emitter research to standard setting can be seen in the references quoted in the metabolic data section of the new ICRP report (ICRP Publication 30). Present trends suggest a possible return to the direct use of internal emitter effects data for obtaining risk estimates. (U.K.)

Postabsorption concentration peaks with brand-name and generic verapamil: a double-blind, crossover study in elderly hypertensive patients.

Science.gov (United States)

Saseen, J J; Porter, J A; Barnette, D J; Bauman, J L; Zajac, E J; Carter, B L

1997-06-01

The pharmacokinetic actions, bioequivalence, and cardiovascular effects of two verapamil products were studied in a randomized, double-blind, crossover study in eight elderly hypertensive patients (median age, 69.5 years; range, 60-79 years) given brand-name or generic immediate-release verapamil in 120-mg twice-daily doses for 14 days. Blood pressures, heart rates, P-R intervals; and serum concentrations of R-/S-verapamil and norverapamil were measured multiple times in patients during the last day of each therapy. Median blood pressure decreased more with generic verapamil than with the brand-name drug, with the largest difference occurring at 0.5 hours (137/74 mmHg versus 144.5/80.5 mmHg; P = 0.05 and 0.091, respectively). Pharmacokinetic parameters were not different for the two products (P generic product, compared with the brand-name drug, had mean area under the concentration-time curve (time 0 to 12 hours) ratios (90% CI) of 1.09 (0.78-1.52), 1.16 (0.87-1.55) and 1.11 (0.81-1.52) for R-, S-, and total verapamil. Seventy concentration peaks (31 with the brand-name drug, 39 with the generic drug) appeared between 8 and 24 hours. Median percentages of increase of these peaks, compared with those of previous concentrations, were 48.3% and 36.3% for brand-name and generic drugs, respectively. Fifty of the 70 peaks (71%) were associated with a stereospecific concentration peak of norverapamil and, temporally, with meals. Our findings suggest that whereas the two verapamil products may not be bioequivalent by Food and Drug Administration criteria, the observed differences in effects were not clinically significant in this elderly population. Multiple concentration peaks after absorption were observed in all patients with both verapamil products and were perhaps related to enterohepatic recirculation.

Large magnetocurrents in double-barrier tunneling transistors

International Nuclear Information System (INIS)

Lee, J.H.; Jun, K.-I.; Shin, K.-H.; Park, S.Y.; Hong, J.K.; Rhie, K.; Lee, B.C.

2005-01-01

Magnetic tunneling transistors (MTT) with double tunneling barriers are fabricated. The structure of the transistor is AFM/FM/I/FM/I/FM/AFM, and ferromagnetic layers serve as the emitter, base and collector. This double-barrier tunneling transistor (DBTT) has an advantage of controlling the potential between the base and collector, compared to the Schottky-barrier-based base and collector of MTT. We found that the collector current density of DBTT is at least 10 3 times larger than that of conventional MTT, since tunneling through AlO x barrier provides much larger current density than that through Schottky barrier

Solid-state single-photon emitters

Science.gov (United States)

Aharonovich, Igor; Englund, Dirk; Toth, Milos

2016-10-01

Single-photon emitters play an important role in many leading quantum technologies. There is still no 'ideal' on-demand single-photon emitter, but a plethora of promising material systems have been developed, and several have transitioned from proof-of-concept to engineering efforts with steadily improving performance. Here, we review recent progress in the race towards true single-photon emitters required for a range of quantum information processing applications. We focus on solid-state systems including quantum dots, defects in solids, two-dimensional hosts and carbon nanotubes, as these are well positioned to benefit from recent breakthroughs in nanofabrication and materials growth techniques. We consider the main challenges and key advantages of each platform, with a focus on scalable on-chip integration and fabrication of identical sources on photonic circuits.

A low emittance configuration for spear

International Nuclear Information System (INIS)

Blumberg, L.N.; Cerino, J.; Harris, J.; Hettel, R.; Hofmann, A.; Liu, R.Z.; Stego, R.; Wiedemann, H.; Winick, H.

1985-01-01

The quality of synchrotron radiation beams from SPEAR, in particular the brilliance of undulator radiation, can be improved significantly by reducing the emittance of the stored electron beam. A reduction of the horizontal emittance by a factor of 3.5 to a value of 130 nanometer-radians (nm-r) at 3 GeV has been achieved by using stronger focussing, mainly in the horizontal plane. The low emittance configuration also reduces the dispersion and vertical beta functions in the straight sections, making them more suitable for wigglers. The higher betatron tunes lead to a larger phase advance between the two kickers, which has to be corrected during injection by shunting current from some quadrupoles. The configuration was optimized within SPEAR hardware limitations and tested for dynamic aperture with the tracking program PATRICIA. After implementation of this scheme, beam was successfully injected and accumulated. The measured emittance of the stored beam was in agreement with calculations. Presently the configuration is being made operational

Emittance growth rates for displaced beams

International Nuclear Information System (INIS)

Anderson, O.A.

1993-05-01

Emittance growth rates have been previously analyzed for nonuniform beams in linear channels and for initially uniform mismatched beams in nonlinear channels. These studies were for centered beams. Additional emittance growth can arise in cases where the beam is initially displaced. The purpose of this study is to obtain growth rates for displaced beams. This work differs from studies involving random displacement of electrodes. Our analysis assumes instead that the focusing system is perfectly aligned but that the beam is initially displaced with respect to the equilibrium axis. If the focusing force is slightly nonlinear, we find a gradual transfer of the potential energy of beam displacement into kinetic energy associated with emittance growth. We present explicit results for the emittance growth distance as a function of the nonlinearity of the channel. These results will have practical importance for designers of accelerators and transport systems when setting realistic tolerances for initial beam alignment. These tolerances will depend on the nonlinearity and the length of the system

Emittance variations in current-amplifying ion induction linacs

International Nuclear Information System (INIS)

Fessenden, T.J.

1991-01-01

Since 1985 the Heavy Ion Fusion Accelerator Research program at the Lawrence Berkeley Laboratory has been studying current amplification and emittance variations in MBE-4, a four-cesium-beam induction linac. This experiment models much of the accelerator physics of the electrostatically focused section of a fusion driver. Four space-charge dominated Cs + beams, initially about one meter in length at currents of 5-10 mA, are focused by electrostatic quadrupoles and accelerated in parallel from approximately 200 keV up to one MeV by 24 accelerating gaps. Final currents of 20-40 mA per beam are typical. Recent experiments with extremely low emittance beams (var-epsilon n =0.03 mm-mRad) have investigated variations of transverse and longitudinal normalized emittance for drifting and accelerating beams. These very strongly tune-depressed beams (σ 0 =72 degree, σ∼6 degree) are difficult to match to the accelerator so as to avoid emittance growth during acceleration. During transport strong emittance fluctuations are observed in good qualitative agreement with simulations. Warmer beams with less tune depression exhibit little to no emittance growth, show smaller emittance fluctuations, and are much easier to match. A summary of findings from the MBE-4 studies is presented

Emittance variations in current-amplifying ion induction linacs

International Nuclear Information System (INIS)

Fessenden, T.J.

1991-04-01

Since 1985 the Heavy Ion Fusion Accelerator Research program at the Lawrence Berkeley Laboratory has been studying current amplification and emittance variations in MBE-4, a four-cesium-beam induction linac. This experiment models much of the accelerator physics of the electrostatically focused section of a fusion driver. Four space-charge dominated Cs + beams, initially about one meter in length at currents of 5--10 mA, are focused by electrostatic quadrupoles and accelerated in parallel from approximately 200 keV up to one MeV by 24 accelerating gaps. Final currents of 20--40 mA per beam are typical. Recent experiments with extremely low emittance beams (ε n = 0.03 mm-mRad) have investigated variations of transverse and longitudinal normalized emittance for drifting and accelerating beams. These very strongly tune-depressed beams (σ o = 72 degrees, σ∼6 degree) are difficult to match the accelerator so as to avoid emittance growth during acceleration. During transport strong emittance fluctuations are observed in good qualitative agreement with simulations. Warmer beams with less tune depression exhibit little to no emittance growth, show smaller emittance fluctuations, and are much easier to match. A summary of findings from the MBE-4 studies is presented. 12 refs., 8 figs

Timing at peak force may be the hidden target controlled in continuation and synchronization tapping.

Science.gov (United States)

Du, Yue; Clark, Jane E; Whitall, Jill

2017-05-01

Timing control, such as producing movements at a given rate or synchronizing movements to an external event, has been studied through a finger-tapping task where timing is measured at the initial contact between finger and tapping surface or the point when a key is pressed. However, the point of peak force is after the time registered at the tapping surface and thus is a less obvious but still an important event during finger tapping. Here, we compared the time at initial contact with the time at peak force as participants tapped their finger on a force sensor at a given rate after the metronome was turned off (continuation task) or in synchrony with the metronome (sensorimotor synchronization task). We found that, in the continuation task, timing was comparably accurate between initial contact and peak force. These two timing events also exhibited similar trial-by-trial statistical dependence (i.e., lag-one autocorrelation). However, the central clock variability was lower at the peak force than the initial contact. In the synchronization task, timing control at peak force appeared to be less variable and more accurate than that at initial contact. In addition to lower central clock variability, the mean SE magnitude at peak force (SEP) was around zero while SE at initial contact (SEC) was negative. Although SEC and SEP demonstrated the same trial-by-trial statistical dependence, we found that participants adjusted the time of tapping to correct SEP, but not SEC, toward zero. These results suggest that timing at peak force is a meaningful target of timing control, particularly in synchronization tapping. This result may explain the fact that SE at initial contact is typically negative as widely observed in the preexisting literature.

Gamma flux responsive self-powered detector with a tubular emitter

International Nuclear Information System (INIS)

Goldstein, N.P.; Todt, W.H.

1982-01-01

A gamma-sensitive flux detector comprises tubular emitter, an insulating core within the emitter and an insulating layer about the emitter, and a tubular conductive collector electrode about the insulating layer. The emitter material may be platinum, lead, bismuth, tantalum, tungsten; platinum preferred

Emittance Growth in the NLCTA First Chicane

International Nuclear Information System (INIS)

Sun, Yipeng

2011-01-01

In this paper, the emittance growth in the NLCTA (Next Linear Collider Test Accelerator) first chicane region is evaluated by simulation studies. It is demonstrated that the higher order fields of the chicane dipole magnet and the dipole corrector magnet (which is attached on the quadrupoles) are the main contributions for the emittance growth, especially for the case with a large initial emittance (γε 0 = 5 (micro)m for instance). These simulation results agree with the experimental observations.

A combined emitter threat assessment method based on ICW-RCM

Science.gov (United States)

Zhang, Ying; Wang, Hongwei; Guo, Xiaotao; Wang, Yubing

2017-08-01

Considering that the tradition al emitter threat assessment methods are difficult to intuitively reflect the degree of target threaten and the deficiency of real-time and complexity, on the basis of radar chart method(RCM), an algorithm of emitter combined threat assessment based on ICW-RCM (improved combination weighting method, ICW) is proposed. The coarse sorting is integrated with fine sorting in emitter combined threat assessment, sequencing the emitter threat level roughly accordance to radar operation mode, and reducing task priority of the low-threat emitter; On the basis of ICW-RCM, sequencing the same radar operation mode emitter roughly, finally, obtain the results of emitter threat assessment through coarse and fine sorting. Simulation analyses show the correctness and effectiveness of this algorithm. Comparing with classical method of emitter threat assessment based on CW-RCM, the algorithm is visual in image and can work quickly with lower complexity.

Measurements of Thermal Emittance for Cesium Telluride Photocathodes at PITZ

CERN Document Server

Miltchev, V; Grabosch, H J; Han, J H; Krasilnikov, M; Oppelt, A; Petrosian, B; Staykov, L; Stephan, F

2005-01-01

The thermal emittance determines the lower emittance limit and its measurement is of high importance to understand the ultimate injector performance. In this contribution we present results of thermal emittance measurements under rf operation conditions for various Cs2Te cathodes and different accelerating gradients. Measurements of thermal emittance scaling with the cathode laser spot size are presented and analysed. The significance of the Schottky effect in the emittance formation process is discussed.

Electron emitter pulsed-type cylindrical IEC

International Nuclear Information System (INIS)

Miley, G.H.; Gu, Y.; Stubbers, R.; Zich, R.; Anderl, R.; Hartwell, J.

1997-01-01

A cylindrical version of the single grid Inertial Electrostatic Confinement (IEC) device (termed the C-device) has been developed for use as a 2.5-MeV D-D fusion neutron source for neutron activation analysis. The C-device employs a hollow-tube type cathode with similar anodes backed up by ''reflector'' dishes. The resulting discharge differs from a conventional hollow cathode discharge, by creating an explicit ion beam which is ''pinched'' in the cathode region. Resulting fusion reactions generate ∼10 6 neutron/s. A pulsed version is under development for applications requiring higher fluxes. Several pulsing techniques are under study, including an electron emitter (e-emitter) assisted discharge in a thorated tungsten wire emitter located behind a slotted area in the reflector dishes. Pulsing is initiated after establishing a low power steady-state discharge by pulsing the e-emitter current using a capacitor switch type circuit. The resulting electron jet, coupled with the discharge by the biased slot array, creates a strong pulse in the pinched ion beam. The pulse length/repetition rate are controlled by the e-emitter pulse circuit. Typical parameters in present studies are ∼30micros, 10Hz and 1-amp ion current. Corresponding neutron measurements are an In-foil type activation counter for time averaged rates. Results for a wide variety of operating conditions are presented

Emittance and beam size distortion due to linear coupling

International Nuclear Information System (INIS)

Parzen, G.

1993-01-01

At injection, the presence of linear coupling may result in an increased beam emittance and in increased beam dimensions. Results for the emittance in the presence of linear coupling will be found. These results for the emittance distortion show that the harmonics of the skew quadrupole field close to ν x + ν y are the important harmonics. Results will be found for the important driving terms for the emittance distortion. It will be shown that if these driving terms are corrected, then the total emittance is unchanged, var-epsilon x + var-epsilon y = var-epsilon 1 + var-epsilon 2 . Also, the increase in the beam dimensions will be limited to a factor which is less than 1.414. If the correction is good enough, see below for details, one can achieve var-epsilon 1 = var-epsilon x , var-epsilon 2 = var-epsilon where var-epsilon 1 , var-epsilon 2 are the emittances in the presence of coupling, and the beam dimensions are unchanged. Global correction of the emittance and beam size distortion appears possible

The Quantum Efficiency and Thermal Emittance of Metal Photocathodes

International Nuclear Information System (INIS)

Dowell, D.

2009-01-01

Modern electron beams have demonstrated the brilliance needed to drive free electron lasers at x-ray wavelengths, with the principle improvements occurring since the invention of the photocathode gun. The state-of-the-art normalized emittance electron beams are now becoming limited by the thermal emittance of the cathode. In both DC and RF photocathode guns, details of the cathode emission physics strongly influence the quantum efficiency and the thermal emittance. Therefore improving cathode performance is essential to increasing the brightness of beams. It is especially important to understand the fundamentals of cathode quantum efficiency and thermal emittance. This paper investigates the relationship between the quantum efficiency and the thermal emittance of metal cathodes using the Fermi-Dirac model for the electron distribution. We derive the thermal emittance and its relationship to the quantum efficiency, and compare our results to those of others

Observation of High Transformer Ratio of Shaped Bunch Generated by an Emittance-Exchange Beam Line.

Science.gov (United States)

Gao, Q; Ha, G; Jing, C; Antipov, S P; Power, J G; Conde, M; Gai, W; Chen, H; Shi, J; Wisniewski, E E; Doran, D S; Liu, W; Whiteford, C E; Zholents, A; Piot, P; Baturin, S S

2018-03-16

Collinear wakefield acceleration has been long established as a method capable of generating ultrahigh acceleration gradients. Because of the success on this front, recently, more efforts have shifted towards developing methods to raise the transformer ratio (TR). This figure of merit is defined as the ratio of the peak acceleration field behind the drive bunch to the peak deceleration field inside the drive bunch. TR is always less than 2 for temporally symmetric drive bunch distributions and therefore recent efforts have focused on generating asymmetric distributions to overcome this limitation. In this Letter, we report on using the emittance-exchange method to generate a shaped drive bunch to experimentally demonstrate a TR≈5 in a dielectric wakefield accelerator.

Cooperative spontaneous emission of nano-emitters with inter-emitter coupling in a leaky microcavity

International Nuclear Information System (INIS)

Hong, Suc-Kyoung; Nam, Seog Woo; Yang, Hyung Jin

2015-01-01

We study the spontaneous emission from a few two-level nano-emitters placed in a leaky microcavity with Lorentzian spectral density near a critically damped regime. Collective features of the spontaneous emission are investigated by numerical analysis of the excitation dynamics when initially one nano-emitter is totally excited but we do not know which one. The results show that there are three decay rates in the excitation dynamics, two for simple exponential decays and one for damped oscillatory decay. The excitation dynamics is found to critically depend on the regime of the system. It is shown that the spontaneous emission is enhanced or suppressed depending on whether the system is in the underdamped or overdamped regime, respectively. On the other hand, the cooperative spontaneous emission is suppressed in the underdamped while it is enhanced in the overdamped regime. Furthermore, the effect of the direct inter-emitter coupling on the breaking of the cooperativeness of the spontaneous emission is shown as well. (paper)

Hidden Curriculum: An Analytical Definition

Directory of Open Access Journals (Sweden)

Mohammad Reza Andarvazh

2018-03-01

Full Text Available Background: The concept of hidden curriculum was first used by Philip Jackson in 1968, and Hafferty brought this concept to the medical education. Many of the subjects that medical students learn are attributed to this curriculum. So far several definitions have been presented for the hidden curriculum, which on the one hand made this concept richer, and on the other hand, led to confusion and ambiguity.This paper tries to provide a clear and comprehensive definition of it.Methods: In this study, concept analysis of McKenna method was used. Using keywords and searching in the databases, 561 English and 26 Persian references related to the concept was found, then by limitingthe research scope, 125 abstracts and by finding more relevant references, 55 articles were fully studied.Results: After analyzing the definitions by McKenna method, the hidden curriculum is defined as follows: The hidden curriculum is a hidden, powerful, intrinsic in organizational structure and culture and sometimes contradictory message, conveyed implicitly and tacitly in the learning environment by structural and human factors and its contents includes cultural habits and customs, norms, values, belief systems, attitudes, skills, desires and behavioral and social expectations can have a positive or negative effect, unplanned, neither planners nor teachers, nor learners are aware of it. The ultimate consequence of the hidden curriculum includes reproducing the existing class structure, socialization, and familiarizing learners for transmission and joining the professional world.Conclusion: Based on the concept analysis, we arrived at an analytical definition of the hidden curriculum that could be useful for further studies in this area.Keywords: CONCEPT ANALYSIS, HIDDEN CURRICULUM, MCKENNA’S METHOD

Hidden particle production at the ILC

International Nuclear Information System (INIS)

Fujii, Keisuke; Itoh, Hideo; Okada, Nobuchika; Hano, Hitoshi; Yoshioka, Tamaki

2008-01-01

In a class of new physics models, the new physics sector is completely or partly hidden, namely, a singlet under the standard model (SM) gauge group. Hidden fields included in such new physics models communicate with the standard model sector through higher-dimensional operators. If a cutoff lies in the TeV range, such hidden fields can be produced at future colliders. We consider a scalar field as an example of the hidden fields. Collider phenomenology on this hidden scalar is similar to that of the SM Higgs boson, but there are several features quite different from those of the Higgs boson. We investigate productions of the hidden scalar at the International Linear Collider (ILC) and study the feasibility of its measurements, in particular, how well the ILC distinguishes the scalar from the Higgs boson, through realistic Monte Carlo simulations.

Diamondoid monolayers as electron emitters

Science.gov (United States)

Yang, Wanli [El Cerrito, CA; Fabbri, Jason D [San Francisco, CA; Melosh, Nicholas A [Menlo Park, CA; Hussain, Zahid [Orinda, CA; Shen, Zhi-Xun [Stanford, CA

2012-04-10

Provided are electron emitters based upon diamondoid monolayers, preferably self-assembled higher diamondoid monolayers. High intensity electron emission has been demonstrated employing such diamondoid monolayers, particularly when the monolayers are comprised of higher diamondoids. The application of such diamondoid monolayers can alter the band structure of substrates, as well as emit monochromatic electrons, and the high intensity electron emissions can also greatly improve the efficiency of field-effect electron emitters as applied to industrial and commercial applications.

Nanodiamond Emitters of Single Photons

Directory of Open Access Journals (Sweden)

Vlasov I.I.

2015-01-01

Full Text Available Luminescence properties of single color centers were studied in nanodiamonds of different origin. It was found that single photon emitters could be realized even in molecularsized diamond (less than 2 nm capable of housing stable luminescent center “silicon-vacancy.” First results on incorporation of single-photon emitters based on luminescent nanodiamonds in plasmonic nanoantennas to enhance the photon count rate and directionality, diminish the fluorescence decay time, and provide polarization selectivity are presented.

Tolerances for the vertical emittance in damping rings

International Nuclear Information System (INIS)

Raubenheimer, T.O.

1991-11-01

Future damping rings for linear colliders will need to have very small vertical emittances. In the limit of low beam current, the vertical emittance is primarily determined by the vertical dispersion and the betatron coupling. In this paper, the contributions to these effects from random misalignments are calculated and tolerances are derived to limit the vertical emittance with a 95% confidence level. 10 refs., 5 figs

Probing hidden sector photons through the Higgs window

International Nuclear Information System (INIS)

Ahlers, M.

2008-07-01

We investigate the possibility that a (light) hidden sector extra photon receives its mass via spontaneous symmetry breaking of a hidden sector Higgs boson, the so-called hidden-Higgs. The hidden-photon can mix with the ordinary photon via a gauge kinetic mixing term. The hidden-Higgs can couple to the Standard Model Higgs via a renormalizable quartic term - sometimes called the Higgs Portal. We discuss the implications of this light hidden-Higgs in the context of laser polarization and light-shining-through-the-wall experiments as well as cosmological, astrophysical, and non-Newtonian force measurements. For hidden-photons receiving their mass from a hidden-Higgs we find in the small mass regime significantly stronger bounds than the bounds on massive hidden sector photons alone. (orig.)

Probing hidden sector photons through the Higgs window

International Nuclear Information System (INIS)

Ahlers, Markus; Jaeckel, Joerg; Redondo, Javier; Ringwald, Andreas

2008-01-01

We investigate the possibility that a (light) hidden sector extra photon receives its mass via spontaneous symmetry breaking of a hidden sector Higgs boson, the so-called hidden-Higgs. The hidden-photon can mix with the ordinary photon via a gauge kinetic mixing term. The hidden-Higgs can couple to the standard model Higgs via a renormalizable quartic term - sometimes called the Higgs portal. We discuss the implications of this light hidden-Higgs in the context of laser polarization and light-shining-through-the-wall experiments as well as cosmological, astrophysical, and non-Newtonian force measurements. For hidden-photons receiving their mass from a hidden-Higgs, we find in the small mass regime significantly stronger bounds than the bounds on massive hidden sector photons alone.

Beam emittance measurements on multicusp ion sources

Energy Technology Data Exchange (ETDEWEB)

Sarstedt, M.; Lee, Y.; Leung, K.N. [and others

1995-08-01

Multicusp ion sources are used for various applications. Presently, the implementation of this type of ion source planned for the development of an ion beam lithography machine, which will be used for the projection of sub-0.2 {mu}m patterns onto a wafer substrate. Since, for this application, a very good beam quality and a small ion energy spread are required, emittance measurements have been performed on a multicusp ion source for various source conditions. It is shown that the installation of proper capacitors between the extraction electrodes is necessary to avoid rf-pickup, which otherwise leads to a distortion of the beam emittance. The influence of the magnetic filter field on the beam emittance has been investigated, and the beam emittance of a dc filament-discharge plasma has also been compared to that of an rf-generated plasma.

Beam emittance measurements on multicusp ion sources

International Nuclear Information System (INIS)

Sarstedt, M.; Lee, Y.; Leung, K.N.

1995-08-01

Multicusp ion sources are used for various applications. Presently, the implementation of this type of ion source planned for the development of an ion beam lithography machine, which will be used for the projection of sub-0.2 μm patterns onto a wafer substrate. Since, for this application, a very good beam quality and a small ion energy spread are required, emittance measurements have been performed on a multicusp ion source for various source conditions. It is shown that the installation of proper capacitors between the extraction electrodes is necessary to avoid rf-pickup, which otherwise leads to a distortion of the beam emittance. The influence of the magnetic filter field on the beam emittance has been investigated, and the beam emittance of a dc filament-discharge plasma has also been compared to that of an rf-generated plasma

Efficient Text Encryption and Hiding with Double-Random Phase-Encoding

Directory of Open Access Journals (Sweden)

Mohammad S. Alam

2012-10-01

Full Text Available In this paper, a double-random phase-encoding technique-based text encryption and hiding method is proposed. First, the secret text is transformed into a 2-dimensional array and the higher bits of the elements in the transformed array are used to store the bit stream of the secret text, while the lower bits are filled with specific values. Then, the transformed array is encoded with double-random phase-encoding technique. Finally, the encoded array is superimposed on an expanded host image to obtain the image embedded with hidden data. The performance of the proposed technique, including the hiding capacity, the recovery accuracy of the secret text, and the quality of the image embedded with hidden data, is tested via analytical modeling and test data stream. Experimental results show that the secret text can be recovered either accurately or almost accurately, while maintaining the quality of the host image embedded with hidden data by properly selecting the method of transforming the secret text into an array and the superimposition coefficient. By using optical information processing techniques, the proposed method has been found to significantly improve the security of text information transmission, while ensuring hiding capacity at a prescribed level.

Insight: Exploring Hidden Roles in Collaborative Play

Directory of Open Access Journals (Sweden)

Tricia Shi

2015-06-01

Full Text Available This paper looks into interaction modes between players in co-located, collaborative games. In particular, hidden traitor games, in which one or more players is secretly working against the group mission, has the effect of increasing paranoia and distrust between players, so this paper looks into the opposite of a hidden traitor – a hidden benefactor. Rather than sabotaging the group mission, the hidden benefactor would help the group achieve the end goal while still having a reason to stay hidden. The paper explores what games with such a role can look like and how the role changes player interactions. Finally, the paper addresses the divide between video game and board game interaction modes; hidden roles are not common within video games, but they are of growing prevalence in board games. This fact, combined with the exploration of hidden benefactors, reveals that hidden roles is a mechanic that video games should develop into in order to match board games’ complexity of player interaction modes.

Hidden attractors in dynamical systems

Science.gov (United States)

Dudkowski, Dawid; Jafari, Sajad; Kapitaniak, Tomasz; Kuznetsov, Nikolay V.; Leonov, Gennady A.; Prasad, Awadhesh

2016-06-01

Complex dynamical systems, ranging from the climate, ecosystems to financial markets and engineering applications typically have many coexisting attractors. This property of the system is called multistability. The final state, i.e., the attractor on which the multistable system evolves strongly depends on the initial conditions. Additionally, such systems are very sensitive towards noise and system parameters so a sudden shift to a contrasting regime may occur. To understand the dynamics of these systems one has to identify all possible attractors and their basins of attraction. Recently, it has been shown that multistability is connected with the occurrence of unpredictable attractors which have been called hidden attractors. The basins of attraction of the hidden attractors do not touch unstable fixed points (if exists) and are located far away from such points. Numerical localization of the hidden attractors is not straightforward since there are no transient processes leading to them from the neighborhoods of unstable fixed points and one has to use the special analytical-numerical procedures. From the viewpoint of applications, the identification of hidden attractors is the major issue. The knowledge about the emergence and properties of hidden attractors can increase the likelihood that the system will remain on the most desirable attractor and reduce the risk of the sudden jump to undesired behavior. We review the most representative examples of hidden attractors, discuss their theoretical properties and experimental observations. We also describe numerical methods which allow identification of the hidden attractors.

Test results on two thermionic converters with cermet emitters

International Nuclear Information System (INIS)

Saunders, M.; Danielson, L.; Huffman, F.

1983-01-01

An emitter made of a directionally solidified Mo-Al 2 O 3 , Cr 2 O 3 eutectic was provided by Eindhoven University of Technology in Eindhoven, The Netherlands. Although the high temperature braze cycle used in bonding this electrode to the emitter substrate destroyed its characteristic needle microstructure, the converter gave good performance. Apparently, chemical species evaporated from the emitter onto the collector provided a low collector work function. The resulting low barrier indices suggest that this surface is a promising emitter

Partially Hidden Markov Models

DEFF Research Database (Denmark)

Forchhammer, Søren Otto; Rissanen, Jorma

1996-01-01

Partially Hidden Markov Models (PHMM) are introduced. They differ from the ordinary HMM's in that both the transition probabilities of the hidden states and the output probabilities are conditioned on past observations. As an illustration they are applied to black and white image compression where...

Energy peaks: A high energy physics outlook

Science.gov (United States)

Franceschini, Roberto

2017-12-01

Energy distributions of decay products carry information on the kinematics of the decay in ways that are at the same time straightforward and quite hidden. I will review these properties and discuss their early historical applications, as well as more recent ones in the context of (i) methods for the measurement of masses of new physics particle with semi-invisible decays, (ii) the characterization of Dark Matter particles produced at colliders, (iii) precision mass measurements of Standard Model particles, in particular of the top quark. Finally, I will give an outlook of further developments and applications of energy peak method for high energy physics at colliders and beyond.

Type 2 Active Galactic Nuclei with Double-peaked [O III] Lines. II. Single AGNs with Complex Narrow-line Region Kinematics are More Common than Binary AGNs

Science.gov (United States)

Shen, Yue; Liu, Xin; Greene, Jenny E.; Strauss, Michael A.

2011-07-01

Approximately 1% of low-redshift (z interpreted as either due to kinematics, such as biconical outflows and/or disk rotation of the narrow line region (NLR) around single black holes, or due to the relative motion of two distinct NLRs in a merging pair of AGNs. Here, we report follow-up near-infrared (NIR) imaging and optical slit spectroscopy of 31 double-peaked [O III] type 2 AGNs drawn from the Sloan Digital Sky Survey (SDSS) parent sample presented in Liu et al. The NIR imaging traces the old stellar population in each galaxy, while the optical slit spectroscopy traces the NLR gas. These data reveal a mixture of origins for the double-peaked feature. Roughly 10% of our objects are best explained by binary AGNs at (projected) kpc-scale separations, where two stellar components with spatially coincident NLRs are seen. ~50% of our objects have [O III] emission offset by a few kpc, corresponding to the two velocity components seen in the SDSS spectra, but there are no spatially coincident double stellar components seen in the NIR imaging. For those objects with sufficiently high-quality slit spectra, we see velocity and/or velocity dispersion gradients in [O III] emission, suggestive of the kinematic signatures of a single NLR. The remaining ~40% of our objects are ambiguous and will need higher spatial resolution observations to distinguish between the two scenarios. Our observations therefore favor the kinematics scenario with a single AGN for the majority of these double-peaked [O III] type 2 AGNs. We emphasize the importance of combining imaging and slit spectroscopy in identifying kpc-scale binary AGNs, i.e., in no cases does one of these alone allow an unambiguous identification. We estimate that ~0.5%-2.5% of the z ~ 150 km s-1. Based in part on observations obtained with the 6.5 m Magellan telescopes located at Las Campanas Observatory, Chile, and with the Apache Point Observatory 3.5 m telescope, which is owned and operated by the Astrophysical Research

Transverse emittance growth in staged laser-wakefield acceleration

Directory of Open Access Journals (Sweden)

T. Mehrling

2012-11-01

Full Text Available We present a study on the emittance evolution of electron bunches, externally injected into laser-driven plasma waves using the three-dimensional particle-in-cell (PIC code OSIRIS. Results show order-of-magnitude transverse emittance growth during the injection process, if the electron bunch is not matched to its intrinsic betatron motion inside the wakefield. This behavior is supported by analytic theory reproducing the simulation data to a percent level. The length over which the full emittance growth develops is found to be less than or comparable to the typical dimension of a single plasma module in current multistage designs. In addition, the analytic theory enables the quantitative prediction of emittance degradation in two consecutive accelerators coupled by free-drift sections, excluding this as a scheme for effective emittance-growth suppression, and thus suggests the necessity of beam-matching sections between acceleration stages with fundamental implications on the overall design of staged laser-wakefield accelerators.

Emittance measurements in Grumman 1 MeV beamline

International Nuclear Information System (INIS)

Debiak, T.; Gammel, G.; Melnychuk, S.

1992-01-01

The emittance of a 30 keV H - beam has been measured with an Allison type electrostatic analyser at two positions separated by 85 cm along the Grumman 1 MeV beamline LEBT at low currents (about 4 mA, no Cs 2 O additive in the source) and at higher currents (10-15 mA, with Cs 2 O additive in the source). No emittance growth was observed between the two positions, but, at the higher current level, the emittance was about 60% higher than at the low current level (Σ n ,rms = .0045 π cm-mrad vs. 0070 π cm-mrad). Argon was then introduced up to a partial pressure of 4x10 -5 torr, and the emittance decreased back to a range corresponding to that found at the lower currents. However, beam noise was observed at the downstream position, and there is evidence for a small amount of emittance growth (<20%) between the two positions

Hidden photons in connection to dark matter

Energy Technology Data Exchange (ETDEWEB)

Andreas, Sarah; Ringwald, Andreas [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Goodsell, Mark D. [CPhT, Ecole Polytechnique, Palaiseau (France)

2013-06-15

Light extra U(1) gauge bosons, so called hidden photons, which reside in a hidden sector have attracted much attention since they are a well motivated feature of many scenarios beyond the Standard Model and furthermore could mediate the interaction with hidden sector dark matter.We review limits on hidden photons from past electron beam dump experiments including two new limits from such experiments at KEK and Orsay. In addition, we study the possibility of having dark matter in the hidden sector. A simple toy model and different supersymmetric realisations are shown to provide viable dark matter candidates in the hidden sector that are in agreement with recent direct detection limits.

Hidden photons in connection to dark matter

International Nuclear Information System (INIS)

Andreas, Sarah; Ringwald, Andreas; Goodsell, Mark D.

2013-06-01

Light extra U(1) gauge bosons, so called hidden photons, which reside in a hidden sector have attracted much attention since they are a well motivated feature of many scenarios beyond the Standard Model and furthermore could mediate the interaction with hidden sector dark matter.We review limits on hidden photons from past electron beam dump experiments including two new limits from such experiments at KEK and Orsay. In addition, we study the possibility of having dark matter in the hidden sector. A simple toy model and different supersymmetric realisations are shown to provide viable dark matter candidates in the hidden sector that are in agreement with recent direct detection limits.

Emittance Growth during Bunch Compression in the CTF-II

Energy Technology Data Exchange (ETDEWEB)

Raubenheimer, Tor O

1999-02-26

Measurements of the beam emittance during bunch compression in the CLIC Test Facility (CTF-II) are described. The measurements were made with different beam charges and different energy correlations versus the bunch compressor settings which were varied from no compression through the point of full compression and to over-compression. Significant increases in the beam emittance were observed with the maximum emittance occurring near the point of full (maximal) compression. Finally, evaluation of possible emittance dilution mechanisms indicate that coherent synchrotron radiation was the most likely cause.

Electrohydrodynamic emitters of ion beams

International Nuclear Information System (INIS)

Dudnikov, V.G.; Shabalin, A.L.

1990-01-01

Physical processes determining generation of ion beams with high emission current density in electrohydrodynamic emitters are considered. Electrohydrodynamic effects developing in ion emission features and kinetics of ion interaction in beams with high density are discussed. Factors determining the size of the emission zone, emission stability at high and low currents, cluster generation, increase of energy spread and decrease of brightness are analyzed. Problems on practical provision of stable EHD emitter functioning are considered. 94 refs.; 8 figs.; 1 tab

Emittance measurements in low energy ion storage rings

Science.gov (United States)

Hunt, J. R.; Carli, C.; Resta-López, J.; Welsch, C. P.

2018-07-01

The development of the next generation of ultra-low energy antiproton and ion facilities requires precise information about the beam emittance to guarantee optimum performance. In the Extra-Low ENergy Antiproton storage ring (ELENA) the transverse emittances will be measured by scraping. However, this diagnostic measurement faces several challenges: non-zero dispersion, non-Gaussian beam distributions due to effects of the electron cooler and various systematic errors such as closed orbit offsets and inaccurate rms momentum spread estimation. In addition, diffusion processes, such as intra-beam scattering might lead to emittance overestimates. Here, we present algorithms to efficiently address the emittance reconstruction in presence of the above effects, and present simulation results for the case of ELENA.

POVMs and hidden variables

International Nuclear Information System (INIS)

Stairs, Allen

2007-01-01

Recent results by Paul Busch and Adan Cabello claim to show that by appealing to POVMs, non-contextual hidden variables can be ruled out in two dimensions. While the results of Busch and Cabello are mathematically correct, interpretive problems render them problematic as no hidden variable proofs

Transverse emittance measurement and preservation at the LHC

Energy Technology Data Exchange (ETDEWEB)

Kuhn, Maria

2016-06-20

The Large Hadron Collider (LHC) at CERN is a high energy storage ring that provides proton and heavy ion collisions to study fundamental particle physics. The luminosity production is closely linked to emittance preservation in the accelerator. The transverse emittance is the phase space density of the beam and should be conserved when the particle beam is transformed through the accelerator. Perturbing effects, however, can lead to emittance increase and hence luminosity degradation. Measuring the emittance growth is a complex task with high intensity beams and changing energies. The machine optics and the transverse beam size have to be measured as accurately as possible. Beta function measurements with k-modulation are discussed. With this method the quadrupole focussing strength is varied and the resulting tune change is traced to determine the beta function at the quadrupole. A new k-modulation measurement tool was developed for the LHC. The fully automatic and online measurement system takes constraints of various systems such as tune measurement precision and powering limitations of the LHC superconducting circuits into account. With sinusoidal k-modulation record low beta function measurement uncertainties in the LHC have been reached. 2015 LHC beta function and β*, which is the beta function at the collision point, measurements with k-modulation will be presented. Wire scanners and synchrotron light monitors are presently used in the LHC to measure the transverse beam size. Accuracy and limitations of the LHC transverse profile monitors are discussed. During the 2012 LHC proton run it was found that wire scanner photomultiplier saturation added significant uncertainty on all measurements. A large discrepancy between emittances from wire scanners and luminosity was discovered but not solved. During Long Shutdown 1 the wire scanner system was upgraded with new photomultipliers. A thorough study of LHC wire scanner measurement precision in 2015 is presented

Improvements in emittance wake field optimization for the SLAC Linear Collider

CERN Document Server

Decker, Franz Josef

2003-01-01

The transverse emittances in the SLAC Linear Collider can be severely diluted by collective wakefield effects and dispersion. For the 1997/98 SLC/SLD run important changes were implemented in the way the emittance is optimized. Early in the linac, where the energy spread is large due to BNS damping, the emittance growth is dominated by dispersion. In this regime emittance tuning bumps may introduce additional wakefield tails and their use is now avoided. At the end of the linac the energy spread is minimal and the emittance measurement is most sensitive to wakefield emittance dilution. In previous years, the emittances were tuned on wire scanners located near but not at the end of the linac (after about 90% of its length). Simulations show that emittance growth of up to 100% can occur in the remaining 10%. In this run wire scanners at the entrance of the Final Focus, the last place where the emittances can be measured, were used for the optimization. Screens at the end of the linac allow additional real time ...

Field emission characteristics of a small number of carbon fiber emitters

Directory of Open Access Journals (Sweden)

Wilkin W. Tang

2016-09-01

Full Text Available This paper reports an experiment that studies the emission characteristics of small number of field emitters. The experiment consists of nine carbon fibers in a square configuration. Experimental results show that the emission characteristics depend strongly on the separation between each emitter, providing evidence of the electric field screening effects. Our results indicate that as the separation between the emitters decreases, the emission current for a given voltage also decreases. The authors compare the experimental results to four carbon fiber emitters in a linear and square configurations as well as to two carbon fiber emitters in a paired array. Voltage-current traces show that the turn-on voltage is always larger for the nine carbon fiber emitters as compared to the two and four emitters in linear configurations, and approximately identical to the four emitters in a square configuration. The observations and analysis reported here, based on Fowler-Nordheim field emission theory, suggest the electric field screening effect depends critically on the number of emitters, the separation between them, and their overall geometric configuration.

Emittance calculations for the Stanford Linear Collider injector

International Nuclear Information System (INIS)

Sheppard, J.C.; Clendenin, J.E.; Helm, R.H.; Lee, M.J.; Miller, R.H.; Blocker, C.A.

1983-03-01

A series of measurements have been performed to determine the emittance of the high intensity, single bunch beam that is to be injected into the Stanford Linear Collider. On-line computer programs were used to control the Linac for the purpose of data acquisition and to fit the data to a model in order to deduce the beam emittance. This paper will describe the method of emittance calculation and present some of the measurement results

Multi-dimensional beam emittance and β-functions

International Nuclear Information System (INIS)

Buon, J.

1993-05-01

The concept of r.m.s. emittance is extended to the case of several degrees of freedom that are coupled. That multi-dimensional emittance is lower than the product of the emittances attached to each degree of freedom, but is conserved in a linear motion. An envelope-hyperellipsoid is introduced to define the β-functions of the beam envelope. On the contrary of an one-degree of freedom motion, it is emphasized that these envelope functions differ from the amplitude functions of the normal modes of motion as a result of the difference between the Liouville and Lagrange invariants. (author) 4 refs

Beam phase space and emittance

International Nuclear Information System (INIS)

Buon, J.

1992-02-01

The classical and elementary results for canonical phase space, the Liouville theorem and the beam emittance are reviewed. Then, the importance of phase portraits to obtain a geometrical description of motion is emphasized, with examples in accelerator physics. Finally, a statistical point of view is used to define beam emittance, to study its law of approximate conservation, with three particular examples, and to introduce a beam envelope-ellipse and the β-function, emphasing the statistical features of its properties. (author) 14 refs.; 11 figs

Combustion powered thermophotovoltaic emitter system

Energy Technology Data Exchange (ETDEWEB)

McHenry, R.S. [Naval Academy, Annapolis, MD (United States). Naval Architecture, Ocean and Marine Engineering

1995-07-01

The US Naval Academy (USNA) has recently completed an engineering design project for a high temperature thermophotovoltaic (TPV) photon emitter. The final apparatus was to be portable, completely self contained, and was to incorporate cycle efficiency optimization such as exhaust stream recuperation. Through computer modeling and prototype experimentation, a methane fueled emitter system was designed from structural ceramic materials to fulfill the high temperature requirements necessary for high system efficiency. This paper outlines the engineering design process, discusses obstacles and solutions encountered, and presents the final design.

Acetaminophen overdose associated with double serum concentration peaks

Directory of Open Access Journals (Sweden)

Cristian Papazoglu

2015-12-01

Full Text Available Acetaminophen is the most commonly used analgesic–antipyretic medication in the United States. Acetaminophen overdose, a frequent cause of drug toxicity, has been recognized as the leading cause of fatal and non-fatal hepatic necrosis. N-Acetylcysteine is the recommended antidote for acetaminophen poisoning. Despite evidence on the efficacy of N-acetylcysteine for prevention of hepatic injury, controversy persists about the optimal duration of the therapy. Here, we describe the case of a 65-year-old male with acetaminophen overdose and opioid co-ingestion who developed a second peak in acetaminophen serum levels after completing the recommended 21-hour intravenous N-acetylcysteine protocol and when the standard criteria for monitoring drug levels was achieved. Prolongation of N-acetylcysteine infusion beyond the standard protocol, despite a significant gap in treatment, was critical for successful avoidance of hepatotoxicity. Delay in acetaminophen absorption may be associated with a second peak in serum concentration following an initial declining trend, especially in cases of concomitant ingestion of opioids. In patients with acetaminophen toxicity who co-ingest other medications that may potentially delay gastric emptying or in those with risk factors for delayed absorption of acetaminophen, we recommend close monitoring of aminotransferase enzyme levels, as well as trending acetaminophen concentrations until undetectable before discontinuing the antidote therapy.

Coupling single emitters to quantum plasmonic circuits

DEFF Research Database (Denmark)

Huck, Alexander; Andersen, Ulrik Lund

2016-01-01

In recent years, the controlled coupling of single-photon emitters to propagating surface plasmons has been intensely studied, which is fueled by the prospect of a giant photonic nonlinearity on a nanoscaled platform. In this article, we will review the recent progress on coupling single emitters...

Formation of shallow boron emitters in crystalline silicon using flash lamp annealing: Role of excess silicon interstitials

Energy Technology Data Exchange (ETDEWEB)

Riise, Heine Nygard, E-mail: h.n.riise@fys.uio.no; Azarov, Alexander; Svensson, Bengt G.; Monakhov, Edouard [Department of Physics/Centre for Materials Science and Nanotechnology, University of Oslo, P. O. Box 1048 Blindern, N-0316 Oslo (Norway); Schumann, Thomas; Hübner, Renè; Skorupa, Wolfgang [Institute of Ion Beam Physics and Materials Research, Helmholtz-Zentrum Dresden-Rossendorf, P. O. Box 510119, 01314 Dresden (Germany)

2015-07-13

Shallow, Boron (B)-doped p{sup +} emitters have been realized using spin-on deposition and Flash Lamp Annealing (FLA) to diffuse B into monocrystalline float zone Silicon (Si). The emitters extend between 50 and 140 nm in depth below the surface, have peak concentrations between 9 × 10{sup 19 }cm{sup –3} and 3 × 10{sup 20 }cm{sup –3}, and exhibit sheet resistances between 70 and 3000 Ω/□. An exceptionally large increase in B diffusion occurs for FLA energy densities exceeding ∼93 J/cm{sup 2} irrespective of 10 or 20 ms pulse duration. The effect is attributed to enhanced diffusion of B caused by Si interstitial injection following a thermally activated reaction between the spin-on diffusant film and the silicon wafer.

Theory and measurements of emittance preservation in plasma wakefield acceleration

Energy Technology Data Exchange (ETDEWEB)

Frederico, Joel

2016-12-01

In this dissertation, we examine the preservation and measurement of emittance in the plasma wakefield acceleration blowout regime. Plasma wakefield acceleration (PWFA) is a revolutionary approach to accelerating charged particles that has been demonstrated to have the potential for gradients orders of magnitude greater than traditional approaches. The application of PWFA to the design of a linear collider will make new high energy physics research possible, but the design parameters must first be shown to be competitive with traditional methods. Emittance preservation is necessary in the design of a linear collider in order to maximize luminosity. We examine the conditions necessary for circular symmetry in the PWFA blowout regime, and demonstrate that current proposals meet these bounds. We also present an application of beam lamentation which describes the process of beam parameter and emittance matching. We show that the emittance growth saturates as a consequence of energy spread in the beam. The initial beam parameters determine the amount of emittance growth, while the contribution of energy spread is negligible. We also present a model for ion motion in the presence of a beam that is much more dense than the plasma. By combining the model of ion motion and emittance growth, we find the emittance growth due to ion motion is minimal in the case of marginal ion motion. In addition, we present a simulation that validates the ion motion model, which is under further development to examine emittance growth of both marginal and pronounced ion motion. Finally, we present a proof-of-concept of an emittance measurement which may enable the analysis of emittance preservation in future PWFA experiments.

Measurement of transverse emittance in the Fermilab booster

Energy Technology Data Exchange (ETDEWEB)

Graves, William Sproull [Wisconsin U., Madison

1994-01-01

A new beam profile monitor has been built and installed in the Fermilab Booster synchrotron. It nondestructively measures the beam's vertical density distribution on a fast turn-by-turn basis. This enables one to measure the beam's transverse emittance and to observe emittance growth as it occurs. For high intensities (>2 times 10^{12 } protons), the normalized 95% emittance was observed to grow from 6pi mm-mrad at injection to 16pi mm-mrad at extraction. The initial (<5 msec) emittance growth and beam losses are shown to be caused by the space charge tune shift onto integer and 1/2 integer resonance lines. The growth near injection accounts for approximately 40% of the observed emittance increase throughout the acceleration cycle. The remaining 60% is due to two factors: slow linear growth due to betatron-motion driven by noise in the rf system; and faster growth after the transition energy that is caused by coupling of the longitudinal beam motion into the transverse planes.

Helioscope bounds on hidden sector photons

International Nuclear Information System (INIS)

Redondo, J.

2008-01-01

The flux of hypothetical ''hidden photons'' from the Sun is computed under the assumption that they interact with normal matter only through kinetic mixing with the ordinary standard model photon. Requiring that the exotic luminosity is smaller than the standard photon luminosity provides limits for the mixing parameter down to χ -14 , depending on the hidden photon mass. Furthermore, it is pointed point out that helioscopes looking for solar axions are also sensitive to hidden photons. The recent results of the CAST collaboration are used to further constrain the mixing parameter χ at low masses (m γ' <1 eV) where the luminosity bound is weaker. In this regime the solar hidden photon ux has a sizable contribution of longitudinally polarized hidden photons of low energy which are invisible for current helioscopes. (orig.)

Electromagnetic compatibility of implantable neurostimulators to RFID emitters.

Science.gov (United States)

Pantchenko, Oxana S; Seidman, Seth J; Guag, Joshua W; Witters, Donald M; Sponberg, Curt L

2011-06-09

The objective of this study is to investigate electromagnetic compatibility (EMC) of implantable neurostimulators with the emissions from radio frequency identification (RFID) emitters. Six active implantable neurostimulators with lead systems were tested for susceptibility to electromagnetic fields generated by 22 RFID emitters. These medical devices have been approved for marketing in the U.S. for a number of intended uses that include: epilepsy, depression, incontinence, Parkinsonian tremor and pain relief. Each RFID emitter had one of the following carrier frequencies: 125 kHz, 134 kHz, 13.56 MHz, 433 MHz, 915 MHz and 2.45 GHz. The test results showed the output of one of the implantable neurostimulators was inhibited by 134 kHz RFID emitter at separation distances of 10 cm or less. The output of the same implantable neurostimulator was also inhibited by another 134 kHz RFID emitter at separation distances of 10 cm or less and also showed inconsistent pulsing rate at a separation distance of 15 cm. Both effects occurred during and lasted through out the duration of the exposure. The clinical significance of the effects was assessed by a clinician at the U.S. Food and Drug Administration. The effects were determined to be clinically significant only if they occurred for extended period of time. There were no observed effects from the other 5 implantable neurostimulators or during exposures from other RFID emitters.

Spherical proton emitters

International Nuclear Information System (INIS)

Berg, S.; Semmes, P.B.; Nazarewicz, W.

1997-01-01

Various theoretical approaches to proton emission from spherical nuclei are investigated, and it is found that all the methods employed give very similar results. The calculated decay widths are found to be qualitatively insensitive to the parameters of the proton-nucleus potential, i.e., changing the potential parameters over a fairly large range typically changes the decay width by no more than a factor of ∼3. Proton half-lives of observed heavy proton emitters are, in general, well reproduced by spherical calculations with the spectroscopic factors calculated in the independent quasiparticle approximation. The quantitative agreement with experimental data obtained in our study requires that the parameters of the proton-nucleus potential be chosen carefully. It also suggests that deformed proton emitters will provide invaluable spectroscopic information on the angular momentum decomposition of single-proton orbitals in deformed nuclei. copyright 1997 The American Physical Society

Self-powered detectors with thulium emitter

International Nuclear Information System (INIS)

Haller, P.; Klar, E.

1978-01-01

In addition to fission chambers, prompt-indicating self-powered (SPN) detectors are used for measuring the neutron flux density in the core of power reactors. Although current SPN detectors with a cobalt emitter give satisfactora results, detectors with other emitter materials have been analyzed and tested. The author describes the properties and decay pattern of the nuclide thulium and presents the results of measurements made while testing thulium detectors. (orig.) [de

Managing Hidden Costs of Offshoring

DEFF Research Database (Denmark)

Larsen, Marcus M.; Pedersen, Torben

2014-01-01

This chapter investigates the concept of the ‘hidden costs’ of offshoring, i.e. unexpected offshoring costs exceeding the initially expected costs. Due to the highly undefined nature of these costs, we position our analysis towards the strategic responses of firms’ realisation of hidden costs....... In this regard, we argue that a major response to the hidden costs of offshoring is the identification and utilisation of strategic mechanisms in the organisational design to eventually achieving system integration in a globally dispersed and disaggregated organisation. This is heavily moderated by a learning......-by-doing process, where hidden costs motivate firms and their employees to search for new and better knowledge on how to successfully manage the organisation. We illustrate this thesis based on the case of the LEGO Group....

The Hidden Costs of Offshoring

DEFF Research Database (Denmark)

Møller Larsen, Marcus; Manning, Stephan; Pedersen, Torben

2011-01-01

of offshoring. Specifically, we propose that hidden costs can be explained by the combination of increasing structural, operational and social complexity of offshoring activities. In addition, we suggest that firm orientation towards organizational design as part of an offshoring strategy and offshoring......This study seeks to explain hidden costs of offshoring, i.e. unexpected costs resulting from the relocation of business tasks and activities outside the home country. We develop a model that highlights the role of complexity, design orientation and experience in explaining hidden costs...... experience moderate the relationship between complexity and hidden costs negatively i.e. reduces the cost generating impact of complexity. We develop three hypotheses and test them on comprehensive data from the Offshoring Research Network (ORN). In general, we find support for our hypotheses. A key result...

DNA double-strand break and apoptosis induction in human lymphocytes in different cycle cell phases by 60Co gamma rays and Bragg peak protons of a medical beam

International Nuclear Information System (INIS)

Khachenkova, A.A.; Boreyko, A.V.; Mozhaeva, A.V.; Chausov, V.N.; Ravnachka, I.I.; Amov, I.; Tiunchik, S.I.

2009-01-01

A comparative analysis is made of the regularities in the formation of DNA double-strand break and apoptosis induction in peripheral human blood lymphocytes in different cell cycle phases after 60 Co gamma and extended Bragg peak proton irradiation. It is shown that the formation of apoptotic cells in a lymphocyte population increases linearly in all the cell cycle stages after proton irradiation. The maximal DNA double-strand break and apoptosis yield in lymphocytes is observed in the S phase of the cell cycle

Localization of Narrowband Single Photon Emitters in Nanodiamonds.

Science.gov (United States)

Bray, Kerem; Sandstrom, Russell; Elbadawi, Christopher; Fischer, Martin; Schreck, Matthias; Shimoni, Olga; Lobo, Charlene; Toth, Milos; Aharonovich, Igor

2016-03-23

Diamond nanocrystals that host room temperature narrowband single photon emitters are highly sought after for applications in nanophotonics and bioimaging. However, current understanding of the origin of these emitters is extremely limited. In this work, we demonstrate that the narrowband emitters are point defects localized at extended morphological defects in individual nanodiamonds. In particular, we show that nanocrystals with defects such as twin boundaries and secondary nucleation sites exhibit narrowband emission that is absent from pristine individual nanocrystals grown under the same conditions. Critically, we prove that the narrowband emission lines vanish when extended defects are removed deterministically using highly localized electron beam induced etching. Our results enhance the current understanding of single photon emitters in diamond and are directly relevant to fabrication of novel quantum optics devices and sensors.

Innovative energy efficient low-voltage electron beam emitters

International Nuclear Information System (INIS)

Felis, Kenneth P.; Avnery, Tovi; Berejka, Anthony J.

2002-01-01

Advanced electron beams (AEB) has developed a modular, low voltage (80-125 keV), high beam current (up to 40 ma), electron emitter with typically 25 cm of beam width, that is housed in an evacuated, returnable chamber that is easy to plug in and connect. The latest in nanofabrication enables AEB to use an ultra-thin beam window. The power supply for AEB's emitter is based on solid-state electronics. This combination of features results in a remarkable electrical efficiency. AEB's electron emitter relies on a touch screen, computer control system. With 80 μm of unit density beam penetration, AEB's electron emitter has gained market acceptance in the curing of opaque, pigmented inks and coatings used on flexible substrates, metals and fiber composites and in the curing of adhesives in foil based laminates

Innovative energy efficient low-voltage electron beam emitters

Science.gov (United States)

Felis, Kenneth P.; Avnery, Tovi; Berejka, Anthony J.

2002-03-01

Advanced electron beams (AEB) has developed a modular, low voltage (80-125 keV), high beam current (up to 40 ma), electron emitter with typically 25 cm of beam width, that is housed in an evacuated, returnable chamber that is easy to plug in and connect. The latest in nanofabrication enables AEB to use an ultra-thin beam window. The power supply for AEB's emitter is based on solid-state electronics. This combination of features results in a remarkable electrical efficiency. AEB's electron emitter relies on a touch screen, computer control system. With 80 μm of unit density beam penetration, AEB's electron emitter has gained market acceptance in the curing of opaque, pigmented inks and coatings used on flexible substrates, metals and fiber composites and in the curing of adhesives in foil based laminates.

Gamma-ray escape peak characteristics of radiation-damaged reverse-electrode germanium coaxial detectors

International Nuclear Information System (INIS)

Pehl, R.H.; Hull, E.L.; Madden, N.W.; Xing Jingshu; Friesel, D.L.

1996-01-01

A comparison of the characteristics of full-energy gamma-ray peaks and their corresponding escape peaks when high energy photons interact in radiation damaged reverse-electrode (n-type) germanium coaxial detectors is presented. Coaxial detector geometry is the dominant factor, causing charge collection to be dramatically better for interactions occurring near the outer periphery of the detector as well as increasing of the probability of escape events occurring in this region. It follows that the resolution of escape peaks is better than that of ordinary gamma-ray peaks. This is experimentally verified. A nearly identical but undamaged detector exhibited significant Doppler broadening of single escape peaks. Because double escape events preferentially occur at outer radii, energy shifts of double escape reflect extremely small amounts of charge trapping in undamaged detectors. (orig.)

Evaluations of carbon nanotube field emitters for electron microscopy

Science.gov (United States)

Nakahara, Hitoshi; Kusano, Yoshikazu; Kono, Takumi; Saito, Yahachi

2009-11-01

Brightness of carbon nanotube (CNT) emitters was already reported elsewhere. However, brightness of electron emitter is affected by a virtual source size of the emitter, which strongly depends on electron optical configuration around the emitter. In this work, I- V characteristics and brightness of a CNT emitter are measured under a practical field emission electron gun (e-gun) configuration to investigate availability of CNT for electron microscopy. As a result, it is obtained that an emission area of MWNT is smaller than its tip surface area, and the emission area corresponds to a five-membered-ring with 2nd nearest six-membered-rings on the MWNT cap surface. Reduced brightness of MWNT is measured as at least 2.6×109 A/m 2 sr V. It is concluded that even a thick MWNT has enough brightness under a practical e-gun electrode configuration and suitable for electron microscopy.

Multiple UV reflectance peaks in the iridescent neck feathers of pigeons

Science.gov (United States)

McGraw, Kevin J.

Recent studies of colorful plumage signals in birds have been aided by the finding that birds can see ultraviolet (UV) light and thus may communicate using colors invisible to humans. Some of the pioneering and more pivotal work on avian color vision was performed with domestic pigeons (Columba livia), yet surprisingly there have been few detailed reports of the UV-reflecting properties of pigeon feathers. Here, I use UV-VIS fiber-optic spectrometry to document the full-spectrum reflectance characteristics of iridescent purple and green neck plumage in pigeons. Neck feathers that appear purple to the human eye exhibit four reflectance peaks-two in the UV and one in the blue and red regions-and thus exhibit a UV-purple hue. Neck feathers that appear green to the human eye are characterized by five spectral peaks: two in the UV (UVA and UVB), a predominant green peak, and secondary violet and red peaks, conferring a UV-purple-green color. Such elaborate UV coloration suggests that birds may use an even more complex and `hidden' UV signaling system than previously thought.

Very bright, near-infrared single photon emitters in diamond

Directory of Open Access Journals (Sweden)

D. W. M. Lau

2013-09-01

Full Text Available We demonstrate activation of bright diamond single photon emitters in the near infrared range by thermal annealing alone, i.e., without ion implantation. The activation is crucially dependent on the annealing ambient. The activation of the single photon emitters is only observed when the sample is annealed in forming gas (4% H2 in Ar above temperatures of 1000 °C. By contrast, no emitters are activated by annealing in vacuum, oxygen, argon or deuterium. The emitters activated by annealing in forming gas exhibit very bright emission in the 730-760 nm wavelength range and have linewidths of ∼1.5-2.5 nm at room temperature.

Measurement of emittance of metal interface in molten salt

International Nuclear Information System (INIS)

Araki, N.; Makino, A.; Nakamura, Y.

1995-01-01

A new technique for measuring the total normal emittance of a metal in a semi-transparent liquid has been proposed and this technique has been applied to measure the emittance of stainless steel (SUS304), nickel, and gold in molten potassium nitrate KNO 3 . These emittance data are indispensable to analyzing the radiative heat transfer between a metal and a semitransparent liquid, such as a molten salt

Boundary conditions on the plasma emitter surface in the presence of a particle counter flow: I. Ion emitter

Energy Technology Data Exchange (ETDEWEB)

Astrelin, V. T., E-mail: V.T.Astrelin@inp.nsk.su; Kotelnikov, I. A. [Russian Academy of Sciences, Budker Institute of Nuclear Physics, Siberian Branch (Russian Federation)

2017-02-15

Emission of positively charged ions from a plasma emitter irradiated by a counterpropagating electron beam is studied theoretically. A bipolar diode with a plasma emitter in which the ion temperature is lower than the electron temperature and the counter electron flow is extracted from the ion collector is calculated in the one-dimensional model. An analog of Bohm’s criterion for ion emission in the presence of a counterpropagating electron beam is derived. The limiting density of the counterpropagating beam in a bipolar diode operating in the space-charge-limited-emission regime is calculated. The full set of boundary conditions on the plasma emitter surface that are required for operation of the high-current optics module in numerical codes used to simulate charged particle sources is formulated.

Electromagnetic compatibility of implantable neurostimulators to RFID emitters

Directory of Open Access Journals (Sweden)

Guag Joshua W

2011-06-01

Full Text Available Abstract Background The objective of this study is to investigate electromagnetic compatibility (EMC of implantable neurostimulators with the emissions from radio frequency identification (RFID emitters. Methods Six active implantable neurostimulators with lead systems were tested for susceptibility to electromagnetic fields generated by 22 RFID emitters. These medical devices have been approved for marketing in the U.S. for a number of intended uses that include: epilepsy, depression, incontinence, Parkinsonian tremor and pain relief. Each RFID emitter had one of the following carrier frequencies: 125 kHz, 134 kHz, 13.56 MHz, 433 MHz, 915 MHz and 2.45 GHz Results The test results showed the output of one of the implantable neurostimulators was inhibited by 134 kHz RFID emitter at separation distances of 10 cm or less. The output of the same implantable neurostimulator was also inhibited by another 134 kHz RFID emitter at separation distances of 10 cm or less and also showed inconsistent pulsing rate at a separation distance of 15 cm. Both effects occurred during and lasted through out the duration of the exposure. Conclusions The clinical significance of the effects was assessed by a clinician at the U.S. Food and Drug Administration. The effects were determined to be clinically significant only if they occurred for extended period of time. There were no observed effects from the other 5 implantable neurostimulators or during exposures from other RFID emitters.

Emittance growth and tune spectra at PETRA III

International Nuclear Information System (INIS)

Wanzenberg, R.

2011-08-01

At DESY the PETRA ring has been converted into a synchrotron radiation facility, called PETRA III. 20 damping wigglers have been installed to achieve an emittance of 1 nm. The commissioning with beam started in April 2009 and user runs have been started in 2010. The design current is 100 mA and the bunch to bunch distance is 8 ns for one particular filling pattern with 960 bunches. At a current of about 50 mA a strong vertical emittance increase has been observed. During machine studies it was found that the emittance increase depends strongly on the bunch filling pattern. For the user operation a filling scheme has been found which mitigates the increase of the vertical emittance. In August 2010 PETRA III has been operated without damping wigglers for one week. The vertical emittance growth was not significantly smaller without wigglers. Furthermore tune spectra at PETRA III show characteristic lines which have been observed at other storage rings in the connection with electron clouds. Measurements at PETRA III are presented for different bunch filling patterns and with and without wiggler magnets. (orig.)

A Fast SVD-Hidden-nodes based Extreme Learning Machine for Large-Scale Data Analytics.

Science.gov (United States)

Deng, Wan-Yu; Bai, Zuo; Huang, Guang-Bin; Zheng, Qing-Hua

2016-05-01

Big dimensional data is a growing trend that is emerging in many real world contexts, extending from web mining, gene expression analysis, protein-protein interaction to high-frequency financial data. Nowadays, there is a growing consensus that the increasing dimensionality poses impeding effects on the performances of classifiers, which is termed as the "peaking phenomenon" in the field of machine intelligence. To address the issue, dimensionality reduction is commonly employed as a preprocessing step on the Big dimensional data before building the classifiers. In this paper, we propose an Extreme Learning Machine (ELM) approach for large-scale data analytic. In contrast to existing approaches, we embed hidden nodes that are designed using singular value decomposition (SVD) into the classical ELM. These SVD nodes in the hidden layer are shown to capture the underlying characteristics of the Big dimensional data well, exhibiting excellent generalization performances. The drawback of using SVD on the entire dataset, however, is the high computational complexity involved. To address this, a fast divide and conquer approximation scheme is introduced to maintain computational tractability on high volume data. The resultant algorithm proposed is labeled here as Fast Singular Value Decomposition-Hidden-nodes based Extreme Learning Machine or FSVD-H-ELM in short. In FSVD-H-ELM, instead of identifying the SVD hidden nodes directly from the entire dataset, SVD hidden nodes are derived from multiple random subsets of data sampled from the original dataset. Comprehensive experiments and comparisons are conducted to assess the FSVD-H-ELM against other state-of-the-art algorithms. The results obtained demonstrated the superior generalization performance and efficiency of the FSVD-H-ELM. Copyright © 2016 Elsevier Ltd. All rights reserved.

A polarization-insensitive plasmonic photoconductive terahertz emitter

KAUST Repository

Li, Xurong

2017-11-16

We present a polarization-insensitive plasmonic photoconductive terahertz emitter that uses a two-dimensional array of nanoscale cross-shaped apertures as the plasmonic contact electrodes. The geometry of the cross-shaped apertures is set to maximize optical pump absorption in close proximity to the contact electrodes. The two-dimensional symmetry of the cross-shaped apertures offers a polarization-insensitive interaction between the plasmonic contact electrodes and optical pump beam. We experimentally demonstrate a polarization-insensitive terahertz radiation from the presented emitter in response to a femtosecond optical pump beam and similar terahertz radiation powers compared to previously demonstrated polarization-sensitive photoconductive emitters with plasmonic contact electrode gratings at the optimum optical pump polarization.

Emittance measurement for high-brightness electron guns

International Nuclear Information System (INIS)

Kobayashi, H.; Kurihara, T.; Sato, I.; Asami, A.; Yamazaki, Y.; Otani, S.; Ishizawa, Y.

1992-01-01

An emittance measurement system based on a high-precision pepper-pot technique has been developed for electron guns with low emittance of around πmm-mrad. Electron guns with a 1 mmφ cathode, the material of which is impregnated tungsten or single-crystal lanthanum hexaboride (La 1-x Ce x )B 6 , have been developed. The performance has been evaluated by putting stress on cathode roughness, which gives rise to an angular divergence, according to the precise emittance measurement system. A new type of cathode holder, which is a modified version of the so called Vogel type, was developed and the beam uniformity has been improved. (Author) 5 figs., tab., 9 refs

Evaluations of carbon nanotube field emitters for electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Nakahara, Hitoshi, E-mail: nakahara@nagoya-u.jp [Department of Quantum Engineering, Graduate School of Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan); Kusano, Yoshikazu; Kono, Takumi; Saito, Yahachi [Department of Quantum Engineering, Graduate School of Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan)

2009-11-30

Brightness of carbon nanotube (CNT) emitters was already reported elsewhere. However, brightness of electron emitter is affected by a virtual source size of the emitter, which strongly depends on electron optical configuration around the emitter. In this work, I-V characteristics and brightness of a CNT emitter are measured under a practical field emission electron gun (e-gun) configuration to investigate availability of CNT for electron microscopy. As a result, it is obtained that an emission area of MWNT is smaller than its tip surface area, and the emission area corresponds to a five-membered-ring with 2nd nearest six-membered-rings on the MWNT cap surface. Reduced brightness of MWNT is measured as at least 2.6x10{sup 9} A/m{sup 2} sr V. It is concluded that even a thick MWNT has enough brightness under a practical e-gun electrode configuration and suitable for electron microscopy.

Few emitters in a cavity: from cooperative emission to individualization

International Nuclear Information System (INIS)

Auffeves, A; Portolan, S; Gerace, D; Drezet, A; Franca Santos, M

2011-01-01

We study the temporal correlations of the field emitted by an electromagnetic resonator coupled to a mesoscopic number of two-level emitters that are incoherently pumped by a weak external drive. We solve the master equation of the system for increasing number of emitters and as a function of the cavity quality factor, and we identify three main regimes characterized by well-distinguished statistical properties of the emitted radiation. For small cavity decay rates, the emission events are uncorrelated and the number of photons in the emitted field becomes larger than one, resembling the build-up of a laser field inside the cavity. At intermediate decay rates (as compared with the emitter-cavity coupling) and for a few emitters, the statistics of the emitted radiation is bunched and strikingly dependent on the parity of the number of emitters. The latter property is related to the cooperativity of the emitters mediated by their coupling to the cavity mode, and its connection with steady-state subradiance is discussed. Finally, in the bad cavity regime the typical situation of emission from a collection of individual emitters is recovered. We also analyze how the cooperative behavior evolves as a function of pure dephasing, which allows us to recover the case of a classical source made of an ensemble of independent emitters, similar to what is obtained for a very leaky cavity. State-of-the-art techniques of Q-switch of resonant cavities, allied with the recent capability of tuning single emitters in and out of resonance, suggest this system to be a versatile source of different quantum states of light.

Few emitters in a cavity: from cooperative emission to individualization

Energy Technology Data Exchange (ETDEWEB)

Auffeves, A; Portolan, S [CEA/CNRS/UJF Joint Team ' Nanophysics and Semiconductors' , Institut Neel-CNRS, BP 166, 25 Rue des Martyrs, 38042 Grenoble Cedex 9 (France); Gerace, D [Dipartimento di Fisica ' Alessandro Volta' and UdR CNISM, Universita di Pavia, via Bassi 6, 27100 Pavia (Italy); Drezet, A [Institut Neel-CNRS, BP 166, 25 Rue des Martyrs, 38042 Grenoble Cedex 9 (France); Franca Santos, M, E-mail: msantos@fisica.ufmg.br [Departamento de Fisica, Universidade Federal de Minas Gerais, Belo Horizonte, CP 702, 30123-970 (Brazil)

2011-09-15

We study the temporal correlations of the field emitted by an electromagnetic resonator coupled to a mesoscopic number of two-level emitters that are incoherently pumped by a weak external drive. We solve the master equation of the system for increasing number of emitters and as a function of the cavity quality factor, and we identify three main regimes characterized by well-distinguished statistical properties of the emitted radiation. For small cavity decay rates, the emission events are uncorrelated and the number of photons in the emitted field becomes larger than one, resembling the build-up of a laser field inside the cavity. At intermediate decay rates (as compared with the emitter-cavity coupling) and for a few emitters, the statistics of the emitted radiation is bunched and strikingly dependent on the parity of the number of emitters. The latter property is related to the cooperativity of the emitters mediated by their coupling to the cavity mode, and its connection with steady-state subradiance is discussed. Finally, in the bad cavity regime the typical situation of emission from a collection of individual emitters is recovered. We also analyze how the cooperative behavior evolves as a function of pure dephasing, which allows us to recover the case of a classical source made of an ensemble of independent emitters, similar to what is obtained for a very leaky cavity. State-of-the-art techniques of Q-switch of resonant cavities, allied with the recent capability of tuning single emitters in and out of resonance, suggest this system to be a versatile source of different quantum states of light.

Emittance formula for slits and pepper-pot measurement

International Nuclear Information System (INIS)

Zhang, M.

1996-10-01

In this note, a rigid formula for slits and pepper-pot emittance measurement is derived. The derivation is based on the one- dimensional slit measurement setup. A mathematical generalization of the slit emittance formula to the pepper-pot measurement is discussed

MEV Energy Electrostatic Accelerator Ion Beam Emittance Measurement

OpenAIRE

I.G. Ignat’ev; M.I. Zakharets; S.V. Kolinko; D.P. Shulha

2014-01-01

The testing equipment was designed, manufactured and tried out permitting measurements of total current, current profile and emittance of an ion beam extracted from the ion beam. MeV energy electrostatic accelerator ion H + beam emittance measurement results are presented.

Alpha-emitters for medical therapy workshop

International Nuclear Information System (INIS)

Feinendegen, L.E.; McClure, J.J.

1996-01-01

A workshop on ''Alpha-Emitters for Medical Therapy'' was held May 30-31, 1996 in Denver Colorado to identify research goals and potential clinical needs for applying alpha-particle emitters and to provide DOE with sufficient information for future planning. The workshop was attended by 36 participants representing radiooncology, nuclear medicine, immunotherapy, radiobiology, molecular biology, biochemistry, radiopharmaceutical chemistry, dosimetry, and physics. This report provides a summary of the key points and recommendations arrived at during the conference

Alpha-emitters for medical therapy workshop

Energy Technology Data Exchange (ETDEWEB)

Feinendegen, L.E.; McClure, J.J.

1996-12-31

A workshop on ``Alpha-Emitters for Medical Therapy`` was held May 30-31, 1996 in Denver Colorado to identify research goals and potential clinical needs for applying alpha-particle emitters and to provide DOE with sufficient information for future planning. The workshop was attended by 36 participants representing radiooncology, nuclear medicine, immunotherapy, radiobiology, molecular biology, biochemistry, radiopharmaceutical chemistry, dosimetry, and physics. This report provides a summary of the key points and recommendations arrived at during the conference.

Experimental investigation of thermal emittance components of copper photocathode

Directory of Open Access Journals (Sweden)

H. J. Qian

2012-04-01

Full Text Available With progress of photoinjector technology, thermal emittance has become the primary limitation of electron beam brightness. Extensive efforts have been devoted to study thermal emittance, but experiment results differ between research groups and few can be well interpreted. Besides the ambiguity of photoemission mechanism, variations of cathode surface conditions during cathode preparation, such as work function, field enhancement factor, and surface roughness, will cause thermal emittance differences. In this paper, we report an experimental study of electric field dependence of copper cathode quantum efficiency (QE and thermal emittance in a radio frequency (rf gun, through which in situ cathode surface parameters and thermal emittance contributions from photon energy, Schottky effect, and surface roughness are extracted. It is found the QE of a copper cathode illuminated by a 266 nm UV laser increased substantially to 1.5×10^{-4} after cathode cleaning during rf conditioning, and a copper work function of 4.16 eV, which is much lower than nominal value (4.65 eV, was measured. Experimental results also show a thermal emittance growth as much as 0.92  mm mrad/mm at 50  MV/m due to the cathode surface roughness effect, which is consistent with cathode surface morphology measurements.

Design for a practical, low-emittance damping ring

International Nuclear Information System (INIS)

Krejcik, P.

1988-01-01

The luminosity requirements for future high-energy linear colliders calls for very low emittances in the two beams. These low emittances can be achieved with damping rings, but, in order to reach the design goal of a factor 10 improvement over present day machines, great care must be taken in their design. This paper emphasizes the need to address simultaneously all of the factors which limit the operational emittance in the ring. Particularly since in standard designs there is a conflict between different design parameters which makes it difficult to extrapolate such designs to very low emittances. The approach chosen here is to resolve such conflicts by separating their design solutions. Wigglers are used predominantly in zero-dispersion regions to achieve the desired damping rate, whereas in the arcs high dispersion insertions are made in regions of zero curvature to allow for easier chromaticity control

Hidden Risk Factors for Women

Science.gov (United States)

... A.S.T. Quiz Hidden Stroke Risk Factors for Women Updated:Nov 22,2016 Excerpted from "What Women Need To Know About The Hidden Risk Factors ... 2012) This year, more than 100,000 U.S. women under 65 will have a stroke. Stroke is ...

Hidden-Sector Dynamics and the Supersymmetric Seesaw

CERN Document Server

Campbell, Bruce A; Maybury, David W

2008-01-01

In light of recent analyses that have shown that nontrivial hidden-sector dynamics in models of supersymmetry breaking can lead to a significant impact on the predicted low-energy supersymmetric spectrum, we extend these studies to consider hidden-sector effects in extensions of the MSSM to include a seesaw model for neutrino masses. A dynamical hidden sector in an interval of mass scales below the seesaw scale would yield renormalization-group running involving both the anomalous dimension from the hidden sector and the seesaw-extended MSSM renormalization group equations (RGEs). These effects interfere in general, altering the generational mixing of the sleptons, and allowing for a substantial change to the expected level of charged-lepton flavour violation in seesaw-extended MSSM models. These results provide further support for recent theoretical observations that knowledge of the hidden sector is required in order to make concrete low-energy predictions, if the hidden sector is strongly coupled. In parti...

Design of a minimum emittance nBA lattice

Science.gov (United States)

Lee, S. Y.

1998-04-01

An attempt to design a minimum emittance n-bend achromat (nBA) lattice has been made. One distinct feature is that dipoles with two different lengths were used. As a multiple bend achromat, five bend achromat lattices with six superperiod were designed. The obtained emittace is three times larger than the theoretical minimum. Tunes were chosen to avoid third order resonances. In order to correct first and second order chromaticities, eight family sextupoles were placed. The obtained emittance of five bend achromat lattices is almost equal to the minimum emittance of five bend achromat lattice consisting of dipoles with equal length.

Remote detection of single emitters via optical waveguides

Science.gov (United States)

Then, Patrick; Razinskas, Gary; Feichtner, Thorsten; Haas, Philippe; Wild, Andreas; Bellini, Nicola; Osellame, Roberto; Cerullo, Giulio; Hecht, Bert

2014-05-01

The integration of lab-on-a-chip technologies with single-molecule detection techniques may enable new applications in analytical chemistry, biotechnology, and medicine. We describe a method based on the reciprocity theorem of electromagnetic theory to determine and optimize the detection efficiency of photons emitted by single quantum emitters through truncated dielectric waveguides of arbitrary shape positioned in their proximity. We demonstrate experimentally that detection of single quantum emitters via such waveguides is possible, confirming the predicted behavior of the detection efficiency. Our findings blaze the trail towards efficient lensless single-emitter detection compatible with large-scale optofluidic integration.

Global Update and Trends of Hidden Hunger, 1995-2011: The Hidden Hunger Index.

Directory of Open Access Journals (Sweden)

Julie C Ruel-Bergeron

Full Text Available Deficiencies in essential vitamins and minerals-also termed hidden hunger-are pervasive and hold negative consequences for the cognitive and physical development of children.This analysis evaluates the change in hidden hunger over time in the form of one composite indicator-the Hidden Hunger Index (HHI-using an unweighted average of prevalence estimates from the Nutrition Impact Model Study for anemia due to iron deficiency, vitamin A deficiency, and stunting (used as a proxy indicator for zinc deficiency. Net changes from 1995-2011 and population weighted regional means for various time periods are measured.Globally, hidden hunger improved (-6.7 net change in HHI from 1995-2011. Africa was the only region to see a deterioration in hidden hunger (+1.9 over the studied time period; East Asia and the Pacific performed exceptionally well (-13.0, while other regions improved only slightly. Improvements in HHI were mostly due to reductions in zinc and vitamin A deficiencies, while anemia due to iron deficiency persisted and even increased.This analysis is critical for informing and tracking the impact of policy and programmatic efforts to reduce micronutrient deficiencies, to advance the global nutrition agenda, and to achieve the Millennium Development Goals (MDGs. However, there remains an unmet need to invest in gathering frequent, nationally representative, high-quality micronutrient data as we renew our efforts to scale up nutrition, and as we enter the post-2015 development agenda.Preparation of this manuscript was funded by Sight and Life. There was no funding involved in the study design, data collection, analysis, or decision to publish.

Movement of Irrigation Water in Soil from a Surface Emitter

Directory of Open Access Journals (Sweden)

Ibrahim Abbas Dawood

2016-09-01

Full Text Available rickle irrigation is one of the most conservative irrigation techniques since it implies supplying water directly on the soil through emitters. Emitters dissipate energy of water at the end of the trickle irrigation system and provide water at emission points. The area wetted by an emitter depends upon the discharge of emitter, soil texture, initial soil water content, and soil permeability. The objectives of this research were to predict water distribution profiles through different soils for different conditions and quantify the distribution profiles in terms of main characteristics of soil and emitter. The wetting patterns were simulated at the end of each hour for a total time of application of 12 hrs, emitter discharges of 0.5, 0.75, 1, 2, 3, 4, and 5 lph, and five initial volumetric soil water contents. Simulation of water flow from a single surface emitter was carried out by using the numerically-based software Hydrus-2D/3D, Version 2.04. Two approaches were used in developing formulas to predict the domains of the wetted pattern. In order to verify the results obtained by implementing the software Hydrus-2D/3D a field experiment was conducted to measure the wetted diameter and compare measured values with simulated ones. The results of the research showed that the developed formulas to express the wetted diameter and depth in terms of emitter discharge, time of application, and initial soil water content are very general and can be used with very good accuracy.

Hidden variables and locality in quantum theory

International Nuclear Information System (INIS)

Shiva, Vandana.

1978-12-01

The status of hidden variables in quantum theory has been debated since the 1920s. The author examines the no-hidden-variable theories of von Neumann, Kochen, Specker and Bell, and finds that they all share one basic assumption: averaging over the hidden variables should reproduce the quantum mechanical probabilities. Von Neumann also makes a linearity assumption, Kochen and Specker require the preservation of certain functional relations between magnitudes, and Bell proposes a locality condition. It has been assumed that the extrastatistical requirements are needed to serve as criteria of success for the introduction of hidden variables because the statistical condition is trivially satisfied, and that Bell's result is based on a locality condition that is physically motivated. The author shows that the requirement of weak locality, which is not physically motivated, is enough to give Bell's result. The proof of Bell's inequality works equally well for any pair of commuting magnitudes satisfying a condition called the degeneracy principle. None of the no-hidden-variable proofs apply to a class of hidden variable theories that are not phase-space reconstructions of quantum mechanics. The author discusses one of these theories, the Bohm-Bub theory, and finds that hidden variable theories that re all the quantum statistics, for single and sequential measurements, must introduce a randomization process for the hidden variables after each measurement. The philosophical significance of this theory lies in the role it can play in solving the conceptual puzzles posed by quantum theory

Recovering the triple coincidence of non-pure positron emitters in preclinical PET

Science.gov (United States)

Lin, Hsin-Hon; Chuang, Keh-Shih; Chen, Szu-Yu; Jan, Meei-Ling

2016-03-01

Non-pure positron emitters, with their long half-lives, allow for the tracing of slow biochemical processes which cannot be adequately examined by the commonly used short-lived positron emitters. Most of these isotopes emit high-energy cascade gamma rays in addition to positron decay that can be detected and create a triple coincidence with annihilation photons. Triple coincidence is discarded in most scanners, however, the majority of the triple coincidence contains true photon pairs that can be recovered. In this study, we propose a strategy for recovering triple coincidence events to raise the sensitivity of PET imaging for non-pure positron emitters. To identify the true line of response (LOR) from a triple coincidence, a framework utilizing geometrical, energy and temporal information is proposed. The geometrical criterion is based on the assumption that the LOR with the largest radial offset among the three sub pairs of triple coincidences is least likely to be a true LOR. Then, a confidence time window is used to test the valid LOR among those within triple coincidence. Finally, a likelihood ratio discriminant rule based on the energy probability density distribution of cascade and annihilation gammas is established to identify the true LOR. An Inveon preclinical PET scanner was modeled with GATE (GEANT4 application for tomographic emission) Monte Carlo software. We evaluated the performance of the proposed method in terms of identification fraction, noise equivalent count rates (NECR), and image quality on various phantoms. With the inclusion of triple coincidence events using the proposed method, the NECR was found to increase from 11% to 26% and 19% to 29% for I-124 and Br-76, respectively, when 7.4-185 MBq of activity was used. Compared to the reconstructed images using double coincidence, this technique increased the SNR by 5.1-7.3% for I-124 and 9.3-10.3% for Br-76 within the activity range of 9.25-74 MBq, without compromising the spatial resolution or

Jamming of Quantum Emitters by Active Coated Nanoparticles

DEFF Research Database (Denmark)

Arslanagic, Samel; Ziolkowski, Richard W.

2013-01-01

to effectively cloak the emitters to a far-field observer is reported and explained through thorough near- and far-field investigations. This property offers an interesting route toward the jamming of quantum emitters/nanoantennas that might be of potential use, for instance, in biological fluorescence assays...

Transverse Emittance Measurement and Preservation at the LHC

CERN Document Server

AUTHOR|(CDS)2082907

The Large Hadron Collider (LHC) at CERN is a high energy storage ring that provides proton and heavy ion collisions to study fundamental particle physics. The luminosity production is closely linked to emittance preservation in the accelerator. The transverse emittance is the phase space density of the beam and should be conserved when the particle beam is transformed through the accelerator. Perturbing effects, however, can lead to emittance increase and hence luminosity degradation. Measuring the emittance growth is a complex task with high intensity beams and changing energies. The machine optics and the transverse beam size have to be measured as accurately as possible. Beta function measurements with k-modulation will be discussed. With this method the quadrupole focussing strength is varied and the resulting tune change is traced to determine the beta function at the quadrupole. A new k-modulation measurement tool was developed for the LHC. The fully automatic and online measurement system takes constra...

Emittance increase caused by core depletion in collisions

CERN Document Server

Bruce, R

2009-01-01

A new effect is presented, which changes the emittance during colliding-beam operation in circular colliders. If the initial transverse distribution is Gaussian, the collision probability is much higher for particles in the core of the beam than in the tails. When small-amplitude particles are removed, the remaining ones therefore have a larger transverse emittance. This effect, called core depletion, may cause a decrease in luminosity. An approximate analytic model is developed to study the effect and benchmarked against a multiparticle tracking simulation. Finally, the time evolution of the intensity and emittances of a Pb bunch in the Large Hadron Collider (LHC) at CERN is calculated, taking into account also other processes than collisions. The results show that integrated luminosity drops by 3--4% if core depletion is taken into account. It is also found that core depletion causes the transverse emittance to be larger when more experiments are active. This observation could be checked against experimenta...

Selective solar absorber emittance measurement at elevated temperature

Science.gov (United States)

Giraud, Philémon; Braillon, Julien; Raccurt, Olivier

2017-06-01

Durability of solar components for CSP (Concentrated Solar Power Plant) technologies is a key point to lower cost and ensure their large deployment. These technologies concentrated the solar radiation by means of mirrors on a receiver tube where it is collected as thermal energy. The absorbers are submitted to strong environmental constraints and the degradation of their optical properties (emittance and solar absorbance) have a direct impact on performance. The characterization of a material in such condition is complicated and requires advanced apparatuses, and different measurement methods exist for the determination of the two quantities of relevance regarding an absorber, which are its emittance and its solar absorbance. The objective is to develop new optical equipment for measure the emittance of this solar absorber at elevated temperature. In this paper, we present an optical bench developed for emittance measurement on absorbers is conditions of use. Results will be shown, with a discussion of some factors of influence over this measurement and how to control them.

Strong coupling of collection of emitters on hyperbolic meta-material

Science.gov (United States)

Biehs, Svend-Age; Xu, Chenran; Agarwal, Girish S.

2018-04-01

Recently, considerable effort has been devoted to the realization of a strong coupling regime of the radiation matter interaction in the context of an emitter at a meta surface. The strong interaction is well realized in cavity quantum electrodynamics, which also show that strong coupling is much easier to realize using a collection of emitters. Keeping this in mind, we study if emitters on a hyperbolic meta materials can yield a strong coupling regime. We show that strong coupling can be realized for densities of emitters exceeding a critical value. A way to detect strong coupling between emitters and hyperbolic metamaterials is to use the Kretschman-Raether configuration. The strong coupling appears as the splitting of the reflectivity dip. In the weak coupling regime, the dip position shifts. The shift and splitting can be used to sense active molecules at surfaces.

Radial arrays of nano-electrospray ionization emitters and methods of forming electrosprays

Science.gov (United States)

Kelly, Ryan T [West Richland, WA; Tang, Keqi [Richland, WA; Smith, Richard D [Richland, WA

2010-10-19

Electrospray ionization emitter arrays, as well as methods for forming electrosprays, are described. The arrays are characterized by a radial configuration of three or more nano-electrospray ionization emitters without an extractor electrode. The methods are characterized by distributing fluid flow of the liquid sample among three or more nano-electrospray ionization emitters, forming an electrospray at outlets of the emitters without utilizing an extractor electrode, and directing the electrosprays into an entrance to a mass spectrometry device. Each of the nano-electrospray ionization emitters can have a discrete channel for fluid flow. The nano-electrospray ionization emitters are circularly arranged such that each is shielded substantially equally from an electrospray-inducing electric field.

The cataphoretic emitter effect exhibited in high intensity discharge lamp electrodes

Science.gov (United States)

Mentel, Juergen

2018-01-01

A mono-layer of atoms, electropositive with respect to the substrate atoms, forms a dipole layer, reducing its work function. Such a layer is generated by diffusion of emitter material from the interior of the substrate, by vapour deposition or by deposition of emitter material onto arc electrodes by cataphoresis. This cataphoretic emitter effect is investigated within metal halide lamps with transparent YAG ceramic burners, and within model lamps. Within the YAG lamps, arcs are operated with switched-dc current between rod shaped tungsten electrodes in high pressure Hg vapour seeded with metal iodides. Within the model lamps, dc arcs are operated between rod-shaped tungsten electrodes—one doped—in atmospheric pressure Ar. Electrode temperatures are determined by 1λ -pyrometry, combined with simulation of the electrode heat balance. Plasma temperatures, atom and ion densities of emitter material are determined by emission and absorption spectroscopy. Phase resolved measurements in YAG lamps seeded with CeI3, CsI, DyI3, TmI3 and LaI3 show, within the cathodic half period, a reduction of the electrode temperature and an enhanced metal ion density in front of the electrode, and an opposite behavior after phase reversal. With increasing operating frequency, the state of the cathode overlaps onto the anodic phase—except for Cs, being low in adsorption energy. Generally, the phase averaged electrode tip temperature is reduced by seeding a lamp with emitter material; its height depends on admixtures. Measurements at tungsten electrodes doped with ThO2, La2O3 and Ce2O3 within the model lamp show that evaporated emitter material is redeposited by an emitter ion current onto the electrode surface. It reduces the work function of tungsten cathodes above the evaporation temperature of the emitter material, too; and also of cold anodes, indicating a field reversal in front of them. The formation of an emitter spot at low cathode temperature and high emitter material

Low emittance lattices for electron storage rings revisited

International Nuclear Information System (INIS)

Trbojevic, D.; Courant, E.

1994-01-01

Conditions for the lowest possible emittance of the lattice for electron storage rings are obtained by a simplified analytical approach. Examples of electron storage lattices with minimum emittances are presented. A simple graphical presentation in the normalized dispersion space (Floquet's transformation) is used to illustrate the conditions and results

BEAM EMITTANCE MEASUREMENT TOOL FOR CEBAF OPERATIONS

International Nuclear Information System (INIS)

Chevtsov, Pavel; Tiefenback, Michael

2008-01-01

A new software tool was created at Jefferson Lab to measure the emittance of the CEBAF electron beams. The tool consists of device control and data analysis applications. The device control application handles the work of wire scanners and writes their measurement results as well as the information about accelerator settings during these measurements into wire scanner data files. The data analysis application reads these files and calculates the beam emittance on the basis of a wire scanner data processing model. Both applications are computer platform independent but are mostly used on LINUX PCs recently installed in the accelerator control room. The new tool significantly simplifies beam emittance measurement procedures for accelerator operations and contributes to a very high availability of the CEBAF machine for the nuclear physics program at Jefferson Lab.

Achievement of ultralow emittance coupling in the Australian Synchrotron storage ring

Directory of Open Access Journals (Sweden)

R. Dowd

2011-01-01

Full Text Available Investigations into producing an electron beam with ultralow vertical emittance have been conducted using the Australian Synchrotron 3 GeV storage ring. A method of tuning the emittance coupling (ϵ_{y}/ϵ_{x} has been developed using a machine model calibrated through the linear optics from closed orbits method. Direct measurements of the beam emittance have not been possible due to diagnostic limitations, however two independent indirect measurements both indicate a vertical emittance of 1.2–1.3 pm rad (ϵ_{y}/ϵ_{x}=0.01%. Other indirect measurements support the validity of these results. This result is the smallest vertical emittance currently achieved in a storage ring.

Measurements of Transverse Emittance for RF Photocathode Gun at the PAL

CERN Document Server

Park Jang Ho; Park, Sung-Ju; Soo Ko In; Wang, Xijie; Woon Parc, Yong; Xiang, Dao

2005-01-01

A BNL GUN-IV type RF photo-cathode gun is under fabrication for use in the FIR (Far Infra-Red) facility being built at the Pohang Accelerator Laboratory (PAL). Performance test of the gun will include the measurement of transverse emittance profile along the longitudinal direction. Successful measurement of the emittance profile will provide powerful tool for the commissioning of the 4GLS (4th generation light source) injectors based on the emittance compensation principle. We are going to achieve this withthe use of pepper-pot based emittance meters that can be moved along the longitudinal direction. In this article, we present design considerations on the emittance meter with the resolution of 1 mm mrad.

Aluminum oxide film thickness and emittance

International Nuclear Information System (INIS)

Thomas, J.K.; Ondrejcin, R.S.

1991-11-01

Aluminum reactor components which are not actively cooled could be subjected to high temperatures due to gamma heating after the core coolant level dropped during the ECS phase of a hypothetical LOCA event. Radiative heat transfer is the dominant heat transfer process in this scenario and therefore the emittance of these components is of interest. Of particular interest are the safety rod thimbles and Mark 60B blanket assemblies; for the K Reactor, these components have been exposed to low temperature (< 55 degrees C) moderator for about a year. The average moderator temperature was assumed to be 30 degrees C. The Al oxide film thickness at this temperature, after one year of exposure, is predicted to be 6.4 μm ± 10%; insensitive to exposure time. Dehydration of the film during the gamma heating accident would result in a film thickness of 6.0 μm ± 11%. Total hemispherical emittance is predicted to be 0.69 at 96 degrees C, decreasing to 0.45 at 600 degrees C. Some phenomena which would tend to yield thicker oxide films in the reactor environment relative to those obtained under experimental conditions were neglected and the predicted film thickness values are therefore conservative. The emittance values predicted for a given film thickness are also conservative. The conservativisms inherent in the predicted emittance are particularly relevant for uncertainty analysis of temperatures generated using these values

biomvRhsmm: Genomic Segmentation with Hidden Semi-Markov Model

Directory of Open Access Journals (Sweden)

Yang Du

2014-01-01

Full Text Available High-throughput technologies like tiling array and next-generation sequencing (NGS generate continuous homogeneous segments or signal peaks in the genome that represent transcripts and transcript variants (transcript mapping and quantification, regions of deletion and amplification (copy number variation, or regions characterized by particular common features like chromatin state or DNA methylation ratio (epigenetic modifications. However, the volume and output of data produced by these technologies present challenges in analysis. Here, a hidden semi-Markov model (HSMM is implemented and tailored to handle multiple genomic profile, to better facilitate genome annotation by assisting in the detection of transcripts, regulatory regions, and copy number variation by holistic microarray or NGS. With support for various data distributions, instead of limiting itself to one specific application, the proposed hidden semi-Markov model is designed to allow modeling options to accommodate different types of genomic data and to serve as a general segmentation engine. By incorporating genomic positions into the sojourn distribution of HSMM, with optional prior learning using annotation or previous studies, the modeling output is more biologically sensible. The proposed model has been compared with several other state-of-the-art segmentation models through simulation benchmarking, which shows that our efficient implementation achieves comparable or better sensitivity and specificity in genomic segmentation.

… To be hidden does not mean to be merely revealed – Part 1 Artistic research on hidden curriculum

Directory of Open Access Journals (Sweden)

Annette Krause

2015-09-01

Full Text Available This text revisits the long-term project Hidden Curriculum, initiated by Annette Krauss. The project addresses unquestioned routines, hierarchies of knowledge (part 1, and the role of the body in learning processes (part 2 from the perspective of secondary/high school education (in the research on a hidden curriculum. A deeper analysis of educational studies on the phenomenon of ‘hidden curriculum’ in relation to the feminist and critical pedagogies of bell hooks, Paulo Freire, and Jacques Rancière brings forward important insights generated through the artistic research within hidden curriculum. The aim of this text is to address academic canons, corporeality, and investigate everyday norms through revisiting the framework, results, and processes of the collaborative research into hidden curriculum with secondary high school students.

Measured emittance dependence on injection method in laser plasma accelerators

Science.gov (United States)

Barber, Samuel; van Tilborg, Jeroen; Schroeder, Carl; Lehe, Remi; Tsai, Hai-En; Swanson, Kelly; Steinke, Sven; Nakamura, Kei; Geddes, Cameron; Benedetti, Carlo; Esarey, Eric; Leemans, Wim

2017-10-01

The success of many laser plasma accelerator (LPA) based applications relies on the ability to produce electron beams with excellent 6D brightness, where brightness is defined as the ratio of charge to the product of the three normalized emittances. As such, parametric studies of the emittance of LPA generated electron beams are essential. Profiting from a stable and tunable LPA setup, combined with a carefully designed single-shot transverse emittance diagnostic, we present a direct comparison of charge dependent emittance measurements of electron beams generated by two different injection mechanisms: ionization injection and shock induced density down-ramp injection. Notably, the measurements reveal that ionization injection results in significantly higher emittance. With the down-ramp injection configuration, emittances less than 1 micron at spectral charge densities up to 2 pC/MeV were measured. This work was supported by the U.S. DOE under Contract No. DE-AC02-05CH11231, by the NSF under Grant No. PHY-1415596, by the U.S. DOE NNSA, DNN R&D (NA22), and by the Gordon and Betty Moore Foundation under Grant ID GBMF4898.

Transverse-to-longitudinal Emittance-exchange with an Energy Chirped Beam

Energy Technology Data Exchange (ETDEWEB)

Thangaraj, J.; Ruan, J.; Johnson, A.S.; Thurman-Keup, R.; Lumpkin, A.H.; Santucci, J.; Sun, Y.-E; Maxwell, T.; Edwards, H.; /Fermilab

2012-05-01

Emittance exchange has been proposed to increase the performance of free electron lasers by tailoring the phase space of an electron beam. The principle of emittance exchange - where the transverse phase space of the electron beam is exchanged with the longitudinal phase space - has been demonstrated recently at the A0 photoinjector. The experiment used a low charge bunch (250 pC) with no energy chirp. Theory predicts an improvement in the emittance exchange scheme when the incoming beam has an energy chirp imparted on it. The energy chirp helps to overcome the thick lens effect of the deflecting mode cavity and other second order effects that might lead to an incomplete emittance exchange at higher charges. In this work, we report experimental and simulation results from operating the emittance exchange beam line using an energy chirped beam with higher charge (500 pC) at different RF-chirp settings.

Internal Auger emitters: effects on spermatogenesis and oogenesis in mice

International Nuclear Information System (INIS)

Rao, D.V.; Mylavarapu, V.B.; Sastry, K.S.R.; Howell, R.W.

1988-01-01

The in vivo biological effects of Auger emitters are investigated using [A] spermatogenesis in mouse testis, and [B] oogenesis in mouse ovary as experimental models. Spermhead survival and induction of abnormal sperm, following intratesticular administration of radiopharmaceuticals, were the end points in Model A. Of interest in Model B is primary oocyte survival after intraperitoneal injection of the radiochemicals. The effectiveness of the Auger emitter is determined relative to its beta emitting companion or external X-rays in the absence of such an analogue. Results reveal pronounced effects of Auger emitters on all end points, not dependent on mode of administration. The efficacy of the Auger emitter is related intimately to its subcellular distribution, which, is governed by the chemical form of the carrier molecule. Conventional dosimetry is inadequate and biophysically meaningful dosimetric approaches are needed to understand in vivo effects of Auger emitters. (author)

Global Update and Trends of Hidden Hunger, 1995-2011: The Hidden Hunger Index

Science.gov (United States)

Stevens, Gretchen A.; Ezzati, Majid; Black, Robert E.; Kraemer, Klaus

2015-01-01

Background Deficiencies in essential vitamins and minerals–also termed hidden hunger–are pervasive and hold negative consequences for the cognitive and physical development of children. Methods This analysis evaluates the change in hidden hunger over time in the form of one composite indicator–the Hidden Hunger Index (HHI)–using an unweighted average of prevalence estimates from the Nutrition Impact Model Study for anemia due to iron deficiency, vitamin A deficiency, and stunting (used as a proxy indicator for zinc deficiency). Net changes from 1995–2011 and population weighted regional means for various time periods are measured. Findings Globally, hidden hunger improved (-6.7 net change in HHI) from 1995–2011. Africa was the only region to see a deterioration in hidden hunger (+1.9) over the studied time period; East Asia and the Pacific performed exceptionally well (-13.0), while other regions improved only slightly. Improvements in HHI were mostly due to reductions in zinc and vitamin A deficiencies, while anemia due to iron deficiency persisted and even increased. Interpretation This analysis is critical for informing and tracking the impact of policy and programmatic efforts to reduce micronutrient deficiencies, to advance the global nutrition agenda, and to achieve the Millennium Development Goals (MDGs). However, there remains an unmet need to invest in gathering frequent, nationally representative, high-quality micronutrient data as we renew our efforts to scale up nutrition, and as we enter the post-2015 development agenda. Funding Preparation of this manuscript was funded by Sight and Life. There was no funding involved in the study design, data collection, analysis, or decision to publish. PMID:26673631

Transverse beam emittance optimization for the injection into BESSY II

Energy Technology Data Exchange (ETDEWEB)

Kramer, Felix [Helmholtz Zentrum Berlin, Institut Beschleunigerphysik (Germany); Humboldt-Universitaet zu Berlin, Institut fuer Physik (Germany)

2016-07-01

For top up injection into the storage ring BESSY II an average injection efficiency of at least 90% is required. In low alpha mode the injection efficiency does not meet the requirements. Future BESSY II features will include shorter bunches in the storage ring (VSR) and user transparent injection with a non linear kicker. These will raise the demands on the quality of the injected beam even further. This work investigates the development of transverse emittance over the acceleration cycle in the synchrotron and the possibility of transverse emittance exchange by a sequence of skew quadrupoles in the transfer line. Results of emittance measurements and emittance exchange simulations will be given.

Calibration of nuclides by gamma-gamma sum peak coincidence counting

International Nuclear Information System (INIS)

Guevara, E.A.

1986-01-01

The feasibility of extending sum peak coincidence counting to the direct calibration of gamma-ray emitters having particular decay schemes was investigated, also checkings of the measurement accuracy, by comparing with more precise beta-gamma coincidence counting have been performed. New theoretical studies and experiments were developed, demonstrating the reliability of the procedure. Uncertainties of less than one percent were obtained when certain radioactive sources were measured. The application of the procedure to 60 Co, 22 Na, 47 Ca and 148 Pm was studied. Theoretical bases of sum peak coincidence counting were set in order to extend it as an alternative method for absolute activity determination. In this respect, theoretical studies were performed for positive and negative beta decay, and electron capture, either accompanied or unaccompanied by coincident gamma rays. They include decay schemes containing up to three daughter nuclide excited levels, for different geometrical configurations. Equations are proposed for a possible generalization of the procedure. (M.E.L.) [es

Pediatric Exercise Testing: Value and Implications of Peak Oxygen Uptake

Directory of Open Access Journals (Sweden)

Paolo T. Pianosi

2017-01-01

Full Text Available Peak oxygen uptake (peak V ˙ O 2 measured by clinical exercise testing is the benchmark for aerobic fitness. Aerobic fitness, estimated from maximal treadmill exercise, is a predictor of mortality in adults. Peak V ˙ O 2 was shown to predict longevity in patients aged 7–35 years with cystic fibrosis over 25 years ago. A surge of exercise studies in young adults with congenital heart disease over the past decade has revealed significant prognostic information. Three years ago, the first clinical trial in children with pulmonary arterial hypertension used peak V ˙ O 2 as an endpoint that likewise delivered clinically relevant data. Cardiopulmonary exercise testing provides clinicians with biomarkers and clinical outcomes, and researchers with novel insights into fundamental biological mechanisms reflecting an integrated physiological response hidden at rest. Momentum from these pioneering observations in multiple disease states should impel clinicians to employ similar methods in other patient populations; e.g., sickle cell disease. Advances in pediatric exercise science will elucidate new pathways that may identify novel biomarkers. Our initial aim of this essay is to highlight the clinical relevance of exercise testing to determine peak V ˙ O 2 , and thereby convince clinicians of its merit, stimulating future clinical investigators to broaden the application of exercise testing in pediatrics.

Compressing the hidden variable space of a qubit

OpenAIRE

Montina, Alberto

2010-01-01

In previously exhibited hidden variable models of quantum state preparation and measurement, the number of continuous hidden variables describing the actual state of a single realization is never smaller than the quantum state manifold dimension. We introduce a simple model for a qubit whose hidden variable space is one-dimensional, i.e., smaller than the two-dimensional Bloch sphere. The hidden variable probability distributions associated with the quantum states satisfy reasonable criteria ...

Alpha particle emitters in medicine

International Nuclear Information System (INIS)

Fisher, D.R.

1989-09-01

Radiation-induced cancer of bone, liver and lung has been a prominent harmful side-effect of medical applications of alpha emitters. In recent years, however, the potential use of antibodies labeled with alpha emitting radionuclides against cancer has seemed promising because alpha particles are highly effective in cell killing. High dose rates at high LET, effectiveness under hypoxic conditions, and minimal expectancy of repair are additional advantages of alpha emitters over antibodies labeled with beta emitting radionuclides for cancer therapy. Cyclotron-produced astatine-211 ( 211 At) and natural bismuth-212 ( 212 Bi) have been proposed and are under extensive study in the United States and Europe. Radium-223 ( 223 Ra) also has favorable properties as a potential alpha emitting label, including a short-lived daughter chain with four alpha emissions. The radiation dosimetry of internal alpha emitters is complex due to nonuniformly distributed sources, short particle tracks, and high relative specific ionization. The variations in dose at the cellular level may be extreme. Alpha-particle radiation dosimetry, therefore, must involve analysis of statistical energy deposition probabilities for cellular level targets. It must also account fully for nonuniform distributions of sources in tissues, source-target geometries, and particle-track physics. 18 refs., 4 figs

Search for Hidden Particles

CERN Multimedia

Solovev, V

The SHiP Experiment is a new general-purpose fixed target facility at the SPS to search for hidden particles as predicted by a very large number of recently elaborated models of Hidden Sectors which are capable of accommodating dark matter, neutrino oscillations, and the origin of the full baryon asymmetry in the Universe. Specifically, the experiment is aimed at searching for very weakly interacting long lived particles including Heavy Neutral Leptons - right-handed partners of the active neutrinos; light supersymmetric particles - sgoldstinos, etc.; scalar, axion and vector portals to the hidden sector. The high intensity of the SPS and in particular the large production of charm mesons with the 400 GeV beam allow accessing a wide variety of light long-lived exotic particles of such models and of SUSY. Moreover, the facility is ideally suited to study the interactions of tau neutrinos.

A numerical study of emittance growths in RF guns

CERN Document Server

Masuda, K; Sobajima, M; Kitagaki, J; Ohnishi, M; Toku, H; Yoshikawa, K

1999-01-01

A beam with greatly reduced emittance is required for further improvements of FELs, in particular, for FELs of shorter wavelengths, and of narrower bandwidths. From this viewpoint, the BNL/SLAC/UCLA 1.6-cell S-band photocathode RF gun performance characteristics were calculated, first in order to evaluate what may contribute to the emittance growths in photocathode RF guns. We developed an RF gun to produce an electron beam with an extremely low emittance, by using a 2-D simulation code. It is found that, by optimizing the laser injection phase, the drive laser spot radius and the cavity shape around the laser spot, the beam emittance by the 1.6-cell RF gun can be greatly reduced to 2.1 pi mm mrad, from the previous 4.4 pi mm mrad of the original shape.

Simulation studies of emittance growth in RMS mismatched beams

International Nuclear Information System (INIS)

Cucchetti, A.; Wangler, T.; Reiser, M.

1991-01-01

As shown in a separate paper, a charged-particle beam, whose rms size is not matched when injected into a transport channel or accelerator, has excess energy compared with that of a matched beam. If nonlinear space-charge forces are present and the mismatched beam transforms to a matched equilibrium state, rms-emittance growth will occur. The theory yields formulas for the possible rms-emittance growth, but not for the time it takes to achieve this growth. In this paper we present the results of systematic simulation studies for a mismatched 2-D round beam in an ideal transport channel with continuous linear focusing. Emittance growth rates obtained from the simulations for different amounts of mismatch and initial charge will be presented and the emittance growth will be compared with the theory. 6 refs., 7 figs

Low Emittance Tuning Studies for SuperB

Energy Technology Data Exchange (ETDEWEB)

Liuzzo, Simone; /INFN, Pisa; Biagini, Maria; /INFN, Rome; Raimondi, Pantaleo; /INFN, Rome; Donald, Martin; /SLAC

2012-07-06

SuperB[1] is an international project for an asymmetric 2 rings collider at the B mesons cm energy to be built in the Rome area in Italy. The two rings will have very small beam sizes at the Interaction Point and very small emittances, similar to the Linear Collider Damping Rings ones. In particular, the ultra low vertical emittances, 7 pm in the LER and 4 pm in the HER, need a careful study of the misalignment errors effects on the machine performances. Studies on the closed orbit, vertical dispersion and coupling corrections have been carried out in order to specify the maximum allowed errors and to provide a procedure for emittance tuning. A new tool which combines MADX and Matlab routines has been developed, allowing for both corrections and tuning. Results of these studies are presented.

Arc-textured metal surfaces for high thermal emittance space radiators

International Nuclear Information System (INIS)

Banks, B.A.; Rutledge, S.K.; Mirtich, M.J.; Behrend, T.; Hotes, D.; Kussmaul, M.; Barry, J.; Stidham, C.; Stueber, T.; DiFilippo, F.

1994-01-01

Carbon arc electrical discharges struck across the surfaces of metals such as Nb-1% Zr, alter the morphology to produce a high thermal emittance surface. Metal from the surface and carbon from the arc electrode vaporize during arcing, and then condense on the metal surface to produce a microscopically rough surface having a high thermal emittance. Quantitative spectral reflectance measurements from 0.33 to 15 μm were made on metal surfaces which were carbon arc treated in an inert gas environment. The resulting spectral reflectance data were then used to calculate thermal emittance as a function of temperature for various methods of arc treatment. The results of arc treatment on various metals are presented for both ac and dc arcs. Surface characterization data, including thermal emittance as a function of temperature, scanning electron microscopy, and atomic oxygen durability, are also presented. Ac arc texturing was found to increase the thermal emittance at 800 K from 0.05. to 0.70

Impact of water temperature and structural parameters on the hydraulic labyrinth-channel emitter performance

Directory of Open Access Journals (Sweden)

Ahmed I. Al-Amoud

2014-06-01

Full Text Available The effects of water temperature and structural parameters of a labyrinth emitter on drip irrigation hydraulic performance were investigated. The inside structural parameters of the trapezoidal labyrinth emitter include path width (W and length (L, trapezoidal unit numbers (N, height (H, and spacing (S. Laboratory experiments were conducted using five different types of labyrinth-channel emitters (three non-pressure compensating and two pressure-compensating emitters commonly used for subsurface drip irrigation systems. The water temperature effect on the hydraulic characteristics at various operating pressures was recorded and a comparison was made to identify the most effective structural parameter on emitter performance. The pressure compensating emitter flow exponent (x average was 0.014, while non-pressure compensating emitter’s values average was 0.456, indicating that the sensitivity of non-pressure compensating emitters to pressure variation is an obvious characteristic (p<0.001 of this type of emitters. The effects of water temperature on emitter flow rate were insignificant (p>0.05 at various operating pressures, where the flow rate index values for emitters were around one. The effects of water temperature on manufacturer’s coefficient of variation (CV values for all emitters were insignificant (p>0.05. The CV values of the non-pressure compensating emitters were lower than those of pressure compensating emitters. This is typical for most compensating models because they are manufactured with more elements than non-compensating emitters are. The results of regression analysis indicate that N and H are the essential factors (p<0.001 to affect the hydraulic performance.

Higgs Portal into Hidden Sectors

CERN Multimedia

CERN. Geneva

2007-01-01

Several attractive theoretical ideas suggest the existence of one or more 'hidden sectors' consisting of standard model singlet fields, some of which may not be too heavy. There is a profound reason to think that the Higgs sector might provide the first access to these hidden sectors. This scenario could affect Higgs phenomenology in drastic ways.

Hidden in plain sight: the formal, informal, and hidden curricula of a psychiatry clerkship.

Science.gov (United States)

Wear, Delese; Skillicorn, Jodie

2009-04-01

To examine perceptions of the formal, informal, and hidden curricula in psychiatry as they are observed and experienced by (1) attending physicians who have teaching responsibilities for residents and medical students, (2) residents who are taught by those same physicians and who have teaching responsibilities for medical students, and (3) medical students who are taught by attendings and residents during their psychiatry rotation. From June to November 2007, the authors conducted focus groups with attendings, residents, and students in one midwestern academic setting. The sessions were audiotaped, transcribed, and analyzed for themes surrounding the formal, informal, and hidden curricula. All three groups offered a similar belief that the knowledge, skills, and values of the formal curriculum focused on building relationships. Similarly, all three suggested that elements of the informal and hidden curricula were expressed primarily as the values arising from attendings' role modeling, as the nature and amount of time attendings spend with patients, and as attendings' advice arising from experience and intuition versus "textbook learning." Whereas students and residents offered negative values arising from the informal and hidden curricula, attendings did not, offering instead the more positive values they intended to encourage through the informal and hidden curricula. The process described here has great potential in local settings across all disciplines. Asking teachers and learners in any setting to think about how they experience the educational environment and what sense they make of all curricular efforts can provide a reality check for educators and a values check for learners as they critically reflect on the meanings of what they are learning.

A Novel Method for Decoding Any High-Order Hidden Markov Model

Directory of Open Access Journals (Sweden)

Fei Ye

2014-01-01

Full Text Available This paper proposes a novel method for decoding any high-order hidden Markov model. First, the high-order hidden Markov model is transformed into an equivalent first-order hidden Markov model by Hadar’s transformation. Next, the optimal state sequence of the equivalent first-order hidden Markov model is recognized by the existing Viterbi algorithm of the first-order hidden Markov model. Finally, the optimal state sequence of the high-order hidden Markov model is inferred from the optimal state sequence of the equivalent first-order hidden Markov model. This method provides a unified algorithm framework for decoding hidden Markov models including the first-order hidden Markov model and any high-order hidden Markov model.

Abelian hidden sectors at a GeV

International Nuclear Information System (INIS)

Morrissey, David E.; Poland, David; Zurek, Kathryn M.

2009-01-01

We discuss mechanisms for naturally generating GeV-scale hidden sectors in the context of weak-scale supersymmetry. Such low mass scales can arise when hidden sectors are more weakly coupled to supersymmetry breaking than the visible sector, as happens when supersymmetry breaking is communicated to the visible sector by gauge interactions under which the hidden sector is uncharged, or if the hidden sector is sequestered from gravity-mediated supersymmetry breaking. We study these mechanisms in detail in the context of gauge and gaugino mediation, and present specific models of Abelian GeV-scale hidden sectors. In particular, we discuss kinetic mixing of a U(1) x gauge force with hypercharge, singlets or bi-fundamentals which couple to both sectors, and additional loop effects. Finally, we investigate the possible relevance of such sectors for dark matter phenomenology, as well as for low- and high-energy collider searches.

Stargate of the Hidden Multiverse

Directory of Open Access Journals (Sweden)

Alexander Antonov

2016-02-01

Full Text Available Concept of Monoverse, which corresponds to the existing broad interpretation of the second postulate of the special theory of relativity, is not consistent with the modern astrophysical reality — existence of the dark matter and the dark energy, the total mass-energy of which is ten times greater than the mass-energy of the visible universe (which has been considered as the entire universe until very recent . This concept does not allow to explain their rather unusual properties — invisibility and lack of baryon content — which would seem to even destroy the very modern understanding of the term ‘matter’. However, all numerous alternative concepts of Multiverses, which have been proposed until today, are unable to explain these properties of the dark matter and dark energy. This article describes a new concept: the concept of the hidden Multiverse and hidden Supermultiverse, which mutual invisibility of parallel universes is explained by the physical reality of imaginary numbers. This concept completely explains the phenomenon of the dark matter and the dark energy. Moreover, it is shown that the dark matter and the dark energy are the experimental evidence for the existence of the hidden Multiverse. Described structure of the hidden Multiverse is fully consistent with the data obtained by the space stations WMAP and Planck. An extremely important property of the hidden Multiverse is an actual possibility of its permeation through stargate located on the Earth.

A novel attack method about double-random-phase-encoding-based image hiding method

Science.gov (United States)

Xu, Hongsheng; Xiao, Zhijun; Zhu, Xianchen

2018-03-01

By using optical image processing techniques, a novel text encryption and hiding method applied by double-random phase-encoding technique is proposed in the paper. The first step is that the secret message is transformed into a 2-dimension array. The higher bits of the elements in the array are used to fill with the bit stream of the secret text, while the lower bits are stored specific values. Then, the transformed array is encoded by double random phase encoding technique. Last, the encoded array is embedded on a public host image to obtain the image embedded with hidden text. The performance of the proposed technique is tested via analytical modeling and test data stream. Experimental results show that the secret text can be recovered either accurately or almost accurately, while maintaining the quality of the host image embedded with hidden data by properly selecting the method of transforming the secret text into an array and the superimposition coefficient.

On the design guideline for the low emittance synchrotron radiation source

International Nuclear Information System (INIS)

Kamiya, Y.; Kihara, M.

1983-09-01

In this note we will describe how the emittance of the electron storage ring is determined by the orbit parameters of the storage ring and show the lowest value of emittance which is achieved theoretically. Implication of this note with regard to the design of the low emittance storage ring will be discussed. (author)

Homogeneous Gaussian Profile P+-Type Emitters: Updated Parameters and Metal-Grid Optimization

Directory of Open Access Journals (Sweden)

M. Cid

2002-10-01

Full Text Available P+-type emitters were optimized keeping the base parameters constant. Updated internal parameters were considered. The surface recombination velocity was considered variable with the surface doping level. Passivated homogeneous emitters were found to have low emitter recombination density and high collection efficiency. A complete structure p+nn+ was analyzed, taking into account optimized shadowing and metal-contacted factors for laboratory cells as function of the surface doping level and the emitter thickness. The base parameters were kept constant to make the emitter characteristics evident. The most efficient P+-type passivated homogeneous emitters, provide efficiencies around 21% for a wide range of emitter sheet resistivity (50 -- 500 omega/ with the surface doping levels Ns=1×10(19 cm-3 and 5×10(19 cm-3. The output electrical parameters were evaluated considering the recently proposed value n i=9.65×10(9 (cm-3. A non-significant increase of 0.1% in the efficiency was obtained, validating all the conclusions obtained in this work, considering n i=1×10(10 cm-3.

Quantitative evaluation of hidden defects in cast iron components using ultrasound activated lock-in vibrothermography.

Science.gov (United States)

Montanini, R; Freni, F; Rossi, G L

2012-09-01

This paper reports one of the first experimental results on the application of ultrasound activated lock-in vibrothermography for quantitative assessment of buried flaws in complex cast parts. The use of amplitude modulated ultrasonic heat generation allowed selective response of defective areas within the part, as the defect itself is turned into a local thermal wave emitter. Quantitative evaluation of hidden damages was accomplished by estimating independently both the area and the depth extension of the buried flaws, while x-ray 3D computed tomography was used as reference for sizing accuracy assessment. To retrieve flaw's area, a simple yet effective histogram-based phase image segmentation algorithm with automatic pixels classification has been developed. A clear correlation was found between the thermal (phase) signature measured by the infrared camera on the target surface and the actual mean cross-section area of the flaw. Due to the very fast cycle time (<30 s/part), the method could potentially be applied for 100% quality control of casting components.

Minimum emittance of three-bend achromats

International Nuclear Information System (INIS)

Li Xiaoyu; Xu Gang

2012-01-01

The calculation of the minimum emittance of three-bend achromats (TBAs) made by Mathematical software can ignore the actual magnets lattice in the matching condition of dispersion function in phase space. The minimum scaling factors of two kinds of widely used TBA lattices are obtained. Then the relationship between the lengths and the radii of the three dipoles in TBA is obtained and so is the minimum scaling factor, when the TBA lattice achieves its minimum emittance. The procedure of analysis and the results can be widely used in achromats lattices, because the calculation is not restricted by the actual lattice. (authors)

High emittance black nickel coating on copper substrate for space applications

Energy Technology Data Exchange (ETDEWEB)

Somasundaram, Soniya, E-mail: jrf0013@isac.gov.in; Pillai, Anju M., E-mail: anjum@isac.gov.in; Rajendra, A., E-mail: rajendra@isac.gov.in; Sharma, A.K., E-mail: aks@isac.gov.in

2015-09-15

Highlights: • High emittance black nickel coating is obtained on copper substrate. • The effect of various process parameters on IR emittance is studied systematically. • Process parameters are optimized to develop a high emittance black nickel coating. • Coating obtained using the finalized parameters exhibited an emittance of 0.83. • SEM and EDAX are used for coating characterization. - Abstract: Black nickel, an alloy coating of zinc and nickel, is obtained on copper substrate by pulse electrodeposition from a modified Fishlock bath containing nickel sulphate, nickel ammonium sulphate, zinc sulphate and ammonium thiocyanate. A nickel undercoat of 4–5 μm thickness is obtained using Watts bath to increase the corrosion resistance and adhesion of the black nickel coating. The effect of bath composition, temperature, solution pH, current density and plating time on the coating appearance and corresponding infra-red emittance of the coating is investigated systematically. Process parameters are optimized to develop a high emittance space worthy black nickel coating to improve the heat radiation characteristics. The effect of the chemistry of the plating bath on the coating composition was studied using energy dispersive X-ray analysis (EDAX) of the coatings. The 5–6 μm thick uniform jet black zinc–nickel alloy coating obtained with optimized process exhibited an emittance of 0.83 and an absorbance of 0.92. The zinc to nickel ratio of black nickel coatings showing high emittance and appealing appearance was found to be in the range 2.3–2.4.

Coding with partially hidden Markov models

DEFF Research Database (Denmark)

Forchhammer, Søren; Rissanen, J.

1995-01-01

Partially hidden Markov models (PHMM) are introduced. They are a variation of the hidden Markov models (HMM) combining the power of explicit conditioning on past observations and the power of using hidden states. (P)HMM may be combined with arithmetic coding for lossless data compression. A general...... 2-part coding scheme for given model order but unknown parameters based on PHMM is presented. A forward-backward reestimation of parameters with a redefined backward variable is given for these models and used for estimating the unknown parameters. Proof of convergence of this reestimation is given....... The PHMM structure and the conditions of the convergence proof allows for application of the PHMM to image coding. Relations between the PHMM and hidden Markov models (HMM) are treated. Results of coding bi-level images with the PHMM coding scheme is given. The results indicate that the PHMM can adapt...

Emittance measuring unit for 100% duty factor linac injector beams

Energy Technology Data Exchange (ETDEWEB)

Shubaly, M R; Pachner, J Jr; Ormrod, J H; Ungrin, J; Schriber, S O [ed.

1976-11-01

A description is given of a system to measure the emittance of a 750 keV 100 mA dc proton beam suitable for injection into a 100% duty factor linear accelerator. A relatively slowly pulsed 45/sup 0/ magnet switches the beam to a beam dump inside the emittance measuring unit for approx. 10 s. A fast pulsed 5/sup 0/ magnet then deflects the beam to a multiple aperture ''pepper-pot'' plate for 300 ..mu..s. Beamlets passing through the plate travel 520 mm and produce a pattern on a scintillator screen. A photograph of the pattern is analyzed to determine beam emittance. Preliminary results on low current beams show a gross increase in the emittance in the horizontal plane.

An Online Multisensor Data Fusion Framework for Radar Emitter Classification

Directory of Open Access Journals (Sweden)

Dongqing Zhou

2016-01-01

Full Text Available Radar emitter classification is a special application of data clustering for classifying unknown radar emitters in airborne electronic support system. In this paper, a novel online multisensor data fusion framework is proposed for radar emitter classification under the background of network centric warfare. The framework is composed of local processing and multisensor fusion processing, from which the rough and precise classification results are obtained, respectively. What is more, the proposed algorithm does not need prior knowledge and training process; it can dynamically update the number of the clusters and the cluster centers when new pulses arrive. At last, the experimental results show that the proposed framework is an efficacious way to solve radar emitter classification problem in networked warfare.

Transverse emittance dilution due to coupler kicks in linear accelerators

Directory of Open Access Journals (Sweden)

Brandon Buckley

2007-11-01

Full Text Available One of the main concerns in the design of low emittance linear accelerators (linacs is the preservation of beam emittance. Here we discuss one possible source of emittance dilution, the coupler kick, due to transverse electromagnetic fields in the accelerating cavities of the linac caused by the power coupler geometry. In addition to emittance growth, the coupler kick also produces orbit distortions. It is common wisdom that emittance growth from coupler kicks can be strongly reduced by using two couplers per cavity mounted opposite each other or by having the couplers of successive cavities alternate from above to below the beam pipe so as to cancel each individual kick. While this is correct, including two couplers per cavity or alternating the coupler location requires large technical changes and increased cost for superconducting cryomodules where cryogenic pipes are arranged parallel to a string of several cavities. We therefore analyze consequences of alternate coupler placements. We show here that alternating the coupler location from above to below compensates the emittance growth as well as the orbit distortions. For sufficiently large Q values, alternating the coupler location from before to after the cavity leads to a cancellation of the orbit distortion but not of the emittance growth, whereas alternating the coupler location from before and above to behind and below the cavity cancels the emittance growth but not the orbit distortion. We show that cancellations hold for sufficiently large Q values. These compensations hold even when each cavity is individually detuned, e.g., by microphonics. Another effective method for reducing coupler kicks that is studied is the optimization of the phase of the coupler kick so as to minimize the effects on emittance from each coupler. This technique is independent of the coupler geometry but relies on operating on crest. A final technique studied is symmetrization of the cavity geometry in the

Emittance and trajectory control in the main linacs of the NLC

International Nuclear Information System (INIS)

Assmann, R.; Adolphsen, C.; Bane, K.; Raubenheimer, T.O.; Thompson, K.

1996-09-01

The main linacs of the next generation of linear colliders need to accelerate the particle beams to energies of up to 750 GeV while maintaining very small emittances. This paper describes the main mechanisms of static emittance growth in the main linacs of the Next Linear Collider (NLC). The authors present detailed simulations of the trajectory and emittance control algorithms that are foreseen for the NLC. They show that the emittance growth in the main linacs can be corrected down to about 110%. That number is significantly better than required for the NLC design luminosity

Compressing the hidden variable space of a qubit

International Nuclear Information System (INIS)

Montina, Alberto

2011-01-01

In previously exhibited hidden variable models of quantum state preparation and measurement, the number of continuous hidden variables describing the actual state of single realizations is never smaller than the quantum state manifold dimension. We introduce a simple model for a qubit whose hidden variable space is one-dimensional, i.e., smaller than the two-dimensional Bloch sphere. The hidden variable probability distributions associated with quantum states satisfy reasonable criteria of regularity. Possible generalizations of this shrinking to an N-dimensional Hilbert space are discussed.

A survey of hidden-variables theories

CERN Document Server

Belinfante, F J

1973-01-01

A Survey of Hidden-Variables Theories is a three-part book on the hidden-variable theories, referred in this book as """"theories of the first kind"""". Part I reviews the motives in developing different types of hidden-variables theories. The quest for determinism led to theories of the first kind; the quest for theories that look like causal theories when applied to spatially separated systems that interacted in the past led to theories of the second kind. Parts II and III further describe the theories of the first kind and second kind, respectively. This book is written to make the literat

A classification of hidden-variable properties

International Nuclear Information System (INIS)

Brandenburger, Adam; Yanofsky, Noson

2008-01-01

Hidden variables are extra components added to try to banish counterintuitive features of quantum mechanics. We start with a quantum-mechanical model and describe various properties that can be asked of a hidden-variable model. We present six such properties and a Venn diagram of how they are related. With two existence theorems and three no-go theorems (EPR, Bell and Kochen-Specker), we show which properties of empirically equivalent hidden-variable models are possible and which are not. Formally, our treatment relies only on classical probability models, and physical phenomena are used only to motivate which models to choose

Modular low-voltage electron emitters

International Nuclear Information System (INIS)

Berejka, Anthony J.

2005-01-01

Modular, low-voltage electron emitters simplify electron beam (EB) technology for many industrial uses and for research and development. Modular electron emitters are produced in quantity as sealed systems that are evacuated at the factory, eliminating the need for vacuum pumps at the point of use. A plug-out-plug-in method of replacement facilitates servicing. By using an ultra-thin 6-7 μm titanium foil window, solid-state power supplies, an innovative design to extract and spread the beam (enabling systems to be placed adjacent to each other to extend beam width) and touch-screen computer controls, these modular units combine ease of use and electrical transfer efficiency at voltages that can be varied between 80 kV and 150 kV with beam currents up to 40 mA per 25 cm across the beam window. These new devices have been made in three widths: 5 cm, 25 cm, and 40 cm. Details of the beam construction and illustrations of industrial uses will be presented. Traditional uses in the graphic arts and coatings areas have welcomed this modular technology as well as uses for surface sterilization. Being compact and lightweight (∼15 kg/emitter), these modular beams have been configured around complex shapes to achieve three-dimensional surface curing at high production rates

Modular low-voltage electron emitters

Science.gov (United States)

Berejka, Anthony J.

2005-12-01

Modular, low-voltage electron emitters simplify electron beam (EB) technology for many industrial uses and for research and development. Modular electron emitters are produced in quantity as sealed systems that are evacuated at the factory, eliminating the need for vacuum pumps at the point of use. A plug-out-plug-in method of replacement facilitates servicing. By using an ultra-thin 6-7 μm titanium foil window, solid-state power supplies, an innovative design to extract and spread the beam (enabling systems to be placed adjacent to each other to extend beam width) and touch-screen computer controls, these modular units combine ease of use and electrical transfer efficiency at voltages that can be varied between 80 kV and 150 kV with beam currents up to 40 mA per 25 cm across the beam window. These new devices have been made in three widths: 5 cm, 25 cm, and 40 cm. Details of the beam construction and illustrations of industrial uses will be presented. Traditional uses in the graphic arts and coatings areas have welcomed this modular technology as well as uses for surface sterilization. Being compact and lightweight (∼15 kg/emitter), these modular beams have been configured around complex shapes to achieve three-dimensional surface curing at high production rates.

Internal friction peaks observed in explosively deformed polycrystalline Mo, Nb, and Cu

Science.gov (United States)

Rieu, G. E.; Grimes, H. H.; Romain, J. P.; Defouquet, J.

1974-01-01

Explosive deformation (50 kbar range) induced, in Cu, Mo and Nb, internal friction peaks identical to those observed after large normal deformation. The variation of the peaks with pressure for Mo and Nb lead to an explanation of these processes in terms of double kink generation in screw and edge dislocations.

Beam dynamics in rf guns and emittance correction techniques

International Nuclear Information System (INIS)

Serafini, L.

1994-01-01

In this paper we present a general review of beam dynamics in a laser-driven rf gun. The peculiarity of such an accelerating structure versus other conventional multi-cell linac structures is underlined on the basis of the Panofsky-Wenzel theorem, which is found to give a theoretical background for the well known Kim's model. A basic explanation for some proposed methods to correct rf induced emittance growth is also derived from the theorem. We also present three emittance correction techniques for the recovery of space-charge induced emittance growth, namely the optimum distributed disk-like bunch technique, the use of rf spatial harmonics to correct spherical aberration induced by space charge forces and the technique of emittance filtering by clipping the electron beam. The expected performances regarding the beam quality achievable with different techniques, as predicted by scaling laws and simulations, are analyzed, and, where available, compared to experimental results. (orig.)

Transverse emittance measurement at REGAE via a solenoid scan

Energy Technology Data Exchange (ETDEWEB)

Hachmann, Max

2012-12-15

The linear accelerator REGAE at DESY produces short and low charged electron bunches, on the one hand to resolve the excitation transitions of atoms temporally by pump probe electron diffraction experiments and on the other hand to investigate principal mechanisms of laser plasma acceleration. For both cases a high quality electron beam is required. A quantity to rate the beam quality is the beam emittance. In the course of this thesis transverse emittance measurements by a solenoid scan could be realized and beyond that an improved theoretical description of a solenoid was successful. The foundation of emittance measurements are constituted by theoretical models which describe the envelope of a beam. Two different models were derived. The first is an often used model to determine the transverse beam emittance without considering space charge effects. More interesting and challenging was the development of an envelope model taking space charge effects into account. It is introduced and cross checked with measurements and simulations.

Laser-assisted electron emission from gated field-emitters

CERN Document Server

Ishizuka, H; Yokoo, K; Mimura, H; Shimawaki, H; Hosono, A

2002-01-01

Enhancement of electron emission by illumination of gated field-emitters was studied using a 100 mW cw YAG laser at a wavelength of 532 nm, intensities up to 10 sup 7 W/m sup 2 and mechanically chopped with a rise time of 4 mu s. When shining an array of 640 silicon emitters, the emission current responded quickly to on-off of the laser. The increase of the emission current was proportional to the basic emission current at low gate voltages, but it was saturated at approx 3 mu A as the basic current approached 100 mu A with the increase of gate voltage. The emission increase was proportional to the square root of laser power at low gate voltages and to the laser power at elevated gate voltages. For 1- and 3-tip silicon emitters, the rise and fall of the current due to on-off of the laser showed a significant time lag. The magnitude of emission increase was independent of the position of laser spot on the emitter base and reached 2 mu A at a basic current of 5 mu A without showing signs of saturation. The mech...

Semi-empirical model to determine pure β--emitters in closed waste packages using Bremsstrahlung radiation

International Nuclear Information System (INIS)

Takacs, S.; Hermanne, A.

2001-01-01

unsealed pure β - -emitting isotopes are applied. The 3 H, 35 S, 32 P and 33 P are widely used for DNA sequencing studies. Also large amount of 3 H and 14 C are used in organic compound synthesis resulting in long-lived low-level radioactive waste. The β - -particles can be detected by beta counter but it is not applicable in the case of closed waste packages, since the β - - particles loss their energy quickly and they are not capable to escape from the sealed waste package. The emitted β - -particles have continuous energy spectrum and no direct gamma radiation follow the decay. The only means of detection of these β - -particles is through the Bremsstrahlung radiation produced while the particle slows down. The cross section of the Bremsstrahlung generation process depends on the initial energy of the slowing down β - - particles and is proportional to the atomic density n and the average Z 2 of the waste matrix. The probability of this process is much lower than that of the ionisation process for beta particles but it is still high enough to produce measurable amounts of photons. We studied the 35 S and 32 P pure β - -emitter sources in sealed waste packages. The continuous nature of the Bremsstrahlung radiation prevents us using the 'full-energy photo peak area' method. Instead a Region of Interest (ROI) was defined. Unlike for the full-energy photo peak method where the detector efficiency is calculated in the function of energy, for pure β - - emitters an optimised ROI was defined in the spectrum and a special efficiency, eps*beta(E) was determined. The used geometry and the nature of the waste matrix requires time consuming efficiency calibrations of the detector system to be able to establish an efficiency - (matrix density, geometry, matrix composition, activity distribution) function. We studied experimentally the possible deviations of the eps*beta(E) function in case of non uniform activity distribution in order to be able to model the associated error

Perspective: Disclosing hidden sources of funding.

Science.gov (United States)

Resnik, David B

2009-09-01

In this article, the author discusses ethical and policy issues related to the disclosure of hidden sources of funding in research. The author argues that authors have an ethical obligation to disclose hidden sources of funding and that journals should adopt policies to enforce this obligation. Journal policies should require disclosure of hidden sources of funding that authors know about and that have a direct relation to their research. To stimulate this discussion, the author describes a recent case: investigators who conducted a lung cancer screening study had received funding from a private foundation that was supported by a tobacco company, but they did not disclose this relationship to the journal. Investigators and journal editors must be prepared to deal with these issues in a manner that promotes honesty, transparency, fairness, and accountability in research. The development of well-defined, reasonable policies pertaining to hidden sources of funding can be a step in this direction.

Improved Rare-Earth Emitter Hollow Cathode

Science.gov (United States)

Goebel, Dan M.

2011-01-01

An improvement has been made to the design of the hollow cathode geometry that was created for the rare-earth electron emitter described in Compact Rare Earth Emitter Hollow Cathode (NPO-44923), NASA Tech Briefs, Vol. 34, No. 3 (March 2010), p. 52. The original interior assembly was made entirely of graphite in order to be compatible with the LaB6 material, which cannot be touched by metals during operation due to boron diffusion causing embrittlement issues in high-temperature refractory materials. Also, the graphite tube was difficult to machine and was subject to vibration-induced fracturing. This innovation replaces the graphite tube with one made out of refractory metal that is relatively easy to manufacture. The cathode support tube is made of molybdenum or molybdenum-rhenium. This material is easily gun-bored to near the tolerances required, and finish machined with steps at each end that capture the orifice plate and the mounting flange. This provides the manufacturability and robustness needed for flight applications, and eliminates the need for expensive e-beam welding used in prior cathodes. The LaB6 insert is protected from direct contact with the refractory metal tube by thin, graphite sleeves in a cup-arrangement around the ends of the insert. The sleeves, insert, and orifice plate are held in place by a ceramic spacer and tungsten spring inserted inside the tube. To heat the cathode, an insulating tube is slipped around the refractory metal hollow tube, which can be made of high-temperature materials like boron nitride or aluminum nitride. A screw-shaped slot, or series of slots, is machined in the outside of the ceramic tube to constrain a refractory metal wire wound inside the slot that is used as the heater. The screw slot can hold a single heater wire that is then connected to the front of the cathode tube by tack-welding to complete the electrical circuit, or it can be a double slot that takes a bifilar wound heater with both leads coming out

Preservation of low slice emittance in bunch compressors

Directory of Open Access Journals (Sweden)

S. Bettoni

2016-03-01

Full Text Available Minimizing the dilution of the electron beam emittance is crucial for the performance of accelerators, in particular for free electron laser facilities, where the length of the machine and the efficiency of the lasing process depend on it. Measurements performed at the SwissFEL Injector Test Facility revealed an increase in slice emittance after compressing the bunch even for moderate compression factors. The phenomenon was experimentally studied by characterizing the dependence of the effect on beam and machine parameters relevant for the bunch compression. The reproduction of these measurements in simulation required the use of a 3D beam dynamics model along the bunch compressor that includes coherent synchrotron radiation. Our investigations identified transverse effects, such as coherent synchrotron radiation and transverse space charge as the sources of the observed emittance dilution, excluding other effects, such as chromatic effects on single slices or spurious dispersion. We also present studies, both experimental and simulation based, on the effect of the optics mismatch of the slices on the variation of the slice emittance along the bunch. After a corresponding reoptimization of the beam optics in the test facility we reached slice emittances below 200 nm for the central slices along the longitudinal dimension with a moderate increase up to 300 nm in the head and tail for a compression factor of 7.5 and a bunch charge of 200 pC, equivalent to a final current of 150 A, at about 230 MeV energy.

Coupling of Quantum Emitters in Nanodiamonds to Plasmonic Structures

DEFF Research Database (Denmark)

Kumar, Shailesh

This PhD thesis describes work towards the enhancement and efficient channeling of photons emitted from a single photon emitter. The emitter used is a defect center, the Nitrogen-Vacancy (NV) center, in diamond. The NV-center has many unique properties, such as long coherence time of its electron...

Emittance growth due to dipole ripple and sextupole

International Nuclear Information System (INIS)

Shih, H.J.; Ellison, J.A.; Syphers, M.J.; Newberger, B.S.

1993-05-01

Ripple in the power supplies for storage ring magnets can have adverse effects on the circulating beams: orbit distortion and emittance growth from dipole ripple, tune modulation and dynamic aperture reduction from quadrupole ripple, etc. In this paper, we study the effects of ripple in the horizontal bending field of the SSC in the presence of nonlinearity, in particular, the growth in beam emittance

Multibunch emittance growth and its corrections in S-Band linear collider

International Nuclear Information System (INIS)

Gao, J.

1994-11-01

Multibunch emittance growths caused by long range wake fields with the misalignments of accelerating structures and quadrupoles in S-Band linear collider are studied. Tolerances for the misalignment errors of accelerating structures and quadrupoles are given corresponding to different detuned+damped structures. At the end of main linac, emittance corrector (EC) is proposed to be used to reduce further the multibunch emittance. Numerical simulations show that the effect of EC is obvious (multibunch emittance can be reduced about one order of magnitude), and it is believed that this kind of EC will be necessary for future linear colliders. (author). 16 refs., 21 figs., 4 tabs

Emittance Measurements from a Laser Driven Electron Injector

Energy Technology Data Exchange (ETDEWEB)

Reis, David A

2003-07-28

The Gun Test Facility (GTF) at the Stanford Linear Accelerator Center was constructed to develop an appropriate electron beam suitable for driving a short wavelength free electron laser (FEL) such as the proposed Linac Coherent Light Source (LCLS). For operation at a wavelength of 1.5 {angstrom}, the LCLS requires an electron injector that can produce an electron beam with approximately 1 {pi} mm-mrad normalized rms emittance with at least 1 nC of charge in a 10 ps or shorter bunch. The GTF consists of a photocathode rf gun, emittance-compensation solenoid, 3 m linear accelerator (linac), drive laser, and diagnostics to measure the beam. The rf gun is a symmetrized 1.6 cell, s-band high gradient, room temperature, photocathode structure. Simulations show that this gun when driven by a temporally and spatially shaped drive laser, appropriately focused with the solenoid, and further accelerated in linac can produce a beam that meets the LCLS requirements. This thesis describes the initial characterization of the laser and electron beam at the GTF. A convolved measurement of the relative timing between the laser and the rf phase in the gun shows that the jitter is less than 2.5 ps rms. Emittance measurements of the electron beam at 35 MeV are reported as a function of the (Gaussian) pulse length and transverse profile of the laser as well as the charge of the electron beam at constant phase and gradient in both the gun and linac. At 1 nC the emittance was found to be {approx} 13 {pi} mm-mrad for 5 ps and 8 ps long laser pulses. At 0.5 nC the measured emittance decreased approximately 20% in the 5 ps case and 40% in the 8 ps case. These measurements are between 40-80% higher than simulations for similar experimental conditions. In addition, the thermal emittance of the electron beam was measured to be 0.5 {pi} mm-mrad.

Quadrupole Transfer Function for Emittance Measurement

CERN Document Server

Cameron, Peter; Jansson, Andreas; Tan, Cheng-Yang

2008-01-01

Historically the use of the quadrupole moment measurement has been impeded by the requirement for large dynamic range, as well as measurement sensitivity to beam position. We investigate the use of the transfer function technique [1-3] in combination with the sensitivity and 160dB revolution line rejection of the direct diode detection analog front end [4] to open the possibility of an emittance diagnostic that may be implemented without operational complication, quasi- parasitic to the operation of existing tune measurement systems. Such a diagnostic would be particularly useful as an emittance monitor during acceleration ramp development in machines like RHIC and the LHC.

Emitter/absorber interface of CdTe solar cells

Energy Technology Data Exchange (ETDEWEB)

Song, Tao, E-mail: tsong241@gmail.com; Sites, James R. [Physics Department, Colorado State University, Fort Collins, Colorado 80523 (United States); Kanevce, Ana [National Renewable Energy Laboratory, Golden, Colorado 80401 (United States)

2016-06-21

The performance of CdTe solar cells can be very sensitive to the emitter/absorber interface, especially for high-efficiency cells with high bulk lifetime. Performance losses from acceptor-type interface defects can be significant when interface defect states are located near mid-gap energies. Numerical simulations show that the emitter/absorber band alignment, the emitter doping and thickness, and the defect properties of the interface (i.e., defect density, defect type, and defect energy) can all play significant roles in the interface recombination. In particular, a type I heterojunction with small conduction-band offset (0.1 eV ≤ ΔE{sub C} ≤ 0.3 eV) can help maintain good cell efficiency in spite of high interface defect density, much like with Cu(In,Ga)Se{sub 2} (CIGS) cells. The basic principle is that positive ΔE{sub C}, often referred to as a “spike,” creates an absorber inversion and hence a large hole barrier adjacent to the interface. As a result, the electron-hole recombination is suppressed due to an insufficient hole supply at the interface. A large spike (ΔE{sub C} ≥ 0.4 eV), however, can impede electron transport and lead to a reduction of photocurrent and fill-factor. In contrast to the spike, a “cliff” (ΔE{sub C} < 0 eV) allows high hole concentration in the vicinity of the interface, which will assist interface recombination and result in a reduced open-circuit voltage. Another way to mitigate performance losses due to interface defects is to use a thin and highly doped emitter, which can invert the absorber and form a large hole barrier at the interface. CdS is the most common emitter material used in CdTe solar cells, but the CdS/CdTe interface is in the cliff category and is not favorable from the band-offset perspective. The ΔE{sub C} of other n-type emitter choices, such as (Mg,Zn)O, Cd(S,O), or (Cd,Mg)Te, can be tuned by varying the elemental ratio for an optimal positive value of ΔE{sub C}. These

Ion concentration in micro and nanoscale electrospray emitters.

Science.gov (United States)

Yuill, Elizabeth M; Baker, Lane A

2018-06-01

Solution-phase ion transport during electrospray has been characterized for nanopipettes, or glass capillaries pulled to nanoscale tip dimensions, and micron-sized electrospray ionization emitters. Direct visualization of charged fluorophores during the electrospray process is used to evaluate impacts of emitter size, ionic strength, analyte size, and pressure-driven flow on heterogeneous ion transport during electrospray. Mass spectrometric measurements of positively- and negatively-charged proteins were taken for micron-sized and nanopipette emitters under low ionic strength conditions to further illustrate a discrepancy in solution-driven transport of charged analytes. A fundamental understanding of analyte electromigration during electrospray, which is not always considered, is expected to provide control over selective analyte depletion and enrichment, and can be harnessed for sample cleanup. Graphical abstract Fluorescence micrographs of ion migration in nanoscale pipettes while solution is electrosprayed.

Experimental study on the double barrier structure at room temperature

Energy Technology Data Exchange (ETDEWEB)

Sheng, H Y; Chua, S J [Centre for Optoelectronics, Dept. of Electrical Engineering, National Univ. of Singapore (Singapore)

1994-06-15

An experimental study of AlAs / GaAs / AlAs double barrier structure is carried out. The double barrier and quantum well structure are grown by MBE. The peak-to-valley ratio 2.6 : 1 with peak current density of 1.6 kA/cm/sup 2 at room temperature have been achieved. (authors)

Hidden Statistics of Schroedinger Equation

Science.gov (United States)

Zak, Michail

2011-01-01

Work was carried out in determination of the mathematical origin of randomness in quantum mechanics and creating a hidden statistics of Schr dinger equation; i.e., to expose the transitional stochastic process as a "bridge" to the quantum world. The governing equations of hidden statistics would preserve such properties of quantum physics as superposition, entanglement, and direct-product decomposability while allowing one to measure its state variables using classical methods.

Emittance of a finite scattering medium with refractive index greater than unity

International Nuclear Information System (INIS)

Crosbie, A.L.

1980-01-01

Refractive index and scattering can significantly influence the transfer of radiation in a semitransparent medium such as water, glass, plastics, or ceramics. In a recent article (1979), the author presented exact numerical results for the emittance of a semiinfinite scattering medium with a refractive index greater than unity. The present investigation extends the analysis to a finite medium. The physical situation consists of a finite planar layer. The isothermal layer emits, absorbs, and isotropically scatters thermal radiation. It is characterized by single scattering albedo, optical thickness, refractive index, and temperature. A formula for the directional emittance is derived, the directional emittance being the emittance of the medium multiplied by the interface transmittance. The ratio of hemispherical to normal emittance is tabulated and discussed

MD2065: Emittance exchange with linear coupling

CERN Document Server

Carver, Lee Robert; Persson, Tobias Hakan Bjorn; Amorim, David; Levens, Tom; Pesah, Arthur Chalom; CERN. Geneva. ATS Department

2018-01-01

In order to better understand the luminosity imbalance between ATLAS and CMS that was observed in 2016, it was proposed to perform a test whereby the horizontal and vertical emittances are exchanged by crossing the tunes in the presence of linear coupling. The luminosity before and after the exchange could be compared to see if the imbalance stems purely from the uneven emittances or if there is an additional mechanism in play. However, due to limited machine availability only tests at injection were able to performed.

Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

Science.gov (United States)

Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

2017-07-19

Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

Coinciding exercise with peak serum caffeine does not improve cycling performance.

Science.gov (United States)

Skinner, Tina L; Jenkins, David G; Taaffe, Dennis R; Leveritt, Michael D; Coombes, Jeff S

2013-01-01

To investigate whether coinciding peak serum caffeine concentration with the onset of exercise enhances subsequent endurance performance. Randomised, double-blind, crossover. In this randomised, placebo-controlled, double-blind crossover study, 14 male trained cyclists and triathletes (age 31±5year, body mass 75.4±5.7 kg, VO₂max 69.5±6.1 mL kg⁻¹ min⁻¹ and peak power output 417±35W, mean±SD) consumed 6 mg kg(-1) caffeine or a placebo either 1h (C(1h)) prior to completing a 40 km time trial or when the start of exercise coincided with individual peak serum caffeine concentrations (C(peak)). C(peak) was determined from a separate 'caffeine profiling' session that involved monitoring caffeine concentrations in the blood every 30 min over a 4h period. Following caffeine ingestion, peak serum caffeine occurred 120 min in 12 participants and 150 min in 2 participants. Time to complete the 40 km time trial was significantly faster (2.0%; p=0.002) in C(1h) compared to placebo. No statistically significant improvement in performance was noted in the C(peak) trial versus placebo (1.1%; p=0.240). Whilst no differences in metabolic markers were found between C(peak) and placebo conditions, plasma concentrations of glucose (p=0.005), norepinephrine and epinephrine (p≤0.002) were higher in the C(1h) trial 6 min post-exercise versus placebo. In contrast to coinciding peak serum caffeine concentration with exercise onset, caffeine consumed 60 min prior to exercise resulted in significant improvements in 40 km time trial performance. The ergogenic effect of caffeine was not found to be related to peak caffeine concentration in the blood at the onset of endurance exercise. Copyright © 2012 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

Prototype of a subsurface drip irrigation emitter: Manufacturing, hydraulic evaluation and experimental analyses

Science.gov (United States)

Souza, Wanderley De Jesus; Rodrigues Sinobas, Leonor; Sánchez, Raúl; Arriel Botrel, Tarlei; Duarte Coelho, Rubens

2013-04-01

Root and soil intrusion into the conventional emitters is one of the major disadvantages to obtain a good uniformity of water application in subsurface drip irrigation (SDI). In the last years, there have been different approaches to reduce these problems such as the impregnation of emitters with herbicide, and the search for an emitter geometry impairing the intrusion of small roots. Within the last this study, has developed and evaluated an emitter model which geometry shows specific physical features to prevent emitter clogging. This work was developed at the Biosystems Engineering Department at ESALQ-USP/Brazil, and it is a part of a research in which an innovated emitteŕs model for SDI has been developed to prevent root and soil particles intrusion. An emitter with a mechanical-hydraulic mechanism (opening and closing the water outlet) for SDI was developed and manufactured using a mechanical lathe process. It was composed by a silicon elastic membrane a polyethylene tube and a Vnyl Polychloride membrane protector system. In this study the performance of the developed prototype was assessed in the laboratory and in the field conditions. In the laboratory, uniformity of water application was calculated by the water emission uniformity coefficient (CUE), and the manufacturer's coefficient of variation (CVm). In addition, variation in the membrane diameter submitted to internal pressures; head losses along the membrane, using the energy equation; and, precision and accuracy of the equation model, analyzed by Pearson's correlation coefficient (r), and by Willmott's concordance index (d) were also calculated with samples of the developed emitters. In the field, the emitters were installed in pots with and without sugar cane culture from October 2010 to January 2012. During this time, flow rate in 20 emitters were measured periodically, and the aspects of them about clogging at the end of the experiment. Emitters flow rates were measured quarterly to calculate

Numerical studies of emittance exchange in 2-D charged-particle beams

International Nuclear Information System (INIS)

Guy, F.W.

1986-01-01

We describe results obtained from a two-dimensional particle-following computer code that simulates a continuous, nonrelativistic, elliptical charged-particle beam with linear continuous focusing. Emittances and focusing strengths can be different in the two transverse directions. The results can be applied, for example, for a quadrupole transport system in a smooth approximation to a real beam with unequal emittances in the two planes. The code was used to study emittance changes caused by kinetic-energy exchange between transverse directions and by shifts in charge distributions. Simulation results for space-charge-dominated beams agree well with analytic formulas. From simulation results, an empirical formula was developed for a ''partition parameter'' (the ratio of kinetic energies in the two directions) as a function of initial conditions and beamline length. Quantitative emittance changes for each transverse direction can be predicted by using this parameter. Simulation results also agree with Hofmann's generalized differential equation relating emittance and field energy

Growth rate of non-thermodynamic emittance of intense electron beams

International Nuclear Information System (INIS)

Carlsten, B.E.

1998-01-01

The nonlinear free-energy concept has been particularly useful in estimating the emittance growth resulting from any excess energy of electron beams in periodic and uniform channels. However, additional emittance growth, that is geometrical rather than thermodynamic in origin, is induced if the particles have different kinetic energies and axial velocities, which is common for mildly relativistic, very intense electron beams. This effect is especially strong if particles lose or gain significant kinetic energy due to the beam's potential depression, as the beam converges and diverges. In this paper we analyze these geometric emittance growth mechanisms for a uniform, continuous, intense electron beam in a focusing transport channel consisting of discrete solenoidal magnets, over distances short enough that the beam does not reach equilibrium. These emittance growth mechanisms are based on the effects of (1) energy variations leading to nonlinearities in the space-charge force even if the current density is uniform, (2) an axial velocity shear radially along the beam due to the beam's azimuthal motion in the solenoids, and (3) an energy redistribution of the beam as the beam compresses or expands. The geometric emittance growth is compared in magnitude with that resulting from the nonlinear free energy, for the case of a mismatched beam in a uniform channel, and is shown to dominate for certain experimental conditions. Rules for minimizing the emittance along a beamline are outlined. copyright 1998 The American Physical Society

Measurement of the transverse emittance for the NSC Pelletron

International Nuclear Information System (INIS)

Rodriques, G.; Mandal, A.; Chopra, S.; Joshi, R.; Datta, S.K.; Roy, A.

1998-01-01

The knowledge of the emittance (transverse and longitudinal) of the NSC pelletron is essential for matching the acceptance of the LINAC which is to be installed to augment the pelletron beam energies. The transverse emittance of NSC pelletron has been measured by employing a focussing element and a down-stream beam profile monitor

Low Cost Constant – Head Drip Irrigation Emitter for Climate ...

African Journals Online (AJOL)

Low Cost Constant – Head Drip Irrigation Emitter for Climate Change Adaptation in Nigeria: Engineering Design and Calibration. ... The drip system comprises of abarrel, sub-main line, lateral lines, tubes and emitters, it can irrigate140 crop ...

Experimental studies on coherent synchrotron radiation at an emittance exchange beam line

Science.gov (United States)

Thangaraj, J. C. T.; Thurman-Keup, R.; Ruan, J.; Johnson, A. S.; Lumpkin, A. H.; Santucci, J.

2012-11-01

One of the goals of the Fermilab A0 photoinjector is to investigate experimentally the transverse to longitudinal emittance exchange (EEX) principle. Coherent synchrotron radiation in the emittance exchange line could limit the performance of the emittance exchanger at short bunch lengths. In this paper, we present experimental and simulation studies of the coherent synchrotron radiation (CSR) in the emittance exchange line at the A0 photoinjector. We report on time-resolved CSR studies using a skew-quadrupole technique. We also demonstrate the advantages of running the EEX with an energy-chirped beam.

Electron field emission characteristics of graphene/carbon nanotubes hybrid field emitter

International Nuclear Information System (INIS)

Chen, Leifeng; He, Hong; Yu, Hua; Cao, Yiqi; Lei, Da; Menggen, QiQiGe; Wu, Chaoxing; Hu, Liqin

2014-01-01

The graphene (GP) and multi-walled carbon nanotubes (MCNTs) hybrid nanostructure emitter was constructed by a larger scale electrophoretic deposition (EPD) method. The field emission (FE) performance of the hybrid emitter is greatly improved compared with that of only GP or MCNTs emitter. The low turn-on electric field (EF), the low threshold EF and the reliability FE properties are obtained from the hybrid emitter. The better FE properties result from the improved electrical properties. For further enhancement FE of hybrids, Ag Nanoparticles (NPs) were decorated on the hybrids and FE characteristics were also studied. These studies indicate that we can use the hybrid nanostructure to improve conductivity and contact resistance, which results in enhancement of the FE properties

Hidden supersymmetry and Fermion number fractionalization

International Nuclear Information System (INIS)

Akhoury, R.

1985-01-01

This paper discusses how a hidden supersymmetry of the underlying field theories can be used to interpret and to calculate fermion number fractionalization in different dimensions. This is made possible by relating it to a corresponding Witten index of the hidden supersymmetry. The closely related anomalies in odd dimensions are also discussed

Studies of emittance growth in the ATF

International Nuclear Information System (INIS)

Zimmermann, F.

1997-03-01

Several different mechanisms of emittance growth in the Accelerator Test Facility (ATF) at KEK are investigated: the author calculates rise times of the fast beam-ion instability for the damping ring (DR), and discusses the emittance growth caused by coherent synchrotron radiation in the beam-transport line (BT), the effect of quadrupole wake fields in the injector linac, and, finally, a single-bunch head-tail ion effect that can occur in both the DR and the BT. A first attempt to measure the quadrupole wake on the real machine is also reported

Chemically doped three-dimensional porous graphene monoliths for high-performance flexible field emitters.

Science.gov (United States)

Kim, Ho Young; Jeong, Sooyeon; Jeong, Seung Yol; Baeg, Kang-Jun; Han, Joong Tark; Jeong, Mun Seok; Lee, Geon-Woong; Jeong, Hee Jin

2015-03-12

Despite the recent progress in the fabrication of field emitters based on graphene nanosheets, their morphological and electrical properties, which affect their degree of field enhancement as well as the electron tunnelling barrier height, should be controlled to allow for better field-emission properties. Here we report a method that allows the synthesis of graphene-based emitters with a high field-enhancement factor and a low work function. The method involves forming monolithic three-dimensional (3D) graphene structures by freeze-drying of a highly concentrated graphene paste and subsequent work-function engineering by chemical doping. Graphene structures with vertically aligned edges were successfully fabricated by the freeze-drying process. Furthermore, their number density could be controlled by varying the composition of the graphene paste. Al- and Au-doped 3D graphene emitters were fabricated by introducing the corresponding dopant solutions into the graphene sheets. The resulting field-emission characteristics of the resulting emitters are discussed. The synthesized 3D graphene emitters were highly flexible, maintaining their field-emission properties even when bent at large angles. This is attributed to the high crystallinity and emitter density and good chemical stability of the 3D graphene emitters, as well as to the strong interactions between the 3D graphene emitters and the substrate.

Emittance growth in the DARHT Axis-II Downstream Transport

Energy Technology Data Exchange (ETDEWEB)

Ekdahl, Jr., Carl August [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Schulze, Martin E. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2015-04-14

Using a particle-in-cell (PIC) code, we investigated the possibilities for emittance growth through the quadrupole magnets of the system used to transport the high-current electron beam from an induction accelerator to the bremsstrahlung converter target used for flash radiography. We found that even highly mismatched beams exhibited little emittance growth (< 6%), which we attribute to softening of their initial hard edge current distributions. We also used this PIC code to evaluate the accuracy of emittance measurements using a solenoid focal scan following the quadrupole magnets. If the beam is round after the solenoids, the simulations indicate that the measurement is highly accurate, but it is substantially inaccurate for elliptical beams

The Hidden Reason Behind Children's Misbehavior.

Science.gov (United States)

Nystul, Michael S.

1986-01-01

Discusses hidden reason theory based on the assumptions that: (1) the nature of people is positive; (2) a child's most basic psychological need is involvement; and (3) a child has four possible choices in life (good somebody, good nobody, bad somebody, or severely mentally ill.) A three step approach for implementing hidden reason theory is…

Field emission from optimized structure of carbon nanotube field emitter array

International Nuclear Information System (INIS)

Chouhan, V.; Noguchi, T.; Kato, S.

2016-01-01

The authors report a detail study on the emission properties of field emitter array (FEA) of micro-circular emitters of multiwall carbon nanotubes (CNTs). The FEAs were fabricated on patterned substrates prepared with an array of circular titanium (Ti) islands on titanium nitride coated tantalum substrates. CNTs were rooted into these Ti islands to prepare an array of circular emitters. The circular emitters were prepared in different diameters and pitches in order to optimize their structure for acquiring a high emission current. The pitch was varied from 0 to 600 μm, while a diameter of circular emitters was kept constant to be 50 μm in order to optimize a pitch. For diameter optimization, a diameter was changed from 50 to 200 μm while keeping a constant edge-to-edge distance of 150 μm between the circular emitters. The FEA with a diameter of 50 μm and a pitch of 120 μm was found to be the best to achieve an emission current of 47 mA corresponding to an effective current density of 30.5 A/cm"2 at 7 V/μm. The excellent emission current was attributed to good quality of CNT rooting into the substrate and optimized FEA structure, which provided a high electric field on a whole circular emitter of 50 μm and the best combination of the strong edge effect and CNT coverage. The experimental results were confirmed with computer simulation.

Field emission from optimized structure of carbon nanotube field emitter array

Energy Technology Data Exchange (ETDEWEB)

Chouhan, V., E-mail: vchouhan@post.kek.jp, E-mail: vijaychouhan84@gmail.com [School of High Energy Accelerator, The Graduate University for Advanced Studies, Tsukuba 305-0801 (Japan); Noguchi, T. [High Energy Accelerator Research Organization (KEK), Tsukuba 305-0801 (Japan); Kato, S. [School of High Energy Accelerator, The Graduate University for Advanced Studies, Tsukuba 305-0801 (Japan); High Energy Accelerator Research Organization (KEK), Tsukuba 305-0801 (Japan)

2016-04-07

The authors report a detail study on the emission properties of field emitter array (FEA) of micro-circular emitters of multiwall carbon nanotubes (CNTs). The FEAs were fabricated on patterned substrates prepared with an array of circular titanium (Ti) islands on titanium nitride coated tantalum substrates. CNTs were rooted into these Ti islands to prepare an array of circular emitters. The circular emitters were prepared in different diameters and pitches in order to optimize their structure for acquiring a high emission current. The pitch was varied from 0 to 600 μm, while a diameter of circular emitters was kept constant to be 50 μm in order to optimize a pitch. For diameter optimization, a diameter was changed from 50 to 200 μm while keeping a constant edge-to-edge distance of 150 μm between the circular emitters. The FEA with a diameter of 50 μm and a pitch of 120 μm was found to be the best to achieve an emission current of 47 mA corresponding to an effective current density of 30.5 A/cm{sup 2} at 7 V/μm. The excellent emission current was attributed to good quality of CNT rooting into the substrate and optimized FEA structure, which provided a high electric field on a whole circular emitter of 50 μm and the best combination of the strong edge effect and CNT coverage. The experimental results were confirmed with computer simulation.

Calculating emittance for Gaussian and Non-Gaussian distributions by the method of correlations for slits

International Nuclear Information System (INIS)

Tan, Cheng-Yang; Fermilab

2006-01-01

One common way for measuring the emittance of an electron beam is with the slits method. The usual approach for analyzing the data is to calculate an emittance that is a subset of the parent emittance. This paper shows an alternative way by using the method of correlations which ties the parameters derived from the beamlets to the actual parameters of the parent emittance. For parent distributions that are Gaussian, this method yields exact results. For non-Gaussian beam distributions, this method yields an effective emittance that can serve as a yardstick for emittance comparisons

Fabrication of multi-emitter array of CNT for enhancement of current density

Energy Technology Data Exchange (ETDEWEB)

Chouhan, Vijay, E-mail: vchouhan@post.kek.jp [Department of Accelerator Science, Graduate University for Advanced Studies, 1-1 Oho, Tsukuba, Ibaraki (Japan); Noguchi, Tsuneyuki [High Energy Accelerator Research Organization-KEK, 1-1 Oho, Tsukuba, Ibaraki (Japan); Kato, Shigeki [Department of Accelerator Science, Graduate University for Advanced Studies, 1-1 Oho, Tsukuba, Ibaraki (Japan); High Energy Accelerator Research Organization-KEK, 1-1 Oho, Tsukuba, Ibaraki (Japan)

2011-11-11

We studied and compared field emission properties of two kinds of emitters of randomly oriented multi-wall carbon nanotubes (MWNTs), viz. continuous film emitter (CFE) and multi-emitter array (MEA). The CFE has a continuous film of MWNTs while the MEA consists of many equidistant small circular emitters. Both types of emitters were prepared by dispersing MWNTs over a titanium (Ti) film (for CFEs) or Ti circular islands (for MEAs) deposited on tantalum (Ta) followed by rooting of MWNTs into the Ti film or the Ti islands at high temperature. Emission properties of both types of emitters were analyzed with changing their emission areas. In case of the CFEs, current density decreased with an increase in emission area whereas consistent current densities were achieved from MEAs with different emission areas. In other words, the total emission current was achieved in proportion to the emission area in the case of MEAs. Additionally a high current density of 22 A/cm{sup 2} was achieved at an electric field of 8 V/{mu}m from MEAs, which was far better than that obtained from CFEs. The high current density in MEAs was attributed to edge effect, in which higher emission current is achieved from the edge of film emitter. The results indicate that the field emission characteristics can be greatly improved if a cathode contains many small equidistant circular emitters instead of a continuous film. The outstanding stability of the CFE and the MEA has been demonstrated for 2100 and 1007 h, respectively.

Emittance growth due to negative-mass instability above transition

International Nuclear Information System (INIS)

Ng, King-Yuen.

1994-08-01

Due to space-charge effect, there is a growth of bunch emittance across transition as a result of negative-mass instability. The models of growth at cutoff frequency and growth from high-frequency Schottky noise are reviewed. The difficulties of performing reliable simulations are discussed. An intuitive self-bunching model for estimating emittance growth is presented

Characteristics of Novel InGaAsN Double Heterojunction Bipolar Transistors

Energy Technology Data Exchange (ETDEWEB)

LI,N.Y.; CHANG,PING-CHIH; BACA,ALBERT G.; LAROCHE,J.R.; REN,F.; ARMOUR,E.; SHARPS,P.R.; HOU,H.Q.

2000-08-01

The authors demonstrate, for the first time, both functional Pnp AlGaAs/InGaAsN/GaAs (Pnp InGaAsN) and Npn InGaP/InGaAsN/GaAs (Npn InGaAsN) double heterojunction bipolar transistors (DHBTs) using a 1.2 eV In{sub 0.03}Ga{sub 0.97}As{sub 0.99}N{sub 0.01} as the base layer for low-power electronic applications. The Pnp InGaAsN DHBT has a peak current gain ({beta}) of 25 and a low turn-on voltage (V{sub ON}) of 0.79 V. This low V{sub ON} is {approximately} 0.25 V lower than in a comparable Pnp AlGAAs/GaAs HBT. For the Npn InGaAsN DHBT, it has a low V{sub ON} of 0.81 V, which is 0.13 V lower than in an InGaP/GaAs HBT. A peak {beta} of 7 with nearly ideal I-V characteristics has been demonstrated. Since GaAs is used as the collector of both Npn and Pnp InGaAsN DHBTs, the emitter-collector breakdown voltage (BV{sub CEO}) are 10 and 12 V, respectively, consistent with the BV{sub CEO} of Npn InGaP/GaAs and Pnp AlGaAs/GaAs HBTs of comparable collector thickness and doping level. All these results demonstrate the potential of InGaAsN DHBTs as an alternative for application in low-power electronics.

Experimental studies on coherent synchrotron radiation at an emittance exchange beam line

Directory of Open Access Journals (Sweden)

J. C. T. Thangaraj

2012-11-01

Full Text Available One of the goals of the Fermilab A0 photoinjector is to investigate experimentally the transverse to longitudinal emittance exchange (EEX principle. Coherent synchrotron radiation in the emittance exchange line could limit the performance of the emittance exchanger at short bunch lengths. In this paper, we present experimental and simulation studies of the coherent synchrotron radiation (CSR in the emittance exchange line at the A0 photoinjector. We report on time-resolved CSR studies using a skew-quadrupole technique. We also demonstrate the advantages of running the EEX with an energy-chirped beam.

Analysis of emittance compensation and simulation results to photo-cathode RF gun

CERN Document Server

LiuShengGuang

2002-01-01

The emittance compensation technology will be used on the photo-cathode RF gun for Shanghai SDUV-FEL. The space charge force and its effect on electron beam transverse emittance in RF gun is studied, the principle of emittance compensation in phase-space is discussed. The authors have designed a compensation solenoid and calculated its magnetic field distribution. Its performance has been studied by the code PARMELA. A simulation result indicates that the normalized transverse RMS emittance for electron beam of 1.5 nC is 1.612 pi mm centre dot mrad, electron energy E = 5.71 MeV

Very low recombination phosphorus emitters for high efficiency crystalline silicon solar cells

International Nuclear Information System (INIS)

Ortega, P; Vetter, M; Bermejo, S; Alcubilla, R

2008-01-01

This work studies low recombination phosphorus emitters on c-Si. The emitters are fabricated by diffusion from solid sources and then passivated by thermal oxide yielding sheet resistances between 15 and 280 Ω/sq. Emitter saturation current densities lie in the 2.5–110 fA cm −2 range, leading to implicit open-circuit voltages between 674 and 725 mV. Bulk lifetime is limited by intrinsic recombination mechanisms. Surface recombination velocities between 80 and 300 cm s −1 have been obtained, appearing among the lowest reported in this range of emitter sheet resistances

High peak power processing up to 100 MV/M on various metallic samples

International Nuclear Information System (INIS)

Luong, M.; Bonin, B.; Safa, H.

1996-01-01

The high peak power processing (HPPP) is a well established way to reduce electronic field emission from radiofrequency (RF) metallic surfaces. The processing occurs because of some kind of instability destroys the emitter, but the basic physical mechanism at work has not yet been clearly identified. RF processing experiments on samples of restricted area, are described with well localized artificial emitting sites (protrusions from scratches on the sample surface). In order to disentangle the role of thermal and mechanical effects, in the processing, the samples were made from metals with different melting temperatures and tensile strengths. (author)

High peak power processing up to 100 MV/m on various metallic samples

International Nuclear Information System (INIS)

Luong, M.; Bonin, B.; Safa, H.; Le Goff, A.

1996-01-01

The high peak power processing (HPPP) is a well established way to reduce electronic field emission from radiofrequency (RF) metallic surfaces. The processing occurs because of some kind of instability destroys the emitter, but the basic physical mechanism at work has not yet been clearly identified. The present study describes RF processing experiments on samples of restricted area, with well localized artificial emitting sites (protrusions from scratches on the sample surface). In order to disentangle the role of thermal and mechanical effects in the processing, the samples were made from metals with different melting temperatures and tensile strengths. (author)

Schottky’s conjecture, field emitters, and the point charge model

Directory of Open Access Journals (Sweden)

Kevin L. Jensen

2016-06-01

Full Text Available A Point Charge Model of conical field emitters, in which the emitter is defined by an equipotential surface of judiciously placed charges over a planar conductor, is used to confirm Schottky’s conjecture that field enhancement factors are multiplicative for a small protrusion placed on top of a larger base structure. Importantly, it is shown that Schottky’s conjecture for conical / ellipsoidal field emitters remains unexpectedly valid even when the dimensions of the protrusion begin to approach the dimensions of the base structure. The model is analytic and therefore the methodology is extensible to other configurations.

Hidden charged dark matter and chiral dark radiation

Science.gov (United States)

Ko, P.; Nagata, Natsumi; Tang, Yong

2017-10-01

In the light of recent possible tensions in the Hubble constant H0 and the structure growth rate σ8 between the Planck and other measurements, we investigate a hidden-charged dark matter (DM) model where DM interacts with hidden chiral fermions, which are charged under the hidden SU(N) and U(1) gauge interactions. The symmetries in this model assure these fermions to be massless. The DM in this model, which is a Dirac fermion and singlet under the hidden SU(N), is also assumed to be charged under the U(1) gauge symmetry, through which it can interact with the chiral fermions. Below the confinement scale of SU(N), the hidden quark condensate spontaneously breaks the U(1) gauge symmetry such that there remains a discrete symmetry, which accounts for the stability of DM. This condensate also breaks a flavor symmetry in this model and Nambu-Goldstone bosons associated with this flavor symmetry appear below the confinement scale. The hidden U(1) gauge boson and hidden quarks/Nambu-Goldstone bosons are components of dark radiation (DR) above/below the confinement scale. These light fields increase the effective number of neutrinos by δNeff ≃ 0.59 above the confinement scale for N = 2, resolving the tension in the measurements of the Hubble constant by Planck and Hubble Space Telescope if the confinement scale is ≲1 eV. DM and DR continuously scatter with each other via the hidden U(1) gauge interaction, which suppresses the matter power spectrum and results in a smaller structure growth rate. The DM sector couples to the Standard Model sector through the exchange of a real singlet scalar mixing with the Higgs boson, which makes it possible to probe our model in DM direct detection experiments. Variants of this model are also discussed, which may offer alternative ways to investigate this scenario.

Positioning with stationary emitters in a two-dimensional space-time

International Nuclear Information System (INIS)

Coll, Bartolome; Ferrando, Joan Josep; Morales, Juan Antonio

2006-01-01

The basic elements of the relativistic positioning systems in a two-dimensional space-time have been introduced in a previous work [Phys. Rev. D 73, 084017 (2006)] where geodesic positioning systems, constituted by two geodesic emitters, have been considered in a flat space-time. Here, we want to show in what precise senses positioning systems allow to make relativistic gravimetry. For this purpose, we consider stationary positioning systems, constituted by two uniformly accelerated emitters separated by a constant distance, in two different situations: absence of gravitational field (Minkowski plane) and presence of a gravitational mass (Schwarzschild plane). The physical coordinate system constituted by the electromagnetic signals broadcasting the proper time of the emitters are the so called emission coordinates, and we show that, in such emission coordinates, the trajectories of the emitters in both situations, the absence and presence of a gravitational field, are identical. The interesting point is that, in spite of this fact, particular additional information on the system or on the user allows us not only to distinguish both space-times, but also to complete the dynamical description of emitters and user and even to measure the mass of the gravitational field. The precise information under which these dynamical and gravimetric results may be obtained is carefully pointed out

Cancer therapy with alpha-emitters labeled peptides.

Science.gov (United States)

Dadachova, Ekaterina

2010-05-01

Actively targeted alpha-particles offer specific tumor cell killing action with less collateral damage to surrounding normal tissues than beta-emitters. During the last decade, radiolabeled peptides that bind to different receptors on the tumors have been investigated as potential therapeutic agents both in the preclinical and clinical settings. Advantages of radiolabeled peptides over antibodies include relatively straightforward chemical synthesis, versatility, easier radiolabeling, rapid clearance from the circulation, faster penetration and more uniform distribution into tissues, and less immunogenicity. Rapid internalization of the radiolabeled peptides with equally rapid re-expression of the cell surface target is a highly desirable property that enhances the total delivery of these radionuclides into malignant sites. Peptides, such as octreotide, alpha-melanocyte-stimulating hormone analogues, arginine-glycine-aspartic acid-containing peptides, bombesin derivatives, and others may all be feasible for use with alpha-emitters. The on-going preclinical work has primarily concentrated on octreotide and octreotate analogues labeled with Bismuth-213 and Astatine-211. In addition, alpha-melanocyte-stimulating hormone analogue has been labeled with Lead-212/Bismuth-212 in vivo generator and demonstrated the encouraging therapeutic efficacy in treatment of experimental melanoma. Obstacles that continue to obstruct widespread acceptance of alpha-emitter-labeled peptides are primarily the supply of these radionuclides and concerns about potential kidney toxicity. New sources and methods for production of these medically valuable radionuclides and better understanding of mechanisms related to the peptide renal uptake and clearance should speed up the introduction of alpha-emitter-labeled peptides into the clinic. Copyright 2010 Elsevier Inc. All rights reserved.

Adaptive filtering for hidden node detection and tracking in networks.

Science.gov (United States)

Hamilton, Franz; Setzer, Beverly; Chavez, Sergio; Tran, Hien; Lloyd, Alun L

2017-07-01

The identification of network connectivity from noisy time series is of great interest in the study of network dynamics. This connectivity estimation problem becomes more complicated when we consider the possibility of hidden nodes within the network. These hidden nodes act as unknown drivers on our network and their presence can lead to the identification of false connections, resulting in incorrect network inference. Detecting the parts of the network they are acting on is thus critical. Here, we propose a novel method for hidden node detection based on an adaptive filtering framework with specific application to neuronal networks. We consider the hidden node as a problem of missing variables when model fitting and show that the estimated system noise covariance provided by the adaptive filter can be used to localize the influence of the hidden nodes and distinguish the effects of different hidden nodes. Additionally, we show that the sequential nature of our algorithm allows for tracking changes in the hidden node influence over time.

Push-pull converter with energy saving circuit for protecting switching transistors from peak power stress

Science.gov (United States)

Mclyman, W. T. (Inventor)

1981-01-01

In a push-pull converter, switching transistors are protected from peak power stresses by a separate snubber circuit in parallel with each comprising a capacitor and an inductor in series, and a diode in parallel with the inductor. The diode is connected to conduct current of the same polarity as the base-emitter juction of the transistor so that energy stored in the capacitor while the transistor is switched off, to protect it against peak power stress, discharges through the inductor when the transistor is turned on, and after the capacitor is discharges through the diode. To return this energy to the power supply, or to utilize this energy in some external circuit, the inductor may be replaced by a transformer having its secondary winding connected to the power supply or to the external circuit.

Laser Process for Selective Emitter Silicon Solar Cells

Directory of Open Access Journals (Sweden)

G. Poulain

2012-01-01

Full Text Available Selective emitter solar cells can provide a significant increase in conversion efficiency. However current approaches need many technological steps and alignment procedures. This paper reports on a preliminary attempt to reduce the number of processing steps and therefore the cost of selective emitter cells. In the developed procedure, a phosphorous glass covered with silicon nitride acts as the doping source. A laser is used to open locally the antireflection coating and at the same time achieve local phosphorus diffusion. In this process the standard chemical etching of the phosphorous glass is avoided. Sheet resistance variation from 100 Ω/sq to 40 Ω/sq is demonstrated with a nanosecond UV laser. Numerical simulation of the laser-matter interaction is discussed to understand the dopant diffusion efficiency. Preliminary solar cells results show a 0.5% improvement compared with a homogeneous emitter structure.

Accurate estimation of the RMS emittance from single current amplifier data

International Nuclear Information System (INIS)

Stockli, Martin P.; Welton, R.F.; Keller, R.; Letchford, A.P.; Thomae, R.W.; Thomason, J.W.G.

2002-01-01

This paper presents the SCUBEEx rms emittance analysis, a self-consistent, unbiased elliptical exclusion method, which combines traditional data-reduction methods with statistical methods to obtain accurate estimates for the rms emittance. Rather than considering individual data, the method tracks the average current density outside a well-selected, variable boundary to separate the measured beam halo from the background. The average outside current density is assumed to be part of a uniform background and not part of the particle beam. Therefore the average outside current is subtracted from the data before evaluating the rms emittance within the boundary. As the boundary area is increased, the average outside current and the inside rms emittance form plateaus when all data containing part of the particle beam are inside the boundary. These plateaus mark the smallest acceptable exclusion boundary and provide unbiased estimates for the average background and the rms emittance. Small, trendless variations within the plateaus allow for determining the uncertainties of the estimates caused by variations of the measured background outside the smallest acceptable exclusion boundary. The robustness of the method is established with complementary variations of the exclusion boundary. This paper presents a detailed comparison between traditional data reduction methods and SCUBEEx by analyzing two complementary sets of emittance data obtained with a Lawrence Berkeley National Laboratory and an ISIS H - ion source

Optimization of a Compton-suppression system by escape-peak ratio

International Nuclear Information System (INIS)

Niu, H.; Chao, J.H.; Wu, S.-C.

1996-01-01

A Compton-suppression system consisting of an HPGe central detector surrounded by eight BGO scintillators in an annular geometry was assembled. This system is dedicated to in-beam γ-ray measurements. The ratios of full-energy to single-escape peak and full-energy of double-escape peak, at γ-rays of 2754, 4443 and 6130 keV, were used to derive associated suppression factors in order to optimize detection conditions of the system. The suppression factors derived both from the escape peak ratios and the corresponding peak-to-Compton ratios of the γ-ray spectra are compared and discussed. This optimization technique may be of great significance for analyzing complicated spectra, where high-energy γ-rays are considered for analytical use. (Author)

The hidden universe

International Nuclear Information System (INIS)

Disney, M.

1985-01-01

Astronomer Disney has followed a somewhat different tack than that of most popular books on cosmology by concentrating on the notion of hidden (as in not directly observable by its own radiation) matter in the universe

Incremental discovery of hidden structure: Applications in theory of elementary particles

International Nuclear Information System (INIS)

Zytkow, J.M.; Fischer, P.J.

1996-01-01

Discovering hidden structure is a challenging, universal research task in Physics, Chemistry, Biology, and other disciplines. Not only must the elements of hidden structure be postulated by the discoverer, but they can only be verified by indirect evidence, at the level of observable objects. In this paper we describe a framework for hidden structure discovery, built on a constructive definition of hidden structure. This definition leads to operators that build models of hidden structure step by step, postulating hidden objects, their combinations and properties, reactions described in terms of hidden objects, and mapping between the hidden and the observed structure. We introduce the operator dependency diagram, which shows the order of operator application and model evaluation. Different observational knowledge supports different evaluation criteria, which lead to different search systems with verifiable sequences of operator applications. Isomorph-free structure generation is another issue critical for efficiency of search. We apply our framework in the system GELL-MANN, that hypothesizes hidden structure for elementary particles and we present the results of a large scale search for quark models

Modulation characteristics of graphene-based thermal emitters

Science.gov (United States)

Mahlmeister, Nathan Howard; Lawton, Lorreta Maria; Luxmoore, Isaac John; Nash, Geoffrey Richard

2016-01-01

We have investigated the modulation characteristics of the emission from a graphene-based thermal emitter both experimentally and through simulations using finite element method modelling. Measurements were performed on devices containing square multilayer graphene emitting areas, with the devices driven by a pulsed DC drive current over a range of frequencies. Simulations show that the dominant heat path is from the emitter to the underlying substrate, and that the thermal resistance between the graphene and the substrate determines the modulation characteristics. This is confirmed by measurements made on devices in which the emitting area is encapsulated by hexagonal boron nitride.

Exponential Increase in Relative Biological Effectiveness Along Distal Edge of a Proton Bragg Peak as Measured by Deoxyribonucleic Acid Double-Strand Breaks

Energy Technology Data Exchange (ETDEWEB)

Cuaron, John J., E-mail: cuaronj@mskcc.org [Memorial Sloan Kettering Cancer Center, New York, New York (United States); Chang, Chang [Texas Center for Proton Therapy, Irving, Texas (United States); Lovelock, Michael; Higginson, Daniel S. [Memorial Sloan Kettering Cancer Center, New York, New York (United States); Mah, Dennis [Procure Proton Therapy Center, Somerset, New Jersey (United States); Cahlon, Oren; Powell, Simon [Memorial Sloan Kettering Cancer Center, New York, New York (United States)

2016-05-01

Purpose: To quantify the relative biological effectiveness (RBE) of the distal edge of the proton Bragg peak, using an in vitro assay of DNA double-strand breaks (DSBs). Methods and Materials: U2OS cells were irradiated within the plateau of a spread-out Bragg peak and at each millimeter position along the distal edge using a custom slide holder, allowing for simultaneous measurement of physical dose. A reference radiation signal was generated using photons. The DNA DSBs at 3 hours (to assess for early damage) and at 24 hours (to assess for residual damage and repair) after irradiation were measured using the γH2AX assay and quantified via flow cytometry. Results were confirmed with clonogenic survival assays. A detailed map of the RBE as a function of depth along the Bragg peak was generated using γH2AX measurements as a biological endpoint. Results: At 3 hours after irradiation, DNA DSBs were higher with protons at every point along the distal edge compared with samples irradiated with photons to similar doses. This effect was even more pronounced after 24 hours, indicating that the impact of DNA repair is less after proton irradiation relative to photons. The RBE demonstrated an exponential increase as a function of depth and was measured to be as high as 4.0 after 3 hours and as high as 6.0 after 24 hours. When the RBE-corrected dose was plotted as a function of depth, the peak effective dose was extended 2-3 mm beyond what would be expected with physical measurement. Conclusions: We generated a highly comprehensive map of the RBE of the distal edge of the Bragg peak, using a direct assay of DNA DSBs in vitro. Our data show that the RBE of the distal edge increases with depth and is significantly higher than previously reported estimates.

Double melting in polytetrafluoroethylene γ-irradiated above its melting point

International Nuclear Information System (INIS)

Serov, S.A.; Khatipov, S.A.; Sadovskaya, N.V.; Tereshenkov, A.V.; Chukov, N.A.

2012-01-01

Highlights: ► PTFE irradiation leads to formation of double melting peaks in DSC curves. ► This is connected to dual crystalline morphology typical for PTFE. ► Two crystalline types exist in the PTFE irradiated in the melt. - Abstract: PTFE irradiation above its melting point leads to formation of double melting and crystallization peaks in DSC curves. Splitting of melting peaks is connected to dual crystalline morphology typical for PTFE irradiated in the melt. According to electron microscopy, two crystalline types with different size and packing density exist in the irradiated PTFE.

Religious Tolerance in the Hidden Curriculum

Directory of Open Access Journals (Sweden)

Kevin Nobel Kurniawan

2018-03-01

Full Text Available Religious intolerance is spreading within the Indonesian institution of education. Previous studies have shown that the growth of intolerance is due to the state’s regulation and pedagogical apparatus. In contrast to the previous studies, I argue that the intolerance is related to hidden curriculum applied by the institution of education.  Normatively, the hidden curriculum contains the value of religious tolerance. However, factually, the author found that there are practices of intolerance, through the formal and informal spheres in the school’s structure, within the hidden curriculum. This article applies a qualitative approach with a mixed method research strategy to analyze data collected from students, teachers, and alumnis through field observation, in-depth interview, and survey.

Equilibrium double layers in extended Pierce diodes

International Nuclear Information System (INIS)

Ciubotariu-Jassy, C.I.

1992-01-01

The extended Pierce diode is similar to the standard (or classical) Pierce diode, but has passive circuit elements in place of the short circuit between the electrodes. This device is important as an approximation to real bounded plasma systems. It consists of two parallel plane electrodes (an emitter located at x=0 and a collector located at x=l) and a collisionless cold electron beam travelling between them. The electrons are neutralized by a background of comoving massive ions. This situation is analysed in this paper and new equilibrium double layer (DL) plasma structures are obtained. (author) 6 refs., 3 figs

Relation between field energy and RMS emittance in intense particle beams

International Nuclear Information System (INIS)

Wangler, T.P.; Crandall, K.R.; Mills, R.S.; Reiser, M.

1985-01-01

An equation is presented for continuous beams with azimuthal symmetry and continuous linear focusing, which expresses a relationship between the rate of change for squared rms emittance and the rate of change for a quantity we call the nonlinear field energy. The nonlinear field energy depends on the shape of the charge distribution and corresponds to the residual field energy possessed by beams with nonuniform charge distributions. The equation can be integrated for the case of an rms matched beam to yield a formula for space-charge-induced emittance growth that we have tested numerically for a variety of initial distributions. The results provide a framework for discussing the scaling of rms emittance growth and an explanation for the well-established lower limit on output emittance. 15 refs., 4 figs

Study of double triple bend achromat (DTBA) lattice for a 3GeV light source

CERN Document Server

Alekou, Androula; Carmignani, Nicola; Liuzzo, Simone Maria; Raimondi, Pantaleo; Pulampong, Thapakron; Walker, Richard

2017-01-01

Starting from the concepts of the Hybrid Multi Bend Achromat (HMBA) lattice developed at ESRF and of the Double-Double Bend Achromat(DDBA) lattice developed at Diamond, we present a new cell tha tincludes all the advantages of the two designs. The resulting Double Triple Bend Achromat(DTBA) cel lallows for a natural horizontal emittance of less than 100pm with a large dynamic aperture and lifetime. It includes two straight sections, for insertion devices, five and three meters long. The lattice is consistent with the engineering design developed for the ESRF-EBS lattice and the layout and user requirements of Diamond. The characteristics of the cell are presented together with the results of the optimisation process.

Recent advances in the chemistry of positron emitters

International Nuclear Information System (INIS)

Wolf, A.P.; Fowler, J.S.

1985-01-01

With the increasing active interest in PET as a method for studying biochemistry in normal and pathological states in humans we can expect to see the development of new techniques for precursor preparation and synthesis. We have seen a doubling of the publication rate in the past three to four years over the previous three to four year period. As the need for these compounds, especially in the tumor and receptor areas, in a purely clinical setting, increases the trend towards true automation of production of the most needeed compounds will accelerate. The cyclotron manufacturers all offer ''black boxes'' for synthesis but the optimum approach to user friendly automation yet needs to be defined. I would note that this paper was not intended as a comprehensive review but rather my goal was to highlight just some of the exciting developments of the past several years. We are entering what may well be the most extensive and active period of research in the synthesis of positron emitter labeled compounds. If 1984 to 1985 is any gauge, many new methods and compounds will appear in the next several years. 37 refs

Comparison between arc drops in ignited thermionic converters with and without ion reflections at the emitter

International Nuclear Information System (INIS)

Lundgren, L.

1985-01-01

The output performance of two thermionic energy converters is compared. One converter has a normal emitter, working with zero field at the emitter which is close to the optimum working point, and the other has a low work function emitter and ion reflection at the emitter. A simple model of the plasma and the sheaths shows that a converter working with a low work function emitter and ion reflections gives a worse performance than a similar converter with a normal emitter

Double beta decay searches with thermal detectors

International Nuclear Information System (INIS)

Pirro, Stefano

2006-01-01

Double beta decay searches have become more and more important in the last few years. The 'second generation' experiments will allow to explore the inverse hierarchy region but, due to the uncertainties in the nuclear matrix elements, none of them will be able to cover completely the allowed region. Thus the need to investigate different DBD emitters becomes more important. The bolometric technique is only one able to study different nuclei with the proper energy resolution, key point for the future experiments. The possibility to reject the natural background arising from fast neutrons and alpha particles was recently directly proved with thermal bolometers, using the double read out (heat and scintillation). This new technique offers the possibility to reach background levels two orders of magnitude smaller with respect to the ones of the next planned experiments, aiming the possibility to investigate direct hierarchy region. (author)

Fitting Hidden Markov Models to Psychological Data

Directory of Open Access Journals (Sweden)

Ingmar Visser

2002-01-01

Full Text Available Markov models have been used extensively in psychology of learning. Applications of hidden Markov models are rare however. This is partially due to the fact that comprehensive statistics for model selection and model assessment are lacking in the psychological literature. We present model selection and model assessment statistics that are particularly useful in applying hidden Markov models in psychology. These statistics are presented and evaluated by simulation studies for a toy example. We compare AIC, BIC and related criteria and introduce a prediction error measure for assessing goodness-of-fit. In a simulation study, two methods of fitting equality constraints are compared. In two illustrative examples with experimental data we apply selection criteria, fit models with constraints and assess goodness-of-fit. First, data from a concept identification task is analyzed. Hidden Markov models provide a flexible approach to analyzing such data when compared to other modeling methods. Second, a novel application of hidden Markov models in implicit learning is presented. Hidden Markov models are used in this context to quantify knowledge that subjects express in an implicit learning task. This method of analyzing implicit learning data provides a comprehensive approach for addressing important theoretical issues in the field.

Geometric phases and hidden local gauge symmetry

International Nuclear Information System (INIS)

Fujikawa, Kazuo

2005-01-01

The analysis of geometric phases associated with level crossing is reduced to the familiar diagonalization of the Hamiltonian in the second quantized formulation. A hidden local gauge symmetry, which is associated with the arbitrariness of the phase choice of a complete orthonormal basis set, becomes explicit in this formulation (in particular, in the adiabatic approximation) and specifies physical observables. The choice of a basis set which specifies the coordinate in the functional space is arbitrary in the second quantization, and a subclass of coordinate transformations, which keeps the form of the action invariant, is recognized as the gauge symmetry. We discuss the implications of this hidden local gauge symmetry in detail by analyzing geometric phases for cyclic and noncyclic evolutions. It is shown that the hidden local symmetry provides a basic concept alternative to the notion of holonomy to analyze geometric phases and that the analysis based on the hidden local gauge symmetry leads to results consistent with the general prescription of Pancharatnam. We however note an important difference between the geometric phases for cyclic and noncyclic evolutions. We also explain a basic difference between our hidden local gauge symmetry and a gauge symmetry (or equivalence class) used by Aharonov and Anandan in their definition of generalized geometric phases

A multiwire secondary emission profile monitor for small emittance beams

International Nuclear Information System (INIS)

Chehab, R.; Bonnard, J.; Humbert, G.; Leblond, B.; Saury, J.L.

1985-01-01

A secondary emission monitor using two multiwire grids separated by a positively biased collector has been constructed and tested with a 1 GeV electron beam at the Orsay Linac. The monitor installed just before the electron-positron converter has 8 gold-plated-tungsten wires of 0.1 mm diameter equally spaced 0.2 mm apart in each plane. Each wire is connected with an integrator using a low-bias current operational amplifier. The wire planes and the collector are moved into the beam by a stepping motor : that allows beam-position verification. We measured narrow profiles for 1 Amp peak current pulses of 30 nanoseconds width. Profiles are displayed on a scope and allow emittance determination by the three gradient method. Such a monitor is very useful to control the electron beam position and dimensions on the converter, because the positron source dimensions are rather bigger than those of the incident beam and the geometrical acceptance of the positron Linac is limited

Locating Hidden Servers

National Research Council Canada - National Science Library

Oeverlier, Lasse; Syverson, Paul F

2006-01-01

.... Announced properties include server resistance to distributed DoS. Both the EFF and Reporters Without Borders have issued guides that describe using hidden services via Tor to protect the safety of dissidents as well as to resist censorship...

Hidden neural networks

DEFF Research Database (Denmark)

Krogh, Anders Stærmose; Riis, Søren Kamaric

1999-01-01

A general framework for hybrids of hidden Markov models (HMMs) and neural networks (NNs) called hidden neural networks (HNNs) is described. The article begins by reviewing standard HMMs and estimation by conditional maximum likelihood, which is used by the HNN. In the HNN, the usual HMM probability...... parameters are replaced by the outputs of state-specific neural networks. As opposed to many other hybrids, the HNN is normalized globally and therefore has a valid probabilistic interpretation. All parameters in the HNN are estimated simultaneously according to the discriminative conditional maximum...... likelihood criterion. The HNN can be viewed as an undirected probabilistic independence network (a graphical model), where the neural networks provide a compact representation of the clique functions. An evaluation of the HNN on the task of recognizing broad phoneme classes in the TIMIT database shows clear...

Hidden neural networks: application to speech recognition

DEFF Research Database (Denmark)

Riis, Søren Kamaric

1998-01-01

We evaluate the hidden neural network HMM/NN hybrid on two speech recognition benchmark tasks; (1) task independent isolated word recognition on the Phonebook database, and (2) recognition of broad phoneme classes in continuous speech from the TIMIT database. It is shown how hidden neural networks...

Probing the emitter site of Renilla luciferase using small organic molecules; an attempt to understand the molecular architecture of the emitter site.

Science.gov (United States)

Salehi, Farajollah; Emamzadeh, Rahman; Nazari, Mahboobeh; Rasa, Seyed Mohammad Mahdi

2016-12-01

Renilla luciferase is a sensitive enzyme and has wide applications in biotechnology such as drug screening. Previous studies have tried to show the catalytic residues, nevertheless, the accurate architecture and molecular behavior of its emitter site remains uncharacterized. In this study, the activity of Renilla luciferase, in the presence of two small organic molecules including dimethyl sulfoxide (DMSO) and isopropanol was considered and the structure was studied by circular dichroism (CD) and fluorescence spectroscopy. Moreover, the interaction of small organic molecules with the Renilla luciferase was studied using molecular dynamics simulations. Kinetics studies showed that at low concentration of DMSO (16.6-66mM) and isopropanol (19.3-76mM) the K m changed and a competitive inhibition pattern was observed. Moreover, spectroscopy studies reveled that the changes of activity of Renilla luciferase in the presence of low concentrations of small organic molecules was not associated with structural collapse or severe changes in the enzyme conformation. Molecular dynamics simulations indicated that DMSO and isopropanol, as probing molecules, were both able to bind to the emitter site and remained with the residues of the emitter site. Based on the probing data, the architecture of the emitter site in the "non-binding" model was proposed. Copyright © 2016 Elsevier B.V. All rights reserved.

Strong nonlinearity-induced correlations for counterpropagating photons scattering on a two-level emitter

DEFF Research Database (Denmark)

Nysteen, Anders; McCutcheon, Dara; Mørk, Jesper

2015-01-01

We analytically treat the scattering of two counterpropagating photons on a two-level emitter embedded in an optical waveguide. We find that the nonlinearity of the emitter can give rise to significant pulse-dependent directional correlations in the scattered photonic state, which could be quanti......We analytically treat the scattering of two counterpropagating photons on a two-level emitter embedded in an optical waveguide. We find that the nonlinearity of the emitter can give rise to significant pulse-dependent directional correlations in the scattered photonic state, which could...

Application of RBF neural network improved by peak density function in intelligent color matching of wood dyeing

International Nuclear Information System (INIS)

Guan, Xuemei; Zhu, Yuren; Song, Wenlong

2016-01-01

According to the characteristics of wood dyeing, we propose a predictive model of pigment formula for wood dyeing based on Radial Basis Function (RBF) neural network. In practical application, however, it is found that the number of neurons in the hidden layer of RBF neural network is difficult to determine. In general, we need to test several times according to experience and prior knowledge, which is lack of a strict design procedure on theoretical basis. And we also don’t know whether the RBF neural network is convergent. This paper proposes a peak density function to determine the number of neurons in the hidden layer. In contrast to existing approaches, the centers and the widths of the radial basis function are initialized by extracting the features of samples. So the uncertainty caused by random number when initializing the training parameters and the topology of RBF neural network is eliminated. The average relative error of the original RBF neural network is 1.55% in 158 epochs. However, the average relative error of the RBF neural network which is improved by peak density function is only 0.62% in 50 epochs. Therefore, the convergence rate and approximation precision of the RBF neural network are improved significantly.

Emittance scans for CMS luminosity calibration in 2017

CERN Document Server

CMS Collaboration

2018-01-01

Emittance scans are short van der Meer type scans performed at the beginning and at the end of LHC fills. The beams are scanned against each other in X and Y planes in 7 displacement steps. These scans are used for LHC diagnostics and since 2017 for a cross check of the CMS luminosity calibration. An XY pair of scans takes around 3 minutes. The BRIL project provides to LHC three independent online luminosity measurement from the Pixel Luminosity Telescope (PLT), the Fast Beam Condition Monitor (BCM1F) and the Forward calorimeter (HF). The excellent performance of the BRIL detector front-ends, fast back-end electronics and CMS XDAQ based data processing and publication allow the use of emittance scans for linearity and stability studies of the luminometers. Emittance scans became a powerful tool and dramatically improved the understanding of the luminosity measurement during the year. Since each luminometer is independently calibrated in every scan the measurements are independent and ratios of luminometers ca...

Low Emittance Gun Project based on Field Emission

CERN Document Server

Ganter, Romain; Dehler, M; Gobrecht, Jens; Gough, Chris; Ingold, Gerhard; Leemann, Simon C; Shing-Bruce-Li, Kevin; Paraliev, Martin; Pedrozzi, Marco; Raguin, Jean Yves; Rivkin, Leonid; Schlott, Volker; Sehr, Harald; Streun, Andreas; Wrulich, Albin F; Zelenika, Sasa

2004-01-01

The design of an electron gun capable of producing beam emittance one order of magnitude lower than current technology would reduce considerably the cost and size of a free electron laser emitting at 0.1nm. Field emitter arrays (FEAs) including a gate and a focusing layer are an attractive technology for such high brightness sources. Electrons are extracted from micrometric tips thanks to voltage pulses between gate and tips. The focusing layer should then reduce the initial divergence of each emitted beamlets. This FEA will be inserted in a high gradient diode configuration coupled with a radiofrequency structure. In the diode part very high electric field pulses (several hundreds of MV/m) will limit the degradation of emittance due to space charge effect. This first acceleration will be obtained with high voltage pulses (typically a megavolt in a few hundred of nanoseconds) synchronized with the low voltage pulses applied to the FEA (typically one hundred of volts in one nanosecond at frequency below kilohe...

Control and Data Analysis for Emittance Measuring Devices

CERN Document Server

Hoffmann, T

2001-01-01

Due to the wide range of heavy ion beam intensities and energies in the GSI linac and the associated transfer channel to the synchrotron, several different types of emittance measurement systems have been established. Many common devices such as slit/grid or dipole-sweep systems are integrated into the GSI control system. Other systems like the single shot pepper pot method using CCD-cameras or stand-alone slit/grid set-ups are connected to personal computers. An overview is given about the various systems and their software integration. Main interest is directed on the software development for emittance front-end control and data analysis such as evaluation algorithms or graphical presentation of the results. In addition, special features for improved usability of the software such as data export, project databases and automatic report generation will be presented. An outlook on a unified evaluation procedure for all different types of emittance measurement is given.

Superconducting wiggler magnets for beam-emittance damping rings

CERN Document Server

Schoerling, Daniel

2012-01-01

Ultra-low emittance beams with a high bunch charge are necessary for the luminosity performance of linear electron-positron colliders, such as the Compact Linear Collider (CLIC). An effective way to create ultra-low emittance beams with a high bunch charge is to use damping rings, or storage rings equipped with strong damping wiggler magnets. The remanent field of the permanent magnet materials and the ohmic losses in normal conductors limit the economically achievable pole field in accelerator magnets operated at around room temperature to below the magnetic saturation induction, which is 2.15 T for iron. In wiggler magnets, the pole field in the center of the gap is reduced further like the hyperbolic cosine of the ratio of the gap size and the period length multiplied by pi. Moreover, damping wiggler magnets require relatively large gaps because they have to accept the un-damped beam and to generate, at a small period length, a large magnetic flux density amplitude to effectively damp the beam emittance....

Nanometer emittance ultralow charge beams from rf photoinjectors

Directory of Open Access Journals (Sweden)

R. K. Li

2012-09-01

Full Text Available In this paper we discuss the generation of a new class of high brightness relativistic electron beams, characterized by ultralow charge (0.1–1 pC and ultralow normalized emittance (<50  nm. These beams are created in rf photoinjectors when the laser is focused on the cathode to very small transverse sizes (<30  μm rms. In this regime, the charge density at the cathode approaches the limit set by the extraction electric field. By shaping the laser pulse to have a cigarlike aspect ratio (the longitudinal dimension much larger than the transverse dimension and a parabolic temporal profile, the resulting space charge dominated dynamics creates a uniformly filled ellipsoidal distribution and the emittance can be nearly preserved to its thermal value. We also present a new method, based on a variation of the pepper-pot technique, for single shot measurements of the ultralow emittances for this new class of beams.

Microwave background constraints on mixing of photons with hidden photons

International Nuclear Information System (INIS)

Mirizzi, Alessandro; Redondo, Javier; Sigl, Guenter

2008-12-01

Various extensions of the Standard Model predict the existence of hidden photons kinetically mixing with the ordinary photon. This mixing leads to oscillations between photons and hidden photons, analogous to the observed oscillations between different neutrino flavors. In this context, we derive new bounds on the photon-hidden photon mixing parameters using the high precision cosmic microwave background spectral data collected by the Far Infrared Absolute Spectrophotometer instrument on board of the Cosmic Background Explorer. Requiring the distortions of the CMB induced by the photon-hidden photon mixing to be smaller than experimental upper limits, this leads to a bound on the mixing angle χ 0 -7 - 10 -5 for hidden photon masses between 10 -14 eV and 10 -7 eV. This low-mass and low-mixing region of the hidden photon parameter space was previously unconstrained. (orig.)

Graphene field emitters: A review of fabrication, characterization and properties

Energy Technology Data Exchange (ETDEWEB)

Chen, Leifeng, E-mail: chlf@hdu.edu.cn [College of Materials and Environmental Engineering, Hangzhou Dianzi University, Hangzhou 310018 (China); State Key Laboratory of Silicon Materials, Zhejiang University, Hangzhou 310027 (China); Yu, Hu; Zhong, Jiasong; Song, Lihui [College of Materials and Environmental Engineering, Hangzhou Dianzi University, Hangzhou 310018 (China); Wu, Jun, E-mail: wujun@hdu.edu.cn [Institute of Electron Device & Application, Hangzhou Dianzi University, Hangzhou, Zhejiang 310018 (China); Su, Weitao [College of Materials and Environmental Engineering, Hangzhou Dianzi University, Hangzhou 310018 (China)

2017-06-15

Highlights: • The preparation, characterization and field emission properties for Gs are reviewed. • The review provides an updated progress on design and construction of Gs field emitters. • The review offers fundamental insights into understanding and design of Gs emitters. • The review can broach the subject and inspire readers in field of Gs based emitters. - Abstract: Graphenes are beneficial to electrons field emission due to its high aspect ratio, high carrier density, the larger carrier mobility, excellent electrical and thermal conductivity, excellent mechanical strength and chemical stability. In recent years, graphene or reduced oxide graphene field emitters have been successfully constructed by various methods such as chemical vapor deposition, chemical exfoliation, electrophoretic deposition, screen-printing and chemical synthesis methods. Graphene emitters are tried to construct in distribution with some angles or vertical orientation with respect to the substrate surface. The vertical alignment of graphene sheets or edges arrays can facilitate efficient electron emission from the atomically thick sheets. Therefore they have even more a low turn-on and threshold-field electronic field, high field enhancement factor, high current stability and high luminance. In this review, we shortly survey and discuss recent research progress in graphene field emission properties with particular an emphasis on their preparing method, characterization and applications in devices especially for vertical graphene and single layer graphene, also including their challenges and future prospects.

Hidden Crises and Communication: An Interactional Analysis of Hidden Crises

NARCIS (Netherlands)

dr. Annette Klarenbeek

2011-01-01

In this paper I describe the ways in which the communication discipline can make a hidden crisis transparent. For this purpose I examine the concept of crisis entrepreneurship from a communication point of view. Using discourse analysis, I analyse the discursive practices of crisis entrepreneurs in

Hidden Crises and Communication : An Interactional Analysis of Hidden Crises

NARCIS (Netherlands)

dr. Annette Klarenbeek

2011-01-01

In this paper I describe the ways in which the communication discipline can make a hidden crisis transparent. For this purpose I examine the concept of crisis entrepreneurship from a communication point of view. Using discourse analysis, I analyse the discursive practices of crisis entrepreneurs in

Chloroatranol, an extremely potent allergen hidden in perfumes

DEFF Research Database (Denmark)

Johansen, Jeanne Duus; Andersen, Klaus Ejner; Svedman, Cecilia

2003-01-01

Oak moss absolute is a long-known, popular natural extract widely used in perfumes. It is reported as the cause of allergic reactions in a significant number of those with perfume allergy. Oak moss absolute has been the target of recent research to identify its allergenic components. Recently...... an open test simulating the use of perfumes on the volar aspect of the forearms in a randomized and double-blinded design. A solution with 5 p.p.m. chloroatranol was used for 14 days, and, in case of no reaction, the applications were continued for another 14 days with a solution containing 25 p.p.m. All....... The dose eliciting a reaction in 50% of the test subjects at patch testing was 0.2 p.p.m. In conclusion, the hidden exposure to a potent allergen widely used in perfumes has caused a highly sensitized cohort of individuals. Judged from the elicitation profile, chloroatranol is the most potent allergen...

Studies and calculations of transverse emittance growth in proton storage rings

International Nuclear Information System (INIS)

Mane, S.R.; Jackson, G.

1989-01-01

When high energy storage rings are used to collide beams of particles and antiparticles for high energy physics experiments, it is important to obtain as high an integrated luminosity as possible. Reduction of integrated luminosity can arise from several factors, in particular from growth of the transverse beam sizes (transverse emittances). We have studied the problem of transverse emittance growth in high energy storage rings caused by random dipole noise kicks to the beam. A theoretical formula for the emittance growth rate is derived, and agreement is obtained with experimental measurements where noise of known amplitude and power spectrum was deliberately injected into the Fermilab Tevatron, to kick the beam randomly. In the experiment, phase noise was introduced into the Tevatron rf system, and the measured dependence of horizontal emittance growth on phase noise amplitude is compared against the theoretically derived response. (orig.)

Hidden treasures - 50 km points of interests

Science.gov (United States)

Lommi, Matias; Kortelainen, Jaana

2015-04-01

Tampere is third largest city in Finland and a regional centre. During 70's there occurred several communal mergers. Nowadays this local area has both strong and diversed identity - from wilderness and agricultural fields to high density city living. Outside the city center there are interesting geological points unknown for modern city settlers. There is even a local proverb, "Go abroad to Teisko!". That is the area the Hidden Treasures -student project is focused on. Our school Tammerkoski Upper Secondary School (or Gymnasium) has emphasis on visual arts. We are going to offer our art students scientific and artistic experiences and knowledge about the hidden treasures of Teisko area and involve the Teisko inhabitants into this project. Hidden treasures - Precambrian subduction zone and a volcanism belt with dense bed of gold (Au) and arsenic (As), operating goldmines and quarries of minerals and metamorphic slates. - North of subduction zone a homogenic precambrian magmastone area with quarries, products known as Kuru Grey. - Former ashores of post-glasial Lake Näsijärvi and it's sediments enabled the developing agriculture and sustained settlement. Nowadays these ashores have both scenery and biodiversity values. - Old cattle sheds and dairy buildings made of local granite stones related to cultural stonebuilding inheritance. - Local active community of Kapee, about 100 inhabitants. Students will discover information of these "hidden" phenomena, and rendering this information trough Enviromental Art Method. Final form of this project will be published in several artistic and informative geocaches. These caches are achieved by a GPS-based special Hidden Treasures Cycling Route and by a website guiding people to find these hidden points of interests.

Emittances Studies at the Fermilab/NICADD Photoinjector Laboratory

CERN Document Server

Tikhoplav, Rodion; Melissinos, A C; Regis-Guy Piot, Philippe

2005-01-01

The Fermilab/NICADD photoinjector incorporates an L-band rf-gun capable of generating 1-10 nC bunches. The bunches are then accelerated to 16 MeV with a TESLA superconducting cavity. In the present paper we present parametric studies of transverse emittances and energy spread for a various operating points of the electron source (RF-gun E-field, laser length and spot size, and solenoid settings). We especially study the impact, on transverse emittance, of Gaussian and Plateau temporal distribution of the photocathode drive-laser.

Activity measurement by using γ-ray sum peak method considering intake radioactivity and its application

International Nuclear Information System (INIS)

Miyahara, Hiroshi; Narita, Norihiko; Tomita, Kenichi; Katoh, Yoshichika; Mori, Chizuo; Momose, Takumaro; Shinohara, Kunihiko

2000-01-01

It is important to measure external and internal exposure dose in the case of accident. The external exposure can be measured by various dosimeters, but the internal exposure is usually calculated from estimated amounts of intake radioactivity because of difficulty of direct measurement. Detection efficiency of human counter used in direct measurement is necessary, but there is no effective method to determine it for non-uniform distribution. The γ-ray sum peak method is tried for the cascade γ-ray emitter under the consideration of small diffusion such as just after intake. After disintegration rates of sources of 46 Sc and 60 Co were determined by 4πβ-γ coincidence method, γ-ray spectra were measured at various positions. Calculated disintegration rates by sum peak method agreed with those by coincidence method within 10%. The similar results were obtained for distributed plural sources in restricted condition. It is also investigated as application for the case that the other nuclide is contained in it. Using peak-to-total ratios measured in advance, the disintegration rates were determined only from the peak intensities. In this case the results had systematic uncertainty of about 20%. (author)

Simple emittance measurement of H- beams from a large plasma source

International Nuclear Information System (INIS)

Guharay, S.K.; Tsumori, K.; Hamabe, M.; Takeiri, Y.; Kaneko, O.; Kuroda, T.

1996-03-01

An emittance meter is developed using pepper-pot method. Kapton foils are used to detect intensity distributions of small beamlets at the 'image' plane of the pepper-pot. Emittance of H - beams from a large plasma source for the neutral beam injector of the Large Helical Device (LHD) has been measured. The normalized emittance (95%) of a 6 mA H - beam with emission current density of about 10 mA/cm 2 is ∼0.59 mm mrad. The present system is very simple, and it eliminates many complexities of the existing schemes. (author)

Achievement of ultra-low emittance beam in the ATF damping ring

CERN Document Server

Honda, Y; Araki, S; Bane, Karl Leopold Freitag; Brachmann, A; Frisch, J; Fukuda, M; Hasegawa, K; Hayano, H; Hendrickson, L; Higashi, Y; Higo, T; Hirano, K; Hirose, T; Iida, K; Imai, T; Inoue, Y; Karataev, P; Kubo, K; Kurihara, Y; Kuriki, M; Kuroda, R; Kuroda, S; Luo, X; Matsuda, M; McCormick, D; Muto, T; Nakajima, K; Nelson, J; Nomura, M; Ohashi, A; Okugi, T; Omori, T; Ross, M; Sakai, H; Sakai, I; Sasao, N; Smith, S; Suzuki, T; Takano, M; Takashi, N; Taniguchi, T; Terunuma, N; Toge, N; Turner, J; Urakawa, J; Vogel, V; Wolski, A; Woodley, M; Yamazaki, I; Yamazaki, Y; Yocky, J; Young, A; Zimmermann, Frank

2003-01-01

We report on the smallest vertical emittance achieved in single-bunch-mode operation of the ATF. The emittances were measured with a laser-wire beam-profile monitor installed in the damping ring. The bunch length and the momentum spread of the beam were also recorded under the same conditions. The smallest vertical rms emittance measured is 4 pm in the limit of zero current. It increases by a factor of 1.5 for a bunch intensity of 10^10 electrons. There are no discrepancies between the measured data and the calculations of intra-beam scattering.

Hidden Markov Model Application to Transfer The Trader Online Forex Brokers

Directory of Open Access Journals (Sweden)

Farida Suharleni

2012-05-01

Full Text Available Hidden Markov Model is elaboration of Markov chain, which is applicable to cases that can’t directly observe. In this research, Hidden Markov Model is used to know trader’s transition to broker forex online. In Hidden Markov Model, observed state is observable part and hidden state is hidden part. Hidden Markov Model allows modeling system that contains interrelated observed state and hidden state. As observed state in trader’s transition to broker forex online is category 1, category 2, category 3, category 4, category 5 by condition of every broker forex online, whereas as hidden state is broker forex online Marketiva, Masterforex, Instaforex, FBS and Others. First step on application of Hidden Markov Model in this research is making construction model by making a probability of transition matrix (A from every broker forex online. Next step is making a probability of observation matrix (B by making conditional probability of five categories, that is category 1, category 2, category 3, category 4, category 5 by condition of every broker forex online and also need to determine an initial state probability (π from every broker forex online. The last step is using Viterbi algorithm to find hidden state sequences that is broker forex online sequences which is the most possible based on model and observed state that is the five categories. Application of Hidden Markov Model is done by making program with Viterbi algorithm using Delphi 7.0 software with observed state based on simulation data. Example: By the number of observation T = 5 and observed state sequences O = (2,4,3,5,1 is found hidden state sequences which the most possible with observed state O as following : where X1 = FBS, X2 = Masterforex, X3 = Marketiva, X4 = Others, and X5 = Instaforex.

Minimum emittance of isochronus rings for synchrotron light source

CERN Document Server

Shoji, Y

1999-01-01

Theoretically achievable minimum emittances of isochronus rings for synchrotron light source are calculated. The rings discussed in this paper consist of isochronus and achromatic bending cells, isochronus TBA (triple bend achromat) cells with negative dispersion, isochronus TBA cells with inverse bends or isochronus QBA (four bend achromat) cells. We show that the minimum emittances of these rings are roughly 2 or 3 times of those of the optimized non-isochronus rings.

Emittance growth from rotated quadrupoles in heavy ion accelerators

International Nuclear Information System (INIS)

Barnard, J.J.

1995-01-01

We derive a set of moment equations which incorporates linear quadrupolar focusing and space-charge defocusing, in the presence of rotational misalignments of the quadrupoles about the direction of beam propagation. Although the usual beam emittance measured relative to fixed transverse x and y coordinate axes is not constant, a conserved emittance-like quantity has been found. Implications for alignment tolerances in accelerators for heavy-ion inertial fusion are discussed

Extragalactic Peaked-spectrum Radio Sources at Low Frequencies

Energy Technology Data Exchange (ETDEWEB)

Callingham, J. R.; Gaensler, B. M.; Sadler, E. M.; Lenc, E. [Sydney Institute for Astronomy (SIfA), School of Physics, The University of Sydney, NSW 2006 (Australia); Ekers, R. D.; Bell, M. E. [CSIRO Astronomy and Space Science (CASS), Marsfield, NSW 2122 (Australia); Line, J. L. B.; Hancock, P. J.; Kapińska, A. D.; McKinley, B.; Procopio, P. [ARC Centre of Excellence for All-Sky Astrophysics (CAASTRO) (Australia); Hurley-Walker, N.; Tingay, S. J.; Franzen, T. M. O.; Morgan, J. [International Centre for Radio Astronomy Research (ICRAR), Curtin University, Bentley, WA 6102 (Australia); Dwarakanath, K. S. [Raman Research Institute (RRI), Bangalore 560080 (India); For, B.-Q. [International Centre for Radio Astronomy Research (ICRAR), The University of Western Australia, Crawley, WA 6009 (Australia); Hindson, L.; Johnston-Hollitt, M. [School of Chemical and Physical Sciences, Victoria University of Wellington, Wellington 6140 (New Zealand); Offringa, A. R., E-mail: joseph.callingham@sydney.edu.au [Netherlands Institute for Radio Astronomy (ASTRON), Dwingeloo (Netherlands); and others

2017-02-20

We present a sample of 1483 sources that display spectral peaks between 72 MHz and 1.4 GHz, selected from the GaLactic and Extragalactic All-sky Murchison Widefield Array (GLEAM) survey. The GLEAM survey is the widest fractional bandwidth all-sky survey to date, ideal for identifying peaked-spectrum sources at low radio frequencies. Our peaked-spectrum sources are the low-frequency analogs of gigahertz-peaked spectrum (GPS) and compact-steep spectrum (CSS) sources, which have been hypothesized to be the precursors to massive radio galaxies. Our sample more than doubles the number of known peaked-spectrum candidates, and 95% of our sample have a newly characterized spectral peak. We highlight that some GPS sources peaking above 5 GHz have had multiple epochs of nuclear activity, and we demonstrate the possibility of identifying high-redshift ( z > 2) galaxies via steep optically thin spectral indices and low observed peak frequencies. The distribution of the optically thick spectral indices of our sample is consistent with past GPS/CSS samples but with a large dispersion, suggesting that the spectral peak is a product of an inhomogeneous environment that is individualistic. We find no dependence of observed peak frequency with redshift, consistent with the peaked-spectrum sample comprising both local CSS sources and high-redshift GPS sources. The 5 GHz luminosity distribution lacks the brightest GPS and CSS sources of previous samples, implying that a convolution of source evolution and redshift influences the type of peaked-spectrum sources identified below 1 GHz. Finally, we discuss sources with optically thick spectral indices that exceed the synchrotron self-absorption limit.

Microwave background constraints on mixing of photons with hidden photons

Energy Technology Data Exchange (ETDEWEB)

Mirizzi, Alessandro [Max-Planck-Institut fuer Physik, Muenchen (Germany); Redondo, Javier [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Sigl, Guenter [Hamburg Univ. (Germany). 2. Inst. fuer Theoretische Physik

2008-12-15

Various extensions of the Standard Model predict the existence of hidden photons kinetically mixing with the ordinary photon. This mixing leads to oscillations between photons and hidden photons, analogous to the observed oscillations between different neutrino flavors. In this context, we derive new bounds on the photon-hidden photon mixing parameters using the high precision cosmic microwave background spectral data collected by the Far Infrared Absolute Spectrophotometer instrument on board of the Cosmic Background Explorer. Requiring the distortions of the CMB induced by the photon-hidden photon mixing to be smaller than experimental upper limits, this leads to a bound on the mixing angle {chi}{sub 0} hidden photon masses between 10{sup -14} eV and 10{sup -7} eV. This low-mass and low-mixing region of the hidden photon parameter space was previously unconstrained. (orig.)

Hidden symmetries in minimal five-dimensional supergravity

International Nuclear Information System (INIS)

Poessel, Markus; Silva, Sebastian

2004-01-01

We study the hidden symmetries arising in the dimensional reduction of d=5, N=2 supergravity to three dimensions. Extending previous partial results for the bosonic part, we give a derivation that includes fermionic terms, shedding light on the appearance of the local hidden symmetry SO(4) in the reduction

Ghost signals in Allison emittance scanners

International Nuclear Information System (INIS)

Stockli, Martin P.; Leitner, M.; Moehs, D.P.; Keller, R.; Welton, R.F.

2004-01-01

For over 20 years, Allison scanners have been used to measure emittances of low-energy ion beams. We show that scanning large trajectory angles produces ghost signals caused by the sampled beamlet impacting on an electric deflection plate. The ghost signal strength is proportional to the amount of beam entering the scanner. Depending on the ions, and their velocity, the ghost signals can have the opposite or the same polarity as the main beam signals. The ghost signals cause significant errors in the emittance estimates because they appear at large trajectory angles. These ghost signals often go undetected because they partly overlap with the real signals, are mostly below the 1% level, and often hide in the noise. A simple deflection plate modification is shown to reduce the ghost signal strength by over 99%

Ghost Signals In Allison Emittance Scanners

International Nuclear Information System (INIS)

Stockli, Martin P.; Leitner, M.; Keller, R.; Moehs, D.P.; Welton, R. F.

2005-01-01

For over 20 years, Allison scanners have been used to measure emittances of low-energy ion beams. We show that scanning large trajectory angles produces ghost signals caused by the sampled beamlet impacting on an electric deflection plate. The ghost signal strength is proportional to the amount of beam entering the scanner. Depending on the ions, and their velocity, the ghost signals can have the opposite or the same polarity as the main beam signals. The ghost signals cause significant errors in the emittance estimates because they appear at large trajectory angles. These ghost signals often go undetected because they partly overlap with the real signals, are mostly below the 1% level, and often hide in the noise. A simple deflection plate modification is shown to reduce the ghost signal strength by over 99%

Computing Eigen-Emittances from Tracking Data

Energy Technology Data Exchange (ETDEWEB)

Alexahin, Y. [Fermilab

2014-09-18

In a strongly nonlinear system the particle distribution in the phase space may develop long tails which contribution to the covariance (sigma) matrix should be suppressed for a correct estimate of the beam emittance. A method is offered based on Gaussian approximation of the original particle distribution in the phase space (Klimontovich distribution) which leads to an equation for the sigma matrix which provides efficient suppression of the tails and cannot be obtained by introducing weights. This equation is easily solved by iterations in the multi-dimensional case. It is also shown how the eigen-emittances and coupled optics functions can be retrieved from the sigma matrix in a strongly coupled system. Finally, the developed algorithm is applied to 6D ionization cooling of muons in HFOFO channel.

High precision 16K, 16 channel peak sensing CAMAC ADC

International Nuclear Information System (INIS)

Jain, Mamta; Subramaniam, E.T

2013-01-01

A high density, peak sensing, analog to digital converter (ADC) double width module with CAMAC back plane has been developed for nuclear physics experiments with a large number of detectors. This module has sixteen independent channels in plug-in daughter card mother board mode

Optical characterization of OLED emitter properties by radiation pattern analyses

Energy Technology Data Exchange (ETDEWEB)

Flaemmich, Michael

2011-09-08

Researches in both, academia and industry are investigating optical loss channels in OLED layered systems by means of optical simulation tools in order to derive promising concepts for a further enhancement of the overall device performance. Besides other factors, the prospects of success of such optimization strategies rely severely on the credibility of the optical input data. The present thesis provides a guideline to measure the active optical properties of OLED emitter materials in situ by radiation pattern analyses. Reliable and widely applicable methods are introduced to determine the internal electroluminescence spectrum, the profile of the emission zone, the dipole emitter orientation, and the internal luminescence quantum efficiency of emissive materials from the optical far field emission of OLEDs in electrical operation. The proposed characterization procedures are applied to sets of OLEDs containing both, fluorescent polymeric materials as well as phosphorescent small-molecular emitters, respectively. On the one hand, quite expected results are obtained. On the other hand, several novel and truly surprising results are found. Most importantly, this thesis contains the first report of a non-isotropic, mainly parallel emitter orientation in a phosphorescent small-molecular guest-host system (Ir(MDQ)2(acac) in a-NPD). Due to the latter result, emitter orientation based optimization of phosphorescent OLEDs seems to be within reach. Since parallel dipoles emit preferably into air, the utilization of smart emissive materials with advantageous molecular orientation is capable to boost the efficiency of phosphorescent OLEDs by 50%. Materials design, the influence of the matrix material and the substrate, as well as film deposition conditions are just a few parameters that need to be studied further in order to exploit the huge potential of the dipole emitter orientation in phosphorescent OLEDs.

Sub-nanometer emittance monitor for high brightness synchrotron radiation source

International Nuclear Information System (INIS)

Nakajima, K.

1991-01-01

Method of measuring a very small beam emittance in electron storage rings is presented. The monitor can sense an intrinsic emittance of beam particles by detecting the angular distribution of Compton scatterings of laser photons on beam electrons. It is possible to achieve measurement resolution smaller than 10 -9 m-rad without difficulty. (author)

Automatic acquisition and shape analysis of metastable peaks

International Nuclear Information System (INIS)

Maendli, H.; Robbiani, R.; Kuster, Th.; Seibl, J.

1979-01-01

A method for automatic acquisition and evaluation of metastable peaks due to transitions in the first field-free region of a double focussing mass spectrometer is presented. The data are acquired by computer-controlled repetitive scanning of the accelerating voltage and concomitant accumulation, the evaluation made by a mathematical derivatization of the resulting curve. Examples for application of the method are given. (Auth.)

Normal spectral emittance of Inconel 718 aeronautical alloy coated with yttria stabilized zirconia films

Energy Technology Data Exchange (ETDEWEB)

Gonzalez-Fernandez, L. [Departamento de Fisica de la Materia Condensada, Facultad de Ciencia y Tecnologia, Universidad del Pais Vasco, Barrio Sarriena s/n, 48940 Leioa, Bizkaia (Spain); Industria de Turbo Propulsores, S.A., Planta de Zamudio, Edificio 300, 48170 Zamudio, Bizkaia (Spain); Campo, L. del [Departamento de Fisica de la Materia Condensada, Facultad de Ciencia y Tecnologia, Universidad del Pais Vasco, Barrio Sarriena s/n, 48940 Leioa, Bizkaia (Spain); Perez-Saez, R.B., E-mail: raul.perez@ehu.es [Departamento de Fisica de la Materia Condensada, Facultad de Ciencia y Tecnologia, Universidad del Pais Vasco, Barrio Sarriena s/n, 48940 Leioa, Bizkaia (Spain); Tello, M.J. [Departamento de Fisica de la Materia Condensada, Facultad de Ciencia y Tecnologia, Universidad del Pais Vasco, Barrio Sarriena s/n, 48940 Leioa, Bizkaia (Spain)

2012-02-05

Highlights: Black-Right-Pointing-Pointer Emittance of Inconel 718 coated with plasma sprayed yttria stabilized zirconia. Black-Right-Pointing-Pointer The coating is opaque for {lambda} > 9 {mu}m and semi-transparent for {lambda} < 9 {mu}m. Black-Right-Pointing-Pointer In the semi-transparent region the emittance decreases with coating thickness. Black-Right-Pointing-Pointer 300 {mu}m thick coatings are still semi-transparent. Black-Right-Pointing-Pointer In the opaque region the surface roughness determines the emittance level. - Abstract: Knowledge of the radiative behaviour of the yttria stabilized zirconia (YSZ) thermal barrier coatings (TBCs) is needed to perform radiative heat transfer calculations in industrial applications. In this paper, normal spectral emittance experimental data of atmospheric plasma sprayed (PS) YSZ films layered on Inconel 718 substrates are shown. The spectral emittance was measured between 2.5 and 22 {mu}m on samples with film thicknesses ranging from 20 to 280 {mu}m. The samples were heated in a controlled environment, and the emittance was measured for several temperatures between 330 and 730 Degree-Sign C. The dependence of the spectral emittance with film thickness, surface roughness and temperature has been studied and compared with the available results for YSZ TBCs obtained by electron-beam physical vapour deposition. The PS-TBC samples show a Christiansen point at {lambda} = 12.8 {mu}m. The films are semi-transparent for {lambda} < 9 {mu}m, and opaque for {lambda} > 9 {mu}m. In the semi-transparent region, the contribution of the radiation emitted by the Inconel 718 substrate to the global emittance of the samples is analysed. In addition, the influence of the roughness in the emittance values in the opaque spectral region is discussed. Finally, the total normal emittance is obtained as a function of the TBC thickness.

Emittance control and RF bunch compression in the NSRRC photoinjector

International Nuclear Information System (INIS)

Lau, W.K.; Hung, S.B.; Lee, A.P.; Chou, C.S.; Huang, N.Y.

2011-01-01

The high-brightness photoinjector being constructed at the National Synchrotron Radiation Research Center is for testing new accelerator and light-source concepts. It is the so-called split photoinjector configuration in which a short solenoid magnet is used for emittance compensation. The UV-drive laser pulses are also shaped to produce uniform cylindrical bunches for further reduction of beam emittance. However, limited by the available power from our microwave power system, the nominal accelerating gradient in the S-band booster linac is set at 18 MV/m. A simulation study with PARMELA shows that the linac operating at this gradient fails to freeze the electron beam emittance at low value. A background solenoid magnetic field is applied for beam emittance control in the linac during acceleration. A satisfactory result that meets our preliminary goal has been achieved with the solenoid magnetic field strength at 0.1 T. RF bunch compression as a means to achieve the required beam brightness for high-gain free-electron laser experiments is also examined. The reduction of bunch length to a few hundred femtoseconds can be obtained.

Benchmarking of measurement and simulation of transverse rms-emittance growth

Directory of Open Access Journals (Sweden)

L. Groening

2008-09-01

Full Text Available Transverse emittance growth along the Alvarez drift tube linac (DTL section is a major concern with respect to the preservation of beam quality of high current beams at the GSI UNILAC. In order to define measures to reduce this growth, appropriate tools to simulate the beam dynamics are indispensable. This paper is about the benchmarking of three beam dynamics simulation codes, i.e. DYNAMION, PARMILA, and PARTRAN against systematic measurements of beam emittances for different transverse phase advances along the DTL. Special emphasis is put on the modeling of the initial distribution for the simulations. The concept of rms equivalence is expanded from full intensity to fractions of less than 100% of the beam. The experimental setup, data reduction, preparation of the simulations, and the evaluation of the simulations are described. In the experiments and in the simulations, a minimum of the rms-emittance growth was observed at zero current phase advances of about 60°. In general, good agreement was found between simulations and experiment for the mean values of horizontal and vertical emittances at the DTL exit.

High efficiency and stable white OLED using a single emitter

Energy Technology Data Exchange (ETDEWEB)

Li, Jian [Arizona State Univ., Tempe, AZ (United States). School of Mechanical, Aerospace, Chemical and Materials Engineering

2016-01-18

The ultimate objective of this project was to demonstrate an efficient and stable white OLED using a single emitter on a planar glass substrate. The focus of the project is on the development of efficient and stable square planar phosphorescent emitters and evaluation of such class of materials in the device settings. Key challenges included improving the emission efficiency of molecular dopants and excimers, controlling emission color of emitters and their excimers, and improving optical and electrical stability of emissive dopants. At the end of this research program, the PI has made enough progress to demonstrate the potential of excimer-based white OLED as a cost-effective solution for WOLED panel in the solid state lighting applications.

Measuring Beam Sizes and Ultra-Small Electron Emittances Using an X-ray Pinhole Camera.

Science.gov (United States)

Elleaume, P; Fortgang, C; Penel, C; Tarazona, E

1995-09-01

A very simple pinhole camera set-up has been built to diagnose the electron beam emittance of the ESRF. The pinhole is placed in the air next to an Al window. An image is obtained with a CCD camera imaging a fluorescent screen. The emittance is deduced from the size of the image. The relationship between the measured beam size and the electron beam emittance depends upon the lattice functions alpha, beta and eta, the screen resolution, pinhole size and photon beam divergence. The set-up is capable of measuring emittances as low as 5 pm rad and is presently routinely used as both an electron beam imaging device and an emittance diagnostic.

Auger electron emitters: Insights gained from in vitro experiments

International Nuclear Information System (INIS)

Makrigiorgos, G.; Adelstein, S.J.; Kassis, A.I.

1990-01-01

This paper outlines the evolution of the current rationale for research into the biological effects of tissue-incorporated Auger electron emitters. The first section is a brief review of the research conducted by several groups in the last fifteen years. The second section describes the in vitro model used in our studies, dosimetric calculations, experimental techniques and recent findings. The third section focuses on the use of Auger electron emitters as in vitro microprobes for the investigation of the radiosensitivity of distinct subcellular components. Examination of the biological effects of the Auger electron emitter 125 I located in different cellular compartments of a single cell line (V 79 hamster lung fibroblast) verifies that DNA is the critical cell structure for radiation damage and that the sensitive sites are of nanometer dimensions. The data from incorporation of several Auger electron emitters at the same location within DNA suggest that there are no saturation effects from the decay of these isotopes (i.e. all the emitted energy is biologically effective) and provide some insight into which of the numerous physical mechanisms accompanying the Auger decay are most important in causing cell damage. Finally the implications of Auger electron emission for radiotherapy and radiation protection in diagnostic nuclear medicine are detailed and further research possibilities are suggested. (orig.)

Evidence of a double peak in muscle activation to enhance strike speed and force: an example with elite mixed martial arts fighters.

Science.gov (United States)

McGill, Stuart M; Chaimberg, Jon D; Frost, David M; Fenwick, Chad M J

2010-02-01

The main issue addressed here is the paradox of muscle contraction to optimize speed and strike force. When muscle contracts, it increases in both force and stiffness. Force creates faster movement, but the corresponding stiffness slows the change of muscle shape and joint velocity. The purpose of this study was to investigate how this speed strength is accomplished. Five elite mixed martial arts athletes were recruited given that they must create high strike force very quickly. Muscle activation using electromyography and 3-dimensional spine motion was measured. A variety of strikes were performed. Many of the strikes intend to create fast motion and finish with a very large striking force, demonstrating a "double peak" of muscle activity. An initial peak was timed with the initiation of motion presumably to enhance stiffness and stability through the body before motion. This appeared to create an inertial mass in the large "core" for limb muscles to "pry" against to initiate limb motion. Then, some muscles underwent a relaxation phase as speed of limb motion increased. A second peak was observed upon contact with the opponent (heavy bag). It was postulated that this would increase stiffness through the body linkage, resulting in a higher effective mass behind the strike and likely a higher strike force. Observation of the contract-relax-contract pulsing cycle during forceful and quick strikes suggests that it may be fruitful to consider pulse training that involves not only the rate of muscle contraction but also the rate of muscle relaxation.

Local models and hidden nonlocality in Quantum Theory

OpenAIRE

Guerini, Leonardo

2014-01-01

This Master's thesis has two central subjects: the simulation of correlations generated by local measurements on entangled quantum states by local hidden-variables models and the revelation of hidden nonlocality. We present and detail the Werner's local model and the hidden nonlocality of some Werner states of dimension $d\\geq5$, the Gisin-Degorre's local model for a Werner state of dimension $d=2$ and the local model of Hirsch et al. for mixtures of the singlet state and noise, all of them f...

Searching for hidden-charm baryonium signals in QCD sum rules

Energy Technology Data Exchange (ETDEWEB)

Chen, Hua-Xing; Zhou, Dan [Beihang University, School of Physics, Beijing Key Laboratory of Advanced Nuclear Materials and Physics, Beijing (China); Chen, Wei [University of Saskatchewan, Department of Physics and Engineering Physics, Saskatoon, SK (Canada); Liu, Xiang [Lanzhou University, School of Physical Science and Technology, Lanzhou (China); Lanzhou University, Research Center for Hadron and CSR Physics, Institute of Modern Physics of CAS, Lanzhou (China); Zhu, Shi-Lin [Peking University, School of Physics, State Key Laboratory of Nuclear Physics and Technology, Beijing (China); Collaborative Innovation Center of Quantum Matter, Beijing (China); Peking University, Center of High Energy Physics, Beijing (China)

2016-11-15

We give an explicit QCD sum rule investigation for hidden-charm baryonium states with the quark content u anti ud anti dc anti c, spin J = 0/1/2/3, and of both positive and negative parities. We systematically construct the relevant local hidden-charm baryonium interpolating currents, which can actually couple to various structures, including hidden-charm baryonium states, charmonium states plus two pions, and hidden-charm tetraquark states plus one pion, etc. We do not know which structure these currents couple to at the beginning, but after sum rule analyses we can obtain some information. We find some of them can couple to hidden-charm baryonium states, using which we evaluate the masses of the lowest-lying hidden-charm baryonium states with quantum numbers J{sup P} = 2{sup -}/3{sup -}/0{sup +}/1{sup +}/2{sup +} to be around 5.0 GeV. We suggest to search for hidden-charm baryonium states, especially the one of J = 3{sup -}, in the D-wave J/ψππ and P-wave J/ψρ and J/ψω channels in this energy region. (orig.)

Beam emittance reduction during operation of Indus-2

Energy Technology Data Exchange (ETDEWEB)

Fakhri, Ali Akbar, E-mail: fakhri@rrcat.gov.in; Kant, Pradeep; Ghodke, A. D.; Singh, Gurnam [Raja Ramanna Centre for Advanced Technology, Indore 452 013 (India)

2015-11-15

Indus-2 storage ring is a 2.5 GeV third generation synchrotron radiation source. This source was commissioned using a moderate optics. Beam injection was accomplished using an off momentum electron beam to avoid difficulties faced in storage of beam at 550 MeV. The injection procedure and relevant beam dynamical studies are discussed. The switch over from the moderate optics to low emittance optics is done at 2.5 GeV after storing the electron beam. The procedure evolved to reduce the beam emittance and its implementation during the operation is discussed.

Nanodiamonds with photostable, sub-gigahertz linewidth quantum emitters

Directory of Open Access Journals (Sweden)

Toan Trong Tran

2017-11-01

Full Text Available Single-photon emitters with narrow linewidths are highly sought after for applications in quantum information processing and quantum communications. In this letter, we report on a bright, highly polarized near infrared single photon emitter embedded in diamond nanocrystals with a narrow, sub-GHz optical linewidth at 10 K. The observed zero-phonon line at ∼780 nm is optically stable under low power excitation and blue shifts as the excitation power increases. Our results highlight the prospect for using new near infrared color centers in nanodiamonds for quantum applications.

Nanodiamonds with photostable, sub-gigahertz linewidth quantum emitters

Science.gov (United States)

Tran, Toan Trong; Kianinia, Mehran; Bray, Kerem; Kim, Sejeong; Xu, Zai-Quan; Gentle, Angus; Sontheimer, Bernd; Bradac, Carlo; Aharonovich, Igor

2017-11-01

Single-photon emitters with narrow linewidths are highly sought after for applications in quantum information processing and quantum communications. In this letter, we report on a bright, highly polarized near infrared single photon emitter embedded in diamond nanocrystals with a narrow, sub-GHz optical linewidth at 10 K. The observed zero-phonon line at ˜780 nm is optically stable under low power excitation and blue shifts as the excitation power increases. Our results highlight the prospect for using new near infrared color centers in nanodiamonds for quantum applications.

Hidden symmetries in five-dimensional supergravity

International Nuclear Information System (INIS)

Poessel, M.

2003-05-01

This thesis is concerned with the study of hidden symmetries in supergravity, which play an important role in the present picture of supergravity and string theory. Concretely, the appearance of a hidden G 2(+2) /SO(4) symmetry is studied in the dimensional reduction of d=5, N=2 supergravity to three dimensions - a parallel model to the more famous E 8(+8) /SO(16) case in eleven-dimensional supergravity. Extending previous partial results for the bosonic part, I give a derivation that includes fermionic terms. This sheds new light on the appearance of the local hidden symmetry SO(4) in the reduction, and shows up an unusual feature which follows from an analysis of the R-symmetry associated with N=4 supergravity and of the supersymmetry variations, and which has no parallel in the eleven-dimensional case: The emergence of an additional SO(3) as part of the enhanced local symmetry, invisible in the dimensional reduction of the gravitino, and corresponding to the fact that, of the SO(4) used in the coset model, only the diagonal SO(3) is visible immediately upon dimensional reduction. The uncovering of the hidden symmetries proceeds via the construction of the proper coset gravity in three dimensions, and matching it with the Lagrangian obtained from the reduction. (orig.)

Room-temperature deposition of diamond-like carbon field emitter on flexible substrates

International Nuclear Information System (INIS)

Chen, H.; Iliev, M.N.; Liu, J.R.; Ma, K.B.; Chu, W.-K.; Badi, N.; Bensaoula, A.; Svedberg, E.B.

2006-01-01

Room-temperature fabrication of diamond-like carbon electron field emitters on flexible polyimide substrate is reported. These thin film field emitters are made using an Ar gas cluster ion beam assisted C 6 vapor deposition method. The bond structure of the as-deposited diamond-like carbon film was studied using Raman spectroscopy. The field emission characteristics of the deposited films were also measured. Electron current densities over 15 mA/cm 2 have been recorded under an electrical field of about 65 V/μm. These diamond-like carbon field emitters are easy and inexpensive to fabricate. The results are promising for flexible field-emission fabrication without the need of complex patterning and tip shaping as compared to the Spindt-type field emitters

DC-SC Photoinjector with Low Emittance at Peking University

CERN Document Server

Xiang Rong; Hao, J; Huang, Senlin; Lu Xiang Yang; Quan, Shengwen; Zhang, Baocheng; Zhao, Kui

2005-01-01

High average power Free Electron Lasers require the high quality electron beams with the low emittance and the sub-picosecond bunches. The design of DC-SC photoinjector, directly combining a DC photoinjector with an SRF cavity, can produce high average current beam with moderate bunch charge and high duty factor. Because of the DC gun, the emittance increases quickly at the beginning, so a carefully design is needed to control that. In this paper, the simulation of an upgraded design has been done to lower the normalized emittance below 1.5mm·mrad. The photoinjector consists of a DC gap and a 2+1/2-cell SRF cavity, and it is designed to produce 4.2 MeV electron beams at 100pC bunch charge and 81.25MHz repetition rate (8 mA average current).

RF emittance in a low energy electron linear accelerator

Science.gov (United States)

Sanaye Hajari, Sh.; Haghtalab, S.; Shaker, H.; Kelisani, M. Dayyani

2018-04-01

Transverse beam dynamics of an 8 MeV low current (10 mA) S-band traveling wave electron linear accelerator has been studied and optimized. The main issue is to limit the beam emittance, mainly induced by the transverse RF forces. The linac is being constructed at Institute for Research in Fundamental Science (IPM), Tehran Iran Labeled as Iran's First Linac, nearly all components of this accelerator are designed and constructed within the country. This paper discusses the RF coupler induced field asymmetry and the corresponding emittance at different focusing levels, introduces a detailed beam dynamics design of a solenoid focusing channel aiming to reduce the emittance growth and studies the solenoid misalignment tolerances. In addition it has been demonstrated that a prebuncher cavity with appropriate parameters can help improving the beam quality in the transverse plane.

Calculations of emittance and damping time effects in the SLC damping rings

International Nuclear Information System (INIS)

Limberg, T.; Moshammer, H.; Raubenheimer, T.; Spencer, J.; Siemann, R.

1992-03-01

In a recent NDR machine experiment the transverse emittance was studied as a function of store time and tune. To explain the observed transverse emittance damping time constants, the magnetic measurement data of the longitudinal field of the bending magnets had to be taken into account. The variation of the transverse emittances with tune due to misalignments and the associated anomalous dispersion is studied as well as the effect of synchrobetatron coupling due to dispersion in the RF cavities

QCD sum rule study of hidden-charm pentaquarks

Energy Technology Data Exchange (ETDEWEB)

Chen, Hua-Xing; Cui, Er-Liang [Beihang University, School of Physics and Beijing Key Laboratory of Advanced Nuclear Materials and Physics, Beijing (China); Chen, Wei; Steele, T.G. [University of Saskatchewan, Department of Physics and Engineering Physics, Saskatoon, Saskatchewan (Canada); Liu, Xiang [Lanzhou University, School of Physical Science and Technology, Lanzhou (China); Lanzhou University and Institute of Modern Physics of CAS, Research Center for Hadron and CSR Physics, Lanzhou (China); Zhu, Shi-Lin [Peking University, School of Physics and State Key Laboratory of Nuclear Physics and Technology, Beijing (China); Collaborative Innovation Center of Quantum Matter, Beijing (China); Peking University, Center of High Energy Physics, Beijing (China)

2016-10-15

We study the mass spectra of hidden-charm pentaquarks having spin J = (1)/(2)/(3)/(2)/(5)/(2) and quark contents uudc anti c. We systematically construct all the relevant local hidden-charm pentaquark currents, and we select some of them to perform QCD sum rule analyses. We find that the P{sub c}(4380) and P{sub c}(4450) can be identified as hidden-charm pentaquark states composed of an anti-charmed meson and a charmed baryon. Besides them, we also find (a) the lowest-lying hidden-charm pentaquark state of J{sup P} = 1/2{sup -} has the mass 4.33{sup +0.17}{sub -0.13} GeV, while the one of J{sup P} = 1/2{sup +} is significantly higher, that is, around 4.7-4.9 GeV; (b) the lowest-lying hidden-charm pentaquark state of J{sup P} = 3/2{sup -} has the mass 4.37{sup +0.18}{sub -0.13} GeV, consistent with the P{sub c}(4380) of J{sup P} = 3/2{sup -}, while the one of J{sup P} = 3/2{sup +} is also significantly higher, that is, above 4.6 GeV; (c) the hidden-charm pentaquark state of J{sup P} = 5/2{sup -} has a mass around 4.5-4.6 GeV, slightly larger than the P{sub c}(4450) of J{sup P} = 5/2{sup +}. (orig.)

Generating femtosecond X-ray pulses using an emittance-spoiling foil in free-electron lasers

Energy Technology Data Exchange (ETDEWEB)

Ding, Y., E-mail: ding@slac.stanford.edu; Coffee, R.; Decker, F.-J.; Emma, P.; Field, C.; Huang, Z.; Krejcik, P.; Krzywinski, J.; Loos, H.; Lutman, A.; Marinelli, A.; Maxwell, T. J.; Turner, J. [SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Behrens, C. [Deutsches Elektronen-Synchrotron DESY, Notkestr. 85, 22607 Hamburg (Germany); Helml, W. [Technische Universität München, James-Franck-Straße 1, 85748 Garching (Germany)

2015-11-09

Generation of femtosecond to sub-femtosecond pulses is attracting much attention in X-ray free-electron laser user community. One method is to use a slotted, emittance-spoiling foil which was proposed before (P. Emma et al., Phys. Rev. Lett. 92, 074801 (2004)) and has been widely used at the Linac Coherent Light Source. Direct experimental characterization of the slotted-foil performance was previously unfeasible due to a lack of appropriate diagnostics. With a recently installed X-band radio-frequency transverse deflector, we are able to characterize the electron bunch spoiling effect and X-ray pulse when using the slotted foil. We show that few-femtosecond X-ray pulses are generated with flexible control of the single-pulse duration or double-pulse separation with comparison to the theoretical model.

Highly flexible and robust N-doped SiC nanoneedle field emitters

KAUST Repository

Chen, Shanliang

2015-01-23

Flexible field emission (FE) emitters, whose unique advantages are lightweight and conformable, promise to enable a wide range of technologies, such as roll-up flexible FE displays, e-papers and flexible light-emitting diodes. In this work, we demonstrate for the first time highly flexible SiC field emitters with low turn-on fields and excellent emission stabilities. n-Type SiC nanoneedles with ultra-sharp tips and tailored N-doping levels were synthesized via a catalyst-assisted pyrolysis process on carbon fabrics by controlling the gas mixture and cooling rate. The turn-on field, threshold field and current emission fluctuation of SiC nanoneedle emitters with an N-doping level of 7.58 at.% are 1.11 V μm-1, 1.55 V μm-1 and 8.1%, respectively, suggesting the best overall performance for such flexible field emitters. Furthermore, characterization of the FE properties under repeated bending cycles and different bending states reveal that the SiC field emitters are mechanically and electrically robust with unprecedentedly high flexibility and stabilities. These findings underscore the importance of concurrent morphology and composition controls in nanomaterial synthesis and establish SiC nanoneedles as the most promising candidate for flexible FE applications. © 2015 Nature Publishing Group All rights reserved.

Optimization of oxidation processes to improve crystalline silicon solar cell emitters

Directory of Open Access Journals (Sweden)

L. Shen

2014-02-01

Full Text Available Control of the oxidation process is one key issue in producing high-quality emitters for crystalline silicon solar cells. In this paper, the oxidation parameters of pre-oxidation time, oxygen concentration during pre-oxidation and pre-deposition and drive-in time were optimized by using orthogonal experiments. By analyzing experimental measurements of short-circuit current, open circuit voltage, series resistance and solar cell efficiency in solar cells with different sheet resistances which were produced by using different diffusion processes, we inferred that an emitter with a sheet resistance of approximately 70 Ω/□ performed best under the existing standard solar cell process. Further investigations were conducted on emitters with sheet resistances of approximately 70 Ω/□ that were obtained from different preparation processes. The results indicate that emitters with surface phosphorus concentrations between 4.96 × 1020 cm−3 and 7.78 × 1020 cm−3 and with junction depths between 0.46 μm and 0.55 μm possessed the best quality. With no extra processing, the final preparation of the crystalline silicon solar cell efficiency can reach 18.41%, which is an increase of 0.4%abs compared to conventional emitters with 50 Ω/□ sheet resistance.

Highly flexible and robust N-doped SiC nanoneedle field emitters

KAUST Repository

Chen, Shanliang; Ying, Pengzhan; Wang, Lin; Wei, Guodong; Gao, Fengmei; Zheng, Jinju; Shang, Minhui; Yang, Zuobao; Yang, Weiyou; Wu, Tao

2015-01-01

Flexible field emission (FE) emitters, whose unique advantages are lightweight and conformable, promise to enable a wide range of technologies, such as roll-up flexible FE displays, e-papers and flexible light-emitting diodes. In this work, we demonstrate for the first time highly flexible SiC field emitters with low turn-on fields and excellent emission stabilities. n-Type SiC nanoneedles with ultra-sharp tips and tailored N-doping levels were synthesized via a catalyst-assisted pyrolysis process on carbon fabrics by controlling the gas mixture and cooling rate. The turn-on field, threshold field and current emission fluctuation of SiC nanoneedle emitters with an N-doping level of 7.58 at.% are 1.11 V μm-1, 1.55 V μm-1 and 8.1%, respectively, suggesting the best overall performance for such flexible field emitters. Furthermore, characterization of the FE properties under repeated bending cycles and different bending states reveal that the SiC field emitters are mechanically and electrically robust with unprecedentedly high flexibility and stabilities. These findings underscore the importance of concurrent morphology and composition controls in nanomaterial synthesis and establish SiC nanoneedles as the most promising candidate for flexible FE applications. © 2015 Nature Publishing Group All rights reserved.

Sociocultural Dimension of Hidden Content in a Professional Language Curriculum

Directory of Open Access Journals (Sweden)

Ekaterina E. Shishlova

2017-12-01

Full Text Available Introduction: studying curriculum as a pedagogical problem has traditionally been reduced to the analysis of its explicit content, set in official educational documents. However, a much less studied hidden content plays a significant role in education. So, what is the role of the hidden curriculum during professional language training? The purpose of the article is to determine the potential impact of hidden curriculum on students’ conceptual worldview. Comparing the worldview presented in textbooks with students’ one has allowed us to estimate the rate of influence of hidden curr iculum. Materials and Methods: the methodological basis of the work is the cultural concept of personalityoriented education. The methodology for studying the role of hidden curriculum includes four stages: at the first stage, the authors set the criteria for selecting textbooks for analysis and do the selection; at the second stage, the authors select sociocultural concepts for analysis; at the third stage, the scheme of analysis is designed and the analysis of textbooks is done; at the fourth stage, the authors identify the potential influence of hidden curriculum on students’ conceptual worldview. Results: the structure of hidden curriculum has been determined and the scheme for analysing its subject component has been developed. The authors have identified a significant influence of hidden curriculum on students’ worldview, which represents the scientific novelty of the article. Discussion and Conclusions: the article gives the definition of a hidden curriculum which is new for Russian pedagogy and presents a methodology for its analysis in EFL textbooks. That analysis is recommended to be conducted when selecting teaching materials both i n languages and other humanities.

Investigations on the transverse phase space at a photo injector for minimized emittance

Energy Technology Data Exchange (ETDEWEB)

Miltchev, V.

2006-08-15

Radio frequency photoinjectors are electron sources able to generate beams of extremely high brightness, which are applicable to linac driven Free Electron Lasers (FEL). Because of the high phase space density, the dynamics of the electron beam is dominated by space charge interactions between the particles. This thesis studies the transverse phase space of space charge dominated electron beams produced by the Photo Injector Test Facility in Zeuthen (PITZ). The operation conditions for minimizing the transverse emittance are studied experimentally, theoretically and in simulations. The influence of the longitudinal profile of the driving UV laser pulse on the transverse emittance is investigated. Emphasis is placed on the experimental study of the emittance as a function of different machine parameters like the laser beam spot size, the amplitude of the focusing magnetic field, the rf phase and the electron bunch charge. First investigations on the thermal emittance for Cs{sub 2}Te photocathodes under rf operating conditions are presented. Measurements of the thermal emittance scaling with the photocathode laser spot size are analyzed. The significance of the applied rf field in the emittance formation process is discussed. (orig.)

Investigations on the transverse phase space at a photo injector for minimized emittance

International Nuclear Information System (INIS)

Miltchev, V.

2006-08-01

Radio frequency photoinjectors are electron sources able to generate beams of extremely high brightness, which are applicable to linac driven Free Electron Lasers (FEL). Because of the high phase space density, the dynamics of the electron beam is dominated by space charge interactions between the particles. This thesis studies the transverse phase space of space charge dominated electron beams produced by the Photo Injector Test Facility in Zeuthen (PITZ). The operation conditions for minimizing the transverse emittance are studied experimentally, theoretically and in simulations. The influence of the longitudinal profile of the driving UV laser pulse on the transverse emittance is investigated. Emphasis is placed on the experimental study of the emittance as a function of different machine parameters like the laser beam spot size, the amplitude of the focusing magnetic field, the rf phase and the electron bunch charge. First investigations on the thermal emittance for Cs 2 Te photocathodes under rf operating conditions are presented. Measurements of the thermal emittance scaling with the photocathode laser spot size are analyzed. The significance of the applied rf field in the emittance formation process is discussed. (orig.)

Infinite hidden conditional random fields for human behavior analysis.

Science.gov (United States)

Bousmalis, Konstantinos; Zafeiriou, Stefanos; Morency, Louis-Philippe; Pantic, Maja

2013-01-01

Hidden conditional random fields (HCRFs) are discriminative latent variable models that have been shown to successfully learn the hidden structure of a given classification problem (provided an appropriate validation of the number of hidden states). In this brief, we present the infinite HCRF (iHCRF), which is a nonparametric model based on hierarchical Dirichlet processes and is capable of automatically learning the optimal number of hidden states for a classification task. We show how we learn the model hyperparameters with an effective Markov-chain Monte Carlo sampling technique, and we explain the process that underlines our iHCRF model with the Restaurant Franchise Rating Agencies analogy. We show that the iHCRF is able to converge to a correct number of represented hidden states, and outperforms the best finite HCRFs--chosen via cross-validation--for the difficult tasks of recognizing instances of agreement, disagreement, and pain. Moreover, the iHCRF manages to achieve this performance in significantly less total training, validation, and testing time.

Simulating double-peak hydrographs from single storms over mixed-use watersheds

Science.gov (United States)

Yang Yang; Theodore A. Endreny; David J. Nowak

2015-01-01

Two-peak hydrographs after a single rain event are observed in watersheds and storms with distinct volumes contributing as fast and slow runoff. The authors developed a hydrograph model able to quantify these separate runoff volumes to help in estimation of runoff processes and residence times used by watershed managers. The model uses parallel application of two...

Emittance studies of the BNL/SLAC/UCLA 1.6 cell photocathode rf gun

International Nuclear Information System (INIS)

Palmer, D.T.; Miller, R.H.; Wang, X.J.

1997-01-01

The symmetrized 1.6 cell S-band photocathode gun developed by the BNL/SLAC/UCLA collaboration is in operation at the Brookhaven Accelerator Test Facility (ATF). A novel emittance compensation solenoid magnet has also been designed, built and is in operation at the ATF. These two subsystems form an emittance compensated photoinjector used for beam dynamics, advanced acceleration and free electron laser experiments at the ATF. The highest acceleration field achieved on the copper cathode is 150 MV/m, and the guns normal operating field is 130 MV/m. The maximum rf pulse length is 3 micros. The transverse emittance of the photoelectron beam were measured for various injection parameters. The 1 nC emittance results are presented along with electron bunch length measurements that indicated that at above the 400 pC, space charge bunch lengthening is occurring. The thermal emittance, ε o , of the copper cathode has been measured

New Method for Determination of Electrically Inactive Phosphorus in n-type Emitters

OpenAIRE

Steyer, Michael; Dastgheib-Shirazi, Amir; Hahn, Giso; Terheiden, Barbara

2015-01-01

The precise knowledge of the amount and the location in depth of inactive phosphorus in an n-type emitter is still a challenge. As a new approach, we determine the total amount of phosphorus (P dose) in the emitter stepwise in dependence of etching depth with the characterization tool ICP-OES. A comparison of the data with the electrically active P concentration profile measured by ECV allows to determine in which depths electrically inactive phosphorus is present. For a highly doped emitter,...

Emittance compensation with dynamically optimized photoelectron beam profiles

Energy Technology Data Exchange (ETDEWEB)

Rosenzweig, J.B. [Department of Physics and Astronomy, UCLA, 405 Hilgard Avenue, Los Angeles, CA 90095 (United States)]. E-mail: rosen@physics.ucla.edu; Cook, A.M. [Department of Physics and Astronomy, UCLA, 405 Hilgard Avenue, Los Angeles, CA 90095 (United States); England, R.J. [Department of Physics and Astronomy, UCLA, 405 Hilgard Avenue, Los Angeles, CA 90095 (United States); Dunning, M. [Department of Physics and Astronomy, UCLA, 405 Hilgard Avenue, Los Angeles, CA 90095 (United States); Anderson, S.G. [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA 94550 (United States); Ferrario, Massimo [Istituto Nazionale di Fisica Nucleare, Laboratori Nazionale di Frascati, Via E. Fermi 41, Frascati, Rome (Italy)

2006-02-01

Much of the theory and experimentation concerning creation of a high-brightness electron beam from a photocathode, and then applying emittance compensation techniques, assumes that one must strive for a uniform density electron beam, having a cylindrical shape. On the other hand, this shape has large nonlinearities in the space-charge field profiles near the beam's longitudinal extrema. These nonlinearities are known to produce both transverse and longitudinal emittance growth. On the other hand, it has recently been shown by Luiten that by illuminating the cathode with an ultra-short laser pulse of appropriate transverse profile, a uniform density, ellipsoidally shaped bunch is dynamically formed, which then has linear space-charge fields in all dimensions inside of the bunch. We study here this process, and its marriage to the standard emittance compensation scenario that is implemented in most recent photoinjectors. It is seen that the two processes are compatible, with simulations indicating a very high brightness beam can be obtained. The robustness of this scheme to systematic errors is examined. Prospects for experimental tests of this scheme are discussed.

Emittance compensation with dynamically optimized photoelectron beam profiles

International Nuclear Information System (INIS)

Rosenzweig, J.B.; Cook, A.M.; England, R.J.; Dunning, M.; Anderson, S.G.; Ferrario, Massimo

2006-01-01

Much of the theory and experimentation concerning creation of a high-brightness electron beam from a photocathode, and then applying emittance compensation techniques, assumes that one must strive for a uniform density electron beam, having a cylindrical shape. On the other hand, this shape has large nonlinearities in the space-charge field profiles near the beam's longitudinal extrema. These nonlinearities are known to produce both transverse and longitudinal emittance growth. On the other hand, it has recently been shown by Luiten that by illuminating the cathode with an ultra-short laser pulse of appropriate transverse profile, a uniform density, ellipsoidally shaped bunch is dynamically formed, which then has linear space-charge fields in all dimensions inside of the bunch. We study here this process, and its marriage to the standard emittance compensation scenario that is implemented in most recent photoinjectors. It is seen that the two processes are compatible, with simulations indicating a very high brightness beam can be obtained. The robustness of this scheme to systematic errors is examined. Prospects for experimental tests of this scheme are discussed

Measuring emittances and sigma matrices

International Nuclear Information System (INIS)

Rees, J.; Rivkin, L.

1984-03-01

The method used for measuring emittance at the SLAC Linac and the linear collider damping ring is described. The basis of the method is derived using one two-by-two matrix to specify the state of the input beam (sigma matrix) and another to describe the lens-drift transport system (R-matrix)

Detecting hidden particles with MATHUSLA

Science.gov (United States)

Evans, Jared A.

2018-03-01

A hidden sector containing light long-lived particles provides a well-motivated place to find new physics. The recently proposed MATHUSLA experiment has the potential to be extremely sensitive to light particles originating from rare meson decays in the very long lifetime region. In this work, we illustrate this strength with the specific example of a light scalar mixed with the standard model-like Higgs boson, a model where MATHUSLA can further probe unexplored parameter space from exotic Higgs decays. Design augmentations should be considered in order to maximize the ability of MATHUSLA to discover very light hidden sector particles.

Double-layer structure in polar mesospheric clouds observed from SOFIE/AIM

Directory of Open Access Journals (Sweden)

H. Gao

2017-02-01

Full Text Available Double-layer structures in polar mesospheric clouds (PMCs are observed by using Solar Occultation for Ice Experiment (SOFIE data between 2007 and 2014. We find 816 and 301 events of double-layer structure with percentages of 10.32 and 7.25 % compared to total PMC events, and the mean distances between two peaks are 3.06 and 2.73 km for the Northern Hemisphere (NH and Southern Hemisphere (SH respectively. Double-layer PMCs almost always have less mean ice water content (IWC than daily IWC during the core of the season, but they are close to each other at the beginning and the end. The result by averaging over all events shows that the particle concentration has obvious double peaks, while the particle radius exhibits an unexpected monotonic increase with decreasing altitude. By further analysis of the background temperature and water vapour residual profiles, we conclude that the lower layer is a reproduced one formed at the bottom of the upper layer. 56.00 and 47.51 % of all double-layer events for the NH and SH respectively have temperature enhancements larger than 2 K locating between their double peaks. The longitudinal anti-correlation between the gravity waves' (GWs' potential energies and occurrence frequencies of double-layer PMCs suggests that the double-layer PMCs tend to form in an environment where the GWs have weaker intensities.

Zipf exponent of trajectory distribution in the hidden Markov model

Science.gov (United States)

Bochkarev, V. V.; Lerner, E. Yu

2014-03-01

This paper is the first step of generalization of the previously obtained full classification of the asymptotic behavior of the probability for Markov chain trajectories for the case of hidden Markov models. The main goal is to study the power (Zipf) and nonpower asymptotics of the frequency list of trajectories of hidden Markov frequencys and to obtain explicit formulae for the exponent of the power asymptotics. We consider several simple classes of hidden Markov models. We prove that the asymptotics for a hidden Markov model and for the corresponding Markov chain can be essentially different.

Zipf exponent of trajectory distribution in the hidden Markov model

International Nuclear Information System (INIS)

Bochkarev, V V; Lerner, E Yu

2014-01-01

This paper is the first step of generalization of the previously obtained full classification of the asymptotic behavior of the probability for Markov chain trajectories for the case of hidden Markov models. The main goal is to study the power (Zipf) and nonpower asymptotics of the frequency list of trajectories of hidden Markov frequencys and to obtain explicit formulae for the exponent of the power asymptotics. We consider several simple classes of hidden Markov models. We prove that the asymptotics for a hidden Markov model and for the corresponding Markov chain can be essentially different

Generation of low-emittance electron beams in electrostatic accelerators for FEL applications

Science.gov (United States)

Teng, Chen; Elias, Luis R.

1995-02-01

This paper reports results of transverse emittance studies and beam propagation in electrostatic accelerators for free electron laser applications. In particular, we discuss emittance growth analysis of a low current electron beam system consisting of a miniature thermoionic electron gun and a National Electrostatics Accelerator (NEC) tube. The emittance growth phenomenon is discussed in terms of thermal effects in the electron gun cathode and aberrations produced by field gradient changes occurring inside the electron gun and throughout the accelerator tube. A method of reducing aberrations using a magnetic solenoidal field is described. Analysis of electron beam emittance was done with the EGUN code. Beam propagation along the accelerator tube was studied using a cylindrically symmetric beam envelope equation that included beam self-fields and the external accelerator fields which were derived from POISSON simulations.

Generation of low-emittance electron beams in electrostatic accelerators for FEL applications

International Nuclear Information System (INIS)

Chen Teng; Central Florida Univ., Orlando, FL; Elias, L.R. R.; Central Florida Univ., Orlando, FL

1995-01-01

This paper reports results of transverse emittance studies and beam propagation in electrostatic accelerators for free electron laser applications. In particular, we discuss emittance growth analysis of a low current electron beam system consisting of a miniature thermoionic electron gun and a National Electrostatics Accelerator (NEC) tube. The emittance growth phenomenon is discussed in terms of thermal effects in the electron gun cathode and aberrations produced by field gradient changes occurring inside the electron gun and throughout the accelerator tube. A method of reducing aberrations using a magnetic solenoidal field is described. Analysis of electron beam emittance was done with the EGUN code. Beam propagation along the accelerator tube was studied using a cylindrically symmetric beam envelope equation that included beam self-fields and the external accelerator fields which were derived from POISSON simulations. ((orig.))

Generation of low-emittance electron beams in electrostatic accelerators for FEL applications

Energy Technology Data Exchange (ETDEWEB)

Chen Teng [University of Central Florida, Orlando, FL (United States). Center for Research in Electro-Optics and Lasers (CREOL)]|[Central Florida Univ., Orlando, FL (United States). Dept. of Physics; Elias, L.R. R. [University of Central Florida, Orlando, FL (United States). Center for Research in Electro-Optics and Lasers (CREOL)]|[Central Florida Univ., Orlando, FL (United States). Dept. of Physics

1995-01-30

This paper reports results of transverse emittance studies and beam propagation in electrostatic accelerators for free electron laser applications. In particular, we discuss emittance growth analysis of a low current electron beam system consisting of a miniature thermoionic electron gun and a National Electrostatics Accelerator (NEC) tube. The emittance growth phenomenon is discussed in terms of thermal effects in the electron gun cathode and aberrations produced by field gradient changes occurring inside the electron gun and throughout the accelerator tube. A method of reducing aberrations using a magnetic solenoidal field is described. Analysis of electron beam emittance was done with the EGUN code. Beam propagation along the accelerator tube was studied using a cylindrically symmetric beam envelope equation that included beam self-fields and the external accelerator fields which were derived from POISSON simulations. ((orig.))

On the linearity of the dose-effect relationship of DNA double strand breaks

International Nuclear Information System (INIS)

Chadwick, K.H.; Leenhouts, H.P.

1994-01-01

Most radiation biologists believe that DNA double-strand breaks are induced linearly with radiation dose for all types of radiation. Since 1985, with the advent of elution and gel electrophoresis techniques which permit the measurement of DNA double-strand breaks induced in mammalian cells at doses having radiobiological relevance, the true nature of the dose-effect relationship has been brought into some doubt. Many investigators measured curvilinear dose-effect relationships and a few found good correlations between the induction of the DNA double-strand breaks and cell survival. We approach the problem pragmatically by assuming that the induction of DNA double-strand breaks by 125 I Auger electron emitters incorporated into the DNA of the cells is a linear function of the number of 125 I decays, and by comparing the dose-effect relationship for sparsely ionizing radiation against this standard. The conclusion drawn that the curvilinear dose-effect relationships and the correlations with survival are real. (Author)

Internal emitter limits for iodine, radium and radon daughters

Energy Technology Data Exchange (ETDEWEB)

Schlenker, R.A.

1984-08-15

This paper identifies some of the issues which arise in the consideration of the derivation of new limits on exposure to internal emitters. Basic and secondary radiation protection limits are discussed. Terms are defined and applied to the limitation of risk from stochastic effects. Non-stochastic data for specific internal emitters (/sup 131/I and the radium isotopes) are presented. Emphasis is placed on the quantitative aspects of the limit setting problem. 65 references, 2 figures, 12 tables.

Transverse emittance measurement at REGAE via a solenoid scan

Energy Technology Data Exchange (ETDEWEB)

Hachmann, Max; Mayet, Frank; Gruener, Florian [Institut fuer Experimentalphysik, Universitaet Hamburg (Germany); Floettmann, Klaus [DESY, Hamburg (Germany)

2013-07-01

The linear accelerator REGAE at DESY produces short and low charged electron bunches, on the one hand to resolve the excitation transitions of atoms temporally by pump probe electron diffraction experiments and on the other hand to investigate principal mechanisms of laser plasma acceleration. For both cases a high quality electron beam is required which can be identified with a small beam emittance. The current method to measure the transverse beam emittance at REGAE and results are presented.

Quantum emitters coupled to surface plasmons of an nanowire

DEFF Research Database (Denmark)

Dzsotjan, David; Sørensen, Anders Søndberg; Fleischhauer, Michael

2010-01-01

We investigate a system consisting of a single, as well as two emitters strongly coupled to surface plasmon modes of a nanowire using a Green's function approach. Explicit expressions are derived for the spontaneous decay rate into the plasmon modes and for the atom-plasmon coupling as well......-qubit quantum gate. We also discuss a possible realization of interesting many-body Hamiltonians, such as the spin-boson model, using strong emitter-plasmon coupling. Udgivelsesdato: 27 August...

Internal emitter limits for iodine, radium and radon daughters

International Nuclear Information System (INIS)

Schlenker, R.A.

1984-01-01

This paper identifies some of the issues which arise in the consideration of the derivation of new limits on exposure to internal emitters. Basic and secondary radiation protection limits are discussed. Terms are defined and applied to the limitation of risk from stochastic effects. Non-stochastic data for specific internal emitters ( 131 I and the radium isotopes) are presented. Emphasis is placed on the quantitative aspects of the limit setting problem. 65 references, 2 figures, 12 tables

SHIFT: server for hidden stops analysis in frame-shifted translation.

Science.gov (United States)

Gupta, Arun; Singh, Tiratha Raj

2013-02-23

Frameshift is one of the three classes of recoding. Frame-shifts lead to waste of energy, resources and activity of the biosynthetic machinery. In addition, some peptides synthesized after frame-shifts are probably cytotoxic which serve as plausible cause for innumerable number of diseases and disorders such as muscular dystrophies, lysosomal storage disorders, and cancer. Hidden stop codons occur naturally in coding sequences among all organisms. These codons are associated with the early termination of translation for incorrect reading frame selection and help to reduce the metabolic cost related to the frameshift events. Researchers have identified several consequences of hidden stop codons and their association with myriad disorders. However the wealth of information available is speckled and not effortlessly acquiescent to data-mining. To reduce this gap, this work describes an algorithmic web based tool to study hidden stops in frameshifted translation for all the lineages through respective genetic code systems. This paper describes SHIFT, an algorithmic web application tool that provides a user-friendly interface for identifying and analyzing hidden stops in frameshifted translation of genomic sequences for all available genetic code systems. We have calculated the correlation between codon usage frequencies and the plausible contribution of codons towards hidden stops in an off-frame context. Markovian chains of various order have been used to model hidden stops in frameshifted peptides and their evolutionary association with naturally occurring hidden stops. In order to obtain reliable and persuasive estimates for the naturally occurring and predicted hidden stops statistical measures have been implemented. This paper presented SHIFT, an algorithmic tool that allows user-friendly exploration, analysis, and visualization of hidden stop codons in frameshifted translations. It is expected that this web based tool would serve as a useful complement for

Low Emittance Guns for the ILC Polarized Electron Beam

International Nuclear Information System (INIS)

Clendenin, J. E.; Brachmann, A.; Ioakeimidi, K.; Kirby, R. E.; Maruyama, T.; Miller, R. H.; Wang, J. W.; Zhou, F.

2007-01-01

Polarized electron beams generated by DC guns are routinely available at several accelerators including JLAB, Mainz and SLAC. These guns operate with a cathode bias on the order of -100 kV. To minimize space charge effects, relatively long bunches are generated at the gun and then compressed longitudinally external to the gun just before and during initial acceleration. For linear colliders, this compression is accomplished using a combination of rf bunchers. For the basic design of the International Linear Collider (ILC), a 120 kV DC photocathode gun is used to produce a series of nanosecond bunches that are each compressed by two sub-harmonic bunchers (SHBs) followed by an L-band buncher and capture section. The longitudinal bunching process results in a significantly higher emittance than produced by the gun alone. While high-energy experiments using polarized beams are not generally sensitive to the source emittance, there are several benefits to a lower source emittance including a simpler more efficient injector system and a lower radiation load during transport especially at bends as at the damping ring. For the ILC, the SHBs could be eliminated if the voltage of the gun is raised sufficiently. Simulations using the General Particle Tracer (GPT) package indicate that a cathode bias voltage of ≥200 kV should allow both SHBs to be operated at 433 or even 650 MHz, while ≥500 kV would be required to eliminate the SHBs altogether. Simulations can be used to determine the minimum emittance possible if the injector is designed for a given increased voltage. A possible alternative to the DC gun is an rf gun. Emittance compensation, routinely used with rf guns, is discussed for higher-voltage DC guns

Low Emittance Guns for the ILC Polarized Electron Beam

International Nuclear Information System (INIS)

Clendenin, J.E.; Brachmann, A.; Ioakeimidi, K.; Kirby, R.E.; Maruyama, T.; Miller, R.H.; Wang, J.W.; Zhou, F.; SLAC

2006-01-01

Polarized electron beams generated by DC guns are routinely available at several accelerators including JLAB, Mainz and SLAC. These guns operate with a cathode bias on the order of -100 kV. To minimize space charge effects, relatively long bunches are generated at the gun and then compressed longitudinally external to the gun just before and during initial acceleration. For linear colliders, this compression is accomplished using a combination of rf bunchers. For the basic design of the International Linear Collider (ILC), a 120 kV DC photocathode gun is used to produce a series of nanosecond bunches that are each compressed by two sub-harmonic bunchers (SHBs) followed by an L-band buncher and capture section. The longitudinal bunching process results in a significantly higher emittance than produced by the gun alone. While high-energy experiments using polarized beams are not generally sensitive to the source emittance, there are several benefits to a lower source emittance including a simpler more efficient injector system and a lower radiation load during transport especially at bends as at the damping ring. For the ILC, the SHBs could be eliminated if the voltage of the gun is raised sufficiently. Simulations using the General Particle Tracer (GPT) package indicate that a cathode bias voltage of (ge)200 kV should allow both SHBs to be operated at 433 or even 650 MHz, while (ge)500 kV would be required to eliminate the SHBs altogether. Simulations can be used to determine the minimum emittance possible if the injector is designed for a given increased voltage. A possible alternative to the DC gun is an rf gun. Emittance compensation, routinely used with rf guns, is discussed for higher-voltage DC guns

Asymptotics for Estimating Equations in Hidden Markov Models

DEFF Research Database (Denmark)

Hansen, Jørgen Vinsløv; Jensen, Jens Ledet

Results on asymptotic normality for the maximum likelihood estimate in hidden Markov models are extended in two directions. The stationarity assumption is relaxed, which allows for a covariate process influencing the hidden Markov process. Furthermore a class of estimating equations is considered...

Emittance growth caused by bends in the Los Alamos free-electron laser energy recovery experiment

International Nuclear Information System (INIS)

Carlsten, B.E.

1987-01-01

Experimentally transporting the beam from the wiggler to the decelerators in the energy recovery experiment (ERX) at the Los Alamos National Laboratory free-electron laser was more difficult than expected because of the large initial emittance in the beam. This emittance was apparently caused in an early 60 0 achromatic bend. To get this beam through subsequent bends without wall interception, the quadrupole focusing had to be changed from the design amount; as a result, the emittance grew further. This paper discusses various mechanisms for this emittance growth in the 60 0 bend, including effects caused by path changes in the bend resulting from wake-field-induced energy changes of particles in the beam and examines emittance filters, ranging from a simple aperture near a beam crossover to more complicated telescope schemes designed to regain the original emittance before the 60 0 bend

A hidden service model based on HS-HS anonymous network

Science.gov (United States)

Meng, Yitong; Zhao, Xing; Fei, Jinlong; Zhu, Yuefei

2017-10-01

The Hidden Service provided by Tor anonymous network can effectively protect the anonymity and security of the Hidden server, this article through the analysis of the data packet structure of Tor, three jump transmission mechanism and link establishment protocol and Hidden Service communication process, in view of the Hidden node number too much, link building Service for too long and too redundant link problem. An improved hidden service model HS-HS is proposed that incorporating multiple transmission link and reuse, and at the same time will be important transit point for reuse protection link anonymity, through the ExperimenTor simulation environment test, verify the improved model of HS-HS can be more effective in guarantee anonymity and security, improve the overall efficiency of data transmission, to meet the needs of today's anonymous service.

Revisiting the Correlations of Peak Luminosity with Spectral Lag and Peak Energy of the Observed Gamma-ray Bursts

Directory of Open Access Journals (Sweden)

Yun-A Jo

2016-12-01

Full Text Available An analysis of light curves and spectra of observed gamma-ray bursts in gamma-ray ranges is frequently demanded because the prompt emission contains immediate details regarding the central engine of gamma-ray bursts (GRBs. We have revisited the relationship between the collimation-corrected peak luminosity and the spectral lag, investigating the lag-luminosity relationships in great detail by focusing on spectral lags resulting from all possible combinations of channels. Firstly, we compiled the opening angle data and demonstrated that the distribution of opening angles of 205 long GRBs is represented by a double Gaussian function having maxima at ~ 0.1 and ~ 0.3 radians. We confirmed that the peak luminosity and the spectral lag are anti-correlated, both in the observer frame and in the source frame. We found that, in agreement with our previous conclusion, the correlation coefficient improves significantly in the source frame. It should be noted that spectral lags involving channel 2 (25-50 keV yield high correlation coefficients, where Swift/Burst Alert Telescope (BAT has four energy channels (channel 1: 15-25 keV, channel 2: 25-50 keV, channel 3: 50-100 keV, channel 4: 100-200 keV. We also found that peak luminosity is positively correlated with peak energy.

VISIBLE COSTS AND HIDDEN COSTS IN THE BAKING INDUSTRY

Directory of Open Access Journals (Sweden)

Criveanu Maria

2013-04-01

Full Text Available Hidden costs are present in the activity of any company, hardly identified in the traditional administrative accounting. The high levels of the hidden costs and their unknown presence have serious consequences on the decisions made by the managers. This paper aims at presenting some aspects related to the hidden costs that occur in the activity of the companies in the baking industry and the possibilities to reduce their level.

Hidden markers, open secrets: on naming, race-marking, and race-making in Cuba

Directory of Open Access Journals (Sweden)

Michael Zeuske

2002-07-01

Full Text Available Focuses on how in Cuba race-marking was interrelated with surname-giving, also after the abolition of slavery. Through researching life histories on the local level in the Cienfuegos region, the author examines names of former slaves, finding that these were after abolition in notarial records often marked with the adjectives s.o.a., or "sin otro apellido" (without other surname, taking into account the Iberian double surname tradition. This, according to him, points to a stigmatization of these black citizens and related to their former status as possession, and is thus a racial marker, only more hidden than the open racial assignations during slavery. He relates these postemancipation surnames of former slaves to the dotation of surnames during slavery, whereby most surnames of slaves were those of the last owner of the slaves. He also discusses differences in name-giving between the notarial records and everyday life. He further indicates that a new racism developed in the Cuban society of the late 19th c. and early 20th c., which was voiced more openly in the realm of culture, and regarding events as incarceration and death, and more hidden within the civil and judicial spheres, where the fiction of a race-blind republic was maintained.

Generation Mix Study Focusing on Nuclear Power by Practical Peak Forecast

International Nuclear Information System (INIS)

Shin, Jung Ho; Roh, Myung Sub

2013-01-01

The excessive underestimation can lead to a range of problem; expansion of LNG plant requiring short construction period, the following increase of electricity price, low reserve margin and inefficient configuration of power source. With regard to nuclear power, the share of the stable and economic base load plant, nuclear power, can reduce under the optimum level. Amongst varied factors which contribute to the underestimate, immoderate target for demand side management (DSM) including double deduction of the constraint amount by DSM from peak demand forecast is one of the causes. The hypothesis in this study is that the better optimum generation mix including the adequate share of nuclear power can be obtained under the condition of the peak demand forecast without deduction of DSM target because this forecast is closer to the actual peak demand. In this study, the hypothesis is verified with comparison between peak demand forecast before (or after) DSM target application and the actual peak demand in the 3 rd through 5 th BPE from 2006 to 2010. Furthermore, this research compares and analyzes several generation mix in 2027 focusing on the nuclear power by a few conditions using the WASP-IV program on the basis of the 6 th BPE in 2013. According to the comparative analysis on the peak demand forecast and actual peak demand from 2006 to 2010, the peak demand forecasts without the deduction of the DSM target is closer to the actual peak demand than the peak demand forecasts considering the DSM target in the 3 th , 4 th , 5 th entirely. In addition, the generation mix until 2027 is examined by the WASP-IV. As a result of the program run, when considering the peak demand forecast without DSM reflection, since the base load plants including nuclear power take up adequate proportion, stable and economic supply of electricity can be achieved. On the contrary, in case of planning based on the peak demand forecast with DSM reflected and then compensating the shortage by

Space-charge driven emittance growth in a 3D mismatched anisotropic beam

International Nuclear Information System (INIS)

Qiang, J.; Ryne, R.D.; Hofmann, I.

2002-01-01

In this paper we present a 3D simulation study of the emittance growth in a mismatched anisotropic beam. The equipartitioning driven by a 4th order space-charge resonance can be significantly modified by the presence of mismatch oscillation and halo formation. This causes emittance growth in both the longitudinal and transverse directions which could drive the beam even further away from equipartition. The averaged emittance growth per degree freedom follows the upper bound of the 2D free energy limit plus the contributions from equipartitioning

The hidden values

DEFF Research Database (Denmark)

Rasmussen, Birgitte; Jensen, Karsten Klint

“The Hidden Values - Transparency in Decision-Making Processes Dealing with Hazardous Activities”. The report seeks to shed light on what is needed to create a transparent framework for political and administrative decisions on the use of GMOs and chemical products. It is our hope that the report...

Selección tecnico-economica de emisores Technical and economical selection of emitters

Directory of Open Access Journals (Sweden)

Eduardo A. Holzapfel

2007-12-01

Full Text Available El presente trabajo tuvo como objetivo estudiar los factores que intervienen en la selección técnico económico de goteros. En el estudio fueron utilizados emisores autocompensados y no autocompensados, considerando a los aspectos técnicos como porcentaje de suelo humedecido, número de emisores por planta y coeficiente de uniformidad y precio y la presión de operación del emisor como aspectos económicos. Los resultados muestran que la presión de operación de los emisores es el factor más importante a considerar en la selección, ya que para valores más bajos de presión de operación se obtuvieron menores valores de costo total anualizado, independiente del tipo de gotero. En general, los goteros no autocompesados presentaron valores de costo anualizado menores, para un rango de presión similar. Finalmente el análisis tecnico-económico en la selección de emisores es un procedimiento importante.The objective of this research was to study the parameters that affect the technical-economical selection of emitters. In the study compensated and non-compensated emitters were used. The technical aspects considered were: percentage of wetted soil, number of emitters per plant and the uniformity coefficient as well as price and operation pressure for economic aspects. The results shows that the operation pressure of emitters is the most important factor to be considered in the selection , with smaller values of pressure giving lower total annual cost, independently of the type of emitter. In general, the non-compensated emitter shows lower annual cost values than for compensated emitters, for a similar range of pressures. Finally the technical-economical analysis in the emitter selection is an important procedure.

A G-band terahertz monolithic integrated amplifier in 0.5-μm InP double heterojunction bipolar transistor technology

International Nuclear Information System (INIS)

Li Ou-Peng; Zhang Yong; Xu Rui-Min; Cheng Wei; Wang Yuan; Niu Bing; Lu Hai-Yan

2016-01-01

Design and characterization of a G-band (140–220 GHz) terahertz monolithic integrated circuit (TMIC) amplifier in eight-stage common-emitter topology are performed based on the 0.5-μm InGaAs/InP double heterojunction bipolar transistor (DHBT). An inverted microstrip line is implemented to avoid a parasitic mode between the ground plane and the InP substrate. The on-wafer measurement results show that peak gains are 20 dB at 140 GHz and more than 15-dB gain at 140–190 GHz respectively. The saturation output powers are −2.688 dBm at 210 GHz and −2.88 dBm at 220 GHz, respectively. It is the first report on an amplifier operating at the G-band based on 0.5-μm InP DHBT technology. Compared with the hybrid integrated circuit of vacuum electronic devices, the monolithic integrated circuit has the advantage of reliability and consistency. This TMIC demonstrates the feasibility of the 0.5-μm InGaAs/InP DHBT amplifier in G-band frequencies applications. (paper)

Compact Rare Earth Emitter Hollow Cathode

Science.gov (United States)

Watkins, Ronald; Goebel, Dan; Hofer, Richard

2010-01-01

A compact, high-current, hollow cathode utilizing a lanthanum hexaboride (LaB6) thermionic electron emitter has been developed for use with high-power Hall thrusters and ion thrusters. LaB6 cathodes are being investigated due to their long life, high current capabilities, and less stringent xenon purity and handling requirements compared to conventional barium oxide (BaO) dispenser cathodes. The new cathode features a much smaller diameter than previously developed versions that permit it to be mounted on axis of a Hall thruster ( internally mounted ), as opposed to the conventional side-mount position external to the outer magnetic circuit ("externally mounted"). The cathode has also been reconfigured to be capable of surviving vibrational loads during launch and is designed to solve the significant heater and materials compatibility problems associated with the use of this emitter material. This has been accomplished in a compact design with the capability of high-emission current (10 to 60 A). The compact, high-current design has a keeper diameter that allows the cathode to be mounted on the centerline of a 6- kW Hall thruster, inside the iron core of the inner electromagnetic coil. Although designed for electric propulsion thrusters in spacecraft station- keeping, orbit transfer, and interplanetary applications, the LaB6 cathodes are applicable to the plasma processing industry in applications such as optical coatings and semiconductor processing where reactive gases are used. Where current electrical propulsion thrusters with BaO emitters have limited life and need extremely clean propellant feed systems at a significant cost, these LaB6 cathodes can run on the crudest-grade xenon propellant available without impact. Moreover, in a laboratory environment, LaB6 cathodes reduce testing costs because they do not require extended conditioning periods under hard vacuum. Alternative rare earth emitters, such as cerium hexaboride (CeB6) can be used in this

Suppressing the QCD axion abundance by hidden monopoles

International Nuclear Information System (INIS)

Kawasaki, Masahiro

2015-11-01

We study the Witten effect of hidden monopoles on the QCD axion dynamics, and show that its abundance as well as isocurvature perturbations can be significantly suppressed if there is a sufficient amount of hidden monopoles. When the hidden monopoles make up a significant fraction of dark matter, the Witten effect suppresses the abundance of axion with the decay constant smaller than 10 12 GeV. The cosmological domain wall problem of the QCD axion can also be avoided, relaxing the upper bound on the decay constant when the Peccei-Quinn symmetry is spontaneously broken after inflation.

Source brightness and useful beam current of carbon nanotubes and other very small emitters

International Nuclear Information System (INIS)

Kruit, P.; Bezuijen, M.; Barth, J.E.

2006-01-01

The potential application of carbon nanotubes as electron sources in electron microscopes is analyzed. The resolution and probe current that can be obtained from a carbon nanotube emitter in a low-voltage scanning electron microscope are calculated and compared to the state of the art using Schottky electron sources. Many analytical equations for probe-size versus probe-current relations in different parameter regimes are obtained. It is shown that for most carbon nanotube emitters, the gun lens aberrations are larger than the emitters' virtual source size and thus restrict the microscope's performance. The result is that the advantages of the higher brightness of nanotube emitters are limited unless the angular emission current is increased over present day values or the gun lens aberrations are decreased. For some nanotubes with a closed cap, it is known that the emitted electron beam is coherent over the full emission cone. We argue that for such emitters the parameter ''brightness'' becomes meaningless. The influence of phase variations in the electron wave front emitted from such a nanotube emitter on the focusing of the electron beam is analyzed

A Program to Generate a Particle Distribution from Emittance Measurements

CERN Document Server

Bouma, DS; Lallement, JB

2010-01-01

We have written a program to generate a particle distribution based on emittance measurements in x-x’ and y-y’. The accuracy of this program has been tested using real and constructed emittance measurements. Based on these tests, the distribution generated by the program can be used to accurately simulate the beam in multi-particle tracking codes, as an alternative to a Gaussian or uniform distribution.

The double peaks and symmetric path phenomena in the catalytic activity of Pd/Al2O3-TiO2 catalysts with different TiO2 contents

Science.gov (United States)

Zhang, Shen; Guo, Yuyu; Li, Xingying; Wu, Xu; Li, Zhe

2018-06-01

Physicochemical properties of Pd/Al2O3-TiO2 catalysts with different amounts of TiO2 contents were investigated by XRD, nitrogen adsorption-desorption, FTIR, NH3-TPD, H2-TPR and XPS techniques. Catalysts of different compositions were tested in the ethanol oxidation reaction to study the effects of TiO2 contents. Double peaks and symmetric path phenomena were observed at certain temperatures with the increase in TiO2 contents. The symmetric peak phenomena and the diverse activity fluctuations have been ascribed to the controlling factors such as temperature and compositions. With the increase in TiO2 content, the surface area, adsorbed oxygen contents and surface acid quantity decreased gradually. The large surface area and adsorbed oxygen contents were conducive to the performance, while increased acid amounts were not beneficial for ethanol oxidation. At 150 and 175 °C, Pd/AT(X1

Experimental Study of Coherent Synchrotron Radiation in the Emittance Exchange Line at the A0-Photoinjector

Science.gov (United States)

Thangaraj, Jayakar C. T.; Thurman-Keup, R.; Johnson, A.; Lumpkin, A. H.; Edwards, H.; Ruan, J.; Santucci, J.; Sun, Y. E.; Church, M.; Piot, P.

2010-11-01

Next generation accelerators will require a high current, low emittance beam with a low energy spread. Such accelerators will employ advanced beam conditioning systems such as emittance exchangers to manipulate high brightness beams. One of the goals of the Fermilab A0 photoinjector is to investigate the transverse to longitudinal emittance exchange principle. Coherent synchrotron radiation could limit high current operation of the emittance exchanger. In this paper, we report on the preliminary experimental and simulation study of the coherent synchroton radiation (CSR) in the emittance exchange line at the A0 photoinjector.

Plexciton quenching by resonant electron transfer from quantum emitter to metallic nanoantenna.

Science.gov (United States)

Marinica, D C; Lourenço-Martins, H; Aizpurua, J; Borisov, A G

2013-01-01

Coupling molecular excitons and localized surface plasmons in hybrid nanostructures leads to appealing, tunable optical properties. In this respect, the knowledge about the excitation dynamics of a quantum emitter close to a plasmonic nanoantenna is of importance from fundamental and practical points of view. We address here the effect of the excited electron tunneling from the emitter into a metallic nanoparticle(s) in the optical response. When close to a plasmonic nanoparticle, the excited state localized on a quantum emitter becomes short-lived because of the electronic coupling with metal conduction band states. We show that as a consequence, the characteristic features associated with the quantum emitter disappear from the optical absorption spectrum. Thus, for the hybrid nanostructure studied here and comprising quantum emitter in the narrow gap of a plasmonic dimer nanoantenna, the quantum tunneling might quench the plexcitonic states. Under certain conditions the optical response of the system approaches that of the individual plasmonic dimer. Excitation decay via resonant electron transfer can play an important role in many situations of interest such as in surface-enhanced spectroscopies, photovoltaics, catalysis, or quantum information, among others.

Polarization measurements made on LFRA and OASIS emitter arrays

Science.gov (United States)

Geske, Jon; Sparkman, Kevin; Oleson, Jim; Laveigne, Joe; Sieglinger, Breck; Marlow, Steve; Lowry, Heard; Burns, James

2008-04-01

Polarization is increasingly being considered as a method of discrimination in passive sensing applications. In this paper the degree of polarization of the thermal emission from the emitter arrays of two new Santa Barbara Infrared (SBIR) micro-bolometer resistor array scene projectors was characterized at ambient temperature and at 77 K. The emitter arrays characterized were from the Large Format Resistive Array (LFRA) and the Optimized Arrays for Space-Background Infrared Simulation (OASIS) scene projectors. This paper reports the results of this testing.

Emittance studies of the 2.45 GHz permanent magnet ECR ion source

Science.gov (United States)

Zelenak, A.; Bogomolov, S. L.; Yazvitsky, N. Yu.

2004-05-01

During the past several years different types of permanent magnet 2.45 GHz (electron cyclotron resonance) ion sources were developed for production of singly charged ions. Ion sources of this type are used in the first stage of DRIBs project, and are planned to be used in the MASHA mass separator. The emittance of the beam provided by the source is one of the important parameters for these applications. An emittance scanner composed from a set of parallel slits and rotary wire beam profile monitor was used for the studying of the beam emittance characteristics. The emittance of helium and argon ion beams was measured with different shapes of the plasma electrode for several ion source parameters: microwave power, source potential, plasma aperture-puller aperture gap distance, gas pressure. The results of measurements are compared with previous simulations of ion optics.

Emittance studies of the 2.45 GHz permanent magnet ECR ion source

International Nuclear Information System (INIS)

Zelenak, A.; Bogomolov, S.L.; Yazvitsky, N.Yu.

2004-01-01

During the past several years different types of permanent magnet 2.45 GHz (electron cyclotron resonance) ion sources were developed for production of singly charged ions. Ion sources of this type are used in the first stage of DRIBs project, and are planned to be used in the MASHA mass separator. The emittance of the beam provided by the source is one of the important parameters for these applications. An emittance scanner composed from a set of parallel slits and rotary wire beam profile monitor was used for the studying of the beam emittance characteristics. The emittance of helium and argon ion beams was measured with different shapes of the plasma electrode for several ion source parameters: microwave power, source potential, plasma aperture-puller aperture gap distance, gas pressure. The results of measurements are compared with previous simulations of ion optics

Emittance measuring system on the UNILAC

International Nuclear Information System (INIS)

Ehrich, A.; Glatz, J.; Strahl, P.

A description is given of one of the beam emittance measuring systems designed for the UNILAC at GSI. The measuring system mechanics and the detector system are detailed, and the associated electronics are discussed. Computer programming and data processing and evaluation are described

Simple emittance measurement of negative hydrogen ion beam using pepper-pot method

International Nuclear Information System (INIS)

Hamabe, M.; Tsumori, K.; Takeiri, Y.; Kaneko, O.; Asano, E.; Kawamoto, T.; Kuroda, T.; Guharay, S.K.

1997-01-01

A simple apparatus for emittance measurement using pepper-pot method is developed. The pepper-pot patterns are directly exposed and recorded on a Kapton foil. Using this apparatus, emittance was measured in the case of the negative hydrogen (H - ) beam from the large negative ion source, which is the 1/3 scaled test device for the negative-ion-based neutral beam injection (N-NBI) on the Large Helical Device (LHD). As the consequence of the first trial, the 95% normalized emittance value is measured as 0.59 mm mrad. (author)

Simple emittance measurement of negative hydrogen ion beam using pepper-pot method

Energy Technology Data Exchange (ETDEWEB)

Hamabe, M.; Tsumori, K.; Takeiri, Y.; Kaneko, O.; Asano, E.; Kawamoto, T.; Kuroda, T. [National Inst. for Fusion Science, Nagoya (Japan); Guharay, S.K.

1997-02-01

A simple apparatus for emittance measurement using pepper-pot method is developed. The pepper-pot patterns are directly exposed and recorded on a Kapton foil. Using this apparatus, emittance was measured in the case of the negative hydrogen (H{sup -}) beam from the large negative ion source, which is the 1/3 scaled test device for the negative-ion-based neutral beam injection (N-NBI) on the Large Helical Device (LHD). As the consequence of the first trial, the 95% normalized emittance value is measured as 0.59 mm mrad. (author)

Effects of emittance and space-charge in femtosecond bunch compression

International Nuclear Information System (INIS)

Kan, K.; Yang, J.; Kondoh, T.; Norizawa, K.; Yoshida, Y.

2008-01-01

Ultrashort electron bunches of the order of <100fs are essential for the study of ultrafast reactions and phenomena by means of time-resolved pump-probe experiments. In order to generate such an electron bunch, the effects of emittance, space-charge (SC) and coherent synchrotron radiation (CSR) on the bunch length in a femtosecond magnetic bunch compressor were studied theoretically. It was observed that the bunch length is dominated by the emittance, SC and CSR effects when the electron bunch is compressed into a femtosecond electron bunch. The increases in bunch length due to the transverse emittance, SC and CSR effects in the bunch compressor were 1.7 fs/mm mrad, 107 fs/nC and 72 fs/nC, respectively. Finally, the simulated bunch length was compared with the experimental results.

Emittance growth in coast in the SPS

CERN Document Server

Alekou, A; Bartosik, H; Calaga, R

2017-01-01

The CERN SPS will be used as a test-bed for the LHCprototype crab-cavities, which will be installed and testedin the SPS in 2018. As the time available for experimen-tal beam dynamics studies with the crab cavities installedin the machine will be limited, a very good preparation isrequired in advance. One of the main concerns is the in-duced emittance growth, driven by phase jitter in the crabcavities. In this respect, several machine development (MD)studies were performed during the past years to quantifyand characterize the emittance evolution of proton beamsin coast in the SPS. In these proceedings, the experimentalobservations from past years are summarized and the MDstudies from 2016 are presented. Finally, a proposal for anexperimental program for 2017 is discussed.

Decoupling Intensity Radiated by the Emitter in Distance Estimation from Camera to IR Emitter

Directory of Open Access Journals (Sweden)

Carlos Andrés Luna Vázquez

2013-05-01

Full Text Available Various models using radiometric approach have been proposed to solve the problem of estimating the distance between a camera and an infrared emitter diode (IRED. They depend directly on the radiant intensity of the emitter, set by the IRED bias current. As is known, this current presents a drift with temperature, which will be transferred to the distance estimation method. This paper proposes an alternative approach to remove temperature drift in the distance estimation method by eliminating the dependence on radiant intensity. The main aim was to use the relative accumulated energy together with other defined models, such as the zeroth-frequency component of the FFT of the IRED image and the standard deviation of pixel gray level intensities in the region of interest containing the IRED image. By using the abovementioned models, an expression free of IRED radiant intensity was obtained. Furthermore, the final model permitted simultaneous estimation of the distance between the IRED and the camera and the IRED orientation angle. The alternative presented in this paper gave a 3% maximum relative error over a range of distances up to 3 m.

Transverse and longitudinal emittance measurements in the ELSA linac

International Nuclear Information System (INIS)

Loulergue, A.; Dowell, D.H.; Joly, S.; De Brion, J.P.; Haouat, G.; Schumann, F.

1997-01-01

The ELSA RF linac photoinjector has been designed to deliver high-brightness electron beams. The present paper deals with the transverse and longitudinal emittance measurements, at different locations along the ELSA beam line, and the analysis of their variations as a function of the photoinjector parameters : magnetic field generated by the anode focusing lens, bunch charge and pulse duration. While transverse emittance has been already studied in other similar installations, there has been little study of the electron beam longitudinal dynamics. Experimental results are presented and compared to simulation-code expectations. For 2.0 nC, 85 A electron bunches, a normalized rms emittance of 2 π mm mrad and a brightness of 4.5 x 10 13 A/(π m rad) 2 at the linac exit have been measured as well as less than 10 keV rms energy spread (or less than 0.1% at 16.5 MeV). (orig.)

A double-voiced reading of Romans 13:1–7 in light of the imperial cult

African Journals Online (AJOL)

Drawing on Mikhail Bakhtin's theory of double-voicedness and James Scott's theory of public and hidden transcripts, this essay investigates the colonial context of Romans 13:1–7 with particular attention to the Roman imperial cult. It is my contention that Paul attempts to persuade the audience to resist the imperial cult, ...

Optically controlled resonant tunneling in a double-barrier diode

Science.gov (United States)

Kan, S. C.; Wu, S.; Sanders, S.; Griffel, G.; Yariv, A.

1991-03-01

The resonant tunneling effect is optically enhanced in a GaAs/GaAlAs double-barrier structure that has partial lateral current confinement. The peak current increases and the valley current decreases simultaneously when the device surface is illuminated, due to the increased conductivity of the top layer of the structure. The effect of the lateral current confinement on the current-voltage characteristic of a double-barrier resonant tunneling structure was also studied. With increased lateral current confinement, the peak and valley current decrease at a different rate such that the current peak-to-valley ratio increases up to three times. The experimental results are explained by solving the electrostatic potential distribution in the structure using a simple three-layer model.

The Hidden Burden of Food Waste: The Double Energy Waste in Italy

Directory of Open Access Journals (Sweden)

Matteo Vittuari

2016-08-01

Full Text Available The energy intensity of modern food systems represents a major issue in a scenario of decreasing oil resources and increasing population. Beside the use of renewable energy, an increased efficiency in food systems could contribute to reduce fossil fuels dependence. In this sense, food losses and waste (FLW have crucial consequences on the energy balance. Based on the concept of “embodied energy”, food wastage can be framed as a double waste of energy, both in terms of non-consumed food energy and the inputs used for production. Secondary data regarding direct and indirect energy inputs and FLW have been collected for the Italian food chain to estimate the embodied energy of food waste. Since in 2011 the production and distribution of food implied the use of 822 PJ and 18 Mt of food was discarded, 67 PJ of food energy and 100 PJ of embodied energy were wasted. These figures are equivalent to 12.2% of the total nutritional energy output and to 1.3% of the final energy use in Italy, respectively. The concept of double energy waste sheds new light on the intertwined relationship between energy and food security, suggesting that appropriate food waste reduction policies could result in a higher food production level and relevant energy savings.

Context Tree Estimation in Variable Length Hidden Markov Models

OpenAIRE

Dumont, Thierry

2011-01-01

We address the issue of context tree estimation in variable length hidden Markov models. We propose an estimator of the context tree of the hidden Markov process which needs no prior upper bound on the depth of the context tree. We prove that the estimator is strongly consistent. This uses information-theoretic mixture inequalities in the spirit of Finesso and Lorenzo(Consistent estimation of the order for Markov and hidden Markov chains(1990)) and E.Gassiat and S.Boucheron (Optimal error exp...

Extracting hidden-photon dark matter from an LC-circuit

International Nuclear Information System (INIS)

Arias, Paola; Arza, Ariel; Gamboa, Jorge; Mendez, Fernando

2014-11-01

We point out that a cold dark matter condensate made of gauge bosons from an extra hidden U(1) sector - dubbed hidden-photons - can create a small, oscillating electric density current. Thus, they could also be searched for in the recently proposed LC-circuit setup conceived for axion cold dark matter search by Sikivie, Sullivan and Tanner. We estimate the sensitivity of this setup for hidden-photon cold dark matter and we find it could cover a sizable, so far unexplored parameter space.

Extracting Hidden-Photon Dark Matter From an LC-Circuit

CERN Document Server

Arias, Paola; Döbrich, Babette; Gamboa, Jorge; Méndez, Fernando

2015-01-01

We point out that a cold dark matter condensate made of gauge bosons from an extra hidden U(1) sector - dubbed hidden- photons - can create a small, oscillating electric density current. Thus, they could also be searched for in the recently proposed LC-circuit setup conceived for axion cold dark matter search by Sikivie, Sullivan and Tanner. We estimate the sensitivity of this setup for hidden-photon cold dark matter and we find it could cover a sizable, so far unexplored parameter space.

Waveguide resonances with selectable polarization in an infrared thermal emitter

Directory of Open Access Journals (Sweden)

Wei-Lun Huang

2017-08-01

Full Text Available A multi-band infrared thermal emitter with polarized waveguide resonances was investigated. The device is constructed by embedding the metallic grating strips within the resonant cavity of a metal/dielectric/metal (MDM structure. The proposed arrangement makes it possible to generate waveguide resonances with mutually orthogonal polarization, thereby providing an additional degree of freedom to vary the resonant wavelengths and polarizations in the medium infrared region. The measured reflection spectra and the finite-difference time-domain (FDTD simulation indicated that the electric fields of the waveguide modes with two orthogonal polarizations are distributed in different regions of the cavity. Resonant wavelengths in different polarizations can be adjusted by altering the period, the metallic line width, or the position of the embedded gold strips. The ratio of the full width at half maximum (FWHM to the peak wavelength was achieved to be smaller than 0.035. This study demonstrated a multi-band infrared thermal emission featuring a narrow bandwidth and polarization characteristics, which is quite suitable to be applied to the non-dispersive infrared (NDIR detection system.

Simple-to-prepare multipoint field emitter

Science.gov (United States)

Sominskii, G. G.; Taradaev, E. P.; Tumareva, T. A.; Mishin, M. V.; Kornishin, S. Yu.

2015-07-01

We investigate multitip field emitters prepared by electroerosion treatment of the surface of molybdenum samples. Their characteristics are determined for operation with a protecting activated fullerene coating. Our experiments indicate that such cathodes are promising for high-voltage electron devices operating in technical vacuum.

Hidden photons in beam dump experiments and in connection with dark matter

Energy Technology Data Exchange (ETDEWEB)

Andreas, Sarah

2012-12-15

Hidden sectors with light extra U(1) gauge bosons, so-called hidden photons, recently received much interest as natural feature of beyond standard model scenarios like string theory and SUSY and because of their possible connection to dark matter. This paper presents limits on hidden photons from past electron beam dump experiments including two new limits from experiments at KEK and Orsay. Additionally, various hidden sector models containing both a hidden photon and a dark matter candidate are discussed with respect to their viability and potential signatures in direct detection.

Hidden photons in beam dump experiments and in connection with dark matter

International Nuclear Information System (INIS)

Andreas, Sarah

2012-12-01

Hidden sectors with light extra U(1) gauge bosons, so-called hidden photons, recently received much interest as natural feature of beyond standard model scenarios like string theory and SUSY and because of their possible connection to dark matter. This paper presents limits on hidden photons from past electron beam dump experiments including two new limits from experiments at KEK and Orsay. Additionally, various hidden sector models containing both a hidden photon and a dark matter candidate are discussed with respect to their viability and potential signatures in direct detection.

Characterization of microstructured fibre emitters: in pursuit of improved nano electrospray ionization performance.

Science.gov (United States)

Wu, Xinyun; Oleschuk, Richard D; Cann, Natalie M

2012-09-21

Full-dimensional computational fluid dynamics (CFD) simulations are presented for nano electrospray ionization (ESI) with various emitter designs. Our CFD electrohydrodynamic simulations are based on the Taylor-Melcher leaky-dielectric model, and the volume of fluid technique for tracking the fast-changing liquid-gas interface. The numerical method is first validated for a conventional 20 μm inner diameter capillary emitter. The impact of ESI voltage, flow rate, emitter tapering, surface hydrophobicity, and fluid conductivity on the nano-ESI behavior are thoroughly investigated and compared with experiments. Multi-electrospray is further simulated with 2-hole and 3-hole emitters with the latter having a linear or triangular hole arrangement. The simulations predict multi-electrospray behavior in good agreement with laboratory observations.

Search for hidden particles with the SHiP experiment

Energy Technology Data Exchange (ETDEWEB)

Hagner, Caren; Bick, Daniel; Bieschke, Stefan; Ebert, Joachim; Schmidt-Parzefall, Walter [Universitaet Hamburg, Institut fuer Experimentalphysik, Luruper Chaussee 149, 22761 Hamburg (Germany)

2016-07-01

Many theories beyond the standard model predict long lived neutral (hidden) particles. There might be a whole Hidden Sector (HS) of weakly interacting particles, which cannot be detected in existing high energy experiments. The SHiP experiment (Search for Hidden Particles) requires a high intensity beam dump, which could be realized by a new facility at the CERN SPS accelerator. New superweakly interacting particles with masses below O(10) GeV could be produced in the beam dump and detected in a general purpose Hidden Sector (HS) detector. In addition there will be a dedicated tau neutrino subdetector. I present the major requirements and technical challenges for the HS detector and discuss how the HS can be accessed through several portals: neutrino portal, scalar portal, vector portal and many more.

Contribution of double scattering to structural coloration in quasiordered nanostructures of bird feathers

Science.gov (United States)

Noh, Heeso; Liew, Seng Fatt; Saranathan, Vinodkumar; Prum, Richard O.; Mochrie, Simon G. J.; Dufresne, Eric R.; Cao, Hui

2010-05-01

We measured the polarization- and angle-resolved optical scattering and reflection spectra of the quasiordered nanostructures in the bird feather barbs. In addition to the primary peak that originates from single scattering, we observed a secondary peak which exhibits depolarization and distinct angular dispersion. We explained the secondary peak in terms of double scattering, i.e., light is scattered successively twice by the structure. The two sequential single-scattering events are considered uncorrelated. Using the Fourier power spectra of the nanostructures obtained from the small-angle x-ray scattering experiment, we calculated the double scattering of light in various directions. The double-scattering spectrum is broader than the single-scattering spectrum, and it splits into two subpeaks at larger scattering angle. The good agreement between the simulation results and the experimental data confirms that double scattering of light makes a significant contribution to the structural color.

Contribution of double scattering to structural coloration in quasiordered nanostructures of bird feathers

Energy Technology Data Exchange (ETDEWEB)

Noh, Heeso; Liew, Seng Fatt; Saranathan, Vinodkumar; Prum, Richard O.; Mochrie, Simon G.J.; Dufresne, Eric R.; Cao, Hui (Yale)

2010-07-28

We measured the polarization- and angle-resolved optical scattering and reflection spectra of the quasiordered nanostructures in the bird feather barbs. In addition to the primary peak that originates from single scattering, we observed a secondary peak which exhibits depolarization and distinct angular dispersion. We explained the secondary peak in terms of double scattering, i.e., light is scattered successively twice by the structure. The two sequential single-scattering events are considered uncorrelated. Using the Fourier power spectra of the nanostructures obtained from the small-angle x-ray scattering experiment, we calculated the double scattering of light in various directions. The double-scattering spectrum is broader than the single-scattering spectrum, and it splits into two subpeaks at larger scattering angle. The good agreement between the simulation results and the experimental data confirms that double scattering of light makes a significant contribution to the structural color.

Global CO_2-energy emissions in 2007. China becomes the largest emitter along with the United States - June 2008

International Nuclear Information System (INIS)

2008-01-01

China becomes the largest emitter along with the United States. Contents: 1990-2007 evolution (key figures of Yearly average evolutions); Global CO_2-energy emissions in 2007: 27,3 GtCO_2; Global CO_2-energy emissions have increased by 3,2% in 2007, largely driven by China. Since 1990, China has more than doubled its CO_2-energy emissions, to reach the same emission level as the USA in 2007. Two very contrasting tendencies appear since 1990: stabilization of emissions in Annex B countries, boom in China and India. Since 1990, more than half of CO_2-energy emissions growth is (logically) due to coal. (authors)

Multilayer Neural Networks with Extensively Many Hidden Units

International Nuclear Information System (INIS)

Rosen-Zvi, Michal; Engel, Andreas; Kanter, Ido

2001-01-01

The information processing abilities of a multilayer neural network with a number of hidden units scaling as the input dimension are studied using statistical mechanics methods. The mapping from the input layer to the hidden units is performed by general symmetric Boolean functions, whereas the hidden layer is connected to the output by either discrete or continuous couplings. Introducing an overlap in the space of Boolean functions as order parameter, the storage capacity is found to scale with the logarithm of the number of implementable Boolean functions. The generalization behavior is smooth for continuous couplings and shows a discontinuous transition to perfect generalization for discrete ones

Hidden Area and Mechanical Nonlinearities in Freestanding Graphene

Science.gov (United States)

Nicholl, Ryan J. T.; Lavrik, Nickolay V.; Vlassiouk, Ivan; Srijanto, Bernadeta R.; Bolotin, Kirill I.

2017-06-01

We investigated the effect of out-of-plane crumpling on the mechanical response of graphene membranes. In our experiments, stress was applied to graphene membranes using pressurized gas while the strain state was monitored through two complementary techniques: interferometric profilometry and Raman spectroscopy. By comparing the data obtained through these two techniques, we determined the geometric hidden area which quantifies the crumpling strength. While the devices with hidden area ˜0 % obeyed linear mechanics with biaxial stiffness 428 ±10 N /m , specimens with hidden area in the range 0.5%-1.0% were found to obey an anomalous nonlinear Hooke's law with an exponent ˜0.1 .

Method validation to determine total alpha beta emitters in water samples using LSC

International Nuclear Information System (INIS)

Al-Masri, M. S.; Nashawati, A.; Al-akel, B.; Saaid, S.

2006-06-01

In this work a method was validated to determine gross alpha and beta emitters in water samples using liquid scintillation counter. 200 ml of water from each sample were evaporated to 20 ml and 8 ml of them were mixed with 12 ml of the suitable cocktail to be measured by liquid scintillation counter Wallac Winspectral 1414. The lower detection limit by this method (LDL) was 0.33 DPM for total alpha emitters and 1.3 DPM for total beta emitters. and the reproducibility limit was (± 2.32 DPM) and (±1.41 DPM) for total alpha and beta emitters respectively, and the repeatability limit was (±2.19 DPM) and (±1.11 DPM) for total alpha and beta emitters respectively. The method is easy and fast because of the simple preparation steps and the large number of samples that can be measured at the same time. In addition, many real samples and standard samples were analyzed by the method and showed accurate results so it was concluded that the method can be used with various water samples. (author)

Mirrorless lasing from light emitters in percolating clusters

Science.gov (United States)

Burlak, Gennadiy; Rubo, Y. G.

2015-07-01

We describe the lasing effect in the three-dimensional percolation system, where the percolating cluster is filled by active media composed by light emitters excited noncoherently. We show that, due to the presence of a topologically nontrivial photonic structure, the stimulated emission is modified with respect to both conventional and random lasers. The time dynamics and spectra of the lasing output are studied numerically with finite-difference time-domain approach. The Fermat principle and Monte Carlo approach are applied to characterize the optimal optical path and interconnection between the radiating emitters. The spatial structure of the laser mode is found by a long-time FDTD simulation.

Extracting hidden-photon dark matter from an LC-circuit

International Nuclear Information System (INIS)

Arias, Paola; Arza, Ariel; Gamboa, Jorge; Mendez, Fernando; Doebrich, Babette

2015-01-01

We point out that a cold dark matter condensate made of gauge bosons from an extra hidden U(1) sector - dubbed hidden photons - can create a small, oscillating electric density current. Thus, they could also be searched for in the recently proposed LC-circuit setup conceived for axion cold dark matter search by Sikivie, Sullivan and Tanner. We estimate the sensitivity of this setup for hidden-photon cold dark matter and we find it could cover a sizable, so far unexplored parameter space. (orig.)

Charged bottomoniumlike structures in the hidden-bottom dipion decays of Υ(11020)

International Nuclear Information System (INIS)

Chen Dianyong; Liu Xiang; Matsuki, Takayuki

2011-01-01

Under the Initial Single Pion Emission mechanism, we study the hidden-bottom dipion decays of Υ(11020), i.e., Υ(11020)→Υ(nS)π + π - (n=1, 2, 3) and Υ(11020)→h b (mP)π + π - (m=1, 2). We predict explicit sharp peak structures close to the BB* and B*B* thresholds and their reflections in the Υ(1S)π + , Υ(2S)π + and h b (1P)π + invariant mass spectrum distributions. We suggest that a future experiment, i.e., Belle, BABAR, and forthcoming BelleII or Super-B, carry out the search for these novel phenomena, which can provide important tests to the Initial Single Emission mechanism existing in higher bottomonia.

Petro Rents, Political Institutions, and Hidden Wealth

DEFF Research Database (Denmark)

Andersen, Jørgen Juel; Johannesen, Niels; Lassen, David Dreyer

2017-01-01

Do political institutions limit rent seeking by politicians? We study the transformation of petroleum rents, almost universally under direct government control, into hidden wealth using unique data on bank deposits in offshore financial centers that specialize in secrecy and asset protection. Our...... rulers is diverted to secret accounts. We find very limited evidence that shocks to other types of income not directly controlled by governments affect hidden wealth....

Hidden charm molecules in a finite volume

International Nuclear Information System (INIS)

Albaladejo, M.; Hidalgo-Duque, C.; Nieves, J.; Oset, E.

2014-01-01

In the present paper we address the interaction of charmed mesons in hidden charm channels in a finite box. We use the interaction from a recent model based on heavy quark spin symmetry that predicts molecules of hidden charm in the infinite volume. The energy levels in the box are generated within this model, and several methods for the analysis of these levels ("inverse problem") are investigated. (author)

B-graph sampling to estimate the size of a hidden population

NARCIS (Netherlands)

Spreen, M.; Bogaerts, S.

2015-01-01

Link-tracing designs are often used to estimate the size of hidden populations by utilizing the relational links between their members. A major problem in studies of hidden populations is the lack of a convenient sampling frame. The most frequently applied design in studies of hidden populations is

Impact of Optics on CSR-Related Emittance Growth in Bunch Compressor Chicanes

CERN Document Server

Limberg, Torsten

2005-01-01

The dependence of emittance growth due to Coherent Synchrotron Radiation (CSR) in bunch compressor chicanes on optics has been noticed and empirically studied in the past. We revisit the subject, suggesting a model to explain slice emittance growth dependence on chicane optics. A simplified model to calculate projected emittance growth when it is mainly caused by transverse slice centroid offsets is presented. It is then used to find optimal compensation of centroid kicks in the single chicanes of a two-stage compression system by adjusting the phase advance of the transport in between and the ration of the compression factors.

Hidden Agendas in Marriage: Affective and Longitudinal Dimensions.

Science.gov (United States)

Krokoff, Lowell J.

1990-01-01

Examines how couples' discussions of troublesome problems reveal hidden agendas (issues not directly discussed or explored). Finds disgust and contempt are at the core of both love and respect agendas for husbands and wives. Finds that wives' more than husbands' hidden agendas are directly predictive of how negatively they argue at home. (SR)

Reducing longitudinal emittance growth in RFQ accelerators

International Nuclear Information System (INIS)

Koscielniak, S.

1994-08-01

Bunching and capture of a monochromatic beam into an rf bucket inevitably lead to substantial emittance growth through the mechanisms of filamentation and non-adiabatic variation of parameters. We describe a three step strategy for minimizing this growth, based on a clear understanding of the non-linear beam dynamics, and apply to acceleration of heavy ions with Z/A = 1/60 (and initial kinetic energy 60 keV/u) in a radio frequency quadrupole (RFQ) operating at 25 MHz. We also describe a scheme, to further reduce the emittance, based upon the use of an external RFQ-type prebuncher before the main accelerator. The external unit permits the bunching voltage to be reduced, to inject into a moving bucket, and to reduce the structure length. (author). 7 refs., 6 figs

The hidden secrets of the E-center in Si and Ge

International Nuclear Information System (INIS)

Larsen, Arne Nylandsted; Mesli, Abdelmadjid

2007-01-01

The group- V vacancy pair, the so-called E-center, has recently been demonstrated to have, both in Si and Ge, more complicated energy-level schemes in the energy gap than were previously assumed. The E-center in silicon has, in addition to its well-established single-acceptor level in the upper half of the band gap, also a donor level in the lower half of the band gap; this donor level has lain hidden for more than 40 years. The E-center in Ge has an even more complicated level scheme as it induces, in addition to two levels analogous to those found in Si, also a double-acceptor level in the upper half of the band gap. Thus the E-center in Si can exist in three charge states and the E-center in Ge in four

Finding Multiple Peaks Signal in Fast Beam Conditions Monitor (BCM1F)

CERN Document Server

Bin Ab Maalek, Abu Ubaidah Amir; CERN. Geneva. EP Department

2017-01-01

Fast Beam Conditions Monitor (BCM1F) is diamond and silicon sensors based luminometer of CMS detector. The methods of finding multiple peaks signal in BCM1F is shown. Multiple peaks signal found at signal with width between 60 ns - 300 ns. Double peaks are counted as single hit in the constant threshold analysis and leads to underestimation in the luminosity. Therefore it should be estimated for different filling schemes and sensor types. The percentage of long width pulse in different sensor for different fill are calculated. About 30 \\% long width pulse found in sCVD sensor, 12 \\% in pCVD and no more than 1 \\% for silicon sensor.

On the LHC sensitivity for non-thermalised hidden sectors

Science.gov (United States)

Kahlhoefer, Felix

2018-04-01

We show under rather general assumptions that hidden sectors that never reach thermal equilibrium in the early Universe are also inaccessible for the LHC. In other words, any particle that can be produced at the LHC must either have been in thermal equilibrium with the Standard Model at some point or must be produced via the decays of another hidden sector particle that has been in thermal equilibrium. To reach this conclusion, we parametrise the cross section connecting the Standard Model to the hidden sector in a very general way and use methods from linear programming to calculate the largest possible number of LHC events compatible with the requirement of non-thermalisation. We find that even the HL-LHC cannot possibly produce more than a few events with energy above 10 GeV involving states from a non-thermalised hidden sector.

Integrated circuits with emitter coupling and their application in nanosecond nuclear electronics

International Nuclear Information System (INIS)

Basiladze, S.G.

1976-01-01

Principal static and dynamic characteristics are considered of integrated circuits with emitter coupling, as well as problems of signal transmission. Diagrams are given of amplifiers, discriminators, time interval drivers, generators, etc. Systems and units of nanosecond electronics employing integrated circuits with emitter coupling are briefly described

Ghostly Glow Reveals a Hidden Class of Long-Wavelength Radio Emitters

Science.gov (United States)

2008-10-01

(Washington, DC. 08)- A team of scientists, including astronomers from the Naval Research Laboratory (NRL), have detected long wavelength radio emission from a colliding, massive galaxy cluster which, surprisingly, is not detected at the shorter wavelengths typically seen in these objects. The discovery implies that existing radio telescopes have missed a large population of these colliding objects. It also provides an important confirmation of the theoretical prediction that colliding galaxy clusters accelerate electrons and other particles to very high energies through the process of turbulent waves. The team revealed their findings in the October 16, 2008 edition of Nature. This new population of objects is most easily detected at long wavelengths. Professor Greg Taylor of the University of New Mexico and scientific director of the Long Wavelength Array (LWA) points out, "This result is just the tip of the iceberg. When an emerging suite of much more powerful low frequency telescopes, including the LWA in New Mexico, turn their views to the cosmos, the sky will 'light up' with hundreds or even thousands of colliding galaxy clusters." NRL has played a key role in promoting the development of this generation of new instruments and is currently involved with the development of the LWA. NRL radio astronomer and LWA Project Scientist Namir Kassim says "Our discovery of a previously hidden class of low frequency cluster-radio sources is particularly important since the study of galaxy clusters was a primary motivation for development of the LWA." The discovery of the emission in the galaxy cluster Abell 521 (or A521 for short) was made using the Giant Metrewave Radiotelescope (GMRT) in India, and its long wavelength nature was confirmed by the National Science Foundation's (NRAO) Very Large Array (VLA) radio telescope in New Mexico. The attached image shows the radio emission at a wavelength of 125cm in red superimposed on a blue image made from data taken by the

Anaphylaxis after eating Italian pizza containing buckwheat as the hidden food allergen.

Science.gov (United States)

Heffler, E; Guida, G; Badiu, I; Nebiolo, F; Rolla, G

2007-01-01

A 20-year-old woman developed anaphylaxis after eating pizza on 4 different occasions in 2 restaurants. Both restaurants made their pizza dough with a mixture of wheat and buckwheat flours. A prick-to-prick test with buckwheat flour was positive. Skin prick tests and specific immunoglobulin E responses to soybean and peanut were weakly positive while the response to buckwheat was negative. We ruled out a pathogenic role for peanut and soybean because the patient usually eats both with no signs of allergic reaction. Double-blind, placebo-controlled food challenges with buckwheat flour were positive after the administration of a cumulative dose of 2.3 g of the culprit flour. To our knowledge, our report describes the first case of anaphylaxis after intake of buckwheat flour as the hidden allergen in pizza dough.

Massive hidden photons as lukewarm dark matter

International Nuclear Information System (INIS)

Redondo, Javier; Postma, Marieke

2008-11-01

We study the possibility that a keV-MeV mass hidden photon (HP), i.e. a hidden sector U(1) gauge boson, accounts for the observed amount of dark matter. We focus on the case where the HP interacts with the standard model sector only through kinetic mixing with the photon. The relic abundance is computed including all relevant plasma effects into the photon's self-energy, which leads to a resonant yield almost independent of the HP mass. The HP can decay into three photons. Moreover, if light enough it can be copiously produced in stars. Including bounds from cosmic photon backgrounds and stellar evolution, we find that the hidden photon can only give a subdominant contribution to the dark matter. This negative conclusion may be avoided if another production mechanism besides kinetic mixing is operative. (orig.)

Massive hidden photons as lukewarm dark matter

Energy Technology Data Exchange (ETDEWEB)

Redondo, Javier [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Postma, Marieke [Nationaal Inst. voor Kernfysica en Hoge-Energiefysica (NIKHEF), Amsterdam (Netherlands)

2008-11-15

We study the possibility that a keV-MeV mass hidden photon (HP), i.e. a hidden sector U(1) gauge boson, accounts for the observed amount of dark matter. We focus on the case where the HP interacts with the standard model sector only through kinetic mixing with the photon. The relic abundance is computed including all relevant plasma effects into the photon's self-energy, which leads to a resonant yield almost independent of the HP mass. The HP can decay into three photons. Moreover, if light enough it can be copiously produced in stars. Including bounds from cosmic photon backgrounds and stellar evolution, we find that the hidden photon can only give a subdominant contribution to the dark matter. This negative conclusion may be avoided if another production mechanism besides kinetic mixing is operative. (orig.)

Dosimetry of internal emitters

International Nuclear Information System (INIS)

Anon.

1982-01-01

The Dosimetry of Internal Emitter Program endeavors to refine the correlation between radiation dose and observed biological effects. The program is presently engaged in the development of studies that will demonstrate the applicability of microdosimetry models developed under the Microdosimetry of Internal Sources Program. The program also provides guidance and assistance to Pacific Northwest Laboratory's Biology Department in the dosimetric analysis of internally deposited radionuclides. This report deals with alpha particle dosimetry plutonium 239 inhalation, and in vitro studies of chromosomal observations

Influence of time-periodic potentials on electronic transport in double-well structure

International Nuclear Information System (INIS)

Chun-Lei, Li; Yan, Xu

2010-01-01

Within the framework of the Floquet theorem, we have investigated single-electron photon-assisted tunneling in a double-well system using the transfer matrix technique. The transmission probability displays satellite peaks on both sides of the main resonance peaks and these satellite peaks originate from emission or absorption photons. The single-electron resonance tunneling can be controlled through changing the applied harmonically potential positions, such as driven potential in wells, in barriers, or in whole double-well systems. This advantage should be useful in the optimization of the parameters of a transmission device. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

Generation Mix Study Focusing on Nuclear Power by Practical Peak Forecast

Energy Technology Data Exchange (ETDEWEB)

Shin, Jung Ho; Roh, Myung Sub [KEPCO International Nuclear Graduate School, Ulsan (Korea, Republic of)

2013-10-15

The excessive underestimation can lead to a range of problem; expansion of LNG plant requiring short construction period, the following increase of electricity price, low reserve margin and inefficient configuration of power source. With regard to nuclear power, the share of the stable and economic base load plant, nuclear power, can reduce under the optimum level. Amongst varied factors which contribute to the underestimate, immoderate target for demand side management (DSM) including double deduction of the constraint amount by DSM from peak demand forecast is one of the causes. The hypothesis in this study is that the better optimum generation mix including the adequate share of nuclear power can be obtained under the condition of the peak demand forecast without deduction of DSM target because this forecast is closer to the actual peak demand. In this study, the hypothesis is verified with comparison between peak demand forecast before (or after) DSM target application and the actual peak demand in the 3{sup rd} through 5{sup th} BPE from 2006 to 2010. Furthermore, this research compares and analyzes several generation mix in 2027 focusing on the nuclear power by a few conditions using the WASP-IV program on the basis of the 6{sup th} BPE in 2013. According to the comparative analysis on the peak demand forecast and actual peak demand from 2006 to 2010, the peak demand forecasts without the deduction of the DSM target is closer to the actual peak demand than the peak demand forecasts considering the DSM target in the 3{sup th}, 4{sup th}, 5{sup th} entirely. In addition, the generation mix until 2027 is examined by the WASP-IV. As a result of the program run, when considering the peak demand forecast without DSM reflection, since the base load plants including nuclear power take up adequate proportion, stable and economic supply of electricity can be achieved. On the contrary, in case of planning based on the peak demand forecast with DSM reflected and then

New limits on hidden photons from past electron beam dumps

International Nuclear Information System (INIS)

Andreas, Sarah; Niebuhr, Carsten; Ringwald, Andreas

2012-09-01

Hidden sectors with light extra U(1) gauge bosons, so called hidden photons, have recently attracted some attention because they are a common feature of physics beyond the Standard Model like string theory and SUSY and additionally are phenomenologically of great interest regarding recent astrophysical observations. The hidden photon is already constrained by various laboratory experiments and presently searched for in running as well as upcoming experiments. We summarize the current status of limits on hidden photons from past electron beam dump experiments including two new limits from such experiments at KEK and Orsay that have so far not been considered. All our limits take into account the experimental acceptances obtained from Monte Carlo simulations.

New limits on hidden photons from past electron beam dumps

Energy Technology Data Exchange (ETDEWEB)

Andreas, Sarah; Niebuhr, Carsten; Ringwald, Andreas

2012-09-15

Hidden sectors with light extra U(1) gauge bosons, so called hidden photons, have recently attracted some attention because they are a common feature of physics beyond the Standard Model like string theory and SUSY and additionally are phenomenologically of great interest regarding recent astrophysical observations. The hidden photon is already constrained by various laboratory experiments and presently searched for in running as well as upcoming experiments. We summarize the current status of limits on hidden photons from past electron beam dump experiments including two new limits from such experiments at KEK and Orsay that have so far not been considered. All our limits take into account the experimental acceptances obtained from Monte Carlo simulations.

Emittance growth in displaced, space-charge-dominated beams with energy spread

International Nuclear Information System (INIS)

Barnard, J.J.; Miller, J.; Haber, I.

1993-01-01

Conversion of transverse energy associated with the coherent motion of displaced beams into thermal energy, and thus emittance growth, has been predicted theoretically by a number of authors. Here, they authors show, using 2-D particle-in-cell simulations, that emittance growth is inhibited for tune depressed beams, if the energy spread of the beam is not too large. Further, using a uniform density model to calculate the space charge field of the beam, they numerically determine the criteria for emittance growth as a function of tune depression, energy spread, and beam displacement over a wide range of parameters. A theoretical interpretation of the results is presented. This study is applicable to an inertial fusion reactor driven by a heavy ion accelerator

Total hemispherical emittance measured at high temperatures by the calorimetric method

International Nuclear Information System (INIS)

DiFilippo, F.; Mirtich, M.J.; Banks, B.A.; Stidham, C.; Kussmaul, M.

1994-01-01

A calorimetric vacuum emissometer (CVE) capable of measuring total hemispherical emittance of surfaces at elevated temperatures was designed, built, and tested. Several materials with a wide range of emittances were measured in the CVE between 773 to 923 K. These results were compared to values calculated from spectral emittance curves measured in a room temperature Hohlraum reflectometer and in an open-air elevated temperature emissometer. The results differed by as much as 0.2 for some materials but were in closer agreement for the more highly-emitting, diffuse-reflecting samples. The differences were attributed to temperature, atmospheric, and directional effects, and errors in the Hohlraum and emissometer measurements (± 5 percent). The probable error of the CVE measurements was typically less than 1 percent

The effects of emitter-tied field plates on lateral PNP ionizing radiation response

International Nuclear Information System (INIS)

Barnaby, H.J.; Schrimpf, R.D.; Cirba, C.R.; Pease, R.L.; Fleetwood, D.M.; Kosier, S.L.

1998-03-01

Radiation response comparisons of lateral PNP bipolar technologies reveal that device hardening may be achieved by extending the emitter contact over the active base. The emitter-tied field plate suppresses recombination of carriers with interface traps

Dielectric Optical Antenna Emitters and Metamaterials

Science.gov (United States)

Schuller, Jon

2009-03-01

Optical antennas are critical components in nanophotonics research due to their unparalleled ability to concentrate electromagnetic energy into nanoscale volumes. Researchers typically construct such antennas from wavelength-size metallic structures. However, recent research has begun to exploit the scattering resonances of high-permittivity particles to realize all-dielectric optical antennas, emitters, and metamaterials. In this talk, we experimentally and theoretically characterize the resonant modes of subwavelength rod-shaped dielectric particles and demonstrate their use in negative index metamaterials and novel infrared light emitters. At mid-infrared frequencies, Silicon Carbide (SiC) is an ideal system for studying the behavior of dielectric optical antennas. At frequencies below the TO phonon resonance, SiC behaves like a dielectric with very large refractive index. Using infrared spectroscopy and analytical Mie calculations we show that individual rod-shaped SiC particles exhibit a multitude of resonant modes. Detailed investigations of these SiC optical antennas reveal a wealth of new physics and applications. We discuss the distinct electromagnetic field profile for each mode, and demonstrate that two of the dielectric-type Mie resonances can be combined in a particle array to form a negative index metamaterial [1]. We further show that these particles can serve as ``broadcasting'' antennas. Using a custom-built thermal emission microscope we collect emissivity spectra from single SiC particles at elevated temperatures, highlighting their use as subwavelength resonant light emitters. Finally, we derive and verify a variety of general analytical results applicable to all cylindrical dielectric antennas and discuss extensions of the demonstrated concepts to different materials systems and frequency regimes. [1] J.A. Schuller, et al., Phys. Rev. Lett. 99, 107401 (2007)

The Hidden Burden of Food Waste: The Double Energy Waste in Italy

OpenAIRE

Matteo Vittuari; Fabio De Menna; Marco Pagani

2016-01-01

The energy intensity of modern food systems represents a major issue in a scenario of decreasing oil resources and increasing population. Beside the use of renewable energy, an increased efficiency in food systems could contribute to reduce fossil fuels dependence. In this sense, food losses and waste (FLW) have crucial consequences on the energy balance. Based on the concept of “embodied energy”, food wastage can be framed as a double waste of energy, both in terms of non-consumed food energ...

Biologic data, models, and dosimetric methods for internal emitters

International Nuclear Information System (INIS)

Weber, D.A.

1990-01-01

The absorbed radiation dose from internal emitters has been and will remain a pivotal factor in assessing risk and therapeutic utility in selecting radiopharmaceuticals for diagnosis and treatment. Although direct measurements of absorbed dose and dose distributions in vivo have been and will continue to be made in limited situations, the measurement of the biodistribution and clearance of radiopharmaceuticals in human subjects and the use of this data is likely to remain the primary means to approach the calculation and estimation of absorbed dose from internal emitters over the next decade. Since several approximations are used in these schema to calculate dose, attention must be given to inspecting and improving the application of this dosimetric method as better techniques are developed to assay body activity and as more experience is gained in applying these schema to calculating absorbed dose. Discussion of the need for considering small scale dosimetry to calculate absorbed dose at the cellular level will be presented in this paper. Other topics include dose estimates for internal emitters, biologic data mathematical models and dosimetric methods employed. 44 refs

Energy dependence of the emittance of damping ring beams

International Nuclear Information System (INIS)

Stiening, R.

1985-01-01

The energy at which the SLC damping rings are operated was chosen to be 1.21 GeV. At the time that that specification was made, the repetition rate of the SLC was expected to be 180 Hz. It is now anticipated that the repetition rate during the initial year of operation of the SLC will be 120 Hz. The following curves which show the output emittance of the damping rings as a function of input emittance and energy suggest that there is a range of energies over which the rings can be operated without changing the SLC luminosity. It should be noted that in the era of polarized beams, the damping ring energy will be fixed at the design value on account of the spin precession required in the LTR and RTL transport lines. The SLC design output emittance of the damping rings is 3 x 10 -5 radian-meters. Because of space charge disruption and quantum emission downstream of the damping rings, much lower values than the design value may not have a large beneficial effect on the luminosity. 3 figures

Fowler Nordheim theory of carbon nanotube based field emitters