WorldWideScience

Sample records for hidden double-peaked emitters

  1. Can double-peaked lines indicate merging effects in AGNs?

    Directory of Open Access Journals (Sweden)

    Popović L.Č.

    2000-01-01

    Full Text Available The influence of merging effects in the central part of an Active Galactic Nucleus (AGN on the emission spectral line shapes are discussed. We present a model of close binary Broad Line Region. The numerical experiments show that the merging effects can explain double peaked lines. The merging effects may also be present in the center of AGNs, although they emit slightly asymmetric as well as symmetric and relatively stable (in profile shape spectral lines. Depending on the black hole masses and their orbit elements such model may explain some of the line profile shapes observed in AGNs. This work shows that if one is looking for the merging effects in the central region as well as in the wide field structure of AGNs, he should first pay attention to objects which have double peaked lines.

  2. MERGERS IN DOUBLE-PEAKED [O III] ACTIVE GALACTIC NUCLEI

    International Nuclear Information System (INIS)

    Fu Hai; Djorgovski, S. G.; Myers, Adam D.; Yan Lin

    2011-01-01

    As a natural consequence of galaxy mergers, binary active galactic nuclei (AGNs) should be commonplace. Nevertheless, observational confirmations are rare, especially for binaries with separations less than 10 kpc. Such a system may show two sets of narrow emission lines in a single spectrum owing to the orbital motion of the binary. We have obtained high-resolution near-infrared images of 50 double-peaked [O III]λ5007 AGNs with the Keck II laser guide star adaptive optics system. The Sloan Digital Sky Survey sample is compiled from the literature and consists of 17 type-1 AGNs between 0.18 BH -σ * relation because of overestimated stellar velocity dispersions, illustrating the importance of removing mergers from the samples defining the M BH -σ * relations. Finally, we find that the emission-line properties are indistinguishable for spatially resolved and unresolved sources, emphasizing that scenarios involving a single AGN can produce the same double-peaked line profiles and they account for at least 70% of the double-peaked [O III] AGNs.

  3. Ghostly Glow Reveals a Hidden Class of Long-Wavelength Radio Emitters

    Science.gov (United States)

    2008-10-01

    (Washington, DC. 08)- A team of scientists, including astronomers from the Naval Research Laboratory (NRL), have detected long wavelength radio emission from a colliding, massive galaxy cluster which, surprisingly, is not detected at the shorter wavelengths typically seen in these objects. The discovery implies that existing radio telescopes have missed a large population of these colliding objects. It also provides an important confirmation of the theoretical prediction that colliding galaxy clusters accelerate electrons and other particles to very high energies through the process of turbulent waves. The team revealed their findings in the October 16, 2008 edition of Nature. This new population of objects is most easily detected at long wavelengths. Professor Greg Taylor of the University of New Mexico and scientific director of the Long Wavelength Array (LWA) points out, "This result is just the tip of the iceberg. When an emerging suite of much more powerful low frequency telescopes, including the LWA in New Mexico, turn their views to the cosmos, the sky will 'light up' with hundreds or even thousands of colliding galaxy clusters." NRL has played a key role in promoting the development of this generation of new instruments and is currently involved with the development of the LWA. NRL radio astronomer and LWA Project Scientist Namir Kassim says "Our discovery of a previously hidden class of low frequency cluster-radio sources is particularly important since the study of galaxy clusters was a primary motivation for development of the LWA." The discovery of the emission in the galaxy cluster Abell 521 (or A521 for short) was made using the Giant Metrewave Radiotelescope (GMRT) in India, and its long wavelength nature was confirmed by the National Science Foundation's (NRAO) Very Large Array (VLA) radio telescope in New Mexico. The attached image shows the radio emission at a wavelength of 125cm in red superimposed on a blue image made from data taken by the

  4. Correlation between the line width and the line flux of the double-peaked broad Hα of 3C390.3

    Science.gov (United States)

    Zhang, Xue-Guang

    2013-03-01

    In this paper, we carefully check the correlation between the line width (second moment) and the line flux of the double-peaked broad Hα of the well-known mapped active galactic nucleus (AGN) 3C390.3 in order to show some further distinctions between double-peaked emitters and normal broad-line AGN. Based on the virialization assumption MBH ∝ RBLR × V2(BLR) and the empirical relation RBLR ∝ L˜0.5, one strong negative correlation between the line width and the line flux of the double-peaked broad lines should be expected for 3C390.3, such as the negative correlation confirmed for the mapped broad-line object NGC 5548, RBLR × V2(BLR) ∝ L˜0.5 × σ2 = constant. Moreover, based on the public spectra around 1995 from the AGN WATCH project for 3C390.3, one reliable positive correlation is found between the line width and the line flux of the double-peaked broad Hα. In the context of the proposed theoretical accretion disc model for double-peaked emitters, the unexpected positive correlation can be naturally explained, due to different time delays for the inner and outer parts of the disc-like broad-line region (BLR) of 3C390.3. Moreover, the virialization assumption is checked and found to be still available for 3C390.3. However, the time-varying size of the BLR of 3C390.3 cannot be expected by the empirical relation RBLR ∝ L˜0.5. In other words, the mean size of the BLR of 3C390.3 can be estimated by the continuum luminosity (line luminosity), while the continuum emission strengthening leads to the size of BLR decreasing (not increasing) in different moments for 3C390.3. Then, we compared our results of 3C390.3 with the previous results reported in the literature for the other double-peaked emitters, and found that before to clearly correct the effects from disc physical parameters varying (such as the effects of disc precession) for long-term observed line spectra, it is not so meaningful to discuss the correlation of the line parameters of double-peaked

  5. Searching for Dual AGNs in Galaxy Mergers: Understanding Double-Peaked [O III] and Ultra Hard X-rays as Selection Method

    Science.gov (United States)

    McGurk, Rosalie C.; Max, Claire E.; Medling, Anne; Shields, Gregory A.

    2015-01-01

    When galaxies merge, gas accretes onto both central supermassive black holes. Thus, one expects to see close pairs of active galactic nuclei (AGNs), or dual AGNs, in a fraction of galaxy mergers. However, finding them remains a challenge. The presence of double-peaked [O III] or of ultra hard X-rays have been proposed as techniques to select dual AGNs efficiently. We studied a sample of double-peaked narrow [O III] emitting AGNs from SDSS DR7. By obtaining new and archival high spatial resolution images taken with the Keck 2 Laser Guide Star Adaptive Optics system and the near-infrared (IR) camera NIRC2, we showed that 30% of double-peaked [O III] emission line SDSS AGNs have two spatial components within a 3' radius. However, spatially resolved spectroscopy or X-ray observations are needed to confirm these galaxy pairs as systems containing two AGNs. We followed up these spatially-double candidate dual AGNs with integral field spectroscopy from Keck OSIRIS and Gemini GMOS and with long-slit spectroscopy from Keck NIRSPEC and Shane Kast Double Spectrograph. We find double-peaked emitters are caused sometimes by dual AGN and sometimes by outflows or narrow line kinematics. We also performed Chandra X-ray ACIS-S observations on 12 double-peaked candidate dual AGNs. Using our observations and 8 archival observations, we compare the distribution of X-ray photons to our spatially double near-IR images, measure X-ray luminosities and hardness ratios, and estimate column densities. By assessing what fraction of double-peaked emission line SDSS AGNs are true dual AGNs, we can better determine whether double-peaked [O III] is an efficient dual AGN indicator and constrain the statistics of dual AGNs. A second technique to find dual AGN is the detection of ultra hard X-rays by the Swift Burst Alert Telescope. We use CARMA observations to measure and map the CO(1-0) present in nearby ultra-hard X-ray Active Galactic Nuclei (AGNs) merging with either a quiescent companion

  6. The Nature of Double-peaked [O III] Active Galactic Nuclei

    Science.gov (United States)

    Fu, Hai; Yan, Lin; Myers, Adam D.; Stockton, Alan; Djorgovski, S. G.; Aldering, G.; Rich, Jeffrey A.

    2012-01-01

    Active galactic nuclei (AGNs) with double-peaked [O III] lines are suspected to be sub-kpc or kpc-scale binary AGNs. However, pure gas kinematics can produce the same double-peaked line profile in spatially integrated spectra. Here we combine integral-field spectroscopy and high-resolution imaging of 42 double-peaked [O III] AGNs from the Sloan Digital Sky Survey to investigate the constituents of the population. We find two binary AGNs where the line splitting is driven by the orbital motion of the merging nuclei. Such objects account for only ~2% of the double-peaked AGNs. Almost all (~98%) of the double-peaked AGNs were selected because of gas kinematics; and half of those show spatially resolved narrow-line regions that extend 4-20 kpc from the nuclei. Serendipitously, we find two spectrally unresolved binary AGNs where gas kinematics produced the double-peaked [O III] lines. The relatively frequent serendipitous discoveries indicate that only ~1% of binary AGNs would appear double-peaked in Sloan spectra and 2.2+2.5 -0.8% of all Sloan AGNs are binary AGNs. Therefore, the double-peaked sample does not offer much advantage over any other AGN samples in finding binary AGNs. The binary AGN fraction implies an elevated AGN duty cycle (8+8 -3%), suggesting galaxy interactions enhance nuclear accretion. We illustrate that integral-field spectroscopy is crucial for identifying binary AGNs: several objects previously classified as "binary AGNs" with long-slit spectra are most likely single AGNs with extended narrow-line regions (ENLRs). The formation of ENLRs driven by radiation pressure is also discussed. Some of the data presented herein were obtained at the W.M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California, and the National Aeronautics and Space Administration. The Observatory was made possible by the generous financial support of the W. M. Keck Foundation.

  7. Novel five-state latch using double-peak negative differential resistance and standard ternary inverter

    Science.gov (United States)

    Shin, Sunhae; Rok Kim, Kyung

    2016-04-01

    We propose complement double-peak negative differential resistance (NDR) devices with ultrahigh peak-to-valley current ratio (PVCR) over 106 by combining tunnel diode with conventional CMOS and its compact five-state latch circuit by introducing standard ternary inverter (STI). At the “high”-state of STI, n-type NDR device (tunnel diode with nMOS) has 1st NDR characteristics with 1st peak and valley by band-to-band tunneling (BTBT) and trap-assisted tunneling (TAT), whereas p-type NDR device (tunnel diode with pMOS) has second NDR characteristics from the suppression of diode current by off-state MOSFET. The “intermediate”-state of STI permits double-peak NDR device to operate five-state latch with only four transistors, which has 33% area reduction compared with that of binary inverter and 57% bit-density reduction compared with binary latch.

  8. The Research of Indoor Positioning Based on Double-peak Gaussian Model

    Directory of Open Access Journals (Sweden)

    Lina Chen

    2014-04-01

    Full Text Available Location fingerprinting using Wi-Fi signals has been very popular and is a well accepted indoor positioning method. The key issue of the fingerprinting approach is generating the fingerprint radio map. Limited by the practical workload, only a few samples of the received signal strength are collected at each reference point. Unfortunately, fewer samples cannot accurately represent the actual distribution of the signal strength from each access point. This study finds most Wi- Fi signals have two peaks. According to the new finding, a double-peak Gaussian arithmetic is proposed to generate a fingerprint radio map. This approach requires little time to receive WiFi signals and it easy to estimate the parameters of the double-peak Gaussian function. Compared to the Gaussian function and histogram method to generate a fingerprint radio map, this method better approximates the occurrence signal distribution. This paper also compared the positioning accuracy using K-Nearest Neighbour theory for three radio maps, the test results show that the positioning distance error utilizing the double-peak Gaussian function is better than the other two methods.

  9. Double-peaked Emission Lines Due to a Radio Outflow in KISSR 1219

    Energy Technology Data Exchange (ETDEWEB)

    Kharb, P.; Vaddi, S. [National Centre for Radio Astrophysics—Tata Institute of Fundamental Research, Postbag 3, Ganeshkhind, Pune 411007 (India); Subramanian, S. [Kavli Institute for Astronomy and Astrophysics, Peking University, 5 Yiheyuan Road, Haidian District, Beijing 100871 (China); Das, M. [Indian Institute of Astrophysics, II Block, Koramangala, Bangalore 560034 (India); Paragi, Z., E-mail: kharb@ncra.tifr.res.in [Joint Institute for VLBI in Europe, Postbus 2, 7990 AA Dwingeloo (Netherlands)

    2017-09-01

    We present the results from 1.5 and 5 GHz phase-referenced VLBA and 1.5 GHz Karl G. Jansky Very Large Array (VLA) observations of the Seyfert 2 galaxy KISSR 1219, which exhibits double-peaked emission lines in its optical spectrum. The VLA and VLBA data reveal a one-sided core-jet structure at roughly the same position angles, providing evidence of an active galactic nucleus outflow. The absence of dual parsec-scale radio cores puts the binary black-hole picture in doubt for the case of KISSR 1219. The high brightness temperatures of the parsec-scale core and jet components (>10{sup 6} K) are consistent with this interpretation. Doppler boosting with jet speeds of ≳0.55 c to ≳0.25 c , going from parsec to kiloparsec scales, at a jet inclination ≳50° can explain the jet one-sidedness in this Seyfert 2 galaxy. A blueshifted broad emission line component in [O iii] is also indicative of an outflow in the emission line gas at a velocity of ∼350 km s{sup −1}, while the [O i] doublet lines suggest the presence of shock-heated gas. A detailed line ratio study using the MAPPINGS III code further suggests that a shock+precursor model can explain the line ionization data well. Overall, our data suggest that the radio outflow in KISSR 1219 is pushing the emission line clouds, both ahead of the jet and in a lateral direction, giving rise to the double peak emission line spectra.

  10. The origin of double peak electric field distribution in heavily irradiated silicon detectors

    CERN Document Server

    Eremin, V; Li, Z

    2002-01-01

    The first observation of double peak (DP) electric field distribution in heavily neutron irradiated (>10 sup 1 sup 4 n/cm sup 2) semiconductor detectors has been published about 6 yr ago. However, this effect was not quantitatively analyzed up to now. The explanation of the DP electric field distribution presented in this paper is based on the properties of radiation induced deep levels in silicon, which act as deep traps, and on the distribution of the thermally generated free carrier concentration in the detector bulk. In the frame of this model, the earlier published considerations on the so-called 'double junction (DJ) effect' are discussed as well. The comparison of the calculated electric field profiles at different temperatures with the experimental ones allows one to determine a set of deep levels. This set of deep levels, and their charge filling status are essential to the value and the distribution of space charge in the space charge region in the range of 305-240 K, which is actual temperature ran...

  11. Emittance preservation

    Energy Technology Data Exchange (ETDEWEB)

    Kain, V; Arduini, G; Goddard, B; Holzer, B J; Jowett, J M; Meddahi, M; Mertens, T; Roncarolo, F; Schaumann, M; Versteegen, R; Wenninger, J [European Organization for Nuclear Research, Geneva (Switzerland)

    2012-07-01

    Emittance measurements during the LHC proton run 2011 indicated a blow-up of 20 % to 30 % from LHC injection to collisions. This presentation will show the emittance preservation throughout the different parts of the LHC cycle and discuss the current limitations on emittance determination. An overview of emittance preservation through the injector complex as function of bunch intensity will also be given. Possible sources for the observed blow-up and required tests in 2012 will be presented. Possible improvements of emittance diagnostics and analysis tools for 2012 will be shown.

  12. Performance test of Spectran-F and Spectran-III computer programs for resolving the 137Cs-110Ag double peak in gamma-ray spectrometric analysis

    International Nuclear Information System (INIS)

    Terada, H.; Malinowski, J.; Blick, H.

    1981-09-01

    The performance of the computer programs (Spectran F and Spectran-III) in resolving the 137 Cs-sup(110m)Ag double peak at 661.6-657.7 keV in the gamma-ray spectrum was investigated. In the experiments, the intensity ratios of both lines in the double peak were varied from 0.1 to 60. The results obtained show, that both programs have almost the same performance in resolving the double peak investigated, with slight superiority of Spectran-F. If accuracy better than 5% is desired, the peak intensity ratio in the dublet must be kept below 10. (orig.)

  13. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    Science.gov (United States)

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  14. A RADIAL VELOCITY TEST FOR SUPERMASSIVE BLACK HOLE BINARIES AS AN EXPLANATION FOR BROAD, DOUBLE-PEAKED EMISSION LINES IN ACTIVE GALACTIC NUCLEI

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Jia; Halpern, Jules P. [Astronomy Department, Columbia University, 550 West 120th Street, New York, NY 10027 (United States); Eracleous, Michael [Department of Astronomy and Institute for Gravitation and The Cosmos, The Pennsylvania State University, 525 Davey Lab, University Park, PA 16802 (United States)

    2016-01-20

    One of the proposed explanations for the broad, double-peaked Balmer emission lines observed in the spectra of some active galactic nuclei (AGNs) is that they are associated with sub-parsec supermassive black hole (SMBH) binaries. Here, we test the binary broad-line region hypothesis through several decades of monitoring of the velocity structure of double-peaked Hα emission lines in 13 low-redshift, mostly radio-loud AGNs. This is a much larger set of objects compared to an earlier test by Eracleous et al. and we use much longer time series for the three objects studied in that paper. Although systematic changes in radial velocity can be traced in many of their lines, they are demonstrably not like those of a spectroscopic binary in a circular orbit. Any spectroscopic binary period must therefore be much longer than the span of the monitoring (assuming a circular orbit), which in turn would require black hole masses that exceed by 1–2 orders of magnitude the values obtained for these objects using techniques such as reverberation mapping and stellar velocity dispersion. Moreover, the response of the double-peaked Balmer line profiles to fluctuations of the ionizing continuum and the shape of the Lyα profiles are incompatible with an SMBH binary. The binary broad-line region hypothesis is therefore disfavored. Other processes evidently shape these line profiles and cause the long-term velocity variations of the double peaks.

  15. Double peak-induced distance error in short-time-Fourier-transform-Brillouin optical time domain reflectometers event detection and the recovery method.

    Science.gov (United States)

    Yu, Yifei; Luo, Linqing; Li, Bo; Guo, Linfeng; Yan, Jize; Soga, Kenichi

    2015-10-01

    The measured distance error caused by double peaks in the BOTDRs (Brillouin optical time domain reflectometers) system is a kind of Brillouin scattering spectrum (BSS) deformation, discussed and simulated for the first time in the paper, to the best of the authors' knowledge. Double peak, as a kind of Brillouin spectrum deformation, is important in the enhancement of spatial resolution, measurement accuracy, and crack detection. Due to the variances of the peak powers of the BSS along the fiber, the measured starting point of a step-shape frequency transition region is shifted and results in distance errors. Zero-padded short-time-Fourier-transform (STFT) can restore the transition-induced double peaks in the asymmetric and deformed BSS, thus offering more accurate and quicker measurements than the conventional Lorentz-fitting method. The recovering method based on the double-peak detection and corresponding BSS deformation can be applied to calculate the real starting point, which can improve the distance accuracy of the STFT-based BOTDR system.

  16. Hidden Liquidity

    OpenAIRE

    Cebiroglu, Gökhan; Horst, Ulrich

    2012-01-01

    We cross-sectionally analyze the presence of aggregated hidden depth and trade volume in the S&P 500 and identify its key determinants. We find that the spread is the main predictor for a stock’s hidden dimension, both in terms of traded and posted liquidity. Our findings moreover suggest that large hidden orders are associated with larger transaction costs, higher price impact and increased volatility. In particular, as large hidden orders fail to attract (latent) liquidity to the market, hi...

  17. Asymmetrical field emitter

    Science.gov (United States)

    Fleming, J.G.; Smith, B.K.

    1995-10-10

    A method is disclosed for providing a field emitter with an asymmetrical emitter structure having a very sharp tip in close proximity to its gate. One preferred embodiment of the present invention includes an asymmetrical emitter and a gate. The emitter having a tip and a side is coupled to a substrate. The gate is connected to a step in the substrate. The step has a top surface and a side wall that is substantially parallel to the side of the emitter. The tip of the emitter is in close proximity to the gate. The emitter is at an emitter potential, and the gate is at a gate potential such that with the two potentials at appropriate values, electrons are emitted from the emitter. In one embodiment, the gate is separated from the emitter by an oxide layer, and the emitter is etched anisotropically to form its tip and its asymmetrical structure. 17 figs.

  18. The relation of double peaks, observed in quartz hydride atomizers, to the fate of free analyte atoms in the determination of arsenic and selenium by atomic absorption spectrometry

    International Nuclear Information System (INIS)

    D'Ulivo, Alessandro; Dedina, Jiri

    2002-01-01

    The mechanism at the origin of double peaks formation in quartz hydride atomizers were investigated by continuous flow hydride generation atomic absorption spectrometry. Arsenic and selenium were used as model analytes. The effect of atomization mode (flame-in-gas-shield (FIGS), miniature diffusion flame and double flame (DF)) and some experimental parameters as oxygen supply rate for microflame and the distance from atomization to free atoms detection point, were investigated on the shape of both analytical signals and calibration graphs. Rollover of calibration graphs and double peak formation are strictly related each to the other and could be observed only in FIGS atomizer mode under some particular conditions. A mechanism based on incomplete atomization of hydrides cannot explain the collected experimental evidences because the microflame of FIGS is able to produce quantitative atomization of large amount of hydrides even at supply rate of oxygen close to extinction threshold of microflame. The heterogeneous gas-solid reactions between finely dispersed particles, formed by free atom recombination, and the free atoms in the gaseous phase are at the origin of double peak formation

  19. Type 2 Active Galactic Nuclei with Double-peaked [O III] Lines. II. Single AGNs with Complex Narrow-line Region Kinematics are More Common than Binary AGNs

    Science.gov (United States)

    Shen, Yue; Liu, Xin; Greene, Jenny E.; Strauss, Michael A.

    2011-07-01

    Approximately 1% of low-redshift (z interpreted as either due to kinematics, such as biconical outflows and/or disk rotation of the narrow line region (NLR) around single black holes, or due to the relative motion of two distinct NLRs in a merging pair of AGNs. Here, we report follow-up near-infrared (NIR) imaging and optical slit spectroscopy of 31 double-peaked [O III] type 2 AGNs drawn from the Sloan Digital Sky Survey (SDSS) parent sample presented in Liu et al. The NIR imaging traces the old stellar population in each galaxy, while the optical slit spectroscopy traces the NLR gas. These data reveal a mixture of origins for the double-peaked feature. Roughly 10% of our objects are best explained by binary AGNs at (projected) kpc-scale separations, where two stellar components with spatially coincident NLRs are seen. ~50% of our objects have [O III] emission offset by a few kpc, corresponding to the two velocity components seen in the SDSS spectra, but there are no spatially coincident double stellar components seen in the NIR imaging. For those objects with sufficiently high-quality slit spectra, we see velocity and/or velocity dispersion gradients in [O III] emission, suggestive of the kinematic signatures of a single NLR. The remaining ~40% of our objects are ambiguous and will need higher spatial resolution observations to distinguish between the two scenarios. Our observations therefore favor the kinematics scenario with a single AGN for the majority of these double-peaked [O III] type 2 AGNs. We emphasize the importance of combining imaging and slit spectroscopy in identifying kpc-scale binary AGNs, i.e., in no cases does one of these alone allow an unambiguous identification. We estimate that ~0.5%-2.5% of the z ~ 150 km s-1. Based in part on observations obtained with the 6.5 m Magellan telescopes located at Las Campanas Observatory, Chile, and with the Apache Point Observatory 3.5 m telescope, which is owned and operated by the Astrophysical Research

  20. Hidden loss

    DEFF Research Database (Denmark)

    Kieffer-Kristensen, Rikke; Johansen, Karen Lise Gaardsvig

    2013-01-01

    to participate. RESULTS: All children were affected by their parents' ABI and the altered family situation. The children's expressions led the authors to identify six themes, including fear of losing the parent, distress and estrangement, chores and responsibilities, hidden loss, coping and support. The main......PRIMARY OBJECTIVE: The purpose of this study was to listen to and learn from children showing high levels of post-traumatic stress symptoms after parental acquired brain injury (ABI), in order to achieve an in-depth understanding of the difficulties the children face in their everyday lives...... finding indicates that the children experienced numerous losses, many of which were often suppressed or neglected by the children to protect the ill parents. CONCLUSIONS: The findings indicated that the children seemed to make a special effort to hide their feelings of loss and grief in order to protect...

  1. PTF11mnb: First analog of supernova 2005bf. Long-rising, double-peaked supernova Ic from a massive progenitor

    Science.gov (United States)

    Taddia, F.; Sollerman, J.; Fremling, C.; Karamehmetoglu, E.; Quimby, R. M.; Gal-Yam, A.; Yaron, O.; Kasliwal, M. M.; Kulkarni, S. R.; Nugent, P. E.; Smadja, G.; Tao, C.

    2018-01-01

    Aims: We study PTF11mnb, a He-poor supernova (SN) whose light curves resemble those of SN 2005bf, a peculiar double-peaked stripped-envelope (SE) SN, until the declining phase after the main peak. We investigate the mechanism powering its light curve and the nature of its progenitor star. Methods: Optical photometry and spectroscopy of PTF11mnb are presented. We compared light curves, colors and spectral properties to those of SN 2005bf and normal SE SNe. We built a bolometric light curve and modeled this light curve with the SuperNova Explosion Code (SNEC) hydrodynamical code explosion of a MESA progenitor star and semi-analytic models. Results: The light curve of PTF11mnb turns out to be similar to that of SN 2005bf until 50 d when the main (secondary) peaks occur at -18.5 mag. The early peak occurs at 20 d and is about 1.0 mag fainter. After the main peak, the decline rate of PTF11mnb is remarkably slower than what was observed in SN 2005bf, and it traces well the 56Co decay rate. The spectra of PTF11mnb reveal a SN Ic and have no traces of He unlike in the case of SN Ib 2005bf, although they have velocities comparable to those of SN 2005bf. The whole evolution of the bolometric light curve is well reproduced by the explosion of a massive (Mej = 7.8 M⊙), He-poor star characterized by a double-peaked 56Ni distribution, a total 56Ni mass of 0.59 M⊙, and an explosion energy of 2.2 × 1051 erg. Alternatively, a normal SN Ib/c explosion (M(56Ni) = 0.11 M⊙, EK = 0.2 × 1051 erg, Mej = 1 M⊙) can power the first peak while a magnetar, with a magnetic field characterized by B = 5.0 × 1014 G, and a rotation period of P = 18.1 ms, provides energy for the main peak. The early g-band light curve can be fit with a shock-breakout cooling tail or an extended envelope model from which a radius of at least 30 R⊙ is obtained. Conclusions: We presented a scenario where PTF11mnb was the explosion of a massive, He-poor star, characterized by a double-peaked 56Ni

  2. Evidence of a double peak in muscle activation to enhance strike speed and force: an example with elite mixed martial arts fighters.

    Science.gov (United States)

    McGill, Stuart M; Chaimberg, Jon D; Frost, David M; Fenwick, Chad M J

    2010-02-01

    The main issue addressed here is the paradox of muscle contraction to optimize speed and strike force. When muscle contracts, it increases in both force and stiffness. Force creates faster movement, but the corresponding stiffness slows the change of muscle shape and joint velocity. The purpose of this study was to investigate how this speed strength is accomplished. Five elite mixed martial arts athletes were recruited given that they must create high strike force very quickly. Muscle activation using electromyography and 3-dimensional spine motion was measured. A variety of strikes were performed. Many of the strikes intend to create fast motion and finish with a very large striking force, demonstrating a "double peak" of muscle activity. An initial peak was timed with the initiation of motion presumably to enhance stiffness and stability through the body before motion. This appeared to create an inertial mass in the large "core" for limb muscles to "pry" against to initiate limb motion. Then, some muscles underwent a relaxation phase as speed of limb motion increased. A second peak was observed upon contact with the opponent (heavy bag). It was postulated that this would increase stiffness through the body linkage, resulting in a higher effective mass behind the strike and likely a higher strike force. Observation of the contract-relax-contract pulsing cycle during forceful and quick strikes suggests that it may be fruitful to consider pulse training that involves not only the rate of muscle contraction but also the rate of muscle relaxation.

  3. Detecting cm-scale hot spot over 24-km-long single-mode fiber by using differential pulse pair BOTDA based on double-peak spectrum.

    Science.gov (United States)

    Diakaridia, Sanogo; Pan, Yue; Xu, Pengbai; Zhou, Dengwang; Wang, Benzhang; Teng, Lei; Lu, Zhiwei; Ba, Dexin; Dong, Yongkang

    2017-07-24

    In distributed Brillouin optical fiber sensor when the length of the perturbation to be detected is much smaller than the spatial resolution that is defined by the pulse width, the measured Brillouin gain spectrum (BGS) experiences two or multiple peaks. In this work, we propose and demonstrate a technique using differential pulse pair Brillouin optical time-domain analysis (DPP-BOTDA) based on double-peak BGS to enhance small-scale events detection capability, where two types of single mode fiber (main fiber and secondary fiber) with 116 MHz Brillouin frequency shift (BFS) difference have been used. We have realized detection of a 5-cm hot spot at the far end of 24-km single mode fiber by employing a 50-cm spatial resolution DPP-BOTDA with only 1GS/s sampling rate (corresponding to 10 cm/point). The BFS at the far end of 24-km sensing fiber has been measured with 0.54 MHz standard deviation which corresponds to a 0.5°C temperature accuracy. This technique is simple and cost effective because it is implemented using the similar experimental setup of the standard BOTDA, however, it should be noted that the consecutive small-scale events have to be separated by a minimum length corresponding to the spatial resolution defined by the pulse width difference.

  4. Cancer from internal emitters

    International Nuclear Information System (INIS)

    Boecker, B.B.; Griffith, W.C. Jr.

    1995-01-01

    Irradiation from internal emitters, or internally deposited radionuclides, is an important component of radiation exposures encountered in the workplace, home, or general environment. Long-term studies of human populations exposed to various internal emitters by different routes of exposure are producing critical information for the protection of workers and members of the general public. The purpose of this report is to examine recent developments and discuss their potential importance for understanding lifetime cancer risks from internal emitters. The major populations of persons being studied for lifetime health effects from internally deposited radionuclides are well known: Lung cancer in underground miners who inhaled Rn progeny, liver cancer from persons injected with the Th-containing radiographic contrast medium Thorotrast, bone cancer from occupational or medical intakes of 226 Ra or medical injections of 224 Ra, and thyroid cancer from exposures to iodine radionuclides in the environment or for medical purposes

  5. Low emittance photoinjectors

    International Nuclear Information System (INIS)

    Ferrario, Massimo

    2001-01-01

    Photon colliders require high charge polarized electron beams with very low normalized emittances, possibly lower than the actual damping rings design goals. Recent analytical and numerical efforts in understanding beam dynamics in RF photoinjectors have raised again the question as to whether the performances of an RF electron gun based injector could be competitive with respect to a damping ring. As a matter of discussion we report in this paper the most recent results concerning low emittance photoinjector designs: the production of polarized electron beams by DC and/or RF guns is illustrated together with space charge compensation techniques and thermal emittance effects. New ideas concerning multi-gun injection system and generation of flat beams by RF gun are also discussed

  6. FACET Emittance Growth

    Energy Technology Data Exchange (ETDEWEB)

    Frederico, J; Hogan, M.J.; Nosochkov, Y.; Litos, M.D.; Raubenheimer, T.; /SLAC

    2011-04-05

    FACET, the Facility for Advanced Accelerator and Experimental Tests, is a new facility being constructed in sector 20 of the SLAC linac primarily to study beam driven plasma wakefield acceleration. The FACET beamline consists of a chicane and final focus system to compress the 23 GeV, 3.2 nC electron bunches to {approx}20 {micro}m long and {approx}10 {micro}m wide. Simulations of the FACET beamline indicate the short-duration and large, 1.5% rms energy spread beams may suffer a factor of four emittance growth from a combination of chromaticity, incoherent synchrotron radiation (ISR), and coherent synchrotron radiation (CSR). Emittance growth is directly correlated to head erosion in plasma wakefield acceleration and is a limiting factor in single stage performance. Studies of the geometric, CSR, and ISR components are presented. Numerical calculation of the rms emittance can be overwhelmed by long tails in the simulated phase space distributions; more useful definitions of emittance are given. A complete simulation of the beamline is presented as well, which agrees with design specifications.

  7. FACET Emittance Growth

    International Nuclear Information System (INIS)

    Frederico, Joel

    2011-01-01

    FACET, the Facility for Advanced Accelerator and Experimental Tests, is a new facility being constructed in sector 20 of the SLAC linac primarily to study beam driven plasma wakefield acceleration. The FACET beamline consists of a chicane and final focus system to compress the 23 GeV, 3.2 nC electron bunches to ∼20 (micro)m long and ∼10 (micro)m wide. Simulations of the FACET beamline indicate the short-duration and large, 1.5% rms energy spread beams may suffer a factor of four emittance growth from a combination of chromaticity, incoherent synchrotron radiation (ISR), and coherent synchrotron radiation (CSR). Emittance growth is directly correlated to head erosion in plasma wakefield acceleration and is a limiting factor in single stage performance. Studies of the geometric, CSR, and ISR components are presented. Numerical calculation of the rms emittance can be overwhelmed by long tails in the simulated phase space distributions; more useful definitions of emittance are given. A complete simulation of the beamline is presented as well, which agrees with design specifications.

  8. Low-emittance Storage Rings

    CERN Document Server

    Wolski, Andrzej

    2014-01-01

    The effects of synchrotron radiation on particle motion in storage rings are discussed. In the absence of radiation, particle motion is symplectic, and the beam emittances are conserved. The inclusion of radiation effects in a classical approximation leads to emittance damping: expressions for the damping times are derived. Then, it is shown that quantum radiation effects lead to excitation of the beam emittances. General expressions for the equilibrium longitudinal and horizontal (natural) emittances are derived. The impact of lattice design on the natural emittance is discussed, with particular attention to the special cases of FODO-, achromat- and theoretical-minimum-emittance-style lattices. Finally, the effects of betatron coupling and vertical dispersion (generated by magnet alignment and lattice tuning errors) on the vertical emittance are considered.

  9. Rare Earth Garnet Selective Emitter

    Science.gov (United States)

    Lowe, Roland A.; Chubb, Donald L.; Farmer, Serene C.; Good, Brian S.

    1994-01-01

    Thin film Ho-YAG and Er-YAG emitters with a platinum substrate exhibit high spectral emittance in the emission band (epsilon(sub lambda) approx. = 0.75, sup 4)|(sub 15/2) - (sup 4)|(sub 13/2),for Er-YAG and epsilon(sub lambda) approx. = 0.65, (sup 5)|(sub 7) - (sup 5)|(sub 8) for Ho-YAG) at 1500 K. In addition, low out-of-band spectral emittance, epsilon(sub lambda) less than 0.2, suggest these materials would be excellent candidates for high efficiency selective emitters in thermophotovoltaic (TPV) systems operating at moderate temperatures (1200-1500 K). Spectral emittance measurements of the thin films were made (1.2 less than lambda less than 3.0 microns) and compared to the theoretical emittances calculated using measured values of the spectral extinction coefficient. In this paper we present the results for a new class of rare earth ion selective emitters. These emitters are thin sections (less than 1 mm) of yttrium aluminum garnet (YAG) single crystal with a rare earth substitutional impurity. Selective emitters in the near IR are of special interest for thermophotovoltaic (TPV) energy conversion. The most promising solid selective emitters for use in a TPV system are rare earth oxides. Early spectral emittance work on rare earth oxides showed strong emission bands in the infrared (0.9 - 3 microns). However, the emittance outside the emission band was also significant and the efficiency of these emitters was low. Recent improvements in efficiency have been made with emitters fabricated from fine (5 - 10 microns) rare earth oxide fibers similar to the Welsbach mantle used in gas lanterns. However, the rare earth garnet emitters are more rugged than the mantle type emitters. A thin film selective emitter on a low emissivity substrate such as gold, platinum etc., is rugged and easily adapted to a wide variety of thermal sources. The garnet structure and its many subgroups have been successfully used as hosts for rare earth ions, introduced as substitutional

  10. Spherical proton emitters

    International Nuclear Information System (INIS)

    Berg, S.; Semmes, P.B.; Nazarewicz, W.

    1997-01-01

    Various theoretical approaches to proton emission from spherical nuclei are investigated, and it is found that all the methods employed give very similar results. The calculated decay widths are found to be qualitatively insensitive to the parameters of the proton-nucleus potential, i.e., changing the potential parameters over a fairly large range typically changes the decay width by no more than a factor of ∼3. Proton half-lives of observed heavy proton emitters are, in general, well reproduced by spherical calculations with the spectroscopic factors calculated in the independent quasiparticle approximation. The quantitative agreement with experimental data obtained in our study requires that the parameters of the proton-nucleus potential be chosen carefully. It also suggests that deformed proton emitters will provide invaluable spectroscopic information on the angular momentum decomposition of single-proton orbitals in deformed nuclei. copyright 1997 The American Physical Society

  11. Dosimetry of internal emitters

    International Nuclear Information System (INIS)

    Anon.

    1982-01-01

    The Dosimetry of Internal Emitter Program endeavors to refine the correlation between radiation dose and observed biological effects. The program is presently engaged in the development of studies that will demonstrate the applicability of microdosimetry models developed under the Microdosimetry of Internal Sources Program. The program also provides guidance and assistance to Pacific Northwest Laboratory's Biology Department in the dosimetric analysis of internally deposited radionuclides. This report deals with alpha particle dosimetry plutonium 239 inhalation, and in vitro studies of chromosomal observations

  12. Sociology of Hidden Curriculum

    Directory of Open Access Journals (Sweden)

    Alireza Moradi

    2017-06-01

    Full Text Available This paper reviews the concept of hidden curriculum in the sociological theories and wants to explain sociological aspects of formation of hidden curriculum. The main question concentrates on the theoretical approaches in which hidden curriculum is explained sociologically.For this purpose it was applied qualitative research methodology. The relevant data include various sociological concepts and theories of hidden curriculum collected by the documentary method. The study showed a set of rules, procedures, relationships and social structure of education have decisive role in the formation of hidden curriculum. A hidden curriculum reinforces by existed inequalities among learners (based on their social classes or statues. There is, in fact, a balance between the learner's "knowledge receptions" with their "inequality proportion".The hidden curriculum studies from different major sociological theories such as Functionalism, Marxism and critical theory, Symbolic internationalism and Feminism. According to the functionalist perspective a hidden curriculum has a social function because it transmits social values. Marxists and critical thinkers correlate between hidden curriculum and the totality of social structure. They depicts that curriculum prepares learners for the exploitation in the work markets. Symbolic internationalism rejects absolute hegemony of hidden curriculum on education and looks to the socialization as a result of interaction between learner and instructor. Feminism theory also considers hidden curriculum as a vehicle which legitimates gender stereotypes.

  13. Nonintercepting emittance monitor

    International Nuclear Information System (INIS)

    Miller, R.H.; Clendenin, J.E.; James, M.B.; Sheppard, J.C.

    1983-08-01

    A nonintercepting emittance monitor is a helpful device for measuring and improving particle beams in accelerators and storage rings as it allows continuous monitoring of the beam's distribution in phase space, and perhaps closed loop computer control of the distributions. Stripline position monitors are being investigated for use as nonintercepting emittance monitors for a beam focused by a FODO array in the first 100 meters of our linear accelerator. The technique described here uses the signal from the four stripline probes of a single position monitor to measure the quadrupole mode of the wall current in the beam pipe. This current is a function of the quadrupole moment of the beam, sigma 2 /sub x/ - sigma 2 /sub y/. In general, six independent measurements of the quadrupole moment are necessary to determine the beam emittance. This technique is dependent on the characteristically large variations of sigma 2 /sub x/ - sigma 2 /sub y/ in a FODO array. It will not work in a focusing system where the beam is round at each focusing element

  14. Monolithic multinozzle emitters for nanoelectrospray mass spectrometry

    Science.gov (United States)

    Wang, Daojing [Daly City, CA; Yang, Peidong [Kensington, CA; Kim, Woong [Seoul, KR; Fan, Rong [Pasadena, CA

    2011-09-20

    Novel and significantly simplified procedures for fabrication of fully integrated nanoelectrospray emitters have been described. For nanofabricated monolithic multinozzle emitters (NM.sup.2 emitters), a bottom up approach using silicon nanowires on a silicon sliver is used. For microfabricated monolithic multinozzle emitters (M.sup.3 emitters), a top down approach using MEMS techniques on silicon wafers is used. The emitters have performance comparable to that of commercially-available silica capillary emitters for nanoelectrospray mass spectrometry.

  15. Low emittance electron storage rings

    Science.gov (United States)

    Levichev, E. B.

    2018-01-01

    Low-emittance electron (positron) beams are essential for synchrotron light sources, linear collider damping rings, and circular Crab Waist colliders. In this review, the principles and methods of emittance minimization are discussed, prospects for developing relativistic electron storage rings with small beam phase volume are assessed, and problems related to emittance minimization are examined together with their possible solutions. The special features and engineering implementation aspects of various facilities are briefly reviewed.

  16. POVMs and hidden variables

    International Nuclear Information System (INIS)

    Stairs, Allen

    2007-01-01

    Recent results by Paul Busch and Adan Cabello claim to show that by appealing to POVMs, non-contextual hidden variables can be ruled out in two dimensions. While the results of Busch and Cabello are mathematically correct, interpretive problems render them problematic as no hidden variable proofs

  17. Partially Hidden Markov Models

    DEFF Research Database (Denmark)

    Forchhammer, Søren Otto; Rissanen, Jorma

    1996-01-01

    Partially Hidden Markov Models (PHMM) are introduced. They differ from the ordinary HMM's in that both the transition probabilities of the hidden states and the output probabilities are conditioned on past observations. As an illustration they are applied to black and white image compression where...

  18. Emittance growth in rf linacs

    International Nuclear Information System (INIS)

    Jameson, R.A.

    1979-01-01

    As the space-charge limit is approached, the current that can be accelerated in an rf linac and the output emittance that can be expected are discussed. The role of the envelope equations to estimate limits is outlined. The results of numerical experiments to explore general properties of emittance growth are given

  19. Beam phase space and emittance

    International Nuclear Information System (INIS)

    Buon, J.

    1990-12-01

    The classical and elementary results for canonical phase space, the Liouville theorem and the beam emittance are reviewed. Then, the importance of phase portraits to obtain a geometrical description of motion is emphasized, with examples in accelerator physics. Finally, a statistical point of view is used to define beam emittance, to study its law of approximate conservation and to treat two particular examples

  20. Hidden gauge symmetry

    International Nuclear Information System (INIS)

    O'Raifeartaigh, L.

    1979-01-01

    This review describes the principles of hidden gauge symmetry and of its application to the fundamental interactions. The emphasis is on the structure of the theory rather than on the technical details and, in order to emphasise the structure, gauge symmetry and hidden symmetry are first treated as independent phenomena before being combined into a single (hidden gauge symmetric) theory. The main application of the theory is to the weak and electromagnetic interactions of the elementary particles, and although models are used for comparison with experiment and for illustration, emphasis is placed on those features of the application which are model-independent. (author)

  1. The hidden universe

    International Nuclear Information System (INIS)

    Disney, M.

    1985-01-01

    Astronomer Disney has followed a somewhat different tack than that of most popular books on cosmology by concentrating on the notion of hidden (as in not directly observable by its own radiation) matter in the universe

  2. Locating Hidden Servers

    National Research Council Canada - National Science Library

    Oeverlier, Lasse; Syverson, Paul F

    2006-01-01

    .... Announced properties include server resistance to distributed DoS. Both the EFF and Reporters Without Borders have issued guides that describe using hidden services via Tor to protect the safety of dissidents as well as to resist censorship...

  3. Hidden charged dark matter

    International Nuclear Information System (INIS)

    Feng, Jonathan L.; Kaplinghat, Manoj; Tu, Huitzu; Yu, Hai-Bo

    2009-01-01

    Can dark matter be stabilized by charge conservation, just as the electron is in the standard model? We examine the possibility that dark matter is hidden, that is, neutral under all standard model gauge interactions, but charged under an exact (\\rm U)(1) gauge symmetry of the hidden sector. Such candidates are predicted in WIMPless models, supersymmetric models in which hidden dark matter has the desired thermal relic density for a wide range of masses. Hidden charged dark matter has many novel properties not shared by neutral dark matter: (1) bound state formation and Sommerfeld-enhanced annihilation after chemical freeze out may reduce its relic density, (2) similar effects greatly enhance dark matter annihilation in protohalos at redshifts of z ∼ 30, (3) Compton scattering off hidden photons delays kinetic decoupling, suppressing small scale structure, and (4) Rutherford scattering makes such dark matter self-interacting and collisional, potentially impacting properties of the Bullet Cluster and the observed morphology of galactic halos. We analyze all of these effects in a WIMPless model in which the hidden sector is a simplified version of the minimal supersymmetric standard model and the dark matter is a hidden sector stau. We find that charged hidden dark matter is viable and consistent with the correct relic density for reasonable model parameters and dark matter masses in the range 1 GeV ∼ X ∼< 10 TeV. At the same time, in the preferred range of parameters, this model predicts cores in the dark matter halos of small galaxies and other halo properties that may be within the reach of future observations. These models therefore provide a viable and well-motivated framework for collisional dark matter with Sommerfeld enhancement, with novel implications for astrophysics and dark matter searches

  4. Electrohydrodynamic emitters of ion beams

    International Nuclear Information System (INIS)

    Dudnikov, V.G.; Shabalin, A.L.

    1990-01-01

    Physical processes determining generation of ion beams with high emission current density in electrohydrodynamic emitters are considered. Electrohydrodynamic effects developing in ion emission features and kinetics of ion interaction in beams with high density are discussed. Factors determining the size of the emission zone, emission stability at high and low currents, cluster generation, increase of energy spread and decrease of brightness are analyzed. Problems on practical provision of stable EHD emitter functioning are considered. 94 refs.; 8 figs.; 1 tab

  5. Diamondoid monolayers as electron emitters

    Science.gov (United States)

    Yang, Wanli [El Cerrito, CA; Fabbri, Jason D [San Francisco, CA; Melosh, Nicholas A [Menlo Park, CA; Hussain, Zahid [Orinda, CA; Shen, Zhi-Xun [Stanford, CA

    2012-04-10

    Provided are electron emitters based upon diamondoid monolayers, preferably self-assembled higher diamondoid monolayers. High intensity electron emission has been demonstrated employing such diamondoid monolayers, particularly when the monolayers are comprised of higher diamondoids. The application of such diamondoid monolayers can alter the band structure of substrates, as well as emit monochromatic electrons, and the high intensity electron emissions can also greatly improve the efficiency of field-effect electron emitters as applied to industrial and commercial applications.

  6. Nanodiamond Emitters of Single Photons

    Directory of Open Access Journals (Sweden)

    Vlasov I.I.

    2015-01-01

    Full Text Available Luminescence properties of single color centers were studied in nanodiamonds of different origin. It was found that single photon emitters could be realized even in molecularsized diamond (less than 2 nm capable of housing stable luminescent center “silicon-vacancy.” First results on incorporation of single-photon emitters based on luminescent nanodiamonds in plasmonic nanoantennas to enhance the photon count rate and directionality, diminish the fluorescence decay time, and provide polarization selectivity are presented.

  7. A device for electron gun emittance measurement

    International Nuclear Information System (INIS)

    Aune, B.; Corveller, P.; Jablonka, M.; Joly, J.M.

    1985-05-01

    In order to improve the final emittance of the beam delivered by the ALS electron linac a new gun is going to be installed. To measure its emittance and evaluate the contribution of different factors to emittance growth we have developed an emittance measurement device. We describe the experimental and mathematical procedure we have followed, and give some results of measurements

  8. Search for Hidden Particles

    CERN Multimedia

    Solovev, V

    The SHiP Experiment is a new general-purpose fixed target facility at the SPS to search for hidden particles as predicted by a very large number of recently elaborated models of Hidden Sectors which are capable of accommodating dark matter, neutrino oscillations, and the origin of the full baryon asymmetry in the Universe. Specifically, the experiment is aimed at searching for very weakly interacting long lived particles including Heavy Neutral Leptons - right-handed partners of the active neutrinos; light supersymmetric particles - sgoldstinos, etc.; scalar, axion and vector portals to the hidden sector. The high intensity of the SPS and in particular the large production of charm mesons with the 400 GeV beam allow accessing a wide variety of light long-lived exotic particles of such models and of SUSY. Moreover, the facility is ideally suited to study the interactions of tau neutrinos.

  9. The double peaks and symmetric path phenomena in the catalytic activity of Pd/Al2O3-TiO2 catalysts with different TiO2 contents

    Science.gov (United States)

    Zhang, Shen; Guo, Yuyu; Li, Xingying; Wu, Xu; Li, Zhe

    2018-06-01

    Physicochemical properties of Pd/Al2O3-TiO2 catalysts with different amounts of TiO2 contents were investigated by XRD, nitrogen adsorption-desorption, FTIR, NH3-TPD, H2-TPR and XPS techniques. Catalysts of different compositions were tested in the ethanol oxidation reaction to study the effects of TiO2 contents. Double peaks and symmetric path phenomena were observed at certain temperatures with the increase in TiO2 contents. The symmetric peak phenomena and the diverse activity fluctuations have been ascribed to the controlling factors such as temperature and compositions. With the increase in TiO2 content, the surface area, adsorbed oxygen contents and surface acid quantity decreased gradually. The large surface area and adsorbed oxygen contents were conducive to the performance, while increased acid amounts were not beneficial for ethanol oxidation. At 150 and 175 °C, Pd/AT(X1

  10. Radiation emitter-detector package

    International Nuclear Information System (INIS)

    O'Brien, J.T.; Limm, A.C.; Nyul, P.; Tassia, V.S. Jr.

    1978-01-01

    Mounted on the metallic base of a radiation emitter-detector is a mounting block is a first projection, and a second projection. A radiation detector is on the first projection and a semiconductor electroluminescent device, i.e., a radiation emitter, is on the second projection such that the plane of the recombination region of the electroluminescent device is perpendicular to the radiation incident surface of the radiation detector. The electroluminescent device has a primary emission and a secondary emission in a direction different from the primary emission. A radiation emitter-detector package as described is ideally suited to those applications wherein the secondary radiation of the electroluminescent device is fed into a feedback circuit regulating the biasing current of the electroluminescent device

  11. Beam phase space and emittance

    International Nuclear Information System (INIS)

    Buon, J.

    1992-02-01

    The classical and elementary results for canonical phase space, the Liouville theorem and the beam emittance are reviewed. Then, the importance of phase portraits to obtain a geometrical description of motion is emphasized, with examples in accelerator physics. Finally, a statistical point of view is used to define beam emittance, to study its law of approximate conservation, with three particular examples, and to introduce a beam envelope-ellipse and the β-function, emphasing the statistical features of its properties. (author) 14 refs.; 11 figs

  12. Combustion powered thermophotovoltaic emitter system

    Energy Technology Data Exchange (ETDEWEB)

    McHenry, R.S. [Naval Academy, Annapolis, MD (United States). Naval Architecture, Ocean and Marine Engineering

    1995-07-01

    The US Naval Academy (USNA) has recently completed an engineering design project for a high temperature thermophotovoltaic (TPV) photon emitter. The final apparatus was to be portable, completely self contained, and was to incorporate cycle efficiency optimization such as exhaust stream recuperation. Through computer modeling and prototype experimentation, a methane fueled emitter system was designed from structural ceramic materials to fulfill the high temperature requirements necessary for high system efficiency. This paper outlines the engineering design process, discusses obstacles and solutions encountered, and presents the final design.

  13. The hidden values

    DEFF Research Database (Denmark)

    Rasmussen, Birgitte; Jensen, Karsten Klint

    “The Hidden Values - Transparency in Decision-Making Processes Dealing with Hazardous Activities”. The report seeks to shed light on what is needed to create a transparent framework for political and administrative decisions on the use of GMOs and chemical products. It is our hope that the report...

  14. Low emittance configuration for spear

    International Nuclear Information System (INIS)

    Blumberg, L.N.; Harris, J.; Stege, R.; Cerino, J.; Hettel, R.; Hofmann, A.; Liu, R.Z.; Wiedemann, H.; Winick, H.

    1985-01-01

    The quality of synchrotron radiation beams from SPEAR, in particular the brilliance of undulator radiation, can be improved significantly by reducing the emittance of the stored electron beam. A reduction of the horizontal emittance by a factor of 3.5 to a value of 130 nanometer-radians (nm-r) at 3 GeV has been achieved by using stronger focussing, mainly in the horizontal plane. The low emittance configuration also reduces the dispersion and vertical beta functions in the straight sections, making them more suitable for wigglers. The higher betatron tunes lead to a larger phase advance between the two kickers, which has to be corrected during injection by shunting current from some quadrupoles. The configuration was optimized within SPEAR hardware limitations and tested for dynamic aperture with the tracking program PATRICIA. After implementation of this scheme, beam was successfully injected and accumulated. The measured emittance of the stored beam was in agreement with calculations. Presently the configuration is being made operational

  15. Measuring emittances and sigma matrices

    International Nuclear Information System (INIS)

    Rees, J.; Rivkin, L.

    1984-03-01

    The method used for measuring emittance at the SLAC Linac and the linear collider damping ring is described. The basis of the method is derived using one two-by-two matrix to specify the state of the input beam (sigma matrix) and another to describe the lens-drift transport system (R-matrix)

  16. Shielding in ungated field emitter arrays

    Energy Technology Data Exchange (ETDEWEB)

    Harris, J. R. [U.S. Navy Reserve, Navy Operational Support Center New Orleans, New Orleans, Louisiana 70143 (United States); Jensen, K. L. [Code 6854, Naval Research Laboratory, Washington, D.C. 20375 (United States); Shiffler, D. A. [Directed Energy Directorate, Air Force Research Laboratory, Albuquerque, New Mexico 87117 (United States); Petillo, J. J. [Leidos, Billerica, Massachusetts 01821 (United States)

    2015-05-18

    Cathodes consisting of arrays of high aspect ratio field emitters are of great interest as sources of electron beams for vacuum electronic devices. The desire for high currents and current densities drives the cathode designer towards a denser array, but for ungated emitters, denser arrays also lead to increased shielding, in which the field enhancement factor β of each emitter is reduced due to the presence of the other emitters in the array. To facilitate the study of these arrays, we have developed a method for modeling high aspect ratio emitters using tapered dipole line charges. This method can be used to investigate proximity effects from similar emitters an arbitrary distance away and is much less computationally demanding than competing simulation approaches. Here, we introduce this method and use it to study shielding as a function of array geometry. Emitters with aspect ratios of 10{sup 2}–10{sup 4} are modeled, and the shielding-induced reduction in β is considered as a function of tip-to-tip spacing for emitter pairs and for large arrays with triangular and square unit cells. Shielding is found to be negligible when the emitter spacing is greater than the emitter height for the two-emitter array, or about 2.5 times the emitter height in the large arrays, in agreement with previously published results. Because the onset of shielding occurs at virtually the same emitter spacing in the square and triangular arrays, the triangular array is preferred for its higher emitter density at a given emitter spacing. The primary contribution to shielding in large arrays is found to come from emitters within a distance of three times the unit cell spacing for both square and triangular arrays.

  17. Double peak spectra in spontaneous edge electroluminescence

    Czech Academy of Sciences Publication Activity Database

    Zavadil, Jiří; Žďánský, Karel

    1993-01-01

    Roč. 36, č. 11 (1993), s. 1623-1632 ISSN 0038-1101 R&D Projects: GA AV ČR IAA167108 Keywords : light emitting diodes * electroluminescence * optical waveguide theory Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.871, year: 1993

  18. Facility Location with Double-peaked Preferences

    DEFF Research Database (Denmark)

    Filos-Ratsikas, Aris; Li, Minming; Zhang, Jie

    2015-01-01

    ; this makes the problem essentially more challenging. As our main contribution, we present a simple truthful-in-expectation mechanism that achieves an approximation ratio of 1+b=c for both the social and the maximum, cost, where b is the distance of the agent from the peak and c is the minimum cost...

  19. Hidden neural networks

    DEFF Research Database (Denmark)

    Krogh, Anders Stærmose; Riis, Søren Kamaric

    1999-01-01

    A general framework for hybrids of hidden Markov models (HMMs) and neural networks (NNs) called hidden neural networks (HNNs) is described. The article begins by reviewing standard HMMs and estimation by conditional maximum likelihood, which is used by the HNN. In the HNN, the usual HMM probability...... parameters are replaced by the outputs of state-specific neural networks. As opposed to many other hybrids, the HNN is normalized globally and therefore has a valid probabilistic interpretation. All parameters in the HNN are estimated simultaneously according to the discriminative conditional maximum...... likelihood criterion. The HNN can be viewed as an undirected probabilistic independence network (a graphical model), where the neural networks provide a compact representation of the clique functions. An evaluation of the HNN on the task of recognizing broad phoneme classes in the TIMIT database shows clear...

  20. A hidden history

    OpenAIRE

    Peppers, Emily

    2008-01-01

    The Cultural Collections Audit project began at the University of Edinburgh in 2004, searching for hidden treasures in its 'distributed heritage collections' across the university. The objects and collections recorded in the Audit ranged widely from fine art and furniture to historical scientific and teaching equipment and personalia relating to key figures in the university's long tradition of academic excellence. This information was gathered in order to create a central database of informa...

  1. Distinguishing Hidden Markov Chains

    OpenAIRE

    Kiefer, Stefan; Sistla, A. Prasad

    2015-01-01

    Hidden Markov Chains (HMCs) are commonly used mathematical models of probabilistic systems. They are employed in various fields such as speech recognition, signal processing, and biological sequence analysis. We consider the problem of distinguishing two given HMCs based on an observation sequence that one of the HMCs generates. More precisely, given two HMCs and an observation sequence, a distinguishing algorithm is expected to identify the HMC that generates the observation sequence. Two HM...

  2. Coupling of Hidden Sector

    OpenAIRE

    Królikowski, Wojciech

    2016-01-01

    A hypothetic Hidden Sector of the Universe, consisting of sterile fer\\-mions (``sterinos'') and sterile mediating bosons (``sterons'') of mass dimension 1 (not 2!) --- the last described by an antisymmetric tensor field --- requires to exist also a scalar isovector and scalar isoscalar in order to be able to construct electroweak invariant coupling (before spontaneously breaking its symmetry). The introduced scalar isoscalar might be a resonant source for the diphoton excess of 750 GeV, sugge...

  3. Alpha particle emitters in medicine

    International Nuclear Information System (INIS)

    Fisher, D.R.

    1989-09-01

    Radiation-induced cancer of bone, liver and lung has been a prominent harmful side-effect of medical applications of alpha emitters. In recent years, however, the potential use of antibodies labeled with alpha emitting radionuclides against cancer has seemed promising because alpha particles are highly effective in cell killing. High dose rates at high LET, effectiveness under hypoxic conditions, and minimal expectancy of repair are additional advantages of alpha emitters over antibodies labeled with beta emitting radionuclides for cancer therapy. Cyclotron-produced astatine-211 ( 211 At) and natural bismuth-212 ( 212 Bi) have been proposed and are under extensive study in the United States and Europe. Radium-223 ( 223 Ra) also has favorable properties as a potential alpha emitting label, including a short-lived daughter chain with four alpha emissions. The radiation dosimetry of internal alpha emitters is complex due to nonuniformly distributed sources, short particle tracks, and high relative specific ionization. The variations in dose at the cellular level may be extreme. Alpha-particle radiation dosimetry, therefore, must involve analysis of statistical energy deposition probabilities for cellular level targets. It must also account fully for nonuniform distributions of sources in tissues, source-target geometries, and particle-track physics. 18 refs., 4 figs

  4. Localization of hidden Chua's attractors

    International Nuclear Information System (INIS)

    Leonov, G.A.; Kuznetsov, N.V.; Vagaitsev, V.I.

    2011-01-01

    The classical attractors of Lorenz, Rossler, Chua, Chen, and other widely-known attractors are those excited from unstable equilibria. From computational point of view this allows one to use numerical method, in which after transient process a trajectory, started from a point of unstable manifold in the neighborhood of equilibrium, reaches an attractor and identifies it. However there are attractors of another type: hidden attractors, a basin of attraction of which does not contain neighborhoods of equilibria. In the present Letter for localization of hidden attractors of Chua's circuit it is suggested to use a special analytical-numerical algorithm. -- Highlights: → There are hidden attractors: basin doesn't contain neighborhoods of equilibria. → Hidden attractors cannot be reached by trajectory from neighborhoods of equilibria. → We suggested special procedure for localization of hidden attractors. → We discovered hidden attractor in Chua's system, L. Chua in his work didn't expect this.

  5. Hidden Liquidity: Determinants and Impact

    OpenAIRE

    Gökhan Cebiroglu; Ulrich Horst

    2012-01-01

    We cross-sectionally analyze the presence of aggregated hidden depth and trade volume in the S&P 500 and identify its key determinants. We find that the spread is the main predictor for a stock’s hidden dimension, both in terms of traded and posted liquidity. Our findings moreover suggest that large hidden orders are associated with larger transaction costs, higher price impact and increased volatility. In particular, as large hidden orders fail to attract (latent) liquidity to the market, ...

  6. Emittance control in linear colliders

    International Nuclear Information System (INIS)

    Ruth, R.D.

    1991-01-01

    Before completing a realistic design of a next-generation linear collider, the authors must first learn the lessons taught by the first generation, the SLC. Given that, they must make designs fault tolerant by including correction and compensation in the basic design. They must also try to eliminate these faults by improved alignment and stability of components. When these two efforts cross, they have a realistic design. The techniques of generation and control of emittance reviewed here provide a foundation for a design which can obtain the necessary luminosity in a next-generation linear collider

  7. Emittance Growth in the NLCTA First Chicane

    International Nuclear Information System (INIS)

    Sun, Yipeng

    2011-01-01

    In this paper, the emittance growth in the NLCTA (Next Linear Collider Test Accelerator) first chicane region is evaluated by simulation studies. It is demonstrated that the higher order fields of the chicane dipole magnet and the dipole corrector magnet (which is attached on the quadrupoles) are the main contributions for the emittance growth, especially for the case with a large initial emittance (γε 0 = 5 (micro)m for instance). These simulation results agree with the experimental observations.

  8. Production of alpha emitters for therapy

    International Nuclear Information System (INIS)

    Vucina, J.; Orlic, M.; Lukic, D.

    2006-01-01

    The basis for the introduction of alpha emitters into nuclear medical practice are their radiobiological properties. High LET values and short ranges in biological tissues are advantageous in comparison with nowadays most often used beta emitters, primarily 90 Y and 131 I. Given are the most important criteria for the introduction of a given radionuclide in the routine use. Shown are the procedures for the production of the most important alpha emitters 211 At, 212 Bi and 213 Bi. (author)

  9. Emittance measurements by variable quadrupole method

    International Nuclear Information System (INIS)

    Toprek, D.

    2005-01-01

    The beam emittance is a measure of both the beam size and beam divergence, we cannot directly measure its value. If the beam size is measured at different locations or under different focusing conditions such that different parts of the phase space ellipse will be probed by the beam size monitor, the beam emittance can be determined. An emittance measurement can be performed by different methods. Here we will consider the varying quadrupole setting method.

  10. Minimum emittance in TBA and MBA lattices

    Science.gov (United States)

    Xu, Gang; Peng, Yue-Mei

    2015-03-01

    For reaching a small emittance in a modern light source, triple bend achromats (TBA), theoretical minimum emittance (TME) and even multiple bend achromats (MBA) have been considered. This paper derived the necessary condition for achieving minimum emittance in TBA and MBA theoretically, where the bending angle of inner dipoles has a factor of 31/3 bigger than that of the outer dipoles. Here, we also calculated the conditions attaining the minimum emittance of TBA related to phase advance in some special cases with a pure mathematics method. These results may give some directions on lattice design.

  11. Minimum emittance in TBA and MBA lattices

    International Nuclear Information System (INIS)

    Xu Gang; Peng Yuemei

    2015-01-01

    For reaching a small emittance in a modern light source, triple bend achromats (TBA), theoretical minimum emittance (TME) and even multiple bend achromats (MBA) have been considered. This paper derived the necessary condition for achieving minimum emittance in TBA and MBA theoretically, where the bending angle of inner dipoles has a factor of 3 1/3 bigger than that of the outer dipoles. Here, we also calculated the conditions attaining the minimum emittance of TBA related to phase advance in some special cases with a pure mathematics method. These results may give some directions on lattice design. (authors)

  12. Hybrid emitter all back contact solar cell

    Science.gov (United States)

    Loscutoff, Paul; Rim, Seung

    2016-04-12

    An all back contact solar cell has a hybrid emitter design. The solar cell has a thin dielectric layer formed on a backside surface of a single crystalline silicon substrate. One emitter of the solar cell is made of doped polycrystalline silicon that is formed on the thin dielectric layer. The other emitter of the solar cell is formed in the single crystalline silicon substrate and is made of doped single crystalline silicon. The solar cell includes contact holes that allow metal contacts to connect to corresponding emitters.

  13. Emittance investigation of RF photo-injector

    CERN Document Server

    Yang Mao Rong; Li Zheng; Li Ming; Xu Zhou

    2002-01-01

    A high-power laser beam illuminates a photocathode surface placed on an end wall of an RF cavity. The emitted electrons are accelerated immediately to a relativistic energy by the strong RF find in the cavity. But space charge effect induces beam emittance growth especially near the cathode where the electrons are still nonrelativistic. The author analyzes the factors which lead the transverse emittance growth and method how to resolve this problem. After introducing solenoidal focusing near the photocathode, the beam emittance growth is suppressed dramatically. The beam emittance is given also after compensation and simulation results. The measurements show these results are coincident

  14. Hidden Risk Factors for Women

    Science.gov (United States)

    ... A.S.T. Quiz Hidden Stroke Risk Factors for Women Updated:Nov 22,2016 Excerpted from "What Women Need To Know About The Hidden Risk Factors ... 2012) This year, more than 100,000 U.S. women under 65 will have a stroke. Stroke is ...

  15. Higgs Portal into Hidden Sectors

    CERN Multimedia

    CERN. Geneva

    2007-01-01

    Several attractive theoretical ideas suggest the existence of one or more 'hidden sectors' consisting of standard model singlet fields, some of which may not be too heavy. There is a profound reason to think that the Higgs sector might provide the first access to these hidden sectors. This scenario could affect Higgs phenomenology in drastic ways.

  16. Emittance control in linear colliders

    International Nuclear Information System (INIS)

    Ruth, R.D.

    1991-05-01

    In this paper, we discuss the generation and control of the emittance in a next-generation linear collider. The beams are extracted from a damping ring and compressed in length by the first bunch compressor. They are then accelerated in a preaccelerator linac up to an energy appropriate for injection into a high gradient linac. In many designs this pre-acceleration is followed by another bunch compression to reach a short bunch. After acceleration in the linac, the bunches are finally focused transversely to a small spot. The proposed vertical beam sizes at the interaction point are the order of a few nanometers while the horizontal sizes are about a factor of 100 larger. This cross-sectional area is about a factor of 10 4 smaller than the SLC. However, the main question is: what are the tolerances to achieve such a small size, and how do they compare to present techniques for alignment and stability? These tolerances are very design dependent. Alignment tolerances in the linac can vary from 1 μm to 100 μm depending upon the basic approach. In this paper we discuss techniques of emittance generation and control which move alignment tolerances to the 100 μm range

  17. Coupling single emitters to quantum plasmonic circuits

    DEFF Research Database (Denmark)

    Huck, Alexander; Andersen, Ulrik Lund

    2016-01-01

    In recent years, the controlled coupling of single-photon emitters to propagating surface plasmons has been intensely studied, which is fueled by the prospect of a giant photonic nonlinearity on a nanoscaled platform. In this article, we will review the recent progress on coupling single emitters...

  18. Hidden attractors in dynamical systems

    Science.gov (United States)

    Dudkowski, Dawid; Jafari, Sajad; Kapitaniak, Tomasz; Kuznetsov, Nikolay V.; Leonov, Gennady A.; Prasad, Awadhesh

    2016-06-01

    Complex dynamical systems, ranging from the climate, ecosystems to financial markets and engineering applications typically have many coexisting attractors. This property of the system is called multistability. The final state, i.e., the attractor on which the multistable system evolves strongly depends on the initial conditions. Additionally, such systems are very sensitive towards noise and system parameters so a sudden shift to a contrasting regime may occur. To understand the dynamics of these systems one has to identify all possible attractors and their basins of attraction. Recently, it has been shown that multistability is connected with the occurrence of unpredictable attractors which have been called hidden attractors. The basins of attraction of the hidden attractors do not touch unstable fixed points (if exists) and are located far away from such points. Numerical localization of the hidden attractors is not straightforward since there are no transient processes leading to them from the neighborhoods of unstable fixed points and one has to use the special analytical-numerical procedures. From the viewpoint of applications, the identification of hidden attractors is the major issue. The knowledge about the emergence and properties of hidden attractors can increase the likelihood that the system will remain on the most desirable attractor and reduce the risk of the sudden jump to undesired behavior. We review the most representative examples of hidden attractors, discuss their theoretical properties and experimental observations. We also describe numerical methods which allow identification of the hidden attractors.

  19. Emittance measurements of the CLIO electron beam

    Science.gov (United States)

    Chaput, R.; Devanz, G.; Joly, P.; Kergosien, B.; Lesrel, J.

    1997-02-01

    We have designed a setup to measure the transverse emittance at the CLIO accelerator exit, based on the "3 gradients" method. The beam transverse size is measured simply by scanning it with a steering coil across a fixed jaw and recording the transmitted current, at various quadrupole strengths. A code then performs a complete calculation of the emittance using the transfer matrix of the quadrupole instead of the usual classical lens approximation. We have studied the influence of various parameters on the emittance: Magnetic field on the e-gun and the peak current. We have also improved a little the emittance by replacing a mismatched pipe between the buncher and accelerating section to avoid wake-field effects; The resulting improvements of the emittance have led to an increase in the FEL emitted power.

  20. Positron emitter labeled enzyme inhibitors

    International Nuclear Information System (INIS)

    Fowler, J.S.; MacGregor, R.R.; Wolf, A.P.; Langstrom, B.

    1990-01-01

    This invention involves a new strategy for imagining and mapping enzyme activity in the living human and animal body using positron emitter-labeled suicide enzyme inactivators or inhibitors which become covalently bound to the enzyme as a result of enzymatic catalysis. Two such suicide inactivators for monoamine oxidase have been labeled with carbon-11 and used to map the enzyme subtypes in the living human and animal body using PET. By using positron emission tomography to image the distribution of radioactivity produced by the body penetrating radiation emitted by carbon-11, a map of functionally active monoamine oxidase activity is obtained. Clorgyline and L-deprenyl are suicide enzyme inhibitors and irreversibly inhibit monoamine oxidase. When these inhibitors are labeled with carbon-11 they provide selective probes for monoamine oxidase localization and reactivity in vivo using positron emission tomography

  1. High current plasma electron emitter

    International Nuclear Information System (INIS)

    Fiksel, G.; Almagri, A.F.; Craig, D.

    1995-07-01

    A high current plasma electron emitter based on a miniature plasma source has been developed. The emitting plasma is created by a pulsed high current gas discharge. The electron emission current is 1 kA at 300 V at the pulse duration of 10 ms. The prototype injector described in this paper will be used for a 20 kA electrostatic current injection experiment in the Madison Symmetric Torus (MST) reversed-field pinch. The source will be replicated in order to attain this total current requirement. The source has a simple design and has proven very reliable in operation. A high emission current, small size (3.7 cm in diameter), and low impurity generation make the source suitable for a variety of fusion and technological applications

  2. Variational Infinite Hidden Conditional Random Fields

    NARCIS (Netherlands)

    Bousmalis, Konstantinos; Zafeiriou, Stefanos; Morency, Louis-Philippe; Pantic, Maja; Ghahramani, Zoubin

    2015-01-01

    Hidden conditional random fields (HCRFs) are discriminative latent variable models which have been shown to successfully learn the hidden structure of a given classification problem. An Infinite hidden conditional random field is a hidden conditional random field with a countably infinite number of

  3. Managing Hidden Costs of Offshoring

    DEFF Research Database (Denmark)

    Larsen, Marcus M.; Pedersen, Torben

    2014-01-01

    This chapter investigates the concept of the ‘hidden costs’ of offshoring, i.e. unexpected offshoring costs exceeding the initially expected costs. Due to the highly undefined nature of these costs, we position our analysis towards the strategic responses of firms’ realisation of hidden costs....... In this regard, we argue that a major response to the hidden costs of offshoring is the identification and utilisation of strategic mechanisms in the organisational design to eventually achieving system integration in a globally dispersed and disaggregated organisation. This is heavily moderated by a learning......-by-doing process, where hidden costs motivate firms and their employees to search for new and better knowledge on how to successfully manage the organisation. We illustrate this thesis based on the case of the LEGO Group....

  4. The Hidden Costs of Offshoring

    DEFF Research Database (Denmark)

    Møller Larsen, Marcus; Manning, Stephan; Pedersen, Torben

    2011-01-01

    of offshoring. Specifically, we propose that hidden costs can be explained by the combination of increasing structural, operational and social complexity of offshoring activities. In addition, we suggest that firm orientation towards organizational design as part of an offshoring strategy and offshoring......This study seeks to explain hidden costs of offshoring, i.e. unexpected costs resulting from the relocation of business tasks and activities outside the home country. We develop a model that highlights the role of complexity, design orientation and experience in explaining hidden costs...... experience moderate the relationship between complexity and hidden costs negatively i.e. reduces the cost generating impact of complexity. We develop three hypotheses and test them on comprehensive data from the Offshoring Research Network (ORN). In general, we find support for our hypotheses. A key result...

  5. Child Abuse: The Hidden Bruises

    Science.gov (United States)

    ... for Families - Vietnamese Spanish Facts for Families Guide Child Abuse - The Hidden Bruises No. 5; Updated November 2014 The statistics on physical child abuse are alarming. It is estimated hundreds of thousands ...

  6. Hidden Statistics of Schroedinger Equation

    Science.gov (United States)

    Zak, Michail

    2011-01-01

    Work was carried out in determination of the mathematical origin of randomness in quantum mechanics and creating a hidden statistics of Schr dinger equation; i.e., to expose the transitional stochastic process as a "bridge" to the quantum world. The governing equations of hidden statistics would preserve such properties of quantum physics as superposition, entanglement, and direct-product decomposability while allowing one to measure its state variables using classical methods.

  7. Hidden Curriculum: An Analytical Definition

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Andarvazh

    2018-03-01

    Full Text Available Background: The concept of hidden curriculum was first used by Philip Jackson in 1968, and Hafferty brought this concept to the medical education. Many of the subjects that medical students learn are attributed to this curriculum. So far several definitions have been presented for the hidden curriculum, which on the one hand made this concept richer, and on the other hand, led to confusion and ambiguity.This paper tries to provide a clear and comprehensive definition of it.Methods: In this study, concept analysis of McKenna method was used. Using keywords and searching in the databases, 561 English and 26 Persian references related to the concept was found, then by limitingthe research scope, 125 abstracts and by finding more relevant references, 55 articles were fully studied.Results: After analyzing the definitions by McKenna method, the hidden curriculum is defined as follows: The hidden curriculum is a hidden, powerful, intrinsic in organizational structure and culture and sometimes contradictory message, conveyed implicitly and tacitly in the learning environment by structural and human factors and its contents includes cultural habits and customs, norms, values, belief systems, attitudes, skills, desires and behavioral and social expectations can have a positive or negative effect, unplanned, neither planners nor teachers, nor learners are aware of it. The ultimate consequence of the hidden curriculum includes reproducing the existing class structure, socialization, and familiarizing learners for transmission and joining the professional world.Conclusion: Based on the concept analysis, we arrived at an analytical definition of the hidden curriculum that could be useful for further studies in this area.Keywords: CONCEPT ANALYSIS, HIDDEN CURRICULUM, MCKENNA’S METHOD

  8. Beam diagnostics using an emittance measurement device

    International Nuclear Information System (INIS)

    Sarstedt, M.; Becker, R.; Klein, H.; Maaser, A.; Mueller, J.; Thomae, R.; Weber, M.

    1995-01-01

    For beam diagnostics aside from Faraday cups for current measurements and analysing magnets for the determination of beam composition and energy the most important tool is an emittance measurement device. With such a system the distribution of the beam particles in phase-space can be determined. This yields information not only on the position of the particles but also on their angle with respect to the beam axis. There are different kinds of emittance measurement devices using either circular holes or slits for separation of part of the beam. The second method (slit-slit measurement), though important for the determination of the rms-emittance, has the disadvantage of integrating over the y- and y'-coordinate (measurement in xx'-plane assumed). This leads to different emittance diagrams than point-point measurements, since in xx'-plane for each two corresponding points of rr'-plane there exists a connecting line. With regard to beam aberrations this makes xx'-emittances harder to interpret. In this paper the two kinds of emittance diagrams are discussed. Additionally the influence of the slit height on the xx'-emittance is considered. The analytical results are compared to experimental measurements in rr'-, rx'- and xx'-phase-space. (orig.)

  9. Beam emittance measurement from CERN thermionic guns

    International Nuclear Information System (INIS)

    Kester, O.; Rao, R.; Rinolfi, L.

    1992-01-01

    In the LEP Injector Linacs (LIL) a thermionic gun provides electron beams with different peak intensities at an energy of 80 keV. The beam emittances were estimated from the EGUN programme. Since the gun is of triode type, the main contribution to the emittance comes from the grid. The simulation programme does not model the real geometry by assuming a cylindrical symmetry, while the grid does not have such symmetry. A Gun Test Facility (GTF), allowing emittance measurements, based on the 3-gradients-method was installed. The experimental results are presented. (author) 6 refs.; 6 figs

  10. Hidden ion population: Revisited

    International Nuclear Information System (INIS)

    Olsen, R.C.; Chappell, C.R.; Gallagher, D.L.; Green, J.L.; Gurnett, D.A.

    1985-01-01

    Satellite potentials in the outer plasmasphere range from near zero to +5 to +10 V. Under such conditions ion measurements may not include the low energy core of the plasma population. In eclipse, the photoelectron current drops to zero, and the spacecraft potential can drop to near zero volts. In regions where the ambient plasma density is below 100 cm -3 , previously unobserved portions of the ambient plasma distribution function can become visible in eclipse. A survey of the data obtained from the retarding ion mass spectrometer (RIMS) on Dynamics Explorer 1 shows that the RIMS detector generally measured the isotropic background in both sunlight and eclipse in the plasma-sphere. Absolute density measurements for the ''hidden'' ion population are obtained for the first time using the plasma wave instrument observations of the upper hybrid resonance. Agreement in total density is found in sunlight and eclipse measurements at densities above 80 cm -3 . In eclipse, agreement is found at densities as low as 20 cm -3 . The isotropic plasma composition is primarily H + , with approx.10% He + , and 0.1 to 1.0% O + . A low energy field-aligned ion population appears in eclipse measurements outside the plasmasphere, which is obscured in sunlight. These field-aligned ions can be interpreted as field-aligned flows with densities of a few particles per cubic centimeter, flowing at 5-20 km/s. The problem in measuring these field-aligned flows in sunlight is the masking of the high energy tail of the field-aligned distribution by the isotropic background. Effective measurement of the core of the magnetospheric plasma distribution awaits satellites with active means of controlling the satellite potential

  11. Internal emitter research and standard setting

    International Nuclear Information System (INIS)

    Stannard, J.N.

    1981-01-01

    The history of the use of data from internal emitter research in the derivation of safety standards is reviewed. At first, observed biological effects were correlated with body burdens or exposure levels. This direct approach is illustrated by detailed accounts of the cases of uranium and plutonium. In the 1950's, when it was decided to provide standards for over 200 isotopes, the direct approach was replaced by a system of calculations. This necessitated changes in internal emitter research programs to provide metabolic data, and the development of models such as Reference Man and the Lung and Gastrointestinal Tract models. The continuing contribution of internal emitter research to standard setting can be seen in the references quoted in the metabolic data section of the new ICRP report (ICRP Publication 30). Present trends suggest a possible return to the direct use of internal emitter effects data for obtaining risk estimates. (U.K.)

  12. Beam emittance measurements on multicusp ion sources

    Energy Technology Data Exchange (ETDEWEB)

    Sarstedt, M.; Lee, Y.; Leung, K.N. [and others

    1995-08-01

    Multicusp ion sources are used for various applications. Presently, the implementation of this type of ion source planned for the development of an ion beam lithography machine, which will be used for the projection of sub-0.2 {mu}m patterns onto a wafer substrate. Since, for this application, a very good beam quality and a small ion energy spread are required, emittance measurements have been performed on a multicusp ion source for various source conditions. It is shown that the installation of proper capacitors between the extraction electrodes is necessary to avoid rf-pickup, which otherwise leads to a distortion of the beam emittance. The influence of the magnetic filter field on the beam emittance has been investigated, and the beam emittance of a dc filament-discharge plasma has also been compared to that of an rf-generated plasma.

  13. Beam emittance measurements on multicusp ion sources

    International Nuclear Information System (INIS)

    Sarstedt, M.; Lee, Y.; Leung, K.N.

    1995-08-01

    Multicusp ion sources are used for various applications. Presently, the implementation of this type of ion source planned for the development of an ion beam lithography machine, which will be used for the projection of sub-0.2 μm patterns onto a wafer substrate. Since, for this application, a very good beam quality and a small ion energy spread are required, emittance measurements have been performed on a multicusp ion source for various source conditions. It is shown that the installation of proper capacitors between the extraction electrodes is necessary to avoid rf-pickup, which otherwise leads to a distortion of the beam emittance. The influence of the magnetic filter field on the beam emittance has been investigated, and the beam emittance of a dc filament-discharge plasma has also been compared to that of an rf-generated plasma

  14. Self-powered detectors with thulium emitter

    International Nuclear Information System (INIS)

    Haller, P.; Klar, E.

    1978-01-01

    In addition to fission chambers, prompt-indicating self-powered (SPN) detectors are used for measuring the neutron flux density in the core of power reactors. Although current SPN detectors with a cobalt emitter give satisfactora results, detectors with other emitter materials have been analyzed and tested. The author describes the properties and decay pattern of the nuclide thulium and presents the results of measurements made while testing thulium detectors. (orig.) [de

  15. Alpha-emitters for medical therapy workshop

    International Nuclear Information System (INIS)

    Feinendegen, L.E.; McClure, J.J.

    1996-01-01

    A workshop on ''Alpha-Emitters for Medical Therapy'' was held May 30-31, 1996 in Denver Colorado to identify research goals and potential clinical needs for applying alpha-particle emitters and to provide DOE with sufficient information for future planning. The workshop was attended by 36 participants representing radiooncology, nuclear medicine, immunotherapy, radiobiology, molecular biology, biochemistry, radiopharmaceutical chemistry, dosimetry, and physics. This report provides a summary of the key points and recommendations arrived at during the conference

  16. Alpha-emitters for medical therapy workshop

    Energy Technology Data Exchange (ETDEWEB)

    Feinendegen, L.E.; McClure, J.J.

    1996-12-31

    A workshop on ``Alpha-Emitters for Medical Therapy`` was held May 30-31, 1996 in Denver Colorado to identify research goals and potential clinical needs for applying alpha-particle emitters and to provide DOE with sufficient information for future planning. The workshop was attended by 36 participants representing radiooncology, nuclear medicine, immunotherapy, radiobiology, molecular biology, biochemistry, radiopharmaceutical chemistry, dosimetry, and physics. This report provides a summary of the key points and recommendations arrived at during the conference.

  17. Stargate of the Hidden Multiverse

    Directory of Open Access Journals (Sweden)

    Alexander Antonov

    2016-02-01

    Full Text Available Concept of Monoverse, which corresponds to the existing broad interpretation of the second postulate of the special theory of relativity, is not consistent with the modern astrophysical reality — existence of the dark matter and the dark energy, the total mass-energy of which is ten times greater than the mass-energy of the visible universe (which has been considered as the entire universe until very recent . This concept does not allow to explain their rather unusual properties — invisibility and lack of baryon content — which would seem to even destroy the very modern understanding of the term ‘matter’. However, all numerous alternative concepts of Multiverses, which have been proposed until today, are unable to explain these properties of the dark matter and dark energy. This article describes a new concept: the concept of the hidden Multiverse and hidden Supermultiverse, which mutual invisibility of parallel universes is explained by the physical reality of imaginary numbers. This concept completely explains the phenomenon of the dark matter and the dark energy. Moreover, it is shown that the dark matter and the dark energy are the experimental evidence for the existence of the hidden Multiverse. Described structure of the hidden Multiverse is fully consistent with the data obtained by the space stations WMAP and Planck. An extremely important property of the hidden Multiverse is an actual possibility of its permeation through stargate located on the Earth.

  18. Multinozzle emitter arrays for ultrahigh-throughput nanoelectrospray mass spectrometry

    Science.gov (United States)

    Wang, Daojing; Mao, Pan; Wang, Hung-Ta; Yang, Peidong

    2017-10-17

    The present invention provides for a structure comprising a plurality of emitters, wherein a first nozzle of a first emitter and a second nozzle of a second emitter emit in two directions that are not or essentially not in the same direction; wherein the walls of the nozzles and the emitters form a monolithic whole. The present invention also provides for a structure comprising an emitter with a sharpened end from which the emitter emits; wherein the emitters forms a monolithic whole. The present invention also provides for a fully integrated separation of proteins and small molecules on a silicon chip before the electrospray mass spectrometry analysis.

  19. Hidden photons in connection to dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Andreas, Sarah; Ringwald, Andreas [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Goodsell, Mark D. [CPhT, Ecole Polytechnique, Palaiseau (France)

    2013-06-15

    Light extra U(1) gauge bosons, so called hidden photons, which reside in a hidden sector have attracted much attention since they are a well motivated feature of many scenarios beyond the Standard Model and furthermore could mediate the interaction with hidden sector dark matter.We review limits on hidden photons from past electron beam dump experiments including two new limits from such experiments at KEK and Orsay. In addition, we study the possibility of having dark matter in the hidden sector. A simple toy model and different supersymmetric realisations are shown to provide viable dark matter candidates in the hidden sector that are in agreement with recent direct detection limits.

  20. Hidden photons in connection to dark matter

    International Nuclear Information System (INIS)

    Andreas, Sarah; Ringwald, Andreas; Goodsell, Mark D.

    2013-06-01

    Light extra U(1) gauge bosons, so called hidden photons, which reside in a hidden sector have attracted much attention since they are a well motivated feature of many scenarios beyond the Standard Model and furthermore could mediate the interaction with hidden sector dark matter.We review limits on hidden photons from past electron beam dump experiments including two new limits from such experiments at KEK and Orsay. In addition, we study the possibility of having dark matter in the hidden sector. A simple toy model and different supersymmetric realisations are shown to provide viable dark matter candidates in the hidden sector that are in agreement with recent direct detection limits.

  1. Hidden worlds in quantum physics

    CERN Document Server

    Gouesbet, Gérard

    2014-01-01

    The past decade has witnessed a resurgence in research and interest in the areas of quantum computation and entanglement. This new book addresses the hidden worlds or variables of quantum physics. Author Gérard Gouesbet studied and worked with a former student of Louis de Broglie, a pioneer of quantum physics. His presentation emphasizes the history and philosophical foundations of physics, areas that will interest lay readers as well as professionals and advanced undergraduate and graduate students of quantum physics. The introduction is succeeded by chapters offering background on relevant concepts in classical and quantum mechanics, a brief history of causal theories, and examinations of the double solution, pilot wave, and other hidden-variables theories. Additional topics include proofs of possibility and impossibility, contextuality, non-locality, classification of hidden-variables theories, and stochastic quantum mechanics. The final section discusses how to gain a genuine understanding of quantum mec...

  2. Measurements of Thermal Emittance for Cesium Telluride Photocathodes at PITZ

    CERN Document Server

    Miltchev, V; Grabosch, H J; Han, J H; Krasilnikov, M; Oppelt, A; Petrosian, B; Staykov, L; Stephan, F

    2005-01-01

    The thermal emittance determines the lower emittance limit and its measurement is of high importance to understand the ultimate injector performance. In this contribution we present results of thermal emittance measurements under rf operation conditions for various Cs2Te cathodes and different accelerating gradients. Measurements of thermal emittance scaling with the cathode laser spot size are presented and analysed. The significance of the Schottky effect in the emittance formation process is discussed.

  3. A low-emittance lattice for SPEAR

    International Nuclear Information System (INIS)

    Safranek, J.; Wiedemann, H.

    1992-01-01

    The design and implementation of a low emittance lattice for the SPEAR storage ring including measurements of the performance of the lattice are presented (J. Safranek, Ph. D. thesis, Stanford University, 1991). The low emittance lattice is designed to optimize the performance of SPEAR as a synchrotron radiation source while keeping SPEAR hardware changes at a minimum. The horizontal emittance of the electron beam in the low emittance lattice is reduced by a factor of 4 from the previous lattice. This reduces the typical horizontal source size and divergence of the photon beams by a factor of 2 each and increases the photon beam brightness. At 3 GeV the horizontal emittance is 129 π nm rad, which makes the low emittance lattice the lowest emittance, runnning synchroton radiation source in the world in the 1.5 to 4.0 GeV energy range for the emittance scaled to 3 GeV. The measured vertical emittance was reduced to half that typically seen at SPEAR in the past. The brightness of the photon beams was further incrased by reducing β y at the insertion devices to 1.1 m and reducing the energy dispersion at the insertion devices by more than a factor of 2 on average. The horizontal despersion at the rf cavities was reduced by a factor of nearly 4 which gives much less problems with synchrobetatron resonances. The dynamic and physical apertures of the lattice are large, giving long beam lifetimes and easy injection of electrons. The measurements of the linear optics and intensity dependent phenomena gave resonable agreement with the design . The overall performance of the machine was very good. Injection rates of 10 to 20 mA/min and larger were achieved routinely, and 100 mA total current was stored. Repeated ramping of stored beam from the injection energy of 2.3 GeV to the running energy of 3.0 GeV was achieved with very little beam loss. This low emittance configuration is expected to be the operating configuration for SPEAR starting in January 1992. (orig.)

  4. Detecting hidden particles with MATHUSLA

    Science.gov (United States)

    Evans, Jared A.

    2018-03-01

    A hidden sector containing light long-lived particles provides a well-motivated place to find new physics. The recently proposed MATHUSLA experiment has the potential to be extremely sensitive to light particles originating from rare meson decays in the very long lifetime region. In this work, we illustrate this strength with the specific example of a light scalar mixed with the standard model-like Higgs boson, a model where MATHUSLA can further probe unexplored parameter space from exotic Higgs decays. Design augmentations should be considered in order to maximize the ability of MATHUSLA to discover very light hidden sector particles.

  5. Hidden Crises and Communication: An Interactional Analysis of Hidden Crises

    NARCIS (Netherlands)

    dr. Annette Klarenbeek

    2011-01-01

    In this paper I describe the ways in which the communication discipline can make a hidden crisis transparent. For this purpose I examine the concept of crisis entrepreneurship from a communication point of view. Using discourse analysis, I analyse the discursive practices of crisis entrepreneurs in

  6. Hidden Crises and Communication : An Interactional Analysis of Hidden Crises

    NARCIS (Netherlands)

    dr. Annette Klarenbeek

    2011-01-01

    In this paper I describe the ways in which the communication discipline can make a hidden crisis transparent. For this purpose I examine the concept of crisis entrepreneurship from a communication point of view. Using discourse analysis, I analyse the discursive practices of crisis entrepreneurs in

  7. Generalized superradiant assembly for nanophotonic thermal emitters

    Science.gov (United States)

    Mallawaarachchi, Sudaraka; Gunapala, Sarath D.; Stockman, Mark I.; Premaratne, Malin

    2018-03-01

    Superradiance explains the collective enhancement of emission, observed when nanophotonic emitters are arranged within subwavelength proximity and perfect symmetry. Thermal superradiant emitter assemblies with variable photon far-field coupling rates are known to be capable of outperforming their conventional, nonsuperradiant counterparts. However, due to the inability to account for assemblies comprising emitters with various materials and dimensional configurations, existing thermal superradiant models are inadequate and incongruent. In this paper, a generalized thermal superradiant assembly for nanophotonic emitters is developed from first principles. Spectral analysis shows that not only does the proposed model outperform existing models in power delivery, but also portrays unforeseen and startling characteristics during emission. These electromagnetically induced transparency like (EIT-like) and superscattering-like characteristics are reported here for a superradiant assembly, and the effects escalate as the emitters become increasingly disparate. The fact that the EIT-like characteristics are in close agreement with a recent experimental observation involving the superradiant decay of qubits strongly bolsters the validity of the proposed model.

  8. Electron emitter pulsed-type cylindrical IEC

    International Nuclear Information System (INIS)

    Miley, G.H.; Gu, Y.; Stubbers, R.; Zich, R.; Anderl, R.; Hartwell, J.

    1997-01-01

    A cylindrical version of the single grid Inertial Electrostatic Confinement (IEC) device (termed the C-device) has been developed for use as a 2.5-MeV D-D fusion neutron source for neutron activation analysis. The C-device employs a hollow-tube type cathode with similar anodes backed up by ''reflector'' dishes. The resulting discharge differs from a conventional hollow cathode discharge, by creating an explicit ion beam which is ''pinched'' in the cathode region. Resulting fusion reactions generate ∼10 6 neutron/s. A pulsed version is under development for applications requiring higher fluxes. Several pulsing techniques are under study, including an electron emitter (e-emitter) assisted discharge in a thorated tungsten wire emitter located behind a slotted area in the reflector dishes. Pulsing is initiated after establishing a low power steady-state discharge by pulsing the e-emitter current using a capacitor switch type circuit. The resulting electron jet, coupled with the discharge by the biased slot array, creates a strong pulse in the pinched ion beam. The pulse length/repetition rate are controlled by the e-emitter pulse circuit. Typical parameters in present studies are ∼30micros, 10Hz and 1-amp ion current. Corresponding neutron measurements are an In-foil type activation counter for time averaged rates. Results for a wide variety of operating conditions are presented

  9. Diamond-based single-photon emitters

    International Nuclear Information System (INIS)

    Aharonovich, I; Castelletto, S; Simpson, D A; Su, C-H; Greentree, A D; Prawer, S

    2011-01-01

    The exploitation of emerging quantum technologies requires efficient fabrication of key building blocks. Sources of single photons are extremely important across many applications as they can serve as vectors for quantum information-thereby allowing long-range (perhaps even global-scale) quantum states to be made and manipulated for tasks such as quantum communication or distributed quantum computation. At the single-emitter level, quantum sources also afford new possibilities in terms of nanoscopy and bio-marking. Color centers in diamond are prominent candidates to generate and manipulate quantum states of light, as they are a photostable solid-state source of single photons at room temperature. In this review, we discuss the state of the art of diamond-based single-photon emitters and highlight their fabrication methodologies. We present the experimental techniques used to characterize the quantum emitters and discuss their photophysical properties. We outline a number of applications including quantum key distribution, bio-marking and sub-diffraction imaging, where diamond-based single emitters are playing a crucial role. We conclude with a discussion of the main challenges and perspectives for employing diamond emitters in quantum information processing.

  10. Entry deterrence and hidden competition

    NARCIS (Netherlands)

    Lavrutich, Maria; Huisman, Kuno; Kort, Peter

    This paper studies strategic investment behavior of firms facing an uncertain demand in a duopoly setting. Firms choose both investment timing and the capacity level while facing additional uncertainty about market participants, which is introduced via the concept of hidden competition. We focus on

  11. Adaptive Partially Hidden Markov Models

    DEFF Research Database (Denmark)

    Forchhammer, Søren Otto; Rasmussen, Tage

    1996-01-01

    Partially Hidden Markov Models (PHMM) have recently been introduced. The transition and emission probabilities are conditioned on the past. In this report, the PHMM is extended with a multiple token version. The different versions of the PHMM are applied to bi-level image coding....

  12. The Hidden Dimensions of Databases.

    Science.gov (United States)

    Jacso, Peter

    1994-01-01

    Discusses methods of evaluating commercial online databases and provides examples that illustrate their hidden dimensions. Topics addressed include size, including the number of records or the number of titles; the number of years covered; and the frequency of updates. Comparisons of Readers' Guide Abstracts and Magazine Article Summaries are…

  13. BEAM EMITTANCE MEASUREMENT TOOL FOR CEBAF OPERATIONS

    International Nuclear Information System (INIS)

    Chevtsov, Pavel; Tiefenback, Michael

    2008-01-01

    A new software tool was created at Jefferson Lab to measure the emittance of the CEBAF electron beams. The tool consists of device control and data analysis applications. The device control application handles the work of wire scanners and writes their measurement results as well as the information about accelerator settings during these measurements into wire scanner data files. The data analysis application reads these files and calculates the beam emittance on the basis of a wire scanner data processing model. Both applications are computer platform independent but are mostly used on LINUX PCs recently installed in the accelerator control room. The new tool significantly simplifies beam emittance measurement procedures for accelerator operations and contributes to a very high availability of the CEBAF machine for the nuclear physics program at Jefferson Lab.

  14. Solid-state single-photon emitters

    Science.gov (United States)

    Aharonovich, Igor; Englund, Dirk; Toth, Milos

    2016-10-01

    Single-photon emitters play an important role in many leading quantum technologies. There is still no 'ideal' on-demand single-photon emitter, but a plethora of promising material systems have been developed, and several have transitioned from proof-of-concept to engineering efforts with steadily improving performance. Here, we review recent progress in the race towards true single-photon emitters required for a range of quantum information processing applications. We focus on solid-state systems including quantum dots, defects in solids, two-dimensional hosts and carbon nanotubes, as these are well positioned to benefit from recent breakthroughs in nanofabrication and materials growth techniques. We consider the main challenges and key advantages of each platform, with a focus on scalable on-chip integration and fabrication of identical sources on photonic circuits.

  15. MD2065: Emittance exchange with linear coupling

    CERN Document Server

    Carver, Lee Robert; Persson, Tobias Hakan Bjorn; Amorim, David; Levens, Tom; Pesah, Arthur Chalom; CERN. Geneva. ATS Department

    2018-01-01

    In order to better understand the luminosity imbalance between ATLAS and CMS that was observed in 2016, it was proposed to perform a test whereby the horizontal and vertical emittances are exchanged by crossing the tunes in the presence of linear coupling. The luminosity before and after the exchange could be compared to see if the imbalance stems purely from the uneven emittances or if there is an additional mechanism in play. However, due to limited machine availability only tests at injection were able to performed.

  16. Minimum emittance of three-bend achromats

    International Nuclear Information System (INIS)

    Li Xiaoyu; Xu Gang

    2012-01-01

    The calculation of the minimum emittance of three-bend achromats (TBAs) made by Mathematical software can ignore the actual magnets lattice in the matching condition of dispersion function in phase space. The minimum scaling factors of two kinds of widely used TBA lattices are obtained. Then the relationship between the lengths and the radii of the three dipoles in TBA is obtained and so is the minimum scaling factor, when the TBA lattice achieves its minimum emittance. The procedure of analysis and the results can be widely used in achromats lattices, because the calculation is not restricted by the actual lattice. (authors)

  17. Quadrupole Transfer Function for Emittance Measurement

    CERN Document Server

    Cameron, Peter; Jansson, Andreas; Tan, Cheng-Yang

    2008-01-01

    Historically the use of the quadrupole moment measurement has been impeded by the requirement for large dynamic range, as well as measurement sensitivity to beam position. We investigate the use of the transfer function technique [1-3] in combination with the sensitivity and 160dB revolution line rejection of the direct diode detection analog front end [4] to open the possibility of an emittance diagnostic that may be implemented without operational complication, quasi- parasitic to the operation of existing tune measurement systems. Such a diagnostic would be particularly useful as an emittance monitor during acceleration ramp development in machines like RHIC and the LHC.

  18. Studies of emittance growth in the ATF

    International Nuclear Information System (INIS)

    Zimmermann, F.

    1997-03-01

    Several different mechanisms of emittance growth in the Accelerator Test Facility (ATF) at KEK are investigated: the author calculates rise times of the fast beam-ion instability for the damping ring (DR), and discusses the emittance growth caused by coherent synchrotron radiation in the beam-transport line (BT), the effect of quadrupole wake fields in the injector linac, and, finally, a single-bunch head-tail ion effect that can occur in both the DR and the BT. A first attempt to measure the quadrupole wake on the real machine is also reported

  19. A low emittance configuration for spear

    International Nuclear Information System (INIS)

    Blumberg, L.N.; Cerino, J.; Harris, J.; Hettel, R.; Hofmann, A.; Liu, R.Z.; Stego, R.; Wiedemann, H.; Winick, H.

    1985-01-01

    The quality of synchrotron radiation beams from SPEAR, in particular the brilliance of undulator radiation, can be improved significantly by reducing the emittance of the stored electron beam. A reduction of the horizontal emittance by a factor of 3.5 to a value of 130 nanometer-radians (nm-r) at 3 GeV has been achieved by using stronger focussing, mainly in the horizontal plane. The low emittance configuration also reduces the dispersion and vertical beta functions in the straight sections, making them more suitable for wigglers. The higher betatron tunes lead to a larger phase advance between the two kickers, which has to be corrected during injection by shunting current from some quadrupoles. The configuration was optimized within SPEAR hardware limitations and tested for dynamic aperture with the tracking program PATRICIA. After implementation of this scheme, beam was successfully injected and accumulated. The measured emittance of the stored beam was in agreement with calculations. Presently the configuration is being made operational

  20. Simple-to-prepare multipoint field emitter

    Science.gov (United States)

    Sominskii, G. G.; Taradaev, E. P.; Tumareva, T. A.; Mishin, M. V.; Kornishin, S. Yu.

    2015-07-01

    We investigate multitip field emitters prepared by electroerosion treatment of the surface of molybdenum samples. Their characteristics are determined for operation with a protecting activated fullerene coating. Our experiments indicate that such cathodes are promising for high-voltage electron devices operating in technical vacuum.

  1. Emittance measuring system on the UNILAC

    International Nuclear Information System (INIS)

    Ehrich, A.; Glatz, J.; Strahl, P.

    A description is given of one of the beam emittance measuring systems designed for the UNILAC at GSI. The measuring system mechanics and the detector system are detailed, and the associated electronics are discussed. Computer programming and data processing and evaluation are described

  2. Emittance growth rates for displaced beams

    International Nuclear Information System (INIS)

    Anderson, O.A.

    1993-05-01

    Emittance growth rates have been previously analyzed for nonuniform beams in linear channels and for initially uniform mismatched beams in nonlinear channels. These studies were for centered beams. Additional emittance growth can arise in cases where the beam is initially displaced. The purpose of this study is to obtain growth rates for displaced beams. This work differs from studies involving random displacement of electrodes. Our analysis assumes instead that the focusing system is perfectly aligned but that the beam is initially displaced with respect to the equilibrium axis. If the focusing force is slightly nonlinear, we find a gradual transfer of the potential energy of beam displacement into kinetic energy associated with emittance growth. We present explicit results for the emittance growth distance as a function of the nonlinearity of the channel. These results will have practical importance for designers of accelerators and transport systems when setting realistic tolerances for initial beam alignment. These tolerances will depend on the nonlinearity and the length of the system

  3. Aluminum oxide film thickness and emittance

    International Nuclear Information System (INIS)

    Thomas, J.K.; Ondrejcin, R.S.

    1991-11-01

    Aluminum reactor components which are not actively cooled could be subjected to high temperatures due to gamma heating after the core coolant level dropped during the ECS phase of a hypothetical LOCA event. Radiative heat transfer is the dominant heat transfer process in this scenario and therefore the emittance of these components is of interest. Of particular interest are the safety rod thimbles and Mark 60B blanket assemblies; for the K Reactor, these components have been exposed to low temperature (< 55 degrees C) moderator for about a year. The average moderator temperature was assumed to be 30 degrees C. The Al oxide film thickness at this temperature, after one year of exposure, is predicted to be 6.4 μm ± 10%; insensitive to exposure time. Dehydration of the film during the gamma heating accident would result in a film thickness of 6.0 μm ± 11%. Total hemispherical emittance is predicted to be 0.69 at 96 degrees C, decreasing to 0.45 at 600 degrees C. Some phenomena which would tend to yield thicker oxide films in the reactor environment relative to those obtained under experimental conditions were neglected and the predicted film thickness values are therefore conservative. The emittance values predicted for a given film thickness are also conservative. The conservativisms inherent in the predicted emittance are particularly relevant for uncertainty analysis of temperatures generated using these values

  4. Low Cost Constant – Head Drip Irrigation Emitter for Climate ...

    African Journals Online (AJOL)

    Low Cost Constant – Head Drip Irrigation Emitter for Climate Change Adaptation in Nigeria: Engineering Design and Calibration. ... The drip system comprises of abarrel, sub-main line, lateral lines, tubes and emitters, it can irrigate140 crop ...

  5. Hidden supersymmetry and large N

    International Nuclear Information System (INIS)

    Alfaro, J.

    1988-01-01

    In this paper we present a new method to deal with the leading order in the large-N expansion of a quantum field theory. The method uses explicitly the hidden supersymmetry that is present in the path-integral formulation of a stochastic process. In addition to this we derive a new relation that is valid in the leading order of the large-N expansion of the hermitian-matrix model for any spacetime dimension. (orig.)

  6. Test results on two thermionic converters with cermet emitters

    International Nuclear Information System (INIS)

    Saunders, M.; Danielson, L.; Huffman, F.

    1983-01-01

    An emitter made of a directionally solidified Mo-Al 2 O 3 , Cr 2 O 3 eutectic was provided by Eindhoven University of Technology in Eindhoven, The Netherlands. Although the high temperature braze cycle used in bonding this electrode to the emitter substrate destroyed its characteristic needle microstructure, the converter gave good performance. Apparently, chemical species evaporated from the emitter onto the collector provided a low collector work function. The resulting low barrier indices suggest that this surface is a promising emitter

  7. Hidden particle production at the ILC

    International Nuclear Information System (INIS)

    Fujii, Keisuke; Itoh, Hideo; Okada, Nobuchika; Hano, Hitoshi; Yoshioka, Tamaki

    2008-01-01

    In a class of new physics models, the new physics sector is completely or partly hidden, namely, a singlet under the standard model (SM) gauge group. Hidden fields included in such new physics models communicate with the standard model sector through higher-dimensional operators. If a cutoff lies in the TeV range, such hidden fields can be produced at future colliders. We consider a scalar field as an example of the hidden fields. Collider phenomenology on this hidden scalar is similar to that of the SM Higgs boson, but there are several features quite different from those of the Higgs boson. We investigate productions of the hidden scalar at the International Linear Collider (ILC) and study the feasibility of its measurements, in particular, how well the ILC distinguishes the scalar from the Higgs boson, through realistic Monte Carlo simulations.

  8. 2-D emittance equation with acceleration and compression

    International Nuclear Information System (INIS)

    Hahn, K.D.; Smith, L.

    1988-10-01

    Since both acceleration and compression are required for an Inertial Fusion Driver, the understanding of their effect on the beam quality, emittance, is important. This report attempts to generalize the usual emittance formula for the drifting beam to include these effects. The derivation of the 2-D emittance equation is carried out and a comparison with the particle code results is given. The 2-D emittance at a given axial location is reasonable to consider for a long beam, particularly with velocity tilt; transverse emittance averaged over the entire bunch is not a useful quantity. 6 refs., 2 figs., 1 tab

  9. Small horizontal emittance in the TESLA damping ring

    International Nuclear Information System (INIS)

    Decking, W.

    2001-01-01

    The present TESLA damping ring is designed for a normalized horizontal emittance of 8x10 -6 m. γ-γ collisions at the TESLA linear collider will benefit from a further decrease of the horizontal emittance. This paper reviews the processes which limit the horizontal emittance in the damping ring. Preliminary estimates on the smallest horizontal emittance for the present TESLA damping ring design as well as an ultimate limit of the emittance reachable with the TESLA damping ring concept will be given

  10. Hidden measurements, hidden variables and the volume representation of transition probabilities

    OpenAIRE

    Oliynyk, Todd A.

    2005-01-01

    We construct, for any finite dimension $n$, a new hidden measurement model for quantum mechanics based on representing quantum transition probabilities by the volume of regions in projective Hilbert space. For $n=2$ our model is equivalent to the Aerts sphere model and serves as a generalization of it for dimensions $n \\geq 3$. We also show how to construct a hidden variables scheme based on hidden measurements and we discuss how joint distributions arise in our hidden variables scheme and th...

  11. Development of Emittance Analysis Software for Ion Beam Characterization

    International Nuclear Information System (INIS)

    Padilla, M.J.; Liu, Yuan

    2007-01-01

    Transverse beam emittance is a crucial property of charged particle beams that describes their angular and spatial spread. It is a figure of merit frequently used to determine the quality of ion beams, the compatibility of an ion beam with a given beam transport system, and the ability to suppress neighboring isotopes at on-line mass separator facilities. Generally, a high-quality beam is characterized by a small emittance. In order to determine and improve the quality of ion beams used at the Holifield Radioactive Ion Beam Facility (HRIBF) for nuclear physics and nuclear astrophysics research, the emittances of the ion beams are measured at the off-line Ion Source Test Facilities. In this project, emittance analysis software was developed to perform various data processing tasks for noise reduction, to evaluate root-mean-square emittance, Twiss parameters, and area emittance of different beam fractions. The software also provides 2D and 3D graphical views of the emittance data, beam profiles, emittance contours, and RMS. Noise exclusion is essential for accurate determination of beam emittance values. A Self-Consistent, Unbiased Elliptical Exclusion (SCUBEEx) method is employed. Numerical data analysis techniques such as interpolation and nonlinear fitting are also incorporated into the software. The software will provide a simplified, fast tool for comprehensive emittance analysis. The main functions of the software package have been completed. In preliminary tests with experimental emittance data, the analysis results using the software were shown to be accurate

  12. DEVELOPMENT OF EMITTANCE ANALYSIS SOFTWARE FOR ION BEAM CHARACTERIZATION

    Energy Technology Data Exchange (ETDEWEB)

    Padilla, M. J.; Liu, Y.

    2007-01-01

    Transverse beam emittance is a crucial property of charged particle beams that describes their angular and spatial spread. It is a fi gure of merit frequently used to determine the quality of ion beams, the compatibility of an ion beam with a given beam transport system, and the ability to suppress neighboring isotopes at on-line mass separator facilities. Generally a high quality beam is characterized by a small emittance. In order to determine and improve the quality of ion beams used at the Holifi eld Radioactive Ion beam Facility (HRIBF) for nuclear physics and nuclear astrophysics research, the emittances of the ion beams are measured at the off-line Ion Source Test Facilities. In this project, emittance analysis software was developed to perform various data processing tasks for noise reduction, to evaluate root-mean-square emittance, Twiss parameters, and area emittance of different beam fractions. The software also provides 2D and 3D graphical views of the emittance data, beam profi les, emittance contours, and RMS. Noise exclusion is essential for accurate determination of beam emittance values. A Self-Consistent, Unbiased Elliptical Exclusion (SCUBEEx) method is employed. Numerical data analysis techniques such as interpolation and nonlinear fi tting are also incorporated into the software. The software will provide a simplifi ed, fast tool for comprehensive emittance analysis. The main functions of the software package have been completed. In preliminary tests with experimental emittance data, the analysis results using the software were shown to be accurate.

  13. Dissipative hidden sector dark matter

    Science.gov (United States)

    Foot, R.; Vagnozzi, S.

    2015-01-01

    A simple way of explaining dark matter without modifying known Standard Model physics is to require the existence of a hidden (dark) sector, which interacts with the visible one predominantly via gravity. We consider a hidden sector containing two stable particles charged under an unbroken U (1 )' gauge symmetry, hence featuring dissipative interactions. The massless gauge field associated with this symmetry, the dark photon, can interact via kinetic mixing with the ordinary photon. In fact, such an interaction of strength ε ˜10-9 appears to be necessary in order to explain galactic structure. We calculate the effect of this new physics on big bang nucleosynthesis and its contribution to the relativistic energy density at hydrogen recombination. We then examine the process of dark recombination, during which neutral dark states are formed, which is important for large-scale structure formation. Galactic structure is considered next, focusing on spiral and irregular galaxies. For these galaxies we modeled the dark matter halo (at the current epoch) as a dissipative plasma of dark matter particles, where the energy lost due to dissipation is compensated by the energy produced from ordinary supernovae (the core-collapse energy is transferred to the hidden sector via kinetic mixing induced processes in the supernova core). We find that such a dynamical halo model can reproduce several observed features of disk galaxies, including the cored density profile and the Tully-Fisher relation. We also discuss how elliptical and dwarf spheroidal galaxies could fit into this picture. Finally, these analyses are combined to set bounds on the parameter space of our model, which can serve as a guideline for future experimental searches.

  14. Ghost signals in Allison emittance scanners

    International Nuclear Information System (INIS)

    Stockli, Martin P.; Leitner, M.; Moehs, D.P.; Keller, R.; Welton, R.F.

    2004-01-01

    For over 20 years, Allison scanners have been used to measure emittances of low-energy ion beams. We show that scanning large trajectory angles produces ghost signals caused by the sampled beamlet impacting on an electric deflection plate. The ghost signal strength is proportional to the amount of beam entering the scanner. Depending on the ions, and their velocity, the ghost signals can have the opposite or the same polarity as the main beam signals. The ghost signals cause significant errors in the emittance estimates because they appear at large trajectory angles. These ghost signals often go undetected because they partly overlap with the real signals, are mostly below the 1% level, and often hide in the noise. A simple deflection plate modification is shown to reduce the ghost signal strength by over 99%

  15. Computing Eigen-Emittances from Tracking Data

    Energy Technology Data Exchange (ETDEWEB)

    Alexahin, Y. [Fermilab

    2014-09-18

    In a strongly nonlinear system the particle distribution in the phase space may develop long tails which contribution to the covariance (sigma) matrix should be suppressed for a correct estimate of the beam emittance. A method is offered based on Gaussian approximation of the original particle distribution in the phase space (Klimontovich distribution) which leads to an equation for the sigma matrix which provides efficient suppression of the tails and cannot be obtained by introducing weights. This equation is easily solved by iterations in the multi-dimensional case. It is also shown how the eigen-emittances and coupled optics functions can be retrieved from the sigma matrix in a strongly coupled system. Finally, the developed algorithm is applied to 6D ionization cooling of muons in HFOFO channel.

  16. Reducing longitudinal emittance growth in RFQ accelerators

    International Nuclear Information System (INIS)

    Koscielniak, S.

    1994-08-01

    Bunching and capture of a monochromatic beam into an rf bucket inevitably lead to substantial emittance growth through the mechanisms of filamentation and non-adiabatic variation of parameters. We describe a three step strategy for minimizing this growth, based on a clear understanding of the non-linear beam dynamics, and apply to acceleration of heavy ions with Z/A = 1/60 (and initial kinetic energy 60 keV/u) in a radio frequency quadrupole (RFQ) operating at 25 MHz. We also describe a scheme, to further reduce the emittance, based upon the use of an external RFQ-type prebuncher before the main accelerator. The external unit permits the bunching voltage to be reduced, to inject into a moving bucket, and to reduce the structure length. (author). 7 refs., 6 figs

  17. Emittance growth in coast in the SPS

    CERN Document Server

    Alekou, A; Bartosik, H; Calaga, R

    2017-01-01

    The CERN SPS will be used as a test-bed for the LHCprototype crab-cavities, which will be installed and testedin the SPS in 2018. As the time available for experimen-tal beam dynamics studies with the crab cavities installedin the machine will be limited, a very good preparation isrequired in advance. One of the main concerns is the in-duced emittance growth, driven by phase jitter in the crabcavities. In this respect, several machine development (MD)studies were performed during the past years to quantifyand characterize the emittance evolution of proton beamsin coast in the SPS. In these proceedings, the experimentalobservations from past years are summarized and the MDstudies from 2016 are presented. Finally, a proposal for anexperimental program for 2017 is discussed.

  18. Mesoscopic quantum emitters coupled to plasmonic nanostructures

    DEFF Research Database (Denmark)

    Andersen, Mads Lykke

    for the spontaneous emission of mesoscopic quantum emitters is developed. The light-matter interaction is in this model modied beyond the dipole expectancy and found to both suppress and enhance the coupling to plasmonic modes in excellent agreement with our measurements. We demonstrate that this mesoscopic effect......This thesis reports research on quantum dots coupled to dielectric and plasmonic nano-structures by way of nano-structure fabrication, optical measurements, and theoretical modeling. To study light-matter interaction, plasmonic gap waveguides with nanometer dimensions as well as samples for studies...... to allow for e- cient plasmon-based single-photon sources. Theoretical studies of coupling and propagation properties of plasmonic waveguides reveal that a high-refractive index of the medium surrounding the emitter, e.g. nGaAs = 3.5, limits the realizability of ecient plasmon-based single-photon sources...

  19. Ghost Signals In Allison Emittance Scanners

    International Nuclear Information System (INIS)

    Stockli, Martin P.; Leitner, M.; Keller, R.; Moehs, D.P.; Welton, R. F.

    2005-01-01

    For over 20 years, Allison scanners have been used to measure emittances of low-energy ion beams. We show that scanning large trajectory angles produces ghost signals caused by the sampled beamlet impacting on an electric deflection plate. The ghost signal strength is proportional to the amount of beam entering the scanner. Depending on the ions, and their velocity, the ghost signals can have the opposite or the same polarity as the main beam signals. The ghost signals cause significant errors in the emittance estimates because they appear at large trajectory angles. These ghost signals often go undetected because they partly overlap with the real signals, are mostly below the 1% level, and often hide in the noise. A simple deflection plate modification is shown to reduce the ghost signal strength by over 99%

  20. Photonic Crystal Emitters for Thermophotovoltaic Energy Conversion

    International Nuclear Information System (INIS)

    Stelmakh, Veronika; Chan, Walker R; Joannopoulos, John D; Celanovic, Ivan; Ghebrebrhan, Michael; Soljacic, Marin

    2015-01-01

    This paper reports the design, fabrication, and characterization of 2D photonic crystal (PhC) thermal emitters for a millimeter-scale hydrocarbon TPV microgenerator as a possible replacement for batteries in portable microelectronics, robotics, etc. In our TPV system, combustion heats a PhC emitter to incandescence and the resulting radiation is converted by a low-bandgap TPV cell. The PhC tailors the photonic density of states to produce spectrally confined thermal emission that matches the bandgap of the TPV cell, enabling high heat-to-electricity conversion efficiency. The work builds on a previously developed fabrication process to produce a square array of cylindrical cavities in a metal substrate. We will present ongoing incremental improvements in the optical and thermo-mechanical properties, the fabrication process, and the system integration, as recently combined with fabrication using novel materials, such as sputtered coatings, to enable a monolithic system. (paper)

  1. Complementary methods of transverse emittance measurement

    Energy Technology Data Exchange (ETDEWEB)

    Zagel, James; Hu, Martin; Jansson, Andreas; Thurman-Keup, Randy; Yan, Ming-Jen; /Fermilab

    2008-05-01

    Several complementary transverse emittance monitors have been developed and used at the Fermilab accelerator complex. These include Ionization profile Monitors (IPM), Flying Wires, Schottky detectors and a Synchrotron Light Monitor (Synchlite). Mechanical scrapers have also been used for calibration purposes. This paper describes the various measurement devices by examining their basic features, calibration requirements, systematic uncertainties, and applications to collider operation. A comparison of results from different kinds of measurements is also presented.

  2. Modular low-voltage electron emitters

    International Nuclear Information System (INIS)

    Berejka, Anthony J.

    2005-01-01

    Modular, low-voltage electron emitters simplify electron beam (EB) technology for many industrial uses and for research and development. Modular electron emitters are produced in quantity as sealed systems that are evacuated at the factory, eliminating the need for vacuum pumps at the point of use. A plug-out-plug-in method of replacement facilitates servicing. By using an ultra-thin 6-7 μm titanium foil window, solid-state power supplies, an innovative design to extract and spread the beam (enabling systems to be placed adjacent to each other to extend beam width) and touch-screen computer controls, these modular units combine ease of use and electrical transfer efficiency at voltages that can be varied between 80 kV and 150 kV with beam currents up to 40 mA per 25 cm across the beam window. These new devices have been made in three widths: 5 cm, 25 cm, and 40 cm. Details of the beam construction and illustrations of industrial uses will be presented. Traditional uses in the graphic arts and coatings areas have welcomed this modular technology as well as uses for surface sterilization. Being compact and lightweight (∼15 kg/emitter), these modular beams have been configured around complex shapes to achieve three-dimensional surface curing at high production rates

  3. Modular low-voltage electron emitters

    Science.gov (United States)

    Berejka, Anthony J.

    2005-12-01

    Modular, low-voltage electron emitters simplify electron beam (EB) technology for many industrial uses and for research and development. Modular electron emitters are produced in quantity as sealed systems that are evacuated at the factory, eliminating the need for vacuum pumps at the point of use. A plug-out-plug-in method of replacement facilitates servicing. By using an ultra-thin 6-7 μm titanium foil window, solid-state power supplies, an innovative design to extract and spread the beam (enabling systems to be placed adjacent to each other to extend beam width) and touch-screen computer controls, these modular units combine ease of use and electrical transfer efficiency at voltages that can be varied between 80 kV and 150 kV with beam currents up to 40 mA per 25 cm across the beam window. These new devices have been made in three widths: 5 cm, 25 cm, and 40 cm. Details of the beam construction and illustrations of industrial uses will be presented. Traditional uses in the graphic arts and coatings areas have welcomed this modular technology as well as uses for surface sterilization. Being compact and lightweight (∼15 kg/emitter), these modular beams have been configured around complex shapes to achieve three-dimensional surface curing at high production rates.

  4. Modified theoretical minimum emittance lattice for an electron storage ring with extreme-low emittance

    Directory of Open Access Journals (Sweden)

    Yi Jiao

    2011-05-01

    Full Text Available In the continuing efforts to reduce the beam emittance of an electron storage ring composed of theoretical minimum emittance (TME lattice, down to a level of several tens of picometers, nonlinear dynamics grows to be a great challenge to the performance of the storage ring because of the strong sextupoles needed to compensate for its large global natural chomaticities coupled with its small average dispersion function. To help in dealing with the challenge of nonlinear optimization, we propose a novel variation of theoretical minimum emittance (TME lattice, named as “modified-TME” lattice, with minimal emittance about 3 times of the exact theoretical minimum, while with more compact layout, lower phase advance per cell, smaller natural chromaticities, and more relaxed optical functions than that in a TME cell, by using horizontally defocusing quadrupole closer to the dipole or simply combined-function dipole with horizontally defocusing gradient. We present approximate scaling formulas to describe the relationships of the design parameters in a modified-TME cell. The applications of modified-TME lattice in the PEP-X storage ring design are illustrated and the proposed lattice appears a good candidate for synchrotron radiation light source with extremely low emittance.

  5. Hidden inventory and safety considerations

    International Nuclear Information System (INIS)

    Anderson, A.R.; James, R.H.; Morgan, F.

    1976-01-01

    Preliminary results are described of the evaluation of residual plutonium in a process line used for the production of experimental fast reactor fuel. Initial attention has been focussed on a selection of work boxes used for processing powders and solutions. Amounts of material measured as ''hidden inventory'' are generally less than 0.1 percent of throughput but in one box containing very complex equipment the amount was exceptionally about 0.5 percent. The total surface area of the box and the installed equipment appears to be the most significant factor in determining the amount of plutonium held-up as ''hidden inventory,'' representing an average of about 4 x 10 -4 g cm -2 . Present results are based on gamma spectrometer measurements but neutron techniques are being developed to overcome some of the inherent uncertainties in the gamma method. It is suggested that the routine use of sample plates of known surface area would be valuable in monitoring the deposition of plutonium in work boxes

  6. Hidden costs of nuclear power

    International Nuclear Information System (INIS)

    England, R.W.

    1979-01-01

    Mr. England contends that these hidden costs add up to a figure much higher than those that appear in the electric utilities' profit and loss account - costs that are borne by Federal taxpayers, by nuclear industry workers, and by all those people who must share their environment with nuclear facilities. Costs he details are additional deaths and illnesses resulting from exposure to radiation, and the use of tax dollars to clean up the lethal garbage produced by those activities. He asserts that careless handling of uranium ore and mill tailings in past years has apparently resulted in serious public health problems in those mining communities. In another example, Mr. England states that the failure to isolate uranium tailings physically from their environment has probably contributed to an acute leukemia rate in Mesa County, Colorado. He mentions much of the technology development for power reactors being done by the Federal government, not by private reactor manufacturers - thus, again, hidden costs that do not show up in electric bills of customers. The back end of the nuclear fuel cycle as a place for Federally subsidized research and development is discussed briefly. 1 figure, 2 tables

  7. The Hidden Reason Behind Children's Misbehavior.

    Science.gov (United States)

    Nystul, Michael S.

    1986-01-01

    Discusses hidden reason theory based on the assumptions that: (1) the nature of people is positive; (2) a child's most basic psychological need is involvement; and (3) a child has four possible choices in life (good somebody, good nobody, bad somebody, or severely mentally ill.) A three step approach for implementing hidden reason theory is…

  8. Hidden neural networks: application to speech recognition

    DEFF Research Database (Denmark)

    Riis, Søren Kamaric

    1998-01-01

    We evaluate the hidden neural network HMM/NN hybrid on two speech recognition benchmark tasks; (1) task independent isolated word recognition on the Phonebook database, and (2) recognition of broad phoneme classes in continuous speech from the TIMIT database. It is shown how hidden neural networks...

  9. Insight: Exploring Hidden Roles in Collaborative Play

    Directory of Open Access Journals (Sweden)

    Tricia Shi

    2015-06-01

    Full Text Available This paper looks into interaction modes between players in co-located, collaborative games. In particular, hidden traitor games, in which one or more players is secretly working against the group mission, has the effect of increasing paranoia and distrust between players, so this paper looks into the opposite of a hidden traitor – a hidden benefactor. Rather than sabotaging the group mission, the hidden benefactor would help the group achieve the end goal while still having a reason to stay hidden. The paper explores what games with such a role can look like and how the role changes player interactions. Finally, the paper addresses the divide between video game and board game interaction modes; hidden roles are not common within video games, but they are of growing prevalence in board games. This fact, combined with the exploration of hidden benefactors, reveals that hidden roles is a mechanic that video games should develop into in order to match board games’ complexity of player interaction modes.

  10. Hidden variables and locality in quantum theory

    International Nuclear Information System (INIS)

    Shiva, Vandana.

    1978-12-01

    The status of hidden variables in quantum theory has been debated since the 1920s. The author examines the no-hidden-variable theories of von Neumann, Kochen, Specker and Bell, and finds that they all share one basic assumption: averaging over the hidden variables should reproduce the quantum mechanical probabilities. Von Neumann also makes a linearity assumption, Kochen and Specker require the preservation of certain functional relations between magnitudes, and Bell proposes a locality condition. It has been assumed that the extrastatistical requirements are needed to serve as criteria of success for the introduction of hidden variables because the statistical condition is trivially satisfied, and that Bell's result is based on a locality condition that is physically motivated. The author shows that the requirement of weak locality, which is not physically motivated, is enough to give Bell's result. The proof of Bell's inequality works equally well for any pair of commuting magnitudes satisfying a condition called the degeneracy principle. None of the no-hidden-variable proofs apply to a class of hidden variable theories that are not phase-space reconstructions of quantum mechanics. The author discusses one of these theories, the Bohm-Bub theory, and finds that hidden variable theories that re all the quantum statistics, for single and sequential measurements, must introduce a randomization process for the hidden variables after each measurement. The philosophical significance of this theory lies in the role it can play in solving the conceptual puzzles posed by quantum theory

  11. Hidden supersymmetry and Fermion number fractionalization

    International Nuclear Information System (INIS)

    Akhoury, R.

    1985-01-01

    This paper discusses how a hidden supersymmetry of the underlying field theories can be used to interpret and to calculate fermion number fractionalization in different dimensions. This is made possible by relating it to a corresponding Witten index of the hidden supersymmetry. The closely related anomalies in odd dimensions are also discussed

  12. Helioscope bounds on hidden sector photons

    International Nuclear Information System (INIS)

    Redondo, J.

    2008-01-01

    The flux of hypothetical ''hidden photons'' from the Sun is computed under the assumption that they interact with normal matter only through kinetic mixing with the ordinary standard model photon. Requiring that the exotic luminosity is smaller than the standard photon luminosity provides limits for the mixing parameter down to χ -14 , depending on the hidden photon mass. Furthermore, it is pointed point out that helioscopes looking for solar axions are also sensitive to hidden photons. The recent results of the CAST collaboration are used to further constrain the mixing parameter χ at low masses (m γ' <1 eV) where the luminosity bound is weaker. In this regime the solar hidden photon ux has a sizable contribution of longitudinally polarized hidden photons of low energy which are invisible for current helioscopes. (orig.)

  13. High brightness fiber laser pump sources based on single emitters and multiple single emitters

    Science.gov (United States)

    Scheller, Torsten; Wagner, Lars; Wolf, Jürgen; Bonati, Guido; Dörfel, Falk; Gabler, Thomas

    2008-02-01

    Driven by the potential of the fiber laser market, the development of high brightness pump sources has been pushed during the last years. The main approaches to reach the targets of this market had been the direct coupling of single emitters (SE) on the one hand and the beam shaping of bars and stacks on the other hand, which often causes higher cost per watt. Meanwhile the power of single emitters with 100μm emitter size for direct coupling increased dramatically, which also pushed a new generation of wide stripe emitters or multi emitters (ME) of up to 1000μm emitter size respectively "minibars" with apertures of 3 to 5mm. The advantage of this emitter type compared to traditional bars is it's scalability to power levels of 40W to 60W combined with a small aperture which gives advantages when coupling into a fiber. We show concepts using this multiple single emitters for fiber coupled systems of 25W up to 40W out of a 100μm fiber NA 0.22 with a reasonable optical efficiency. Taking into account a further efficiency optimization and an increase in power of these devices in the near future, the EUR/W ratio pushed by the fiber laser manufacturer will further decrease. Results will be shown as well for higher power pump sources. Additional state of the art tapered fiber bundles for photonic crystal fibers are used to combine 7 (19) pump sources to output powers of 100W (370W) out of a 130μm (250μm) fiber NA 0.6 with nominal 20W per port. Improving those TFB's in the near future and utilizing 40W per pump leg, an output power of even 750W out of 250μm fiber NA 0.6 will be possible. Combined Counter- and Co-Propagated pumping of the fiber will then lead to the first 1kW fiber laser oscillator.

  14. Hidden scale invariance of metals

    DEFF Research Database (Denmark)

    Hummel, Felix; Kresse, Georg; Dyre, Jeppe C.

    2015-01-01

    Density functional theory (DFT) calculations of 58 liquid elements at their triple point show that most metals exhibit near proportionality between the thermal fluctuations of the virial and the potential energy in the isochoric ensemble. This demonstrates a general “hidden” scale invariance...... of metals making the condensed part of the thermodynamic phase diagram effectively one dimensional with respect to structure and dynamics. DFT computed density scaling exponents, related to the Grüneisen parameter, are in good agreement with experimental values for the 16 elements where reliable data were...... available. Hidden scale invariance is demonstrated in detail for magnesium by showing invariance of structure and dynamics. Computed melting curves of period three metals follow curves with invariance (isomorphs). The experimental structure factor of magnesium is predicted by assuming scale invariant...

  15. Hidden Valley Search at ATLAS

    CERN Document Server

    Verducci, M

    2011-01-01

    A number of extensions of the Standard Model result in neutral and weakly-coupled particles that decay to multi hadrons or multi leptons with macroscopic decay lengths. These particles with decay paths that can be comparable with ATLAS detector dimensions represent, from an experimental point of view, a challenge both for the trigger and for the reconstruction capabilities of the ATLAS detector. We will present a set of signature driven triggers for the ATLAS detector that target such displaced decays and evaluate their performances for some benchmark models and describe analysis strategies and limits on the production of such long-lived particles. A first estimation of the Hidden Valley trigger rates has been evaluated with 6 pb-1 of data collected at ATLAS during the data taking of 2010.

  16. Criteria for emittance compensation in high-brightness photoinjectors

    Directory of Open Access Journals (Sweden)

    Chun-xi Wang

    2007-10-01

    Full Text Available A critical process in high-brightness photoinjectors is emittance compensation, which brings under control the correlated transverse emittance growth due to the linear space-charge force. Although emittance compensation has been used and studied for almost two decades, the exact criteria to achieve emittance compensation is not as clear as it should be. In this paper, a perturbative analysis of slice envelopes and emittance evolution close to any reference envelope is developed, via which space-charge and chromatic effects are investigated. A new criterion for emittance compensation is found, which is complementary to the well-known matching condition for the invariant envelope and agrees very well with simulations.

  17. Quantum efficiency and thermal emittance of metal photocathodes

    Directory of Open Access Journals (Sweden)

    David H. Dowell

    2009-07-01

    Full Text Available Modern electron beams have demonstrated the brilliance needed to drive free electron lasers at x-ray wavelengths with major advances occurring since the invention of the photocathode gun and the realization of emittance compensation. These state-of-the-art electron beams are now becoming limited by the intrinsic thermal emittance of the cathode. In both dc and rf photocathode guns details of the cathode emission physics strongly influence the quantum efficiency and the thermal emittance. Therefore improving cathode performance is essential to increasing the brightness of beams. It is especially important to understand the fundamentals of cathode quantum efficiency and thermal emittance. This paper investigates the relationship between the quantum efficiency and the thermal emittance for metal cathodes using the Fermi-Dirac model for the electron distribution. We use a consistent theory to derive the quantum efficiency and thermal emittance, and compare our results to those of others.

  18. The Quantum Efficiency and Thermal Emittance of Metal Photocathodes

    International Nuclear Information System (INIS)

    Dowell, D.

    2009-01-01

    Modern electron beams have demonstrated the brilliance needed to drive free electron lasers at x-ray wavelengths, with the principle improvements occurring since the invention of the photocathode gun. The state-of-the-art normalized emittance electron beams are now becoming limited by the thermal emittance of the cathode. In both DC and RF photocathode guns, details of the cathode emission physics strongly influence the quantum efficiency and the thermal emittance. Therefore improving cathode performance is essential to increasing the brightness of beams. It is especially important to understand the fundamentals of cathode quantum efficiency and thermal emittance. This paper investigates the relationship between the quantum efficiency and the thermal emittance of metal cathodes using the Fermi-Dirac model for the electron distribution. We derive the thermal emittance and its relationship to the quantum efficiency, and compare our results to those of others

  19. Dielectric optical antenna thermal emitters and metamaterials

    Science.gov (United States)

    Schuller, Jonathan Aaron

    Optical antennas are critical components in nanophotonics research due to their unparalleled ability to concentrate electromagnetic energy into nanoscale volumes. Researchers typically construct such antennas from wavelength-size metallic structures. However, recent research has begun to exploit the scattering resonances of high-permittivity particles to realize all-dielectric optical antennas, emitters, and metamaterials. In this thesis, we experimentally and theoretically characterize the resonant modes of subwavelength rod-shaped dielectric particles and demonstrate their use in negative index metamaterials and novel infrared light emitters. At mid-infrared frequencies, Silicon Carbide (SiC) is an ideal system for studying the behavior of dielectric optical antennas. At frequencies below the TO phonon resonance, SiC behaves like a dielectric with very large refractive index. Using infrared spectroscopy and analytical Mie calculations we show that individual rod-shaped SiC particles exhibit a multitude of resonant modes. Detailed investigations of these SiC optical antennas reveal a wealth of new physics and applications. We discuss the distinct electromagnetic field profile for each mode, and demonstrate that two of the dielectric-type Mie resonances can be combined in a particle array to form a negative index metamaterial. We further show that these particles can serve as "broadcasting" antennas. Using a custom-built thermal emission microscope we collect emissivity spectra from single SiC particles at elevated temperatures, highlighting their use as subwavelength resonant light emitters. Finally, we derive and verify a variety of general analytical results applicable to all cylindrical dielectric antennas.

  20. Dielectric Optical Antenna Emitters and Metamaterials

    Science.gov (United States)

    Schuller, Jon

    2009-03-01

    Optical antennas are critical components in nanophotonics research due to their unparalleled ability to concentrate electromagnetic energy into nanoscale volumes. Researchers typically construct such antennas from wavelength-size metallic structures. However, recent research has begun to exploit the scattering resonances of high-permittivity particles to realize all-dielectric optical antennas, emitters, and metamaterials. In this talk, we experimentally and theoretically characterize the resonant modes of subwavelength rod-shaped dielectric particles and demonstrate their use in negative index metamaterials and novel infrared light emitters. At mid-infrared frequencies, Silicon Carbide (SiC) is an ideal system for studying the behavior of dielectric optical antennas. At frequencies below the TO phonon resonance, SiC behaves like a dielectric with very large refractive index. Using infrared spectroscopy and analytical Mie calculations we show that individual rod-shaped SiC particles exhibit a multitude of resonant modes. Detailed investigations of these SiC optical antennas reveal a wealth of new physics and applications. We discuss the distinct electromagnetic field profile for each mode, and demonstrate that two of the dielectric-type Mie resonances can be combined in a particle array to form a negative index metamaterial [1]. We further show that these particles can serve as ``broadcasting'' antennas. Using a custom-built thermal emission microscope we collect emissivity spectra from single SiC particles at elevated temperatures, highlighting their use as subwavelength resonant light emitters. Finally, we derive and verify a variety of general analytical results applicable to all cylindrical dielectric antennas and discuss extensions of the demonstrated concepts to different materials systems and frequency regimes. [1] J.A. Schuller, et al., Phys. Rev. Lett. 99, 107401 (2007)

  1. Investigations on cermet electrodes for thermionic emitters

    International Nuclear Information System (INIS)

    Schmidt, D.; Nazare, S.

    1975-01-01

    Unstable Ba 2 CaWO 6 -W with their own supply of Ba, as well as stable UO 2 -Mo-emitter cermets that have to be operated with an external Ba-source, have been prepared by axial hot pressing. The relevant properties of these cermets such as electrical resistivity and thermal expansion are reported and compared with theoretical predictions. The electron emission of these materials is discussed on the basis of the surface films formed. It provides the basis for optimising the behavior of these materials

  2. Multi-channel polarized thermal emitter

    Science.gov (United States)

    Lee, Jae-Hwang; Ho, Kai-Ming; Constant, Kristen P

    2013-07-16

    A multi-channel polarized thermal emitter (PTE) is presented. The multi-channel PTE can emit polarized thermal radiation without using a polarizer at normal emergence. The multi-channel PTE consists of two layers of metallic gratings on a monolithic and homogeneous metallic plate. It can be fabricated by a low-cost soft lithography technique called two-polymer microtransfer molding. The spectral positions of the mid-infrared (MIR) radiation peaks can be tuned by changing the periodicity of the gratings and the spectral separation between peaks are tuned by changing the mutual angle between the orientations of the two gratings.

  3. High efficiency quasi-monochromatic infrared emitter

    Energy Technology Data Exchange (ETDEWEB)

    Brucoli, Giovanni; Besbes, Mondher; Benisty, Henri, E-mail: henri.benisty@institutoptique.fr; Greffet, Jean-Jacques [Laboratoire Charles Fabry, UMR 8501, Institut d’Optique, CNRS, Université Paris-Sud 11, 2, Avenue Augustin Fresnel, 91127 Palaiseau Cedex (France); Bouchon, Patrick; Haïdar, Riad [Office National d’Études et de Recherches Aérospatiales, Chemin de la Hunière, 91761 Palaiseau (France)

    2014-02-24

    Incandescent radiation sources are widely used as mid-infrared emitters owing to the lack of alternative for compact and low cost sources. A drawback of miniature hot systems such as membranes is their low efficiency, e.g., for battery powered systems. For targeted narrow-band applications such as gas spectroscopy, the efficiency is even lower. In this paper, we introduce design rules valid for very generic membranes demonstrating that their energy efficiency for use as incandescent infrared sources can be increased by two orders of magnitude.

  4. Longitudinal emittance measurement at the ATS

    International Nuclear Information System (INIS)

    Cottingame, W.B.; Cortez, J.H.; Higgins, W.W.; Sander, O.R.; Sandoval, D.P.

    1986-01-01

    With increasing brightness, beam diagnostic techniques requiring interception of the beam become impractical. For H - particle beams, solutions for this problem based on the phenomenon of photodissociation are now being investigated at the Los Alamos National Laboratory accelerator test stand (ATS). A laser can be used to selectively neutralize portions of the beam than can be characterized after the charged particles have been swept away. We have used this technique for measuring longitudinal emittance at the output of the ATS radio-frequency quadrupole

  5. Emittance growth from transient coherent synchrotron radiation

    International Nuclear Information System (INIS)

    Bohn, C.L.; Li, R.; Bisognano, J.J.

    1996-01-01

    If the energies of individual particles in a bunch change as the bunch traverses a bending system, even if it is achromatic, betatron oscillations can be excited. Consequently, the transverse emittance of the bunch will grow as it moves downstream. Short bunches may be particularly susceptible to emission of coherent synchrotron radiation which can act back on the particles to change their energies and trajectories. Because a bend spans a well-defined length and angle, the bunch-excited wakefield and its effect back on the bunch are inherently transient. We outline a recently developed theory of this effect and apply it to example bending systems

  6. Tolerances for the vertical emittance in damping rings

    International Nuclear Information System (INIS)

    Raubenheimer, T.O.

    1991-11-01

    Future damping rings for linear colliders will need to have very small vertical emittances. In the limit of low beam current, the vertical emittance is primarily determined by the vertical dispersion and the betatron coupling. In this paper, the contributions to these effects from random misalignments are calculated and tolerances are derived to limit the vertical emittance with a 95% confidence level. 10 refs., 5 figs

  7. Emittance calculations for the Stanford Linear Collider injector

    International Nuclear Information System (INIS)

    Sheppard, J.C.; Clendenin, J.E.; Helm, R.H.; Lee, M.J.; Miller, R.H.; Blocker, C.A.

    1983-03-01

    A series of measurements have been performed to determine the emittance of the high intensity, single bunch beam that is to be injected into the Stanford Linear Collider. On-line computer programs were used to control the Linac for the purpose of data acquisition and to fit the data to a model in order to deduce the beam emittance. This paper will describe the method of emittance calculation and present some of the measurement results

  8. Measurement of emittance of metal interface in molten salt

    International Nuclear Information System (INIS)

    Araki, N.; Makino, A.; Nakamura, Y.

    1995-01-01

    A new technique for measuring the total normal emittance of a metal in a semi-transparent liquid has been proposed and this technique has been applied to measure the emittance of stainless steel (SUS304), nickel, and gold in molten potassium nitrate KNO 3 . These emittance data are indispensable to analyzing the radiative heat transfer between a metal and a semitransparent liquid, such as a molten salt

  9. Transverse beam emittance optimization for the injection into BESSY II

    Energy Technology Data Exchange (ETDEWEB)

    Kramer, Felix [Helmholtz Zentrum Berlin, Institut Beschleunigerphysik (Germany); Humboldt-Universitaet zu Berlin, Institut fuer Physik (Germany)

    2016-07-01

    For top up injection into the storage ring BESSY II an average injection efficiency of at least 90% is required. In low alpha mode the injection efficiency does not meet the requirements. Future BESSY II features will include shorter bunches in the storage ring (VSR) and user transparent injection with a non linear kicker. These will raise the demands on the quality of the injected beam even further. This work investigates the development of transverse emittance over the acceleration cycle in the synchrotron and the possibility of transverse emittance exchange by a sequence of skew quadrupoles in the transfer line. Results of emittance measurements and emittance exchange simulations will be given.

  10. Emittance Growth during Bunch Compression in the CTF-II

    Energy Technology Data Exchange (ETDEWEB)

    Raubenheimer, Tor O

    1999-02-26

    Measurements of the beam emittance during bunch compression in the CLIC Test Facility (CTF-II) are described. The measurements were made with different beam charges and different energy correlations versus the bunch compressor settings which were varied from no compression through the point of full compression and to over-compression. Significant increases in the beam emittance were observed with the maximum emittance occurring near the point of full (maximal) compression. Finally, evaluation of possible emittance dilution mechanisms indicate that coherent synchrotron radiation was the most likely cause.

  11. A survey of hidden-variables theories

    CERN Document Server

    Belinfante, F J

    1973-01-01

    A Survey of Hidden-Variables Theories is a three-part book on the hidden-variable theories, referred in this book as """"theories of the first kind"""". Part I reviews the motives in developing different types of hidden-variables theories. The quest for determinism led to theories of the first kind; the quest for theories that look like causal theories when applied to spatially separated systems that interacted in the past led to theories of the second kind. Parts II and III further describe the theories of the first kind and second kind, respectively. This book is written to make the literat

  12. A classification of hidden-variable properties

    International Nuclear Information System (INIS)

    Brandenburger, Adam; Yanofsky, Noson

    2008-01-01

    Hidden variables are extra components added to try to banish counterintuitive features of quantum mechanics. We start with a quantum-mechanical model and describe various properties that can be asked of a hidden-variable model. We present six such properties and a Venn diagram of how they are related. With two existence theorems and three no-go theorems (EPR, Bell and Kochen-Specker), we show which properties of empirically equivalent hidden-variable models are possible and which are not. Formally, our treatment relies only on classical probability models, and physical phenomena are used only to motivate which models to choose

  13. Dosimetry of internal emitters - quo vadis?

    International Nuclear Information System (INIS)

    Reddy, A.R.; Nagaratnam, A.; Jain, S.C.; Gupta, M.M.; Mehta, S.C.

    1999-01-01

    The dosimetry of internally administered radiopharmaceuticals in nuclear medicine procedures using MIRD formalisms and dosimetry in the case of intakes of radionuclides and ICRP methodology for the purpose of radiological protection are well established working practices. It should, however, be remembered that dose or dose coefficients calculated refer to a reference individual, defined in terms of a mathematical phantom established on the basis of certain biokinetic reference parameters. The reference individual represents a typical caucasian adult of West Europe or North American origin. Recently, some attempts have been made to define a Reference Asian and a Reference Indian individual and to assess the effects of anatomical differences and changes in the biokinetics of radiopharmaceuticals and other radionuclides in these different reference individuals on the estimation of dose and dose coefficients in relation to the intake of internal radionuclides. The assessment of doses to the embryo/fetus due to intake of radionuclides by pregnant women, local dose estimates, microdosimetry, radiobiology and radiation protection aspects relating to Auger electron emitters represent other areas of active research in the area of dosimetry of internal emitters. The present review summarises these different aspects of work. (orig.) [de

  14. Barium depletion in hollow cathode emitters

    International Nuclear Information System (INIS)

    Polk, James E.; Mikellides, Ioannis G.; Katz, Ira; Capece, Angela M.

    2016-01-01

    Dispenser hollow cathodes rely on a consumable supply of Ba released by BaO-CaO-Al 2 O 3 source material in the pores of a tungsten matrix to maintain a low work function surface. The examination of cathode emitters from long duration tests shows deposits of tungsten at the downstream end that appear to block the flow of Ba from the interior. In addition, a numerical model of Ba transport in the cathode plasma indicates that the Ba partial pressure in the insert may exceed the equilibrium vapor pressure of the dominant Ba-producing reaction, and it was postulated previously that this would suppress Ba loss in the upstream part of the emitter. New measurements of the Ba depletion depth from a cathode insert operated for 8200 h reveal that Ba loss is confined to a narrow region near the downstream end, confirming this hypothesis. The Ba transport model was modified to predict the depletion depth with time. A comparison of the calculated and measured depletion depths gives excellent qualitative agreement, and quantitative agreement was obtained assuming an insert temperature 70 °C lower than measured beginning-of-life values

  15. Emittance growth of bunched beams in bends

    International Nuclear Information System (INIS)

    Carlsten, B.E.; Raubenheimer, T.O.

    1995-01-01

    Talman [Phys. Rev. Lett. 56, 1429 (1986)] has proposed a novel relativistic effect that occurs when a charged particle beam is bent in the magnetic field from an external dipole. The consequence of this effect is that the space-charge forces from the particles do not exhibit the usual inverse-square energy dependence and some part of them are, in fact, independent of energy. This led to speculation that this effect could introduce significant emittance growth for a bending electron beam. Subsequently, it was shown that this effect's influence on the beam's transverse motion is canceled for a dc beam by a potential depression within the beam (to first order in the beam radius divided by the bend radius). In this paper, we extend the analysis to include short bunch lengths (as compared to the beam pipe dimensions) and find that there is no longer the cancellation for forces both transverse to and in the direction of motion. We provide an estimate for the emittance growth as a function of bend angle, beam radius, and current, and for magnetic compression of an electron bunch

  16. Emittance measurements from the LLUMC proton accelerator

    International Nuclear Information System (INIS)

    Coutrakon, G.; Gillespie, G.H.; Hubbard, J.; Sanders, E.

    2005-01-01

    A new method of calculating beam emittances at the extraction point of a particle accelerator is presented. The technique uses the optimization programs NPSOL and MINOS developed at Stanford University in order to determine the initial values of beam size, divergence and correlation parameters (i.e. beam sigma matrix, σ ij ) that best fit measured beam parameters. These σ ij elements are then used to compute the Twiss parameters α, β, and the phase space area, ε, of the beam at the extraction point. Beam size measurements in X and Y throughout the transport line were input to the optimizer along with the magnetic elements of bends, quads, and drifts. The σ ij parameters were optimized at the accelerator's extraction point by finding the best agreement between these measured beam sizes and those predicted by TRANSPORT. This expands upon a previous study in which a 'trial and error' technique was used instead of the optimizer software, and which yielded similar results. The Particle Beam Optics Laboratory (PBO Lab TM ) program used for this paper integrates particle beam optics and other codes into a single intuitive graphically-based computing environment. This new software provides a seamless interface between the NPSOL and MINOS optimizer and TRANSPORT calculations. The results of these emittance searches are presented here for the eight clinical energies between 70 and 250 MeV currently being used at LLUMC

  17. Narrowband infrared emitters for combat ID

    Science.gov (United States)

    Pralle, Martin U.; Puscasu, Irina; Daly, James; Fallon, Keith; Loges, Peter; Greenwald, Anton; Johnson, Edward

    2007-04-01

    There is a strong desire to create narrowband infrared light sources as personnel beacons for application in infrared Identify Friend or Foe (IFF) systems. This demand has augmented dramatically in recent years with the reports of friendly fire casualties in Afghanistan and Iraq. ICx Photonics' photonic crystal enhanced TM (PCE TM) infrared emitter technology affords the possibility of creating narrowband IR light sources tuned to specific IR wavebands (near 1-2 microns, mid 3-5 microns, and long 8-12 microns) making it the ideal solution for infrared IFF. This technology is based on a metal coated 2D photonic crystal of air holes in a silicon substrate. Upon thermal excitation the photonic crystal modifies the emitted yielding narrowband IR light with center wavelength commensurate with the periodicity of the lattice. We have integrated this technology with microhotplate MEMS devices to yield 15mW IR light sources in the 3-5 micron waveband with wall plug efficiencies in excess of 10%, 2 orders of magnitude more efficient that conventional IR LEDs. We have further extended this technology into the LWIR with a light source that produces 9 mW of 8-12 micron light at an efficiency of 8%. Viewing distances >500 meters were observed with fielded camera technologies, ideal for ground to ground troop identification. When grouped into an emitter panel, the viewing distances were extended to 5 miles, ideal for ground to air identification.

  18. Compact Rare Earth Emitter Hollow Cathode

    Science.gov (United States)

    Watkins, Ronald; Goebel, Dan; Hofer, Richard

    2010-01-01

    A compact, high-current, hollow cathode utilizing a lanthanum hexaboride (LaB6) thermionic electron emitter has been developed for use with high-power Hall thrusters and ion thrusters. LaB6 cathodes are being investigated due to their long life, high current capabilities, and less stringent xenon purity and handling requirements compared to conventional barium oxide (BaO) dispenser cathodes. The new cathode features a much smaller diameter than previously developed versions that permit it to be mounted on axis of a Hall thruster ( internally mounted ), as opposed to the conventional side-mount position external to the outer magnetic circuit ("externally mounted"). The cathode has also been reconfigured to be capable of surviving vibrational loads during launch and is designed to solve the significant heater and materials compatibility problems associated with the use of this emitter material. This has been accomplished in a compact design with the capability of high-emission current (10 to 60 A). The compact, high-current design has a keeper diameter that allows the cathode to be mounted on the centerline of a 6- kW Hall thruster, inside the iron core of the inner electromagnetic coil. Although designed for electric propulsion thrusters in spacecraft station- keeping, orbit transfer, and interplanetary applications, the LaB6 cathodes are applicable to the plasma processing industry in applications such as optical coatings and semiconductor processing where reactive gases are used. Where current electrical propulsion thrusters with BaO emitters have limited life and need extremely clean propellant feed systems at a significant cost, these LaB6 cathodes can run on the crudest-grade xenon propellant available without impact. Moreover, in a laboratory environment, LaB6 cathodes reduce testing costs because they do not require extended conditioning periods under hard vacuum. Alternative rare earth emitters, such as cerium hexaboride (CeB6) can be used in this

  19. UV Photography Shows Hidden Sun Damage

    Science.gov (United States)

    ... mcat1=de12", ]; for (var c = 0; c UV photography shows hidden sun damage A UV photograph gives ... developing skin cancer and prematurely aged skin. Normal photography UV photography 18 months of age: This boy's ...

  20. Coding with partially hidden Markov models

    DEFF Research Database (Denmark)

    Forchhammer, Søren; Rissanen, J.

    1995-01-01

    Partially hidden Markov models (PHMM) are introduced. They are a variation of the hidden Markov models (HMM) combining the power of explicit conditioning on past observations and the power of using hidden states. (P)HMM may be combined with arithmetic coding for lossless data compression. A general...... 2-part coding scheme for given model order but unknown parameters based on PHMM is presented. A forward-backward reestimation of parameters with a redefined backward variable is given for these models and used for estimating the unknown parameters. Proof of convergence of this reestimation is given....... The PHMM structure and the conditions of the convergence proof allows for application of the PHMM to image coding. Relations between the PHMM and hidden Markov models (HMM) are treated. Results of coding bi-level images with the PHMM coding scheme is given. The results indicate that the PHMM can adapt...

  1. Hidden costs, value lost: uninsurance in America

    National Research Council Canada - National Science Library

    Committee on the Consequences of Uninsurance

    2003-01-01

    Hidden Cost, Value Lost , the fifth of a series of six books on the consequences of uninsurance in the United States, illustrates some of the economic and social losses to the country of maintaining...

  2. The hidden epidemic: confronting sexually transmitted diseases

    National Research Council Canada - National Science Library

    Eng, Thomas R; Butler, William T

    .... In addition, STDs increase the risk of HIV transmission. The Hidden Epidemic examines the scope of sexually transmitted infections in the United States and provides a critical assessment of the nation's response to this public health crisis...

  3. Perspective: Disclosing hidden sources of funding.

    Science.gov (United States)

    Resnik, David B

    2009-09-01

    In this article, the author discusses ethical and policy issues related to the disclosure of hidden sources of funding in research. The author argues that authors have an ethical obligation to disclose hidden sources of funding and that journals should adopt policies to enforce this obligation. Journal policies should require disclosure of hidden sources of funding that authors know about and that have a direct relation to their research. To stimulate this discussion, the author describes a recent case: investigators who conducted a lung cancer screening study had received funding from a private foundation that was supported by a tobacco company, but they did not disclose this relationship to the journal. Investigators and journal editors must be prepared to deal with these issues in a manner that promotes honesty, transparency, fairness, and accountability in research. The development of well-defined, reasonable policies pertaining to hidden sources of funding can be a step in this direction.

  4. Petro Rents, Political Institutions, and Hidden Wealth

    DEFF Research Database (Denmark)

    Andersen, Jørgen Juel; Johannesen, Niels; Lassen, David Dreyer

    2017-01-01

    Do political institutions limit rent seeking by politicians? We study the transformation of petroleum rents, almost universally under direct government control, into hidden wealth using unique data on bank deposits in offshore financial centers that specialize in secrecy and asset protection. Our...... rulers is diverted to secret accounts. We find very limited evidence that shocks to other types of income not directly controlled by governments affect hidden wealth....

  5. Hidden charm molecules in a finite volume

    International Nuclear Information System (INIS)

    Albaladejo, M.; Hidalgo-Duque, C.; Nieves, J.; Oset, E.

    2014-01-01

    In the present paper we address the interaction of charmed mesons in hidden charm channels in a finite box. We use the interaction from a recent model based on heavy quark spin symmetry that predicts molecules of hidden charm in the infinite volume. The energy levels in the box are generated within this model, and several methods for the analysis of these levels ("inverse problem") are investigated. (author)

  6. Workplace ageism: discovering hidden bias.

    Science.gov (United States)

    Malinen, Sanna; Johnston, Lucy

    2013-01-01

    BACKGROUND/STUDY CONTEXT: Research largely shows no performance differences between older and younger employees, or that older workers even outperform younger employees, yet negative attitudes towards older workers can underpin discrimination. Unfortunately, traditional "explicit" techniques for assessing attitudes (i.e., self-report measures) have serious drawbacks. Therefore, using an approach that is novel to organizational contexts, the authors supplemented explicit with implicit (indirect) measures of attitudes towards older workers, and examined the malleability of both. This research consists of two studies. The authors measured self-report (explicit) attitudes towards older and younger workers with a survey, and implicit attitudes with a reaction-time-based measure of implicit associations. In addition, to test whether attitudes were malleable, the authors measured attitudes before and after a mental imagery intervention, where the authors asked participants in the experimental group to imagine respected and valued older workers from their surroundings. Negative, stable implicit attitudes towards older workers emerged in two studies. Conversely, explicit attitudes showed no age bias and were more susceptible to change intervention, such that attitudes became more positive towards older workers following the experimental manipulation. This research demonstrates the unconscious nature of bias against older workers, and highlights the utility of implicit attitude measures in the context of the workplace. In the current era of aging workforce and skill shortages, implicit measures may be necessary to illuminate hidden workplace ageism.

  7. Hidden slow pulsars in binaries

    Science.gov (United States)

    Tavani, Marco; Brookshaw, Leigh

    1993-01-01

    The recent discovery of the binary containing the slow pulsar PSR 1718-19 orbiting around a low-mass companion star adds new light on the characteristics of binary pulsars. The properties of the radio eclipses of PSR 1718-19 are the most striking observational characteristics of this system. The surface of the companion star produces a mass outflow which leaves only a small 'window' in orbital phase for the detection of PSR 1718-19 around 400 MHz. At this observing frequency, PSR 1718-19 is clearly observable only for about 1 hr out of the total 6.2 hr orbital period. The aim of this Letter is twofold: (1) to model the hydrodynamical behavior of the eclipsing material from the companion star of PSR 1718-19 and (2) to argue that a population of binary slow pulsars might have escaped detection in pulsar surveys carried out at 400 MHz. The possible existence of a population of partially or totally hidden slow pulsars in binaries will have a strong impact on current theories of binary evolution of neutron stars.

  8. Movement of Irrigation Water in Soil from a Surface Emitter

    Directory of Open Access Journals (Sweden)

    Ibrahim Abbas Dawood

    2016-09-01

    Full Text Available rickle irrigation is one of the most conservative irrigation techniques since it implies supplying water directly on the soil through emitters. Emitters dissipate energy of water at the end of the trickle irrigation system and provide water at emission points. The area wetted by an emitter depends upon the discharge of emitter, soil texture, initial soil water content, and soil permeability. The objectives of this research were to predict water distribution profiles through different soils for different conditions and quantify the distribution profiles in terms of main characteristics of soil and emitter. The wetting patterns were simulated at the end of each hour for a total time of application of 12 hrs, emitter discharges of 0.5, 0.75, 1, 2, 3, 4, and 5 lph, and five initial volumetric soil water contents. Simulation of water flow from a single surface emitter was carried out by using the numerically-based software Hydrus-2D/3D, Version 2.04. Two approaches were used in developing formulas to predict the domains of the wetted pattern. In order to verify the results obtained by implementing the software Hydrus-2D/3D a field experiment was conducted to measure the wetted diameter and compare measured values with simulated ones. The results of the research showed that the developed formulas to express the wetted diameter and depth in terms of emitter discharge, time of application, and initial soil water content are very general and can be used with very good accuracy.

  9. Coupling of Quantum Emitters in Nanodiamonds to Plasmonic Structures

    DEFF Research Database (Denmark)

    Kumar, Shailesh

    This PhD thesis describes work towards the enhancement and efficient channeling of photons emitted from a single photon emitter. The emitter used is a defect center, the Nitrogen-Vacancy (NV) center, in diamond. The NV-center has many unique properties, such as long coherence time of its electron...

  10. Emittance growth due to dipole ripple and sextupole

    International Nuclear Information System (INIS)

    Shih, H.J.; Ellison, J.A.; Syphers, M.J.; Newberger, B.S.

    1993-05-01

    Ripple in the power supplies for storage ring magnets can have adverse effects on the circulating beams: orbit distortion and emittance growth from dipole ripple, tune modulation and dynamic aperture reduction from quadrupole ripple, etc. In this paper, we study the effects of ripple in the horizontal bending field of the SSC in the presence of nonlinearity, in particular, the growth in beam emittance

  11. Emittance growth due to negative-mass instability above transition

    International Nuclear Information System (INIS)

    Ng, King-Yuen.

    1994-08-01

    Due to space-charge effect, there is a growth of bunch emittance across transition as a result of negative-mass instability. The models of growth at cutoff frequency and growth from high-frequency Schottky noise are reviewed. The difficulties of performing reliable simulations are discussed. An intuitive self-bunching model for estimating emittance growth is presented

  12. Emittance formula for slits and pepper-pot measurement

    International Nuclear Information System (INIS)

    Zhang, M.

    1996-10-01

    In this note, a rigid formula for slits and pepper-pot emittance measurement is derived. The derivation is based on the one- dimensional slit measurement setup. A mathematical generalization of the slit emittance formula to the pepper-pot measurement is discussed

  13. MEV Energy Electrostatic Accelerator Ion Beam Emittance Measurement

    OpenAIRE

    I.G. Ignat’ev; M.I. Zakharets; S.V. Kolinko; D.P. Shulha

    2014-01-01

    The testing equipment was designed, manufactured and tried out permitting measurements of total current, current profile and emittance of an ion beam extracted from the ion beam. MeV energy electrostatic accelerator ion H + beam emittance measurement results are presented.

  14. Measurement of the transverse emittance for the NSC Pelletron

    International Nuclear Information System (INIS)

    Rodriques, G.; Mandal, A.; Chopra, S.; Joshi, R.; Datta, S.K.; Roy, A.

    1998-01-01

    The knowledge of the emittance (transverse and longitudinal) of the NSC pelletron is essential for matching the acceptance of the LINAC which is to be installed to augment the pelletron beam energies. The transverse emittance of NSC pelletron has been measured by employing a focussing element and a down-stream beam profile monitor

  15. Jamming of Quantum Emitters by Active Coated Nanoparticles

    DEFF Research Database (Denmark)

    Arslanagic, Samel; Ziolkowski, Richard W.

    2013-01-01

    to effectively cloak the emitters to a far-field observer is reported and explained through thorough near- and far-field investigations. This property offers an interesting route toward the jamming of quantum emitters/nanoantennas that might be of potential use, for instance, in biological fluorescence assays...

  16. Low emittance lattices for electron storage rings revisited

    International Nuclear Information System (INIS)

    Trbojevic, D.; Courant, E.

    1994-01-01

    Conditions for the lowest possible emittance of the lattice for electron storage rings are obtained by a simplified analytical approach. Examples of electron storage lattices with minimum emittances are presented. A simple graphical presentation in the normalized dispersion space (Floquet's transformation) is used to illustrate the conditions and results

  17. Evaluations of carbon nanotube field emitters for electron microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Nakahara, Hitoshi, E-mail: nakahara@nagoya-u.jp [Department of Quantum Engineering, Graduate School of Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan); Kusano, Yoshikazu; Kono, Takumi; Saito, Yahachi [Department of Quantum Engineering, Graduate School of Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan)

    2009-11-30

    Brightness of carbon nanotube (CNT) emitters was already reported elsewhere. However, brightness of electron emitter is affected by a virtual source size of the emitter, which strongly depends on electron optical configuration around the emitter. In this work, I-V characteristics and brightness of a CNT emitter are measured under a practical field emission electron gun (e-gun) configuration to investigate availability of CNT for electron microscopy. As a result, it is obtained that an emission area of MWNT is smaller than its tip surface area, and the emission area corresponds to a five-membered-ring with 2nd nearest six-membered-rings on the MWNT cap surface. Reduced brightness of MWNT is measured as at least 2.6x10{sup 9} A/m{sup 2} sr V. It is concluded that even a thick MWNT has enough brightness under a practical e-gun electrode configuration and suitable for electron microscopy.

  18. Evaluations of carbon nanotube field emitters for electron microscopy

    Science.gov (United States)

    Nakahara, Hitoshi; Kusano, Yoshikazu; Kono, Takumi; Saito, Yahachi

    2009-11-01

    Brightness of carbon nanotube (CNT) emitters was already reported elsewhere. However, brightness of electron emitter is affected by a virtual source size of the emitter, which strongly depends on electron optical configuration around the emitter. In this work, I- V characteristics and brightness of a CNT emitter are measured under a practical field emission electron gun (e-gun) configuration to investigate availability of CNT for electron microscopy. As a result, it is obtained that an emission area of MWNT is smaller than its tip surface area, and the emission area corresponds to a five-membered-ring with 2nd nearest six-membered-rings on the MWNT cap surface. Reduced brightness of MWNT is measured as at least 2.6×109 A/m 2 sr V. It is concluded that even a thick MWNT has enough brightness under a practical e-gun electrode configuration and suitable for electron microscopy.

  19. Emittance compensation of CW DC-gun photoinjector

    International Nuclear Information System (INIS)

    Li Peng; Wu Dai; Xu Zhou; Li Ming; Yang Xingfan

    2011-01-01

    Emittance growth induced by space charge effect is very important, especially for CW DC-gun photoinjector. In this work, the linear space charge force and its effect on electron beam transverse emittance are studied, and the principle and properties of emittance compensation by solenoid are analyzed. The CAEP DC-gun photoinjector with a solenoid is also simulated by code Parmela. Simulated results indicate that the normalized transverse emittance of an 80 pC bunch at the 350 keV DC-gun ex-it is 5.14 mm · mrad. And after compensated by a solenoid, it becomes 1.27 mm · mrad. The emittance of beam is well compensated. (authors)

  20. Internal Auger emitters: effects on spermatogenesis and oogenesis in mice

    International Nuclear Information System (INIS)

    Rao, D.V.; Mylavarapu, V.B.; Sastry, K.S.R.; Howell, R.W.

    1988-01-01

    The in vivo biological effects of Auger emitters are investigated using [A] spermatogenesis in mouse testis, and [B] oogenesis in mouse ovary as experimental models. Spermhead survival and induction of abnormal sperm, following intratesticular administration of radiopharmaceuticals, were the end points in Model A. Of interest in Model B is primary oocyte survival after intraperitoneal injection of the radiochemicals. The effectiveness of the Auger emitter is determined relative to its beta emitting companion or external X-rays in the absence of such an analogue. Results reveal pronounced effects of Auger emitters on all end points, not dependent on mode of administration. The efficacy of the Auger emitter is related intimately to its subcellular distribution, which, is governed by the chemical form of the carrier molecule. Conventional dosimetry is inadequate and biophysically meaningful dosimetric approaches are needed to understand in vivo effects of Auger emitters. (author)

  1. Plasma treatment for producing electron emitters

    Science.gov (United States)

    Coates, Don Mayo; Walter, Kevin Carl

    2001-01-01

    Plasma treatment for producing carbonaceous field emission electron emitters is disclosed. A plasma of ions is generated in a closed chamber and used to surround the exposed surface of a carbonaceous material. A voltage is applied to an electrode that is in contact with the carbonaceous material. This voltage has a negative potential relative to a second electrode in the chamber and serves to accelerate the ions toward the carbonaceous material and provide an ion energy sufficient to etch the exposed surface of the carbonaceous material but not sufficient to result in the implantation of the ions within the carbonaceous material. Preferably, the ions used are those of an inert gas or an inert gas with a small amount of added nitrogen.

  2. International Standardization of Pure Beta Emitters

    International Nuclear Information System (INIS)

    Los Arcos, Jose Maria; Rodriguez, Leonor

    2006-01-01

    The paper describes the traditional methods of standardization of Pure Beta Emitters, their principal characteristics, advantage and drawbacks. It does comparisons between two metrological LSC methods: Triple to double coincidence ratio (TDCR) method and the CIEMAT/NIST method and presents the result obtained with several Key Comparisons serving as practical test of both methods. Both of them represent the siferrit of methods of standardization of pure (and mixed decay) radionuclides. ESIR WG of CCRI(II) is to implement a reference exchange system for the permanent equivalence of β, α and electron capture nuclides, similar to traditional SIR gamma. ESIR project is currently testing a new XAN scintillator and operational tests of the whole system at BIPM are expected by the end of 2006 (test restricted to ESIR NMI members)

  3. Gamma emitters in Hong Kong water

    International Nuclear Information System (INIS)

    Shun-Yin, L.; Chung-Keung, M.; Wai-Kwok, N.; Shiu-Chun, A.

    1990-01-01

    Radioactivity in water originates from natural and artificial sources. The development of a nuclear powerplant near Hong Kong necessitates that attention be given to formulating techniques to assess the possible resultant environmental radioactive contamination. Water samples collected from various sites in Hong Kong in the spring and summer of 1987, representing seawater, river water, reservoir water, drinking water, and underground water were studied through gamma-ray spectral analysis. Only gamma emitters in the U238 and Th232 series and K40 were detected. No fission product was detected with specific activity above 0.1 Bq/kg. The data could be the baseline for future monitoring of the radioactivity released from a nuclear plant being built at a 50-km distance from Hong Kong. The variation of detected specific activities may be due to geological differences and the effect of plants. 1 ref., 3 tabs

  4. Beta-delayed proton emitter $^{113}Xe$

    CERN Document Server

    Hagberg, E; Jonson, B; Jørgensen, B; Kugler, E; Mowinckel, T

    1973-01-01

    The ISOLDE facility at the CERN synchrocyclotron has been used for extending the series of beta -delayed proton emitters in xenon to masses lighter than those previously observed (/sup 115,117/Xe). Owing to the rapid decrease of the yields, experiments with solid-state counters were inconclusive, and instead a new and much more sensitive method based on nuclear emulsions was developed. The mass range 111-114 showed one new activity, /sup 113/Xe, with a half-life of 2.8+or-0.2 sec. From measurements of the track lengths for a total of 1130 protons from /sup 113/Xe it was possible to determine the energy spectrum. The results extend the systematics of beta -strength functions in the light xenon isotopes. (19 refs).

  5. Passivated emitters in silicon solar cells

    International Nuclear Information System (INIS)

    King, R.R.; Gruenbaum, P.E.; Sinton, R.A.; Swanson, R.M.

    1990-01-01

    In high-efficiency silicon solar cells with low metal contact coverage fractions and high bulk lifetimes, cell performance is often dominated by recombination in the oxide-passivated diffusions on the cell surface. Measurements of the emitter saturation current density, J o , of oxide-passivated, boron and phosphorus diffusions are presented, and from these measurements, the dependence of surface recombination velocity on dopant concentration was extracted. The lowest observed values of J o which are stable under UV light are given for both boron- and phosphorus-doped, oxide-passivated diffusions, for both textured and untextured surfaces. Contour plots which incorporate the above data have been applied to two types of backside-contact solar cells with large area (37.5 cm 2 ) and one-sun efficiencies up to 22.7%

  6. Radiation dosimetry in radiotherapy with internal emitters

    International Nuclear Information System (INIS)

    Stabin, Michael G.

    1997-01-01

    Full text. Radiation dosimetry radionuclides are currently being labeled to various biological agents used in internal emitter radiotherapy. This talk will review the various technologies and types of radiolabel in current use, with focus on the characterization of the radiation dose to the various important tissues of the body. Methods for obtaining data, developing kinetic models, and calculating radiation doses will be reviewed. Monoclonal antibodies are currently being labeled with both alpha and beta emitting radionuclides in attempts to find effective agents against cancer. Several radionuclides are also being used as bone pain palliation agents. These agents must be studied in clinical trials to determine the biokinetics and radiation dosimetry prior to approval for general use. In such studies, it is important to ensure the collection of the appropriate kinds of data and to collect the data at appropriate time intervals. The uptake and retention of activity in all significant source organs and in excreta be measured periodically (with at least 2 data points phase of uptake or clearance). Then, correct dosimetry methods must be applied - the best available methods for characterizing the radionuclide kinetic and for estimating the dosimetry in the various organs of the body especially the marrow, should be used. Attempts are also under way to develop methods for estimating true patient-specific dosimetry. Cellular and animal studies are also. Valuable in evaluating the efficacy of the agents in shrinking or eliminating tumors; some results from such studies will also be discussed. The estimation of radiation doses to patients in therapy with internal emitters involves several complex phases of analysis. Careful attention to detail and the use of the best available methods are essential to the protection of the patient and a successful outcome

  7. Theory and measurements of emittance preservation in plasma wakefield acceleration

    Energy Technology Data Exchange (ETDEWEB)

    Frederico, Joel

    2016-12-01

    In this dissertation, we examine the preservation and measurement of emittance in the plasma wakefield acceleration blowout regime. Plasma wakefield acceleration (PWFA) is a revolutionary approach to accelerating charged particles that has been demonstrated to have the potential for gradients orders of magnitude greater than traditional approaches. The application of PWFA to the design of a linear collider will make new high energy physics research possible, but the design parameters must first be shown to be competitive with traditional methods. Emittance preservation is necessary in the design of a linear collider in order to maximize luminosity. We examine the conditions necessary for circular symmetry in the PWFA blowout regime, and demonstrate that current proposals meet these bounds. We also present an application of beam lamentation which describes the process of beam parameter and emittance matching. We show that the emittance growth saturates as a consequence of energy spread in the beam. The initial beam parameters determine the amount of emittance growth, while the contribution of energy spread is negligible. We also present a model for ion motion in the presence of a beam that is much more dense than the plasma. By combining the model of ion motion and emittance growth, we find the emittance growth due to ion motion is minimal in the case of marginal ion motion. In addition, we present a simulation that validates the ion motion model, which is under further development to examine emittance growth of both marginal and pronounced ion motion. Finally, we present a proof-of-concept of an emittance measurement which may enable the analysis of emittance preservation in future PWFA experiments.

  8. Comparison between arc drops in ignited thermionic converters with and without ion reflections at the emitter

    International Nuclear Information System (INIS)

    Lundgren, L.

    1985-01-01

    The output performance of two thermionic energy converters is compared. One converter has a normal emitter, working with zero field at the emitter which is close to the optimum working point, and the other has a low work function emitter and ion reflection at the emitter. A simple model of the plasma and the sheaths shows that a converter working with a low work function emitter and ion reflections gives a worse performance than a similar converter with a normal emitter

  9. Cooperative spontaneous emission of nano-emitters with inter-emitter coupling in a leaky microcavity

    International Nuclear Information System (INIS)

    Hong, Suc-Kyoung; Nam, Seog Woo; Yang, Hyung Jin

    2015-01-01

    We study the spontaneous emission from a few two-level nano-emitters placed in a leaky microcavity with Lorentzian spectral density near a critically damped regime. Collective features of the spontaneous emission are investigated by numerical analysis of the excitation dynamics when initially one nano-emitter is totally excited but we do not know which one. The results show that there are three decay rates in the excitation dynamics, two for simple exponential decays and one for damped oscillatory decay. The excitation dynamics is found to critically depend on the regime of the system. It is shown that the spontaneous emission is enhanced or suppressed depending on whether the system is in the underdamped or overdamped regime, respectively. On the other hand, the cooperative spontaneous emission is suppressed in the underdamped while it is enhanced in the overdamped regime. Furthermore, the effect of the direct inter-emitter coupling on the breaking of the cooperativeness of the spontaneous emission is shown as well. (paper)

  10. Probing hidden sector photons through the Higgs window

    International Nuclear Information System (INIS)

    Ahlers, M.

    2008-07-01

    We investigate the possibility that a (light) hidden sector extra photon receives its mass via spontaneous symmetry breaking of a hidden sector Higgs boson, the so-called hidden-Higgs. The hidden-photon can mix with the ordinary photon via a gauge kinetic mixing term. The hidden-Higgs can couple to the Standard Model Higgs via a renormalizable quartic term - sometimes called the Higgs Portal. We discuss the implications of this light hidden-Higgs in the context of laser polarization and light-shining-through-the-wall experiments as well as cosmological, astrophysical, and non-Newtonian force measurements. For hidden-photons receiving their mass from a hidden-Higgs we find in the small mass regime significantly stronger bounds than the bounds on massive hidden sector photons alone. (orig.)

  11. Probing hidden sector photons through the Higgs window

    International Nuclear Information System (INIS)

    Ahlers, Markus; Jaeckel, Joerg; Redondo, Javier; Ringwald, Andreas

    2008-01-01

    We investigate the possibility that a (light) hidden sector extra photon receives its mass via spontaneous symmetry breaking of a hidden sector Higgs boson, the so-called hidden-Higgs. The hidden-photon can mix with the ordinary photon via a gauge kinetic mixing term. The hidden-Higgs can couple to the standard model Higgs via a renormalizable quartic term - sometimes called the Higgs portal. We discuss the implications of this light hidden-Higgs in the context of laser polarization and light-shining-through-the-wall experiments as well as cosmological, astrophysical, and non-Newtonian force measurements. For hidden-photons receiving their mass from a hidden-Higgs, we find in the small mass regime significantly stronger bounds than the bounds on massive hidden sector photons alone.

  12. Emittance variations in current-amplifying ion induction linacs

    International Nuclear Information System (INIS)

    Fessenden, T.J.

    1991-01-01

    Since 1985 the Heavy Ion Fusion Accelerator Research program at the Lawrence Berkeley Laboratory has been studying current amplification and emittance variations in MBE-4, a four-cesium-beam induction linac. This experiment models much of the accelerator physics of the electrostatically focused section of a fusion driver. Four space-charge dominated Cs + beams, initially about one meter in length at currents of 5-10 mA, are focused by electrostatic quadrupoles and accelerated in parallel from approximately 200 keV up to one MeV by 24 accelerating gaps. Final currents of 20-40 mA per beam are typical. Recent experiments with extremely low emittance beams (var-epsilon n =0.03 mm-mRad) have investigated variations of transverse and longitudinal normalized emittance for drifting and accelerating beams. These very strongly tune-depressed beams (σ 0 =72 degree, σ∼6 degree) are difficult to match to the accelerator so as to avoid emittance growth during acceleration. During transport strong emittance fluctuations are observed in good qualitative agreement with simulations. Warmer beams with less tune depression exhibit little to no emittance growth, show smaller emittance fluctuations, and are much easier to match. A summary of findings from the MBE-4 studies is presented

  13. Emittance variations in current-amplifying ion induction linacs

    International Nuclear Information System (INIS)

    Fessenden, T.J.

    1991-04-01

    Since 1985 the Heavy Ion Fusion Accelerator Research program at the Lawrence Berkeley Laboratory has been studying current amplification and emittance variations in MBE-4, a four-cesium-beam induction linac. This experiment models much of the accelerator physics of the electrostatically focused section of a fusion driver. Four space-charge dominated Cs + beams, initially about one meter in length at currents of 5--10 mA, are focused by electrostatic quadrupoles and accelerated in parallel from approximately 200 keV up to one MeV by 24 accelerating gaps. Final currents of 20--40 mA per beam are typical. Recent experiments with extremely low emittance beams (ε n = 0.03 mm-mRad) have investigated variations of transverse and longitudinal normalized emittance for drifting and accelerating beams. These very strongly tune-depressed beams (σ o = 72 degrees, σ∼6 degree) are difficult to match the accelerator so as to avoid emittance growth during acceleration. During transport strong emittance fluctuations are observed in good qualitative agreement with simulations. Warmer beams with less tune depression exhibit little to no emittance growth, show smaller emittance fluctuations, and are much easier to match. A summary of findings from the MBE-4 studies is presented. 12 refs., 8 figs

  14. Emittance and beam size distortion due to linear coupling

    International Nuclear Information System (INIS)

    Parzen, G.

    1993-01-01

    At injection, the presence of linear coupling may result in an increased beam emittance and in increased beam dimensions. Results for the emittance in the presence of linear coupling will be found. These results for the emittance distortion show that the harmonics of the skew quadrupole field close to ν x + ν y are the important harmonics. Results will be found for the important driving terms for the emittance distortion. It will be shown that if these driving terms are corrected, then the total emittance is unchanged, var-epsilon x + var-epsilon y = var-epsilon 1 + var-epsilon 2 . Also, the increase in the beam dimensions will be limited to a factor which is less than 1.414. If the correction is good enough, see below for details, one can achieve var-epsilon 1 = var-epsilon x , var-epsilon 2 = var-epsilon where var-epsilon 1 , var-epsilon 2 are the emittances in the presence of coupling, and the beam dimensions are unchanged. Global correction of the emittance and beam size distortion appears possible

  15. Few emitters in a cavity: from cooperative emission to individualization

    International Nuclear Information System (INIS)

    Auffeves, A; Portolan, S; Gerace, D; Drezet, A; Franca Santos, M

    2011-01-01

    We study the temporal correlations of the field emitted by an electromagnetic resonator coupled to a mesoscopic number of two-level emitters that are incoherently pumped by a weak external drive. We solve the master equation of the system for increasing number of emitters and as a function of the cavity quality factor, and we identify three main regimes characterized by well-distinguished statistical properties of the emitted radiation. For small cavity decay rates, the emission events are uncorrelated and the number of photons in the emitted field becomes larger than one, resembling the build-up of a laser field inside the cavity. At intermediate decay rates (as compared with the emitter-cavity coupling) and for a few emitters, the statistics of the emitted radiation is bunched and strikingly dependent on the parity of the number of emitters. The latter property is related to the cooperativity of the emitters mediated by their coupling to the cavity mode, and its connection with steady-state subradiance is discussed. Finally, in the bad cavity regime the typical situation of emission from a collection of individual emitters is recovered. We also analyze how the cooperative behavior evolves as a function of pure dephasing, which allows us to recover the case of a classical source made of an ensemble of independent emitters, similar to what is obtained for a very leaky cavity. State-of-the-art techniques of Q-switch of resonant cavities, allied with the recent capability of tuning single emitters in and out of resonance, suggest this system to be a versatile source of different quantum states of light.

  16. Few emitters in a cavity: from cooperative emission to individualization

    Energy Technology Data Exchange (ETDEWEB)

    Auffeves, A; Portolan, S [CEA/CNRS/UJF Joint Team ' Nanophysics and Semiconductors' , Institut Neel-CNRS, BP 166, 25 Rue des Martyrs, 38042 Grenoble Cedex 9 (France); Gerace, D [Dipartimento di Fisica ' Alessandro Volta' and UdR CNISM, Universita di Pavia, via Bassi 6, 27100 Pavia (Italy); Drezet, A [Institut Neel-CNRS, BP 166, 25 Rue des Martyrs, 38042 Grenoble Cedex 9 (France); Franca Santos, M, E-mail: msantos@fisica.ufmg.br [Departamento de Fisica, Universidade Federal de Minas Gerais, Belo Horizonte, CP 702, 30123-970 (Brazil)

    2011-09-15

    We study the temporal correlations of the field emitted by an electromagnetic resonator coupled to a mesoscopic number of two-level emitters that are incoherently pumped by a weak external drive. We solve the master equation of the system for increasing number of emitters and as a function of the cavity quality factor, and we identify three main regimes characterized by well-distinguished statistical properties of the emitted radiation. For small cavity decay rates, the emission events are uncorrelated and the number of photons in the emitted field becomes larger than one, resembling the build-up of a laser field inside the cavity. At intermediate decay rates (as compared with the emitter-cavity coupling) and for a few emitters, the statistics of the emitted radiation is bunched and strikingly dependent on the parity of the number of emitters. The latter property is related to the cooperativity of the emitters mediated by their coupling to the cavity mode, and its connection with steady-state subradiance is discussed. Finally, in the bad cavity regime the typical situation of emission from a collection of individual emitters is recovered. We also analyze how the cooperative behavior evolves as a function of pure dephasing, which allows us to recover the case of a classical source made of an ensemble of independent emitters, similar to what is obtained for a very leaky cavity. State-of-the-art techniques of Q-switch of resonant cavities, allied with the recent capability of tuning single emitters in and out of resonance, suggest this system to be a versatile source of different quantum states of light.

  17. Fitting Hidden Markov Models to Psychological Data

    Directory of Open Access Journals (Sweden)

    Ingmar Visser

    2002-01-01

    Full Text Available Markov models have been used extensively in psychology of learning. Applications of hidden Markov models are rare however. This is partially due to the fact that comprehensive statistics for model selection and model assessment are lacking in the psychological literature. We present model selection and model assessment statistics that are particularly useful in applying hidden Markov models in psychology. These statistics are presented and evaluated by simulation studies for a toy example. We compare AIC, BIC and related criteria and introduce a prediction error measure for assessing goodness-of-fit. In a simulation study, two methods of fitting equality constraints are compared. In two illustrative examples with experimental data we apply selection criteria, fit models with constraints and assess goodness-of-fit. First, data from a concept identification task is analyzed. Hidden Markov models provide a flexible approach to analyzing such data when compared to other modeling methods. Second, a novel application of hidden Markov models in implicit learning is presented. Hidden Markov models are used in this context to quantify knowledge that subjects express in an implicit learning task. This method of analyzing implicit learning data provides a comprehensive approach for addressing important theoretical issues in the field.

  18. Geometric phases and hidden local gauge symmetry

    International Nuclear Information System (INIS)

    Fujikawa, Kazuo

    2005-01-01

    The analysis of geometric phases associated with level crossing is reduced to the familiar diagonalization of the Hamiltonian in the second quantized formulation. A hidden local gauge symmetry, which is associated with the arbitrariness of the phase choice of a complete orthonormal basis set, becomes explicit in this formulation (in particular, in the adiabatic approximation) and specifies physical observables. The choice of a basis set which specifies the coordinate in the functional space is arbitrary in the second quantization, and a subclass of coordinate transformations, which keeps the form of the action invariant, is recognized as the gauge symmetry. We discuss the implications of this hidden local gauge symmetry in detail by analyzing geometric phases for cyclic and noncyclic evolutions. It is shown that the hidden local symmetry provides a basic concept alternative to the notion of holonomy to analyze geometric phases and that the analysis based on the hidden local gauge symmetry leads to results consistent with the general prescription of Pancharatnam. We however note an important difference between the geometric phases for cyclic and noncyclic evolutions. We also explain a basic difference between our hidden local gauge symmetry and a gauge symmetry (or equivalence class) used by Aharonov and Anandan in their definition of generalized geometric phases

  19. Design of a minimum emittance nBA lattice

    Science.gov (United States)

    Lee, S. Y.

    1998-04-01

    An attempt to design a minimum emittance n-bend achromat (nBA) lattice has been made. One distinct feature is that dipoles with two different lengths were used. As a multiple bend achromat, five bend achromat lattices with six superperiod were designed. The obtained emittace is three times larger than the theoretical minimum. Tunes were chosen to avoid third order resonances. In order to correct first and second order chromaticities, eight family sextupoles were placed. The obtained emittance of five bend achromat lattices is almost equal to the minimum emittance of five bend achromat lattice consisting of dipoles with equal length.

  20. Remote detection of single emitters via optical waveguides

    Science.gov (United States)

    Then, Patrick; Razinskas, Gary; Feichtner, Thorsten; Haas, Philippe; Wild, Andreas; Bellini, Nicola; Osellame, Roberto; Cerullo, Giulio; Hecht, Bert

    2014-05-01

    The integration of lab-on-a-chip technologies with single-molecule detection techniques may enable new applications in analytical chemistry, biotechnology, and medicine. We describe a method based on the reciprocity theorem of electromagnetic theory to determine and optimize the detection efficiency of photons emitted by single quantum emitters through truncated dielectric waveguides of arbitrary shape positioned in their proximity. We demonstrate experimentally that detection of single quantum emitters via such waveguides is possible, confirming the predicted behavior of the detection efficiency. Our findings blaze the trail towards efficient lensless single-emitter detection compatible with large-scale optofluidic integration.

  1. Multi-dimensional beam emittance and β-functions

    International Nuclear Information System (INIS)

    Buon, J.

    1993-05-01

    The concept of r.m.s. emittance is extended to the case of several degrees of freedom that are coupled. That multi-dimensional emittance is lower than the product of the emittances attached to each degree of freedom, but is conserved in a linear motion. An envelope-hyperellipsoid is introduced to define the β-functions of the beam envelope. On the contrary of an one-degree of freedom motion, it is emphasized that these envelope functions differ from the amplitude functions of the normal modes of motion as a result of the difference between the Liouville and Lagrange invariants. (author) 4 refs

  2. Engineered Emitters for Improved Silicon Photovoltaics

    Science.gov (United States)

    Kamat, Ronak A.

    In 2014, installation of 5.3GW of new Photovoltaic (PV) systems occurred in the United States, raising the total installed capacity to 16.36GW. Strong growth is predicted for the domestic PV market with analysts reporting goals of 696GW by 2020. Conventional single crystalline silicon cells are the technology of choice, accounting for 90% of the installations in the global commercial market. Cells made of GaAs offer higher efficiencies, but at a substantially higher cost. Thin film technologies such as CIGS and CdTe compete favorably with multi-crystalline Si (u-Si), but at 20% efficiency, still lag the c-Si cell in performance. The c-Si cell can be fabricated to operate at approximately 25% efficiency, but commercially the efficiencies are in the 18-21% range, which is a direct result of cost trade-offs between process complexity and rapid throughput. With the current cost of c-Si cell modules at nearly 0.60/W. The technology is well below the historic metric of 1/W for economic viability. The result is that more complex processes, once cost-prohibitive, may now be viable. An example is Panasonic's HIT cell which operates in the 22-24% efficiency range. To facilitate research and development of novel PV materials and techniques, RIT has developed a basic solar cell fabrication process. Student projects prior to this work had produced cells with 12.8% efficiency using p type substrates. This thesis reports on recent work to improve cell efficiencies while simultaneously expanding the capability of the rapid prototyping process. In addition to the p-Si substrates, cells have been produced using n-Si substrates. The cell emitter, which is often done with a single diffusion or implant has been re-engineered using a dual implant of the same dose. This dual-implanted emitter has been shown to lower contact resistance, increase Voc, and increase the efficiency. A p-Si substrate cell has been fabricated with an efficiency of 14.6% and n-Si substrate cell with a 13

  3. Improved Rare-Earth Emitter Hollow Cathode

    Science.gov (United States)

    Goebel, Dan M.

    2011-01-01

    An improvement has been made to the design of the hollow cathode geometry that was created for the rare-earth electron emitter described in Compact Rare Earth Emitter Hollow Cathode (NPO-44923), NASA Tech Briefs, Vol. 34, No. 3 (March 2010), p. 52. The original interior assembly was made entirely of graphite in order to be compatible with the LaB6 material, which cannot be touched by metals during operation due to boron diffusion causing embrittlement issues in high-temperature refractory materials. Also, the graphite tube was difficult to machine and was subject to vibration-induced fracturing. This innovation replaces the graphite tube with one made out of refractory metal that is relatively easy to manufacture. The cathode support tube is made of molybdenum or molybdenum-rhenium. This material is easily gun-bored to near the tolerances required, and finish machined with steps at each end that capture the orifice plate and the mounting flange. This provides the manufacturability and robustness needed for flight applications, and eliminates the need for expensive e-beam welding used in prior cathodes. The LaB6 insert is protected from direct contact with the refractory metal tube by thin, graphite sleeves in a cup-arrangement around the ends of the insert. The sleeves, insert, and orifice plate are held in place by a ceramic spacer and tungsten spring inserted inside the tube. To heat the cathode, an insulating tube is slipped around the refractory metal hollow tube, which can be made of high-temperature materials like boron nitride or aluminum nitride. A screw-shaped slot, or series of slots, is machined in the outside of the ceramic tube to constrain a refractory metal wire wound inside the slot that is used as the heater. The screw slot can hold a single heater wire that is then connected to the front of the cathode tube by tack-welding to complete the electrical circuit, or it can be a double slot that takes a bifilar wound heater with both leads coming out

  4. Massive hidden photons as lukewarm dark matter

    International Nuclear Information System (INIS)

    Redondo, Javier; Postma, Marieke

    2008-11-01

    We study the possibility that a keV-MeV mass hidden photon (HP), i.e. a hidden sector U(1) gauge boson, accounts for the observed amount of dark matter. We focus on the case where the HP interacts with the standard model sector only through kinetic mixing with the photon. The relic abundance is computed including all relevant plasma effects into the photon's self-energy, which leads to a resonant yield almost independent of the HP mass. The HP can decay into three photons. Moreover, if light enough it can be copiously produced in stars. Including bounds from cosmic photon backgrounds and stellar evolution, we find that the hidden photon can only give a subdominant contribution to the dark matter. This negative conclusion may be avoided if another production mechanism besides kinetic mixing is operative. (orig.)

  5. Massive hidden photons as lukewarm dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Redondo, Javier [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Postma, Marieke [Nationaal Inst. voor Kernfysica en Hoge-Energiefysica (NIKHEF), Amsterdam (Netherlands)

    2008-11-15

    We study the possibility that a keV-MeV mass hidden photon (HP), i.e. a hidden sector U(1) gauge boson, accounts for the observed amount of dark matter. We focus on the case where the HP interacts with the standard model sector only through kinetic mixing with the photon. The relic abundance is computed including all relevant plasma effects into the photon's self-energy, which leads to a resonant yield almost independent of the HP mass. The HP can decay into three photons. Moreover, if light enough it can be copiously produced in stars. Including bounds from cosmic photon backgrounds and stellar evolution, we find that the hidden photon can only give a subdominant contribution to the dark matter. This negative conclusion may be avoided if another production mechanism besides kinetic mixing is operative. (orig.)

  6. Religious Tolerance in the Hidden Curriculum

    Directory of Open Access Journals (Sweden)

    Kevin Nobel Kurniawan

    2018-03-01

    Full Text Available Religious intolerance is spreading within the Indonesian institution of education. Previous studies have shown that the growth of intolerance is due to the state’s regulation and pedagogical apparatus. In contrast to the previous studies, I argue that the intolerance is related to hidden curriculum applied by the institution of education.  Normatively, the hidden curriculum contains the value of religious tolerance. However, factually, the author found that there are practices of intolerance, through the formal and informal spheres in the school’s structure, within the hidden curriculum. This article applies a qualitative approach with a mixed method research strategy to analyze data collected from students, teachers, and alumnis through field observation, in-depth interview, and survey.

  7. Hafnium carbide nanocrystal chains for field emitters

    International Nuclear Information System (INIS)

    Tian, Song; Li, Hejun; Zhang, Yulei; Ren, Jincui; Qiang, Xinfa; Zhang, Shouyang

    2014-01-01

    A hafnium carbide (HfC) nanostructure, i.e., HfC nanocrystal chain, was synthesized by a chemical vapor deposition (CVD) method. X-ray diffractometer, field-emission scanning electron microscope, transmission electron microscope, and energy-dispersive X-ray spectrometer were employed to characterize the product. The synthesized one-dimensional (1D) nanostructures with many faceted octahedral nanocrystals possess diameters of tens of nanometers to 500 nm and lengths of a few microns. The chain-like structures possess a single crystalline structure and preferential growth direction along the [1 0 0] crystal orientation. The growth of the chains occurred through the vapor–liquid–solid process along with a negative-feedback mechanism. The field emission (FE) properties of the HfC nanocrystal chains as the cold cathode emitters were examined. The HfC nanocrystal chains display good FE properties with a low turn-on field of about 3.9 V μm −1 and a high field enhancement factor of 2157, implying potential applications in vacuum microelectronics.

  8. Analysis of low energy beta-emitters

    International Nuclear Information System (INIS)

    Murphy, D.L.

    1979-10-01

    A survey was made of the instruments used for the determination of low energy beta radioactivity. Techniques commonly used are gas flow proportional counting, liquid scintillation counting, solid scintillation counting, and internal ionization chamber counting, solid state detector counting, and radiochemical separation followed by counting using one of the preceeding techniques. The first four techniques were examined and compared with each other. The sensitivities of the techniques were compared on the basis of the detection limits quoted for instruments described in the technical and reviewed literature. The detection limits were then related to the occupational and public individual maximum levels for air and water. Attention is focused primarily on the continuous monitoring of air for 3 H and 85 Kr, a medium energy β-emitter. It is clear that several continuous air monitoring instruments are readily available for measuring low energy β concentrations, even in presence of certain other activity, at occupational levels. However, these instruments do not typically have sensitivities comparable to the public individual levels. Moreover, their capabilities for giving results in real time and for differentiating among the radionuclides actually present is limited

  9. Sources of Emittance in RF Photocathode Injectors

    Energy Technology Data Exchange (ETDEWEB)

    Dowell, David [SLAC National Accelerator Lab., Menlo Park, CA (United States)

    2016-12-11

    Advances in electron beam technology have been central to creating the current generation of x-ray free electron lasers and ultra-fast electron microscopes. These once exotic devices have become essential tools for basic research and applied science. One important beam technology for both is the electron source which, for many of these instruments, is the photocathode RF gun. The invention of the photocathode gun and the concepts of emittance compensation and beam matching in the presence of space charge and RF forces have made these high-quality beams possible. Achieving even brighter beams requires a taking a finer resolution view of the electron dynamics near the cathode during photoemission and the initial acceleration of the beam. In addition, the high brightness beam is more sensitive to degradation by the optical aberrations of the gun’s RF and magnetic lenses. This paper discusses these topics including the beam properties due to fundamental photoemission physics, space charge effects close to the cathode, and optical distortions introduced by the RF and solenoid fields. Analytic relations for these phenomena are derived and compared with numerical simulations.

  10. Hidden treasures - 50 km points of interests

    Science.gov (United States)

    Lommi, Matias; Kortelainen, Jaana

    2015-04-01

    Tampere is third largest city in Finland and a regional centre. During 70's there occurred several communal mergers. Nowadays this local area has both strong and diversed identity - from wilderness and agricultural fields to high density city living. Outside the city center there are interesting geological points unknown for modern city settlers. There is even a local proverb, "Go abroad to Teisko!". That is the area the Hidden Treasures -student project is focused on. Our school Tammerkoski Upper Secondary School (or Gymnasium) has emphasis on visual arts. We are going to offer our art students scientific and artistic experiences and knowledge about the hidden treasures of Teisko area and involve the Teisko inhabitants into this project. Hidden treasures - Precambrian subduction zone and a volcanism belt with dense bed of gold (Au) and arsenic (As), operating goldmines and quarries of minerals and metamorphic slates. - North of subduction zone a homogenic precambrian magmastone area with quarries, products known as Kuru Grey. - Former ashores of post-glasial Lake Näsijärvi and it's sediments enabled the developing agriculture and sustained settlement. Nowadays these ashores have both scenery and biodiversity values. - Old cattle sheds and dairy buildings made of local granite stones related to cultural stonebuilding inheritance. - Local active community of Kapee, about 100 inhabitants. Students will discover information of these "hidden" phenomena, and rendering this information trough Enviromental Art Method. Final form of this project will be published in several artistic and informative geocaches. These caches are achieved by a GPS-based special Hidden Treasures Cycling Route and by a website guiding people to find these hidden points of interests.

  11. The origin of the hidden supersymmetry

    International Nuclear Information System (INIS)

    Jakubsky, Vit; Nieto, Luis-Miguel; Plyushchay, Mikhail S.

    2010-01-01

    The hidden supersymmetry and related tri-supersymmetric structure of the free particle system, the Dirac delta potential problem and the Aharonov-Bohm effect (planar, bound state, and tubule models) are explained by a special nonlocal unitary transformation, which for the usual N=2 supercharges has a nature of Foldy-Wouthuysen transformation. We show that in general case, the bosonized supersymmetry of nonlocal, parity even systems emerges in the same construction, and explain the origin of the unusual N=2 supersymmetry of electron in three-dimensional parity even magnetic field. The observation extends to include the hidden superconformal symmetry.

  12. Signatures of a hidden cosmic microwave background.

    Science.gov (United States)

    Jaeckel, Joerg; Redondo, Javier; Ringwald, Andreas

    2008-09-26

    If there is a light Abelian gauge boson gamma' in the hidden sector its kinetic mixing with the photon can produce a hidden cosmic microwave background (HCMB). For meV masses, resonant oscillations gammagamma' happen after big bang nucleosynthesis (BBN) but before CMB decoupling, increasing the effective number of neutrinos Nnu(eff) and the baryon to photon ratio, and distorting the CMB blackbody spectrum. The agreement between BBN and CMB data provides new constraints. However, including Lyman-alpha data, Nnu(eff) > 3 is preferred. It is tempting to attribute this effect to the HCMB. The interesting parameter range will be tested in upcoming laboratory experiments.

  13. Hidden simplicity of gauge theory amplitudes

    Energy Technology Data Exchange (ETDEWEB)

    Drummond, J M, E-mail: drummond@lapp.in2p3.f [LAPTH, Universite de Savoie, CNRS, B.P. 110, F-74941 Annecy-le-Vieux, Cedex (France)

    2010-11-07

    These notes were given as lectures at the CERN Winter School on Supergravity, Strings and Gauge Theory 2010. We describe the structure of scattering amplitudes in gauge theories, focussing on the maximally supersymmetric theory to highlight the hidden symmetries which appear. Using the Britto, Cachzo, Feng and Witten (BCFW) recursion relations we solve the tree-level S-matrix in N=4 super Yang-Mills theory and describe how it produces a sum of invariants of a large symmetry algebra. We review amplitudes in the planar theory beyond tree level, describing the connection between amplitudes and Wilson loops, and discuss the implications of the hidden symmetries.

  14. A numerical study of emittance growths in RF guns

    CERN Document Server

    Masuda, K; Sobajima, M; Kitagaki, J; Ohnishi, M; Toku, H; Yoshikawa, K

    1999-01-01

    A beam with greatly reduced emittance is required for further improvements of FELs, in particular, for FELs of shorter wavelengths, and of narrower bandwidths. From this viewpoint, the BNL/SLAC/UCLA 1.6-cell S-band photocathode RF gun performance characteristics were calculated, first in order to evaluate what may contribute to the emittance growths in photocathode RF guns. We developed an RF gun to produce an electron beam with an extremely low emittance, by using a 2-D simulation code. It is found that, by optimizing the laser injection phase, the drive laser spot radius and the cavity shape around the laser spot, the beam emittance by the 1.6-cell RF gun can be greatly reduced to 2.1 pi mm mrad, from the previous 4.4 pi mm mrad of the original shape.

  15. An Online Multisensor Data Fusion Framework for Radar Emitter Classification

    Directory of Open Access Journals (Sweden)

    Dongqing Zhou

    2016-01-01

    Full Text Available Radar emitter classification is a special application of data clustering for classifying unknown radar emitters in airborne electronic support system. In this paper, a novel online multisensor data fusion framework is proposed for radar emitter classification under the background of network centric warfare. The framework is composed of local processing and multisensor fusion processing, from which the rough and precise classification results are obtained, respectively. What is more, the proposed algorithm does not need prior knowledge and training process; it can dynamically update the number of the clusters and the cluster centers when new pulses arrive. At last, the experimental results show that the proposed framework is an efficacious way to solve radar emitter classification problem in networked warfare.

  16. Emittance measuring unit for 100% duty factor linac injector beams

    Energy Technology Data Exchange (ETDEWEB)

    Shubaly, M R; Pachner, J Jr; Ormrod, J H; Ungrin, J; Schriber, S O [ed.

    1976-11-01

    A description is given of a system to measure the emittance of a 750 keV 100 mA dc proton beam suitable for injection into a 100% duty factor linear accelerator. A relatively slowly pulsed 45/sup 0/ magnet switches the beam to a beam dump inside the emittance measuring unit for approx. 10 s. A fast pulsed 5/sup 0/ magnet then deflects the beam to a multiple aperture ''pepper-pot'' plate for 300 ..mu..s. Beamlets passing through the plate travel 520 mm and produce a pattern on a scintillator screen. A photograph of the pattern is analyzed to determine beam emittance. Preliminary results on low current beams show a gross increase in the emittance in the horizontal plane.

  17. Localization of Narrowband Single Photon Emitters in Nanodiamonds.

    Science.gov (United States)

    Bray, Kerem; Sandstrom, Russell; Elbadawi, Christopher; Fischer, Martin; Schreck, Matthias; Shimoni, Olga; Lobo, Charlene; Toth, Milos; Aharonovich, Igor

    2016-03-23

    Diamond nanocrystals that host room temperature narrowband single photon emitters are highly sought after for applications in nanophotonics and bioimaging. However, current understanding of the origin of these emitters is extremely limited. In this work, we demonstrate that the narrowband emitters are point defects localized at extended morphological defects in individual nanodiamonds. In particular, we show that nanocrystals with defects such as twin boundaries and secondary nucleation sites exhibit narrowband emission that is absent from pristine individual nanocrystals grown under the same conditions. Critically, we prove that the narrowband emission lines vanish when extended defects are removed deterministically using highly localized electron beam induced etching. Our results enhance the current understanding of single photon emitters in diamond and are directly relevant to fabrication of novel quantum optics devices and sensors.

  18. Innovative energy efficient low-voltage electron beam emitters

    International Nuclear Information System (INIS)

    Felis, Kenneth P.; Avnery, Tovi; Berejka, Anthony J.

    2002-01-01

    Advanced electron beams (AEB) has developed a modular, low voltage (80-125 keV), high beam current (up to 40 ma), electron emitter with typically 25 cm of beam width, that is housed in an evacuated, returnable chamber that is easy to plug in and connect. The latest in nanofabrication enables AEB to use an ultra-thin beam window. The power supply for AEB's emitter is based on solid-state electronics. This combination of features results in a remarkable electrical efficiency. AEB's electron emitter relies on a touch screen, computer control system. With 80 μm of unit density beam penetration, AEB's electron emitter has gained market acceptance in the curing of opaque, pigmented inks and coatings used on flexible substrates, metals and fiber composites and in the curing of adhesives in foil based laminates

  19. Innovative energy efficient low-voltage electron beam emitters

    Science.gov (United States)

    Felis, Kenneth P.; Avnery, Tovi; Berejka, Anthony J.

    2002-03-01

    Advanced electron beams (AEB) has developed a modular, low voltage (80-125 keV), high beam current (up to 40 ma), electron emitter with typically 25 cm of beam width, that is housed in an evacuated, returnable chamber that is easy to plug in and connect. The latest in nanofabrication enables AEB to use an ultra-thin beam window. The power supply for AEB's emitter is based on solid-state electronics. This combination of features results in a remarkable electrical efficiency. AEB's electron emitter relies on a touch screen, computer control system. With 80 μm of unit density beam penetration, AEB's electron emitter has gained market acceptance in the curing of opaque, pigmented inks and coatings used on flexible substrates, metals and fiber composites and in the curing of adhesives in foil based laminates.

  20. Emittance measurements in low energy ion storage rings

    Science.gov (United States)

    Hunt, J. R.; Carli, C.; Resta-López, J.; Welsch, C. P.

    2018-07-01

    The development of the next generation of ultra-low energy antiproton and ion facilities requires precise information about the beam emittance to guarantee optimum performance. In the Extra-Low ENergy Antiproton storage ring (ELENA) the transverse emittances will be measured by scraping. However, this diagnostic measurement faces several challenges: non-zero dispersion, non-Gaussian beam distributions due to effects of the electron cooler and various systematic errors such as closed orbit offsets and inaccurate rms momentum spread estimation. In addition, diffusion processes, such as intra-beam scattering might lead to emittance overestimates. Here, we present algorithms to efficiently address the emittance reconstruction in presence of the above effects, and present simulation results for the case of ELENA.

  1. Very bright, near-infrared single photon emitters in diamond

    Directory of Open Access Journals (Sweden)

    D. W. M. Lau

    2013-09-01

    Full Text Available We demonstrate activation of bright diamond single photon emitters in the near infrared range by thermal annealing alone, i.e., without ion implantation. The activation is crucially dependent on the annealing ambient. The activation of the single photon emitters is only observed when the sample is annealed in forming gas (4% H2 in Ar above temperatures of 1000 °C. By contrast, no emitters are activated by annealing in vacuum, oxygen, argon or deuterium. The emitters activated by annealing in forming gas exhibit very bright emission in the 730-760 nm wavelength range and have linewidths of ∼1.5-2.5 nm at room temperature.

  2. Transverse Emittance Measurement and Preservation at the LHC

    CERN Document Server

    AUTHOR|(CDS)2082907

    The Large Hadron Collider (LHC) at CERN is a high energy storage ring that provides proton and heavy ion collisions to study fundamental particle physics. The luminosity production is closely linked to emittance preservation in the accelerator. The transverse emittance is the phase space density of the beam and should be conserved when the particle beam is transformed through the accelerator. Perturbing effects, however, can lead to emittance increase and hence luminosity degradation. Measuring the emittance growth is a complex task with high intensity beams and changing energies. The machine optics and the transverse beam size have to be measured as accurately as possible. Beta function measurements with k-modulation will be discussed. With this method the quadrupole focussing strength is varied and the resulting tune change is traced to determine the beta function at the quadrupole. A new k-modulation measurement tool was developed for the LHC. The fully automatic and online measurement system takes constra...

  3. Beam dynamics in rf guns and emittance correction techniques

    International Nuclear Information System (INIS)

    Serafini, L.

    1994-01-01

    In this paper we present a general review of beam dynamics in a laser-driven rf gun. The peculiarity of such an accelerating structure versus other conventional multi-cell linac structures is underlined on the basis of the Panofsky-Wenzel theorem, which is found to give a theoretical background for the well known Kim's model. A basic explanation for some proposed methods to correct rf induced emittance growth is also derived from the theorem. We also present three emittance correction techniques for the recovery of space-charge induced emittance growth, namely the optimum distributed disk-like bunch technique, the use of rf spatial harmonics to correct spherical aberration induced by space charge forces and the technique of emittance filtering by clipping the electron beam. The expected performances regarding the beam quality achievable with different techniques, as predicted by scaling laws and simulations, are analyzed, and, where available, compared to experimental results. (orig.)

  4. Transverse emittance measurement at REGAE via a solenoid scan

    Energy Technology Data Exchange (ETDEWEB)

    Hachmann, Max

    2012-12-15

    The linear accelerator REGAE at DESY produces short and low charged electron bunches, on the one hand to resolve the excitation transitions of atoms temporally by pump probe electron diffraction experiments and on the other hand to investigate principal mechanisms of laser plasma acceleration. For both cases a high quality electron beam is required. A quantity to rate the beam quality is the beam emittance. In the course of this thesis transverse emittance measurements by a solenoid scan could be realized and beyond that an improved theoretical description of a solenoid was successful. The foundation of emittance measurements are constituted by theoretical models which describe the envelope of a beam. Two different models were derived. The first is an often used model to determine the transverse beam emittance without considering space charge effects. More interesting and challenging was the development of an envelope model taking space charge effects into account. It is introduced and cross checked with measurements and simulations.

  5. Design for a practical, low-emittance damping ring

    International Nuclear Information System (INIS)

    Krejcik, P.

    1988-01-01

    The luminosity requirements for future high-energy linear colliders calls for very low emittances in the two beams. These low emittances can be achieved with damping rings, but, in order to reach the design goal of a factor 10 improvement over present day machines, great care must be taken in their design. This paper emphasizes the need to address simultaneously all of the factors which limit the operational emittance in the ring. Particularly since in standard designs there is a conflict between different design parameters which makes it difficult to extrapolate such designs to very low emittances. The approach chosen here is to resolve such conflicts by separating their design solutions. Wigglers are used predominantly in zero-dispersion regions to achieve the desired damping rate, whereas in the arcs high dispersion insertions are made in regions of zero curvature to allow for easier chromaticity control

  6. Emittance increase caused by core depletion in collisions

    CERN Document Server

    Bruce, R

    2009-01-01

    A new effect is presented, which changes the emittance during colliding-beam operation in circular colliders. If the initial transverse distribution is Gaussian, the collision probability is much higher for particles in the core of the beam than in the tails. When small-amplitude particles are removed, the remaining ones therefore have a larger transverse emittance. This effect, called core depletion, may cause a decrease in luminosity. An approximate analytic model is developed to study the effect and benchmarked against a multiparticle tracking simulation. Finally, the time evolution of the intensity and emittances of a Pb bunch in the Large Hadron Collider (LHC) at CERN is calculated, taking into account also other processes than collisions. The results show that integrated luminosity drops by 3--4% if core depletion is taken into account. It is also found that core depletion causes the transverse emittance to be larger when more experiments are active. This observation could be checked against experimenta...

  7. Simulation studies of emittance growth in RMS mismatched beams

    International Nuclear Information System (INIS)

    Cucchetti, A.; Wangler, T.; Reiser, M.

    1991-01-01

    As shown in a separate paper, a charged-particle beam, whose rms size is not matched when injected into a transport channel or accelerator, has excess energy compared with that of a matched beam. If nonlinear space-charge forces are present and the mismatched beam transforms to a matched equilibrium state, rms-emittance growth will occur. The theory yields formulas for the possible rms-emittance growth, but not for the time it takes to achieve this growth. In this paper we present the results of systematic simulation studies for a mismatched 2-D round beam in an ideal transport channel with continuous linear focusing. Emittance growth rates obtained from the simulations for different amounts of mismatch and initial charge will be presented and the emittance growth will be compared with the theory. 6 refs., 7 figs

  8. CSR-induced emittance growth in achromats: Linear formalism revisited

    Energy Technology Data Exchange (ETDEWEB)

    Venturini, M.

    2015-09-11

    We review the R-matrix formalism used to describe Coherent Synchrotron Radiation (CSR)-induced projected emittance growth in electron beam transport lines and establish the connection with a description in terms of the dispersion-invariant function.

  9. Progress on low emittance tuning for the CLIC Damping Rings

    CERN Document Server

    Alabau-Gonzalvo, J; Papaphilippou, Y

    2014-01-01

    In the frame of the CLIC main Damping Ring a study on the sensitivity of the lattice to different sources of misalignment is presented. The minimum equilibrium emittance is simulated and analytically estimated under dipole and quadrupole rolls, and quadrupole and sextupole vertical offsets. The result of this study establishes alignment tolerances to preserve the vertical emittance below the design value (1 pmrad). Non-linear dynamics studies have been done to determine the dynamic aperture in the presence of misalignments.

  10. Emittance growth from rotated quadrupoles in heavy ion accelerators

    International Nuclear Information System (INIS)

    Barnard, J.J.

    1995-01-01

    We derive a set of moment equations which incorporates linear quadrupolar focusing and space-charge defocusing, in the presence of rotational misalignments of the quadrupoles about the direction of beam propagation. Although the usual beam emittance measured relative to fixed transverse x and y coordinate axes is not constant, a conserved emittance-like quantity has been found. Implications for alignment tolerances in accelerators for heavy-ion inertial fusion are discussed

  11. Minimum emittance of isochronus rings for synchrotron light source

    CERN Document Server

    Shoji, Y

    1999-01-01

    Theoretically achievable minimum emittances of isochronus rings for synchrotron light source are calculated. The rings discussed in this paper consist of isochronus and achromatic bending cells, isochronus TBA (triple bend achromat) cells with negative dispersion, isochronus TBA cells with inverse bends or isochronus QBA (four bend achromat) cells. We show that the minimum emittances of these rings are roughly 2 or 3 times of those of the optimized non-isochronus rings.

  12. Quantum emitters coupled to surface plasmons of an nanowire

    DEFF Research Database (Denmark)

    Dzsotjan, David; Sørensen, Anders Søndberg; Fleischhauer, Michael

    2010-01-01

    We investigate a system consisting of a single, as well as two emitters strongly coupled to surface plasmon modes of a nanowire using a Green's function approach. Explicit expressions are derived for the spontaneous decay rate into the plasmon modes and for the atom-plasmon coupling as well......-qubit quantum gate. We also discuss a possible realization of interesting many-body Hamiltonians, such as the spin-boson model, using strong emitter-plasmon coupling. Udgivelsesdato: 27 August...

  13. Transverse emittance measurement at REGAE via a solenoid scan

    Energy Technology Data Exchange (ETDEWEB)

    Hachmann, Max; Mayet, Frank; Gruener, Florian [Institut fuer Experimentalphysik, Universitaet Hamburg (Germany); Floettmann, Klaus [DESY, Hamburg (Germany)

    2013-07-01

    The linear accelerator REGAE at DESY produces short and low charged electron bunches, on the one hand to resolve the excitation transitions of atoms temporally by pump probe electron diffraction experiments and on the other hand to investigate principal mechanisms of laser plasma acceleration. For both cases a high quality electron beam is required which can be identified with a small beam emittance. The current method to measure the transverse beam emittance at REGAE and results are presented.

  14. Internal emitter limits for iodine, radium and radon daughters

    Energy Technology Data Exchange (ETDEWEB)

    Schlenker, R.A.

    1984-08-15

    This paper identifies some of the issues which arise in the consideration of the derivation of new limits on exposure to internal emitters. Basic and secondary radiation protection limits are discussed. Terms are defined and applied to the limitation of risk from stochastic effects. Non-stochastic data for specific internal emitters (/sup 131/I and the radium isotopes) are presented. Emphasis is placed on the quantitative aspects of the limit setting problem. 65 references, 2 figures, 12 tables.

  15. Internal emitter limits for iodine, radium and radon daughters

    International Nuclear Information System (INIS)

    Schlenker, R.A.

    1984-01-01

    This paper identifies some of the issues which arise in the consideration of the derivation of new limits on exposure to internal emitters. Basic and secondary radiation protection limits are discussed. Terms are defined and applied to the limitation of risk from stochastic effects. Non-stochastic data for specific internal emitters ( 131 I and the radium isotopes) are presented. Emphasis is placed on the quantitative aspects of the limit setting problem. 65 references, 2 figures, 12 tables

  16. A Program to Generate a Particle Distribution from Emittance Measurements

    CERN Document Server

    Bouma, DS; Lallement, JB

    2010-01-01

    We have written a program to generate a particle distribution based on emittance measurements in x-x’ and y-y’. The accuracy of this program has been tested using real and constructed emittance measurements. Based on these tests, the distribution generated by the program can be used to accurately simulate the beam in multi-particle tracking codes, as an alternative to a Gaussian or uniform distribution.

  17. Gamma flux responsive self-powered detector with a tubular emitter

    International Nuclear Information System (INIS)

    Goldstein, N.P.; Todt, W.H.

    1982-01-01

    A gamma-sensitive flux detector comprises tubular emitter, an insulating core within the emitter and an insulating layer about the emitter, and a tubular conductive collector electrode about the insulating layer. The emitter material may be platinum, lead, bismuth, tantalum, tungsten; platinum preferred

  18. Searching for hidden sectors in multiparticle production at the LHC

    CERN Document Server

    Sanchis-Lozano, Miguel-Angel; Moreno-Picot, Salvador

    2016-01-01

    We study the impact of a hidden sector beyond the Standard Model, e.g. a Hidden Valley model, on factorial moments and cumulants of multiplicity distributions in multiparticle production with a special emphasis on the prospects for LHC results.

  19. Electromagnetic compatibility of implantable neurostimulators to RFID emitters.

    Science.gov (United States)

    Pantchenko, Oxana S; Seidman, Seth J; Guag, Joshua W; Witters, Donald M; Sponberg, Curt L

    2011-06-09

    The objective of this study is to investigate electromagnetic compatibility (EMC) of implantable neurostimulators with the emissions from radio frequency identification (RFID) emitters. Six active implantable neurostimulators with lead systems were tested for susceptibility to electromagnetic fields generated by 22 RFID emitters. These medical devices have been approved for marketing in the U.S. for a number of intended uses that include: epilepsy, depression, incontinence, Parkinsonian tremor and pain relief. Each RFID emitter had one of the following carrier frequencies: 125 kHz, 134 kHz, 13.56 MHz, 433 MHz, 915 MHz and 2.45 GHz. The test results showed the output of one of the implantable neurostimulators was inhibited by 134 kHz RFID emitter at separation distances of 10 cm or less. The output of the same implantable neurostimulator was also inhibited by another 134 kHz RFID emitter at separation distances of 10 cm or less and also showed inconsistent pulsing rate at a separation distance of 15 cm. Both effects occurred during and lasted through out the duration of the exposure. The clinical significance of the effects was assessed by a clinician at the U.S. Food and Drug Administration. The effects were determined to be clinically significant only if they occurred for extended period of time. There were no observed effects from the other 5 implantable neurostimulators or during exposures from other RFID emitters.

  20. Electromagnetic compatibility of implantable neurostimulators to RFID emitters

    Directory of Open Access Journals (Sweden)

    Guag Joshua W

    2011-06-01

    Full Text Available Abstract Background The objective of this study is to investigate electromagnetic compatibility (EMC of implantable neurostimulators with the emissions from radio frequency identification (RFID emitters. Methods Six active implantable neurostimulators with lead systems were tested for susceptibility to electromagnetic fields generated by 22 RFID emitters. These medical devices have been approved for marketing in the U.S. for a number of intended uses that include: epilepsy, depression, incontinence, Parkinsonian tremor and pain relief. Each RFID emitter had one of the following carrier frequencies: 125 kHz, 134 kHz, 13.56 MHz, 433 MHz, 915 MHz and 2.45 GHz Results The test results showed the output of one of the implantable neurostimulators was inhibited by 134 kHz RFID emitter at separation distances of 10 cm or less. The output of the same implantable neurostimulator was also inhibited by another 134 kHz RFID emitter at separation distances of 10 cm or less and also showed inconsistent pulsing rate at a separation distance of 15 cm. Both effects occurred during and lasted through out the duration of the exposure. Conclusions The clinical significance of the effects was assessed by a clinician at the U.S. Food and Drug Administration. The effects were determined to be clinically significant only if they occurred for extended period of time. There were no observed effects from the other 5 implantable neurostimulators or during exposures from other RFID emitters.

  1. Measured emittance dependence on injection method in laser plasma accelerators

    Science.gov (United States)

    Barber, Samuel; van Tilborg, Jeroen; Schroeder, Carl; Lehe, Remi; Tsai, Hai-En; Swanson, Kelly; Steinke, Sven; Nakamura, Kei; Geddes, Cameron; Benedetti, Carlo; Esarey, Eric; Leemans, Wim

    2017-10-01

    The success of many laser plasma accelerator (LPA) based applications relies on the ability to produce electron beams with excellent 6D brightness, where brightness is defined as the ratio of charge to the product of the three normalized emittances. As such, parametric studies of the emittance of LPA generated electron beams are essential. Profiting from a stable and tunable LPA setup, combined with a carefully designed single-shot transverse emittance diagnostic, we present a direct comparison of charge dependent emittance measurements of electron beams generated by two different injection mechanisms: ionization injection and shock induced density down-ramp injection. Notably, the measurements reveal that ionization injection results in significantly higher emittance. With the down-ramp injection configuration, emittances less than 1 micron at spectral charge densities up to 2 pC/MeV were measured. This work was supported by the U.S. DOE under Contract No. DE-AC02-05CH11231, by the NSF under Grant No. PHY-1415596, by the U.S. DOE NNSA, DNN R&D (NA22), and by the Gordon and Betty Moore Foundation under Grant ID GBMF4898.

  2. Experimental investigation of thermal emittance components of copper photocathode

    Directory of Open Access Journals (Sweden)

    H. J. Qian

    2012-04-01

    Full Text Available With progress of photoinjector technology, thermal emittance has become the primary limitation of electron beam brightness. Extensive efforts have been devoted to study thermal emittance, but experiment results differ between research groups and few can be well interpreted. Besides the ambiguity of photoemission mechanism, variations of cathode surface conditions during cathode preparation, such as work function, field enhancement factor, and surface roughness, will cause thermal emittance differences. In this paper, we report an experimental study of electric field dependence of copper cathode quantum efficiency (QE and thermal emittance in a radio frequency (rf gun, through which in situ cathode surface parameters and thermal emittance contributions from photon energy, Schottky effect, and surface roughness are extracted. It is found the QE of a copper cathode illuminated by a 266 nm UV laser increased substantially to 1.5×10^{-4} after cathode cleaning during rf conditioning, and a copper work function of 4.16 eV, which is much lower than nominal value (4.65 eV, was measured. Experimental results also show a thermal emittance growth as much as 0.92  mm mrad/mm at 50  MV/m due to the cathode surface roughness effect, which is consistent with cathode surface morphology measurements.

  3. Compressing the hidden variable space of a qubit

    OpenAIRE

    Montina, Alberto

    2010-01-01

    In previously exhibited hidden variable models of quantum state preparation and measurement, the number of continuous hidden variables describing the actual state of a single realization is never smaller than the quantum state manifold dimension. We introduce a simple model for a qubit whose hidden variable space is one-dimensional, i.e., smaller than the two-dimensional Bloch sphere. The hidden variable probability distributions associated with the quantum states satisfy reasonable criteria ...

  4. Decoupling Intensity Radiated by the Emitter in Distance Estimation from Camera to IR Emitter

    Directory of Open Access Journals (Sweden)

    Carlos Andrés Luna Vázquez

    2013-05-01

    Full Text Available Various models using radiometric approach have been proposed to solve the problem of estimating the distance between a camera and an infrared emitter diode (IRED. They depend directly on the radiant intensity of the emitter, set by the IRED bias current. As is known, this current presents a drift with temperature, which will be transferred to the distance estimation method. This paper proposes an alternative approach to remove temperature drift in the distance estimation method by eliminating the dependence on radiant intensity. The main aim was to use the relative accumulated energy together with other defined models, such as the zeroth-frequency component of the FFT of the IRED image and the standard deviation of pixel gray level intensities in the region of interest containing the IRED image. By using the abovementioned models, an expression free of IRED radiant intensity was obtained. Furthermore, the final model permitted simultaneous estimation of the distance between the IRED and the camera and the IRED orientation angle. The alternative presented in this paper gave a 3% maximum relative error over a range of distances up to 3 m.

  5. Barium Depletion in Hollow Cathode Emitters

    Science.gov (United States)

    Polk, James E.; Capece, Angela M.; Mikellides, Ioannis G.; Katz, Ira

    2009-01-01

    The effect of tungsten erosion, transport and redeposition on the operation of dispenser hollow cathodes was investigated in detailed examinations of the discharge cathode inserts from an 8200 hour and a 30,352 hour ion engine wear test. Erosion and subsequent re-deposition of tungsten in the electron emission zone at the downstream end of the insert reduces the porosity of the tungsten matrix, preventing the ow of barium from the interior. This inhibits the interfacial reactions of the barium-calcium-aluminate impregnant with the tungsten in the pores. A numerical model of barium transport in the internal xenon discharge plasma shows that the barium required to reduce the work function in the emission zone can be supplied from upstream through the gas phase. Barium that flows out of the pores of the tungsten insert is rapidly ionized in the xenon discharge and pushed back to the emitter surface by the electric field and drag from the xenon ion flow. This barium ion flux is sufficient to maintain a barium surface coverage at the downstream end greater than 0.6, even if local barium production at that point is inhibited by tungsten deposits. The model also shows that the neutral barium pressure exceeds the equilibrium vapor pressure of the impregnant decomposition reaction over much of the insert length, so the reactions are suppressed. Only a small region upstream of the zone blocked by tungsten deposits is active and supplies the required barium. These results indicate that hollow cathode failure models based on barium depletion rates in vacuum dispenser cathodes are very conservative.

  6. Silicon Carbide Emitter Turn-Off Thyristor

    Directory of Open Access Journals (Sweden)

    Jun Wang

    2008-01-01

    Full Text Available A novel MOS-controlled SiC thyristor device, the SiC emitter turn-off thyristor (ETO is a promising technology for future high-voltage switching applications because it integrates the excellent current conduction capability of a SiC thyristor with a simple MOS-control interface. Through unity-gain turn-off, the SiC ETO also achieves excellent Safe Operation Area (SOA and faster switching speeds than silicon ETOs. The world's first 4.5-kV SiC ETO prototype shows a forward voltage drop of 4.26 V at 26.5 A/cm2 current density at room and elevated temperatures. Tested in an inductive circuit with a 2.5 kV DC link voltage and a 9.56-A load current, the SiC ETO shows a fast turn-off time of 1.63 microseconds and a low 9.88 mJ turn-off energy. The low switching loss indicates that the SiC ETO could operate at about 4 kHz if 100 W/cm2 conduction and the 100 W/cm2 turn-off losses can be removed by the thermal management system. This frequency capability is about 4 times higher than 4.5-kV-class silicon power devices. The preliminary demonstration shows that the SiC ETO is a promising candidate for high-frequency, high-voltage power conversion applications, and additional developments to optimize the device for higher voltage (>5 kV and higher frequency (10 kHz are needed.

  7. Hidden Markov Models for Human Genes

    DEFF Research Database (Denmark)

    Baldi, Pierre; Brunak, Søren; Chauvin, Yves

    1997-01-01

    We analyse the sequential structure of human genomic DNA by hidden Markov models. We apply models of widely different design: conventional left-right constructs and models with a built-in periodic architecture. The models are trained on segments of DNA sequences extracted such that they cover com...

  8. The Hidden Cost of Buying a Computer.

    Science.gov (United States)

    Johnson, Michael

    1983-01-01

    In order to process data in a computer, application software must be either developed or purchased. Costs for modifications of the software package and maintenance are often hidden. The decision to buy or develop software packages should be based upon factors of time and maintenance. (MLF)

  9. Hidden symmetries in five-dimensional supergravity

    International Nuclear Information System (INIS)

    Poessel, M.

    2003-05-01

    This thesis is concerned with the study of hidden symmetries in supergravity, which play an important role in the present picture of supergravity and string theory. Concretely, the appearance of a hidden G 2(+2) /SO(4) symmetry is studied in the dimensional reduction of d=5, N=2 supergravity to three dimensions - a parallel model to the more famous E 8(+8) /SO(16) case in eleven-dimensional supergravity. Extending previous partial results for the bosonic part, I give a derivation that includes fermionic terms. This sheds new light on the appearance of the local hidden symmetry SO(4) in the reduction, and shows up an unusual feature which follows from an analysis of the R-symmetry associated with N=4 supergravity and of the supersymmetry variations, and which has no parallel in the eleven-dimensional case: The emergence of an additional SO(3) as part of the enhanced local symmetry, invisible in the dimensional reduction of the gravitino, and corresponding to the fact that, of the SO(4) used in the coset model, only the diagonal SO(3) is visible immediately upon dimensional reduction. The uncovering of the hidden symmetries proceeds via the construction of the proper coset gravity in three dimensions, and matching it with the Lagrangian obtained from the reduction. (orig.)

  10. Discovering hidden sectors with monophoton Z' searches

    International Nuclear Information System (INIS)

    Gershtein, Yuri; Petriello, Frank; Quackenbush, Seth; Zurek, Kathryn M.

    2008-01-01

    In many theories of physics beyond the standard model, from extra dimensions to Hidden Valleys and models of dark matter, Z ' bosons mediate between standard model particles and hidden sector states. We study the feasibility of observing such hidden states through an invisibly decaying Z ' at the LHC. We focus on the process pp→γZ ' →γXX † , where X is any neutral, (quasi-) stable particle, whether a standard model neutrino or a new state. This complements a previous study using pp→ZZ ' →l + l - XX † . Only the Z ' mass and two effective charges are needed to describe this process. If the Z ' decays invisibly only to standard model neutrinos, then these charges are predicted by observation of the Z ' through the Drell-Yan process, allowing discrimination between Z ' decays to standard model ν's and invisible decays to new states. We carefully discuss all backgrounds and systematic errors that affect this search. We find that hidden sector decays of a 1 TeV Z ' can be observed at 5σ significance with 50 fb -1 at the LHC. Observation of a 1.5 TeV state requires super-LHC statistics of 1 ab -1 . Control of the systematic errors, in particular, the parton distribution function uncertainty of the dominant Zγ background, is crucial to maximize the LHC search reach.

  11. Hidden Markov models for labeled sequences

    DEFF Research Database (Denmark)

    Krogh, Anders Stærmose

    1994-01-01

    A hidden Markov model for labeled observations, called a class HMM, is introduced and a maximum likelihood method is developed for estimating the parameters of the model. Instead of training it to model the statistics of the training sequences it is trained to optimize recognition. It resembles MMI...

  12. Transverse emittance measurement and preservation at the LHC

    Energy Technology Data Exchange (ETDEWEB)

    Kuhn, Maria

    2016-06-20

    The Large Hadron Collider (LHC) at CERN is a high energy storage ring that provides proton and heavy ion collisions to study fundamental particle physics. The luminosity production is closely linked to emittance preservation in the accelerator. The transverse emittance is the phase space density of the beam and should be conserved when the particle beam is transformed through the accelerator. Perturbing effects, however, can lead to emittance increase and hence luminosity degradation. Measuring the emittance growth is a complex task with high intensity beams and changing energies. The machine optics and the transverse beam size have to be measured as accurately as possible. Beta function measurements with k-modulation are discussed. With this method the quadrupole focussing strength is varied and the resulting tune change is traced to determine the beta function at the quadrupole. A new k-modulation measurement tool was developed for the LHC. The fully automatic and online measurement system takes constraints of various systems such as tune measurement precision and powering limitations of the LHC superconducting circuits into account. With sinusoidal k-modulation record low beta function measurement uncertainties in the LHC have been reached. 2015 LHC beta function and β*, which is the beta function at the collision point, measurements with k-modulation will be presented. Wire scanners and synchrotron light monitors are presently used in the LHC to measure the transverse beam size. Accuracy and limitations of the LHC transverse profile monitors are discussed. During the 2012 LHC proton run it was found that wire scanner photomultiplier saturation added significant uncertainty on all measurements. A large discrepancy between emittances from wire scanners and luminosity was discovered but not solved. During Long Shutdown 1 the wire scanner system was upgraded with new photomultipliers. A thorough study of LHC wire scanner measurement precision in 2015 is presented

  13. Transverse emittance dilution due to coupler kicks in linear accelerators

    Directory of Open Access Journals (Sweden)

    Brandon Buckley

    2007-11-01

    Full Text Available One of the main concerns in the design of low emittance linear accelerators (linacs is the preservation of beam emittance. Here we discuss one possible source of emittance dilution, the coupler kick, due to transverse electromagnetic fields in the accelerating cavities of the linac caused by the power coupler geometry. In addition to emittance growth, the coupler kick also produces orbit distortions. It is common wisdom that emittance growth from coupler kicks can be strongly reduced by using two couplers per cavity mounted opposite each other or by having the couplers of successive cavities alternate from above to below the beam pipe so as to cancel each individual kick. While this is correct, including two couplers per cavity or alternating the coupler location requires large technical changes and increased cost for superconducting cryomodules where cryogenic pipes are arranged parallel to a string of several cavities. We therefore analyze consequences of alternate coupler placements. We show here that alternating the coupler location from above to below compensates the emittance growth as well as the orbit distortions. For sufficiently large Q values, alternating the coupler location from before to after the cavity leads to a cancellation of the orbit distortion but not of the emittance growth, whereas alternating the coupler location from before and above to behind and below the cavity cancels the emittance growth but not the orbit distortion. We show that cancellations hold for sufficiently large Q values. These compensations hold even when each cavity is individually detuned, e.g., by microphonics. Another effective method for reducing coupler kicks that is studied is the optimization of the phase of the coupler kick so as to minimize the effects on emittance from each coupler. This technique is independent of the coupler geometry but relies on operating on crest. A final technique studied is symmetrization of the cavity geometry in the

  14. Emittance growth and tune spectra at PETRA III

    International Nuclear Information System (INIS)

    Wanzenberg, R.

    2011-08-01

    At DESY the PETRA ring has been converted into a synchrotron radiation facility, called PETRA III. 20 damping wigglers have been installed to achieve an emittance of 1 nm. The commissioning with beam started in April 2009 and user runs have been started in 2010. The design current is 100 mA and the bunch to bunch distance is 8 ns for one particular filling pattern with 960 bunches. At a current of about 50 mA a strong vertical emittance increase has been observed. During machine studies it was found that the emittance increase depends strongly on the bunch filling pattern. For the user operation a filling scheme has been found which mitigates the increase of the vertical emittance. In August 2010 PETRA III has been operated without damping wigglers for one week. The vertical emittance growth was not significantly smaller without wigglers. Furthermore tune spectra at PETRA III show characteristic lines which have been observed at other storage rings in the connection with electron clouds. Measurements at PETRA III are presented for different bunch filling patterns and with and without wiggler magnets. (orig.)

  15. Measurement of transverse emittance in the Fermilab booster

    Energy Technology Data Exchange (ETDEWEB)

    Graves, William Sproull [Wisconsin U., Madison

    1994-01-01

    A new beam profile monitor has been built and installed in the Fermilab Booster synchrotron. It nondestructively measures the beam's vertical density distribution on a fast turn-by-turn basis. This enables one to measure the beam's transverse emittance and to observe emittance growth as it occurs. For high intensities (>2 times 10^{12 } protons), the normalized 95% emittance was observed to grow from 6pi mm-mrad at injection to 16pi mm-mrad at extraction. The initial (<5 msec) emittance growth and beam losses are shown to be caused by the space charge tune shift onto integer and 1/2 integer resonance lines. The growth near injection accounts for approximately 40% of the observed emittance increase throughout the acceleration cycle. The remaining 60% is due to two factors: slow linear growth due to betatron-motion driven by noise in the rf system; and faster growth after the transition energy that is caused by coupling of the longitudinal beam motion into the transverse planes.

  16. Transverse emittance growth in staged laser-wakefield acceleration

    Directory of Open Access Journals (Sweden)

    T. Mehrling

    2012-11-01

    Full Text Available We present a study on the emittance evolution of electron bunches, externally injected into laser-driven plasma waves using the three-dimensional particle-in-cell (PIC code OSIRIS. Results show order-of-magnitude transverse emittance growth during the injection process, if the electron bunch is not matched to its intrinsic betatron motion inside the wakefield. This behavior is supported by analytic theory reproducing the simulation data to a percent level. The length over which the full emittance growth develops is found to be less than or comparable to the typical dimension of a single plasma module in current multistage designs. In addition, the analytic theory enables the quantitative prediction of emittance degradation in two consecutive accelerators coupled by free-drift sections, excluding this as a scheme for effective emittance-growth suppression, and thus suggests the necessity of beam-matching sections between acceleration stages with fundamental implications on the overall design of staged laser-wakefield accelerators.

  17. Graphene field emitters: A review of fabrication, characterization and properties

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Leifeng, E-mail: chlf@hdu.edu.cn [College of Materials and Environmental Engineering, Hangzhou Dianzi University, Hangzhou 310018 (China); State Key Laboratory of Silicon Materials, Zhejiang University, Hangzhou 310027 (China); Yu, Hu; Zhong, Jiasong; Song, Lihui [College of Materials and Environmental Engineering, Hangzhou Dianzi University, Hangzhou 310018 (China); Wu, Jun, E-mail: wujun@hdu.edu.cn [Institute of Electron Device & Application, Hangzhou Dianzi University, Hangzhou, Zhejiang 310018 (China); Su, Weitao [College of Materials and Environmental Engineering, Hangzhou Dianzi University, Hangzhou 310018 (China)

    2017-06-15

    Highlights: • The preparation, characterization and field emission properties for Gs are reviewed. • The review provides an updated progress on design and construction of Gs field emitters. • The review offers fundamental insights into understanding and design of Gs emitters. • The review can broach the subject and inspire readers in field of Gs based emitters. - Abstract: Graphenes are beneficial to electrons field emission due to its high aspect ratio, high carrier density, the larger carrier mobility, excellent electrical and thermal conductivity, excellent mechanical strength and chemical stability. In recent years, graphene or reduced oxide graphene field emitters have been successfully constructed by various methods such as chemical vapor deposition, chemical exfoliation, electrophoretic deposition, screen-printing and chemical synthesis methods. Graphene emitters are tried to construct in distribution with some angles or vertical orientation with respect to the substrate surface. The vertical alignment of graphene sheets or edges arrays can facilitate efficient electron emission from the atomically thick sheets. Therefore they have even more a low turn-on and threshold-field electronic field, high field enhancement factor, high current stability and high luminance. In this review, we shortly survey and discuss recent research progress in graphene field emission properties with particular an emphasis on their preparing method, characterization and applications in devices especially for vertical graphene and single layer graphene, also including their challenges and future prospects.

  18. Emittance measurements in Grumman 1 MeV beamline

    International Nuclear Information System (INIS)

    Debiak, T.; Gammel, G.; Melnychuk, S.

    1992-01-01

    The emittance of a 30 keV H - beam has been measured with an Allison type electrostatic analyser at two positions separated by 85 cm along the Grumman 1 MeV beamline LEBT at low currents (about 4 mA, no Cs 2 O additive in the source) and at higher currents (10-15 mA, with Cs 2 O additive in the source). No emittance growth was observed between the two positions, but, at the higher current level, the emittance was about 60% higher than at the low current level (Σ n ,rms = .0045 π cm-mrad vs. 0070 π cm-mrad). Argon was then introduced up to a partial pressure of 4x10 -5 torr, and the emittance decreased back to a range corresponding to that found at the lower currents. However, beam noise was observed at the downstream position, and there is evidence for a small amount of emittance growth (<20%) between the two positions

  19. Extended abstract of a hidden agenda

    Energy Technology Data Exchange (ETDEWEB)

    Goguen, J.; Malcolm, G. [Oxford Univ. (United Kingdom)

    1996-12-31

    The initial goal of our hidden research programme was both straightforward and ambitious: give a semantics for software engineering, and in particular for the object paradigm, supporting correctness proofs that are as simple and mechanical as possible. This emphasizes proofs rather than models, and thus suggests an equational approach, rather than one based on higher order logic, denotational semantics, or any kind of model, because equational proofs achieve maximal simplicity and mechanization, and yet are fully expressive. We introduce powerful coinduction techniques for proving behavioral properties of complex systems. We make the no doubt outrageous claim that our hidden approach gives simpler proofs than other formalisms; this is because we exploit algebraic structure that most other approaches discard.

  20. Laser experiments explore the hidden sector

    International Nuclear Information System (INIS)

    Ahlers, M.

    2007-11-01

    Recently, the laser experiments BMV and GammeV, searching for light shining through walls, have published data and calculated new limits on the allowed masses and couplings for axion-like particles. In this note we point out that these experiments can serve to constrain a much wider variety of hidden-sector particles such as, e.g., minicharged particles and hidden-sector photons. The new experiments improve the existing bounds from the older BFRT experiment by a factor of two. Moreover, we use the new PVLAS constraints on a possible rotation and ellipticity of light after it has passed through a strong magnetic field to constrain pure minicharged particle models. For masses -7 times the electron electric charge. This is the best laboratory bound and comparable to bounds inferred from the energy spectrum of the cosmic microwave background. (orig.)

  1. Quantum mechanics and hidden superconformal symmetry

    Science.gov (United States)

    Bonezzi, R.; Corradini, O.; Latini, E.; Waldron, A.

    2017-12-01

    Solvability of the ubiquitous quantum harmonic oscillator relies on a spectrum generating osp (1 |2 ) superconformal symmetry. We study the problem of constructing all quantum mechanical models with a hidden osp (1 |2 ) symmetry on a given space of states. This problem stems from interacting higher spin models coupled to gravity. In one dimension, we show that the solution to this problem is the Vasiliev-Plyushchay family of quantum mechanical models with hidden superconformal symmetry obtained by viewing the harmonic oscillator as a one dimensional Dirac system, so that Grassmann parity equals wave function parity. These models—both oscillator and particlelike—realize all possible unitary irreducible representations of osp (1 |2 ).

  2. Hidden Costs and the Role of Modularity

    DEFF Research Database (Denmark)

    Larsen, Marcus M.

    2013-01-01

    that the inability to effectively estimate the costs of implementing an activity in a foreign location has a negative impact on the process performance of that activity. Performance is deterred as operations are likely to be disrupted by opportunity costs and managerial responses. However, this relationship......This paper addresses estimation errors in strategic decision-making processes due to hidden costs. While previous research has investigated the antecedents of hidden costs, this paper investigates performance consequences. Using unique data on 221 offshoring implementations, it is argued...... is mitigated by the degree of modularity in the activity as it reduces the need for costly coordination in offshoring. This paper contributes to research on offshoring and strategic decision-making by emphasizing the importance of organizational design and of estimating the costs of internal organizational...

  3. High efficiency and stable white OLED using a single emitter

    Energy Technology Data Exchange (ETDEWEB)

    Li, Jian [Arizona State Univ., Tempe, AZ (United States). School of Mechanical, Aerospace, Chemical and Materials Engineering

    2016-01-18

    The ultimate objective of this project was to demonstrate an efficient and stable white OLED using a single emitter on a planar glass substrate. The focus of the project is on the development of efficient and stable square planar phosphorescent emitters and evaluation of such class of materials in the device settings. Key challenges included improving the emission efficiency of molecular dopants and excimers, controlling emission color of emitters and their excimers, and improving optical and electrical stability of emissive dopants. At the end of this research program, the PI has made enough progress to demonstrate the potential of excimer-based white OLED as a cost-effective solution for WOLED panel in the solid state lighting applications.

  4. A polarization-insensitive plasmonic photoconductive terahertz emitter

    KAUST Repository

    Li, Xurong

    2017-11-16

    We present a polarization-insensitive plasmonic photoconductive terahertz emitter that uses a two-dimensional array of nanoscale cross-shaped apertures as the plasmonic contact electrodes. The geometry of the cross-shaped apertures is set to maximize optical pump absorption in close proximity to the contact electrodes. The two-dimensional symmetry of the cross-shaped apertures offers a polarization-insensitive interaction between the plasmonic contact electrodes and optical pump beam. We experimentally demonstrate a polarization-insensitive terahertz radiation from the presented emitter in response to a femtosecond optical pump beam and similar terahertz radiation powers compared to previously demonstrated polarization-sensitive photoconductive emitters with plasmonic contact electrode gratings at the optimum optical pump polarization.

  5. Control and Data Analysis for Emittance Measuring Devices

    CERN Document Server

    Hoffmann, T

    2001-01-01

    Due to the wide range of heavy ion beam intensities and energies in the GSI linac and the associated transfer channel to the synchrotron, several different types of emittance measurement systems have been established. Many common devices such as slit/grid or dipole-sweep systems are integrated into the GSI control system. Other systems like the single shot pepper pot method using CCD-cameras or stand-alone slit/grid set-ups are connected to personal computers. An overview is given about the various systems and their software integration. Main interest is directed on the software development for emittance front-end control and data analysis such as evaluation algorithms or graphical presentation of the results. In addition, special features for improved usability of the software such as data export, project databases and automatic report generation will be presented. An outlook on a unified evaluation procedure for all different types of emittance measurement is given.

  6. Emittance growth in the DARHT Axis-II Downstream Transport

    Energy Technology Data Exchange (ETDEWEB)

    Ekdahl, Jr., Carl August [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Schulze, Martin E. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-04-14

    Using a particle-in-cell (PIC) code, we investigated the possibilities for emittance growth through the quadrupole magnets of the system used to transport the high-current electron beam from an induction accelerator to the bremsstrahlung converter target used for flash radiography. We found that even highly mismatched beams exhibited little emittance growth (< 6%), which we attribute to softening of their initial hard edge current distributions. We also used this PIC code to evaluate the accuracy of emittance measurements using a solenoid focal scan following the quadrupole magnets. If the beam is round after the solenoids, the simulations indicate that the measurement is highly accurate, but it is substantially inaccurate for elliptical beams

  7. Low Emittance Tuning Studies for SuperB

    Energy Technology Data Exchange (ETDEWEB)

    Liuzzo, Simone; /INFN, Pisa; Biagini, Maria; /INFN, Rome; Raimondi, Pantaleo; /INFN, Rome; Donald, Martin; /SLAC

    2012-07-06

    SuperB[1] is an international project for an asymmetric 2 rings collider at the B mesons cm energy to be built in the Rome area in Italy. The two rings will have very small beam sizes at the Interaction Point and very small emittances, similar to the Linear Collider Damping Rings ones. In particular, the ultra low vertical emittances, 7 pm in the LER and 4 pm in the HER, need a careful study of the misalignment errors effects on the machine performances. Studies on the closed orbit, vertical dispersion and coupling corrections have been carried out in order to specify the maximum allowed errors and to provide a procedure for emittance tuning. A new tool which combines MADX and Matlab routines has been developed, allowing for both corrections and tuning. Results of these studies are presented.

  8. Ion concentration in micro and nanoscale electrospray emitters.

    Science.gov (United States)

    Yuill, Elizabeth M; Baker, Lane A

    2018-06-01

    Solution-phase ion transport during electrospray has been characterized for nanopipettes, or glass capillaries pulled to nanoscale tip dimensions, and micron-sized electrospray ionization emitters. Direct visualization of charged fluorophores during the electrospray process is used to evaluate impacts of emitter size, ionic strength, analyte size, and pressure-driven flow on heterogeneous ion transport during electrospray. Mass spectrometric measurements of positively- and negatively-charged proteins were taken for micron-sized and nanopipette emitters under low ionic strength conditions to further illustrate a discrepancy in solution-driven transport of charged analytes. A fundamental understanding of analyte electromigration during electrospray, which is not always considered, is expected to provide control over selective analyte depletion and enrichment, and can be harnessed for sample cleanup. Graphical abstract Fluorescence micrographs of ion migration in nanoscale pipettes while solution is electrosprayed.

  9. Emittance measurement for high-brightness electron guns

    International Nuclear Information System (INIS)

    Kobayashi, H.; Kurihara, T.; Sato, I.; Asami, A.; Yamazaki, Y.; Otani, S.; Ishizawa, Y.

    1992-01-01

    An emittance measurement system based on a high-precision pepper-pot technique has been developed for electron guns with low emittance of around πmm-mrad. Electron guns with a 1 mmφ cathode, the material of which is impregnated tungsten or single-crystal lanthanum hexaboride (La 1-x Ce x )B 6 , have been developed. The performance has been evaluated by putting stress on cathode roughness, which gives rise to an angular divergence, according to the precise emittance measurement system. A new type of cathode holder, which is a modified version of the so called Vogel type, was developed and the beam uniformity has been improved. (Author) 5 figs., tab., 9 refs

  10. Transverse and longitudinal emittance measurements in the ELSA linac

    International Nuclear Information System (INIS)

    Loulergue, A.; Dowell, D.H.; Joly, S.; De Brion, J.P.; Haouat, G.; Schumann, F.

    1997-01-01

    The ELSA RF linac photoinjector has been designed to deliver high-brightness electron beams. The present paper deals with the transverse and longitudinal emittance measurements, at different locations along the ELSA beam line, and the analysis of their variations as a function of the photoinjector parameters : magnetic field generated by the anode focusing lens, bunch charge and pulse duration. While transverse emittance has been already studied in other similar installations, there has been little study of the electron beam longitudinal dynamics. Experimental results are presented and compared to simulation-code expectations. For 2.0 nC, 85 A electron bunches, a normalized rms emittance of 2 π mm mrad and a brightness of 4.5 x 10 13 A/(π m rad) 2 at the linac exit have been measured as well as less than 10 keV rms energy spread (or less than 0.1% at 16.5 MeV). (orig.)

  11. RF emittance in a low energy electron linear accelerator

    Science.gov (United States)

    Sanaye Hajari, Sh.; Haghtalab, S.; Shaker, H.; Kelisani, M. Dayyani

    2018-04-01

    Transverse beam dynamics of an 8 MeV low current (10 mA) S-band traveling wave electron linear accelerator has been studied and optimized. The main issue is to limit the beam emittance, mainly induced by the transverse RF forces. The linac is being constructed at Institute for Research in Fundamental Science (IPM), Tehran Iran Labeled as Iran's First Linac, nearly all components of this accelerator are designed and constructed within the country. This paper discusses the RF coupler induced field asymmetry and the corresponding emittance at different focusing levels, introduces a detailed beam dynamics design of a solenoid focusing channel aiming to reduce the emittance growth and studies the solenoid misalignment tolerances. In addition it has been demonstrated that a prebuncher cavity with appropriate parameters can help improving the beam quality in the transverse plane.

  12. DC-SC Photoinjector with Low Emittance at Peking University

    CERN Document Server

    Xiang Rong; Hao, J; Huang, Senlin; Lu Xiang Yang; Quan, Shengwen; Zhang, Baocheng; Zhao, Kui

    2005-01-01

    High average power Free Electron Lasers require the high quality electron beams with the low emittance and the sub-picosecond bunches. The design of DC-SC photoinjector, directly combining a DC photoinjector with an SRF cavity, can produce high average current beam with moderate bunch charge and high duty factor. Because of the DC gun, the emittance increases quickly at the beginning, so a carefully design is needed to control that. In this paper, the simulation of an upgraded design has been done to lower the normalized emittance below 1.5mm·mrad. The photoinjector consists of a DC gap and a 2+1/2-cell SRF cavity, and it is designed to produce 4.2 MeV electron beams at 100pC bunch charge and 81.25MHz repetition rate (8 mA average current).

  13. Laser Process for Selective Emitter Silicon Solar Cells

    Directory of Open Access Journals (Sweden)

    G. Poulain

    2012-01-01

    Full Text Available Selective emitter solar cells can provide a significant increase in conversion efficiency. However current approaches need many technological steps and alignment procedures. This paper reports on a preliminary attempt to reduce the number of processing steps and therefore the cost of selective emitter cells. In the developed procedure, a phosphorous glass covered with silicon nitride acts as the doping source. A laser is used to open locally the antireflection coating and at the same time achieve local phosphorus diffusion. In this process the standard chemical etching of the phosphorous glass is avoided. Sheet resistance variation from 100 Ω/sq to 40 Ω/sq is demonstrated with a nanosecond UV laser. Numerical simulation of the laser-matter interaction is discussed to understand the dopant diffusion efficiency. Preliminary solar cells results show a 0.5% improvement compared with a homogeneous emitter structure.

  14. Radiation doses and risks from internal emitters

    International Nuclear Information System (INIS)

    Harrison, John; Day, Philip

    2008-01-01

    This review updates material prepared for the UK Government Committee Examining Radiation Risks from Internal Emitters (CERRIE) and also refers to the new recommendations of the International Commission on Radiological Protection (ICRP) and other recent developments. Two conclusions from CERRIE were that ICRP should clarify and elaborate its advice on the use of its dose quantities, equivalent and effective dose, and that more attention should be paid to uncertainties in dose and risk estimates and their implications. The new ICRP recommendations provide explanations of the calculation and intended purpose of the protection quantities, but further advice on their use would be helpful. The new recommendations refer to the importance of understanding uncertainties in estimates of dose and risk, although methods for doing this are not suggested. Dose coefficients (Sv per Bq intake) for the inhalation or ingestion of radionuclides are published as reference values without uncertainty. The primary purpose of equivalent and effective dose is to enable the summation of doses from different radionuclides and from external sources for comparison with dose limits, constraints and reference levels that relate to stochastic risks of whole-body radiation exposure. Doses are calculated using defined biokinetic and dosimetric models, including reference anatomical data for the organs and tissues of the human body. Radiation weighting factors are used to adjust for the different effectiveness of different radiation types, per unit absorbed dose (Gy), in causing stochastic effects at low doses and dose rates. Tissue weighting factors are used to take account of the contribution of individual organs and tissues to overall detriment from cancer and hereditary effects, providing a simple set of rounded values chosen on the basis of age- and sex-averaged values of relative detriment. While the definition of absorbed dose has the scientific rigour required of a basic physical quantity

  15. The Hidden Gifts of Quiet Kids

    Science.gov (United States)

    Trierweiler, Hannah

    2006-01-01

    The author relates that she was an introvert child. It has always taken her time and energy to find her place in a group. As a grown-up, she still needed quiet time to regroup during a busy day. In this article, the author presents an interview with Marti Olsen Laney, author of "The Hidden Gifts of the Introverted Child." During the interview,…

  16. Hidden neuronal correlations in cultured networks

    International Nuclear Information System (INIS)

    Segev, Ronen; Baruchi, Itay; Hulata, Eyal; Ben-Jacob, Eshel

    2004-01-01

    Utilization of a clustering algorithm on neuronal spatiotemporal correlation matrices recorded during a spontaneous activity of in vitro networks revealed the existence of hidden correlations: the sequence of synchronized bursting events (SBEs) is composed of statistically distinguishable subgroups each with its own distinct pattern of interneuron spatiotemporal correlations. These findings hint that each of the SBE subgroups can serve as a template for coding, storage, and retrieval of a specific information

  17. A masking index for quantifying hidden glitches

    OpenAIRE

    Berti-Equille, Laure; Loh, J. M.; Dasu, T.

    2015-01-01

    Data glitches are errors in a dataset. They are complex entities that often span multiple attributes and records. When they co-occur in data, the presence of one type of glitch can hinder the detection of another type of glitch. This phenomenon is called masking. In this paper, we define two important types of masking and propose a novel, statistically rigorous indicator called masking index for quantifying the hidden glitches. We outline four cases of masking: outliers masked by missing valu...

  18. Cold dark matter from the hidden sector

    International Nuclear Information System (INIS)

    Arias, Paola; Pontificia Univ. Catolica de Chile, Santiago

    2012-02-01

    Weakly interacting slim particles (WISPs) such as hidden photons (HP) and axion-like particles (ALPs) have been proposed as cold dark matter candidates. They might be produced non-thermally via the misalignment mechanism, similarly to cold axions. In this talk we review the main processes of thermalisation of HP and we compute the parameter space that may survive as cold dark matter population until today. Our findings are quite encouraging for experimental searches in the laboratory in the near future.

  19. Completing Quantum Mechanics with Quantized Hidden Variables

    OpenAIRE

    van Enk, S. J.

    2015-01-01

    I explore the possibility that a quantum system S may be described completely by the combination of its standard quantum state $|\\psi\\rangle$ and a (hidden) quantum state $|\\phi\\rangle$ (that lives in the same Hilbert space), such that the outcome of any standard projective measurement on the system S is determined once the two quantum states are specified. I construct an algorithm that retrieves the standard quantum-mechanical probabilities, which depend only on $|\\psi\\rangle$, by assuming t...

  20. Cold dark matter from the hidden sector

    Energy Technology Data Exchange (ETDEWEB)

    Arias, Paola [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Pontificia Univ. Catolica de Chile, Santiago (Chile). Facultad de Fisica

    2012-02-15

    Weakly interacting slim particles (WISPs) such as hidden photons (HP) and axion-like particles (ALPs) have been proposed as cold dark matter candidates. They might be produced non-thermally via the misalignment mechanism, similarly to cold axions. In this talk we review the main processes of thermalisation of HP and we compute the parameter space that may survive as cold dark matter population until today. Our findings are quite encouraging for experimental searches in the laboratory in the near future.

  1. Hidden histories: challenges for pedagogy and participation

    OpenAIRE

    Morrice, Linda

    2013-01-01

    Higher Education has become and an increasingly diverse and globalised system in which the binaries between ‘traditional’ and ‘non-traditional’ students, exclusion and inclusion have less resonance and analytical purchase. Drawing on research with refugees Linda will suggest that higher education can be marked simultaneously by belonging and recognition, deficit and exclusion. Complex differences and inequalities remain hidden and unspoken, raising new questions and challenges for pedagogy an...

  2. Hidden sector behind the CKM matrix

    Science.gov (United States)

    Okawa, Shohei; Omura, Yuji

    2017-08-01

    The small quark mixing, described by the Cabibbo-Kobayashi-Maskawa (CKM) matrix in the standard model, may be a clue to reveal new physics around the TeV scale. We consider a simple scenario that extra particles in a hidden sector radiatively mediate the flavor violation to the quark sector around the TeV scale and effectively realize the observed CKM matrix. The lightest particle in the hidden sector, whose contribution to the CKM matrix is expected to be dominant, is a good dark matter (DM) candidate. There are many possible setups to describe this scenario, so that we investigate some universal predictions of this kind of model, focusing on the contribution of DM to the quark mixing and flavor physics. In this scenario, there is an explicit relation between the CKM matrix and flavor violating couplings, such as four-quark couplings, because both are radiatively induced by the particles in the hidden sector. Then, we can explicitly find the DM mass region and the size of Yukawa couplings between the DM and quarks, based on the study of flavor physics and DM physics. In conclusion, we show that DM mass in our scenario is around the TeV scale, and the Yukawa couplings are between O (0.01 ) and O (1 ). The spin-independent DM scattering cross section is estimated as O (10-9) [pb]. An extra colored particle is also predicted at the O (10 ) TeV scale.

  3. Optical characterization of OLED emitter properties by radiation pattern analyses

    Energy Technology Data Exchange (ETDEWEB)

    Flaemmich, Michael

    2011-09-08

    Researches in both, academia and industry are investigating optical loss channels in OLED layered systems by means of optical simulation tools in order to derive promising concepts for a further enhancement of the overall device performance. Besides other factors, the prospects of success of such optimization strategies rely severely on the credibility of the optical input data. The present thesis provides a guideline to measure the active optical properties of OLED emitter materials in situ by radiation pattern analyses. Reliable and widely applicable methods are introduced to determine the internal electroluminescence spectrum, the profile of the emission zone, the dipole emitter orientation, and the internal luminescence quantum efficiency of emissive materials from the optical far field emission of OLEDs in electrical operation. The proposed characterization procedures are applied to sets of OLEDs containing both, fluorescent polymeric materials as well as phosphorescent small-molecular emitters, respectively. On the one hand, quite expected results are obtained. On the other hand, several novel and truly surprising results are found. Most importantly, this thesis contains the first report of a non-isotropic, mainly parallel emitter orientation in a phosphorescent small-molecular guest-host system (Ir(MDQ)2(acac) in a-NPD). Due to the latter result, emitter orientation based optimization of phosphorescent OLEDs seems to be within reach. Since parallel dipoles emit preferably into air, the utilization of smart emissive materials with advantageous molecular orientation is capable to boost the efficiency of phosphorescent OLEDs by 50%. Materials design, the influence of the matrix material and the substrate, as well as film deposition conditions are just a few parameters that need to be studied further in order to exploit the huge potential of the dipole emitter orientation in phosphorescent OLEDs.

  4. Calculating emittance for Gaussian and Non-Gaussian distributions by the method of correlations for slits

    International Nuclear Information System (INIS)

    Tan, Cheng-Yang; Fermilab

    2006-01-01

    One common way for measuring the emittance of an electron beam is with the slits method. The usual approach for analyzing the data is to calculate an emittance that is a subset of the parent emittance. This paper shows an alternative way by using the method of correlations which ties the parameters derived from the beamlets to the actual parameters of the parent emittance. For parent distributions that are Gaussian, this method yields exact results. For non-Gaussian beam distributions, this method yields an effective emittance that can serve as a yardstick for emittance comparisons

  5. Polarization measurements made on LFRA and OASIS emitter arrays

    Science.gov (United States)

    Geske, Jon; Sparkman, Kevin; Oleson, Jim; Laveigne, Joe; Sieglinger, Breck; Marlow, Steve; Lowry, Heard; Burns, James

    2008-04-01

    Polarization is increasingly being considered as a method of discrimination in passive sensing applications. In this paper the degree of polarization of the thermal emission from the emitter arrays of two new Santa Barbara Infrared (SBIR) micro-bolometer resistor array scene projectors was characterized at ambient temperature and at 77 K. The emitter arrays characterized were from the Large Format Resistive Array (LFRA) and the Optimized Arrays for Space-Background Infrared Simulation (OASIS) scene projectors. This paper reports the results of this testing.

  6. Beam emittance reduction during operation of Indus-2

    Energy Technology Data Exchange (ETDEWEB)

    Fakhri, Ali Akbar, E-mail: fakhri@rrcat.gov.in; Kant, Pradeep; Ghodke, A. D.; Singh, Gurnam [Raja Ramanna Centre for Advanced Technology, Indore 452 013 (India)

    2015-11-15

    Indus-2 storage ring is a 2.5 GeV third generation synchrotron radiation source. This source was commissioned using a moderate optics. Beam injection was accomplished using an off momentum electron beam to avoid difficulties faced in storage of beam at 550 MeV. The injection procedure and relevant beam dynamical studies are discussed. The switch over from the moderate optics to low emittance optics is done at 2.5 GeV after storing the electron beam. The procedure evolved to reduce the beam emittance and its implementation during the operation is discussed.

  7. Nanodiamonds with photostable, sub-gigahertz linewidth quantum emitters

    Directory of Open Access Journals (Sweden)

    Toan Trong Tran

    2017-11-01

    Full Text Available Single-photon emitters with narrow linewidths are highly sought after for applications in quantum information processing and quantum communications. In this letter, we report on a bright, highly polarized near infrared single photon emitter embedded in diamond nanocrystals with a narrow, sub-GHz optical linewidth at 10 K. The observed zero-phonon line at ∼780 nm is optically stable under low power excitation and blue shifts as the excitation power increases. Our results highlight the prospect for using new near infrared color centers in nanodiamonds for quantum applications.

  8. Nanodiamonds with photostable, sub-gigahertz linewidth quantum emitters

    Science.gov (United States)

    Tran, Toan Trong; Kianinia, Mehran; Bray, Kerem; Kim, Sejeong; Xu, Zai-Quan; Gentle, Angus; Sontheimer, Bernd; Bradac, Carlo; Aharonovich, Igor

    2017-11-01

    Single-photon emitters with narrow linewidths are highly sought after for applications in quantum information processing and quantum communications. In this letter, we report on a bright, highly polarized near infrared single photon emitter embedded in diamond nanocrystals with a narrow, sub-GHz optical linewidth at 10 K. The observed zero-phonon line at ˜780 nm is optically stable under low power excitation and blue shifts as the excitation power increases. Our results highlight the prospect for using new near infrared color centers in nanodiamonds for quantum applications.

  9. Epitaxial Growth of Germanium on Silicon for Light Emitters

    Directory of Open Access Journals (Sweden)

    Chengzhao Chen

    2012-01-01

    Full Text Available This paper describes the role of Ge as an enabler for light emitters on a Si platform. In spite of the large lattice mismatch of ~4.2% between Ge and Si, high-quality Ge layers can be epitaxially grown on Si by ultrahigh-vacuum chemical vapor deposition. Applications of the Ge layers to near-infrared light emitters with various structures are reviewed, including the tensile-strained Ge epilayer, the Ge epilayer with a delta-doping SiGe layer, and the Ge/SiGe multiple quantum wells on Si. The fundamentals of photoluminescence physics in the different Ge structures are discussed briefly.

  10. Modulation characteristics of graphene-based thermal emitters

    Science.gov (United States)

    Mahlmeister, Nathan Howard; Lawton, Lorreta Maria; Luxmoore, Isaac John; Nash, Geoffrey Richard

    2016-01-01

    We have investigated the modulation characteristics of the emission from a graphene-based thermal emitter both experimentally and through simulations using finite element method modelling. Measurements were performed on devices containing square multilayer graphene emitting areas, with the devices driven by a pulsed DC drive current over a range of frequencies. Simulations show that the dominant heat path is from the emitter to the underlying substrate, and that the thermal resistance between the graphene and the substrate determines the modulation characteristics. This is confirmed by measurements made on devices in which the emitting area is encapsulated by hexagonal boron nitride.

  11. Spectrum of classes of point emitters of electromagnetic wave fields.

    Science.gov (United States)

    Castañeda, Román

    2016-09-01

    The spectrum of classes of point emitters has been introduced as a numerical tool suitable for the design, analysis, and synthesis of non-paraxial optical fields in arbitrary states of spatial coherence. In this paper, the polarization state of planar electromagnetic wave fields is included in the spectrum of classes, thus increasing its modeling capabilities. In this context, optical processing is realized as a filtering on the spectrum of classes of point emitters, performed by the complex degree of spatial coherence and the two-point correlation of polarization, which could be implemented dynamically by using programmable optical devices.

  12. Emittances Studies at the Fermilab/NICADD Photoinjector Laboratory

    CERN Document Server

    Tikhoplav, Rodion; Melissinos, A C; Regis-Guy Piot, Philippe

    2005-01-01

    The Fermilab/NICADD photoinjector incorporates an L-band rf-gun capable of generating 1-10 nC bunches. The bunches are then accelerated to 16 MeV with a TESLA superconducting cavity. In the present paper we present parametric studies of transverse emittances and energy spread for a various operating points of the electron source (RF-gun E-field, laser length and spot size, and solenoid settings). We especially study the impact, on transverse emittance, of Gaussian and Plateau temporal distribution of the photocathode drive-laser.

  13. Mirrorless lasing from light emitters in percolating clusters

    Science.gov (United States)

    Burlak, Gennadiy; Rubo, Y. G.

    2015-07-01

    We describe the lasing effect in the three-dimensional percolation system, where the percolating cluster is filled by active media composed by light emitters excited noncoherently. We show that, due to the presence of a topologically nontrivial photonic structure, the stimulated emission is modified with respect to both conventional and random lasers. The time dynamics and spectra of the lasing output are studied numerically with finite-difference time-domain approach. The Fermat principle and Monte Carlo approach are applied to characterize the optimal optical path and interconnection between the radiating emitters. The spatial structure of the laser mode is found by a long-time FDTD simulation.

  14. Model of emittance growth in a self-pinched beam

    International Nuclear Information System (INIS)

    Lee, E.P.; Yu, S.S.

    1979-01-01

    A semi-phenomenological formula is proposed for the change of emittance of a self-pinched beam which is not matched to its equilibrium radius. Near equilibrium this formula, coupled with an envelope equation, yields the damped sausage oscillations observed in simulation and experiments. For a beam which is injected cold (no transverse velocity spread), the formula coincides with the analytically calculated initial growth of emittance. The basic theory is developed here and used to compute the linear damping rate for several current profiles. The resultant non-linear increase in equilibrium quantities is also calculated in lowest order of the degree of mismatch

  15. Boundary conditions on the plasma emitter surface in the presence of a particle counter flow: I. Ion emitter

    Energy Technology Data Exchange (ETDEWEB)

    Astrelin, V. T., E-mail: V.T.Astrelin@inp.nsk.su; Kotelnikov, I. A. [Russian Academy of Sciences, Budker Institute of Nuclear Physics, Siberian Branch (Russian Federation)

    2017-02-15

    Emission of positively charged ions from a plasma emitter irradiated by a counterpropagating electron beam is studied theoretically. A bipolar diode with a plasma emitter in which the ion temperature is lower than the electron temperature and the counter electron flow is extracted from the ion collector is calculated in the one-dimensional model. An analog of Bohm’s criterion for ion emission in the presence of a counterpropagating electron beam is derived. The limiting density of the counterpropagating beam in a bipolar diode operating in the space-charge-limited-emission regime is calculated. The full set of boundary conditions on the plasma emitter surface that are required for operation of the high-current optics module in numerical codes used to simulate charged particle sources is formulated.

  16. Microwave background constraints on mixing of photons with hidden photons

    International Nuclear Information System (INIS)

    Mirizzi, Alessandro; Redondo, Javier; Sigl, Guenter

    2008-12-01

    Various extensions of the Standard Model predict the existence of hidden photons kinetically mixing with the ordinary photon. This mixing leads to oscillations between photons and hidden photons, analogous to the observed oscillations between different neutrino flavors. In this context, we derive new bounds on the photon-hidden photon mixing parameters using the high precision cosmic microwave background spectral data collected by the Far Infrared Absolute Spectrophotometer instrument on board of the Cosmic Background Explorer. Requiring the distortions of the CMB induced by the photon-hidden photon mixing to be smaller than experimental upper limits, this leads to a bound on the mixing angle χ 0 -7 - 10 -5 for hidden photon masses between 10 -14 eV and 10 -7 eV. This low-mass and low-mixing region of the hidden photon parameter space was previously unconstrained. (orig.)

  17. Microwave background constraints on mixing of photons with hidden photons

    Energy Technology Data Exchange (ETDEWEB)

    Mirizzi, Alessandro [Max-Planck-Institut fuer Physik, Muenchen (Germany); Redondo, Javier [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Sigl, Guenter [Hamburg Univ. (Germany). 2. Inst. fuer Theoretische Physik

    2008-12-15

    Various extensions of the Standard Model predict the existence of hidden photons kinetically mixing with the ordinary photon. This mixing leads to oscillations between photons and hidden photons, analogous to the observed oscillations between different neutrino flavors. In this context, we derive new bounds on the photon-hidden photon mixing parameters using the high precision cosmic microwave background spectral data collected by the Far Infrared Absolute Spectrophotometer instrument on board of the Cosmic Background Explorer. Requiring the distortions of the CMB induced by the photon-hidden photon mixing to be smaller than experimental upper limits, this leads to a bound on the mixing angle {chi}{sub 0} hidden photon masses between 10{sup -14} eV and 10{sup -7} eV. This low-mass and low-mixing region of the hidden photon parameter space was previously unconstrained. (orig.)

  18. A thermionic energy converter with A molybdenum alumina cermet emitter

    NARCIS (Netherlands)

    Gubbels, G.H.M.; Wolff, L.R.; Metselaar, R.; Yogi Goswami, D.

    1988-01-01

    The I-V characteristics of a thermionic converter equipped with a Mo-1w/o AI203 emitter and a Mo collector were measured. The conditions were varied over a limited range without, as well as with Cs. Work functions of Mo as well as Mo-1w/o AI203 were determined. Measurements were carried out in a

  19. Laser-assisted electron emission from gated field-emitters

    CERN Document Server

    Ishizuka, H; Yokoo, K; Mimura, H; Shimawaki, H; Hosono, A

    2002-01-01

    Enhancement of electron emission by illumination of gated field-emitters was studied using a 100 mW cw YAG laser at a wavelength of 532 nm, intensities up to 10 sup 7 W/m sup 2 and mechanically chopped with a rise time of 4 mu s. When shining an array of 640 silicon emitters, the emission current responded quickly to on-off of the laser. The increase of the emission current was proportional to the basic emission current at low gate voltages, but it was saturated at approx 3 mu A as the basic current approached 100 mu A with the increase of gate voltage. The emission increase was proportional to the square root of laser power at low gate voltages and to the laser power at elevated gate voltages. For 1- and 3-tip silicon emitters, the rise and fall of the current due to on-off of the laser showed a significant time lag. The magnitude of emission increase was independent of the position of laser spot on the emitter base and reached 2 mu A at a basic current of 5 mu A without showing signs of saturation. The mech...

  20. Calculation Of Extraction Optics For Ion System With Plazma Emitter

    CERN Document Server

    Frolov, B A

    2004-01-01

    The 2-D code for simulating of ion optics system of positive ion extraction from a plasma source is described. Example calculation of 100 kV optics for the extraction ion IHEP gun is presented. The trajectories of particles and emittance plots are resulted. The aberrations influ-ence strongly on ion optics for considered geometry.

  1. Short-lived positron emitter labeled radiotracers - present status

    International Nuclear Information System (INIS)

    Fowler, J.S.; Wolf, A.P.

    1982-01-01

    The preparation of labelled compounds is important for the application of positron emission transaxial tomography (PETT) in biomedical sciences. This paper describes problems and progress in the synthesis of short-lived positron emitter ( 11 C, 18 F, 13 N) labelled tracers for PETT. Synthesis of labelled sugars, amino acids, and neurotransmitter receptors (pimozide and spiroperidol tagged with 11 C) is discussed in particular

  2. Scanning Emitter Lifetime Imaging Microscopy for Spontaneous Emission Control

    DEFF Research Database (Denmark)

    Frimmer, Martin; Chen, Yuntian; Koenderink, A. Femius

    2011-01-01

    We report an experimental technique to map and exploit the local density of optical states of arbitrary planar nanophotonic structures. The method relies on positioning a spontaneous emitter attached to a scanning probe deterministically and reversibly with respect to its photonic environment while...

  3. Emittance control and RF bunch compression in the NSRRC photoinjector

    International Nuclear Information System (INIS)

    Lau, W.K.; Hung, S.B.; Lee, A.P.; Chou, C.S.; Huang, N.Y.

    2011-01-01

    The high-brightness photoinjector being constructed at the National Synchrotron Radiation Research Center is for testing new accelerator and light-source concepts. It is the so-called split photoinjector configuration in which a short solenoid magnet is used for emittance compensation. The UV-drive laser pulses are also shaped to produce uniform cylindrical bunches for further reduction of beam emittance. However, limited by the available power from our microwave power system, the nominal accelerating gradient in the S-band booster linac is set at 18 MV/m. A simulation study with PARMELA shows that the linac operating at this gradient fails to freeze the electron beam emittance at low value. A background solenoid magnetic field is applied for beam emittance control in the linac during acceleration. A satisfactory result that meets our preliminary goal has been achieved with the solenoid magnetic field strength at 0.1 T. RF bunch compression as a means to achieve the required beam brightness for high-gain free-electron laser experiments is also examined. The reduction of bunch length to a few hundred femtoseconds can be obtained.

  4. Application of positron emitters to studies on plants

    Energy Technology Data Exchange (ETDEWEB)

    Ishioka, N S; Matsuoka, H [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment; Sekine, T [and others

    1998-10-01

    A newly developed positron emitting tracer imaging system enables us to study dynamically the physiological function of plants, although this system covers, at present, a limited area in a plant. Production of the positron emitters {sup 11}C, {sup 13}N, {sup 18}F and {sup 48}V for this application, using an AVF cyclotron, is described. (author)

  5. Beam emittance of the Stony Brook Tandem-LINAC booster

    International Nuclear Information System (INIS)

    Scholldorf, A.H.

    1984-01-01

    This dissertation is primarily a study of the longitudinal and transverse beam emittance of the Stony Brook Heavy Ion Tandem LINAC Accelerator Facility, with a secondary emphasis on the beam dynamical design of two key elements of the system: a low energy double-drift buncher, and an achromatic double-90 0 LINAC injection system. A transverse emittance measuring system consisting of two translation stages controlled by stepper motors is described. Each stage carried a pair of beam defining slits mounted so that both horizontal and vertical emittances could be measured with only linear motion of the stage assembly. Beam currents were measured directly by a low-noise, high-sensitivity electrometer circuit integrated with the second slit-stage assembly. A mini-computer controlled the motors and acquired and displayed the data. Transverse emittance areas of beams of 12 C, 16 O, 32 S, and 58 Ni were measured at ion source extraction potential, after ion source acceleration, after tandem acceleration, and after LINAC acceleration. The results were analyzed in terms of source sputter-cone geometry, angle straggling in gas and foil strippers, and a variety of other factors

  6. Emittance growth due to beam-gas scattering

    International Nuclear Information System (INIS)

    Raubenheimer, T.O.

    1992-06-01

    The effect of beam-gas scattering on beam emittance is examined by deriving the beam distribution function. The distribution function is found by treating the beam-gas scattering as a filtered Poisson process and calculating the cumulants of the distribution. (author)

  7. Emittance growth in laser-driven RF electron guns

    International Nuclear Information System (INIS)

    Kim, K.J.

    1989-01-01

    A simple analysis for the evolution of the electron-beam phase space distribution in laser-driven rf guns is presented. In particular, formulas are derived for the transverse and longitudinal emittances at the exit of the gun. The results are compared and found to agree well with those from simulation. (Author). 9 refs.; 4 figs

  8. A compact electron gun using field emitter array

    International Nuclear Information System (INIS)

    Asakawa, M.R.; Ikeda, A.; Miyabe, N.; Yamaguchi, S.; Kusaba, M.; Tsunawaki, Y.

    2008-01-01

    A compact electron gun using field emitter array has been developed. With a simple triode configuration consisting of FEA, mid-electrode and anode electrode, the electron gun produces a parallel beam with a diameter of 0.5 mm. This electron gun is applicable for compact radiation sources such as Cherenkov free-electron lasers

  9. Beam aperture and emittance growth in the AGS-Booster

    International Nuclear Information System (INIS)

    Parsa, Z.

    1987-01-01

    The authors have developed analytical tools for calculating the variation of particle action, smear and emittance growth due to nonlinear elements in accelerators (with second order perturbation theory in two dimensions). The authors' results for the AGS-Booster is presented

  10. The emittance of high current heavy ion beams

    International Nuclear Information System (INIS)

    White, N.R.; Devaney, A.S.

    1989-01-01

    Ion implantation is the main application for high current heavy ion beams. Transfer ratio is defined as the ratio of the total ion current leaving the ion source to the current delivered to the endstation. This ratio is monitored and logged and its importance is explained. It is also affected by other factors, such as the isotopic and molecular composition of the total ion beam. The transfer ratio reveals the fraction of ions which are intercepted by parts of the beamline system. The effects of these ions are discussed in two categories: processing purity and reliability. In discussing the emittance of ribbon beams, the two orthogonal planes are usually considered separately. Longitudinal emittance is determined by slot length and by plasma ion temperature. It has already been revealed that the longitudinal divergence of the beams from BF3 is perhaps double that of the beam from arsenic vapour or argon, at the same total perveance from the ion source. This poses the question: why is the ion temperature higher for BF3 than for As or Ar? The transverse emittance is in practical terms dominated by the divergence. It is the most fruitful area for improvement in most real-world systems. There is an intrinsic divergence arising from initial ion energies within the plasma, and there is emittance growth that can occur as a result of aberration in the beam extraction optics. (N.K.)

  11. Porous Emitter Colloid Thruster Performance Characterization Using Optical Techniques

    Science.gov (United States)

    2013-03-01

    that the surface of the cone is equipotential . In order to include this constraint, Laplace’s Equation was used in the axisymmetric case to solve...43 ix Page 3.3 Emitter Surface Imaging...3. Taylor Cone geometry showing the opposing electric and internal surface tension stresses

  12. Selective solar absorber emittance measurement at elevated temperature

    Science.gov (United States)

    Giraud, Philémon; Braillon, Julien; Raccurt, Olivier

    2017-06-01

    Durability of solar components for CSP (Concentrated Solar Power Plant) technologies is a key point to lower cost and ensure their large deployment. These technologies concentrated the solar radiation by means of mirrors on a receiver tube where it is collected as thermal energy. The absorbers are submitted to strong environmental constraints and the degradation of their optical properties (emittance and solar absorbance) have a direct impact on performance. The characterization of a material in such condition is complicated and requires advanced apparatuses, and different measurement methods exist for the determination of the two quantities of relevance regarding an absorber, which are its emittance and its solar absorbance. The objective is to develop new optical equipment for measure the emittance of this solar absorber at elevated temperature. In this paper, we present an optical bench developed for emittance measurement on absorbers is conditions of use. Results will be shown, with a discussion of some factors of influence over this measurement and how to control them.

  13. Auger electron emitters: Insights gained from in vitro experiments

    International Nuclear Information System (INIS)

    Makrigiorgos, G.; Adelstein, S.J.; Kassis, A.I.

    1990-01-01

    This paper outlines the evolution of the current rationale for research into the biological effects of tissue-incorporated Auger electron emitters. The first section is a brief review of the research conducted by several groups in the last fifteen years. The second section describes the in vitro model used in our studies, dosimetric calculations, experimental techniques and recent findings. The third section focuses on the use of Auger electron emitters as in vitro microprobes for the investigation of the radiosensitivity of distinct subcellular components. Examination of the biological effects of the Auger electron emitter 125 I located in different cellular compartments of a single cell line (V 79 hamster lung fibroblast) verifies that DNA is the critical cell structure for radiation damage and that the sensitive sites are of nanometer dimensions. The data from incorporation of several Auger electron emitters at the same location within DNA suggest that there are no saturation effects from the decay of these isotopes (i.e. all the emitted energy is biologically effective) and provide some insight into which of the numerous physical mechanisms accompanying the Auger decay are most important in causing cell damage. Finally the implications of Auger electron emission for radiotherapy and radiation protection in diagnostic nuclear medicine are detailed and further research possibilities are suggested. (orig.)

  14. Accurate measurement of directional emittance of solar energy materials

    NARCIS (Netherlands)

    Nijnatten, van P.A.; Hugo-Le Gof, A.; Granqvist, C.-G.; Lampert, C.M.

    1992-01-01

    Directional emittance plays an important role in the calculation of radiative heat exchange. It partly determines the thermal insulation of single and multiple glazing and the efficiency of solar collectors. An emissiometer has been designed and built, capable for measurements of the directional

  15. Development of new microencapsulated beta emitters for internal radiotherapy

    International Nuclear Information System (INIS)

    Perdrisot, R.; Monteil, J.; Le Jeune, J.J.; Pouliquen, D.; Jallet, P.; Beau, P.; Lepape, A.

    1993-01-01

    We have developed new microencapsulated beta emitter radiotracers which could be used in nuclear medicine for selective internal radiotherapy. Their efficacy was evaluated on B16 melanoma tumor model in mice, using phosphorus 31 spectroscopy. This kind of tracer would allow a precise targetting of beta irradiation

  16. Passive emitter location with Doppler frequency and interferometric measurements

    NARCIS (Netherlands)

    Groot, J.S.; Dam, F.A.M.; Theil, A.

    2008-01-01

    Ground based emitters can be located with a receiver installed on an airborne platform. This paper discusses techniques based on Doppler frequency and differential phase measurements (interferometry). Measurements of the first technique are provided, while we discuss and compare the theoretical

  17. A combined emitter threat assessment method based on ICW-RCM

    Science.gov (United States)

    Zhang, Ying; Wang, Hongwei; Guo, Xiaotao; Wang, Yubing

    2017-08-01

    Considering that the tradition al emitter threat assessment methods are difficult to intuitively reflect the degree of target threaten and the deficiency of real-time and complexity, on the basis of radar chart method(RCM), an algorithm of emitter combined threat assessment based on ICW-RCM (improved combination weighting method, ICW) is proposed. The coarse sorting is integrated with fine sorting in emitter combined threat assessment, sequencing the emitter threat level roughly accordance to radar operation mode, and reducing task priority of the low-threat emitter; On the basis of ICW-RCM, sequencing the same radar operation mode emitter roughly, finally, obtain the results of emitter threat assessment through coarse and fine sorting. Simulation analyses show the correctness and effectiveness of this algorithm. Comparing with classical method of emitter threat assessment based on CW-RCM, the algorithm is visual in image and can work quickly with lower complexity.

  18. The effects of emitter-tied field plates on lateral PNP ionizing radiation response

    International Nuclear Information System (INIS)

    Barnaby, H.J.; Schrimpf, R.D.; Cirba, C.R.; Pease, R.L.; Fleetwood, D.M.; Kosier, S.L.

    1998-03-01

    Radiation response comparisons of lateral PNP bipolar technologies reveal that device hardening may be achieved by extending the emitter contact over the active base. The emitter-tied field plate suppresses recombination of carriers with interface traps

  19. VISIBLE COSTS AND HIDDEN COSTS IN THE BAKING INDUSTRY

    Directory of Open Access Journals (Sweden)

    Criveanu Maria

    2013-04-01

    Full Text Available Hidden costs are present in the activity of any company, hardly identified in the traditional administrative accounting. The high levels of the hidden costs and their unknown presence have serious consequences on the decisions made by the managers. This paper aims at presenting some aspects related to the hidden costs that occur in the activity of the companies in the baking industry and the possibilities to reduce their level.

  20. Emitter/absorber interface of CdTe solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Song, Tao, E-mail: tsong241@gmail.com; Sites, James R. [Physics Department, Colorado State University, Fort Collins, Colorado 80523 (United States); Kanevce, Ana [National Renewable Energy Laboratory, Golden, Colorado 80401 (United States)

    2016-06-21

    The performance of CdTe solar cells can be very sensitive to the emitter/absorber interface, especially for high-efficiency cells with high bulk lifetime. Performance losses from acceptor-type interface defects can be significant when interface defect states are located near mid-gap energies. Numerical simulations show that the emitter/absorber band alignment, the emitter doping and thickness, and the defect properties of the interface (i.e., defect density, defect type, and defect energy) can all play significant roles in the interface recombination. In particular, a type I heterojunction with small conduction-band offset (0.1 eV ≤ ΔE{sub C} ≤ 0.3 eV) can help maintain good cell efficiency in spite of high interface defect density, much like with Cu(In,Ga)Se{sub 2} (CIGS) cells. The basic principle is that positive ΔE{sub C}, often referred to as a “spike,” creates an absorber inversion and hence a large hole barrier adjacent to the interface. As a result, the electron-hole recombination is suppressed due to an insufficient hole supply at the interface. A large spike (ΔE{sub C} ≥ 0.4 eV), however, can impede electron transport and lead to a reduction of photocurrent and fill-factor. In contrast to the spike, a “cliff” (ΔE{sub C} < 0 eV) allows high hole concentration in the vicinity of the interface, which will assist interface recombination and result in a reduced open-circuit voltage. Another way to mitigate performance losses due to interface defects is to use a thin and highly doped emitter, which can invert the absorber and form a large hole barrier at the interface. CdS is the most common emitter material used in CdTe solar cells, but the CdS/CdTe interface is in the cliff category and is not favorable from the band-offset perspective. The ΔE{sub C} of other n-type emitter choices, such as (Mg,Zn)O, Cd(S,O), or (Cd,Mg)Te, can be tuned by varying the elemental ratio for an optimal positive value of ΔE{sub C}. These

  1. Compressing the hidden variable space of a qubit

    International Nuclear Information System (INIS)

    Montina, Alberto

    2011-01-01

    In previously exhibited hidden variable models of quantum state preparation and measurement, the number of continuous hidden variables describing the actual state of single realizations is never smaller than the quantum state manifold dimension. We introduce a simple model for a qubit whose hidden variable space is one-dimensional, i.e., smaller than the two-dimensional Bloch sphere. The hidden variable probability distributions associated with quantum states satisfy reasonable criteria of regularity. Possible generalizations of this shrinking to an N-dimensional Hilbert space are discussed.

  2. Zipf exponent of trajectory distribution in the hidden Markov model

    Science.gov (United States)

    Bochkarev, V. V.; Lerner, E. Yu

    2014-03-01

    This paper is the first step of generalization of the previously obtained full classification of the asymptotic behavior of the probability for Markov chain trajectories for the case of hidden Markov models. The main goal is to study the power (Zipf) and nonpower asymptotics of the frequency list of trajectories of hidden Markov frequencys and to obtain explicit formulae for the exponent of the power asymptotics. We consider several simple classes of hidden Markov models. We prove that the asymptotics for a hidden Markov model and for the corresponding Markov chain can be essentially different.

  3. Zipf exponent of trajectory distribution in the hidden Markov model

    International Nuclear Information System (INIS)

    Bochkarev, V V; Lerner, E Yu

    2014-01-01

    This paper is the first step of generalization of the previously obtained full classification of the asymptotic behavior of the probability for Markov chain trajectories for the case of hidden Markov models. The main goal is to study the power (Zipf) and nonpower asymptotics of the frequency list of trajectories of hidden Markov frequencys and to obtain explicit formulae for the exponent of the power asymptotics. We consider several simple classes of hidden Markov models. We prove that the asymptotics for a hidden Markov model and for the corresponding Markov chain can be essentially different

  4. Low Emittance Guns for the ILC Polarized Electron Beam

    International Nuclear Information System (INIS)

    Clendenin, J. E.; Brachmann, A.; Ioakeimidi, K.; Kirby, R. E.; Maruyama, T.; Miller, R. H.; Wang, J. W.; Zhou, F.

    2007-01-01

    Polarized electron beams generated by DC guns are routinely available at several accelerators including JLAB, Mainz and SLAC. These guns operate with a cathode bias on the order of -100 kV. To minimize space charge effects, relatively long bunches are generated at the gun and then compressed longitudinally external to the gun just before and during initial acceleration. For linear colliders, this compression is accomplished using a combination of rf bunchers. For the basic design of the International Linear Collider (ILC), a 120 kV DC photocathode gun is used to produce a series of nanosecond bunches that are each compressed by two sub-harmonic bunchers (SHBs) followed by an L-band buncher and capture section. The longitudinal bunching process results in a significantly higher emittance than produced by the gun alone. While high-energy experiments using polarized beams are not generally sensitive to the source emittance, there are several benefits to a lower source emittance including a simpler more efficient injector system and a lower radiation load during transport especially at bends as at the damping ring. For the ILC, the SHBs could be eliminated if the voltage of the gun is raised sufficiently. Simulations using the General Particle Tracer (GPT) package indicate that a cathode bias voltage of ≥200 kV should allow both SHBs to be operated at 433 or even 650 MHz, while ≥500 kV would be required to eliminate the SHBs altogether. Simulations can be used to determine the minimum emittance possible if the injector is designed for a given increased voltage. A possible alternative to the DC gun is an rf gun. Emittance compensation, routinely used with rf guns, is discussed for higher-voltage DC guns

  5. Preservation of low slice emittance in bunch compressors

    Directory of Open Access Journals (Sweden)

    S. Bettoni

    2016-03-01

    Full Text Available Minimizing the dilution of the electron beam emittance is crucial for the performance of accelerators, in particular for free electron laser facilities, where the length of the machine and the efficiency of the lasing process depend on it. Measurements performed at the SwissFEL Injector Test Facility revealed an increase in slice emittance after compressing the bunch even for moderate compression factors. The phenomenon was experimentally studied by characterizing the dependence of the effect on beam and machine parameters relevant for the bunch compression. The reproduction of these measurements in simulation required the use of a 3D beam dynamics model along the bunch compressor that includes coherent synchrotron radiation. Our investigations identified transverse effects, such as coherent synchrotron radiation and transverse space charge as the sources of the observed emittance dilution, excluding other effects, such as chromatic effects on single slices or spurious dispersion. We also present studies, both experimental and simulation based, on the effect of the optics mismatch of the slices on the variation of the slice emittance along the bunch. After a corresponding reoptimization of the beam optics in the test facility we reached slice emittances below 200 nm for the central slices along the longitudinal dimension with a moderate increase up to 300 nm in the head and tail for a compression factor of 7.5 and a bunch charge of 200 pC, equivalent to a final current of 150 A, at about 230 MeV energy.

  6. Low Emittance Guns for the ILC Polarized Electron Beam

    International Nuclear Information System (INIS)

    Clendenin, J.E.; Brachmann, A.; Ioakeimidi, K.; Kirby, R.E.; Maruyama, T.; Miller, R.H.; Wang, J.W.; Zhou, F.; SLAC

    2006-01-01

    Polarized electron beams generated by DC guns are routinely available at several accelerators including JLAB, Mainz and SLAC. These guns operate with a cathode bias on the order of -100 kV. To minimize space charge effects, relatively long bunches are generated at the gun and then compressed longitudinally external to the gun just before and during initial acceleration. For linear colliders, this compression is accomplished using a combination of rf bunchers. For the basic design of the International Linear Collider (ILC), a 120 kV DC photocathode gun is used to produce a series of nanosecond bunches that are each compressed by two sub-harmonic bunchers (SHBs) followed by an L-band buncher and capture section. The longitudinal bunching process results in a significantly higher emittance than produced by the gun alone. While high-energy experiments using polarized beams are not generally sensitive to the source emittance, there are several benefits to a lower source emittance including a simpler more efficient injector system and a lower radiation load during transport especially at bends as at the damping ring. For the ILC, the SHBs could be eliminated if the voltage of the gun is raised sufficiently. Simulations using the General Particle Tracer (GPT) package indicate that a cathode bias voltage of (ge)200 kV should allow both SHBs to be operated at 433 or even 650 MHz, while (ge)500 kV would be required to eliminate the SHBs altogether. Simulations can be used to determine the minimum emittance possible if the injector is designed for a given increased voltage. A possible alternative to the DC gun is an rf gun. Emittance compensation, routinely used with rf guns, is discussed for higher-voltage DC guns

  7. Hidden acoustic information revealed by intentional nonlinearity

    Science.gov (United States)

    Dowling, David R.

    2017-11-01

    Acoustic waves are omnipresent in modern life and are well described by the linearized equations of fluid dynamics. Once generated, acoustic waves carry and collect information about their source and the environment through which they propagate, respectively, and this information may be retrieved by analyzing recordings of these waves. Because of this, acoustics is the primary means for observation, surveillance, reconnaissance, and remote sensing in otherwise opaque environments, such as the Earth's oceans and crust, and the interior of the human body. For such information-retrieval tasks, acoustic fields are nearly always interrogated within their recorded frequency range or bandwidth. However, this frequency-range restriction is not general; acoustic fields may also carry (hidden) information at frequencies outside their bandwidth. Although such a claim may seem counter intuitive, hidden acoustic-field information can be revealed by re-introducing a marquee trait of fluid dynamics: nonlinearity. In particular, an intentional quadratic nonlinearity - a form of intra-signal heterodyning - can be used to obtain acoustic field information at frequencies outside a recorded acoustic field's bandwidth. This quadratic nonlinearity enables a variety of acoustic remote sensing applications that were long thought to be impossible. In particular, it allows the detrimental effects of sparse recordings and random scattering to be suppressed when the original acoustic field has sufficient bandwidth. In this presentation, the topic is developed heuristically, with a just brief exposition of the relevant mathematics. Hidden acoustic field information is then revealed from simulated and measured acoustic fields in simple and complicated acoustic environments involving frequencies from a few Hertz to more than 100 kHz, and propagation distances from tens of centimeters to hundreds of kilometers. Sponsored by ONR, NAVSEA, and NSF.

  8. Recovering a hidden polarization by ghost polarimetry.

    Science.gov (United States)

    Janassek, Patrick; Blumenstein, Sébastien; Elsäßer, Wolfgang

    2018-02-15

    By exploiting polarization correlations of light from a broadband fiber-based amplified spontaneous emission source we succeed in reconstructing a hidden polarization in a ghost polarimetry experiment in close analogy to ghost imaging and ghost spectroscopy. Thereby, an original linear polarization state in the object arm of a Mach-Zehnder interferometer configuration which has been camouflaged by a subsequent depolarizer is recovered by correlating it with light from a reference beam. The variation of a linear polarizer placed inside the reference beam results in a Malus law type second-order intensity correlation with high contrast, thus measuring a ghost polarigram.

  9. Pruning Boltzmann networks and hidden Markov models

    DEFF Research Database (Denmark)

    Pedersen, Morten With; Stork, D.

    1996-01-01

    We present sensitivity-based pruning algorithms for general Boltzmann networks. Central to our methods is the efficient calculation of a second-order approximation to the true weight saliencies in a cross-entropy error. Building upon previous work which shows a formal correspondence between linear...... Boltzmann chains and hidden Markov models (HMMs), we argue that our method can be applied to HMMs as well. We illustrate pruning on Boltzmann zippers, which are equivalent to two HMMs with cross-connection links. We verify that our second-order approximation preserves the rank ordering of weight saliencies...

  10. Hidden Scale Invariance in Condensed Matter

    DEFF Research Database (Denmark)

    Dyre, J. C.

    2014-01-01

    . This means that the phase diagram becomes effectively one-dimensional with regard to several physical properties. Liquids and solids with isomorphs include most or all van der Waals bonded systems and metals, as well as weakly ionic or dipolar systems. On the other hand, systems with directional bonding...... (hydrogen bonds or covalent bonds) or strong Coulomb forces generally do not exhibit hidden scale invariance. The article reviews the theory behind this picture of condensed matter and the evidence for it coming from computer simulations and experiments...

  11. Uncovering the Hidden Costs of Offshoring

    DEFF Research Database (Denmark)

    Larsen, Marcus M.; Manning, Stephan; Pedersen, Torben

    2013-01-01

    This study investigates estimation errors due to hidden costs—the costs of implementation that are neglected in strategic decision-making processes—in the context of services offshoring. Based on data from the Offshoring Research Network, we find that decision makers are more likely to make cost......-estimation errors given increasing configuration and task complexity in captive offshoring and offshore outsourcing, respectively. Moreover, we show that experience and a strong orientation toward organizational design in the offshoring strategy reduce the cost-estimation errors that follow from complexity. Our...

  12. The hidden face of the petroleum

    International Nuclear Information System (INIS)

    Laurent, E.

    2006-02-01

    For the first time, a book reveals what that was hidden to the public opinions: why the petroleum crisis of 1973 what only a manipulation, an arrangement between the OPEC and the petroleum companies, why the data concerning the petroleum reserves are wrong and increased by the producers countries, how Washington used the Saudi petroleum weapon to create the Soviet Union fall, and why from march 2001 maps of the Iraq (where were drawn the future petroleum explorations) were working documents for the vice President Cheney and petroleum managers for the ''secret society''. (A.L.B.)

  13. Evolving the structure of hidden Markov Models

    DEFF Research Database (Denmark)

    won, K. J.; Prugel-Bennett, A.; Krogh, A.

    2006-01-01

    A genetic algorithm (GA) is proposed for finding the structure of hidden Markov Models (HMMs) used for biological sequence analysis. The GA is designed to preserve biologically meaningful building blocks. The search through the space of HMM structures is combined with optimization of the emission...... and transition probabilities using the classic Baum-Welch algorithm. The system is tested on the problem of finding the promoter and coding region of C. jejuni. The resulting HMM has a superior discrimination ability to a handcrafted model that has been published in the literature....

  14. The hidden costs of nuclear power

    International Nuclear Information System (INIS)

    Keough, C.

    1981-01-01

    The two basic hidden costs of nuclear power are public money and public health. Nuclear power appears to be economical because many of the costs of producins electricity in these plants are paid by the federal government. So, like it or not, the citizens are footing the bill with their taxes. Design and development of plants have been paid for with public money, and disposal and cleanup costs will also be paid in this manner. The economic and health costs associated with nuclear accidents are staggering

  15. Genetic Algorithms Principles Towards Hidden Markov Model

    Directory of Open Access Journals (Sweden)

    Nabil M. Hewahi

    2011-10-01

    Full Text Available In this paper we propose a general approach based on Genetic Algorithms (GAs to evolve Hidden Markov Models (HMM. The problem appears when experts assign probability values for HMM, they use only some limited inputs. The assigned probability values might not be accurate to serve in other cases related to the same domain. We introduce an approach based on GAs to find
    out the suitable probability values for the HMM to be mostly correct in more cases than what have been used to assign the probability values.

  16. Detecting Structural Breaks using Hidden Markov Models

    DEFF Research Database (Denmark)

    Ntantamis, Christos

    Testing for structural breaks and identifying their location is essential for econometric modeling. In this paper, a Hidden Markov Model (HMM) approach is used in order to perform these tasks. Breaks are defined as the data points where the underlying Markov Chain switches from one state to another....... The estimation of the HMM is conducted using a variant of the Iterative Conditional Expectation-Generalized Mixture (ICE-GEMI) algorithm proposed by Delignon et al. (1997), that permits analysis of the conditional distributions of economic data and allows for different functional forms across regimes...

  17. On the design guideline for the low emittance synchrotron radiation source

    International Nuclear Information System (INIS)

    Kamiya, Y.; Kihara, M.

    1983-09-01

    In this note we will describe how the emittance of the electron storage ring is determined by the orbit parameters of the storage ring and show the lowest value of emittance which is achieved theoretically. Implication of this note with regard to the design of the low emittance storage ring will be discussed. (author)

  18. Global Update and Trends of Hidden Hunger, 1995-2011: The Hidden Hunger Index

    Science.gov (United States)

    Stevens, Gretchen A.; Ezzati, Majid; Black, Robert E.; Kraemer, Klaus

    2015-01-01

    Background Deficiencies in essential vitamins and minerals–also termed hidden hunger–are pervasive and hold negative consequences for the cognitive and physical development of children. Methods This analysis evaluates the change in hidden hunger over time in the form of one composite indicator–the Hidden Hunger Index (HHI)–using an unweighted average of prevalence estimates from the Nutrition Impact Model Study for anemia due to iron deficiency, vitamin A deficiency, and stunting (used as a proxy indicator for zinc deficiency). Net changes from 1995–2011 and population weighted regional means for various time periods are measured. Findings Globally, hidden hunger improved (-6.7 net change in HHI) from 1995–2011. Africa was the only region to see a deterioration in hidden hunger (+1.9) over the studied time period; East Asia and the Pacific performed exceptionally well (-13.0), while other regions improved only slightly. Improvements in HHI were mostly due to reductions in zinc and vitamin A deficiencies, while anemia due to iron deficiency persisted and even increased. Interpretation This analysis is critical for informing and tracking the impact of policy and programmatic efforts to reduce micronutrient deficiencies, to advance the global nutrition agenda, and to achieve the Millennium Development Goals (MDGs). However, there remains an unmet need to invest in gathering frequent, nationally representative, high-quality micronutrient data as we renew our efforts to scale up nutrition, and as we enter the post-2015 development agenda. Funding Preparation of this manuscript was funded by Sight and Life. There was no funding involved in the study design, data collection, analysis, or decision to publish. PMID:26673631

  19. Global Update and Trends of Hidden Hunger, 1995-2011: The Hidden Hunger Index.

    Directory of Open Access Journals (Sweden)

    Julie C Ruel-Bergeron

    Full Text Available Deficiencies in essential vitamins and minerals-also termed hidden hunger-are pervasive and hold negative consequences for the cognitive and physical development of children.This analysis evaluates the change in hidden hunger over time in the form of one composite indicator-the Hidden Hunger Index (HHI-using an unweighted average of prevalence estimates from the Nutrition Impact Model Study for anemia due to iron deficiency, vitamin A deficiency, and stunting (used as a proxy indicator for zinc deficiency. Net changes from 1995-2011 and population weighted regional means for various time periods are measured.Globally, hidden hunger improved (-6.7 net change in HHI from 1995-2011. Africa was the only region to see a deterioration in hidden hunger (+1.9 over the studied time period; East Asia and the Pacific performed exceptionally well (-13.0, while other regions improved only slightly. Improvements in HHI were mostly due to reductions in zinc and vitamin A deficiencies, while anemia due to iron deficiency persisted and even increased.This analysis is critical for informing and tracking the impact of policy and programmatic efforts to reduce micronutrient deficiencies, to advance the global nutrition agenda, and to achieve the Millennium Development Goals (MDGs. However, there remains an unmet need to invest in gathering frequent, nationally representative, high-quality micronutrient data as we renew our efforts to scale up nutrition, and as we enter the post-2015 development agenda.Preparation of this manuscript was funded by Sight and Life. There was no funding involved in the study design, data collection, analysis, or decision to publish.

  20. Hidden in plain sight: the formal, informal, and hidden curricula of a psychiatry clerkship.

    Science.gov (United States)

    Wear, Delese; Skillicorn, Jodie

    2009-04-01

    To examine perceptions of the formal, informal, and hidden curricula in psychiatry as they are observed and experienced by (1) attending physicians who have teaching responsibilities for residents and medical students, (2) residents who are taught by those same physicians and who have teaching responsibilities for medical students, and (3) medical students who are taught by attendings and residents during their psychiatry rotation. From June to November 2007, the authors conducted focus groups with attendings, residents, and students in one midwestern academic setting. The sessions were audiotaped, transcribed, and analyzed for themes surrounding the formal, informal, and hidden curricula. All three groups offered a similar belief that the knowledge, skills, and values of the formal curriculum focused on building relationships. Similarly, all three suggested that elements of the informal and hidden curricula were expressed primarily as the values arising from attendings' role modeling, as the nature and amount of time attendings spend with patients, and as attendings' advice arising from experience and intuition versus "textbook learning." Whereas students and residents offered negative values arising from the informal and hidden curricula, attendings did not, offering instead the more positive values they intended to encourage through the informal and hidden curricula. The process described here has great potential in local settings across all disciplines. Asking teachers and learners in any setting to think about how they experience the educational environment and what sense they make of all curricular efforts can provide a reality check for educators and a values check for learners as they critically reflect on the meanings of what they are learning.

  1. Atlas of solar hidden photon emission

    Energy Technology Data Exchange (ETDEWEB)

    Redondo, Javier [Departamento de Física Teórica, Universidad de Zaragoza,Pedro Cerbuna 12, E-50009, Zaragoza (Spain); Max-Planck-Institut für Physik, Werner-Heisenberg-Institut,Föhringer Ring 6, 80805 München (Germany)

    2015-07-20

    Hidden photons, gauge bosons of a U(1) symmetry of a hidden sector, can constitute the dark matter of the universe and a smoking gun for large volume compactifications of string theory. In the sub-eV mass range, a possible discovery experiment consists on searching the copious flux of these particles emitted from the Sun in a helioscope setup à la Sikivie. In this paper, we compute in great detail the flux of HPs from the Sun, a necessary ingredient for interpreting such experiments. We provide a detailed exposition of transverse photon-HP oscillations in inhomogenous media, with special focus on resonance oscillations, which play a leading role in many cases. The region of the Sun emitting HPs resonantly is a thin spherical shell for which we justify an averaged-emission formula and which implies a distinctive morphology of the angular distribution of HPs on Earth in many cases. Low mass HPs with energies in the visible and IR have resonances very close to the photosphere where the solar plasma is not fully ionised and requires building a detailed model of solar refraction and absorption. We present results for a broad range of HP masses (from 0–1 keV) and energies (from the IR to the X-ray range), the most complete atlas of solar HP emission to date.

  2. Atlas of solar hidden photon emission

    Energy Technology Data Exchange (ETDEWEB)

    Redondo, Javier, E-mail: redondo@mpp.mpg.de [Departamento de Física Teórica, Universidad de Zaragoza, Pedro Cerbuna 12, E-50009, Zaragoza, España (Spain)

    2015-07-01

    Hidden photons, gauge bosons of a U(1) symmetry of a hidden sector, can constitute the dark matter of the universe and a smoking gun for large volume compactifications of string theory. In the sub-eV mass range, a possible discovery experiment consists on searching the copious flux of these particles emitted from the Sun in a helioscope setup à la Sikivie. In this paper, we compute in great detail the flux of HPs from the Sun, a necessary ingredient for interpreting such experiments. We provide a detailed exposition of transverse photon-HP oscillations in inhomogenous media, with special focus on resonance oscillations, which play a leading role in many cases. The region of the Sun emitting HPs resonantly is a thin spherical shell for which we justify an averaged-emission formula and which implies a distinctive morphology of the angular distribution of HPs on Earth in many cases. Low mass HPs with energies in the visible and IR have resonances very close to the photosphere where the solar plasma is not fully ionised and requires building a detailed model of solar refraction and absorption. We present results for a broad range of HP masses (from 0–1 keV) and energies (from the IR to the X-ray range), the most complete atlas of solar HP emission to date.

  3. Bayesian structural inference for hidden processes

    Science.gov (United States)

    Strelioff, Christopher C.; Crutchfield, James P.

    2014-04-01

    We introduce a Bayesian approach to discovering patterns in structurally complex processes. The proposed method of Bayesian structural inference (BSI) relies on a set of candidate unifilar hidden Markov model (uHMM) topologies for inference of process structure from a data series. We employ a recently developed exact enumeration of topological ɛ-machines. (A sequel then removes the topological restriction.) This subset of the uHMM topologies has the added benefit that inferred models are guaranteed to be ɛ-machines, irrespective of estimated transition probabilities. Properties of ɛ-machines and uHMMs allow for the derivation of analytic expressions for estimating transition probabilities, inferring start states, and comparing the posterior probability of candidate model topologies, despite process internal structure being only indirectly present in data. We demonstrate BSI's effectiveness in estimating a process's randomness, as reflected by the Shannon entropy rate, and its structure, as quantified by the statistical complexity. We also compare using the posterior distribution over candidate models and the single, maximum a posteriori model for point estimation and show that the former more accurately reflects uncertainty in estimated values. We apply BSI to in-class examples of finite- and infinite-order Markov processes, as well to an out-of-class, infinite-state hidden process.

  4. Hidden Markov Model for Stock Selection

    Directory of Open Access Journals (Sweden)

    Nguyet Nguyen

    2015-10-01

    Full Text Available The hidden Markov model (HMM is typically used to predict the hidden regimes of observation data. Therefore, this model finds applications in many different areas, such as speech recognition systems, computational molecular biology and financial market predictions. In this paper, we use HMM for stock selection. We first use HMM to make monthly regime predictions for the four macroeconomic variables: inflation (consumer price index (CPI, industrial production index (INDPRO, stock market index (S&P 500 and market volatility (VIX. At the end of each month, we calibrate HMM’s parameters for each of these economic variables and predict its regimes for the next month. We then look back into historical data to find the time periods for which the four variables had similar regimes with the forecasted regimes. Within those similar periods, we analyze all of the S&P 500 stocks to identify which stock characteristics have been well rewarded during the time periods and assign scores and corresponding weights for each of the stock characteristics. A composite score of each stock is calculated based on the scores and weights of its features. Based on this algorithm, we choose the 50 top ranking stocks to buy. We compare the performances of the portfolio with the benchmark index, S&P 500. With an initial investment of $100 in December 1999, over 15 years, in December 2014, our portfolio had an average gain per annum of 14.9% versus 2.3% for the S&P 500.

  5. Hidden ion population of the magnetosphere

    International Nuclear Information System (INIS)

    Olsen, R.C.

    1982-01-01

    Particle data from two geosynchronous satellites (Applied Technology Satellite 6 and SCATHA) show a normally hidden ion population appearing when the satellites are in the earth's shadow. Ion and electron data show the spacecraft potential dropping from +10 V in sunlight to +4 and +5 V in eclipse at local midnight, in low-energy (T/sub e/ -2 ), isotropic ion population appears which was invisible in sunlight because of the larger positive spacecraft potential. Higher-energy populations generally cover the tails of the hidden ion populations, so they cannot be inferred from daylight data. The isotropic populations appears only in a few percent of the spacecraft eclipse events, appearing only at times of low Kp (2 or less, preceded by a day with Σ Kp< or =20). A low-energy (T = 1--2 eV) field-aligned population often appears with and without the isotropic population, at slightly higher flux levels. These fluxes are visible in sunlight, but again the distribution functions obtained in eclipse differ from those that would be inferred from daylight data. Measurement of the thermal plasma population on a consistent basis, particularly in the plasma sheet, will require some method of controlling the detector potential with respect to the ambient plamsa

  6. ESO's Hidden Treasures Brought to Light

    Science.gov (United States)

    2011-01-01

    ESO's Hidden Treasures 2010 astrophotography competition attracted nearly 100 entries, and ESO is delighted to announce the winners. Hidden Treasures gave amateur astronomers the opportunity to search ESO's vast archives of astronomical data for a well-hidden cosmic gem. Astronomy enthusiast Igor Chekalin from Russia won the first prize in this difficult but rewarding challenge - the trip of a lifetime to ESO's Very Large Telescope at Paranal, Chile. The pictures of the Universe that can be seen in ESO's releases are impressive. However, many hours of skilful work are required to assemble the raw greyscale data captured by the telescopes into these colourful images, correcting them for distortions and unwanted signatures of the instrument, and enhancing them so as to bring out the details contained in the astronomical data. ESO has a team of professional image processors, but for the ESO's Hidden Treasures 2010 competition, the experts decided to give astronomy and photography enthusiasts the opportunity to show the world what they could do with the mammoth amount of data contained in ESO's archives. The enthusiasts who responded to the call submitted nearly 100 entries in total - far exceeding initial expectations, given the difficult nature of the challenge. "We were completely taken aback both by the quantity and the quality of the images that were submitted. This was not a challenge for the faint-hearted, requiring both an advanced knowledge of data processing and an artistic eye. We are thrilled to have discovered so many talented people," said Lars Lindberg Christensen, Head of ESO's education and Public Outreach Department. Digging through many terabytes of professional astronomical data, the entrants had to identify a series of greyscale images of a celestial object that would reveal the hidden beauty of our Universe. The chance of a great reward for the lucky winner was enough to spur on the competitors; the first prize being a trip to ESO's Very Large

  7. Epitope discovery with phylogenetic hidden Markov models.

    LENUS (Irish Health Repository)

    Lacerda, Miguel

    2010-05-01

    Existing methods for the prediction of immunologically active T-cell epitopes are based on the amino acid sequence or structure of pathogen proteins. Additional information regarding the locations of epitopes may be acquired by considering the evolution of viruses in hosts with different immune backgrounds. In particular, immune-dependent evolutionary patterns at sites within or near T-cell epitopes can be used to enhance epitope identification. We have developed a mutation-selection model of T-cell epitope evolution that allows the human leukocyte antigen (HLA) genotype of the host to influence the evolutionary process. This is one of the first examples of the incorporation of environmental parameters into a phylogenetic model and has many other potential applications where the selection pressures exerted on an organism can be related directly to environmental factors. We combine this novel evolutionary model with a hidden Markov model to identify contiguous amino acid positions that appear to evolve under immune pressure in the presence of specific host immune alleles and that therefore represent potential epitopes. This phylogenetic hidden Markov model provides a rigorous probabilistic framework that can be combined with sequence or structural information to improve epitope prediction. As a demonstration, we apply the model to a data set of HIV-1 protein-coding sequences and host HLA genotypes.

  8. Pentaquarks with hidden charm as hadroquarkonia

    Energy Technology Data Exchange (ETDEWEB)

    Eides, Michael I. [University of Kentucky, Department of Physics and Astronomy, Lexington, KY (United States); Petersburg Nuclear Physics Institute, St. Petersburg (Russian Federation); Petrov, Victor Yu. [Petersburg Nuclear Physics Institute, St. Petersburg (Russian Federation); Polyakov, Maxim V. [Petersburg Nuclear Physics Institute, St. Petersburg (Russian Federation); Ruhr-Universitaet Bochum, Institut fuer Theoretische Physik II, Bochum (Germany)

    2018-01-15

    We consider hidden charm pentaquarks as hadroquarkonium states in a QCD inspired approach. Pentaquarks arise naturally as bound states of quarkonia excitations and ordinary baryons. The LHCb P{sub c}(4450) pentaquark is interpreted as a ψ{sup '}-nucleon bound state with spin-parity J{sup P} = 3/2{sup -}. The partial decay width Γ(P{sub c}(4450) → J/ψ + N) ∼ 11 MeV is calculated and turned out to be in agreement with the experimental data for P{sub c}(4450). The P{sub c}(4450) pentaquark is predicted to be a member of one of the two almost degenerate hidden-charm baryon octets with spin-parities J{sup P} = 1/2{sup -}, 3/2{sup -}. The masses and decay widths of the octet pentaquarks are calculated. The widths are small and comparable with the width of the P{sub c}(4450) pentaquark, and the masses of the octet pentaquarks satisfy the Gell-Mann-Okubo relation. Interpretation of pentaquarks as loosely bound Σ{sub c} anti D* and Σ{sub c}{sup *} anti D* deuteronlike states is also considered. We determine quantum numbers of these bound states and calculate their masses in the one-pion exchange scenario. The hadroquarkonium and molecular approaches to exotic hadrons are compared and the relative advantages and drawbacks of each approach are discussed. (orig.)

  9. Low energy theorems of hidden local symmetries

    International Nuclear Information System (INIS)

    Harada, Masayasu; Kugo, Taichiro; Yamawaki, Koichi.

    1994-01-01

    We prove to all orders of the loop expansion the low energy theorems of hidden local symmetries in four-dimensional nonlinear sigma models based on the coset space G/H, with G and H being arbitrary compact groups. Although the models are non-renormalizable, the proof is done in an analogous manner to the renormalization proof of gauge theories and two-dimensional nonlinear sigma models by restricting ourselves to the operators with two derivatives (counting a hidden gauge boson field as one derivative), i.e., with dimension 2, which are the only operators relevant to the low energy limit. Through loop-wise mathematical induction based on the Ward-Takahashi identity for the BRS symmetry, we solve renormalization equation for the effective action up to dimension-2 terms plus terms with the relevant BRS sources. We then show that all the quantum corrections to the dimension-2 operators, including the finite parts as well as the divergent ones, can be entirely absorbed into a re-definition (renormalization) of the parameters and the fields in the dimension-2 part of the tree-level Lagrangian. (author)

  10. Black holes, hidden symmetries, and complete integrability.

    Science.gov (United States)

    Frolov, Valeri P; Krtouš, Pavel; Kubizňák, David

    2017-01-01

    The study of higher-dimensional black holes is a subject which has recently attracted vast interest. Perhaps one of the most surprising discoveries is a realization that the properties of higher-dimensional black holes with the spherical horizon topology and described by the Kerr-NUT-(A)dS metrics are very similar to the properties of the well known four-dimensional Kerr metric. This remarkable result stems from the existence of a single object called the principal tensor. In our review we discuss explicit and hidden symmetries of higher-dimensional Kerr-NUT-(A)dS black hole spacetimes. We start with discussion of the Killing and Killing-Yano objects representing explicit and hidden symmetries. We demonstrate that the principal tensor can be used as a "seed object" which generates all these symmetries. It determines the form of the geometry, as well as guarantees its remarkable properties, such as special algebraic type of the spacetime, complete integrability of geodesic motion, and separability of the Hamilton-Jacobi, Klein-Gordon, and Dirac equations. The review also contains a discussion of different applications of the developed formalism and its possible generalizations.

  11. Emittance Measurements from a Laser Driven Electron Injector

    Energy Technology Data Exchange (ETDEWEB)

    Reis, David A

    2003-07-28

    The Gun Test Facility (GTF) at the Stanford Linear Accelerator Center was constructed to develop an appropriate electron beam suitable for driving a short wavelength free electron laser (FEL) such as the proposed Linac Coherent Light Source (LCLS). For operation at a wavelength of 1.5 {angstrom}, the LCLS requires an electron injector that can produce an electron beam with approximately 1 {pi} mm-mrad normalized rms emittance with at least 1 nC of charge in a 10 ps or shorter bunch. The GTF consists of a photocathode rf gun, emittance-compensation solenoid, 3 m linear accelerator (linac), drive laser, and diagnostics to measure the beam. The rf gun is a symmetrized 1.6 cell, s-band high gradient, room temperature, photocathode structure. Simulations show that this gun when driven by a temporally and spatially shaped drive laser, appropriately focused with the solenoid, and further accelerated in linac can produce a beam that meets the LCLS requirements. This thesis describes the initial characterization of the laser and electron beam at the GTF. A convolved measurement of the relative timing between the laser and the rf phase in the gun shows that the jitter is less than 2.5 ps rms. Emittance measurements of the electron beam at 35 MeV are reported as a function of the (Gaussian) pulse length and transverse profile of the laser as well as the charge of the electron beam at constant phase and gradient in both the gun and linac. At 1 nC the emittance was found to be {approx} 13 {pi} mm-mrad for 5 ps and 8 ps long laser pulses. At 0.5 nC the measured emittance decreased approximately 20% in the 5 ps case and 40% in the 8 ps case. These measurements are between 40-80% higher than simulations for similar experimental conditions. In addition, the thermal emittance of the electron beam was measured to be 0.5 {pi} mm-mrad.

  12. Experimental Study of Coherent Synchrotron Radiation in the Emittance Exchange Line at the A0-Photoinjector

    Science.gov (United States)

    Thangaraj, Jayakar C. T.; Thurman-Keup, R.; Johnson, A.; Lumpkin, A. H.; Edwards, H.; Ruan, J.; Santucci, J.; Sun, Y. E.; Church, M.; Piot, P.

    2010-11-01

    Next generation accelerators will require a high current, low emittance beam with a low energy spread. Such accelerators will employ advanced beam conditioning systems such as emittance exchangers to manipulate high brightness beams. One of the goals of the Fermilab A0 photoinjector is to investigate the transverse to longitudinal emittance exchange principle. Coherent synchrotron radiation could limit high current operation of the emittance exchanger. In this paper, we report on the preliminary experimental and simulation study of the coherent synchroton radiation (CSR) in the emittance exchange line at the A0 photoinjector.

  13. An introduction to hidden Markov models for biological sequences

    DEFF Research Database (Denmark)

    Krogh, Anders Stærmose

    1998-01-01

    A non-matematical tutorial on hidden Markov models (HMMs) plus a description of one of the applications of HMMs: gene finding.......A non-matematical tutorial on hidden Markov models (HMMs) plus a description of one of the applications of HMMs: gene finding....

  14. Asymptotics for Estimating Equations in Hidden Markov Models

    DEFF Research Database (Denmark)

    Hansen, Jørgen Vinsløv; Jensen, Jens Ledet

    Results on asymptotic normality for the maximum likelihood estimate in hidden Markov models are extended in two directions. The stationarity assumption is relaxed, which allows for a covariate process influencing the hidden Markov process. Furthermore a class of estimating equations is considered...

  15. Secret Codes: The Hidden Curriculum of Semantic Web Technologies

    Science.gov (United States)

    Edwards, Richard; Carmichael, Patrick

    2012-01-01

    There is a long tradition in education of examination of the hidden curriculum, those elements which are implicit or tacit to the formal goals of education. This article draws upon that tradition to open up for investigation the hidden curriculum and assumptions about students and knowledge that are embedded in the coding undertaken to facilitate…

  16. Searching for hidden sector in multiparticle production at LHC

    Directory of Open Access Journals (Sweden)

    Miguel-Angel Sanchis-Lozano

    2016-03-01

    Full Text Available We study the impact of a hidden sector beyond the Standard Model, e.g. a Hidden Valley model, on factorial moments and cumulants of multiplicity distributions in multiparticle production with a special emphasis on the prospects for LHC results.

  17. Hidden Agendas in Marriage: Affective and Longitudinal Dimensions.

    Science.gov (United States)

    Krokoff, Lowell J.

    1990-01-01

    Examines how couples' discussions of troublesome problems reveal hidden agendas (issues not directly discussed or explored). Finds disgust and contempt are at the core of both love and respect agendas for husbands and wives. Finds that wives' more than husbands' hidden agendas are directly predictive of how negatively they argue at home. (SR)

  18. Hidden symmetries in minimal five-dimensional supergravity

    International Nuclear Information System (INIS)

    Poessel, Markus; Silva, Sebastian

    2004-01-01

    We study the hidden symmetries arising in the dimensional reduction of d=5, N=2 supergravity to three dimensions. Extending previous partial results for the bosonic part, we give a derivation that includes fermionic terms, shedding light on the appearance of the local hidden symmetry SO(4) in the reduction

  19. Monte Carlo Transverse Emittance Study on Cs2Te

    CERN Document Server

    Banfi, F; Galimberti, P G; Giannetti, C; Pagliara, S; Parmigiani, F; Pedersoli, E

    2005-01-01

    A Monte Carlo study of electron transport in Cs2Te films is performed to investigate the transverse emittance epsilon at the cathode surface. We find the photoemitted electron angular distribution and explain the physical mechanism involved in the process, a mechanism hindered by the statistical nature of the Monte Carlo method. The effects of electron-phonon scattering are discussed. The transverse emittance is calculated for different radiation wavelengths and a laser spot size of 1.5*10(-3) m. For a laser radiation at 265 nm we find epsilon = 0.56 mm-mrad. The dependence of epsilon and the quantum yield on the electron affinity Ea is also investigated. The data shows the importance of aging/contamination on the material.

  20. Low emittance optics of photon factory storage ring at KEK

    International Nuclear Information System (INIS)

    Kamiya, Y.; Katoh, M.; Honjo, I.; Araki, A.; Kihara, M.

    1987-01-01

    A new optics is being successfully tested at the Photon Factory Storage Ring (PF-RING) in order to reduce the emittance to 0.13 mm mrad, about one third of the present value. This optics with four additional quadrupole magnets is a modified version of one of the optics designed as an option at the early period of PF construction. One advantage of this new optics is that the beta-function at RF-sections is smaller than that of the old option. The other advantage is that the dispersion function is zero at the long straight sections for insertion devices and RF cavities. The aim of this paper is to describe the new low-emittance optics as well as the parameters of the new quadrupole magnets and power supplies. Some preliminary results of machine study are also presented

  1. Emittance preservation during bunch compression with a magnetized beam

    Energy Technology Data Exchange (ETDEWEB)

    Stratakis, Diktys [Brookhaven National Lab. (BNL), Upton, NY (United States)

    2015-09-02

    The deleterious effects of coherent synchrotron radiation (CSR) on the phase-space and energy spread of high-energy beams in accelerator light sources can significantly constrain the machine design and performance. In this paper, we present a simple method to preserve the beam emittance by means of using magnetized beams that exhibit a large aspect ratio on their transverse dimensions. The concept is based on combining a finite solenoid field where the beam is generated together with a special optics adapter. Numerical simulations of this new type of beam source show that the induced phase-space density growth can be notably suppressed to less than 1% for any bunch charge. This work elucidates the key parameters that are needed for emittance preservation, such as the required field and aspect ratio for a given bunch charge.

  2. Nanodiamond composite as a material for cold electron emitters

    International Nuclear Information System (INIS)

    Arkhipov, A V; Sominski, G G; Uvarov, A A; Gordeev, S K; Korchagina, S B

    2008-01-01

    Characteristics of field-induced electron emission were investigated for one of newly designed all-carbon materials - nanodiamond composite (NDC). The composite is comprised by 4-6 nm diamond grains covered with 0.2-1 nm-thick graphite-like shells that merge at grain junctions and determine such properties as mechanical strength and high electric conductivity. Large number of uniformly distributed sp 3 -sp 2 interfaces allowed to expect enhanced electron emission in electric field. Combination of these features makes NDC a promising material for cold electron emitters in various applications. Experimental testing confirmed high efficiency of electron emission from NDC. In comparison with previousely tested forms of nanocarbon, NDC emitters demonstrated better stabily and tolerance to performance conditions. Unusual activation scenarios and thermal dependencies of emission characteristics observed in experiments with NDC can add new background for explanation of facilitated electron emission from nanocarbons with relatively 'smooth' surface morphology

  3. Emittance Correction in the 2006 ILC Bunch Compressor

    International Nuclear Information System (INIS)

    Tenenbaum, P.; SLAC

    2007-01-01

    A recent study [1] has indicated substantial potential emittance growth in the ILC bunch compressor due to quad misalignments, BPM misalignments, and pitches in the RF cavities. Table 1 summarizes several results from [1]. In this simulation, quad misalignments and cavity pitches are Gaussian distributed and are considered with respect to the nominal survey line; BPM misalignments are also Gaussian-distributed but are considered with respect to the quadrupole axis. It is assumed that the BPM offsets with respect to the quads are found in a previous quad-shunting BBA step which is not simulated. In this study we seek to repeat the studies documented above, and additionally to perform a study in which additional dispersion bumps are used to further reduce the projected emittance

  4. Generalized emittance measurements in a beam transport line

    International Nuclear Information System (INIS)

    Skelly, J.; Gardner, C.; Luccio, A.; Kponou, A.; Reece, K.

    1991-01-01

    Motivated by the need to commission 3 beam transport lines for the new AGS Booster project, we have developed a generalized emittance-measurement program; beam line specifics are entirely resident in data tables, not in program code. For instrumentation, the program requires one or more multi-wire profile monitors; one or multiple profiles are acquired from each monitor, corresponding to one or multiple tunes of the transport line. Emittances and Twiss parameters are calculated using generalized algorithms. The required matix descriptions of the beam optics are constructed by an on-line general beam modeling program. Design of the program, its algorithms, and initial experience with it will be described. 4 refs., 2 figs., 1 tab

  5. Rose, a rotating system for 4D emittance measurements

    Energy Technology Data Exchange (ETDEWEB)

    Maier, Michael; Groening, Lars; Xiao, Chen; Mickat, Sascha; Du, Xiaonan; Gerhard, Peter; Vormann, Hartmut [GSI Helmholtzzentrum fuer Schwerionenforschung GmbH (Germany)

    2016-07-01

    A ROtating System for Emittance measurements ROSE, to measure the full 4 dimensional transverse beam matrix of a heavy ion beam has been developed and commissioned. Different heavy ion beams behind the HLI at GSI have been used in two commissioning beam times. All technical aspects of Rose have been tested, Rose has been benchmarked against existing emittance scanners for horizontal and vertical projections and the method, hard- and software to measure the 4D beam matrix has been upgraded, refined and successfully commissioned. The inter plane correlations of the HLI beam have been measured, yet as no significant initial correlations were found to be present, controlled coupling of the beam by using a skew triplet has been applied and confirmed with Rose. The next step is to use ROSE to measure and remove the known inter plane correlations of a Uranium beam before SIS18 injection.

  6. Tellurium adsorption on tungsten and molybdenum field emitters

    International Nuclear Information System (INIS)

    Collins, R.A.; Kiwanga, C.A.

    1977-01-01

    Studies of the adsorption of tellurium onto tungsten and molybdenum field emitters are described and the results obtained are compared with those obtained in previous work on the adsorption of silicon and selenium. The adsorption of Te onto W was found to be much more uniform than in the case of Se. Although Te is metallic in many of its properties its adsorptive behavior on field emitters is found to be similar to that of selenium and these adsorptive properties are basically common to all semiconductors. The most evident property of these adsorbates is that the work function and emission current decrease simultaneously at coverages of less than half a monolayer and the work function subsequently increases. (B.D.)

  7. Electron Cloud at Low Emittance in CesrTA

    CERN Document Server

    Palmer, Mark; Billing, Michael; Calvey, Joseph; Conolly, Christopher; Crittenden, James; Dobbins, John; Dugan, Gerald; Eggert, Nicholas; Fontes, Ernest; Forster, Michael; Gallagher, Richard; Gray, Steven; Greenwald, Shlomo; Hartill, Donald; Hopkins, Walter; Kreinick, David; Kreis, Benjamin; Leong, Zhidong; Li, Yulin; Liu, Xianghong; Livezey, Jesse; Lyndaker, Aaron; Makita, Junki; McDonald, Michael; Medjidzade, Valeri; Meller, Robert; O'Connell, Tim; Peck, Stuart; Peterson, Daniel; Ramirez, Gabriel; Rendina, Matthew; Revesz, Peter; Rider, Nate; Rice, David; Rubin, David; Sagan, David; Savino, James; Schwartz, Robert; Seeley, Robert; Sexton, James; Shanks, James; Sikora, John; Smith, Eric; Strohman, Charles; Williams, Heather; Antoniou, Fanouria; Calatroni, Sergio; Gasior, Marek; Jones, Owain Rhodri; Papaphilippou, Yannis; Pfingstner, Juergen; Rumolo, Giovanni; Schmickler, Hermann; Taborelli, Mauro; Asner, David; Boon, Laura; Garfinkel, Arthur; Byrd, John; Celata, Christine; Corlett, John; De Santis, Stefano; Furman, Miguel; Jackson, Alan; Kraft, Rick; Munson, Dawn; Penn, Gregory; Plate, David; Venturini, Marco; Carlson, Benjamin; Demma, Theo; Dowd, Rohan; Flanagan, John; Jain, Puneet; Kanazawa, Ken-ichi; Kubo, Kiyoshi; Ohmi, Kazuhito; Sakai, Hiroshi; Shibata, Kyo; Suetsugu, Yusuke; Tobiyama, Makoto; Gonnella, Daniel; Guo, Weiming; Harkay, Katherine; Holtzapple, Robert; Jones, James; Wolski, Andrzej; Kharakh, David; Ng, Johnny; Pivi, Mauro; Wang, Lanfa; Ross, Marc; Tan, Cheng-Yang; Zwaska, Robert; Schachter, Levi; Wilkinson, Eric

    2010-01-01

    The Cornell Electron Storage Ring (CESR) has been reconfigured as a test accelerator (CesrTA) for a program of electron cloud (EC) research at ultra low emittance. The instrumentation in the ring has been upgraded with local diagnostics for measurement of cloud density and with improved beam diagnostics for the characterization of both the low emittance performance and the beam dynamics of high intensity bunch trains interacting with the cloud. A range of EC mitigation methods have been deployed and tested and their effectiveness is discussed. Measurements of the electron cloud’s effect on the beam under a range of conditions are discussed along with the simulations being used to quantitatively understand these results

  8. Emittance preservation during bunch compression with a magnetized beam

    Energy Technology Data Exchange (ETDEWEB)

    Stratakis, Diktys

    2016-03-01

    The deleterious effects of coherent synchrotron radiation (CSR) on the phase-space and energy spread of high-energy beams in accelerator light sources can significantly constrain the machine design and performance. In this paper, we present a simple method to preserve the beam emittance by means of using magnetized beams that exhibit a large aspect ratio on their transverse dimensions. The concept is based in combining a finite solenoid field where the beam is generated with a special optics adapter. Numerical simulations of this new type of beam source show that the induced phase-space density growth from CSR can be notably suppressed to less than 1% for any bunch charge. This work elucidates the key parameters that are needed for emittance preservation, such as the required field and aspect ratio for a given bunch charge.

  9. Nanodiamond composite as a material for cold electron emitters

    Energy Technology Data Exchange (ETDEWEB)

    Arkhipov, A V; Sominski, G G; Uvarov, A A [St.Petersburg State Polytechnic University, 29 Politchnicheskaya, St.Petersburg, 195251 (Russian Federation); Gordeev, S K; Korchagina, S B [FSUE ' Central Research Institute for Materials' , 8 Paradnaya Street, St.Petersburg, 191014 (Russian Federation)], E-mail: arkhipov@rphf.spbstu.ru

    2008-03-15

    Characteristics of field-induced electron emission were investigated for one of newly designed all-carbon materials - nanodiamond composite (NDC). The composite is comprised by 4-6 nm diamond grains covered with 0.2-1 nm-thick graphite-like shells that merge at grain junctions and determine such properties as mechanical strength and high electric conductivity. Large number of uniformly distributed sp{sup 3}-sp{sup 2} interfaces allowed to expect enhanced electron emission in electric field. Combination of these features makes NDC a promising material for cold electron emitters in various applications. Experimental testing confirmed high efficiency of electron emission from NDC. In comparison with previousely tested forms of nanocarbon, NDC emitters demonstrated better stabily and tolerance to performance conditions. Unusual activation scenarios and thermal dependencies of emission characteristics observed in experiments with NDC can add new background for explanation of facilitated electron emission from nanocarbons with relatively 'smooth' surface morphology.

  10. Emittance growth in non-symmetric beam configurations

    International Nuclear Information System (INIS)

    Anderson, O.A.

    1996-06-01

    Emittance growth in intense beams due to nonuniformity, mismatch, and misalignment has been analyzed by Reiser for the special case of axisymmetry. A more complex problem occurs in cases where a number of discrete beamlets are to be merged into a single focusing channel, for example, in designs for Heavy Ion Fusion drivers or Magnetic Fusion negative-ion systems. Celata, assuming the system to be perfectly matched and aligned, analyzed the case of four round beamlets arranged in a square array. We generalize these previous studies and analyze emittance growth in systems that are less symmetric. We include beam systems that are not necessarily matched and where the x and y moments may be unequal. We also include the possibility of initial convergence velocities that may differ in the two planes and allow for misalignment of the beam center-of-mass position and direction

  11. Abelian hidden sectors at a GeV

    International Nuclear Information System (INIS)

    Morrissey, David E.; Poland, David; Zurek, Kathryn M.

    2009-01-01

    We discuss mechanisms for naturally generating GeV-scale hidden sectors in the context of weak-scale supersymmetry. Such low mass scales can arise when hidden sectors are more weakly coupled to supersymmetry breaking than the visible sector, as happens when supersymmetry breaking is communicated to the visible sector by gauge interactions under which the hidden sector is uncharged, or if the hidden sector is sequestered from gravity-mediated supersymmetry breaking. We study these mechanisms in detail in the context of gauge and gaugino mediation, and present specific models of Abelian GeV-scale hidden sectors. In particular, we discuss kinetic mixing of a U(1) x gauge force with hypercharge, singlets or bi-fundamentals which couple to both sectors, and additional loop effects. Finally, we investigate the possible relevance of such sectors for dark matter phenomenology, as well as for low- and high-energy collider searches.

  12. From classical to quantum plasmonics: Classical emitter and SPASER

    Science.gov (United States)

    Balykin, V. I.

    2018-02-01

    The key advantage of plasmonics is in pushing our control of light down to the nanoscale. It is possible to envision lithographically fabricated plasmonic devices for future quantum information processing or cryptography at the nanoscale in two dimensions. A first step in this direction is a demonstration of a highly efficient nanoscale light source. Here we demonstrate two types of nanoscale sources of optical fields: 1) the classical metallic nanostructure emitter and 2) the plasmonic nanolaser - SPASER.

  13. A program to research emittance growth in bends

    International Nuclear Information System (INIS)

    Bohn, C.L.

    1995-01-01

    A research program to explore the phenomenon of emittance growth in bends due to noninertial space-charge effects has been defined and initiated. The program combines theoretical, numerical, and experimental investigations. This paper summarizes the motivation of the work and highlights CEBAF's need for immediate results. The program's key elements, some of which qualitatively differ from the standard approach used to investigate the production and effects of coherent synchrotron radiation in synchrotrons and storage rings, are enumerated and discussed. 1 fig

  14. Interconnection network architectures based on integrated orbital angular momentum emitters

    Science.gov (United States)

    Scaffardi, Mirco; Zhang, Ning; Malik, Muhammad Nouman; Lazzeri, Emma; Klitis, Charalambos; Lavery, Martin; Sorel, Marc; Bogoni, Antonella

    2018-02-01

    Novel architectures for two-layer interconnection networks based on concentric OAM emitters are presented. A scalability analysis is done in terms of devices characteristics, power budget and optical signal to noise ratio by exploiting experimentally measured parameters. The analysis shows that by exploiting optical amplifications, the proposed interconnection networks can support a number of ports higher than 100. The OAM crosstalk induced-penalty, evaluated through an experimental characterization, do not significantly affect the interconnection network performance.

  15. Cancer therapy with alpha-emitters labeled peptides.

    Science.gov (United States)

    Dadachova, Ekaterina

    2010-05-01

    Actively targeted alpha-particles offer specific tumor cell killing action with less collateral damage to surrounding normal tissues than beta-emitters. During the last decade, radiolabeled peptides that bind to different receptors on the tumors have been investigated as potential therapeutic agents both in the preclinical and clinical settings. Advantages of radiolabeled peptides over antibodies include relatively straightforward chemical synthesis, versatility, easier radiolabeling, rapid clearance from the circulation, faster penetration and more uniform distribution into tissues, and less immunogenicity. Rapid internalization of the radiolabeled peptides with equally rapid re-expression of the cell surface target is a highly desirable property that enhances the total delivery of these radionuclides into malignant sites. Peptides, such as octreotide, alpha-melanocyte-stimulating hormone analogues, arginine-glycine-aspartic acid-containing peptides, bombesin derivatives, and others may all be feasible for use with alpha-emitters. The on-going preclinical work has primarily concentrated on octreotide and octreotate analogues labeled with Bismuth-213 and Astatine-211. In addition, alpha-melanocyte-stimulating hormone analogue has been labeled with Lead-212/Bismuth-212 in vivo generator and demonstrated the encouraging therapeutic efficacy in treatment of experimental melanoma. Obstacles that continue to obstruct widespread acceptance of alpha-emitter-labeled peptides are primarily the supply of these radionuclides and concerns about potential kidney toxicity. New sources and methods for production of these medically valuable radionuclides and better understanding of mechanisms related to the peptide renal uptake and clearance should speed up the introduction of alpha-emitter-labeled peptides into the clinic. Copyright 2010 Elsevier Inc. All rights reserved.

  16. Device for the radiation centering at electron emitters

    International Nuclear Information System (INIS)

    Panzer, S.; Ardenne, T. von; Jessat, K.; Bahr, G.

    1985-01-01

    The invention has been directed at a device for a simplified and reliable centering of electron beams at electron emitters in particular for welding and thermal surface modifications. The electron beam has been focussed relatively to an electron-optical lens. A movable masked electron detector has been arranged at the electron beam deflection plane. The electron detector is connected with an electronic data evaluation equipment

  17. Industrial application of electron sources with plasma emitters

    CERN Document Server

    Belyuk, S I; Rempe, N G

    2001-01-01

    Paper contains a description, operation, design and parameters of electron sources with plasma emitters. One presents examples of application of these sources as part of automated electron-beam welding lines. Paper describes application of such sources for electron-beam deposition of composite powders. Electron-beam deposition is used to rebuild worn out part and to increase strength of new parts of machines and tools. Paper presents some examples of rebuilding part and the advantages gained in this case

  18. Multi-gated field emitters for a micro-column

    International Nuclear Information System (INIS)

    Mimura, Hidenori; Kioke, Akifumi; Aoki, Toru; Neo, Yoichiro; Yoshida, Tomoya; Nagao, Masayoshi

    2011-01-01

    We have developed a multi-gated field emitter (FE) such as a quadruple-gated FE with a three-stacked electrode lens and a quintuple-gated FE with a four-stacked electrode lens. Both the FEs can focus the electron beam. However, the quintuple-gated FE has a stronger electron convergence than the quadruple-gated FE, and a beam crossover is clearly observed for the quintuple-gated FE.

  19. Wire scanner data analysis for the SSC Linac emittance measurement

    International Nuclear Information System (INIS)

    Yao, C.Y.; Hurd, J.W.; Sage, J.

    1993-07-01

    The wire scanners are designed in the SSC Linac for measurement of beam emittance at various locations. In order to obtain beam parameters from the scan signal, a data analysis program was developed that considers the problems of noise reduction, machine modeling, parameter fitting, and correction. This program is intended as a tool for Linac commissioning and also as part of the Linac control program. Some of the results from commissioning runs are presented

  20. Identifying hidden sexual bridging communities in Chicago.

    Science.gov (United States)

    Youm, Yoosik; Mackesy-Amiti, Mary Ellen; Williams, Chyvette T; Ouellet, Lawrence J

    2009-07-01

    Bridge populations can play a central role in the spread of human immunodeficiency virus (HIV) by providing transmission links between higher and lower prevalence populations. While social network methods are well suited to the study of bridge populations, analyses tend to focus on dyads (i.e., risk between drug and/or sex partners) and ignore bridges between distinct subpopulations. This study takes initial steps toward moving the analysis of sexual network linkages beyond individual and risk group levels to a community level in which Chicago's 77 community areas are examined as subpopulations for the purpose of identifying potential bridging communities. Of particular interest are "hidden" bridging communities; that is, areas with above-average levels of sexual ties with other areas but whose below-average AIDS prevalence may hide their potential importance for HIV prevention. Data for this analysis came from the first wave of recruiting at the Chicago Sexual Acquisition and Transmission of HIV Cooperative Agreement Program site. Between August 2005 through October 2006, respondent-driven sampling was used to recruit users of heroin, cocaine, or methamphetamine, men who have sex with men regardless of drug use, the sex partners of these two groups, and sex partners of the sex partners. In this cross-sectional study of the sexual transmission of HIV, participants completed a network-focused computer-assisted self-administered interview, which included questions about the geographic locations of sexual contacts with up to six recent partners. Bridging scores for each area were determined using a matrix representing Chicago's 77 community areas and were assessed using two measures: non-redundant ties and flow betweenness. Bridging measures and acquired immunodeficiency syndrome (AIDS) case prevalence rates were plotted for each community area on charts representing four conditions: below-average bridging and AIDS prevalence, below-average bridging and above

  1. Impact of water temperature and structural parameters on the hydraulic labyrinth-channel emitter performance

    Directory of Open Access Journals (Sweden)

    Ahmed I. Al-Amoud

    2014-06-01

    Full Text Available The effects of water temperature and structural parameters of a labyrinth emitter on drip irrigation hydraulic performance were investigated. The inside structural parameters of the trapezoidal labyrinth emitter include path width (W and length (L, trapezoidal unit numbers (N, height (H, and spacing (S. Laboratory experiments were conducted using five different types of labyrinth-channel emitters (three non-pressure compensating and two pressure-compensating emitters commonly used for subsurface drip irrigation systems. The water temperature effect on the hydraulic characteristics at various operating pressures was recorded and a comparison was made to identify the most effective structural parameter on emitter performance. The pressure compensating emitter flow exponent (x average was 0.014, while non-pressure compensating emitter’s values average was 0.456, indicating that the sensitivity of non-pressure compensating emitters to pressure variation is an obvious characteristic (p<0.001 of this type of emitters. The effects of water temperature on emitter flow rate were insignificant (p>0.05 at various operating pressures, where the flow rate index values for emitters were around one. The effects of water temperature on manufacturer’s coefficient of variation (CV values for all emitters were insignificant (p>0.05. The CV values of the non-pressure compensating emitters were lower than those of pressure compensating emitters. This is typical for most compensating models because they are manufactured with more elements than non-compensating emitters are. The results of regression analysis indicate that N and H are the essential factors (p<0.001 to affect the hydraulic performance.

  2. Biologic data, models, and dosimetric methods for internal emitters

    International Nuclear Information System (INIS)

    Weber, D.A.

    1990-01-01

    The absorbed radiation dose from internal emitters has been and will remain a pivotal factor in assessing risk and therapeutic utility in selecting radiopharmaceuticals for diagnosis and treatment. Although direct measurements of absorbed dose and dose distributions in vivo have been and will continue to be made in limited situations, the measurement of the biodistribution and clearance of radiopharmaceuticals in human subjects and the use of this data is likely to remain the primary means to approach the calculation and estimation of absorbed dose from internal emitters over the next decade. Since several approximations are used in these schema to calculate dose, attention must be given to inspecting and improving the application of this dosimetric method as better techniques are developed to assay body activity and as more experience is gained in applying these schema to calculating absorbed dose. Discussion of the need for considering small scale dosimetry to calculate absorbed dose at the cellular level will be presented in this paper. Other topics include dose estimates for internal emitters, biologic data mathematical models and dosimetric methods employed. 44 refs

  3. Low Emittance Gun Project based on Field Emission

    CERN Document Server

    Ganter, Romain; Dehler, M; Gobrecht, Jens; Gough, Chris; Ingold, Gerhard; Leemann, Simon C; Shing-Bruce-Li, Kevin; Paraliev, Martin; Pedrozzi, Marco; Raguin, Jean Yves; Rivkin, Leonid; Schlott, Volker; Sehr, Harald; Streun, Andreas; Wrulich, Albin F; Zelenika, Sasa

    2004-01-01

    The design of an electron gun capable of producing beam emittance one order of magnitude lower than current technology would reduce considerably the cost and size of a free electron laser emitting at 0.1nm. Field emitter arrays (FEAs) including a gate and a focusing layer are an attractive technology for such high brightness sources. Electrons are extracted from micrometric tips thanks to voltage pulses between gate and tips. The focusing layer should then reduce the initial divergence of each emitted beamlets. This FEA will be inserted in a high gradient diode configuration coupled with a radiofrequency structure. In the diode part very high electric field pulses (several hundreds of MV/m) will limit the degradation of emittance due to space charge effect. This first acceleration will be obtained with high voltage pulses (typically a megavolt in a few hundred of nanoseconds) synchronized with the low voltage pulses applied to the FEA (typically one hundred of volts in one nanosecond at frequency below kilohe...

  4. Transverse emittance studies of an induction accelerator of heavy ions

    International Nuclear Information System (INIS)

    Garvey, T.; Eylon, S.; Fessenden, T.J.; Hahn, K.; Henestroza, E.

    1991-01-01

    Current amplification of heavy ion beams is an integral feature of the induction linac approach to heavy ion fusion. As part of the Heavy Ion Fusion Accelerator Research program at LBL the authors have been studying the evolution of the transverse emittance of ion beams while they are undergoing current amplification, achieved by longitudinal bunch compression and acceleration. Experiments are conducted on MBE-4, a four beam Cs + induction linac. The space-charge dominated beams of MBE-4 are focused by electrostatic quadrupoles while they are accelerated from nominally 200 keV up to ∼ 1 MEV by 24 accelerating gaps. Initially the beams have currents of typically 4 mA to 10 mA per beam. Early experimental results showed a growth of the normalized emittance by a factor of 2 while the beam current was amplified by up to 9 times its initial value. The authors will discuss the results of recent experiments in which a mild bunch length compression rate, more typical of that required by a fusion driver, has shown that the normalized emittance can be maintained at its injection value (0.03 mm-mr) during acceleration

  5. Emittance Measurement for Beamline Extension at the PET Cyclotron

    Directory of Open Access Journals (Sweden)

    Sae-Hoon Park

    2016-01-01

    Full Text Available Particle-induced X-ray emission is used for determining the elemental composition of materials. This method uses low-energy protons (of several MeV, which can be obtained from high-energy (of tens MeV accelerators. Instead of manufacturing an accelerator for generating the MeV protons, the use of a PET cyclotron has been suggested for designing the beamline for multipurpose applications, especially for the PIXE experiment, which has a dedicated high-energy (of tens MeV accelerator. The beam properties of the cyclotron were determined at this experimental facility by using an external beamline before transferring the ion beam to the experimental chamber. We measured the beam profile and calculated the emittance using the pepper-pot method. The beam profile was measured as the beam current using a wire scanner, and the emittance was measured as the beam distribution at the beam dump using a radiochromic film. We analyzed the measurement results and are planning to use the results obtained in the simulations of external beamline and aligned beamline components. We will consider energy degradation after computing the beamline simulation. The experimental study focused on measuring the emittance from the cyclotron, and the results of this study are presented in this paper.

  6. Emittance scans for CMS luminosity calibration in 2017

    CERN Document Server

    CMS Collaboration

    2018-01-01

    Emittance scans are short van der Meer type scans performed at the beginning and at the end of LHC fills. The beams are scanned against each other in X and Y planes in 7 displacement steps. These scans are used for LHC diagnostics and since 2017 for a cross check of the CMS luminosity calibration. An XY pair of scans takes around 3 minutes. The BRIL project provides to LHC three independent online luminosity measurement from the Pixel Luminosity Telescope (PLT), the Fast Beam Condition Monitor (BCM1F) and the Forward calorimeter (HF). The excellent performance of the BRIL detector front-ends, fast back-end electronics and CMS XDAQ based data processing and publication allow the use of emittance scans for linearity and stability studies of the luminometers. Emittance scans became a powerful tool and dramatically improved the understanding of the luminosity measurement during the year. Since each luminometer is independently calibrated in every scan the measurements are independent and ratios of luminometers ca...

  7. 1024x1024 resistive emitter array design and fabrication status

    Science.gov (United States)

    Bryant, Paul T.; Oleson, Jim; McHugh, Stephen W.; Beuville, Eric; Schlesselmann, John D.; Woolaway, James T.; Barskey, Steve; Solomon, Steven L.; Joyner, Thomas W.

    2002-07-01

    Santa Barbara Infrared (SBIR) is producing a high performance 1,024 x 1,024 Large Format Resistive emitter Array (LFRA) for use in the next generation of IR Scene Projectors (IRSPs). LFRA requirements were developed through close cooperation with the Tri-Service IR Scene Projector working group, and through detailed trade studies sponsored by the OSD Central T&E Investment Program (CTEIP) and a Phase I US Navy Small Business Innovative Research (SBIR) contract. The CMOS Read-In Integrated Circuit (RIIC) is being designed by SBIR and Indigo Systems under a Small Business Innovative Research (SBIR) contract. Performance and features include 750 K MWIR maximum apparent temperature, 5 ms radiance rise time, 200 Hz full frame update, and 400 Hz window mode operation. Ten 8-inch CMOS wafers will be fabricated and characterized in mid-2002, followed by emitter fabrication in late 2002. This paper discusses array performance, requirements flow-down, array design, fabrication of 2 X 2-inch CMOS devices, and plans for subsequent RIIC wafer test and emitter pixel fabrication.

  8. Fowler Nordheim theory of carbon nanotube based field emitters

    Energy Technology Data Exchange (ETDEWEB)

    Parveen, Shama; Kumar, Avshish [Department of Physics, Jamia Millia Islamia (Central University), New Delhi (India); Husain, Samina [Centre for Nanoscience and Nanotechnology, Jamia Millia Islamia (Central University), New Delhi (India); Husain, Mushahid, E-mail: mush_reslab@rediffmail.com [Department of Physics, Jamia Millia Islamia (Central University), New Delhi (India)

    2017-01-15

    Field emission (FE) phenomena are generally explained in the frame-work of Fowler Nordheim (FN) theory which was given for flat metal surfaces. In this work, an effort has been made to present the field emission mechanism in carbon nanotubes (CNTs) which have tip type geometry at nanoscale. High aspect ratio of CNTs leads to large field enhancement factor and lower operating voltages because the electric field strength in the vicinity of the nanotubes tip can be enhanced by thousand times. The work function of nanostructure by using FN plot has been calculated with reverse engineering. With the help of modified FN equation, an important formula for effective emitting area (active area for emission of electrons) has been derived and employed to calculate the active emitting area for CNT field emitters. Therefore, it is of great interest to present a state of art study on the complete solution of FN equation for CNTs based field emitter displays. This manuscript will also provide a better understanding of calculation of different FE parameters of CNTs field emitters using FN equation.

  9. Energy dependence of the emittance of damping ring beams

    International Nuclear Information System (INIS)

    Stiening, R.

    1985-01-01

    The energy at which the SLC damping rings are operated was chosen to be 1.21 GeV. At the time that that specification was made, the repetition rate of the SLC was expected to be 180 Hz. It is now anticipated that the repetition rate during the initial year of operation of the SLC will be 120 Hz. The following curves which show the output emittance of the damping rings as a function of input emittance and energy suggest that there is a range of energies over which the rings can be operated without changing the SLC luminosity. It should be noted that in the era of polarized beams, the damping ring energy will be fixed at the design value on account of the spin precession required in the LTR and RTL transport lines. The SLC design output emittance of the damping rings is 3 x 10 -5 radian-meters. Because of space charge disruption and quantum emission downstream of the damping rings, much lower values than the design value may not have a large beneficial effect on the luminosity. 3 figures

  10. Photonic emitters and circuits based on colloidal quantum dot composites

    Science.gov (United States)

    Menon, Vinod M.; Husaini, Saima; Valappil, Nikesh; Luberto, Matthew

    2009-02-01

    We discuss our work on light emitters and photonic circuits realized using colloidal quantum dot composites. Specifically we will report our recent work on flexible microcavity laser, microdisk emitters and integrated active - passive waveguides. The entire microcavity laser structure was realized using spin coating and consisted of an all-polymer distributed Bragg reflector with a poly-vinyl carbazole cavity layer embedded with InGaP/ZnS colloidal quantum dots. These microcavities can be peeled off the substrate yielding a flexible structure that can conform to any shape and whose emission spectra can be mechanically tuned. The microdisk emitters and the integrated waveguide structures were realized using soft lithography and photo-lithography, respectively and were fabricated using a composite consisting of quantum dots embedded in SU8 matrix. Finally, we will discuss the effect of the host matrix on the optical properties of the quantum dots using results of steady-state and time-resolved luminescence measurements. In addition to their specific functionalities, these novel device demonstrations and their development present a low cost alternative to the traditional photonic device fabrication techniques.

  11. Superconducting wiggler magnets for beam-emittance damping rings

    CERN Document Server

    Schoerling, Daniel

    2012-01-01

    Ultra-low emittance beams with a high bunch charge are necessary for the luminosity performance of linear electron-positron colliders, such as the Compact Linear Collider (CLIC). An effective way to create ultra-low emittance beams with a high bunch charge is to use damping rings, or storage rings equipped with strong damping wiggler magnets. The remanent field of the permanent magnet materials and the ohmic losses in normal conductors limit the economically achievable pole field in accelerator magnets operated at around room temperature to below the magnetic saturation induction, which is 2.15 T for iron. In wiggler magnets, the pole field in the center of the gap is reduced further like the hyperbolic cosine of the ratio of the gap size and the period length multiplied by pi. Moreover, damping wiggler magnets require relatively large gaps because they have to accept the un-damped beam and to generate, at a small period length, a large magnetic flux density amplitude to effectively damp the beam emittance....

  12. Nanometer emittance ultralow charge beams from rf photoinjectors

    Directory of Open Access Journals (Sweden)

    R. K. Li

    2012-09-01

    Full Text Available In this paper we discuss the generation of a new class of high brightness relativistic electron beams, characterized by ultralow charge (0.1–1 pC and ultralow normalized emittance (<50  nm. These beams are created in rf photoinjectors when the laser is focused on the cathode to very small transverse sizes (<30  μm rms. In this regime, the charge density at the cathode approaches the limit set by the extraction electric field. By shaping the laser pulse to have a cigarlike aspect ratio (the longitudinal dimension much larger than the transverse dimension and a parabolic temporal profile, the resulting space charge dominated dynamics creates a uniformly filled ellipsoidal distribution and the emittance can be nearly preserved to its thermal value. We also present a new method, based on a variation of the pepper-pot technique, for single shot measurements of the ultralow emittances for this new class of beams.

  13. Emittance compensation with dynamically optimized photoelectron beam profiles

    Energy Technology Data Exchange (ETDEWEB)

    Rosenzweig, J.B. [Department of Physics and Astronomy, UCLA, 405 Hilgard Avenue, Los Angeles, CA 90095 (United States)]. E-mail: rosen@physics.ucla.edu; Cook, A.M. [Department of Physics and Astronomy, UCLA, 405 Hilgard Avenue, Los Angeles, CA 90095 (United States); England, R.J. [Department of Physics and Astronomy, UCLA, 405 Hilgard Avenue, Los Angeles, CA 90095 (United States); Dunning, M. [Department of Physics and Astronomy, UCLA, 405 Hilgard Avenue, Los Angeles, CA 90095 (United States); Anderson, S.G. [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA 94550 (United States); Ferrario, Massimo [Istituto Nazionale di Fisica Nucleare, Laboratori Nazionale di Frascati, Via E. Fermi 41, Frascati, Rome (Italy)

    2006-02-01

    Much of the theory and experimentation concerning creation of a high-brightness electron beam from a photocathode, and then applying emittance compensation techniques, assumes that one must strive for a uniform density electron beam, having a cylindrical shape. On the other hand, this shape has large nonlinearities in the space-charge field profiles near the beam's longitudinal extrema. These nonlinearities are known to produce both transverse and longitudinal emittance growth. On the other hand, it has recently been shown by Luiten that by illuminating the cathode with an ultra-short laser pulse of appropriate transverse profile, a uniform density, ellipsoidally shaped bunch is dynamically formed, which then has linear space-charge fields in all dimensions inside of the bunch. We study here this process, and its marriage to the standard emittance compensation scenario that is implemented in most recent photoinjectors. It is seen that the two processes are compatible, with simulations indicating a very high brightness beam can be obtained. The robustness of this scheme to systematic errors is examined. Prospects for experimental tests of this scheme are discussed.

  14. Emittance compensation with dynamically optimized photoelectron beam profiles

    International Nuclear Information System (INIS)

    Rosenzweig, J.B.; Cook, A.M.; England, R.J.; Dunning, M.; Anderson, S.G.; Ferrario, Massimo

    2006-01-01

    Much of the theory and experimentation concerning creation of a high-brightness electron beam from a photocathode, and then applying emittance compensation techniques, assumes that one must strive for a uniform density electron beam, having a cylindrical shape. On the other hand, this shape has large nonlinearities in the space-charge field profiles near the beam's longitudinal extrema. These nonlinearities are known to produce both transverse and longitudinal emittance growth. On the other hand, it has recently been shown by Luiten that by illuminating the cathode with an ultra-short laser pulse of appropriate transverse profile, a uniform density, ellipsoidally shaped bunch is dynamically formed, which then has linear space-charge fields in all dimensions inside of the bunch. We study here this process, and its marriage to the standard emittance compensation scenario that is implemented in most recent photoinjectors. It is seen that the two processes are compatible, with simulations indicating a very high brightness beam can be obtained. The robustness of this scheme to systematic errors is examined. Prospects for experimental tests of this scheme are discussed

  15. … To be hidden does not mean to be merely revealed – Part 1 Artistic research on hidden curriculum

    Directory of Open Access Journals (Sweden)

    Annette Krause

    2015-09-01

    Full Text Available This text revisits the long-term project Hidden Curriculum, initiated by Annette Krauss. The project addresses unquestioned routines, hierarchies of knowledge (part 1, and the role of the body in learning processes (part 2 from the perspective of secondary/high school education (in the research on a hidden curriculum. A deeper analysis of educational studies on the phenomenon of ‘hidden curriculum’ in relation to the feminist and critical pedagogies of bell hooks, Paulo Freire, and Jacques Rancière brings forward important insights generated through the artistic research within hidden curriculum. The aim of this text is to address academic canons, corporeality, and investigate everyday norms through revisiting the framework, results, and processes of the collaborative research into hidden curriculum with secondary high school students.

  16. Dynamic portfolio optimization across hidden market regimes

    DEFF Research Database (Denmark)

    Nystrup, Peter; Madsen, Henrik; Lindström, Erik

    2017-01-01

    Regime-based asset allocation has been shown to add value over rebalancing to static weights and, in particular, reduce potential drawdowns by reacting to changes in market conditions. The predominant approach in previous studies has been to specify in advance a static decision rule for changing...... the allocation based on the state of financial markets or the economy. In this article, model predictive control (MPC) is used to dynamically optimize a portfolio based on forecasts of the mean and variance of financial returns from a hidden Markov model with time-varying parameters. There are computational...... than a buy-and-hold investment in various major stock market indices. This is after accounting for transaction costs, with a one-day delay in the implementation of allocation changes, and with zero-interest cash as the only alternative to the stock indices. Imposing a trading penalty that reduces...

  17. Supersymmetric leptogenesis with a light hidden sector

    International Nuclear Information System (INIS)

    De Simone, Andrea

    2010-04-01

    Supersymmetric scenarios incorporating thermal leptogenesis as the origin of the observed matter-antimatter asymmetry generically predict abundances of the primordial elements which are in conflict with observations. In this paper we pro- pose a simple way to circumvent this tension and accommodate naturally ther- mal leptogenesis and primordial nucleosynthesis. We postulate the existence of a light hidden sector, coupled very weakly to the Minimal Supersymmetric Standard Model, which opens up new decay channels for the next-to-lightest supersymmetric particle, thus diluting its abundance during nucleosynthesis. We present a general model-independent analysis of this mechanism as well as two concrete realizations, and describe the relevant cosmological and astrophysical bounds and implications for this dark matter scenario. Possible experimental signatures at colliders and in cosmic-ray observations are also discussed. (orig.)

  18. Nuclear scissors modes and hidden angular momenta

    Energy Technology Data Exchange (ETDEWEB)

    Balbutsev, E. B., E-mail: balbuts@theor.jinr.ru; Molodtsova, I. V. [Joint Institute for Nuclear Research (Russian Federation); Schuck, P. [Université Paris-Sud, Institut de Physique Nucléaire, IN2P3–CNRS (France)

    2017-01-15

    The coupled dynamics of low-lying modes and various giant resonances are studied with the help of the Wigner Function Moments method generalized to take into account spin degrees of freedom and pair correlations simultaneously. The method is based on Time-Dependent Hartree–Fock–Bogoliubov equations. The model of the harmonic oscillator including spin–orbit potential plus quadrupole–quadrupole and spin–spin interactions is considered. New low-lying spin-dependent modes are analyzed. Special attention is paid to the scissors modes. A new source of nuclear magnetism, connected with counter-rotation of spins up and down around the symmetry axis (hidden angular momenta), is discovered. Its inclusion into the theory allows one to improve substantially the agreement with experimental data in the description of energies and transition probabilities of scissors modes.

  19. Neuroevolution Mechanism for Hidden Markov Model

    Directory of Open Access Journals (Sweden)

    Nabil M. Hewahi

    2011-12-01

    Full Text Available Hidden Markov Model (HMM is a statistical model based on probabilities. HMM is becoming one of the major models involved in many applications such as natural language
    processing, handwritten recognition, image processing, prediction systems and many more. In this research we are concerned with finding out the best HMM for a certain application domain. We propose a neuroevolution process that is based first on converting the HMM to a neural network, then generating many neural networks at random where each represents a HMM. We proceed by
    applying genetic operators to obtain new set of neural networks where each represents HMMs, and updating the population. Finally select the best neural network based on a fitness function.

  20. Improved hidden Markov model for nosocomial infections.

    Science.gov (United States)

    Khader, Karim; Leecaster, Molly; Greene, Tom; Samore, Matthew; Thomas, Alun

    2014-12-01

    We propose a novel hidden Markov model (HMM) for parameter estimation in hospital transmission models, and show that commonly made simplifying assumptions can lead to severe model misspecification and poor parameter estimates. A standard HMM that embodies two commonly made simplifying assumptions, namely a fixed patient count and binomially distributed detections is compared with a new alternative HMM that does not require these simplifying assumptions. Using simulated data, we demonstrate how each of the simplifying assumptions used by the standard model leads to model misspecification, whereas the alternative model results in accurate parameter estimates. © The Authors 2013. Published by Oxford University Press on behalf of the Institute of Mathematics and its Applications. All rights reserved.

  1. The elliptic genus and Hidden symmetry

    International Nuclear Information System (INIS)

    Jaffe, A.

    2001-01-01

    We study the elliptic genus (a partition function) in certain interacting, twist quantum field theories. Without twists, these theories have N=2 supersymmetry. The twists provide a regularization, and also partially break the supersymmetry. In spite of the regularization, one can establish a homotopy of the elliptic genus in a coupling parameter. Our construction relies on a priori estimates and other methods from constructive quantum field theory; this mathematical underpinning allows us to justify evaluating the elliptic genus at one endpoint of the homotopy. We obtain a version of Witten's proposed formula for the elliptic genus in terms of classical theta functions. As a consequence, the elliptic genus has a hidden SL(2,Z) symmetry characteristic of conformal theory, even though the underlying theory is not conformal. (orig.)

  2. Hidden conformal symmetry of extremal black holes

    International Nuclear Information System (INIS)

    Chen Bin; Long Jiang; Zhang Jiaju

    2010-01-01

    We study the hidden conformal symmetry of extremal black holes. We introduce a new set of conformal coordinates to write the SL(2,R) generators. We find that the Laplacian of the scalar field in many extremal black holes, including Kerr(-Newman), Reissner-Nordstrom, warped AdS 3 , and null warped black holes, could be written in terms of the SL(2,R) quadratic Casimir. This suggests that there exist dual conformal field theory (CFT) descriptions of these black holes. From the conformal coordinates, the temperatures of the dual CFTs could be read directly. For the extremal black hole, the Hawking temperature is vanishing. Correspondingly, only the left (right) temperature of the dual CFT is nonvanishing, and the excitations of the other sector are suppressed. In the probe limit, we compute the scattering amplitudes of the scalar off the extremal black holes and find perfect agreement with the CFT prediction.

  3. Exact solution of the hidden Markov processes

    Science.gov (United States)

    Saakian, David B.

    2017-11-01

    We write a master equation for the distributions related to hidden Markov processes (HMPs) and solve it using a functional equation. Thus the solution of HMPs is mapped exactly to the solution of the functional equation. For a general case the latter can be solved only numerically. We derive an exact expression for the entropy of HMPs. Our expression for the entropy is an alternative to the ones given before by the solution of integral equations. The exact solution is possible because actually the model can be considered as a generalized random walk on a one-dimensional strip. While we give the solution for the two second-order matrices, our solution can be easily generalized for the L values of the Markov process and M values of observables: We should be able to solve a system of L functional equations in the space of dimension M -1 .

  4. Social exclusion, health and hidden homelessness.

    Science.gov (United States)

    Watson, J; Crawley, J; Kane, D

    2016-10-01

    Homelessness and poverty are extreme forms of social exclusion which extend beyond the lack of physical or material needs. The purpose of this study was to explore and expand the concept of social exclusion within the social determinants of health perspective - to understand how the social environment, health behaviours and health status are associated with material and social deprivation. Fundamental qualitative description with tones of focused ethnography. Participants who identified as hidden homeless described their everyday living conditions and how these everyday conditions were impacted and influenced by their social environments, coping/health behaviours and current health status. Research Ethics Board approval was granted and informed consents were obtained from 21 participants prior to the completion of individual interviews. Qualitative content analysis examined the descriptions of men and women experiencing hidden homelessness. Participants described the 'lack of quality social interactions and supports' and their 'daily struggles of street life'. They also shared the 'pain of addiction' and how coping strategies influenced health. Participants were hopeful that their insights would 'better the health of homeless people' by helping shape public policy and funding of community resources that would reduce barriers and improve overall health. Health professionals who understand health behaviours as coping mechanisms for poor quality social environments can provide more comprehensive and holistic care. The findings of this study can be used to support the importance of housing as a key factor in the health and well-being of people experiencing poverty, homelessness and social exclusion; and consequently, reinforces the need for a national housing strategy. Copyright © 2016 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.

  5. Skyrmions with holography and hidden local symmetry

    International Nuclear Information System (INIS)

    Nawa, Kanabu; Hosaka, Atsushi; Suganuma, Hideo

    2009-01-01

    We study baryons as Skyrmions in holographic QCD with D4/D8/D8 multi-D brane system in type IIA superstring theory, and also in the nonlinear sigma model with hidden local symmetry. Comparing these two models, we find that the extra dimension and its nontrivial curvature can largely change the role of (axial) vector mesons for baryons in four-dimensional space-time. In the hidden local symmetry approach, the ρ-meson field as a massive Yang-Mills field has a singular configuration in Skyrmion, which gives a strong repulsion for the baryon as a stabilizer. When the a 1 meson is added in this approach, the stability of Skyrmion is lost by the cancellation of ρ and a 1 contributions. On the contrary, in holographic QCD, the ρ-meson field does not appear as a massive Yang-Mills field due to the extra dimension and its nontrivial curvature. We show that the ρ-meson field has a regular configuration in Skyrmion, which gives a weak attraction for the baryon in holographic QCD. We argue that Skyrmion with π, ρ, and a 1 mesons become stable due to the curved extra dimension and also the presence of the Skyrme term in holographic QCD. From this result, we also discuss the features of our truncated-resonance analysis on baryon properties with π and ρ mesons below the cutoff scale M KK ∼1 GeV in holographic QCD, which is compared with other 5D instanton analysis.

  6. Quantitative evaluation of hidden defects in cast iron components using ultrasound activated lock-in vibrothermography.

    Science.gov (United States)

    Montanini, R; Freni, F; Rossi, G L

    2012-09-01

    This paper reports one of the first experimental results on the application of ultrasound activated lock-in vibrothermography for quantitative assessment of buried flaws in complex cast parts. The use of amplitude modulated ultrasonic heat generation allowed selective response of defective areas within the part, as the defect itself is turned into a local thermal wave emitter. Quantitative evaluation of hidden damages was accomplished by estimating independently both the area and the depth extension of the buried flaws, while x-ray 3D computed tomography was used as reference for sizing accuracy assessment. To retrieve flaw's area, a simple yet effective histogram-based phase image segmentation algorithm with automatic pixels classification has been developed. A clear correlation was found between the thermal (phase) signature measured by the infrared camera on the target surface and the actual mean cross-section area of the flaw. Due to the very fast cycle time (<30 s/part), the method could potentially be applied for 100% quality control of casting components.

  7. Adaptive filtering for hidden node detection and tracking in networks.

    Science.gov (United States)

    Hamilton, Franz; Setzer, Beverly; Chavez, Sergio; Tran, Hien; Lloyd, Alun L

    2017-07-01

    The identification of network connectivity from noisy time series is of great interest in the study of network dynamics. This connectivity estimation problem becomes more complicated when we consider the possibility of hidden nodes within the network. These hidden nodes act as unknown drivers on our network and their presence can lead to the identification of false connections, resulting in incorrect network inference. Detecting the parts of the network they are acting on is thus critical. Here, we propose a novel method for hidden node detection based on an adaptive filtering framework with specific application to neuronal networks. We consider the hidden node as a problem of missing variables when model fitting and show that the estimated system noise covariance provided by the adaptive filter can be used to localize the influence of the hidden nodes and distinguish the effects of different hidden nodes. Additionally, we show that the sequential nature of our algorithm allows for tracking changes in the hidden node influence over time.

  8. Hidden gauge structure of supersymmetric free differential algebras

    Energy Technology Data Exchange (ETDEWEB)

    Andrianopoli, Laura [DISAT, Politecnico di Torino,Corso Duca degli Abruzzi 24, I-10129 Turin (Italy); INFN - Sezione di Torino,Torino (Italy); D’Auria, Riccardo [DISAT, Politecnico di Torino,Corso Duca degli Abruzzi 24, I-10129 Turin (Italy); Ravera, Lucrezia [DISAT, Politecnico di Torino,Corso Duca degli Abruzzi 24, I-10129 Turin (Italy); INFN - Sezione di Torino,Torino (Italy)

    2016-08-16

    The aim of this paper is to clarify the role of the nilpotent fermionic generator Q{sup ′} introduced in http://dx.doi.org/10.1016/0550-3213(82)90376-5 and appearing in the hidden supergroup underlying the free differential algebra (FDA) of D=11 supergravity. We give a physical explanation of its role by looking at the gauge properties of the theory. We find that its presence is necessary, in order that the extra 1-forms of the hidden supergroup give rise to the correct gauge transformations of the p-forms of the FDA. This interpretation is actually valid for any supergravity containing antisymmetric tensor fields, and any supersymmetric FDA can always be traded for a hidden Lie superalgebra containing extra fermionic nilpotent generators. As an interesting example we construct the hidden superalgebra associated with the FDA of N=2, D=7 supergravity. In this case we are able to parametrize the mutually non local 2- and 3-form B{sup (2)} and B{sup (3)} in terms of hidden 1-forms and find that supersymmetry and gauge invariance require in general the presence of two nilpotent fermionic generators in the hidden algebra. We propose that our approach, where all the invariances of the FDA are expressed as Lie derivatives of the p-forms in the hidden supergroup manifold, could be an appropriate framework to discuss theories defined in enlarged versions of superspace recently considered in the literature, such us double field theory and its generalizations.

  9. Sociocultural Dimension of Hidden Content in a Professional Language Curriculum

    Directory of Open Access Journals (Sweden)

    Ekaterina E. Shishlova

    2017-12-01

    Full Text Available Introduction: studying curriculum as a pedagogical problem has traditionally been reduced to the analysis of its explicit content, set in official educational documents. However, a much less studied hidden content plays a significant role in education. So, what is the role of the hidden curriculum during professional language training? The purpose of the article is to determine the potential impact of hidden curriculum on students’ conceptual worldview. Comparing the worldview presented in textbooks with students’ one has allowed us to estimate the rate of influence of hidden curr iculum. Materials and Methods: the methodological basis of the work is the cultural concept of personalityoriented education. The methodology for studying the role of hidden curriculum includes four stages: at the first stage, the authors set the criteria for selecting textbooks for analysis and do the selection; at the second stage, the authors select sociocultural concepts for analysis; at the third stage, the scheme of analysis is designed and the analysis of textbooks is done; at the fourth stage, the authors identify the potential influence of hidden curriculum on students’ conceptual worldview. Results: the structure of hidden curriculum has been determined and the scheme for analysing its subject component has been developed. The authors have identified a significant influence of hidden curriculum on students’ worldview, which represents the scientific novelty of the article. Discussion and Conclusions: the article gives the definition of a hidden curriculum which is new for Russian pedagogy and presents a methodology for its analysis in EFL textbooks. That analysis is recommended to be conducted when selecting teaching materials both i n languages and other humanities.

  10. Multilayer Neural Networks with Extensively Many Hidden Units

    International Nuclear Information System (INIS)

    Rosen-Zvi, Michal; Engel, Andreas; Kanter, Ido

    2001-01-01

    The information processing abilities of a multilayer neural network with a number of hidden units scaling as the input dimension are studied using statistical mechanics methods. The mapping from the input layer to the hidden units is performed by general symmetric Boolean functions, whereas the hidden layer is connected to the output by either discrete or continuous couplings. Introducing an overlap in the space of Boolean functions as order parameter, the storage capacity is found to scale with the logarithm of the number of implementable Boolean functions. The generalization behavior is smooth for continuous couplings and shows a discontinuous transition to perfect generalization for discrete ones

  11. Update on hidden sectors with dark forces and dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Andreas, Sarah

    2012-11-15

    Recently there has been much interest in hidden sectors, especially in the context of dark matter and ''dark forces'', since they are a common feature of beyond standard model scenarios like string theory and SUSY and additionally exhibit interesting phenomenological aspects. Various laboratory experiments place limits on the so-called hidden photon and continuously further probe and constrain the parameter space; an updated overview is presented here. Furthermore, for several hidden sector models with light dark matter we study the viability with respect to the relic abundance and direct detection experiments.

  12. Hidden photon dark matter search with large metallic mirror

    International Nuclear Information System (INIS)

    Doebrich, Babette; Lindner, Axel; Daumiller, Kai; Engel, Ralph; Roth, Markus; Kowalski, Marek

    2014-10-01

    If Dark Matter is composed of hidden-sector photons that kinetically mix with photons of the visible sector, then Dark Matter has a tiny oscillating electric field component. Its presence would lead to a small amount of visible radiation being emitted from a conducting surface, with the photon frequency given approximately by the mass of the hidden photon. Here, we report on experimental efforts that have started recently to search for such hidden photon Dark Matter in the (sub-)eV regime with a prototype mirror for the Auger fluorescence detector at the Karlsruhe Institute for Technology.

  13. Naturally light hidden photons in LARGE volume string compactifications

    International Nuclear Information System (INIS)

    Goodsell, M.; Jaeckel, J.; Redondo, J.; Ringwald, A.

    2009-09-01

    Extra ''hidden'' U(1) gauge factors are a generic feature of string theory that is of particular phenomenological interest. They can kinetically mix with the Standard Model photon and are thereby accessible to a wide variety of astrophysical and cosmological observations and laboratory experiments. In this paper we investigate the masses and the kinetic mixing of hidden U(1)s in LARGE volume compactifications of string theory. We find that in these scenarios the hidden photons can be naturally light and that their kinetic mixing with the ordinary electromagnetic photon can be of a size interesting for near future experiments and observations. (orig.)

  14. Hidden Area and Mechanical Nonlinearities in Freestanding Graphene

    Science.gov (United States)

    Nicholl, Ryan J. T.; Lavrik, Nickolay V.; Vlassiouk, Ivan; Srijanto, Bernadeta R.; Bolotin, Kirill I.

    2017-06-01

    We investigated the effect of out-of-plane crumpling on the mechanical response of graphene membranes. In our experiments, stress was applied to graphene membranes using pressurized gas while the strain state was monitored through two complementary techniques: interferometric profilometry and Raman spectroscopy. By comparing the data obtained through these two techniques, we determined the geometric hidden area which quantifies the crumpling strength. While the devices with hidden area ˜0 % obeyed linear mechanics with biaxial stiffness 428 ±10 N /m , specimens with hidden area in the range 0.5%-1.0% were found to obey an anomalous nonlinear Hooke's law with an exponent ˜0.1 .

  15. Context Tree Estimation in Variable Length Hidden Markov Models

    OpenAIRE

    Dumont, Thierry

    2011-01-01

    We address the issue of context tree estimation in variable length hidden Markov models. We propose an estimator of the context tree of the hidden Markov process which needs no prior upper bound on the depth of the context tree. We prove that the estimator is strongly consistent. This uses information-theoretic mixture inequalities in the spirit of Finesso and Lorenzo(Consistent estimation of the order for Markov and hidden Markov chains(1990)) and E.Gassiat and S.Boucheron (Optimal error exp...

  16. Local models and hidden nonlocality in Quantum Theory

    OpenAIRE

    Guerini, Leonardo

    2014-01-01

    This Master's thesis has two central subjects: the simulation of correlations generated by local measurements on entangled quantum states by local hidden-variables models and the revelation of hidden nonlocality. We present and detail the Werner's local model and the hidden nonlocality of some Werner states of dimension $d\\geq5$, the Gisin-Degorre's local model for a Werner state of dimension $d=2$ and the local model of Hirsch et al. for mixtures of the singlet state and noise, all of them f...

  17. Suppressing the QCD axion abundance by hidden monopoles

    International Nuclear Information System (INIS)

    Kawasaki, Masahiro

    2015-11-01

    We study the Witten effect of hidden monopoles on the QCD axion dynamics, and show that its abundance as well as isocurvature perturbations can be significantly suppressed if there is a sufficient amount of hidden monopoles. When the hidden monopoles make up a significant fraction of dark matter, the Witten effect suppresses the abundance of axion with the decay constant smaller than 10 12 GeV. The cosmological domain wall problem of the QCD axion can also be avoided, relaxing the upper bound on the decay constant when the Peccei-Quinn symmetry is spontaneously broken after inflation.

  18. Emittance growth caused by bends in the Los Alamos free-electron laser energy recovery experiment

    International Nuclear Information System (INIS)

    Carlsten, B.E.

    1987-01-01

    Experimentally transporting the beam from the wiggler to the decelerators in the energy recovery experiment (ERX) at the Los Alamos National Laboratory free-electron laser was more difficult than expected because of the large initial emittance in the beam. This emittance was apparently caused in an early 60 0 achromatic bend. To get this beam through subsequent bends without wall interception, the quadrupole focusing had to be changed from the design amount; as a result, the emittance grew further. This paper discusses various mechanisms for this emittance growth in the 60 0 bend, including effects caused by path changes in the bend resulting from wake-field-induced energy changes of particles in the beam and examines emittance filters, ranging from a simple aperture near a beam crossover to more complicated telescope schemes designed to regain the original emittance before the 60 0 bend

  19. Radial arrays of nano-electrospray ionization emitters and methods of forming electrosprays

    Science.gov (United States)

    Kelly, Ryan T [West Richland, WA; Tang, Keqi [Richland, WA; Smith, Richard D [Richland, WA

    2010-10-19

    Electrospray ionization emitter arrays, as well as methods for forming electrosprays, are described. The arrays are characterized by a radial configuration of three or more nano-electrospray ionization emitters without an extractor electrode. The methods are characterized by distributing fluid flow of the liquid sample among three or more nano-electrospray ionization emitters, forming an electrospray at outlets of the emitters without utilizing an extractor electrode, and directing the electrosprays into an entrance to a mass spectrometry device. Each of the nano-electrospray ionization emitters can have a discrete channel for fluid flow. The nano-electrospray ionization emitters are circularly arranged such that each is shielded substantially equally from an electrospray-inducing electric field.

  20. High Energy Colliders and Hidden Sectors

    Science.gov (United States)

    Dror, Asaf Jeff

    This thesis explores two dominant frontiers of theoretical physics, high energy colliders and hidden sectors. The Large Hadron Collider (LHC) is just starting to reach its maximum operational capabilities. However, already with the current data, large classes of models are being put under significant pressure. It is crucial to understand whether the (thus far) null results are a consequence of a lack of solution to the hierarchy problem around the weak scale or requires expanding the search strategy employed at the LHC. It is the duty of the current generation of physicists to design new searches to ensure that no stone is left unturned. To this end, we study the sensitivity of the LHC to the couplings in the Standard Model top sector. We find it can significantly improve the measurements on ZtRtR coupling by a novel search strategy, making use of an implied unitarity violation in such models. Analogously, we show that other couplings in the top sector can also be measured with the same technique. Furthermore, we critically analyze a set of anomalies in the LHC data and how they may appear from consistent UV completions. We also propose a technique to measure lifetimes of new colored particles with non-trivial spin. While the high energy frontier will continue to take data, it is likely the only collider of its kind for the next couple decades. On the other hand, low-energy experiments have a promising future with many new proposed experiments to probe the existence of particles well below the weak scale but with small couplings to the Standard Model. In this work we survey the different possibilities, focusingon the constraints as well as possible new hidden sector dynamics. In particular, we show that vector portals which couple to an anomalous current, e.g., baryon number, are significantly constrained from flavor changing meson decays and rare Z decays. Furthermore, we present a new mechanism for dark matter freezeout which depletes the dark sector through an

  1. Alleviating hidden hunger. Approaches that work

    International Nuclear Information System (INIS)

    Kennedy, E.; Mannar, V.; Iyengar, V.

    2003-01-01

    The world has come a long way in understanding the nature, magnitude and range of solutions to micronutrient malnutrition - often called 'hidden hunger'. The most sustainable solutions - that is those that are likely to be maintained in the long term - almost surely will include food-based approaches including diet diversity, food fortification and biofortification. Food fortification and biofortification could be some of the most cost-effective of all public health interventions and thus within the economic reach of even the world's poorest. In order to implement them in a sustainable manner, a combination of technical, operational, economic, behavioural and political factors need to be addressed. In some ways the technological issues are the easiest. Because of attention to research, we now have a variety of ways for both single and multiple micronutrients to reach the target population. We also know what is needed in order to ensure delivery systems. The key factor for continued success in reducing micronutrient malnutrition through fortification is a political commitment at the national and international level and creating effective public-private partnerships at the national level. The payoff for eliminating hidden hunger through nutrient fortification is enormous and few other public health interventions offer such a promising health, nutrition and economic success story. Nuclear and isotopic techniques are valuable tools in helping to meet the multifaceted challenges posed by nutritional disorders affecting the entire human life span (embryonic to elderly). Among the numerous applications available, isotopic techniques are uniquely well suited for targeting and tracking progress in food and nutrition development programmes (See box: How Nutrients are Tracked). These include: use of the stable isotopes of iron (Fe) and zinc (Zn) as a kind of gold standard in studies of their bioavailability from foods; trace element bioavailability and pool sizes for

  2. An integrated microcombustor and photonic crystal emitter for thermophotovoltaics

    Science.gov (United States)

    Chan, Walker R.; Stelmakh, Veronika; Allmon, William R.; Waits, Christopher M.; Soljacic, Marin; Joannopoulos, John D.; Celanovic, Ivan

    2016-11-01

    Thermophotovoltaic (TPV) energy conversion is appealing for portable millimeter- scale generators because of its simplicity, but it relies on a high temperatures. The performance and reliability of the high-temperature components, a microcombustor and a photonic crystal emitter, has proven challenging because they are subjected to 1000-1200°C and stresses arising from thermal expansion mismatches. In this paper, we adopt the industrial process of diffusion brazing to fabricate an integrated microcombustor and photonic crystal by bonding stacked metal layers. Diffusion brazing is simpler and faster than previous approaches of silicon MEMS and welded metal, and the end result is more robust.

  3. An integrated microcombustor and photonic crystal emitter for thermophotovoltaics

    International Nuclear Information System (INIS)

    Chan, Walker R.; Stelmakh, Veronika; Joannopoulos, John D.; Celanovic, Ivan; Allmon, William R.; Waits, Christopher M.; Soljacic, Marin

    2016-01-01

    Thermophotovoltaic (TPV) energy conversion is appealing for portable millimeter- scale generators because of its simplicity, but it relies on a high temperatures. The performance and reliability of the high-temperature components, a microcombustor and a photonic crystal emitter, has proven challenging because they are subjected to 1000-1200°C and stresses arising from thermal expansion mismatches. In this paper, we adopt the industrial process of diffusion brazing to fabricate an integrated microcombustor and photonic crystal by bonding stacked metal layers. Diffusion brazing is simpler and faster than previous approaches of silicon MEMS and welded metal, and the end result is more robust. (paper)

  4. Revisiting the level scheme of the proton emitter 151Lu

    International Nuclear Information System (INIS)

    Wang, F.; Sun, B.H.; Liu, Z.; Scholey, C.; Eeckhaudt, S.; Grahn, T.; Greenlees, P.T.; Jones, P.; Julin, R.; Juutinen, S.; Kettelhut, S.; Leino, M.; Nyman, M.; Rahkila, P.; Saren, J.; Sorri, J.; Uusitalo, J.; Ashley, S.F.; Cullen, I.J.; Garnsworthy, A.B.; Gelletly, W.; Jones, G.A.; Pietri, S.; Podolyak, Z.; Steer, S.; Thompson, N.J.; Walker, P.M.; Williams, S.; Bianco, L.; Darby, I.G.; Joss, D.T.; Page, R.D.; Pakarinen, J.; Rigby, S.; Cullen, D.M.; Khan, S.; Kishada, A.; Gomez-Hornillos, M.B.; Simpson, J.; Jenkins, D.G.; Niikura, M.; Seweryniak, D.; Shizuma, Toshiyuki

    2015-01-01

    An experiment aiming to search for new isomers in the region of proton emitter 151 Lu was performed at the Accelerator Laboratory of the University of Jyväskylä (JYFL), by combining the high resolution γ-ray array JUROGAM, gas-filled RITU separator and GREAT detectors with the triggerless total data readout acquisition (TDR) system. In this proceeding, we revisit the level scheme of 151 Lu by using the proton-tagging technique. A level scheme consistent with the latest experimental results is obtained, and 3 additional levels are identified at high excitation energies. (author)

  5. Bent solenoids for spectrometers and emittance exchange sections

    International Nuclear Information System (INIS)

    Norem, J.

    1999-01-01

    Bent solenoids can be used to transport low energy beams as they provide both confinement and dispersion of particle orbits. Solenoids are being considered both as emittance exchange sections and spectrometers in the muon cooling system as part of the study of the muon collider. They present the results of a study of bent solenoids which considers the design of coupling sections between bent solenoids to straight solenoids, drift compensation fields, aberrations, and factors relating to the construction, such as field ripple, stored energy, coil forces and field errors

  6. A program to research emittance growth in bends

    International Nuclear Information System (INIS)

    Bohn, C.L.

    1996-01-01

    A research program to explore the phenomenon of emittance growth in bends due to noninertial space-charge effects has been defined and initiated. The program combines theoretical, numerical, and experimental investigations. This paper summarizes the motivation of the work and highlights CEBAF close-quote s need for immediate results. The program close-quote s key elements, some of which qualitatively differ from the standard approach used to investigate the production and effects of coherent synchrotron radiation in synchrotrons and storage rings, are enumerated and discussed. copyright 1996 American Institute of Physics

  7. The Brookhaven ATF low-emittance beam line

    International Nuclear Information System (INIS)

    Wang, X.J.; Kirk, H.G.

    1991-01-01

    One component of the experimental program at the Brookhaven Accelerator Test Facility (ATF) consists of a class of experiments which will study the acceleration of electrons through micron-size structures which are exposed in coincidence to a 100 GW CO 2 laser beam. These experiments require the development and control of an electron beam with geometric emittances on the order of 10 -10 m-rad and intensities on the order of 10 6 electrons. In this paper, the authors describe the strategies for producing such beams and the effects of higher-order aberrations. Particle tracking results are presented for the final-focus system

  8. The Brookhaven ATF low-emittance beam line

    International Nuclear Information System (INIS)

    Wang, X.J.

    1991-01-01

    One component of the experimental program at the Brookhaven Accelerator Test Facility (ATF) consists of a class of experiments which will study the acceleration of electrons through micron-size structures which are exposed in coincidence to a 100 GW CO 2 laser beam. These experiments require the development and control of an electron beam with geometric emittances on the order of 10 -10 m-rad and intensities on the order of 10 6 electrons. In this paper, we describe the strategies for producing such beams and the effects of high-order aberrations. Particle tracking results are presented for the final-focus system. 9 refs., 6 figs., 2 tabs

  9. Measurement of Alpha Emitters Concentration in Imported Cigarettes

    International Nuclear Information System (INIS)

    Nasser Allah, Z.K.; Musa, W.A.; AL-Rawi, A.A.S.

    2011-01-01

    The aime of this study was to measured the alpha emitters concentration of (15) different kinds of imported cigarettes. the nuclear reaction used U-235(n, f) obtained by the bombardment of U-235 with thermal neutrons from (Am B e)neutron source with thermal flux of(5*10 3 n.cm -2 .s -1 ). The Results obtained showed the values of the Uranium concentration, and varies from (0.041 ppm) in five stares kind to (2.374ppm) in Machbeth (chocolate) 100's kind. All the result obtained are within the limit levels as given by UNSCAR data

  10. Calculations of emittance and damping time effects in the SLC damping rings

    International Nuclear Information System (INIS)

    Limberg, T.; Moshammer, H.; Raubenheimer, T.; Spencer, J.; Siemann, R.

    1992-03-01

    In a recent NDR machine experiment the transverse emittance was studied as a function of store time and tune. To explain the observed transverse emittance damping time constants, the magnetic measurement data of the longitudinal field of the bending magnets had to be taken into account. The variation of the transverse emittances with tune due to misalignments and the associated anomalous dispersion is studied as well as the effect of synchrobetatron coupling due to dispersion in the RF cavities

  11. Prediction of Annual Rainfall Pattern Using Hidden Markov Model ...

    African Journals Online (AJOL)

    ADOWIE PERE

    Hidden Markov model is very influential in stochastic world because of its ... the earth from the clouds. The usual ... Rainfall modelling and ... Markov Models have become popular tools ... environment sciences, University of Jos, plateau state,.

  12. New limits on hidden photons from past electron beam dumps

    International Nuclear Information System (INIS)

    Andreas, Sarah; Niebuhr, Carsten; Ringwald, Andreas

    2012-09-01

    Hidden sectors with light extra U(1) gauge bosons, so called hidden photons, have recently attracted some attention because they are a common feature of physics beyond the Standard Model like string theory and SUSY and additionally are phenomenologically of great interest regarding recent astrophysical observations. The hidden photon is already constrained by various laboratory experiments and presently searched for in running as well as upcoming experiments. We summarize the current status of limits on hidden photons from past electron beam dump experiments including two new limits from such experiments at KEK and Orsay that have so far not been considered. All our limits take into account the experimental acceptances obtained from Monte Carlo simulations.

  13. Search for hidden particles with the SHiP experiment

    Energy Technology Data Exchange (ETDEWEB)

    Hagner, Caren; Bick, Daniel; Bieschke, Stefan; Ebert, Joachim; Schmidt-Parzefall, Walter [Universitaet Hamburg, Institut fuer Experimentalphysik, Luruper Chaussee 149, 22761 Hamburg (Germany)

    2016-07-01

    Many theories beyond the standard model predict long lived neutral (hidden) particles. There might be a whole Hidden Sector (HS) of weakly interacting particles, which cannot be detected in existing high energy experiments. The SHiP experiment (Search for Hidden Particles) requires a high intensity beam dump, which could be realized by a new facility at the CERN SPS accelerator. New superweakly interacting particles with masses below O(10) GeV could be produced in the beam dump and detected in a general purpose Hidden Sector (HS) detector. In addition there will be a dedicated tau neutrino subdetector. I present the major requirements and technical challenges for the HS detector and discuss how the HS can be accessed through several portals: neutrino portal, scalar portal, vector portal and many more.

  14. Cosmological abundance of the QCD axion coupled to hidden photons

    Science.gov (United States)

    Kitajima, Naoya; Sekiguchi, Toyokazu; Takahashi, Fuminobu

    2018-06-01

    We study the cosmological evolution of the QCD axion coupled to hidden photons. For a moderately strong coupling, the motion of the axion field leads to an explosive production of hidden photons by tachyonic instability. We use lattice simulations to evaluate the cosmological abundance of the QCD axion. In doing so, we incorporate the backreaction of the produced hidden photons on the axion dynamics, which becomes significant in the non-linear regime. We find that the axion abundance is suppressed by at most O (102) for the decay constant fa =1016GeV, compared to the case without the coupling. For a sufficiently large coupling, the motion of the QCD axion becomes strongly damped, and as a result, the axion abundance is enhanced. Our results show that the cosmological upper bound on the axion decay constant can be relaxed by a few hundred for a certain range of the coupling to hidden photons.

  15. Dopamine reward prediction errors reflect hidden state inference across time

    Science.gov (United States)

    Starkweather, Clara Kwon; Babayan, Benedicte M.; Uchida, Naoshige; Gershman, Samuel J.

    2017-01-01

    Midbrain dopamine neurons signal reward prediction error (RPE), or actual minus expected reward. The temporal difference (TD) learning model has been a cornerstone in understanding how dopamine RPEs could drive associative learning. Classically, TD learning imparts value to features that serially track elapsed time relative to observable stimuli. In the real world, however, sensory stimuli provide ambiguous information about the hidden state of the environment, leading to the proposal that TD learning might instead compute a value signal based on an inferred distribution of hidden states (a ‘belief state’). In this work, we asked whether dopaminergic signaling supports a TD learning framework that operates over hidden states. We found that dopamine signaling exhibited a striking difference between two tasks that differed only with respect to whether reward was delivered deterministically. Our results favor an associative learning rule that combines cached values with hidden state inference. PMID:28263301

  16. Optimisation of Hidden Markov Model using Baum–Welch algorithm ...

    Indian Academy of Sciences (India)

    The present work is a part of development of Hidden Markov Model. (HMM) based ... the Himalaya. In this work, HMMs have been developed for forecasting of maximum and minimum ..... data collection teams of Snow and Avalanche Study.

  17. On the LHC sensitivity for non-thermalised hidden sectors

    Science.gov (United States)

    Kahlhoefer, Felix

    2018-04-01

    We show under rather general assumptions that hidden sectors that never reach thermal equilibrium in the early Universe are also inaccessible for the LHC. In other words, any particle that can be produced at the LHC must either have been in thermal equilibrium with the Standard Model at some point or must be produced via the decays of another hidden sector particle that has been in thermal equilibrium. To reach this conclusion, we parametrise the cross section connecting the Standard Model to the hidden sector in a very general way and use methods from linear programming to calculate the largest possible number of LHC events compatible with the requirement of non-thermalisation. We find that even the HL-LHC cannot possibly produce more than a few events with energy above 10 GeV involving states from a non-thermalised hidden sector.

  18. Risk from the frontlines of a hidden epidemic sexuality, masculinities ...

    African Journals Online (AJOL)

    Risk from the frontlines of a hidden epidemic sexuality, masculinities and social pressures ... It frames risk in the context of the dynamics governing sexuality, underlined ... MSM risk and practice, in these contexts, are consequently shaped by ...

  19. New limits on hidden photons from past electron beam dumps

    Energy Technology Data Exchange (ETDEWEB)

    Andreas, Sarah; Niebuhr, Carsten; Ringwald, Andreas

    2012-09-15

    Hidden sectors with light extra U(1) gauge bosons, so called hidden photons, have recently attracted some attention because they are a common feature of physics beyond the Standard Model like string theory and SUSY and additionally are phenomenologically of great interest regarding recent astrophysical observations. The hidden photon is already constrained by various laboratory experiments and presently searched for in running as well as upcoming experiments. We summarize the current status of limits on hidden photons from past electron beam dump experiments including two new limits from such experiments at KEK and Orsay that have so far not been considered. All our limits take into account the experimental acceptances obtained from Monte Carlo simulations.

  20. A Novel Method for Decoding Any High-Order Hidden Markov Model

    Directory of Open Access Journals (Sweden)

    Fei Ye

    2014-01-01

    Full Text Available This paper proposes a novel method for decoding any high-order hidden Markov model. First, the high-order hidden Markov model is transformed into an equivalent first-order hidden Markov model by Hadar’s transformation. Next, the optimal state sequence of the equivalent first-order hidden Markov model is recognized by the existing Viterbi algorithm of the first-order hidden Markov model. Finally, the optimal state sequence of the high-order hidden Markov model is inferred from the optimal state sequence of the equivalent first-order hidden Markov model. This method provides a unified algorithm framework for decoding hidden Markov models including the first-order hidden Markov model and any high-order hidden Markov model.

  1. A two particle hidden sector and the oscillations with photons

    Energy Technology Data Exchange (ETDEWEB)

    Alvarez, Pedro D. [Universidad de Antofagasta, Departamento de Fisica, Antofagasta (Chile); Arias, Paola; Maldonado, Carlos [Universidad de Santiago de Chile, Departmento de Fisica, Santiago (Chile)

    2018-01-15

    We present a detailed study of the oscillations and optical properties for vacuum, in a model for the dark sector that contains axion-like particles and hidden photons. We provide bounds for the couplings versus the mass, using current results from ALPS-I and PVLAS. We also discuss the challenges for the detection of models with more than one hidden particle in light shining trough wall-like experiments. (orig.)

  2. Rare Z boson decays to a hidden sector

    Science.gov (United States)

    Blinov, Nikita; Izaguirre, Eder; Shuve, Brian

    2018-01-01

    We demonstrate that rare decays of the Standard Model Z boson can be used to discover and characterize the nature of new hidden-sector particles. We propose new searches for these particles in soft, high-multiplicity leptonic final states at the Large Hadron Collider. The proposed searches are sensitive to low-mass particles produced in Z decays, and we argue that these striking signatures can shed light on the hidden-sector couplings and mechanism for mass generation.

  3. Anticipating hidden text salting in emails (extended abstract)

    OpenAIRE

    Lioma, Christina; Moens, Marie-Francine; Gomez, Juan Carlos; De Beer, Jan; Bergholz, Andre; Paass, Gerhard; Horkan, Patrick

    2008-01-01

    Salting is the intentional addition or distortion of content, aimed to evade automatic filtering. Salting is usually found in spam emails. Salting can also be hidden in phishing emails, which aim to steal personal information from users. We present a novel method that detects hidden salting tricks as visual anomalies in text. We solely use these salting tricks to successfully classify emails as phishing (F-measure >90%).

  4. Hidden twelve-dimensional super Poincare symmetry in eleven dimensions

    International Nuclear Information System (INIS)

    Bars, Itzhak; Deliduman, Cemsinan; Pasqua, Andrea; Zumino, Bruno

    2004-01-01

    First, we review a result in our previous paper, of how a ten-dimensional superparticle, taken off-shell, has a hidden eleven-dimensional super Poincare symmetry. Then, we show that the physical sector is defined by three first-class constraints which preserve the full eleven-dimensional symmetry. Applying the same concepts to the eleven-dimensional superparticle, taken off-shell, we discover a hidden twelve-dimensional super Poincare symmetry that governs the theory

  5. Hidden charged dark matter and chiral dark radiation

    Science.gov (United States)

    Ko, P.; Nagata, Natsumi; Tang, Yong

    2017-10-01

    In the light of recent possible tensions in the Hubble constant H0 and the structure growth rate σ8 between the Planck and other measurements, we investigate a hidden-charged dark matter (DM) model where DM interacts with hidden chiral fermions, which are charged under the hidden SU(N) and U(1) gauge interactions. The symmetries in this model assure these fermions to be massless. The DM in this model, which is a Dirac fermion and singlet under the hidden SU(N), is also assumed to be charged under the U(1) gauge symmetry, through which it can interact with the chiral fermions. Below the confinement scale of SU(N), the hidden quark condensate spontaneously breaks the U(1) gauge symmetry such that there remains a discrete symmetry, which accounts for the stability of DM. This condensate also breaks a flavor symmetry in this model and Nambu-Goldstone bosons associated with this flavor symmetry appear below the confinement scale. The hidden U(1) gauge boson and hidden quarks/Nambu-Goldstone bosons are components of dark radiation (DR) above/below the confinement scale. These light fields increase the effective number of neutrinos by δNeff ≃ 0.59 above the confinement scale for N = 2, resolving the tension in the measurements of the Hubble constant by Planck and Hubble Space Telescope if the confinement scale is ≲1 eV. DM and DR continuously scatter with each other via the hidden U(1) gauge interaction, which suppresses the matter power spectrum and results in a smaller structure growth rate. The DM sector couples to the Standard Model sector through the exchange of a real singlet scalar mixing with the Higgs boson, which makes it possible to probe our model in DM direct detection experiments. Variants of this model are also discussed, which may offer alternative ways to investigate this scenario.

  6. Emittance and trajectory control in the main linacs of the NLC

    International Nuclear Information System (INIS)

    Assmann, R.; Adolphsen, C.; Bane, K.; Raubenheimer, T.O.; Thompson, K.

    1996-09-01

    The main linacs of the next generation of linear colliders need to accelerate the particle beams to energies of up to 750 GeV while maintaining very small emittances. This paper describes the main mechanisms of static emittance growth in the main linacs of the Next Linear Collider (NLC). The authors present detailed simulations of the trajectory and emittance control algorithms that are foreseen for the NLC. They show that the emittance growth in the main linacs can be corrected down to about 110%. That number is significantly better than required for the NLC design luminosity

  7. Experimental studies on coherent synchrotron radiation at an emittance exchange beam line

    Directory of Open Access Journals (Sweden)

    J. C. T. Thangaraj

    2012-11-01

    Full Text Available One of the goals of the Fermilab A0 photoinjector is to investigate experimentally the transverse to longitudinal emittance exchange (EEX principle. Coherent synchrotron radiation in the emittance exchange line could limit the performance of the emittance exchanger at short bunch lengths. In this paper, we present experimental and simulation studies of the coherent synchrotron radiation (CSR in the emittance exchange line at the A0 photoinjector. We report on time-resolved CSR studies using a skew-quadrupole technique. We also demonstrate the advantages of running the EEX with an energy-chirped beam.

  8. Multibunch emittance growth and its corrections in S-Band linear collider

    International Nuclear Information System (INIS)

    Gao, J.

    1994-11-01

    Multibunch emittance growths caused by long range wake fields with the misalignments of accelerating structures and quadrupoles in S-Band linear collider are studied. Tolerances for the misalignment errors of accelerating structures and quadrupoles are given corresponding to different detuned+damped structures. At the end of main linac, emittance corrector (EC) is proposed to be used to reduce further the multibunch emittance. Numerical simulations show that the effect of EC is obvious (multibunch emittance can be reduced about one order of magnitude), and it is believed that this kind of EC will be necessary for future linear colliders. (author). 16 refs., 21 figs., 4 tabs

  9. Emittance growth due to noise and its suppression with the Feedback system in large hadron colliders

    International Nuclear Information System (INIS)

    Lebedev, V.; Parkhomchuk, V.; Shiltsev, V.; Stupakov, G.

    1993-03-01

    The problem of emittance growth due to random fluctuation of the magnetic field in hadron colliders is considered. Based on a simple one-dimensional linear model, a formula for an emittance growth rate as a function of the noise spectrum is derived. Different sources of the noise are analyzed and their role is estimated for the Superconducting Super Collider (SSC). A theory of feedback suppression of the emittance growth is developed which predicts the residual growth of the emittance in the accelerator with a feedback system

  10. Improvements in emittance wake field optimization for the SLAC Linear Collider

    CERN Document Server

    Decker, Franz Josef

    2003-01-01

    The transverse emittances in the SLAC Linear Collider can be severely diluted by collective wakefield effects and dispersion. For the 1997/98 SLC/SLD run important changes were implemented in the way the emittance is optimized. Early in the linac, where the energy spread is large due to BNS damping, the emittance growth is dominated by dispersion. In this regime emittance tuning bumps may introduce additional wakefield tails and their use is now avoided. At the end of the linac the energy spread is minimal and the emittance measurement is most sensitive to wakefield emittance dilution. In previous years, the emittances were tuned on wire scanners located near but not at the end of the linac (after about 90% of its length). Simulations show that emittance growth of up to 100% can occur in the remaining 10%. In this run wire scanners at the entrance of the Final Focus, the last place where the emittances can be measured, were used for the optimization. Screens at the end of the linac allow additional real time ...

  11. Strong nonlinearity-induced correlations for counterpropagating photons scattering on a two-level emitter

    DEFF Research Database (Denmark)

    Nysteen, Anders; McCutcheon, Dara; Mørk, Jesper

    2015-01-01

    We analytically treat the scattering of two counterpropagating photons on a two-level emitter embedded in an optical waveguide. We find that the nonlinearity of the emitter can give rise to significant pulse-dependent directional correlations in the scattered photonic state, which could be quanti......We analytically treat the scattering of two counterpropagating photons on a two-level emitter embedded in an optical waveguide. We find that the nonlinearity of the emitter can give rise to significant pulse-dependent directional correlations in the scattered photonic state, which could...

  12. Very low recombination phosphorus emitters for high efficiency crystalline silicon solar cells

    International Nuclear Information System (INIS)

    Ortega, P; Vetter, M; Bermejo, S; Alcubilla, R

    2008-01-01

    This work studies low recombination phosphorus emitters on c-Si. The emitters are fabricated by diffusion from solid sources and then passivated by thermal oxide yielding sheet resistances between 15 and 280 Ω/sq. Emitter saturation current densities lie in the 2.5–110 fA cm −2 range, leading to implicit open-circuit voltages between 674 and 725 mV. Bulk lifetime is limited by intrinsic recombination mechanisms. Surface recombination velocities between 80 and 300 cm s −1 have been obtained, appearing among the lowest reported in this range of emitter sheet resistances

  13. Analysis of emittance compensation and simulation results to photo-cathode RF gun

    CERN Document Server

    LiuShengGuang

    2002-01-01

    The emittance compensation technology will be used on the photo-cathode RF gun for Shanghai SDUV-FEL. The space charge force and its effect on electron beam transverse emittance in RF gun is studied, the principle of emittance compensation in phase-space is discussed. The authors have designed a compensation solenoid and calculated its magnetic field distribution. Its performance has been studied by the code PARMELA. A simulation result indicates that the normalized transverse RMS emittance for electron beam of 1.5 nC is 1.612 pi mm centre dot mrad, electron energy E = 5.71 MeV

  14. Experimental studies on coherent synchrotron radiation at an emittance exchange beam line

    Science.gov (United States)

    Thangaraj, J. C. T.; Thurman-Keup, R.; Ruan, J.; Johnson, A. S.; Lumpkin, A. H.; Santucci, J.

    2012-11-01

    One of the goals of the Fermilab A0 photoinjector is to investigate experimentally the transverse to longitudinal emittance exchange (EEX) principle. Coherent synchrotron radiation in the emittance exchange line could limit the performance of the emittance exchanger at short bunch lengths. In this paper, we present experimental and simulation studies of the coherent synchrotron radiation (CSR) in the emittance exchange line at the A0 photoinjector. We report on time-resolved CSR studies using a skew-quadrupole technique. We also demonstrate the advantages of running the EEX with an energy-chirped beam.

  15. Field emission characteristics of a small number of carbon fiber emitters

    Directory of Open Access Journals (Sweden)

    Wilkin W. Tang

    2016-09-01

    Full Text Available This paper reports an experiment that studies the emission characteristics of small number of field emitters. The experiment consists of nine carbon fibers in a square configuration. Experimental results show that the emission characteristics depend strongly on the separation between each emitter, providing evidence of the electric field screening effects. Our results indicate that as the separation between the emitters decreases, the emission current for a given voltage also decreases. The authors compare the experimental results to four carbon fiber emitters in a linear and square configurations as well as to two carbon fiber emitters in a paired array. Voltage-current traces show that the turn-on voltage is always larger for the nine carbon fiber emitters as compared to the two and four emitters in linear configurations, and approximately identical to the four emitters in a square configuration. The observations and analysis reported here, based on Fowler-Nordheim field emission theory, suggest the electric field screening effect depends critically on the number of emitters, the separation between them, and their overall geometric configuration.

  16. Intelligent Variable Emittance Panels Using New, ""True"" Solid Electrolyte, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — This work further developed a highly promising Variable Emittance technology for spacecraft thermal control based on Conducting Polymer (CP) electrochromics...

  17. Hidden Markov models in automatic speech recognition

    Science.gov (United States)

    Wrzoskowicz, Adam

    1993-11-01

    This article describes a method for constructing an automatic speech recognition system based on hidden Markov models (HMMs). The author discusses the basic concepts of HMM theory and the application of these models to the analysis and recognition of speech signals. The author provides algorithms which make it possible to train the ASR system and recognize signals on the basis of distinct stochastic models of selected speech sound classes. The author describes the specific components of the system and the procedures used to model and recognize speech. The author discusses problems associated with the choice of optimal signal detection and parameterization characteristics and their effect on the performance of the system. The author presents different options for the choice of speech signal segments and their consequences for the ASR process. The author gives special attention to the use of lexical, syntactic, and semantic information for the purpose of improving the quality and efficiency of the system. The author also describes an ASR system developed by the Speech Acoustics Laboratory of the IBPT PAS. The author discusses the results of experiments on the effect of noise on the performance of the ASR system and describes methods of constructing HMM's designed to operate in a noisy environment. The author also describes a language for human-robot communications which was defined as a complex multilevel network from an HMM model of speech sounds geared towards Polish inflections. The author also added mandatory lexical and syntactic rules to the system for its communications vocabulary.

  18. Search algorithms, hidden labour and information control

    Directory of Open Access Journals (Sweden)

    Paško Bilić

    2016-06-01

    Full Text Available The paper examines some of the processes of the closely knit relationship between Google’s ideologies of neutrality and objectivity and global market dominance. Neutrality construction comprises an important element sustaining the company’s economic position and is reflected in constant updates, estimates and changes to utility and relevance of search results. Providing a purely technical solution to these issues proves to be increasingly difficult without a human hand in steering algorithmic solutions. Search relevance fluctuates and shifts through continuous tinkering and tweaking of the search algorithm. The company also uses third parties to hire human raters for performing quality assessments of algorithmic updates and adaptations in linguistically and culturally diverse global markets. The adaptation process contradicts the technical foundations of the company and calculations based on the initial Page Rank algorithm. Annual market reports, Google’s Search Quality Rating Guidelines, and reports from media specialising in search engine optimisation business are analysed. The Search Quality Rating Guidelines document provides a rare glimpse into the internal architecture of search algorithms and the notions of utility and relevance which are presented and structured as neutral and objective. Intertwined layers of ideology, hidden labour of human raters, advertising revenues, market dominance and control are discussed throughout the paper.

  19. Hidden Structural Codes in Protein Intrinsic Disorder.

    Science.gov (United States)

    Borkosky, Silvia S; Camporeale, Gabriela; Chemes, Lucía B; Risso, Marikena; Noval, María Gabriela; Sánchez, Ignacio E; Alonso, Leonardo G; de Prat Gay, Gonzalo

    2017-10-17

    Intrinsic disorder is a major structural category in biology, accounting for more than 30% of coding regions across the domains of life, yet consists of conformational ensembles in equilibrium, a major challenge in protein chemistry. Anciently evolved papillomavirus genomes constitute an unparalleled case for sequence to structure-function correlation in cases in which there are no folded structures. E7, the major transforming oncoprotein of human papillomaviruses, is a paradigmatic example among the intrinsically disordered proteins. Analysis of a large number of sequences of the same viral protein allowed for the identification of a handful of residues with absolute conservation, scattered along the sequence of its N-terminal intrinsically disordered domain, which intriguingly are mostly leucine residues. Mutation of these led to a pronounced increase in both α-helix and β-sheet structural content, reflected by drastic effects on equilibrium propensities and oligomerization kinetics, and uncovers the existence of local structural elements that oppose canonical folding. These folding relays suggest the existence of yet undefined hidden structural codes behind intrinsic disorder in this model protein. Thus, evolution pinpoints conformational hot spots that could have not been identified by direct experimental methods for analyzing or perturbing the equilibrium of an intrinsically disordered protein ensemble.

  20. Dietary phytate, zinc and hidden zinc deficiency.

    Science.gov (United States)

    Sandstead, Harold H; Freeland-Graves, Jeanne H

    2014-10-01

    Epidemiological data suggest at least one in five humans are at risk of zinc deficiency. This is in large part because the phytate in cereals and legumes has not been removed during food preparation. Phytate, a potent indigestible ligand for zinc prevents it's absorption. Without knowledge of the frequency of consumption of foods rich in phytate, and foods rich in bioavailable zinc, the recognition of zinc deficiency early in the illness may be difficult. Plasma zinc is insensitive to early zinc deficiency. Serum ferritin concentration≤20μg/L is a potential indirect biomarker. Early effects of zinc deficiency are chemical, functional and may be "hidden". The clinical problem is illustrated by 2 studies that involved US Mexican-American children, and US premenopausal women. The children were consuming home diets that included traditional foods high in phytate. The premenopausal women were not eating red meat on a regular basis, and their consumption of phytate was mainly from bran breakfast cereals. In both studies the presence of zinc deficiency was proven by functional responses to controlled zinc treatment. In the children lean-mass, reasoning, and immunity were significantly affected. In the women memory, reasoning, and eye-hand coordination were significantly affected. A screening self-administered food frequency questionnaire for office might help caregiver's identify patients at risk of zinc deficiency. Copyright © 2014 Elsevier GmbH. All rights reserved.

  1. Natural inflation with hidden scale invariance

    Directory of Open Access Journals (Sweden)

    Neil D. Barrie

    2016-05-01

    Full Text Available We propose a new class of natural inflation models based on a hidden scale invariance. In a very generic Wilsonian effective field theory with an arbitrary number of scalar fields, which exhibits scale invariance via the dilaton, the potential necessarily contains a flat direction in the classical limit. This flat direction is lifted by small quantum corrections and inflation is realised without need for an unnatural fine-tuning. In the conformal limit, the effective potential becomes linear in the inflaton field, yielding to specific predictions for the spectral index and the tensor-to-scalar ratio, being respectively: ns−1≈−0.025(N⋆60−1 and r≈0.0667(N⋆60−1, where N⋆≈30–65 is a number of efolds during observable inflation. This predictions are in reasonable agreement with cosmological measurements. Further improvement of the accuracy of these measurements may turn out to be critical in falsifying our scenario.

  2. Detecting hidden sources-STUK/HUT team

    Energy Technology Data Exchange (ETDEWEB)

    Nikkinen, M.; Aarnio, P. [Helsinki Univ. of Technology, Espoo (Finland); Honkamaa, T.; Tiilikainen, H. [Finnish Centre for Radiation and Nuclear Safety, Helsinki (Finland)

    1997-12-31

    The task of the team was to locate and to identify hidden sources in a specified area in Padasjoki Auttoinen village. The team used AB-420 helicopter of the Finnish Frontier Guard. The team had two measuring systems: HPGe system (relative efficiency 18%) and 5`x5` NaI system. The team found two sources in real-time and additional two sources after 24 h analysis time. After the locations and characteristics of the sources were announced it was found out that altogether six sources would have been possible to find using the measured data. The total number of sources was ten. The NaI detector was good at detecting and locating the sources and HPGe was most useful in identification and calculation of the activity estimates. The following development should be made: 1) larger detectors are needed, 2) the software has to be improved. (This has been performed after the exercise) and 3) the navigation must be based on DGPS. visual navigation causes easily gaps between the flight lines and some sources may not be detected. (au).

  3. Gauging hidden symmetries in two dimensions

    International Nuclear Information System (INIS)

    Samtleben, Henning; Weidner, Martin

    2007-01-01

    We initiate the systematic construction of gauged matter-coupled supergravity theories in two dimensions. Subgroups of the affine global symmetry group of toroidally compactified supergravity can be gauged by coupling vector fields with minimal couplings and a particular topological term. The gauge groups typically include hidden symmetries that are not among the target-space isometries of the ungauged theory. The gaugings constructed in this paper are described group-theoretically in terms of a constant embedding tensor subject to a number of constraints which parametrizes the different theories and entirely encodes the gauged Lagrangian. The prime example is the bosonic sector of the maximally supersymmetric theory whose ungauged version admits an affine e 9 global symmetry algebra. The various parameters (related to higher-dimensional p-form fluxes, geometric and non-geometric fluxes, etc.) which characterize the possible gaugings, combine into an embedding tensor transforming in the basic representation of e 9 . This yields an infinite-dimensional class of maximally supersymmetric theories in two dimensions. We work out and discuss several examples of higher-dimensional origin which can be systematically analyzed using the different gradings of e 9

  4. Academic mobbing: hidden health hazard at workplace.

    Science.gov (United States)

    Khoo, Sb

    2010-01-01

    Academic mobbing is a non-violent, sophisticated, 'ganging up' behaviour adopted by academicians to "wear and tear" a colleague down emotionally through unjustified accusation, humiliation, general harassment and emotional abuse. These are directed at the target under a veil of lies and justifications so that they are "hidden" to others and difficult to prove. Bullies use mobbing activities to hide their own weaknesses and incompetence. Targets selected are often intelligent, innovative high achievers, with good integrity and principles. Mobbing activities appear trivial and innocuous on its own but the frequency and pattern of their occurrence over long period of time indicates an aggressive manipulation to "eliminate" the target. Mobbing activities typically progress through five stereotypical phases that begins with an unsolved minor conflict between two workers and ultimately escalates into a senseless mobbing whereby the target is stigmatized and victimized to justify the behaviours of the bullies. The result is always physical, mental, social distress or illness and, most often, expulsion of target from the workplace. Organizations are subjected to great financial loss, loss of key workers and a tarnished public image and reputation. Public awareness, education, effective counselling, establishment of anti-bullying policies and legislations at all levels are necessary to curb academic mobbing. General practitioners (GPs) play an important role in supporting patients subjected to mental and physical health injury caused by workplace bullying and mobbing.

  5. Detecting hidden sources-STUK/HUT team

    Energy Technology Data Exchange (ETDEWEB)

    Nikkinen, M; Aarnio, P [Helsinki Univ. of Technology, Espoo (Finland); Honkamaa, T; Tiilikainen, H [Finnish Centre for Radiation and Nuclear Safety, Helsinki (Finland)

    1998-12-31

    The task of the team was to locate and to identify hidden sources in a specified area in Padasjoki Auttoinen village. The team used AB-420 helicopter of the Finnish Frontier Guard. The team had two measuring systems: HPGe system (relative efficiency 18%) and 5`x5` NaI system. The team found two sources in real-time and additional two sources after 24 h analysis time. After the locations and characteristics of the sources were announced it was found out that altogether six sources would have been possible to find using the measured data. The total number of sources was ten. The NaI detector was good at detecting and locating the sources and HPGe was most useful in identification and calculation of the activity estimates. The following development should be made: 1) larger detectors are needed, 2) the software has to be improved. (This has been performed after the exercise) and 3) the navigation must be based on DGPS. visual navigation causes easily gaps between the flight lines and some sources may not be detected. (au).

  6. Hidden-Sector Dynamics and the Supersymmetric Seesaw

    CERN Document Server

    Campbell, Bruce A; Maybury, David W

    2008-01-01

    In light of recent analyses that have shown that nontrivial hidden-sector dynamics in models of supersymmetry breaking can lead to a significant impact on the predicted low-energy supersymmetric spectrum, we extend these studies to consider hidden-sector effects in extensions of the MSSM to include a seesaw model for neutrino masses. A dynamical hidden sector in an interval of mass scales below the seesaw scale would yield renormalization-group running involving both the anomalous dimension from the hidden sector and the seesaw-extended MSSM renormalization group equations (RGEs). These effects interfere in general, altering the generational mixing of the sleptons, and allowing for a substantial change to the expected level of charged-lepton flavour violation in seesaw-extended MSSM models. These results provide further support for recent theoretical observations that knowledge of the hidden sector is required in order to make concrete low-energy predictions, if the hidden sector is strongly coupled. In parti...

  7. Problems in radiological protection involving alpha emitters in bone

    International Nuclear Information System (INIS)

    Dolphin, G.W.

    1976-01-01

    Quantitative dose/effect relationships for humans exposed to α emitters can only be established from data on humans exposed to this type of radiation. The risk of bone sarcoma from exposure to plutonium-239 may be established from the data on the human cases exposed to radium-226 either by consideration of the radiation dose to the osteoprogenitor cells or by use of the average bone dose together with a modifying factor to take into account the greater toxicity of plutonium relative to radium. The relative toxicity can be evaluated from the data on osteosarcoma incidence in animals. Both methods of risk estimation are given and criticised in the paper. In future recommendations, ICRP will not use the critical organ concept and the late effects from α emitters deposited in organs other than the bone will have to be taken into account in setting maximum permissible annual intakes. The implications of this and other proposed changes in ICRP concepts are discussed. (orig.) [de

  8. Field Emitter Arrays for a Free Electron Laser Application

    CERN Document Server

    Shing-Bruce-Li, Kevin; Ganter, Romain; Gobrecht, Jens; Raguin, Jean Yves; Rivkin, Leonid; Wrulich, Albin F

    2004-01-01

    The development of a new electron gun with the lowest possible emittance would help reducing the total length and cost of a free electron laser. Field emitter arrays (FEAs) are an attractive technology for electron sources of ultra high brightness. Indeed, several thousands of microscopic tips can be deposited on a 1 mm diameter area. Electrons are then extracted by applying voltage to a first grid layer close to the tip apexes, the so called gate layer, and focused by a second grid layer one micrometer above the tips. The typical aperture diameter of the gate and the focusing layer is in the range of one micrometer. One challenge for such cathodes is to produce peak currents in the ampere range since the usual applications of FEAs require less than milliampere. Encouraging peak current performances have been obtained by applying voltage pulses at low frequency between gate and tips. In this paper we report on different tip materials available on the market: diamond FEAs from Extreme Devices Inc., ZrC single ...

  9. Emittance scanner for intense low-energy ion beams

    International Nuclear Information System (INIS)

    Allison, P.W.; Sherman, J.D.; Holtkamp, D.B.

    1983-01-01

    An emittance scanner has been developed for use with low-energy H - ion beams to satisfy the following requirements: (1) angular resolution of +-1/2 mrad, (2) small errors from beam space charge, and (3) compact and simple design. The scanner consists of a 10-cm-long analyzer containing two slits and a pair of electric deflection plates driven by a +-500-V linear ramp generator. As the analyzer is mechanically driven across the beam, the front slit passes a thin ribbon of beam through the plates. The ion transit time is short compared with the ramp speed; therefore, the initial angle of the ions that pass through the rear slit is proportional to the instantaneous ramp voltage. The current through the rear slit then is proportional to the phase-space density d 2 i/dxdx'. The data are computer-analyzed to give, for example, rms emittance and phase-space density contours. Comparison of measured data with those calculated from a prepared (collimated) phase space is in good agreement

  10. Emittance measurement and modeling for the Fermilab Booster

    Directory of Open Access Journals (Sweden)

    Xiaobiao Huang

    2006-01-01

    Full Text Available Turn-by-turn beam profile data measured at the Fermilab Booster are studied. Lattice models with experimental accelerator ramping parameters are used to obtain the lattice functions for data analysis. We studied the horizontal and vertical emittance growth behavior in different stages of a booster ramping cycle and its relation to the beam intensity. The transverse and longitudinal components in the horizontal beam width are separated by a fitting model which makes use of the different scaling rules of the beam momentum. We analyze the post-transition horizontal beam size oscillation based on a model where the longitudinal phase-space mismatch has resulted from rf voltage mismatch during the transition-energy crossing. We carried out systematic multiparticle simulation to show that the source of the vertical emittance growth is a combination of the random errors in skew-quadrupole and dipole fields, and the systematic Montague resonance. The effect of random quadrupole field is small for the Fermilab Booster because the betatron envelope tunes are reasonably far away from the half-integer stop band.

  11. Longitudinal emittance blowup in the large hadron collider

    CERN Document Server

    Baudrenghien, P

    2013-01-01

    The Large Hadron Collider (LHC) relies on Landau damping for longitudinal stability. To avoid decreasing the stability margin at high energy, the longitudinal emittance must be continuously increased during the acceleration ramp. Longitudinal blowup provides the required emittance growth. The method was implemented through the summer of 2010. Band-limited RF phase-noise is injected in the main accelerating cavities during the whole ramp of about 11min. Synchrotron frequencies change along the energy ramp, but the digitally created noise tracks the frequency change. The position of the noise-band, relative to the nominal synchrotron frequency, and the bandwidth of the spectrum are set by pre-defined constants, making the diffusion stop at the edges of the demanded distribution. The noise amplitude is controlled by feedback using the measurement of the average bunch length. This algorithm reproducibly achieves the programmed bunch length of about 1.2ns, at flat top with low bunch-to-bunch scatter and provides a...

  12. Longitudinal emittance reduction in LEIR of ion beams for LHC

    CERN Document Server

    Angoletta, M E; Findlay, A; Hancock, S; Manglunki, D

    2014-01-01

    For the 2013 LHC ion run the anticipated request for batches from the PS Complex comprising four ion bunches spaced by 100 ns was changed to batches of two bunches spaced by 200 ns. This modified demand was met by suppressing a splitting step in the PS machine, but with the consequence of halving the longitudinal emittance required from LEIR. Thus NOMINAL Pb54+ beams from LEIR had to be delivered inside ~9 eVs to provide sufficient blow-up margin in the PS. Machine Development (MD) sessions were carried out in LEIR to investigate methods to satisfy these stricter requirements. Two main ingredients were found to reduce longitudinal emittance. The first and most important was to adjust carefully the frequency offset at capture in order to align the RF with the position where the beam is deposited by the electron cooling system prior to acceleration. The second ingredient was to reduce the final bucket area in order to reduce any residual filamentation during capture. This note documents the results obtaine...

  13. Infrared Organic Light-Emitting Diodes with Carbon Nanotube Emitters.

    Science.gov (United States)

    Graf, Arko; Murawski, Caroline; Zakharko, Yuriy; Zaumseil, Jana; Gather, Malte C

    2018-03-01

    While organic light-emitting diodes (OLEDs) covering all colors of the visible spectrum are widespread, suitable organic emitter materials in the near-infrared (nIR) beyond 800 nm are still lacking. Here, the first OLED based on single-walled carbon nanotubes (SWCNTs) as the emitter is demonstrated. By using a multilayer stacked architecture with matching charge blocking and charge-transport layers, narrow-band electroluminescence at wavelengths between 1000 and 1200 nm is achieved, with spectral features characteristic of excitonic and trionic emission of the employed (6,5) SWCNTs. Here, the OLED performance is investigated in detail and it is found that local conduction hot-spots lead to pronounced trion emission. Analysis of the emissive dipole orientation shows a strong horizontal alignment of the SWCNTs with an average inclination angle of 12.9° with respect to the plane, leading to an exceptionally high outcoupling efficiency of 49%. The SWCNT-based OLEDs represent a highly attractive platform for emission across the entire nIR. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Emittance Measurements from a Laser Driven Electron Injector

    CERN Document Server

    Reis, D

    2003-01-01

    The Gun Test Facility (GTF) at the Stanford Linear Accelerator Center was constructed to develop an appropriate electron beam suitable for driving a short wavelength free electron laser (FEL) such as the proposed Linac Coherent Light Source (LCLS). For operation at a wavelength of 1.5 (angstrom), the LCLS requires an electron injector that can produce an electron beam with approximately 1 pi mm-mrad normalized rms emittance with at least 1 nC of charge in a 10 ps or shorter bunch. The GTF consists of a photocathode rf gun, emittance-compensation solenoid, 3 m linear accelerator (linac), drive laser, and diagnostics to measure the beam. The rf gun is a symmetrized 1.6 cell, s-band high gradient, room temperature, photocathode structure. Simulations show that this gun when driven by a temporally and spatially shaped drive laser, appropriately focused with the solenoid, and further accelerated in linac can produce a beam that meets the LCLS requirements. This thesis describes the initial characterization of the ...

  15. Rayleigh scattering in an emitter-nanofiber-coupling system

    Science.gov (United States)

    Tang, Shui-Jing; Gao, Fei; Xu, Da; Li, Yan; Gong, Qihuang; Xiao, Yun-Feng

    2017-04-01

    Scattering is a general process in both fundamental and applied physics. In this paper, we investigate Rayleigh scattering of a solid-state-emitter coupled to a nanofiber, by S -matrix-like theory in k -space description. Under this model, both Rayleigh scattering and dipole interaction are studied between a two-level artificial atom embedded in a nanocrystal and fiber modes (guided and radiation modes). It is found that Rayleigh scattering plays a critical role in the transport properties and quantum statistics of photons. On the one hand, Rayleigh scattering produces the transparency in the optical transmitted field of the nanofiber, accompanied by the change of atomic phase, population, and frequency shift. On the other hand, the interference between two kinds of scattering fields by Rayleigh scattering and dipole transition modifies the photon statistics (second-order autocorrelation function) of output fields, showing a strong wavelength dependence. This study provides guidance for the solid-state emitter acting as a single-photon source and can be extended to explore the scattering effect in many-body physics.

  16. Operating single quantum emitters with a compact Stirling cryocooler.

    Science.gov (United States)

    Schlehahn, A; Krüger, L; Gschrey, M; Schulze, J-H; Rodt, S; Strittmatter, A; Heindel, T; Reitzenstein, S

    2015-01-01

    The development of an easy-to-operate light source emitting single photons has become a major driving force in the emerging field of quantum information technology. Here, we report on the application of a compact and user-friendly Stirling cryocooler in the field of nanophotonics. The Stirling cryocooler is used to operate a single quantum emitter constituted of a semiconductor quantum dot (QD) at a base temperature below 30 K. Proper vibration decoupling of the cryocooler and its surrounding enables free-space micro-photoluminescence spectroscopy to identify and analyze different charge-carrier states within a single quantum dot. As an exemplary application in quantum optics, we perform a Hanbury-Brown and Twiss experiment demonstrating a strong suppression of multi-photon emission events with g((2))(0) Stirling-cooled single quantum emitter under continuous wave excitation. Comparative experiments performed on the same quantum dot in a liquid helium (LHe)-flow cryostat show almost identical values of g((2))(0) for both configurations at a given temperature. The results of this proof of principle experiment demonstrate that low-vibration Stirling cryocoolers that have so far been considered exotic to the field of nanophotonics are an attractive alternative to expensive closed-cycle cryostats or LHe-flow cryostats, which could pave the way for the development of high-quality table-top non-classical light sources.

  17. Operating single quantum emitters with a compact Stirling cryocooler

    Energy Technology Data Exchange (ETDEWEB)

    Schlehahn, A.; Krüger, L.; Gschrey, M.; Schulze, J.-H.; Rodt, S.; Strittmatter, A.; Heindel, T., E-mail: tobias.heindel@tu-berlin.de; Reitzenstein, S. [Institute of Solid State Physics, Technische Universität Berlin, 10623 Berlin (Germany)

    2015-01-15

    The development of an easy-to-operate light source emitting single photons has become a major driving force in the emerging field of quantum information technology. Here, we report on the application of a compact and user-friendly Stirling cryocooler in the field of nanophotonics. The Stirling cryocooler is used to operate a single quantum emitter constituted of a semiconductor quantum dot (QD) at a base temperature below 30 K. Proper vibration decoupling of the cryocooler and its surrounding enables free-space micro-photoluminescence spectroscopy to identify and analyze different charge-carrier states within a single quantum dot. As an exemplary application in quantum optics, we perform a Hanbury-Brown and Twiss experiment demonstrating a strong suppression of multi-photon emission events with g{sup (2)}(0) < 0.04 from this Stirling-cooled single quantum emitter under continuous wave excitation. Comparative experiments performed on the same quantum dot in a liquid helium (LHe)-flow cryostat show almost identical values of g{sup (2)}(0) for both configurations at a given temperature. The results of this proof of principle experiment demonstrate that low-vibration Stirling cryocoolers that have so far been considered exotic to the field of nanophotonics are an attractive alternative to expensive closed-cycle cryostats or LHe-flow cryostats, which could pave the way for the development of high-quality table-top non-classical light sources.

  18. Transfer mechanisms between emitter molecules for OLED applications

    Energy Technology Data Exchange (ETDEWEB)

    Steinbacher, Frank [Department of Materials Science VI, University of Erlangen-Nuernberg (Germany); Siemens AG, CT MM 1, Erlangen (Germany); Chiu, Chien-Shu [Department of Electrical Engineering and Information Technology, Technical University of Braunschweig (Germany); Siemens AG, CT MM 1, Erlangen (Germany); Krause, Ralf; Hunze, Arvid [Siemens AG, CT MM 1, Erlangen (Germany); Winnacker, Albrecht [Department of Materials Science VI, University of Erlangen-Nuernberg (Germany)

    2009-07-01

    Within the last few years white organic light emitting diodes based on small molecules have shown the potential to have a promising future in the field of lighting technology. Nevertheless there is still room for improvement of the overall efficiency and lifetime of white OLEDs. A deeper understanding of the energy transfer mechanisms between different matrix and emitter molecules used in the OLED stack concept can help to optimize the layout and reduce driving voltage thus increasing the power efficiency and color stability of the device. To simplify the complex interactions within a complete white OLED we start out with a basic model system only containing the molecules of interest. This enables us to predict the fundamental concepts causing the behavior of more intricate systems. Using photoluminescence, excitation spectra and time-resolved photoluminescence we investigated the exciton transfer between different dyes for a variety of emitter systems. Our results indicate a dependence of exciton transfer probability on the total concentrations and therefore the distance between the molecules involved.

  19. Discrete space charge affected field emission: Flat and hemisphere emitters

    Energy Technology Data Exchange (ETDEWEB)

    Jensen, Kevin L., E-mail: kevin.jensen@nrl.navy.mil [Code 6854, Naval Research Laboratory, Washington, DC 20375 (United States); Shiffler, Donald A.; Tang, Wilkin [Air Force Research Laboratory, Kirtland AFB, New Mexico 87117 (United States); Rittersdorf, Ian M. [Code 6770, Naval Research Laboratory, Washington, DC 20375 (United States); Lebowitz, Joel L. [Department of Mathematics and Department of Physics, Rutgers University, Piscataway, New Jersey 08854-8019 (United States); Harris, John R. [U.S. Navy Reserve, New Orleans, Louisiana 70143 (United States); Lau, Y. Y. [Department of Nuclear Engineering and Radiological Sciences, University of Michigan, Ann Arbor, Michigan 48109 (United States); Petillo, John J. [Leidos, Billerica, Massachusetts 01821 (United States); Luginsland, John W. [Physics and Electronics Directorate, AFOSR, Arlington, Virginia 22203 (United States)

    2015-05-21

    Models of space-charge affected thermal-field emission from protrusions, able to incorporate the effects of both surface roughness and elongated field emitter structures in beam optics codes, are desirable but difficult. The models proposed here treat the meso-scale diode region separate from the micro-scale regions characteristic of the emission sites. The consequences of discrete emission events are given for both one-dimensional (sheets of charge) and three dimensional (rings of charge) models: in the former, results converge to steady state conditions found by theory (e.g., Rokhlenko et al. [J. Appl. Phys. 107, 014904 (2010)]) but show oscillatory structure as they do. Surface roughness or geometric features are handled using a ring of charge model, from which the image charges are found and used to modify the apex field and emitted current. The roughness model is shown to have additional constraints related to the discrete nature of electron charge. The ability of a unit cell model to treat field emitter structures and incorporate surface roughness effects inside a beam optics code is assessed.

  20. A Laboratory Goniometer System for Measuring Reflectance and Emittance Anisotropy

    Directory of Open Access Journals (Sweden)

    Arjan de Jong

    2012-12-01

    Full Text Available In this paper, a laboratory goniometer system for performing multi-angular measurements under controlled illumination conditions is described. A commercially available robotic arm enables the acquisition of a large number of measurements over the full hemisphere within a short time span making it much faster than other goniometers. In addition, the presented set-up enables assessment of anisotropic reflectance and emittance behaviour of soils, leaves and small canopies. Mounting a spectrometer enables acquisition of either hemispherical measurements or measurements in the horizontal plane. Mounting a thermal camera allows directional observations of the thermal emittance. This paper also presents three showcases of these different measurement set-ups in order to illustrate its possibilities. Finally, suggestions for applying this instrument and for future research directions are given, including linking the measured reflectance anisotropy with physically-based anisotropy models on the one hand and combining them with field goniometry measurements for joint analysis with remote sensing data on the other hand. The speed and flexibility of the system offer a large added value to the existing pool of laboratory goniometers.