
Sample records for hidden collection sara

  1. 76 FR 2712 - Sara Lee Corporation, Master Data, Cash Applications, Deductions, Collections, Call Center... (United States)


    ..., Collections, Call Center, Information Technology, Accounts Payable, General Accounts, Financial Accounts..., Collections, Call Center, Information Technology, Accounts Payable, General Accounts, Financial Accounting..., Deductions, Collections, Call Center, Information Technology, Accounts Payable, General Accounts,......

  2. Topic Information Collection based on the Hidden Markov Model

    Directory of Open Access Journals (Sweden)

    Hai-yan Jiang


    Full Text Available Specific-subject oriented information collection is one of the key technologies of vertical search engines, which directly affects the speed and relevance of search results. The topic information collection algorithm is widely used for its accuracy. The Hidden Markov Model (HMM is used to learn and judge the relevance between the Uniform Resource Locator (URL and the topic information. The Rocchio method is used to construct the prototype vectors relevant to the topic information, and the HMM is used to learn the preferred browsing paths. The concept maps including the semantics of the webpage are constructed and the web's link structures can be decided. The validity of the algorithm is proved by the experiment at last. Comparing with the Best-First algorithm, this algorithm can get more information pages and has higher precision ratio.

  3. using SARA analysis

    Directory of Open Access Journals (Sweden)

    Oscar Ramirez


    Full Text Available La solubilidad del CO2 en un crudo pesado colombiano fue calculada usando la ecuación cúbica de estado de Peng-Robinson y la correlación de Lee-Kesler. El crudo fue representado como una mezcla de pseudo-componentes y para cada uno de ellos se calcularon las propiedades termodinámicas y críticas. Los resultados obtenidos en la representación del crudo con cuatro, cinco y seis pseudocomponentes muestran que todas las representaciones producen resultados similares y por lo tanto el uso de cuatro pseudo-componentes es suficiente y tiene un costo computacional más bajo. Fueron obtenidos excelentes resultados al comparar los datos experimentales y calculados. Para este sistema es suficiente tener una completa caracterización del análisis SARA y usar cuatro pseudo-componentes para modelar adecuadamente el equilibrio líquido-vapor de CO2-crudo pesado.

  4. Ecological Hidden Troubles and Countermeasures under Reform of Collective Forest Tenure

    Institute of Scientific and Technical Information of China (English)


    Three stages of reform of collective forest tenure after reform and opening up are reviewed.The reform of forest tenure brings sharp increase of economic benefit.However,due to forest farmers’ subjective pursuit for economic benefit and objective lack of necessary economic,financial and technical support,ecological hidden troubles are created.Based on these,we put forward countermeasures,including strengthening forest farmers’ awareness of ecological protection and solving ecological problems in accordance with actual conditions of the region.

  5. Search for Hidden Knowledge in Collective Intelligence dealing Indeterminacy Ontology of Folksonomy with Linguistic Pragmatics and Quantum Logic

    CERN Document Server

    Mas, Massimiliano Dal


    Information retrieval is not only the most frequent application executed on the Web but it is also the base of different types of applications. Considering collective intelligence of groups of individuals as a framework for evaluating and incorporating new experiences and information we often cannot retrieve such knowledge being tacit. Tacit knowledge underlies many competitive capabilities and it is hard to articulate on discrete ontology structure. It is unstructured or unorganized, and therefore remains hidden. Developing generic solutions that can find the hidden knowledge is extremely complex. Moreover this will be a great challenge for the developers of semantic technologies. This work aims to explore ways to make explicit and available the tacit knowledge hidden in the collective intelligence of a collaborative environment within organizations. The environment was defined by folksonomies supported by a faceted semantic search. Vector space model which incorporates an analogy with the mathematical appar...

  6. 2012 SARA Students Technical Report

    Energy Technology Data Exchange (ETDEWEB)

    Briccetti, Angelo [Los Alamos National Laboratory; Lorei, Nathan [Los Alamos National Laboratory; Yonkings, David [Los Alamos National Laboratory; Lorio, David [Los Alamos National Laboratory; Goorley, John T. [Los Alamos National Laboratory; Sood, Avneet [Los Alamos National Laboratory


    The Service Academy Research Associates (SARA) program provides an opportunity for Midshipmen and Cadets from US Service Academies to participate in research at Los Alamos National Laboratory (LANL), Lawrence Livermore National Laboratory (LLNL), and Sandia National Laboratory for several weeks during the summer as part of their summer training assignments. During the summer of 2012, three Midshipmen were assigned to work with the XCP Division at LANL for approximately 5-6 weeks. As one of the nation's top national security science laboratories, LANL stretches across 36 square miles, has over 2,100 facilities, and employs over 9,000 individuals including a significant number of students and postdocs. LANL's mission is to 'apply science and technology to: ensure the safety, security, and reliability of the US nuclear deterrent, reduce global threats, and solve other emerging national security challenges.' While LANL officially operates under the US Department of Energy (DoE), fulfilling this mission requires mutual cooperation with the US Department of Defense (DoD) as well. LANL's high concentration of knowledge and experience provides interns a chance to perform research in many disciplines, and its connection with the DoD in both operation and personnel gives SARA students insight to career possibilities both during and after military service. SARA students have plenty of opportunity to enjoy hiking, camping, the Los Alamos YMCA, and many other outdoor activities in New Mexico while staying at the Buffalo Thunder Resort, located 20 miles east of the lab. XCP Division is the Computational Physics division of LANL's Weapons Department. Working with XCP Division requires individuals to be Q cleared by the DoE. This means it is significantly more convenient for SARA students to be assigned to XCP Division than their civilian counterparts as the DoD CNWDI clearance held by SARA students is easily transferred to the lab prior to the

  7. Sharing AIS Related Anomalies (SARA) (United States)


    misconfiguration and intentional misuse. These unintended behaviours generate an abundance of anomalies that the security community has an interest in monitoring...Lastly, the feedback loop formed with clients is essential to SARA’s advancement. The more SARA is exposed, the better and faster it can be end-user needs and thus be adopted by them. This section is organised as follows : • Section 2.1 describes the strategy used to identify potential

  8. The SARA REU Site Program (United States)

    Wood, M. A.; Oswalt, T. D.; SARA Collaboration


    We present an overview of the Research Experiences for Undergraduates (REU) Site Program hosted by the Southeastern Association for Research in Astronomy (SARA) for the past 6 years. SARA is a consortium of the six universities: Florida Institute of Technology, East Tennessee State University, Florida International University, The University of Georgia, Valdosta State University, and Clemson University. We host 10-11 student interns per year out of an application pool of ~150-200. Recruiting flyers are sent to the ~3400 undergraduate institutions in the United States, and we use a web-based application form and review process. We are a distributed REU Site, but come together for group meetings at the beginning and end of the summer program and stay in contact in between using email list manager software. Interns complete a research project working one-on-one with a faculty mentor, and each intern travels to observe at the SARA Observatory at Kitt Peak National Observatory. Interns give both oral and display presentations of their results at the final group meeting. In addition, all interns write a paper for publication in the IAPPP Communications, an international amateur-professional journal, and several present at professional meetings and in refereed publications. We include in the group meetings a ``how-to'' session on giving talks and posters, an Ethics Session, and a session on Women in Astronomy. This work was supported by the NSF Research Experiences for Undergraduates (REU) Site Program through grant AST 96169939 to The Florida Institute of Technology.

  9. Exon: CBRC-SARA-01-0866 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CCAGGGGGTCACCGGTGTCTGGGTCAGTGGGAccatctctggagtcatgcatACGGCAGTTACTTATCCCATTCACTTCTGTGCCCCCCGcatcattcaccagttcttctgtgacatcCTCCAAGTCCTCCTGCTCTAG ... ...CBRC-SARA-01-0866 atgctcatcatcaccaccacttccctggatgacagtctccagtcccccatgtatttcttcctgaa

  10. Exon: CBRC-SARA-01-0862 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CCAGGGGGTCACCGGTGTCTGGGTCAGTGGGAccatctctggagtcatgcatACGGCAGTTACTTATCCCATTCACTTCTGTGCCCCCCGcatcattcaccagttcttctgtgacatcCTCCAAGTCCTCCTGCTCTAG ... ...CBRC-SARA-01-0862 atgctcatcatcaccaccacttccctggatgacagtctccagtcccccatgtatttcttcctgaa

  11. Experience with the SARA OSL method

    DEFF Research Database (Denmark)

    Mejdahl, V.; Bøtter-Jensen, L.


    on the added dose is shown. Advantages of the SARA method is discussed and results obtained using this method for 15 archaeological samples are compared with TL results. A correlation coefficient of 0.967 was found. The test also included comparison of a SARA dare with an archaeomagnetic date for a brick kiln....... Identical results were obtained (1795 +/- 20 AD and 1800 +/- 20 AD, respectively). Similarly. SARA results for 14 sediments are compared with results obtained by TL and IRSL (multiple aliquots)and here the resulting correlation coefficient was 0.983. (C) 1997 Elsevier Science Ltd....

  12. Severe Accident Recriticality Analyses (SARA)

    Energy Technology Data Exchange (ETDEWEB)

    Frid, W. [Swedish Nuclear Power Inspectorate, Stockholm (Sweden); Hoejerup, F. [Risoe National Lab. (Denmark); Lindholm, I.; Miettinen, J.; Puska, E.K. [VTT Energy, Helsinki (Finland); Nilsson, Lars [Studsvik Eco and Safety AB, Nykoeping (Sweden); Sjoevall, H. [Teoliisuuden Voima Oy (Finland)


    Recriticality in a BWR has been studied for a total loss of electric power accident scenario. In a BWR, the B{sub 4}C control rods would melt and relocate from the core before the fuel during core uncovery and heat-up. If electric power returns during this time-window unborated water from ECCS systems will start to reflood the partly control rod free core. Recriticality might take place for which the only mitigating mechanisms are the Doppler effect and void formation. In order to assess the impact of recriticality on reactor safety, including accident management measures, the following issues have been investigated in the SARA project: 1. the energy deposition in the fuel during super-prompt power burst, 2. the quasi steady-state reactor power following the initial power burst and 3. containment response to elevated quasi steady-state reactor power. The approach was to use three computer codes and to further develop and adapt them for the task. The codes were SIMULATE-3K, APROS and RECRIT. Recriticality analyses were carried out for a number of selected reflooding transients for the Oskarshamn 3 plant in Sweden with SIMULATE-3K and for the Olkiluoto 1 plant in Finland with all three codes. The core state initial and boundary conditions prior to recriticality have been studied with the severe accident codes SCDAP/RELAP5, MELCOR and MAAP4. The results of the analyses show that all three codes predict recriticality - both superprompt power bursts and quasi steady-state power generation - for the studied range of parameters, i. e. with core uncovery and heat-up to maximum core temperatures around 1800 K and water flow rates of 45 kg/s to 2000 kg/s injected into the downcomer. Since the recriticality takes place in a small fraction of the core the power densities are high which results in large energy deposition in the fuel during power burst in some accident scenarios. The highest value, 418 cal/g, was obtained with SIMULATE-3K for an Oskarshamn 3 case with reflooding

  13. Expression, purification, and functional characterization of recombinant PTD-SARA

    Institute of Scientific and Technical Information of China (English)

    Chen Huang; Rui Du; Peng Zhang; Hua Meng; Huiwei Jia; Yang Song; Man Li; Yingqi Zhang; Shiren Sun


    The Smad anchor for receptor activation (SARA) protein is a binding partner for Smad2/3 that plays an important role in the fibrotic promoting signaling pathway initiated by transforming growth factor-β1 (TGF-β1). The C-terminal 665-750 aa of SARA comprises the Smad-binding domain (SBD). By direct interaction through the SBD, SARA inhibits Smad2/3 phosphorylation and blocks the interaction between Smad2/3 and Smad4, thereby restrains the process of fibrosis.In this study, we constructed a SARA peptide aptamer based on the SBD sequence. The recombinant SARA aptamer,fused with a protein transduction domain (PTD-SARA), was cloned, purified from E. coli, and characterized for the first time. The full-length PTD-SARA coding sequence, created with E. coli favored codons, was cloned into a pQE-30 vector,and the recombinant plasmid was transformed into an M15 strain. After Isopropyl β-D-1-Thiogalactopyranoside (IPTG) induction and Ni2+ affinity purification, recombinant PTD-SARA was further identified by immunobiotting and protein N-terminal sequencing. Epifluorescence microscopy revealed that the recombinant PTD-SARA was transferred into the cytoplasm and nucleus more efficiently than SARA.Moreover, the recombinant PTD-SARA was found to up-regulate the level of E-cadherin and down-regulate the levels of α-SMA and phospho-Smad3 more efficiently than SARA (P< 0.05). Our work explored a method to obtain recombinant PTD-SARA protein. The recombinant PTDSARA fusion protein could enter HK2 cells (an immortalized proximal tubule epithelial cell line) more efficiently than the SARA protein and reverse the renal epithelial-to-mesenchymal transdifferentiation process that was induced by TGF-β1 more effectively than the SARA protein. Recombinant PDT-SARA is likely to be a potential candidate for clinical prevention and treatment of renal fibrosis.

  14. Exon: CBRC-SARA-01-1228 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1228 ATGTGgttttgctgttgttcttttctactgtggggatcaagcctgggtctccTATATGCAAGCCA...TAATATGCCCCGCCCTGCAGCTgtgtttttccctccctccctcccagctttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttcc...ttccttccttccttccttccttccttccttcctgccttccttcctgccttcctgccttccttcctccctcccttcctcccttccttcctgccttccttcctccctcc...cttcctcccttccttcctccctcccttccttccttccttccttccttccttccttccttccttccttccttccttccttcc...ttccttccttccttccttccttccttcctcccttcctgccttcctgccttttttccttttttctttttcttcctgtctgtctgt

  15. Aqueous SARA ATRP using Inorganic Sulfites. (United States)

    Abreu, Carlos M R; Fu, Liye; Carmali, Sheiliza; Serra, Arménio C; Matyjaszewski, Krzysztof; Coelho, Jorge F J


    Aqueous supplemental activator and reducing agent atom transfer radical polymerization (SARA ATRP) using inorganic sulfites was successfully carried out for the first time. Under optimized conditions, a well-controlled poly[oligo(ethylene oxide) methyl ether acrylate] (POEOA) was obtained with sulfites (e.g. Na2S2O4) were continuously fed into the reaction mixture. The mechanistic studies proved that these salts can activate alkyl halides directly and regenerate the activator complex. The effects of the feeding rate of the SARA agent (inorganic sulfites), ligand and its concentration, halide salt and its concentration, sulfite used, and copper concentration, were systematically studied to afford fast polymerizations rates while maintaining the control over polymerization. The kinetic data showed linear first-order kinetics, linear evolution of molecular weights with conversion, and polymers with narrow molecular weight distributions (Đ ~1.2) during polymerization even at relatively high monomer conversions (~80%). "One-pot" chain extension and "one-pot" block copolymerization experiments proved the high chain-end functionality. The polymerization could be directly regulated by starting or stopping the continuous feeding of the SARA agent. Under biologically relevant conditions, the aqueous SARA ATRP using inorganic sulfites was used to synthesize a well-defined protein-polymer hybrid by grafting of P(OEOA480) from BSA-O-[iBBr]30.

  16. Hidden biodiversity in entomological collections: The overlooked co-occurrence of dipteran and hymenopteran ant parasitoids in stored biological material. (United States)

    Pérez-Lachaud, Gabriela; Lachaud, Jean-Paul


    Biological collections around the world are the repository of biodiversity on Earth; they also hold a large quantity of unsorted, unidentified, or misidentified material and can house behavioral information on species that are difficult to access or no longer available to science. Among the unsorted, alcohol-preserved material stored in the Formicidae Collection of the 'El Colegio de la Frontera Sur' Research Center (Chetumal, Mexico), we found nine colonies of the ponerine ant Neoponera villosa, that had been collected in bromeliads at Calakmul (Campeche, Mexico) in 1999. Ants and their brood were revised for the presence of any sign of parasitism. Cocoons were dissected and their content examined under a stereomicroscope. Six N. villosa prepupae had been attacked by the ectoparasitoid syrphid fly Hypselosyrphus trigonus Hull (Syrphidae: Microdontinae), to date the only known dipteran species of the Microdontinae with a parasitoid lifestyle. In addition, six male pupae from three colonies contained gregarious endoparasitoid wasps. These were specialized in parasitizing this specific host caste as no gyne or worker pupae displayed signs of having been attacked. Only immature stages (larvae and pupae) of the wasp could be obtained. Due to the long storage period, DNA amplification failed; however, based on biological and morphological data, pupae were placed in the Encyrtidae family. This is the first record of an encyrtid wasp parasitizing N. villosa, and the second example of an encyrtid as a primary parasitoid of ants. Furthermore, it is also the first record of co-occurrence of a dipteran ectoparasitoid and a hymenopteran endoparasitoid living in sympatry within the same population of host ants. Our findings highlight the importance of biological collections as reservoirs of hidden biodiversity, not only at the taxonomic level, but also at the behavioral level, revealing complex living networks. They also highlight the need for funding in order to carry out

  17. Hidden biodiversity revealed by collections-based research - Laboulbeniales in millipedes: genus Rickia

    DEFF Research Database (Denmark)

    Enghoff, Henrik; P. S. Reboleira, Ana Sofia; Santamaria, S.


    Nine new species of the genus Rickia parasitizing Diplopoda are described: R. appendicifera from Iran on Chiraziulus, R. candelabriformis from Australia and New Zealand on several Spirostreptida, R. galatheae from New Zealand on Eumastigonus, R. gigas from Tanzania on ‘Spirostreptus’ and Archispi...... preserved mostly at the Natural History Museum of Denmark, from samples collected between 1916 to the present....

  18. Proteomic-based biotyping reveals hidden diversity within a microalgae culture collection: An example using Dunaliella (United States)

    Emami, Kaveh; Hack, Ethan; Nelson, Andrew; Brain, Chelsea M.; Lyne, Fern M.; Mesbahi, Ehsan; Day, John G.; Caldwell, Gary S.


    Accurate and defendable taxonomic identification of microalgae strains is vital for culture collections, industry and academia; particularly when addressing issues of intellectual property. We demonstrate the remarkable effectiveness of Matrix Assisted Laser Desorption Ionisation Time of Flight Mass Spectrometry (MALDI-TOF-MS) biotyping to deliver rapid and accurate strain separation, even in situations where standard molecular tools prove ineffective. Highly distinctive MALDI spectra were obtained for thirty two biotechnologically interesting Dunaliella strains plus strains of Arthrospira, Chlorella, Isochrysis, Tetraselmis and a range of culturable co-occurring bacteria. Spectra were directly compared with genomic DNA sequences (internal transcribed spacer, ITS). Within individual Dunaliella isolates MALDI discriminated between strains with identical ITS sequences, thereby emphasising and enhancing knowledge of the diversity within microalgae culture collections. Further, MALDI spectra did not vary with culture age or growth stage during the course of the experiment; therefore MALDI presents stable and accurate strain-specific signature spectra. Bacterial contamination did not affect MALDI’s discriminating power. Biotyping by MALDI-TOF-MS will prove effective in situations wherein precise strain identification is vital, for example in cases involving intellectual property disputes and in monitoring and safeguarding biosecurity. MALDI should be accepted as a biotyping tool to complement and enhance standard molecular taxonomy for microalgae.

  19. Hidden Layers of Hafiz’s Psyche (a new analysis of Hafiz’s poetry based on collective unconscious’ archetypes

    Directory of Open Access Journals (Sweden)

    M Rozatian


    Full Text Available There are many words about Hafiz and his poetry, perhaps more than other Persian poets. The reason for this can be sought in his ambiguous poems. Thus, a critic calls him a broad-minded mystic whose poems have mystical implications, whereas another one considers him as a fickle person who changes his opinions every moment. For some critics he is a smart poet who has simply created a literary work without inserting his mindset into it. For this reason, there are a number of paradoxical and even opposite interpretations for most of his verses and it seems that new interpretations are still possible. One reason for the interpretability of his poems is the presence of various characters such as Rend (the libertine, Pire Moghan (the old Magian, Saghi (the cup-bearer, Sufi, Mohtaseb (the reckoner in his Divan for some of which historical equivalents have been presented in several works and some scholars have tried to prove that each of these characters refers to real persons in Hafiz’s epoch or past epochs. Contemplation on the atmosphere of his poetry brings this question to the mind that if it is possible to consider each of these characters as hidden layers of Hafiz’s psyche that his consciousness tries to achieve self-knowledge and Perfection through recognition of such layers and creating balance and harmony between them. Using the idea proposed in analytical psychology about archetypes of collective unconscious, this article tries to find an answer for the mentioned question to achieve a new horizon in the analysis of Hafiz’s poems.

  20. SARA: a server for function annotation of RNA structures. (United States)

    Capriotti, Emidio; Marti-Renom, Marc A


    Recent interest in non-coding RNA transcripts has resulted in a rapid increase of deposited RNA structures in the Protein Data Bank. However, a characterization and functional classification of the RNA structure and function space have only been partially addressed. Here, we introduce the SARA program for pair-wise alignment of RNA structures as a web server for structure-based RNA function assignment. The SARA server relies on the SARA program, which aligns two RNA structures based on a unit-vector root-mean-square approach. The likely accuracy of the SARA alignments is assessed by three different P-values estimating the statistical significance of the sequence, secondary structure and tertiary structure identity scores, respectively. Our benchmarks, which relied on a set of 419 RNA structures with known SCOR structural class, indicate that at a negative logarithm of mean P-value higher or equal than 2.5, SARA can assign the correct or a similar SCOR class to 81.4% and 95.3% of the benchmark set, respectively. The SARA server is freely accessible via the World Wide Web at

  1. Serum acute phase proteins in cows with SARA (Subacute Ruminal Acidosis suspect

    Directory of Open Access Journals (Sweden)

    C. Cannizzo


    Full Text Available The aim of this study was to evaluate the variations of Acute Phase Proteins (APPs and other blood constituents during the onset of the sub-acute ruminal acidosis (SARA pathological status. A total of 108 cows from 12 dairy herds were randomly selected and divided into three Groups of 36 animals each. All animals were subjected to a rumenocentesis. Group A was composed by subjects with a rumen pH>5.8, Group B was composed by subjects with a rumen pH ≤5.5≤5.8 and Group C was composed by subjects with a rumen pH<5.5. Blood samples were collected by jugular venipuncture and Haptoglobin (Hp, Serum Amyloid A (SAA, Total Proteins, Albumin and White Blood Cells (WBC were determined. One-way ANOVA showed a statistical significance on Rumen pH, Hp, SAA. SARA seems not stimulate the APPs production from liver.

  2. Sara endosomes and the asymmetric division of intestinal stem cells. (United States)

    Montagne, Chrystelle; Gonzalez-Gaitan, Marcos


    Tissue homeostasis is maintained by adult stem cells, which self-renew and give rise to differentiating cells. The generation of daughter cells with different fates is mediated by signalling molecules coming from an external niche or being asymmetrically dispatched between the two daughters upon stem cell mitosis. In the adult Drosophila midgut, the intestinal stem cell (ISC) divides to generate a new ISC and an enteroblast (EB) differentiating daughter. Notch signalling activity restricted to the EB regulates intestinal cell fate decision. Here, we show that ISCs divide asymmetrically, and Sara endosomes in ISCs are specifically dispatched to the presumptive EB. During ISC mitosis, Notch and Delta traffic through Sara endosomes, thereby contributing to Notch signalling bias, as revealed in Sara mutants: Sara itself contributes to the control of the ISC asymmetric division. Our data uncover an intrinsic endosomal mechanism during ISC mitosis, which participates in the maintenance of the adult intestinal lineage.

  3. Sensor Activation and Radius Adaptation (SARA) in Heterogeneous Sensor Networks

    CERN Document Server

    Bartolini, Novella; la Porta, Thomas; Petrioli, Chiara; Silvestri, Simone


    In this paper we address the problem of prolonging the lifetime of wireless sensor networks (WSNs) deployed to monitor an area of interest. In this scenario, a helpful approach is to reduce coverage redundancy and therefore the energy expenditure due to coverage. We introduce the first algorithm which reduces coverage redundancy by means of Sensor Activation and sensing Radius Adaptation (SARA)in a general applicative scenario with two classes of devices: sensors that can adapt their sensing range (adjustable sensors) and sensors that cannot (fixed sensors). In particular, SARA activates only a subset of all the available sensors and reduces the sensing range of the adjustable sensors that have been activated. In doing so, SARA also takes possible heterogeneous coverage capabilities of sensors belonging to the same class into account. It specifically addresses device heterogeneity by modeling the coverage problem in the Laguerre geometry through Voronoi-Laguerre diagrams. SARA executes quickly and is guarante...

  4. Gene : CBRC-SARA-01-1782 [SEVENS

    Lifescience Database Archive (English)


  5. Gene : CBRC-SARA-01-1760 [SEVENS

    Lifescience Database Archive (English)


  6. UCLA SARA (System Architect's Apprentice) demonstration

    Energy Technology Data Exchange (ETDEWEB)

    Fenchel, R.S.; Razouk, R.R.


    A sample session with the SARA system is given. The system is a set of design and modeling tools which are implemented on the MIT-Multics computer system. This demonstration is intended to acquaint all interested persons with the state of implementation of the SARA system and the flavor of its use. The system is currently under implementation; however, all the demonstrated tools are available to any user with access to the MIT-Multics system. Additional tools will soon be available.

  7. Changes in Microbiota in Rumen Digesta and Feces Due to a Grain-Based Subacute Ruminal Acidosis (SARA) Challenge. (United States)

    Plaizier, Jan C; Li, Shucong; Danscher, Anne Mette; Derakshani, Hooman; Andersen, Pia H; Khafipour, Ehsan


    The effects of a grain-based subacute ruminal acidosis (SARA) challenge on bacteria in the rumen and feces of lactating dairy cows were determined. Six lactating, rumen-cannulated Danish Holstein cows were used in a cross-over study with two periods. Periods included two cows on a control diet and two cows on a SARA challenge. The control diet was a total mixed ration containing 45.5% dry matter (DM), 43.8% DM neutral detergent fiber, and 19.6% DM starch. The SARA challenge was conducted by gradually substituting the control diet with pellets containing 50% wheat and 50% barley over 3 days to reach a diet containing 55.6% DM, 31.3% DM neutral detergent fiber, and 31.8% DM starch, which was fed for four more days. Rumen fluid samples were collected at day 7 and 10 of experimental periods. Feces samples were collected on days 8 and 10 of these periods. Extracted DNA from the rumen and feces samples was analyzed to assess their bacterial communities using MiSeq Illumina sequencing of the V4 region of the 16S rRNA gene. The induction of SARA reduced the richness, diversity, and stability of bacterial communities and resulted in distinctly different microbiota in the rumen and feces. Bacteroidetes and Firmicutes were the most abundant phyla and, combined, they represented 76.9 and 94.4% of the bacterial community in the rumen fluid and the feces, respectively. Only the relative abundance of Firmicutes in the rumen was increased by the SARA challenge. In rumen fluid and feces, the abundances of nine out of the 90 and 25 out of the 89 taxa, respectively, were affected by the challenge. Hence, SARA challenge altered the composition of the bacterial community at the lower taxonomical level in the feces and therefore also likely in the hindgut, as well as in the rumen. However, only reductions in the bacterial richness and diversity in the rumen fluid and feces were in agreement with those of other studies and had a biological basis. Although the composition of the

  8. The relationship between SARA fractions and crude oil stability

    Directory of Open Access Journals (Sweden)

    Siavash Ashoori


    Full Text Available Asphaltene precipitation and deposition are drastic issues in the petroleum industry. Monitoring the asphaltene stability in crude oil is still a serious problem and has been subject of many studies. To investigate crude oil stability by saturate, aromatic, resin and asphaltene (SARA analysis seven types of crudes with different components were used. The applied methods for SARA quantification are IP-143 and ASTM D893-69 and the colloidal instability index (CII is computed from the SARA values as well. In comparison between CII results, the values of oil compositions demonstrated that the stability of asphaltenes in crude oils is a phenomenon that is related to all these components and it cannot be associated only with one of them, individually.

  9. Hidden loss

    DEFF Research Database (Denmark)

    Kieffer-Kristensen, Rikke; Johansen, Karen Lise Gaardsvig


    to participate. RESULTS: All children were affected by their parents' ABI and the altered family situation. The children's expressions led the authors to identify six themes, including fear of losing the parent, distress and estrangement, chores and responsibilities, hidden loss, coping and support. The main...... the ill parent. These findings contribute to a deeper understanding of the traumatic process of parental ABI that some children experience and emphasize the importance of family-centred interventions that include the children....

  10. Det udstødtes poesi hos Sara Stridsberg

    DEFF Research Database (Denmark)

    Rösing, Lilian Munk


    Det synes at være et gennemgående projekt i Sara Stridsbergs forfatterskab at genoprejse en række upopulære, eller i hvert fald tvivlsomme og angribelige, kvindeskikkelser – hvad enten vi taler om historiske personer eller fiktive karakterer: Sally Bauer, Valerie Solanas, Medea, Lolita. Artiklen...

  11. Gene : CBRC-SARA-01-0195 [SEVENS

    Lifescience Database Archive (English)


  12. Det udstødtes poesi hos Sara Stridsberg

    DEFF Research Database (Denmark)

    Rösing, Lilian Munk


    Det synes at være et gennemgående projekt i Sara Stridsbergs forfatterskab at genoprejse en række upopulære, eller i hvert fald tvivlsomme og angribelige, kvindeskikkelser – hvad enten vi taler om historiske personer eller fiktive karakterer: Sally Bauer, Valerie Solanas, Medea, Lolita. Artiklen...

  13. First Results on the Epoch of Reionization from First Light with SARAS 2 (United States)

    Singh, Saurabh; Subrahmanyan, Ravi; Udaya Shankar, N.; Sathyanarayana Rao, Mayuri; Fialkov, Anastasia; Cohen, Aviad; Barkana, Rennan; Girish, B. S.; Raghunathan, A.; Somashekar, R.; Srivani, K. S.


    Long-wavelength spectral distortions in the cosmic microwave background arising from the 21 cm transition in neutral hydrogen are a key probe of the Cosmic Dawn and the Epoch of Reionization. These features may reveal the nature of the first stars and ultra-faint galaxies that transformed the spin temperature and ionization state of the primordial gas. SARAS 2 is a spectral radiometer purposely designed for the precision measurement of these monopole or all-sky global 21 cm spectral distortions. We use 63 hr nighttime observations of the radio background in the frequency band 110-200 MHz, with the radiometer deployed at the Timbaktu Collective in Southern India, to derive likelihoods for plausible redshifted 21 cm signals predicted by theoretical models. First light with SARAS 2 disfavors the class of models that feature weak X-ray heating (with {f}X≤slant 0.1) and rapid reionization (with peak \\tfrac{{{dT}}b}{{dz}}≥slant 120 mK per unit redshift interval).

  14. Apocalipsis XX di Sara de Ibáñez

    Directory of Open Access Journals (Sweden)

    Stefano Tedeschi


    Full Text Available Rewriting the text of Saint John, Sara de Ibáñez uses a kind of style innovative and away from schools and trends in vogue: is thus able able to evoke the tragic experiences of the twentieth century, but the date of publication of the book (1970 reveals that it advances in themes and forms the concrete apocalypse lived by Uruguay and Latin America in the seventies. However, far from political themes and motifs, Sara de Ibáñez is able to express the absolute horror of contemporary tragedies and to propose a poetic reflection of great quality. This article suggests a rediscovery of this twentieth-century poetic voice, unjustly forgotten, through her 'apocalyptic' text.

  15. Placeres, amores y viajes en Demasiado amor de Sara Sefchovich

    Directory of Open Access Journals (Sweden)

    Paula Daniela Bianchi


    Full Text Available The purpose of this paper is to investigate the construction of the prostitute female body where we analyze some strands of the circulation of pleasure, bodies, money and sexual intercourse in Demasiado amor (1990, Agustín Yáñez by Mexican writer Sara Sefchovich. Starting from a journey, of the protagonist of the novel, as nomadism and as a geographical corporal and internal displacement, the journey is seen as a deterritorialization of the body and the subjectivity.

  16. Placeres, amores y viajes en Demasiado amor de Sara Sefchovich


    Paula Daniela Bianchi


    The purpose of this paper is to investigate the construction of the prostitute female body where we analyze some strands of the circulation of pleasure, bodies, money and sexual intercourse in Demasiado amor (1990, Agustín Yáñez) by Mexican writer Sara Sefchovich. Starting from a journey, of the protagonist of the novel, as nomadism and as a geographical corporal and internal displacement, the journey is seen as a deterritorialization of the body and the subjectivity.

  17. Subacute ruminal acidosis (SARA) challenge, ruminal condition and cellular immunity in cattle. (United States)

    Sato, Shigeru


    Subacute ruminal acidosis (SARA) is characterized by repeated bouts of low ruminal pH. Cows with SARA often develop complications or other diseases, and associate physiologically with immunosuppression and inflammation. Ruminal free lipopolysaccharide (LPS) increases during SARA and translocates into the blood circulation activating an inflammatory response. Ruminal fermentation and cellular immunity are encouraged by supplementing hay with calf starter during weaning. SARA calves given a 5-day repeated administration of a bacteria-based probiotic had stable ruminal pH levels (6.6-6.8). The repeated administration of probiotics enhance cellular immune function and encourage recovery from diarrhea in pre-weaning calves. Furthermore, the ruminal fermentation could guard against acute and short-term feeding changes, and changes in the rumen microbial composition of SARA cattle might occur following changes in ruminal pH. The repeated bouts of low ruminal pH in SARA cattle might be associated with depression of cellular immunity.

  18. Indicators of induced subacute ruminal acidosis (SARA) in Danish Holstein cows

    DEFF Research Database (Denmark)

    Danscher, Anne Mette; Li, Shucong; Andersen, Pia H.;


    BACKGROUND: The prevalence of subacute ruminal acidosis (SARA) in dairy cows is high with large impact on economy and welfare. Its current field diagnosis is based on point ruminal pH measurements by oral probe or rumenocentesis. These techniques are invasive and inaccurate, and better markers...... for the diagnosis of SARA are needed. The goal of this study was to evaluate clinical signs of SARA and to investigate the use of blood, faecal and urinary parameters as indicators of SARA. Six lactating, rumen cannulated, Danish Holstein cows were used in a cross-over study with three periods. The first and second...... periods included two cows on control diet and two cows on nutritional SARA challenge. The third period only included two cows on SARA challenge. Control diet was a conventional total mixed ration [45.5% dry matter (DM), 17.8% crude protein, 43.8% neutral detergent fibre, and 22.5% acid detergent fibre (DM...

  19. Teologi Politik Berbalu SARA Antara Ambisi dan Konspirasi

    Directory of Open Access Journals (Sweden)

    M. Sidi Ritau'din


    Full Text Available In a multi-cultural democracy based on Pancasila philosophy of independence, ethnic, religious, racial and intergroup issues it call (SARA are political indicators that can trigger conflict and division. If the player is ambitious and power-hungry, then he will not hesitate to do everything he can to gain power, even build a big conspiracy using SARA as a tool to divide the ummah, then he emerges as a unifier and presents programs prestigious sympathetic, there Imaging actions and slogans of the pro poor people, but essentially no more as political deceit, a false gift of hope, it familiar said (PHP that never realized, only reap the political advantage in the game of SARA, even not hesitate to shout thief when he Itself is a thieving thief based on greed and greed where the horizontal relations of fellow human beings deny the bond of faith as the foundation. Political conspiracy based on political interests and abuse of power, an action of political pathology that is not civilized that has become a trend of contemporary politics and globalization.

  20. SarA positively controls bap-dependent biofilm formation in Staphylococcus aureus. (United States)

    Trotonda, María Pilar; Manna, Adhar C; Cheung, Ambrose L; Lasa, Iñigo; Penadés, José R


    The biofilm-associated protein Bap is a staphylococcal surface protein involved in biofilm formation. We investigated the influence of the global regulatory locus sarA on bap expression and Bap-dependent biofilm formation in three unrelated Staphylococcus aureus strains. The results showed that Bap-dependent biofilm formation was diminished in the sarA mutants by an agr-independent mechanism. Complementation studies using a sarA clone confirmed that the defect in biofilm formation was due to the sarA mutation. As expected, the diminished capacity to form biofilms in the sarA mutants correlated with the decreased presence of Bap in the bacterial surface. Using transcriptional fusion and Northern analysis data, we demonstrated that the sarA gene product acts as an activator of bap expression. Finally, the bap promoter was characterized and the transcriptional start point was mapped by the rapid amplification of cDNA ends technique. As expected, we showed that purified SarA protein binds specifically to the bap promoter, as determined by gel shift and DNase I footprinting assays. Based on the previous studies of others as well as our work demonstrating the role for SarA in icaADBC and bap expression, we propose that SarA is an essential regulator controlling biofilm formation in S. aureus.

  1. Gene : CBRC-SARA-01-1167 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ctin receptor 1 isoform 3 [Macaca mulatta] ref|XP_001105751.1| PREDICTED: similar to adiponectin... receptor 1 isoform 4 [Macaca mulatta] ref|XP_001105805.1| PREDICTED: similar to adiponectin re...ceptor 1 isoform 5 [Macaca mulatta] ref|XP_001105878.1| PREDICTED: similar to adiponectin... receptor 1 isoform 6 [Macaca mulatta] ref|XP_001105957.1| PREDICTED: similar to adiponectin recepto...CBRC-SARA-01-1167 Novel UN B UNKNOWN ADR1_HUMAN 1e-139 67% ref|XP_001105680.1| PREDICTED: similar to adipone

  2. Factors contributing to the biofilm-deficient phenotype of Staphylococcus aureus sarA mutants.

    Directory of Open Access Journals (Sweden)

    Laura H Tsang

    Full Text Available Mutation of sarA in Staphylococcus aureus results in a reduced capacity to form a biofilm, but the mechanistic basis for this remains unknown. Previous transcriptional profiling experiments identified a number of genes that are differentially expressed both in a biofilm and in a sarA mutant. This included genes involved in acid tolerance and the production of nucleolytic and proteolytic exoenzymes. Based on this we generated mutations in alsSD, nuc and sspA in the S. aureus clinical isolate UAMS-1 and its isogenic sarA mutant and assessed the impact on biofilm formation. Because expression of alsSD was increased in a biofilm but decreased in a sarA mutant, we also generated a plasmid construct that allowed expression of alsSD in a sarA mutant. Mutation of alsSD limited biofilm formation, but not to the degree observed with the corresponding sarA mutant, and restoration of alsSD expression did not restore the ability to form a biofilm. In contrast, concomitant mutation of sarA and nuc significantly enhanced biofilm formation by comparison to the sarA mutant. Although mutation of sspA had no significant impact on the ability of a sarA mutant to form a biofilm, a combination of protease inhibitors (E-64, 1-10-phenanthroline, and dichloroisocoumarin that was shown to inhibit the production of multiple extracellular proteases without inhibiting growth was also shown to enhance the ability of a sarA mutant to form a biofilm. This effect was evident only when all three inhibitors were used concurrently. This suggests that the reduced capacity of a sarA mutant to form a biofilm involves extracellular proteases of all three classes (serine, cysteine and metalloproteases. Inclusion of protease inhibitors also enhanced biofilm formation in a sarA/nuc mutant, with the combined effect of mutating nuc and adding protease inhibitors resulting in a level of biofilm formation with the sarA mutant that approached that of the UAMS-1 parent strain. These results

  3. Hidden realities inside PBL design processes: Is consensus design an impossible clash of interest between the individual and the collective, and is architecture its first victim?

    Directory of Open Access Journals (Sweden)

    Ole Pihl


    Full Text Available How do architecture students experience the contradictions between the individual and the group at the Department of Architecture and Design of Aalborg University? The Problem-Based Learning model has been extensively applied to the department’s degree programs in coherence with the Integrated Design Process, but is a group-based architecture and design education better than that which is individually based? How does PBL affect space, form, and creative processes? Hans Kiib, professor and one of the founders of the Department of Architecture and Design in Aalborg, describes his intentions for the education as being intuition, reflection, artistic progression and critical interpretation (Kiib 2004. “As the reflection and critical interpretation are well integrated within the education, mostly parts of the exam evaluation, it seems like the artistic progression and intuition are somewhat drowning within the group work, as it is closer related to the actual PBL process”. Is the Integrated Design Process (Knudstrup 2004 and is Colb (1975 still current and valid? Can we still use these methodologies when we must create “learning for an unknown future,” as Ronald Barnett (2004 claims that we are passing from a complex world into one based on super complexity? Could Gaston Bachelard (1958, who writes in his book The Poetic of Space "that poets and artists are born phenomenologists," help architecture and design students in their journey to find his/her own professional expression? This paper investigates the creative processes of the collective and the individual and clarifies some of the hidden realities behind the PBL-based creative processes, both through an inquiry with the students and a more methodological and theoretical approach. The paper also explores how to integrate artistic progression and intuition within group work by investigating a group of concrete project cases from the Department of Architecture and Design based upon the

  4. Low energy neutral atom imaging on the Moon with the SARA instrument aboard Chandrayaan-1 mission

    Indian Academy of Sciences (India)

    Anil Bhardwaj; Stas Barabash; Yoshifumi Futaana; Yoichi Kazama; Kazushi Asamura; David McCann; R Sridharan; Mats Holmstrom; Peter Wurz; Rickard Lundin


    This paper reports on the Sub-keV Atom Reflecting Analyzer (SARA)experiment that will be flown on the first Indian lunar mission Chandrayaan-1.The SARA is a low energy neutral atom (LENA)imaging mass spectrometer,which will perform remote sensing of the lunar surface via detection of neutral atoms in the energy range from 10 eV to 3 keV from a 100 km polar orbit.In this report we present the basic design of the SARA experiment and discuss various scientific issues that will be addressed.The SARA instrument consists of three major subsystems:a LENA sensor (CENA),a solar wind monitor (SWIM),and a digital processing unit (DPU).SARA will be used to image the solar wind –surface interaction to study primarily the surface composition and surface magnetic anomalies and associated mini-magnetospheres.Studies of lunar exosphere sources and space weathering on the Moon will also be attempted.SARA is the first LENA imaging mass spectrometer of its kind to be flown on a space mission.A replica of SARA is planned to fly to Mercury onboard the BepiColombo mission.

  5. Staphylococcus aureus sarA regulates inflammation and colonization during central nervous system biofilm formation.

    Directory of Open Access Journals (Sweden)

    Jessica N Snowden

    Full Text Available Infection is a frequent and serious complication following the treatment of hydrocephalus with CSF shunts, with limited therapeutic options because of biofilm formation along the catheter surface. Here we evaluated the possibility that the sarA regulatory locus engenders S. aureus more resistant to immune recognition in the central nervous system (CNS based on its reported ability to regulate biofilm formation. We utilized our established model of CNS catheter-associated infection, similar to CSF shunt infections seen in humans, to compare the kinetics of bacterial titers, cytokine production and inflammatory cell influx elicited by wild type S. aureus versus an isogenic sarA mutant. The sarA mutant was more rapidly cleared from infected catheters compared to its isogenic wild type strain. Consistent with this finding, several pro-inflammatory cytokines and chemokines, including IL-17, CXCL1, and IL-1β were significantly increased in the brain following infection with the sarA mutant versus wild type S. aureus, in agreement with the fact that the sarA mutant displayed impaired biofilm growth and favored a planktonic state. Neutrophil influx into the infected hemisphere was also increased in the animals infected with the sarA mutant compared to wild type bacteria. These changes were not attributable to extracellular protease activity, which is increased in the context of SarA mutation, since similar responses were observed between sarA and a sarA/protease mutant. Overall, these results demonstrate that sarA plays an important role in attenuating the inflammatory response during staphylococcal biofilm infection in the CNS via a mechanism that remains to be determined.

  6. System Analysis and Risk Assessment system (SARA) Version 4.0

    Energy Technology Data Exchange (ETDEWEB)

    Sattison, M B; Russell, K D; Skinner, N L [EG and G Idaho, Inc., Idaho Falls, ID (United States)


    This NUREG is the tutorial for the System Analysis and Risk Assessment System (SARA) Version 4.0, a microcomputer-based system used to analyze the safety issues of a family (i.e., a power plant, a manufacturing facility, any facility on which a probabilistic risk assessment (PRA) might be performed). A series of lessons are provided that walk the user through some basic steps common to most analyses performed with SARA. The example problems presented in the lessons build on one another, and in combination, lead the user through all aspects of SARA sensitivity analysis.

  7. SarA influences the sporulation and secondary metabolism in Streptomyces coelicolor M145

    Institute of Scientific and Technical Information of China (English)

    Xijun Ou; Bo Zhang; Lin Zhang; Kai Dong; Chun Liu; Guoping Zhao; Xiaoming Ding


    The filamentous bacteria Streptomyces exhibit a complex life cycle involving morphological differentiation and secondary metabolism. A putative membrane protein gene sarA (sco4069), sporulation and antibiotic production related gene A, was partially characterized in Streptomyces coelicolor M145. The gene product had no characterized functional domains and was highly conserved in Streptomyces. Compared with the wild-type M145, the sarA mutant accelerated sporulation and dramatically decreased the production of actinorhodin and undecylprodigiosin.Reverse transcription-polymerase chain reaction analysis showed that SarA influenced antibiotic production by controlling the abundance of actll-orf4 and redZ messenger RNA.

  8. Sara, a patient with borderline personality structure: A "crisis" management

    Directory of Open Access Journals (Sweden)

    Paola Marinelli


    Full Text Available In this article the author examines some significant passages of his treatment of a patient with borderline personality structure, with the intention of giving a formative contribution to the delicate issue of the search for congruence between theory and clinic operations. This reflection is therefore an opportunity to integrate these aspects. The individualization of the therapeutic relationship in the theoretical framework of group analysis allowed the emotional investment in the person of the therapist, which is useful in the construction of a meaningful relationship on the human, emotional and cognitive plane; a space within which it has become increasingly possible for Sara, share and process emotions, re-build, contact parts of the self frustrated and disappointed, perceive less and less the void and become less vulnerable, being able to pull over to the original trauma. 

  9. PDB: CBRC-SARA-01-0838 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0838 3ODU,3OE0,3OE6,3OE8,3OE9, Region:8-324(Identity=89%) PDB:3ODU Chain:A (X-ray Resolution...=2.5),Region:8-324(Identity=89%) PDB:3OE0 Chain:A (X-ray Resolution=2.9),Region:8-330(...Identity=90%) PDB:3OE6 Chain:A (X-ray Resolution=3.2),Region:8-324(Identity=89%) PDB:3OE8 Chain:A (X-ray Resolution...=3.1),Region:8-324(Identity=89%) PDB:3OE9 Chain:A (X-ray Resolution=3.1), ...

  10. Depression of biofilm formation and antibiotic resistance by sarA disruption in Staphylococcus epidermidis

    Institute of Scientific and Technical Information of China (English)

    Ju-Hong Tao; Chang-Sheng Fan; Shan-E Gao; Hai-Jiao Wang; Guo-Xin Liang; Qing Zhang


    AIM: To study the effects of disruption of sarA gene on biofilm formation and antibiotic resistance of Staphylococcus epidermidis (S. epidermidis ).METHODS: In order to disrupt sarA gene, the doublecrossover homologous recombination was applied in S. epidermidis RP62A, and tetracycline resistance gene (tet) was used as the selective marker which was amplified by PCR from the pBR322 and inserted into the locus between sarA upstream and downstream,resulting in pBT2△sarA. By electroporation, the plasmid pBT2△sarA was transformed into S. epidermidis.Gene transcription was detected by real-time reverse transcription-PCR (RT-PCR). Determination of biofilm was performed in 96-well flat-bottomed culture plates, and antibiotic resistance was analyzed with test tube culture by spectrophotometry at 570 nm respectively.RESULTS: A sarA disrupted strain named S. epidermidis RP62A△sarA was constructed, which was completely defective in biofilm formation, while the sarA complement strain RP62A△sarA (pHPS9sarA) restored the biofilm formation phenotype. Additionally, the knockout of sarA resulted in decreased erythromycin and kanamycin resistance of S. epidermidis RP62A. Compared to the original strain, S. epidermidis RP62A△sarA had an increase of the sensitivity to erythromycin at 200-400 μg/mL and kanamycin at 200-800 μg/mL respectively.CONCLUSION: The knockout of sarA can result in the defect in biofilm formation and the decreased erythromycin and kanamycin resistance in S. epidermidis RP62A.

  11. Impact of the Regulators SigB, Rot, SarA and sarS on the Toxic Shock Tst Promoter and TSST-1 Expression in Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Diego O Andrey

    Full Text Available Staphylococcus aureus is an important pathogen manifesting virulence through diverse disease forms, ranging from acute skin infections to life-threatening bacteremia or systemic toxic shock syndromes. In the latter case, the prototypical superantigen is TSST-1 (Toxic Shock Syndrome Toxin 1, encoded by tst(H, and carried on a mobile genetic element that is not present in all S. aureus strains. Transcriptional regulation of tst is only partially understood. In this study, we dissected the role of sarA, sarS (sarH1, RNAIII, rot, and the alternative stress sigma factor sigB (σB. By examining tst promoter regulation predominantly in the context of its native sequence within the SaPI1 pathogenicity island of strain RN4282, we discovered that σB emerged as a particularly important tst regulator. We did not detect a consensus σB site within the tst promoter, and thus the effect of σB is likely indirect. We found that σB strongly repressed the expression of the toxin via at least two distinct regulatory pathways dependent upon sarA and agr. Furthermore rot, a member of SarA family, was shown to repress tst expression when overexpressed, although its deletion had no consistent measurable effect. We could not find any detectable effect of sarS, either by deletion or overexpression, suggesting that this regulator plays a minimal role in TSST-1 expression except when combined with disruption of sarA. Collectively, our results extend our understanding of complex multifactorial regulation of tst, revealing several layers of negative regulation. In addition to environmental stimuli thought to impact TSST-1 production, these findings support a model whereby sporadic mutation in a few key negative regulators can profoundly affect and enhance TSST-1 expression.

  12. Impact of the Regulators SigB, Rot, SarA and sarS on the Toxic Shock Tst Promoter and TSST-1 Expression in Staphylococcus aureus. (United States)

    Andrey, Diego O; Jousselin, Ambre; Villanueva, Maite; Renzoni, Adriana; Monod, Antoinette; Barras, Christine; Rodriguez, Natalia; Kelley, William L


    Staphylococcus aureus is an important pathogen manifesting virulence through diverse disease forms, ranging from acute skin infections to life-threatening bacteremia or systemic toxic shock syndromes. In the latter case, the prototypical superantigen is TSST-1 (Toxic Shock Syndrome Toxin 1), encoded by tst(H), and carried on a mobile genetic element that is not present in all S. aureus strains. Transcriptional regulation of tst is only partially understood. In this study, we dissected the role of sarA, sarS (sarH1), RNAIII, rot, and the alternative stress sigma factor sigB (σB). By examining tst promoter regulation predominantly in the context of its native sequence within the SaPI1 pathogenicity island of strain RN4282, we discovered that σB emerged as a particularly important tst regulator. We did not detect a consensus σB site within the tst promoter, and thus the effect of σB is likely indirect. We found that σB strongly repressed the expression of the toxin via at least two distinct regulatory pathways dependent upon sarA and agr. Furthermore rot, a member of SarA family, was shown to repress tst expression when overexpressed, although its deletion had no consistent measurable effect. We could not find any detectable effect of sarS, either by deletion or overexpression, suggesting that this regulator plays a minimal role in TSST-1 expression except when combined with disruption of sarA. Collectively, our results extend our understanding of complex multifactorial regulation of tst, revealing several layers of negative regulation. In addition to environmental stimuli thought to impact TSST-1 production, these findings support a model whereby sporadic mutation in a few key negative regulators can profoundly affect and enhance TSST-1 expression.

  13. SarA and not sigmaB is essential for biofilm development by Staphylococcus aureus. (United States)

    Valle, Jaione; Toledo-Arana, Alejandro; Berasain, Carmen; Ghigo, Jean-Marc; Amorena, Beatriz; Penadés, José R; Lasa, Iñigo


    Staphylococcus aureus biofilm formation is associated with the production of the polysaccharide intercellular adhesin (PIA/PNAG), the product of the ica operon. The staphylococcal accessory regulator, SarA, is a central regulatory element that controls the production of S. aureus virulence factors. By screening a library of Tn917 insertions in a clinical S. aureus strain, we identified SarA as being essential for biofilm development. Non-polar mutations of sarA in four genetically unrelated S. aureus strains decreased PIA/PNAG production and completely impaired biofilm development, both in steady state and flow conditions via an agr-independent mechanism. Accordingly, real-time PCR showed that the mutation in the sarA gene resulted in downregulation of the ica operon transcription. We also demonstrated that complete deletion of sigmaB did not affect PIA/PNAG production and biofilm formation, although it slightly decreased ica operon transcription. Furthermore, the sarA-sigmaB double mutant showed a significant decrease of ica expression but an increase of PIA/PNAG production and biofilm formation compared to the sarA single mutant. We propose that SarA activates S. aureus development of biofilm by both enhancing the ica operon transcription and suppressing the transcription of either a protein involved in the turnover of PIA/PNAG or a repressor of its synthesis, whose expression would be sigmaB-dependent.

  14. Partially Hidden Markov Models

    DEFF Research Database (Denmark)

    Forchhammer, Søren Otto; Rissanen, Jorma


    Partially Hidden Markov Models (PHMM) are introduced. They differ from the ordinary HMM's in that both the transition probabilities of the hidden states and the output probabilities are conditioned on past observations. As an illustration they are applied to black and white image compression wher...

  15. Single-access retroperitoneoscopic adrenalectomy (SARA) versus conventional retroperitoneoscopic adrenalectomy (CORA): a case-control study. (United States)

    Walz, Martin K; Groeben, Harald; Alesina, Piero F


    Stimulated by the concept of Natural Orifice Transluminal Endoscopic Surgery (NOTES), minimizing the access even further has become a new trend in minimally invasive surgery. We compare our recently described new method of endoscopic single-access adrenalectomy with the conventional retroperitoneoscopic approach in a matched-pairs study. Fifty single-access retroperitoneoscopic adrenalectomies (SARA) were performed in 47 selected patients suffering from Conn's adenomas (n = 20), pheochromocytomas (n = 15), Cushing's adenomas (n = 6), and other diseases (n = 6). For SARA, a single 2-cm skin incision beneath the 12th rib was used. Following creation of the retroperitoneal space with the rigid endoscope, dissection was carried out single-handed. Another 47 patients served as control group; they were treated by the traditional retroperitoneoscopic three-port approach (CORA). Patients were matched with respect to gender, body mass index, diagnoses, tumor size, and tumor site. Mortality was zero and no major complications occurred in both groups. SARA was completed in 41 cases (86%). The overall complication rate was 8.5% in SARA and 6.4% in CORA. Operative time was longer for SARA (56 +/- 28 min) than for CORA (40 +/- 12 min) (P CORA patients (P = 0.01). Mean hospital stay was 2.4 +/- 0.7 days (SARA) and 3.1 +/- 1.2 days (CORA) (P < 0.01). Because feasibility and safety of SARA could be demonstrated in a large group of selected patients, this surgical technique may represent a new milestone in minimally invasive endocrine surgery.

  16. Directional Notch trafficking in Sara endosomes during asymmetric cell division in the spinal cord. (United States)

    Kressmann, Sabine; Campos, Claudia; Castanon, Irinka; Fürthauer, Maximilian; González-Gaitán, Marcos


    Asymmetric division of neural precursor cells contributes to the generation of a variety of neuronal types. Asymmetric division is mediated by the asymmetric inheritance of fate determinants by the two daughter cells. In vertebrates, asymmetric fate determinants, such as Par3 and Mib, are only now starting to be identified. Here we show that, during mitosis of neural precursors in zebrafish, directional trafficking of Sara endosomes to one of the daughters can function as such a determinant. In asymmetric lineages, where one daughter cell becomes a neuron (n cell) whereas the other divides again to give rise to two neurons (p cell), we found that the daughter that inherits most of the Sara endosomes acquires the p fate. Sara endosomes carry an endocytosed pool of the Notch ligand DeltaD, which is thereby itself distributed asymmetrically. Sara and Notch are both essential for cell fate assignation within asymmetric lineages. Therefore, the Sara endosome system determines the fate decision between neuronal differentiation and mitosis in asymmetric lineages and thereby contributes to controlling the number of neural precursors and differentiated neurons during neurogenesis in a vertebrate.

  17. Entanglement without hidden nonlocality (United States)

    Hirsch, Flavien; Túlio Quintino, Marco; Bowles, Joseph; Vértesi, Tamás; Brunner, Nicolas


    We consider Bell tests in which the distant observers can perform local filtering before testing a Bell inequality. Notably, in this setup, certain entangled states admitting a local hidden variable model in the standard Bell scenario can nevertheless violate a Bell inequality after filtering, displaying so-called hidden nonlocality. Here we ask whether all entangled states can violate a Bell inequality after well-chosen local filtering. We answer this question in the negative by showing that there exist entangled states without hidden nonlocality. Specifically, we prove that some two-qubit Werner states still admit a local hidden variable model after any possible local filtering on a single copy of the state.

  18. Microwave background constraints on mixing of photons with hidden photons

    Energy Technology Data Exchange (ETDEWEB)

    Mirizzi, Alessandro [Max-Planck-Institut fuer Physik, Muenchen (Germany); Redondo, Javier [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Sigl, Guenter [Hamburg Univ. (Germany). 2. Inst. fuer Theoretische Physik


    Various extensions of the Standard Model predict the existence of hidden photons kinetically mixing with the ordinary photon. This mixing leads to oscillations between photons and hidden photons, analogous to the observed oscillations between different neutrino flavors. In this context, we derive new bounds on the photon-hidden photon mixing parameters using the high precision cosmic microwave background spectral data collected by the Far Infrared Absolute Spectrophotometer instrument on board of the Cosmic Background Explorer. Requiring the distortions of the CMB induced by the photon-hidden photon mixing to be smaller than experimental upper limits, this leads to a bound on the mixing angle {chi}{sub 0} hidden photon masses between 10{sup -14} eV and 10{sup -7} eV. This low-mass and low-mixing region of the hidden photon parameter space was previously unconstrained. (orig.)

  19. Case study: Is the 'catch-all-plastics bin' useful in unlocking the hidden resource potential in the residual waste collection system? (United States)

    Kranzinger, Lukas; Schopf, Kerstin; Pomberger, Roland; Punesch, Elisabeth


    Austria's performance in the collection of separated waste is adequate. However, the residual waste still contains substantial amounts of recyclable materials - for example, plastics, paper and board, glass and composite packaging. Plastics (lightweight packaging and similar non-packaging materials) are detected at an average mass content of 13% in residual waste. Despite this huge potential, only 3% of the total amount of residual waste (1,687,000 t y(-1)) is recycled. This implies that most of the recyclable materials contained in the residual waste are destined for thermal recovery and are lost for recycling. This pilot project, commissioned by the Land of Lower Austria, applied a holistic approach, unique in Europe, to the Lower Austrian waste management system. It aims to transfer excess quantities of plastic packaging and non-packaging recyclables from the residual waste system to the separately collected waste system by introducing a so-called 'catch-all-plastics bin'. A quantity flow model was constructed and the results showed a realistic increase in the amount of plastics collected of 33.9 wt%. This equals a calculated excess quantity of 19,638 t y(-1). The increased plastics collection resulted in a positive impact on the climate footprint (CO2 equivalent) in line with the targets of EU Directive 94/62/EG (Circular Economy Package) and its Amendments. The new collection system involves only moderate additional costs.


    Directory of Open Access Journals (Sweden)

    Sulistyastuti Sutomo


    Full Text Available Not only does art   have   self-fullfillment, but  it also has axiological  benefits both socially, culturally, religiously, and economiclally.  So does Sara Douda dance.  Sara Douda aesthetics  is first contained  in its whole dance movements. In addition, it  can also be found in the whole dance equipments.  Moreover,  this dance aesthetics  may  also be contained in the verbal symbols in the speech forms  prior to the dance performance. However,  both verbal and non-verbal aesthetical forms are incorporated by the pieces of socio-cultural and  religious values in the Loli community about  their honoring their ancestors,  having social harmony, and  highly respecting each other among the community members. This study uses a cultural linguistic approach to find out and to review the aesthetics of Sara Douda dance.   Seni memang memiliki kepenuhan dalam dirinya sendiri. Tetapi ia juga sekaligus punya faedah aksiologis, baik secara sosial, kultural, religius maupun secara ekonomis. Tarian Sara Douda pun demikian. Estetika Sara Douda pertama-tama ada dalam semua gerak tariannya. Juga dalam seluruh perlengkapan tarian tersebut. Bukan itu saja, estetika tarian ini juga ada dalam simbol-simbol verbal berupa tuturan menjelang tarian. Tetapi baik bentuk-bentuk estetisasi nonverbal maupun verbal, sama-sama disatukan oleh kepingan-kepingan nilai-nilai sosio-kultural dan religius masyarakat Loli tentang penghormatan kepada leluhur, tentang harmoni sosial, dan tentang penghargaan yang tinggi terhadap satu sama lain. Penelitian ini menggunakan pendekatan linguistik kebudayaan demi menemukan dan menelaah estetika dalam tarian Sara Douda

  1. Hidden circuits and argumentation (United States)

    Leinonen, Risto; Kesonen, Mikko H. P.; Hirvonen, Pekka E.


    Despite the relevance of DC circuits in everyday life and schools, they have been shown to cause numerous learning difficulties at various school levels. In the course of this article, we present a flexible method for teaching DC circuits at lower secondary level. The method is labelled as hidden circuits, and the essential idea underlying hidden circuits is in hiding the actual wiring of DC circuits, but to make their behaviour evident for pupils. Pupils are expected to find out the wiring of the circuit which should enhance their learning of DC circuits. We present two possible ways to utilise hidden circuits in a classroom. First, they can be used to test and enhance pupils’ conceptual understanding when pupils are expected to find out which one of the offered circuit diagram options corresponds to the actual circuit shown. This method aims to get pupils to evaluate the circuits holistically rather than locally, and as a part of that aim this method highlights any learning difficulties of pupils. Second, hidden circuits can be used to enhance pupils’ argumentation skills with the aid of argumentation sheet that illustrates the main elements of an argument. Based on the findings from our co-operating teachers and our own experiences, hidden circuits offer a flexible and motivating way to supplement teaching of DC circuits.

  2. How Hidden Can Be Even More Hidden?

    CERN Document Server

    Fraczek, Wojciech; Szczypiorski, Krzysztof


    The paper presents Deep Hiding Techniques (DHTs) that define general techniques that can be applied to every network steganography method to improve its undetectability and make steganogram extraction harder to perform. We define five groups of techniques that can make steganogram less susceptible to detection and extraction. For each of the presented group, examples of the usage are provided based on existing network steganography methods. To authors' best knowledge presented approach is the first attempt in the state of the art to systematically describe general solutions that can make steganographic communication more hidden and steganogram extraction harder to perform.

  3. Search for Hidden Particles

    CERN Multimedia

    The SHiP Experiment is a new general-purpose fixed target facility at the SPS to search for hidden particles as predicted by a very large number of recently elaborated models of Hidden Sectors which are capable of accommodating dark matter, neutrino oscillations, and the origin of the full baryon asymmetry in the Universe. Specifically, the experiment is aimed at searching for very weakly interacting long lived particles including Heavy Neutral Leptons - right-handed partners of the active neutrinos; light supersymmetric particles - sgoldstinos, etc.; scalar, axion and vector portals to the hidden sector. The high intensity of the SPS and in particular the large production of charm mesons with the 400 GeV beam allow accessing a wide variety of light long-lived exotic particles of such models and of SUSY. Moreover, the facility is ideally suited to study the interactions of tau neutrinos.

  4. Solar Hidden Photon Search

    CERN Document Server

    Schwarz, Matthias; Redondo, Javier; Ringwald, Andreas; Wiedemann, Guenter


    The Solar Hidden Photon Search (SHIPS) is a joint astroparticle project of the Hamburger Sternwarte and DESY. The main target is to detect the solar emission of a new species of particles, so called Hidden Photons (HPs). Due to kinetic mixing, photons and HPs can convert into each other as they propagate. A small number of solar HPs - originating from photon to HP oscillations in the interior of the Sun - can be converted into photons in a long vacuum pipe pointing to the Sun - the SHIPS helioscope.

  5. Solar Hidden Photon Search

    Energy Technology Data Exchange (ETDEWEB)

    Schwarz, Matthias; Wiedemann, Guenter [Hamburg Univ. (Germany). Sternwarte; Lindner, Axel; Ringwald, Andreas [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Redondo, Javier [Max-Planck-Institut fuer Physik und Astrophysik, Muenchen (Germany)


    The Solar Hidden Photon Search (SHIPS) is a joint astroparticle project of the Hamburger Sternwarte and DESY. The main target is to detect the solar emission of a new species of particles, so called Hidden Photons (HPs). Due to kinetic mixing, photons and HPs can convert into each other as they propagate. A small number of solar HPs - originating from photon to HP oscillations in the interior of the Sun - can be converted into photons in a long vacuum pipe pointing to the Sun - the SHIPS helioscope. (orig.)

  6. NCBI nr-aa BLAST: CBRC-SARA-01-1986 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1986 ref|YP_001391163.1| hypothetical protein CLI_1905 [Clostridium botulinum F str. Langel...and] gb|ABS40017.1| hypothetical protein CLI_1905 [Clostridium botulinum F str. Langeland] YP_001391163.1 3.1 34% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-1177 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1177 ref|XP_592012.3| PREDICTED: similar to Sphingomyelin phosphodiest...erase 3 (Neutral sphingomyelinase 2) (Neutral sphingomyelinase II) (nSMase2) (nSMase-2) (Confluent 3Y1 cell-associated protein 1) isoform 1 [Bos taurus] XP_592012.3 7.4 33% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1323 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1323 ref|NP_001008277.1| rhodopsin [Canis lupus familiaris] ref|XP_855...608.1| PREDICTED: rhodopsin [Canis familiaris] emb|CAA70209.1| unnamed protein product [Canis familiaris] NP_001008277.1 2e-62 94% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-2020 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2020 ref|YP_857334.1| exopolyphosphatase [Aeromonas hydrophila subsp. hydrop...hila ATCC 7966] gb|ABK35937.1| exopolyphosphatase [Aeromonas hydrophila subsp. hydrophila ATCC 7966] YP_857334.1 5.5 42% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-1116 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1116 gb|AAC62470.1| chemokine receptor CCR5 [Cercocebus torquatus torq...uatus] gb|AAC62473.1| chemokine receptor CCR5 [Cercocebus torquatus torquatus] AAC62470.1 3e-72 86% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-0200 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0200 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 3e-47 59% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-0834 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0834 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 3e-47 59% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-1766 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1766 ref|NP_776833.1| opioid receptor, mu 1 [Bos taurus] sp|P79350|OPRM_BOVIN Mu-type opioid... receptor (MOR-1) gb|AAB49477.2| mu opioid receptor [Bos taurus] NP_776833.1 0.0 91% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-1766 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1766 ref|NP_001029087.1| opioid receptor, mu 1 [Pan troglodytes] sp|Q5...IS39|OPRM_PANTR Mu-type opioid receptor (MOR-1) gb|AAV74327.1| opioid receptor MU-1 [Pan troglodytes] NP_001029087.1 0.0 90% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-0854 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0854 gb|EAW79490.1| calcium-sensing receptor (hypocalciuric hypercalcemia 1, severe neonatal...eptor (hypocalciuric hypercalcemia 1, severe neonatal hyperparathyroidism), isoform CRA_c [Homo sapiens] EAW79490.1 0.0 90% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-1309 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1309 ref|YP_001125845.1| hypothetical protein GTNG_1736 [Geobacillus thermoden...itrificans NG80-2] gb|ABO67100.1| Conserved hypothetical protein [Geobacillus thermodenitrificans NG80-2] YP_001125845.1 0.47 23% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1804 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1804 ref|NP_965427.1| hypothetical protein LJ1621 [Lactobacillus johnson...ii NCC 533] gb|AAS09393.1| hypothetical protein LJ_1621 [Lactobacillus johnsonii NCC 533] NP_965427.1 0.12 24% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1366 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1366 gb|AAI40135.1| Olfactory receptor 1239 [synthetic construct] gb|A...AI40175.1| Olfactory receptor 1239 [synthetic construct] gb|AAI43150.1| Olfactory receptor 1239 [synthetic construct] AAI40135.1 2e-80 82% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-0489 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0489 ref|ZP_01035526.1| exopolysaccharide biosynthesis domain protein [Roseo...varius sp. 217] gb|EAQ25691.1| exopolysaccharide biosynthesis domain protein [Roseovarius sp. 217] ZP_01035526.1 1.0 26% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-0832 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0832 ref|ZP_01585795.1| Polyphosphate kinase [Dinoroseobacter shibae D...FL 12] gb|ABV92485.1| Polyphosphate kinase [Dinoroseobacter shibae DFL 12] ZP_01585795.1 1.8 28% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-0832 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0832 ref|ZP_01035526.1| exopolysaccharide biosynthesis domain protein [Roseo...varius sp. 217] gb|EAQ25691.1| exopolysaccharide biosynthesis domain protein [Roseovarius sp. 217] ZP_01035526.1 1.0 26% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-0489 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0489 ref|ZP_01585795.1| Polyphosphate kinase [Dinoroseobacter shibae D...FL 12] gb|ABV92485.1| Polyphosphate kinase [Dinoroseobacter shibae DFL 12] ZP_01585795.1 1.8 28% ...

  3. Indicators of induced subacute ruminal acidosis (SARA) in Danish Holstein cows

    DEFF Research Database (Denmark)

    Danscher, Anne Mette; Li, Shucong; Andersen, Pia H.;


    BACKGROUND: The prevalence of subacute ruminal acidosis (SARA) in dairy cows is high with large impact on economy and welfare. Its current field diagnosis is based on point ruminal pH measurements by oral probe or rumenocentesis. These techniques are invasive and inaccurate, and better markers fo...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-0590 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0590 ref|NP_297344.1| hypothetical protein XF0051 [Xylella fastidiosa ...9a5c] gb|AAF82864.1|AE003859_5 hypothetical protein XF_0051 [Xylella fastidiosa 9a5c] NP_297344.1 8e-19 51% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0430 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0430 ref|NP_878187.1| NADH dehydrogenase subunit 1 [Fejervarya limnoch...aris] gb|AAO12107.1| NADH dehydrogenase subunit 1 [Fejervarya limnocharis] NP_878187.1 2.5 29% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-1095 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1095 ref|XP_001231930.1| PREDICTED: similar to claudin 14b [Gallus gal...lus] ref|XP_001231960.1| PREDICTED: similar to claudin 14b [Gallus gallus] XP_001231930.1 6e-34 37% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-1648 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1648 ref|NP_694727.1| histamine H4 receptor [Mus musculus] gb|AAK97380.1|AF358859_1 histamine... H4 receptor [Mus musculus] gb|EDL01579.1| histamine H4 receptor [Mus musculus] NP_694727.1 1e-129 61% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1089 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1089 ref|ZP_00518636.1| Major facilitator superfamily [Crocosphaera watson...ii WH 8501] gb|EAM48279.1| Major facilitator superfamily [Crocosphaera watsonii WH 8501] ZP_00518636.1 1.3 32% ...

  9. Rumen Microbiome Composition in Cattle during Grain-Induced Subacute Ruminal Acidosis (SARA)

    DEFF Research Database (Denmark)

    Danscher, Anne Mette; Derakshani, Hooman; Li, Shucong


    day of the control period, and first and last day of full SARA-feeding. DNA was extracted and V4 region of bacterial 16S rRNA amplified and subjected to Illumina sequencing. Data was analyzed using QIIME pipelines and resultant operational taxonomic units (OTUs) were aligned to Greengenes database...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-1804 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1804 ref|ZP_00743402.1| Sensory box/GGDEF family protein [Bacillus thuringiensis serovar israel...ensis ATCC 35646] gb|EAO52327.1| Sensory box/GGDEF family protein [Bacillus thuringiensis serovar israelensis ATCC 35646] ZP_00743402.1 0.20 36% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-0256 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0256 ref|ZP_00739965.1| Integral membrane protein [Bacillus thuringiensis serovar israel...ensis ATCC 35646] gb|EAO55770.1| Integral membrane protein [Bacillus thuringiensis serovar israelensis ATCC 35646] ZP_00739965.1 1.3 24% ...

  12. The new species of Mysidacea (Crustacea), Anchialina labatus and Gastrosaccus sarae, from south west Australia

    Digital Repository Service at National Institute of Oceanography (India)

    Panampunnayil, S.U.

    Descriptions of two new sepcies Anchialina labatus and Gastrosaccus sarae, are give. A. lobatus is distinguished from the other species of the genus by the presence of a hairy lobe on the first segment of the antennule, by the modified setae...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-1922 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1922 ref|NP_001003037.1| melanin-concentrating hormone receptor 2 [ lupus familiaris] gb|AAM51852.1| melanin-concentrating hormone receptor subtype 2 [Canis familiaris] NP_001003037.1 1e-126 73% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-1922 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1922 ref|NP_001038074.1| putative melanin concentrating hormone recept...or 2 [Sus scrofa] emb|CAJ55683.1| putative melanin concentrating hormone receptor 2 [Sus scrofa] NP_001038074.1 1e-129 73% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-1099 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1099 ref|YP_001337495.1| hypothetical protein KPN_03841 [Klebsiella pneumoniae subsp. pneumonia...e MGH 78578] gb|ABR79228.1| hypothetical protein KPN_03841 [Klebsiella pneumoniae subsp. pneumoniae MGH 78578] YP_001337495.1 0.93 29% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-0303 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0303 ref|YP_001109469.1| valine-pyruvate aminotransferase [Saccharopol...yspora erythraea NRRL 2338] emb|CAM06544.1| valine-pyruvate aminotransferase [Saccharopolyspora erythraea NRRL 2338] YP_001109469.1 5.0 33% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-0991 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0991 ref|YP_873218.1| chitinase. Glycosyl Hydrolase family 18. [Acidot...hermus cellulolyticus 11B] gb|ABK53232.1| chitinase. Glycosyl Hydrolase family 18. [Acidothermus cellulolyticus 11B] YP_873218.1 9.3 29% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01788010.1| multidrug resistance protein [Haemophilus influenza...e 3655] gb|EDJ93712.1| multidrug resistance protein [Haemophilus influenzae 3655] ZP_01788010.1 0.22 27% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01792636.1| multidrug resistance protein [Haemophilus influenza...e PittHH] gb|EDK09769.1| multidrug resistance protein [Haemophilus influenzae PittHH] ZP_01792636.1 0.22 27% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01797490.1| multidrug resistance protein [Haemophilus influenza...e R3021] gb|EDK13267.1| multidrug resistance protein [Haemophilus influenzae 22.4-21] ZP_01797490.1 0.22 27% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01785759.1| multidrug resistance protein [Haemophilus influenza...e 22.4-21] gb|EDJ91681.1| multidrug resistance protein [Haemophilus influenzae R3021] ZP_01785759.1 0.22 27% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01789776.1| multidrug resistance protein [Haemophilus influenza...e PittAA] gb|EDK08502.1| multidrug resistance protein [Haemophilus influenzae PittAA] ZP_01789776.1 0.22 27% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|YP_248596.1| multidrug resistance protein [Haemophilus influenza...e 86-028NP] gb|AAX87936.1| multidrug resistance protein [Haemophilus influenzae 86-028NP] YP_248596.1 0.22 27% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-0900 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0900 ref|YP_026098.1| NADH dehydrogenase subunit 5 [Habronattus oregon...ensis] gb|AAT02495.1| NADH dehydrogenase subunit 5 [Habronattus oregonensis] YP_026098.1 0.032 22% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0491 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0491 ref|YP_001517065.1| hypothetical protein AM1_2749 [Acaryochloris marina... MBIC11017] gb|ABW27749.1| conserved hypothetical protein [Acaryochloris marina MBIC11017] YP_001517065.1 2e-13 45% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-1485 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1485 ref|YP_001518234.1| pentapeptide repeat domain protein [Acaryochloris marina... MBIC11017] gb|ABW28917.1| pentapeptide repeat domain protein [Acaryochloris marina MBIC11017] YP_001518234.1 1.9 43% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-0594 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0594 ref|NP_937902.1| NADH dehydrogenase subunit 5 [Strongyloides] emb|CAD90562.1| NADH dehydrogenase subunit 5 [Strongyloides stercoralis] NP_937902.1 3e-10 35% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1578 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1578 ref|NP_001077100.1| cOR52N9 olfactory receptor family 52 subfamily N-like [Canis lupus... familiaris] gb|ABO36681.1| 52N9 olfactory receptor protein [Canis lupus familiaris] NP_001077100.1 1e-146 78% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-1392 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1392 sp|Q9BDS7|GPR15_MACFA G-protein coupled receptor 15 gb|AAK25741.1...|AF291670_1 orphan seven transmembrane receptor GPR15 [Macaca fascicularis] Q9BDS7 1e-169 81% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-2020 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2020 ref|ZP_01666375.1| conserved hypothetical protein 374 [Thermosinus... carboxydivorans Nor1] gb|EAX47725.1| conserved hypothetical protein 374 [Thermosinus carboxydivorans Nor1] ZP_01666375.1 0.86 31% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-0522 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0522 ref|YP_001499570.1| Peptidyl-tRNA hydrolase [Rickettsia massiliae... MTU5] gb|ABV85023.1| Peptidyl-tRNA hydrolase [Rickettsia massiliae MTU5] YP_001499570.1 4.7 36% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-1560 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1560 ref|YP_984227.1| filamentous haemagglutinin family outer membrane... protein [Polaromonas naphthalenivorans CJ2] gb|ABM39306.1| filamentous haemagglutinin family outer membrane protein [Polaromonas naphthalenivorans CJ2] YP_984227.1 2.9 30% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-0844 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0844 ref|NP_949451.1| putative conjugal transfer protein trbI [Rhodopseudomonas... palustris CGA009] emb|CAE29556.1| putative conjugal transfer protein trbI [Rhodopseudomonas palustris CGA009] NP_949451.1 0.38 29% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-1393 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1393 ref|NP_946691.1| hypothetical protein RPA1341 [Rhodopseudomonas p...alustris CGA009] emb|CAE26784.1| conserved hypothetical protein [Rhodopseudomonas palustris CGA009] NP_946691.1 2.4 28% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-1960 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1960 ref|YP_687145.1| hypothetical protein RRC34 [uncultured methanogen...ic archaeon RC-I] emb|CAJ37819.1| hypothetical protein [uncultured methanogenic archaeon RC-I] YP_687145.1 9e-19 40% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-1960 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1960 ref|YP_687144.1| hypothetical protein RRC32 [uncultured methanogen...ic archaeon RC-I] emb|CAJ37818.1| hypothetical protein [uncultured methanogenic archaeon RC-I] YP_687144.1 7e-22 39% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1273 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1273 ref|YP_001111321.1| hypothetical protein GrBNV_gp54 [Gryllus bima...culatus nudivirus] gb|ABO45387.1| unknown [Gryllus bimaculatus nudivirus] YP_001111321.1 0.001 35% ...

  18. Reading, Laterality, and the Brain: Early Contributions on Reading Disabilities by Sara S. Sparrow (United States)

    Fletcher, Jack M.; Morris, Robin D.


    Although best known for work with children and adults with intellectual disabilities and autism spectrum disorders, training in speech pathology and a doctorate in clinical psychology and neuropsychology was the foundation for Sara Sparrow's long-term interest in reading disabilities. Her first papers were on dyslexia and laterality, and the…

  19. NCBI nr-aa BLAST: CBRC-SARA-01-1167 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1167 ref|XP_848356.1| PREDICTED: similar to adiponectin receptor 1 iso...form 2 [Canis familiaris] ref|XP_537118.2| PREDICTED: similar to adiponectin receptor 1 isoform 1 [Canis familiaris] XP_848356.1 1e-138 67% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1030 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1030 ref|NP_001015581.1| chemokine binding protein 2 [Bos taurus] gb|A...AX46341.1| chemokine binding protein 2 [Bos taurus] gb|AAX46675.1| chemokine binding protein 2 [Bos taurus] NP_001015581.1 1e-170 79% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1688 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1688 emb|CAH72617.1| chromosome 10 open reading frame 18 [Homo sapiens...] emb|CAI13368.1| chromosome 10 open reading frame 18 [Homo sapiens] CAH72617.1 1e-103 49% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-0522 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ensis HTE831] sp|Q8EQA1|PRSW_OCEIH Protease prsW (Protease responsible for activating sigma-W) dbj|BAC13763....CBRC-SARA-01-0522 ref|NP_692728.1| hypothetical protein OB1807 [Oceanobacillus ihey

  3. NCBI nr-aa BLAST: CBRC-SARA-01-0991 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0991 ref|YP_574775.1| transcriptional regulator, LysR family [Chromohalobacter salex...igens DSM 3043] gb|ABE60076.1| transcriptional regulator, LysR family [Chromohalobacter salexigens DSM 3043] YP_574775.1 9.3 31% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-0831 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0831 ref|XP_001526559.1| hypothetical protein LELG_01387 [Lodderomyces... elongisporus NRRL YB-4239] gb|EDK43209.1| hypothetical protein LELG_01387 [Lodderomyces elongisporus NRRL YB-4239] XP_001526559.1 2.8 51% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0106 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0106 ref|XP_001524609.1| hypothetical protein LELG_04581 [Lodderomyces... elongisporus NRRL YB-4239] gb|EDK46400.1| hypothetical protein LELG_04581 [Lodderomyces elongisporus NRRL YB-4239] XP_001524609.1 3e-17 39% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-0566 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0566 sp|Q91ZI0|CELR3_MOUSE Cadherin EGF LAG seven-pass G-type receptor... 3 precursor gb|AAL25099.1|AF427498_1 cadherin EGF LAG seven-pass G-type receptor [Mus musculus] Q91ZI0 0.0 74% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-0144 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0144 ref|YP_438659.1| alcohol dehydrogenase, zinc-containing [Burkholderia thail...andensis E264] gb|ABC35120.1| alcohol dehydrogenase, zinc-containing [Burkholderia thailandensis E264] YP_438659.1 0.69 35% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-0383 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0383 ref|XP_361721.2| hypothetical protein MGG_04195 [Magnaporthe gris...ea 70-15] gb|EDJ99501.1| hypothetical protein MGG_04195 [Magnaporthe grisea 70-15] XP_361721.2 1.4 24% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0195 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0195 ref|NP_001009331.1| cannabinoid receptor 1 [Felis catus] sp|O02777|CNR1_FELCA Canna...binoid receptor 1 (CB1) (CB-R) gb|AAB53440.1| CB1 cannabinoid receptor [Felis catus] NP_001009331.1 0.0 96% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-0175 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0175 ref|NP_603288.1| hypothetical protein FN0384 [Fusobacterium nucle...atum subsp. nucleatum ATCC 25586] gb|AAL94587.1| Hypothetical protein [Fusobacterium nucleatum subsp. nucleatum ATCC 25586] NP_603288.1 9.0 32% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-0415 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0415 ref|YP_547770.1| NADH dehydrogenase (quinone) [Polaromonas sp. JS...666] gb|ABE42872.1| NADH dehydrogenase (quinone) [Polaromonas sp. JS666] YP_547770.1 4.6 26% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-1012 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1012 ref|YP_468056.1| phosphate ABC transporter, permease protein [Rhizobium... etli CFN 42] gb|ABC89329.1| phosphate ABC transporter, permease protein [Rhizobium etli CFN 42] YP_468056.1 1.1 27% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-1549 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1549 ref|YP_001101288.1| twin-arginine translocase subunit, sec-indepe...ndent protein export [Herminiimonas arsenicoxydans] emb|CAL63167.1| twin-arginine translocase subunit, sec-i

  14. NCBI nr-aa BLAST: CBRC-SARA-01-1142 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1142 ref|NP_787448.1| twin-arginine translocase TatC component [Trophe...ryma whipplei str. Twist] gb|AAO44417.1| twin-arginine translocase TatC component [Tropheryma whipplei str. Twist] NP_787448.1 0.17 24% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-0268 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0268 ref|XP_566600.1| hypothetical protein [Cryptococcus neoformans var. neo...formans JEC21] gb|AAW40781.1| expressed protein [Cryptococcus neoformans var. neoformans JEC21] XP_566600.1 0.017 30% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-0144 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0144 ref|XP_572921.1| hypothetical protein CNI03200 [Cryptococcus neoformans var. neo...formans JEC21] gb|AAW45614.1| hypothetical protein CNI03200 [Cryptococcus neoformans var. neoformans JEC21] XP_572921.1 0.90 26% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-0348 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0348 ref|XP_001586881.1| predicted protein [Sclerotinia sclerotiorum 1...980] gb|EDN97385.1| predicted protein [Sclerotinia sclerotiorum 1980] XP_001586881.1 2.4 28% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1099 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1099 ref|XP_001588188.1| predicted protein [Sclerotinia sclerotiorum 1...980] gb|EDN94760.1| predicted protein [Sclerotinia sclerotiorum 1980] XP_001588188.1 4.6 34% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-1986 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1986 ref|NP_223335.1| INTEGRASE-RECOMBINASE PROTEIN (XERCD FAMILY) [Helicobacter... pylori J99] gb|AAD06197.1| INTEGRASE-RECOMBINASE PROTEIN (XERCD FAMILY) [Helicobacter pylori J99] NP_223335.1 5.2 32% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1253 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1253 ref|YP_264377.1| hypothetical protein Psyc_1092 [Psychrobacter 273-4] gb|AAZ18943.1| conserved hypothetical protein [Psychrobacter arcticus 273-4] YP_264377.1 1.2 25% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-0873 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0873 ref|ZP_01187451.1| conserved hypothetical protein [Bacillus weihenstep...hanensis KBAB4] gb|EAR73176.1| conserved hypothetical protein [Bacillus weihenstephanensis KBAB4] ZP_01187451.1 0.36 25% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-1488 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1488 ref|ZP_01187451.1| conserved hypothetical protein [Bacillus weihenstep...hanensis KBAB4] gb|EAR73176.1| conserved hypothetical protein [Bacillus weihenstephanensis KBAB4] ZP_01187451.1 0.78 25% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-1099 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1099 ref|YP_708759.1| hypothetical protein RHA1_ro10412 [Rhodococcus s...p. RHA1] gb|ABH00601.1| conserved hypothetical protein [Rhodococcus sp. RHA1] YP_708759.1 2.7 25% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-1967 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1967 ref|ZP_00370594.1| Predicted DNA repair exonuclease [Campylobacter upsalien...sis RM3195] gb|EAL53370.1| Predicted DNA repair exonuclease [Campylobacter upsaliensis RM3195] ZP_00370594.1 0.047 31% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0033 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0033 ref|NP_001015622.1| prostacyclin receptor [Bos taurus] sp|P79393|PI2R_BOVIN Prostacy...clin receptor (Prostanoid IP receptor) (PGI receptor) (Prostaglandin I2 receptor) emb|CAB07510.1| prostacyclin receptor [Bos taurus] NP_001015622.1 1e-113 86% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-0378 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0378 ref|YP_001302962.1| putative flippase [Parabacteroides distasonis... ATCC 8503] gb|ABR43340.1| putative flippase [Parabacteroides distasonis ATCC 8503] YP_001302962.1 5.1 26% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-0459 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0459 ref|YP_001297164.1| hypothetical protein FP2308 [Flavobacterium p...sychrophilum JIP02/86] emb|CAL44363.1| Protein of unknown function [Flavobacterium psychrophilum JIP02/86] YP_001297164.1 7.3 30% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1901 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1901 ref|ZP_01733372.1| hypothetical protein FBBAL38_03440 [Flavobacte...ria bacterium BAL38] gb|EAZ96441.1| hypothetical protein FBBAL38_03440 [Flavobacteria bacterium BAL38] ZP_01733372.1 4.4 19% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0253 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0253 ref|NP_001038089.1| G protein-coupled receptor 54 [Sus scrofa] gb...|ABE73452.1| G protein-coupled receptor 54 [Sus scrofa] gb|ABE73453.1| G protein-coupled receptor 54 [Sus scrofa] NP_001038089.1 3e-51 67% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-0420 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0420 ref|ZP_00588106.1| Bile acid:sodium symporter [Pelodictyon phaeocl...athratiforme BU-1] gb|EAN26387.1| Bile acid:sodium symporter [Pelodictyon phaeoclathratiforme BU-1] ZP_00588106.1 0.33 29% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-1117 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available moniae subsp. pneumoniae MGH 78578] gb|ABR77598.1| putative H+/gluconate symporter ...and related permeases [Klebsiella pneumoniae subsp. pneumoniae MGH 78578] YP_001335828.1 1.8 26% ... ...CBRC-SARA-01-1117 ref|YP_001335828.1| putative H+/gluconate symporter and related permeases [Klebsiella pneu

  12. NCBI nr-aa BLAST: CBRC-SARA-01-1572 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1572 ref|NP_652753.1| NADH dehydrogenase subunit 5 [Tigriopus japonicu...s] dbj|BAB97224.1| NADH dehydrogenase subunit 5 [Tigriopus japonicus] NP_652753.1 0.14 27% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-1999 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1999 ref|YP_126627.1| hypothetical protein lpl1277 [Legionella pneumop...hila str. Lens] emb|CAH15517.1| hypothetical protein [Legionella pneumophila str. Lens] YP_126627.1 0.38 21% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-1615 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1615 ref|XP_001683626.1| formin, putative [Leishmania major] emb|CAJ04...769.1| formin, putative [Leishmania major] gb|ABQ43162.1| formin B [Leishmania major] XP_001683626.1 0.52 46% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-2040 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2040 ref|NP_001075253.1| 5-hydroxytryptamine (serotonin) receptor 2A [Equus caba...llus] dbj|BAF32954.1| 5-hydroxytryptamine receptor 2A [Equus caballus] NP_001075253.1 1e-128 87% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-0322 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0322 ref|ZP_01459778.1| conserved hypothetical protein [Stigmatella aura...ntiaca DW4/3-1] gb|EAU69359.1| conserved hypothetical protein [Stigmatella aurantiaca DW4/3-1] ZP_01459778.1 5.2 34% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-0796 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0796 ref|ZP_01774245.1| conserved hypothetical protein [Geobacter bemi...djiensis Bem] gb|EDJ80432.1| conserved hypothetical protein [Geobacter bemidjiensis Bem] ZP_01774245.1 3e-33 39% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-0771 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0771 ref|NP_001029253.1| progestin and adipoQ receptor family member V...II [Rattus norvegicus] gb|AAY67652.1| progestin membrane receptor alpha [Rattus norvegicus] NP_001029253.1 1e-167 82% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-0771 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0771 ref|NP_001033642.1| progestin and adipoQ receptor family member V...II [Bos taurus] gb|AAI11285.1| Progestin and adipoQ receptor family member VII [Bos taurus] NP_001033642.1 1e-180 87% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1656 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1656 ref|NP_001034958.1| bitter taste receptor Modo-T2R7B [Monodelphis... domestica] dbj|BAE80368.1| bitter taste receptor [Monodelphis domestica] NP_001034958.1 2e-39 43% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1755 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1755 ref|NP_001034947.1| bitter taste receptor Modo-T2R25 [Monodelphis... domestica] dbj|BAE80373.1| bitter taste receptor [Monodelphis domestica] NP_001034947.1 1e-40 35% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-0389 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0389 ref|NP_001034959.1| bitter taste receptor Modo-T2R41 [Monodelphis... domestica] dbj|BAE80381.1| bitter taste receptor [Monodelphis domestica] NP_001034959.1 1e-101 60% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-1309 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1309 ref|YP_033365.1| hypothetical protein BH05300 [Bartonella hensela...e str. Houston-1] emb|CAF27338.1| hypothetical protein [Bartonella henselae str. Houston-1] YP_033365.1 0.47 19% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-1189 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1189 ref|ZP_01099747.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni 84-25] gb|EAQ95323.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni 84-25] ZP_01099747.1 0.40 27% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-1189 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1189 ref|ZP_01068559.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni CF93-6] gb|EAQ56421.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni CF93-6] ZP_01068559.1 0.53 28% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-0337 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0337 ref|ZP_01068559.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni CF93-6] gb|EAQ56421.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni CF93-6] ZP_01068559.1 0.67 27% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-1189 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1189 ref|ZP_01069237.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni 260.94] gb|EAQ59437.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni 260.94] ZP_01069237.1 0.53 28% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-0337 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0337 ref|ZP_01099747.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni 84-25] gb|EAQ95323.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni 84-25] ZP_01099747.1 0.52 27% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0337 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0337 ref|ZP_01069237.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni 260.94] gb|EAQ59437.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni 260.94] ZP_01069237.1 0.67 27% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-1348 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1348 ref|NP_001028103.1| cholinergic receptor, muscarinic 5 [Macaca mu...latta] sp|P56490|ACM5_MACMU Muscarinic acetylcholine receptor M5 gb|AAB95159.1| muscarinic receptor [Macaca mulatta] NP_001028103.1 0.0 88% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-0900 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0900 ref|YP_898010.1| phosphatidylserine synthase [Francisella tularen...sis subsp. novicida U112] gb|ABK89256.1| phosphatidylserine synthase [Francisella tularensis subsp. novicida U112] YP_898010.1 3.0 27% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-0378 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0378 ref|NP_693392.1| glycerol-3-phosphate dehydrogenase [ iheyensis HTE831] dbj|BAC14427.1| glycerol-3-phosphate dehydrogenase [Oceanobacillus iheyensis HTE831] NP_693392.1 8.7 23% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-1651 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1651 ref|NP_203156.1|ND2_15766 NADH dehydrogenase subunit 2 [Tribolium... castaneum] emb|CAC51700.1| NADH dehydrogenase subunit 2 [Tribolium castaneum] NP_203156.1 1.5 19% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-2020 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2020 ref|NP_203162.1|ND5_15766 NADH dehydrogenase subunit 5 [Tribolium... castaneum] emb|CAC51706.1| NADH dehydrogenase subunit 5 [Tribolium castaneum] NP_203162.1 5.5 32% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-0795 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0795 ref|NP_203156.1|ND2_15766 NADH dehydrogenase subunit 2 [Tribolium... castaneum] emb|CAC51700.1| NADH dehydrogenase subunit 2 [Tribolium castaneum] NP_203156.1 1.8 19% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-1199 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1199 ref|NP_001039945.1| opioid receptor, kappa 1 [Bos taurus] sp|Q2KIP6|OPRK_BOVIN opioid receptor (KOR-1) gb|AAI12562.1| Opioid receptor, kappa 1 [Bos taurus] NP_001039945.1 9e-80 92% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1236 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1236 ref|XP_001221542.1| hypothetical protein CHGG_05447 [Chaetomium globo...sum CBS 148.51] gb|EAQ88828.1| hypothetical protein CHGG_05447 [Chaetomium globosum CBS 148.51] XP_001221542.1 0.21 28% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1012 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1012 ref|XP_001229383.1| hypothetical protein CHGG_02867 [Chaetomium globo...sum CBS 148.51] gb|EAQ90932.1| hypothetical protein CHGG_02867 [Chaetomium globosum CBS 148.51] XP_001229383.1 4.1 30% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-0179 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0179 ref|XP_001226930.1| predicted protein [Chaetomium globosum CBS 14...8.51] gb|EAQ84989.1| predicted protein [Chaetomium globosum CBS 148.51] XP_001226930.1 1e-04 40% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-0522 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0522 ref|YP_913161.1| ATP synthase F0 subunit 6 [Romanomermis culicivo...rax] gb|ABL11588.1| ATP synthase F0 subunit 6 [Romanomermis culicivorax] YP_913161.1 0.33 24% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1697 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1697 ref|YP_913162.1| NADH dehydrogenase subunit 5 [Romanomermis culic...ivorax] gb|ABL11589.1| NADH dehydrogenase subunit 5 [Romanomermis culicivorax] YP_913162.1 0.62 35% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-1085 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1085 ref|NP_829355.1| hypothetical protein CCA00489 [Chlamydophila cav...iae GPIC] gb|AAP05233.1| conserved hypothetical protein [Chlamydophila caviae GPIC] NP_829355.1 0.26 23% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-2026 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2026 ref|YP_008277.1| hypothetical protein pc1278 [Candidatus Protochlamydia... amoebophila UWE25] emb|CAF24002.1| conserved hypothetical protein [Candidatus Protochlamydia amoebophila UWE25] YP_008277.1 0.89 28% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-0159 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0159 ref|YP_008619.1| hypothetical protein pc1620 [Candidatus Protochlamydia... amoebophila UWE25] emb|CAF24344.1| conserved hypothetical protein [Candidatus Protochlamydia amoebophila UWE25] YP_008619.1 7.8 27% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-2026 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2026 ref|YP_008281.1| hypothetical protein pc1282 [Candidatus Protochlamydia... amoebophila UWE25] emb|CAF24006.1| conserved hypothetical protein [Candidatus Protochlamydia amoebophila UWE25] YP_008281.1 3.4 25% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-1753 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1753 ref|YP_001476411.1| amino acid permease-associated region [Serratia proteam...aculans 568] gb|ABV39283.1| amino acid permease-associated region [Serratia proteamaculans 568] YP_001476411.1 0.83 35% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-1462 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1462 ref|YP_300930.1| accessory gene regulator C [Staphylococcus saprophyticus subsp. saprophyt...icus ATCC 15305] dbj|BAE17985.1| accessory gene regulator C [Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305] YP_300930.1 0.020 25% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1236 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1236 ref|YP_213442.1| putative iron transport, fusion membrane protein... [Bacteroides fragilis NCTC 9343] emb|CAH09534.1| putative iron transport, fusion membrane protein [Bacteroides fragilis NCTC 9343] YP_213442.1 1.8 26% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-1386 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1386 ref|XP_001165973.1| PREDICTED: prokineticin receptor 2 isoform 1 ...[Pan troglodytes] ref|XP_001166012.1| PREDICTED: prokineticin receptor 2 isoform 2 [Pan troglodytes] XP_001165973.1 1e-115 91% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-1868 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1868 ref|NP_067356.2| prokineticin receptor 1 [Mus musculus] gb|AAH59003.1| Prokinetic...2080.1| unnamed protein product [Mus musculus] gb|EDK99210.1| prokineticin receptor 1 [Mus musculus] NP_067356.2 2e-55 77% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-1746 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1746 ref|NP_001100989.1| non imprinted in Prader-Willi/Angelman 1 homolog [Rattus norvegicus] gb|EDL86455.1| non imprinted in Prader-Willi/Angelman syndrome 1 homolog (human) (predicted) [Rattus norvegicus] NP_001100989.1 1e-113 80% ...

  12. Feminism and Faith: Exploring Christian Spaces in the Writing of Sara Maitland and Michèle Roberts

    Directory of Open Access Journals (Sweden)



    Full Text Available En 1983, les féministes britanniques Sara Maitland et Jo Garcia ont publié Walking on the Water (London : Virago, une collection d’essais, de récits, de poèmes et de photos produits par des femmes sur le thème de la spiritualité. Les contributrices ont été en particulier invitées à explorer la relation entre leur identité féministe et leurs croyances religieuses. Le ton de ces contributions varie fortement, allant de l’envie passionnée de concilier les objectifs du féminisme avec le christianisme à un rejet total de l’Eglise comme institution patriarcale suprême. Cet article met en dialogue des récits diamétralement opposés du rapport entre christianisme et féminisme en s’intéressante plus particulièrement à deux des contributrices, Sara Maitland (1950 - et Michèle Roberts (1949 - . Ces deux écrivaines, qui se sont activement impliquées dans les mouvements féministes des années 1970, ont toutes deux lutté pour se réconcilier avec leur héritage chrétien. Néanmoins, alors que Maitland tente essentiellement de revisiter le christianisme en y incorporant les points essentiels d’une idéologie féministe, Roberts sent le besoin impérieux de se défaire de son identité religieuse afin de devenir indépendante ; en effet, dans son autobiographie Paper Houses (2007 elle décrit son éducation catholique comme “autoritaire et misogyne” (16. Cet article explore les façons dont l’identité spirituelle se construit dans le jeu complexe des interactions entre féminisme et foi. Il se propose, dans une perspective comparatiste, d’analyser d’une part le recueil de nouvelles de Sara Maitland intitulé A Book of Spells, et d’autre part, le roman acclamé de Michèle Roberts, Daughters of the House. Dans ces écrits, Maitland et Roberts ont un objectif commun qui est de renégocier la place des femmes dans l’histoire chrétienne dont elles reconnaissent – il est vrai à partir de perspectives diff

  13. Hidden neural networks

    DEFF Research Database (Denmark)

    Krogh, Anders Stærmose; Riis, Søren Kamaric


    A general framework for hybrids of hidden Markov models (HMMs) and neural networks (NNs) called hidden neural networks (HNNs) is described. The article begins by reviewing standard HMMs and estimation by conditional maximum likelihood, which is used by the HNN. In the HNN, the usual HMM probability...... parameters are replaced by the outputs of state-specific neural networks. As opposed to many other hybrids, the HNN is normalized globally and therefore has a valid probabilistic interpretation. All parameters in the HNN are estimated simultaneously according to the discriminative conditional maximum...... likelihood criterion. The HNN can be viewed as an undirected probabilistic independence network (a graphical model), where the neural networks provide a compact representation of the clique functions. An evaluation of the HNN on the task of recognizing broad phoneme classes in the TIMIT database shows clear...

  14. Coupling of Hidden Sector

    CERN Document Server

    Królikowski, Wojciech


    A hypothetic Hidden Sector of the Universe, consisting of sterile fermions ("sterinos") and sterile mediating bosons ("sterons") of mass dimension 1 (not 2!) - the last described by an antisymmetric tensor field - requires to exist also a scalar isovector and scalar isoscalar in order to be able to construct electroweak invariant coupling (before spontaneously breaking its symmetry). The introduced scalar isoscalar might be a resonant source for the diphoton excess of 750 GeV, suggested recently by experiment.

  15. Hidden variables and hidden time in quantum theory


    Kurakin, Pavel V.


    Bell's theorem proves only that hidden variables evolving in true physical time can't exist; still the theorem's meaning is usually interpreted intolerably wide. The concept of hidden time (and, in general, hidden space-time) is introduced. Such concept provides a whole new class of physical theories, fully compatible with current knowledge, but giving new tremendous possibilities. Those theories do not violate Bell's theorem.

  16. Graph model of behavior simulator. [Interactive simulator developed as part of UCLA SARA system

    Energy Technology Data Exchange (ETDEWEB)

    Razouk, R.R.; Estrin, G.


    An interactive simulator developed at UCLA as part of the SARA system is described. This simulator, in conjunction with other design tools of the SARA system, allows the user to model the behavior of the system being designed at various levels of detail. The models which drive the simulator are control graphs and associated data graphs. The simulator uses the control graph to express synchronization of sequences of events. Initiation of any control node triggers the simulator to call on the data graph model to provide interpretation of a process at a desired level of abstraction. The simulator gives the user the capability to examine, or modify, the state of the control and data graphs during a simulation. 8 figures.

  17. SARA (System ARchitects Apprentice): Modeling, analysis, and simulation support for design of concurrent systems

    Energy Technology Data Exchange (ETDEWEB)

    Estrin, G.; Fenchel, R.S.; Razouk, R.R.; Vernon, M.K.


    An environment to support designers in the modeling, analysis and simulation of concurrent systems is described. It is shown how a fully nested structure model supports multilevel design and focuses attention on the interfaces between the modules which serve to encapsulate behavior. Using simple examples the paper indicates how a formal graph model can be used to model behavior in three domains: control flow, data flow, and interpretation. The effectiveness of the explicity environment model in SARA is discussed and the capability to analyze correctness and evaluate performance of a system model are demonstrated. A description of the integral help designed into SARA shows how the designer can be offered consistent use of any new tool introduced to support the design process.

  18. The Remote Observatories of the Southeastern Association for Research in Astronomy (SARA)

    CERN Document Server

    Keel, William C; Mack, Peter; Henson, Gary; Hillwig, Todd; Batcheldor, Daniel; Berrington, Robert; De Pree, Chris; Hartmann, Dieter; Leake, Martha; Licandro, Javier; Murphy, Brian; Webb, James; Wood, Matt A


    We describe the remote facilities operated by the Southeastern Association for Research in Astronomy (SARA), a consortium of colleges and universities in the US partnered with Lowell Observatory, the Chilean National Telescope Allocation Committee, and the Instituto de Astrofisica de Canarias. SARA observatories comprise a 0.96m telescope at Kitt Peak, Arizona; a 0.6m instrument on Cerro Tololo, Chile; and the 1m Jacobus Kapteyn Telescope at the Roque de los Muchachos, La Palma, Spain. All are operated using standard VNC or Radmin protocols communicating with on-site PCs. Remote operation offers considerable flexibility in scheduling, allowing long-term observational cadences difficult to achieve with classical observing at remote facilities, as well as obvious travel savings. Multiple observers at different locations can share a telescope for training, educational use, or collaborative research programs. Each telescope has a CCD system for optical imaging, using thermoelectric cooling to avoid the need for f...

  19. Reading, Laterality, and the Brain: Early Contributions on Reading Disabilities by Sara S. Sparrow


    Fletcher, Jack M.; Morris, Robin D


    Although best known for work with children and adults with intellectual disabilities and autism spectrum disorders, training in speech pathology and a doctorate in clinical psychology and neuropsychology was the foundation for Sara Sparrow’s long-term interest in reading disabilities. Her first papers were on dyslexia and laterality, and the maturational lag theory of developmental dyslexia proposed with Paul Satz, her mentor. The research program that emerged from this work had a wide impact...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1423 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1423 ref|NP_999614.1| luteinizing hormone/choriogonadotropin receptor ...[Sus scrofa] sp|P16582|LSHR_PIG Lutropin-choriogonadotropic hormone receptor precursor (LH/CG-R) (LSH-R) (Lute...inizing hormone receptor) gb|AAA31062.1| luteinizing hormone receptor precursor NP_999614.1 0.0 65% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1423 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1423 ref|NP_776806.1| luteinizing hormone/choriogonadotropin receptor ...[Bos taurus] sp|Q28005|LSHR_BOVIN Lutropin-choriogonadotropic hormone receptor precursor (LH/CG-R) (LSH-R) (Lute...inizing hormone receptor) gb|AAC24012.1| luteinizing hormone receptor [Bos taurus] NP_776806.1 0.0 65% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-1215 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1215 ref|NP_776826.1| neuropeptide Y receptor Y2 [Bos taurus] sp|P79113|NPY2R_BOVIN Neurope...ptide Y receptor type 2 (NPY2-R) (NPY-Y2 receptor) gb|AAB40600.1| type 2 neuropeptide Y receptor NP_776826.1 0.0 85% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-0123 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0123 dbj|BAF32759.1| taste receptor, type 1, member 3 [Sus scrofa domestic...a] dbj|BAF32761.1| taste receptor, type 1, member 3 [Sus scrofa domestica] dbj|BAF32762.1| taste recepto...r, type 1, member 3 [Sus scrofa domestica] dbj|BAF32763.1| taste receptor, type 1, member 3 [Sus scrofa domestica] BAF32759.1 1e-120 70% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-1746 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1746 ref|NP_653200.2| non-imprinted in Prader-Willi/Angelman syndrome ...1 [Homo sapiens] sp|Q7RTP0|NIPA1_HUMAN Non-imprinted in Prader-Willi/Angelman syndrome region protein 1 tpg|...DAA01477.1| TPA_exp: non-imprinted in Prader-Willi/Angelman syndrome 1 [Homo sapiens] NP_653200.2 1e-113 81% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0466 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0466 dbj|BAF32759.1| taste receptor, type 1, member 3 [Sus scrofa domestic...a] dbj|BAF32761.1| taste receptor, type 1, member 3 [Sus scrofa domestica] dbj|BAF32762.1| taste recepto...r, type 1, member 3 [Sus scrofa domestica] dbj|BAF32763.1| taste receptor, type 1, member 3 [Sus scrofa domestica] BAF32759.1 3e-32 71% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-1400 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1400 gb|AAW70053.1| MRGX2 [Homo sapiens] gb|AAW70054.1| MRGX2 [Homo sapie...ns] gb|AAW70055.1| MRGX2 [Homo sapiens] gb|AAW70070.1| MRGX2 [Homo sapiens] gb|AAW70083.1| MRGX2 [Homo sapiens] AAW70053.1 4e-34 52% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-1193 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1193 ref|NP_776427.1| calcium-sensing receptor [Bos taurus] sp|P35384|...CASR_BOVIN Extracellular calcium-sensing receptor precursor (CaSR) (Parathyroid Cell calcium-sensing recepto...r) gb|AAB29171.1| Ca(2+)-sensing receptor [Bos taurus] prf||2002360A Ca-sensing receptor NP_776427.1 0.0 86% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1360 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1360 ref|NP_599155.1| trace-amine-associated receptor 1 [Rattus norveg...icus] gb|AAL65137.1|AF421352_1 trace amine receptor 1 [Rattus norvegicus] gb|AAV70127.1| trace amine associa...ted receptor 1 [Rattus norvegicus] gb|EDL87747.1| trace-amine-associated receptor 1 [Rattus norvegicus] NP_599155.1 1e-145 74% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0585 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0585 ref|NP_001071387.1| hypothetical protein LOC514131 [Bos taurus] r...ef|XP_001254537.1| PREDICTED: hypothetical protein LOC514131 [Bos taurus] dbj|BAF36506.1| p97Bucentaur-2 [Bos tau...rus] gb|AAI49203.1| P97Bucentaur-2 [Bos taurus] NP_001071387.1 4e-12 32% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-0259 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0259 ref|NP_001029267.1| tubulin, alpha, ubiquitous [Pan troglodytes] ...sp|Q5R1W4|TBA1B_PANTR Tubulin alpha-1B chain (Tubulin alpha-ubiquitous chain) (Alpha-tubulin ubiquitous) (Tu...bulin K-alpha-1) dbj|BAD74034.1| ubiquitous alpha-tubulin [Pan troglodytes verus] NP_001029267.1 1e-136 86% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-1488 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1488 ref|YP_001474562.1| DNA internalization-related competence protei...n ComEC/Rec2 [Shewanella sediminis HAW-EB3] gb|ABV37434.1| DNA internalization-related competence protein ComEC/Rec2 [Shewanella sediminis HAW-EB3] YP_001474562.1 1.7 33% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-0675 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0675 ref|NP_667223.1| olfactory receptor 1047 [Mus musculus] gb|AAL60739.1| olfactory... receptor MOR188-3 [Mus musculus] gb|AAP71493.1| olfactory receptor Olfr1047 [Mus musculus] emb|CAM18161.1| olfactory... receptor 1047 [Mus musculus] gb|EDL27358.1| olfactory receptor 1047 [Mus musculus] NP_667223.1 1e-136 76% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-1437 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1437 ref|NP_667223.1| olfactory receptor 1047 [Mus musculus] gb|AAL60739.1| olfactory... receptor MOR188-3 [Mus musculus] gb|AAP71493.1| olfactory receptor Olfr1047 [Mus musculus] emb|CAM18161.1| olfactory... receptor 1047 [Mus musculus] gb|EDL27358.1| olfactory receptor 1047 [Mus musculus] NP_667223.1 1e-123 71% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-0312 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0312 ref|NP_667223.1| olfactory receptor 1047 [Mus musculus] gb|AAL60739.1| olfactory... receptor MOR188-3 [Mus musculus] gb|AAP71493.1| olfactory receptor Olfr1047 [Mus musculus] emb|CAM18161.1| olfactory... receptor 1047 [Mus musculus] gb|EDL27358.1| olfactory receptor 1047 [Mus musculus] NP_667223.1 1e-137 76% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-1238 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1238 ref|NP_667223.1| olfactory receptor 1047 [Mus musculus] gb|AAL60739.1| olfactory... receptor MOR188-3 [Mus musculus] gb|AAP71493.1| olfactory receptor Olfr1047 [Mus musculus] emb|CAM18161.1| olfactory... receptor 1047 [Mus musculus] gb|EDL27358.1| olfactory receptor 1047 [Mus musculus] NP_667223.1 1e-116 72% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-0756 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0756 gb|AAW70053.1| MRGX2 [Homo sapiens] gb|AAW70054.1| MRGX2 [Homo sa...piens] gb|AAW70055.1| MRGX2 [Homo sapiens] gb|AAW70070.1| MRGX2 [Homo sapiens] gb|AAW70083.1| MRGX2 [Homo sapiens] AAW70053.1 1e-66 52% ...

  17. The Remote Observatories of the Southeastern Association for Research in Astronomy (SARA) (United States)

    Keel, William C.; Oswalt, Terry; Mack, Peter; Henson, Gary; Hillwig, Todd; Batcheldor, Daniel; Berrington, Robert; De Pree, Chris; Hartmann, Dieter; Leake, Martha; Licandro, Javier; Murphy, Brian; Webb, James; Wood, Matt A.


    We describe the remote facilities operated by the Southeastern Association for Research in Astronomy (SARA) , a consortium of colleges and universities in the US partnered with Lowell Observatory, the Chilean National Telescope Allocation Committee, and the Instituto de Astrofísica de Canarias. SARA observatories comprise a 0.96 m telescope at Kitt Peak, Arizona; one of 0.6 m aperture on Cerro Tololo, Chile; and the 1 m Jacobus Kapteyn Telescope at the Roque de los Muchachos, La Palma, Spain. All are operated using standard VNC or Radmin protocols communicating with on-site PCs. Remote operation offers considerable flexibility in scheduling, allowing long-term observational cadences difficult to achieve with classical observing at remote facilities, as well as obvious travel savings. Multiple observers at different locations can share a telescope for training, educational use, or collaborative research programs. Each telescope has a CCD system for optical imaging, using thermoelectric cooling to avoid the need for frequent local service, and a second CCD for offset guiding. The Arizona and Chile telescopes also have fiber-fed echelle spectrographs. Switching between imaging and spectroscopy is very rapid, so a night can easily accommodate mixed observing modes. We present some sample observational programs. For the benefit of other groups organizing similar consortia, we describe the operating structure and principles of SARA, as well as some lessons learned from almost 20 years of remote operations.

  18. Innovative Stormwater Quality Tools by SARA for Holistic Watershed Master Planning (United States)

    Thomas, S. M.; Su, Y. C.; Hummel, P. R.


    Stormwater management strategies such as Best Management Practices (BMP) and Low-Impact Development (LID) have increasingly gained attention in urban runoff control, becoming vital to holistic watershed master plans. These strategies can help address existing water quality impairments and support regulatory compliance, as well as guide planning and management of future development when substantial population growth and urbanization is projected to occur. However, past efforts have been limited to qualitative planning due to the lack of suitable tools to conduct quantitative assessment. The San Antonio River Authority (SARA), with the assistance of Lockwood, Andrews & Newnam, Inc. (LAN) and AQUA TERRA Consultants (a division of RESPEC), developed comprehensive hydrodynamic and water quality models using the Hydrological Simulation Program-FORTRAN (HSPF) for several urban watersheds in the San Antonio River Basin. These models enabled watershed management to look at water quality issues on a more refined temporal and spatial scale than the limited monitoring data. They also provided a means to locate and quantify potential water quality impairments and evaluate the effects of mitigation measures. To support the models, a suite of software tools were developed. including: 1) SARA Timeseries Utility Tool for managing and processing of large model timeseries files, 2) SARA Load Reduction Tool to determine load reductions needed to achieve screening levels for each modeled constituent on a sub-basin basis, and 3) SARA Enhanced BMP Tool to determine the optimal combination of BMP types and units needed to achieve the required load reductions. Using these SARA models and tools, water quality agencies and stormwater professionals can determine the optimal combinations of BMP/LID to accomplish their goals and save substantial stormwater infrastructure and management costs. The tools can also help regulators and permittees evaluate the feasibility of achieving compliance

  19. Reactivity of Athabasca residue and of its SARA fractions during residue hydroconversion

    Energy Technology Data Exchange (ETDEWEB)

    Verstraete, J.; Danial-Fortain, P.; Gauthier, T.; Merdrignac, I. [IFP-Lyon, Vermaison (France); Budzinski, H. [Bordeaux Univ. (France). ISM-LPTC, UMR CNRS


    Residue conversion processes are becoming increasingly important because of the declining market for residual fuel oil and a greater demand for middle distillates. Ebullated-bed hydroconversion is a commercially proven technology for converting heavy feedstocks with high amounts of impurities. The process enables the conversion of atmospheric or vacuum residues at temperatures up to 440 degrees C, and at liquid hourly space velocity (LHSV) conditions in the range of 0.15 to 0.5 per hour. A 540 degrees C conversion of up to 80 weight per cent can be achieved under these conditions. This paper reported on a research study conducted at IFP Lyon in which the residue hydroconversion in a large-scale ebullated bed bench unit was investigated to determine the impact of operating conditions and feed properties on yield and product qualities. Hydrogen was added to the feed in the bench units to keep a high hydrogen partial pressure and favour the catalytic hydroconversion reactions. In a typical test, the reactor was fed with 50 g of feedstock and 0.45 g of crushed equilibrium industrial NiMo catalyst, pressurized hydrogen and quickly heated at the reaction temperature. This paper also discussed the conversion of Athabasca bitumen residue in the large-scale pilot plant and also in the small scale batch reactor. The effect of operating temperature and space velocity was examined. The reactivity of the saturates, aromatics, resins and asphaltenes (SARA) fractions of the bitumen was studied separately in order to better understand the conversion mechanisms and reactivities. The Athabasca bitumen feed and SARA fractions were also analyzed in terms of standard petroleum analysis, SARA fractionation, elemental analysis, size exclusion chromatography (SEC) and 13C NMR. Hydroconversion experiments were conducted in the batch unit at different reaction temperatures and reaction times. A comparison of small-scale batch results with those obtained with the continuous large-scale bench

  20. Maurice Halbwachs: Official and hidden memory

    Directory of Open Access Journals (Sweden)

    Carretero, Angel


    Full Text Available This article tries to show, in general terms, how Maurice Halbwachs has discovered presence and vitality in the collective memorieswhich have been excluded from the socially-institutionalized world. In order to decipher his opaque writing, one should try for a sociology of the depths, for a sociological look that, separating itself from the dominant positivism of the social sciences, manages to penetrate the hidden logic that permanently underlies social life. This article seeks to uncover the nature of a collective memory that respects the vicissitudes of time, as well as its difficult relations both with official memory and with the dominant historical record.

  1. Impact of subacute ruminal acidosis (SARA) adaptation and recovery on the density and diversity of bacteria in the rumen of dairy cows

    NARCIS (Netherlands)

    Hook, S.E.; Steele, M.A.; Northwood, K.S.; Dijkstra, J.; France, J.; Wright, A.G.; McBride, B.W.


    Subacute ruminal acidosis (SARA) is characterized by ruminal pH depression and microbial perturbation. The impact of SARA adaptation and recovery on rumen bacterial density and diversity was investigated following high-grain feeding. Four ruminally cannulated dairy cows were fed a hay diet, transiti

  2. Hidden attractors in dynamical systems (United States)

    Dudkowski, Dawid; Jafari, Sajad; Kapitaniak, Tomasz; Kuznetsov, Nikolay V.; Leonov, Gennady A.; Prasad, Awadhesh


    Complex dynamical systems, ranging from the climate, ecosystems to financial markets and engineering applications typically have many coexisting attractors. This property of the system is called multistability. The final state, i.e., the attractor on which the multistable system evolves strongly depends on the initial conditions. Additionally, such systems are very sensitive towards noise and system parameters so a sudden shift to a contrasting regime may occur. To understand the dynamics of these systems one has to identify all possible attractors and their basins of attraction. Recently, it has been shown that multistability is connected with the occurrence of unpredictable attractors which have been called hidden attractors. The basins of attraction of the hidden attractors do not touch unstable fixed points (if exists) and are located far away from such points. Numerical localization of the hidden attractors is not straightforward since there are no transient processes leading to them from the neighborhoods of unstable fixed points and one has to use the special analytical-numerical procedures. From the viewpoint of applications, the identification of hidden attractors is the major issue. The knowledge about the emergence and properties of hidden attractors can increase the likelihood that the system will remain on the most desirable attractor and reduce the risk of the sudden jump to undesired behavior. We review the most representative examples of hidden attractors, discuss their theoretical properties and experimental observations. We also describe numerical methods which allow identification of the hidden attractors.

  3. Nutritional Models of Experimentally-Induced Subacute Ruminal Acidosis (SARA) Differ in Their Impact on Rumen and Hindgut Bacterial Communities in Dairy Cows (United States)

    Plaizier, Jan C.; Li, Shucong; Tun, Hein M.; Khafipour, Ehsan


    Effects of subacute ruminal acidosis (SARA) challenges on the bacteria in rumen fluid, cecal digesta, and feces of dairy cows were determined using 16S rRNA gene pyrosequencing and real-time quantitative PCR. Six non-lactating Holstein cows with cannulas in the rumen and cecum were used in a 3 × 3 Latin square arrangement of treatments. During the first 3 wk of each experimental period, cows received a control diet containing 70% forages on a dry matter (DM) basis. In wk 4 of each period, cows received one of three diets: (1) the control diet; (2) a diet in which 34% of the dietary DM was replaced with pellets of ground wheat and barley (GBSC); or (3) a diet in which 37% of dietary DM was replaced with pellets of ground alfalfa (APSC). Rumen fluid, cecal digesta and feces were collected on d 5 of wk 4 of each period and the composition of the bacterial community was studied. Rumen fermentation responses were reported in a companion study. Both SARA-inducing challenges resulted in similar digesta pH depressions (as shown by the companion study), and reduced bacterial richness and diversity in rumen fluid, but GBSC had the larger effect. None of the challenges affected these measures in cecal digesta, and only GBSC reduced bacterial richness and diversity in feces. Only GBSC reduced the abundance of Bacteroidetes in rumen fluid. Abundances of limited number of bacterial genera identified by 16S rRNA gene sequencing in the rumen, cecum and feces were affected by the GBSC. The APSC did not affect any of these abundances. Both challenges increased the abundances of several starch, pectin, xylan, dextrin, lactate, succinate, and sugar fermenting bacterial species in the rumen, cecum, and feces as determined by qPCR. Only GBSC increased that of Megasphaera elsdenii in the rumen. Both challenges decreased the abundance of Streptococcus bovis, and increased that of Escherichia coli, in cecal digesta and feces, with GBSC having the larger effect. These results showed that

  4. PLS models for determination of SARA analysis of Colombian vacuum residues and molecular distillation fractions using MIR-ATR

    Directory of Open Access Journals (Sweden)

    Jorge A. Orrego-Ruiz


    Full Text Available In this work, prediction models of Saturates, Aromatics, Resins and Asphaltenes fractions (SARA from thirty-seven vacuum residues of representative Colombian crudes and eighteen fractions of molecular distillation process were obtained. Mid-Infrared (MIR Attenuated Total Reflection (ATR spectroscopy in combination with partial least squares (PLS regression analysis was used to estimate accurately SARA analysis in these kind of samples. Calibration coefficients of prediction models were for saturates, aromatics, resins and asphaltenes fractions, 0.99, 0.96, 0.97 and 0.99, respectively. This methodology permits to control the molecular distillation process since small differences in chemical composition can be detected. Total time elapsed to give the SARA analysis per sample is 10 minutes.

  5. SARAS: a precision system for measurement of the Cosmic Radio Background and signatures from the Epoch of Reionization

    CERN Document Server

    Patra, Nipanjana; Raghunathan, A; Shankar, N Udaya


    SARAS is a correlation spectrometer purpose designed for precision measurements of the cosmic radio background and faint features in the sky spectrum at long wavelengths that arise from redshifted 21-cm from gas in the reionization epoch. SARAS operates in the octave band 87.5-175 MHz. We present herein the system design arguing for a complex correlation spectrometer concept. The SARAS design concept provides a differential measurement between the antenna temperature and that of an internal reference termination, with measurements in switched system states allowing for cancellation of additive contaminants from a large part of the signal flow path including the digital spectrometer. A switched noise injection scheme provides absolute spectral calibration. Additionally, we argue for an electrically small frequency-independent antenna over an absorber ground. Various critical design features that aid in avoidance of systematics and in providing calibration products for the parametrization of other unavoidable s...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-0144 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0144 ref|YP_104995.1| alcohol dehydrogenase, zinc-containing [Burkholder...ia mallei ATCC 23344] ref|YP_111924.1| alcohol dehydrogenase [Burkholderia pseudomallei K96243] ref|ZP_004...40487.1| COG1064: Zn-dependent alcohol dehydrogenases [Burkholderia mallei GB8 horse 4] ref|YP_336176.1| alc...ohol dehydrogenase, zinc-containing [Burkholderia pseudomallei 1710b] ref|ZP_0093...0750.1| COG1064: Zn-dependent alcohol dehydrogenases [Burkholderia mallei FMH] ref|ZP_00934487.1| COG1064: Z

  7. NCBI nr-aa BLAST: CBRC-SARA-01-1695 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1695 sp|Q9NYW0|T2R10_HUMAN Taste receptor type 2 member 10 (T2R10) (Taste... receptor family B member 2) (TRB2) gb|AAH69089.1| Taste receptor, type 2, member 10 [Homo sapiens] gb|AA...U21148.1| taste receptor T2R10 [Homo sapiens] gb|AAI01763.1| Taste receptor, type 2, member 10 [Homo sapiens] gb|AAI01765.1| Taste

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1608 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1608 ref|NP_001832.1| cannabinoid receptor 2 (macrophage) [Homo sapien...s] sp|P34972|CNR2_HUMAN Cannabinoid receptor 2 (CB2) (CB-2) (CX5) emb|CAA52376.1| CB2 (peripheral) cannabinoid... receptor [Homo sapiens] emb|CAD22548.1| peripheral cannabinoid receptor CB2 [Homo sapiens] emb|CAD22549.1| peripheral cannabinoid... receptor CB2 [Homo sapiens] gb|AAO92299.1| cannabinoid r...eceptor 2 [Homo sapiens] emb|CAI14799.1| cannabinoid receptor 2 (macrophage) [Homo sapiens] emb|CAJ42137.1| cannabinoid

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0195 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0195 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cannabinoid... receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cannabinoid... receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 97% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-0921 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0921 ref|NP_003292.1| thyrotropin-releasing hormone receptor [Homo sap...iens] sp|P34981|TRFR_HUMAN Thyrotropin-releasing hormone receptor (TRH-R) (Thyroliberin receptor) emb|CAA52965.1| thyrotropin-releasi...BAA04120.1| human thyrotropin-releasing hormone receptor [Homo sapiens] gb|AAB32222.1| hormone receptor; TRH receptor [Homo sapiens] dbj|BAA12796.1| thyrotropin-releasing... hormone receptor [Homo sapiens] gb|AAR84356.1| thyrotropin-releasing hormone receptor [Homo sapiens] gb|

  11. NCBI nr-aa BLAST: CBRC-SARA-01-1167 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1167 ref|XP_001105680.1| PREDICTED: similar to adiponectin receptor 1 ...isoform 3 [Macaca mulatta] ref|XP_001105751.1| PREDICTED: similar to adiponectin receptor 1 isoform 4 [Macac...a mulatta] ref|XP_001105805.1| PREDICTED: similar to adiponectin receptor 1 isoform 5 [Macaca mulatta] ref|X...P_001105878.1| PREDICTED: similar to adiponectin receptor 1 isoform 6 [Macaca mul...atta] ref|XP_001105957.1| PREDICTED: similar to adiponectin receptor 1 isoform 7 [Macaca mulatta] XP_001105680.1 1e-138 67% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-1167 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1167 ref|NP_057083.2| adiponectin receptor 1 [Homo sapiens] ref|XP_514107.1| PREDICTED: adipone...ctin receptor 1 isoform 7 [Pan troglodytes] ref|XP_001152270.1| PREDICTED: adiponectin... receptor 1 isoform 1 [Pan troglodytes] ref|XP_001152338.1| PREDICTED: adiponectin receptor 1 isoform 2 [...Pan troglodytes] ref|XP_001152393.1| PREDICTED: adiponectin receptor 1 isoform 3 ...[Pan troglodytes] ref|XP_001152460.1| PREDICTED: adiponectin receptor 1 isoform 4 [Pan troglodytes] ref|XP_0

  13. NCBI nr-aa BLAST: CBRC-SARA-01-0033 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0033 ref|NP_000951.1| prostaglandin I2 (prostacyclin) receptor (IP) [ I2 receptor) dbj|BAA05008.1| prostacyclin receptor [Homo sapiens] gb|AAA36448.1| prostanoid IP receptor dbj|BAA06110.1| pros...tacyclin receptor [Homo sapiens] dbj|BAA07325.1| prostacyclin ...receptor [Homo sapiens] gb|AAO92301.1| prostaglandin I2 (prostacyclin) receptor [Homo sapiens] gb|AAH75814.1| Prostaglandin I2 (pros...tacyclin) receptor (IP) [Homo sapiens] gb|EAW57432.1| prostaglandin I2 (prostacyclin

  14. NCBI nr-aa BLAST: CBRC-SARA-01-0259 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0259 ref|XP_001107503.1| PREDICTED: tubulin, alpha, ubiquitous isoform... 10 [Macaca mulatta] ref|XP_001107562.1| PREDICTED: tubulin, alpha, ubiquitous isoform 11 [Macaca mulatta] r...ef|XP_001107624.1| PREDICTED: tubulin, alpha, ubiquitous isoform 12 [Macaca mulatta] ref|XP_001107684.1| PRE...| PREDICTED: tubulin, alpha, ubiquitous isoform 14 [Macaca mulatta] ref|XP_001107805.1| PREDICTED: tubulin, alpha, ubiquitous... isoform 15 [Macaca mulatta] ref|XP_001107870.1| PREDICTED: tubulin, alpha, ubiquitous isof

  15. NCBI nr-aa BLAST: CBRC-SARA-01-0771 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0771 ref|NP_848509.1| progestin and adipoQ receptor family member VII ...[Homo sapiens] sp|Q86WK9|MPRA_HUMAN Membrane progestin receptor alpha (mPR alpha) (Progestin and adipoQ rece...ptor family member VII) gb|AAO47233.1|AF313620_1 putative membrane steroid receptor [Homo sapiens] gb|AAR08373.1| progesti...1| hCG1642829 [Homo sapiens] emb|CAM12867.1| progestin and adipoQ receptor family member VII [Homo sapiens] NP_848509.1 1e-178 87% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-0900 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0900 ref|YP_001122232.1| CDP-alcohol phosphatidyltransferase [Francise...lla tularensis subsp. tularensis WY96-3418] ref|YP_001427783.1| CDP-alcohol phosphatidyltransferase [Francis...ella tularensis subsp. holarctica FTA] gb|ABO47111.1| CDP-alcohol phosphatidyltransferase [Francisella tular...ensis subsp. tularensis WY96-3418] gb|EDN35713.1| phosphatidylserine synthase [Francis...ella tularensis subsp. novicida GA99-3549] gb|EDN37179.1| hypothetical protein FTDG_01588 [Francisella

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1750 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1750 gb|ABR53744.1| opsin 1 short-wavelength senstive protein [Daubent...onia madagascariensis] gb|ABR53745.1| opsin 1 short-wavelength senstive protein [Daubentonia madagascariensi...s] gb|ABR53746.1| opsin 1 short-wavelength senstive protein [Daubentonia madagascariensis] gb|ABR53747.1| opsin 1 short-wave...length senstive protein [Daubentonia madagascariensis] gb|ABR53748.1| opsin 1 short-wave...length senstive protein [Daubentonia madagascariensis] gb|ABR53749.1| opsin 1 short-wave

  18. Managing Hidden Costs of Offshoring

    DEFF Research Database (Denmark)

    Larsen, Marcus M.; Pedersen, Torben


    This chapter investigates the concept of the ‘hidden costs’ of offshoring, i.e. unexpected offshoring costs exceeding the initially expected costs. Due to the highly undefined nature of these costs, we position our analysis towards the strategic responses of firms’ realisation of hidden costs....... In this regard, we argue that a major response to the hidden costs of offshoring is the identification and utilisation of strategic mechanisms in the organisational design to eventually achieving system integration in a globally dispersed and disaggregated organisation. This is heavily moderated by a learning...

  19. saeRS and sarA act synergistically to repress protease production and promote biofilm formation in Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Lara N Mrak

    Full Text Available Mutation of the staphylococcal accessory regulator (sarA limits biofilm formation in diverse strains of Staphylococcus aureus, but there are exceptions. One of these is the commonly studied strain Newman. This strain has two defects of potential relevance, the first being mutations that preclude anchoring of the fibronectin-binding proteins FnbA and FnbB to the cell wall, and the second being a point mutation in saeS that results in constitutive activation of the saePQRS regulatory system. We repaired these defects to determine whether either plays a role in biofilm formation and, if so, whether this could account for the reduced impact of sarA in Newman. Restoration of surface-anchored FnbA enhanced biofilm formation, but mutation of sarA in this fnbA-positive strain increased rather than decreased biofilm formation. Mutation of sarA in an saeS-repaired derivative of Newman (P18L or a Newman saeRS mutant (ΔsaeRS resulted in a biofilm-deficient phenotype like that observed in clinical isolates, even in the absence of surface-anchored FnbA. These phenotypes were correlated with increased production of extracellular proteases and decreased accumulation of FnbA and/or Spa in the P18L and ΔsaeRS sarA mutants by comparison to the Newman sarA mutant. The reduced accumulation of Spa was reversed by mutation of the gene encoding aureolysin, while the reduced accumulation of FnbA was reversed by mutation of the sspABC operon. These results demonstrate that saeRS and sarA act synergistically to repress the production of extracellular proteases that would otherwise limit accumulation of critical proteins that contribute to biofilm formation, with constitutive activation of saeRS limiting protease production, even in a sarA mutant, to a degree that can be correlated with increased enhanced capacity to form a biofilm. Although it remains unclear whether these effects are mediated directly or indirectly, studies done with an sspA::lux reporter suggest they

  20. Variational Infinite Hidden Conditional Random Fields

    NARCIS (Netherlands)

    Bousmalis, Konstantinos; Zafeiriou, Stefanos; Morency, Louis-Philippe; Pantic, Maja; Ghahramani, Zoubin


    Hidden conditional random fields (HCRFs) are discriminative latent variable models which have been shown to successfully learn the hidden structure of a given classification problem. An Infinite hidden conditional random field is a hidden conditional random field with a countably infinite number of

  1. Hidden Statistics of Schroedinger Equation (United States)

    Zak, Michail


    Work was carried out in determination of the mathematical origin of randomness in quantum mechanics and creating a hidden statistics of Schr dinger equation; i.e., to expose the transitional stochastic process as a "bridge" to the quantum world. The governing equations of hidden statistics would preserve such properties of quantum physics as superposition, entanglement, and direct-product decomposability while allowing one to measure its state variables using classical methods.

  2. Microgenetic analysis of hidden figures


    Marković Slobodan S.; Gvozdenović Vasilije P.


    In this study the phenomenological and processual aspects of the perception of hidden figures were compared. The question was whether the more probable percepts of hidden figures, compared to the less probable percepts, were generated in earlier stages of the perceptual process. In the pilot study the subjects were asked to say what they see in a complex linear pattern. The three most frequent and the three least frequent perceptual descriptions were selected. In the experiment the microgenes...

  3. Illness, everyday life and narrative montage: the visual aesthetics of cancer in Sara Bro's Diary. (United States)

    Henriksen, Nina; Tjørnhøj-Thomsen, Tine; Hansen, Helle Ploug


    This article presents a study of Sara Bro's Diary (2004), a book montage of images and texts recording the experiences of a Danish breast cancer survivor, Sara Bro. It examines two montages of photography and text, drawing on Roland Barthes' concept of 'the third meaning' to explain and discuss the effect of the layered meanings in the montage alongside their multi-medium and self-referential expression. The discussion is centred on the aesthetic practices that are invited by Bro's book montage. The article considers how the juxtaposition of images and texts are experienced and co-created by the reader. It points to the effect of the aesthetics of disguise and carnival implicit in the visual-verbal montage and argues that these generate a third meaning. This meaning is associated with the breast cancer experience but is not directly discernible in the montage. The article concludes by discussing how Bro's montage acts as an ideological statement, subverting or 'poaching on' the health care system.

  4. The Hidden Subgroup Problem

    CERN Document Server

    Wang, Frédéric


    We give an overview of the Hidden Subgroup Problem (HSP) as of July 2010, including new results discovered since the survey of arXiv:quant-ph/0411037v1. We recall how the problem provides a framework for efficient quantum algorithms and present the standard methods based on coset sampling. We study the Dihedral and Symmetric HSPs and how they relate to hard problems on lattices and graphs. Finally, we conclude with the known solutions and techniques, describe connections with efficient algorithms as well as miscellaneous variants of HSP. We also bring various contributions to the topic. We show that in theory, we can solve HSP over a given group inductively: the base case is solving HSP over its simple factor groups and the inductive step is building efficient oracles over a normal subgroup N and over the factor group G/N. We apply this analysis to the Dedekindian HSP to get an alternative abelian HSP algorithm based on a change of the underlying group. We also propose a quotient reduction by the normal group...

  5. Managing Hidden Costs of Offshoring

    DEFF Research Database (Denmark)

    Larsen, Marcus M.; Pedersen, Torben


    This chapter investigates the concept of the ‘hidden costs’ of offshoring, i.e. unexpected offshoring costs exceeding the initially expected costs. Due to the highly undefined nature of these costs, we position our analysis towards the strategic responses of firms’ realisation of hidden costs. In......-by-doing process, where hidden costs motivate firms and their employees to search for new and better knowledge on how to successfully manage the organisation. We illustrate this thesis based on the case of the LEGO Group.......This chapter investigates the concept of the ‘hidden costs’ of offshoring, i.e. unexpected offshoring costs exceeding the initially expected costs. Due to the highly undefined nature of these costs, we position our analysis towards the strategic responses of firms’ realisation of hidden costs....... In this regard, we argue that a major response to the hidden costs of offshoring is the identification and utilisation of strategic mechanisms in the organisational design to eventually achieving system integration in a globally dispersed and disaggregated organisation. This is heavily moderated by a learning...

  6. The Hidden Costs of Offshoring

    DEFF Research Database (Denmark)

    Møller Larsen, Marcus; Manning, Stephan; Pedersen, Torben


    This study seeks to explain hidden costs of offshoring, i.e. unexpected costs resulting from the relocation of business tasks and activities outside the home country. We develop a model that highlights the role of complexity, design orientation and experience in explaining hidden costs of offshor...... of our study is to suggest how hidden costs of offshoring can be mitigated through an explicit orientation towards improving organizational processes and structures as well as experience with offshoring.......This study seeks to explain hidden costs of offshoring, i.e. unexpected costs resulting from the relocation of business tasks and activities outside the home country. We develop a model that highlights the role of complexity, design orientation and experience in explaining hidden costs...... of offshoring. Specifically, we propose that hidden costs can be explained by the combination of increasing structural, operational and social complexity of offshoring activities. In addition, we suggest that firm orientation towards organizational design as part of an offshoring strategy and offshoring...

  7. Should Community College Be Free? Forum. "Education Next" Talks with Sara Goldrick-Rab and Andrew P. Kelly (United States)

    Goldrick-Rab, Sara; Kelly, Andrew P.


    In this article, "Education Next" talks with Sara Goldrick-Rab and Andrew Kelly. President Obama's proposal for tuition-free community college, seems to have laid down a marker for the Democratic Party. Vermont senator Bernie Sanders is touting his plan for free four-year public college on the primary trail; Massachusetts senator…

  8. A Different Curriculum of Preparation for Work: Commentary on Mike Rose, Sara Goldrick-Rab, Kris Gutierrez and Norton Grubb (United States)

    Worthen, Helena Harlow


    The January 2012 issue of "Mind, Culture, and Activity" published the Invited Presidential Address "Rethinking Remedial Education and the Academic-Vocational Divide," given by Mike Rose at the 2011 meeting of the American Educational Research Association in New Orleans, along with responses and commentary by Sara Goldrick-Rab, Kris Gutierrez, and…

  9. Stargate of the Hidden Multiverse

    Directory of Open Access Journals (Sweden)

    Alexander Antonov


    Full Text Available Concept of Monoverse, which corresponds to the existing broad interpretation of the second postulate of the special theory of relativity, is not consistent with the modern astrophysical reality — existence of the dark matter and the dark energy, the total mass-energy of which is ten times greater than the mass-energy of the visible universe (which has been considered as the entire universe until very recent . This concept does not allow to explain their rather unusual properties — invisibility and lack of baryon content — which would seem to even destroy the very modern understanding of the term ‘matter’. However, all numerous alternative concepts of Multiverses, which have been proposed until today, are unable to explain these properties of the dark matter and dark energy. This article describes a new concept: the concept of the hidden Multiverse and hidden Supermultiverse, which mutual invisibility of parallel universes is explained by the physical reality of imaginary numbers. This concept completely explains the phenomenon of the dark matter and the dark energy. Moreover, it is shown that the dark matter and the dark energy are the experimental evidence for the existence of the hidden Multiverse. Described structure of the hidden Multiverse is fully consistent with the data obtained by the space stations WMAP and Planck. An extremely important property of the hidden Multiverse is an actual possibility of its permeation through stargate located on the Earth.

  10. Hidden photons in connection to dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Andreas, Sarah; Ringwald, Andreas [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Goodsell, Mark D. [CPhT, Ecole Polytechnique, Palaiseau (France)


    Light extra U(1) gauge bosons, so called hidden photons, which reside in a hidden sector have attracted much attention since they are a well motivated feature of many scenarios beyond the Standard Model and furthermore could mediate the interaction with hidden sector dark matter.We review limits on hidden photons from past electron beam dump experiments including two new limits from such experiments at KEK and Orsay. In addition, we study the possibility of having dark matter in the hidden sector. A simple toy model and different supersymmetric realisations are shown to provide viable dark matter candidates in the hidden sector that are in agreement with recent direct detection limits.

  11. On Noncontextual, Non-Kolmogorovian Hidden Variable Theories (United States)

    Feintzeig, Benjamin H.; Fletcher, Samuel C.


    One implication of Bell's theorem is that there cannot in general be hidden variable models for quantum mechanics that both are noncontextual and retain the structure of a classical probability space. Thus, some hidden variable programs aim to retain noncontextuality at the cost of using a generalization of the Kolmogorov probability axioms. We generalize a theorem of Feintzeig (Br J Philos Sci 66(4): 905-927, 2015) to show that such programs are committed to the existence of a finite null cover for some quantum mechanical experiments, i.e., a finite collection of probability zero events whose disjunction exhausts the space of experimental possibilities.

  12. On Noncontextual, Non-Kolmogorovian Hidden Variable Theories (United States)

    Feintzeig, Benjamin H.; Fletcher, Samuel C.


    One implication of Bell's theorem is that there cannot in general be hidden variable models for quantum mechanics that both are noncontextual and retain the structure of a classical probability space. Thus, some hidden variable programs aim to retain noncontextuality at the cost of using a generalization of the Kolmogorov probability axioms. We generalize a theorem of Feintzeig (Br J Philos Sci 66(4): 905-927, 2015) to show that such programs are committed to the existence of a finite null cover for some quantum mechanical experiments, i.e., a finite collection of probability zero events whose disjunction exhausts the space of experimental possibilities.

  13. Hidden worlds in quantum physics

    CERN Document Server

    Gouesbet, Gérard


    The past decade has witnessed a resurgence in research and interest in the areas of quantum computation and entanglement. This new book addresses the hidden worlds or variables of quantum physics. Author Gérard Gouesbet studied and worked with a former student of Louis de Broglie, a pioneer of quantum physics. His presentation emphasizes the history and philosophical foundations of physics, areas that will interest lay readers as well as professionals and advanced undergraduate and graduate students of quantum physics. The introduction is succeeded by chapters offering background on relevant concepts in classical and quantum mechanics, a brief history of causal theories, and examinations of the double solution, pilot wave, and other hidden-variables theories. Additional topics include proofs of possibility and impossibility, contextuality, non-locality, classification of hidden-variables theories, and stochastic quantum mechanics. The final section discusses how to gain a genuine understanding of quantum mec...

  14. Hidden Variables or Positive Probabilities?

    CERN Document Server

    Rothman, T; Rothman, Tony


    Despite claims that Bell's inequalities are based on the Einstein locality condition, or equivalent, all derivations make an identical mathematical assumption: that local hidden-variable theories produce a set of positive-definite probabilities for detecting a particle with a given spin orientation. The standard argument is that because quantum mechanics assumes that particles are emitted in a superposition of states the theory cannot produce such a set of probabilities. We examine a paper by Eberhard who claims to show that a generalized Bell inequality, the CHSH inequality, can be derived solely on the basis of the locality condition, without recourse to hidden variables. We point out that he nonetheless assumes a set of positive-definite probabilities, which supports the claim that hidden variables or "locality" is not at issue here, positive-definite probabilities are. We demonstrate that quantum mechanics does predict a set of probabilities that violate the CHSH inequality; however these probabilities ar...

  15. Psyche’s Daughter of Today: Sara Jeannette Duncan and the New Woman

    Directory of Open Access Journals (Sweden)

    Michelle Gadpaille


    Full Text Available The Canadian novelist Sara Jeannette Duncan (1861-1922 constructed a New Woman heroine in the fin-de- siecle novel; A Daughter of Today (1894. Written in the popular mode of the transatlantic novel; the work engages in debate on the appropriate construction of femininity in art and public life. The heroine; Elfrida Bell; descends from artist; to muse; to model; to painted image—a descent framed by a rival male artist and a hostile London art scene. Represented as Psyche; the heroine undergoes a quest and failure similar to the mythical one. Adaptation of the Psyche myth clarifies the position of Duncan in the spectrum of gender ideologies of the fin-de- siecle.

  16. NCBI nr-aa BLAST: CBRC-SARA-01-1066 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1066 ref|NP_473371.1| MAS-related GPR, member X2 [Homo sapiens] sp|Q96...LB1|MRGX2_HUMAN Mas-related G-protein coupled receptor member X2 gb|AAK91805.1| G protein-coupled receptor [Homo sapie...ns] dbj|BAB89339.1| putative G-protein coupled receptor [Homo sapiens] dbj|BAC06030.1| seven trans...membrane helix receptor [Homo sapiens] gb|AAH63450.1| MAS-related GPR, member X2 [Homo sapie...ns] gb|AAW70056.1| MRGX2 [Homo sapiens] gb|AAW70057.1| MRGX2 [Homo sapiens] gb|AAW70058.1| MRGX2 [Homo sapie

  17. NCBI nr-aa BLAST: CBRC-SARA-01-0185 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0185 ref|NP_000852.1| histamine receptor H1 [Homo sapiens] ref|NP_001091681.1| histamine... receptor H1 [Homo sapiens] ref|NP_001091682.1| histamine receptor H1 [Homo sapiens] ref|NP_001091683.1| histamine... receptor H1 [Homo sapiens] sp|P35367|HRH1_HUMAN Histamine H1 receptor emb|CAA54182.1| histamine... H1 receptor [Homo sapiens] dbj|BAA05840.1| histamine H1 receptor [ sapiens] emb|CAA84380.1| Human histamine H1 receptor [Homo sapiens] dbj|BAA03319.1| histamine H1 receptor

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1746 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1746 ref|NP_705806.1| non-imprinted in Prader-Willi/Angelman syndrome ...1 [Mus musculus] sp|Q8BHK1|NIPA1_MOUSE Non-imprinted in Prader-Willi/Angelman syndrome region protein 1 homo...log gb|AAM34534.1| non-imprinted in Prader-Willi/Angelman syndrome 1 [Mus musculus] dbj|BAC32809.1| unnamed ...protein product [Mus musculus] gb|AAH55828.1| Non imprinted in Prader-Willi/ syndrome 1 homolog (human) [Mus musculus] gb|EDL21870.1| non imprinted in Prader-Willi/Angelman syndrome 1 homolog (human) [Mus musculus] NP_705806.1 1e-113 81% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-1199 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1199 ref|NP_035141.1| opioid receptor, kappa 1 [Mus musculus] sp|P33534|OPRK_MOUSE opioid receptor (KOR-1) (MSL-1) gb|AAA39363.1| kappa opioid receptor gb|AAB34130.2| opioid receptor; KOR [Mus sp.] gb|AAP32232.1| kappa-opioid receptor [Mus sp.] gb|AAI16796.1| Opioid receptor, 1 [Mus musculus] gb|AAI19027.1| Opioid receptor, kappa 1 [Mus muscu...lus] gb|EDL14259.1| opioid receptor, kappa 1, isoform CRA_a [Mus musculus] NP_035141.1 1e-78 92% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-0004 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0004 ref|NP_000900.1| neuropeptide Y receptor Y1 [Homo sapiens] sp|P25929|NPY1R_HUMAN Neurope...ptide Y receptor type 1 (NPY1-R) gb|AAA73215.1| [Human neuropeptide Y peptide YY rece...ptor mRNA, complete cds.], gene product gb|AAA59947.1| neuropeptide Y receptor Y1 gb|AAH36657.1| Neuropeptid...e Y receptor Y1 [Homo sapiens] gb|AAS55647.1| neuropeptide Y1 receptor [Homo sapiens] gb|AAH71720.1| Neuro...peptide Y receptor Y1 [Homo sapiens] gb|EAX04841.1| neuropeptide Y receptor Y1 [Hom

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1215 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1215 ref|NP_000901.1| neuropeptide Y receptor Y2 [Homo sapiens] ref|NP_001012655.1| neurope...ptide Y receptor Y2 [Pan troglodytes] sp|P49146|NPY2R_HUMAN Neuropeptide Y receptor typ...e 2 (NPY2-R) (NPY-Y2 receptor) sp|Q5IS62|NPY2R_PANTR Neuropeptide Y receptor type 2 (NPY2-R) (NPY-Y2 receptor) gb|AAC50281.1| neurope...ptide Y/peptide YY Y2 receptor gb|AAB04120.1| y2 receptor gb|AAC51115.1| type 2 neuropeptide Y receptor gb|AAO92062.1| neuropeptide Y receptor Y2 [Homo

  2. SarA is a negative regulator of Staphylococcus epidermidis biofilm formation

    DEFF Research Database (Denmark)

    Martin, Christer; Heinze, C.; Busch, M.


    Biofilm formation is essential for Staphylococcus epidermidis pathogenicity in implant-associated infections. Nonetheless, large proportions of invasive S. epidermidis isolates fail to show accumulative biofilm growth in vitro. We here tested the hypothesis that this apparent paradox is related...... to the existence of superimposed regulatory systems suppressing a multi-cellular biofilm life style in vitro. Transposon mutagenesis of clinical significant but biofilm-negative S. epidermidis 1585 was used to isolate a biofilm positive mutant carrying a Tn917 insertion in sarA,chief regulator of staphylococcal...... virulence. Genetic analysis revealed that inactivation of sarA induced biofilm formation via over-expression of the giant 1 MDa extracellular matrix binding protein (Embp), serving as an intercellular adhesin. In addition to Embp, increased extracellular DNA (eDNA) release significantly contributed...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-1942 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1942 ref|NP_000669.1| alpha-1D-adrenergic receptor [Homo sapiens] sp|P...25100|ADA1D_HUMAN Alpha-1D adrenergic receptor (Alpha 1D-adrenoceptor) (Alpha 1D-adrenoreceptor) (Alpha-1A adrenerg...ic receptor) (Alpha adrenergic receptor 1a) gb|AAB60351.1| adrenergic alpha-1a receptor protein gb|AA...B59487.1| alpha 1a/d adrenergic receptor dbj|BAA06222.1| alpha1A/D adrenergic rec...eptor [Homo sapiens] emb|CAH70478.1| adrenergic, alpha-1D-, receptor [Homo sapiens] emb|CAC00601.2| adrenerg

  4. Using the hidden curriculum to teach professionalism in nursing students. (United States)

    Karimi, Zohreh; Ashktorab, Tahereh; Mohammadi, Easa; Abedi, Heidar Ali


    Professionalism in nursing is critical for creating credibility and a positive image. This study was carried out to explain the use of hidden curriculum in teaching professionalism in nursing students. This qualitative study was conducted through purposeful sampling strategy by the participation of 32 nursing students. The data were collected by using semi-structured interviews, and this process was continued until achieving data saturation and themes' emergence. Content analysis method was used for data analysis. DATA ANALYSIS REVEALED THREE MAIN THEMES: Development of understanding the professionalism elements, Variety of influenceability strategies, and Influenceability to various resources. Each theme consisted of some subthemes. The nursing students learnt the professionalism elements by different methods from different resources through the hidden curriculum. Therefore, exploration of the currently administered hidden curricula is suggested.

  5. Escribiendo el silencio: la contemplación poética de Sara Pujol

    Directory of Open Access Journals (Sweden)

    Gala, Candelas


    Full Text Available Reading Sara Pujol Russell's El fuego tiende su aire (1999 and Intacto asombro de la luz del silencio (2001, is entering into a poetic world whose content and form are both innovative and complex. This poetry invites the reader into a state of meditative contemplation that seeks correspondences among different elements in reality as the key to access a superior type of knowledge. Pujol's writing moves in the fringes between voice and silence, art and nature, meaning and nothingness, identity and difference, it seeks to surpass its own verbal texture while only in that texture does it find articulation and only through it does transcendence becones accessible. The focus of the present reading centers on the point where Pujol's language seeks to transcend the disjunction between sign and surrounding, the point where synthesis is fusion about to dissolve.La lectura de El fuego tiende su aire (1999 e Intacto asombro en la luz del silencio (2001 de Sara Pujol Russell, supone la entrada en un discurso poético innovador y complejo tanto en contenido como en forma. Esta poesía invita a una contemplación meditativa que busca las correspondencias entre los diversos elementos de la realidad como clave para acceder a un conocimiento superior. Su escritura se mueve en los bordes entre la voz y el silencio, el arte y la naturaleza, el sentido y el vacío, la identidad y la diferencia, buscando trascender lo que está más allá de su misma urdimbre verbal pero que sólo en ella se configura, y sólo desde ella se puede acceder. En el movimiento de esta escritura por superar la disyunción entre signo y entorno, en esa síntesis a punto de disolverse, es donde se enfoca la lectura en este ensayo.

  6. The Hidden Costs of Offshoring

    DEFF Research Database (Denmark)

    Møller Larsen, Marcus; Manning, Stephan; Pedersen, Torben


    experience moderate the relationship between complexity and hidden costs negatively i.e. reduces the cost generating impact of complexity. We develop three hypotheses and test them on comprehensive data from the Offshoring Research Network (ORN). In general, we find support for our hypotheses. A key result...... of offshoring. Specifically, we propose that hidden costs can be explained by the combination of increasing structural, operational and social complexity of offshoring activities. In addition, we suggest that firm orientation towards organizational design as part of an offshoring strategy and offshoring...

  7. Hidden symmetries in jammed systems (United States)

    Morse, Peter K.; Corwin, Eric I.


    There are deep, but hidden, geometric structures within jammed systems, associated with hidden symmetries. These can be revealed by repeated transformations under which these structures lead to fixed points. These geometric structures can be found in the Voronoi tesselation of space defined by the packing. In this paper we examine two iterative processes: maximum inscribed sphere (MIS) inversion and a real-space coarsening scheme. Under repeated iterations of the MIS inversion process we find invariant systems in which every particle is equal to the maximum inscribed sphere within its Voronoi cell. Using a real-space coarsening scheme we reveal behavior in geometric order parameters which is length-scale invariant.

  8. Hidden Crises and Communication : An Interactional Analysis of Hidden Crises

    NARCIS (Netherlands)

    Klarenbeek, Annette


    In this paper I describe the ways in which the communication discipline can make a hidden crisis transparent. For this purpose I examine the concept of crisis entrepreneurship from a communication point of view. Using discourse analysis, I analyse the discursive practices of crisis entrepreneurs in

  9. Functional impairment in patients with myotonic dystrophy type 1 can be assessed by an ataxia rating scale (SARA). (United States)

    DiPaolo, Giovanni; Jimenez-Moreno, Cecilia; Nikolenko, Nikoletta; Atalaia, Antonio; Monckton, Darren G; Guglieri, Michela; Lochmüller, Hanns


    Myotonic dystrophy type 1 (DM1) is not characterised by ataxia per se; however, DM1 and ataxia patients show similar disturbances in movement coordination often experiencing walking and balance difficulties, although caused by different underlying pathologies. This study aims to investigate the use of a scale previously described for the assessment and rating of ataxia (SARA) with the hypothesis that it could have utility in DM1 patients as a measure of disease severity and risk of falling. Data from 54 DM1 patients were pulled from the PHENO-DM1 natural history study for analysis. Mean SARA score in the DM1 population was 5.45 relative to the maximum score of eight. A flooring effect (score 0) was observed in mild cases within the sample. Inter-rater and test-retest reliability was high with intraclass coefficients (ICC) of 0.983 and 1.00, respectively. Internal consistency was acceptable as indicated by a Cronbach's alpha of 0.761. Component analysis revealed two principle components. SARA correlated with: (1) all measures of muscle function tested, including quantitative muscle testing of ankle dorsiflexion (r = -0.584*), the 6 min walk test (r = -0.739*), 10 m walk test (r = 0.741*), and the nine hole peg test (r = 0.602*) and (2) measures of disease severity/burden, such as MIRS (r = 0.718*), MDHI (r = 0.483*), and DM1-Activ (r = -0.749*) (*p < 0.001). The SARA score was predicted by an interaction between modal CTG repeat length and age at sampling (r = 0.678, p = 0.003). A score of eight or above predicted the use of a walking aid with a sensitivity of 100% and a specificity of 85.7%. We suggest that further research is warranted to ascertain whether SARA or components of SARA are useful outcome measures for clinical trials in DM1. As a tool, it can be used for gathering information about disease severity/burden and helping to identify patients in need of a walking aid, and can potentially be applied in both research and healthcare

  10. Modeling Multiple Risks: Hidden Domain of Attraction

    CERN Document Server

    Mitra, Abhimanyu


    Hidden regular variation is a sub-model of multivariate regular variation and facilitates accurate estimation of joint tail probabilities. We generalize the model of hidden regular variation to what we call hidden domain of attraction. We exhibit examples that illustrate the need for a more general model and discuss detection and estimation techniques.

  11. Pentaquark states with hidden charm (United States)

    Bijker, Roelof


    I develop an extension of the usual three-flavor quark model to four flavors (u, d, s and c), and discuss the classification of pentaquark states with hidden charm. This work is motivated by the recent observation of such states by the LHCb Collatoration at CERN.

  12. Microgenetic analysis of hidden figures

    Directory of Open Access Journals (Sweden)

    Marković Slobodan S.


    Full Text Available In this study the phenomenological and processual aspects of the perception of hidden figures were compared. The question was whether the more probable percepts of hidden figures, compared to the less probable percepts, were generated in earlier stages of the perceptual process. In the pilot study the subjects were asked to say what they see in a complex linear pattern. The three most frequent and the three least frequent perceptual descriptions were selected. In the experiment the microgenesis of the perception of hidden figures was investigated. The primed matching paradigm and the same-different task were used. In each experiment two types of test figures were contrasted: the more frequent and the less frequent ones. There were two prime types: identical (equal to test figures and complex (the pattern with hidden test figures. The prime duration was varied, 50 ms and 400 ms. The main result indicates that in the case of complex priming the more frequent test figures were processed significantly faster than the less frequent ones in both prime duration conditions. These results suggest that the faster the processing of a figure, the more probable the perceptual generation of this figure.

  13. Women's hidden transcripts about abortion in Brazil. (United States)

    Nations, M K; Misago, C; Fonseca, W; Correia, L L; Campbell, O M


    Two folk medical conditions, "delayed" (atrasada) and "suspended" (suspendida) menstruation, are described as perceived by poor Brazilian women in Northeast Brazil. Culturally prescribed methods to "regulate" these conditions and provoke menstrual bleeding are also described, including ingesting herbal remedies, patent drugs, and modern pharmaceuticals. The ingestion of such self-administered remedies is facilitated by the cognitive ambiguity, euphemisms, folklore, etc., which surround conception and gestation. The authors argue that the ethnomedical conditions of "delayed" and "suspended" menstruation and subsequent menstrual regulation are part of the "hidden reproductive transcript" of poor and powerless Brazilian women. Through popular culture, they voice their collective dissent to the official, public opinion about the illegality and immorality of induced abortion and the chronic lack of family planning services in Northeast Brazil. While many health professionals consider women's explanations of menstrual regulation as a "cover-up" for self-induced abortions, such popular justifications may represent either an unconscious or artful manipulation of hegemonic, anti-abortion ideology expressed in prudent, unobtrusive and veiled ways. The development of safer abortion alternatives should consider women's hidden reproductive transcripts.


    Directory of Open Access Journals (Sweden)

    Neni Lestari


    Full Text Available This study aimed to evaluate the implementation and impact of Hidden Curriculum, as well as the determinant factors of success and sustainability in SMPN 2 Boja Kendal. This study was an evaluative research using qualitative approach. The data collected by using observation, interviews, and documentation. Data analyzed by collecting and selecting to be deduce. Validity used triangulation data that combined the result of observation, interviews, and documentation. The results of the study were: 1 The activities of hidden curriculum development at SMPN 2 Boja Kendal, namely: flag ceremony, school environmental management, establishing and enforcing discipline, special religious worship, smiles, greetings and courtesies, exemplary, relationship among students and principal, teachers, and staff, school canteen services. 2 The impact of the hidden curriculum development was the changing of school community’s behavior being better, created clean and beautiful school environment, the improvement of public trust to the school toward their kids’ education. Development of the hidden curriculum could establish students good character and an optimal achievement as well as a good school culture. 3 Internal supporting factors including: qualified human resources, the availability of school facilities, school environment was clean and beautiful. External supporting factors occur in the form of endorsement of the parents, school committees and communities in establishing good and virtuous character for the students.

  15. The Sub-keV Atom Reflecting Analyzer (SARA) Experiment Aboard Chandrayaan-1 Mission: Instrument and Observations

    CERN Document Server

    Bhardwaj, Anil; Dhanya, M B; Barabash, Stas; Yoshifumi, Futaana; Holmstrom, Mats; Sridharan, R; Wurz, Peter; Schaufelberger, Audrey; Kazushi, Asamura


    SARA experiment aboard the first Indian lunar mission Chandrayaan-1 had the objective to explore the solar wind-lunar interaction using energetic neutral atoms (ENA) from the lunar surface as diagnostic tool. SARA consisted of an ENA imaging mass analyzer CENA (Chandrayaan-1 Energetic Neutral Analyzer) and an ion mass analyser SWIM (Solar Wind Monitor), along with a digital processing unit (DPU) which commands and controls the sensors and provides the interface to the spacecraft. Both sensors have provided excellent observational data. CENA has observed ENAs from the lunar surface and found that ~20% of the incident solar wind ions get backscattered as ENAs from the lunar surface. This is contrary to the previous assumptions of almost complete absorption of solar wind by the lunar surface. The observation is relevant for other airless bodies in the solar system.

  16. Detect and exploit hidden structure in fatty acid signature data (United States)

    Budge, Suzanne; Bromaghin, Jeffrey; Thiemann, Gregory


    Estimates of predator diet composition are essential to our understanding of their ecology. Although several methods of estimating diet are practiced, methods based on biomarkers have become increasingly common. Quantitative fatty acid signature analysis (QFASA) is a popular method that continues to be refined and extended. Quantitative fatty acid signature analysis is based on differences in the signatures of prey types, often species, which are recognized and designated by investigators. Similarly, predator signatures may be structured by known factors such as sex or age class, and the season or region of sample collection. The recognized structure in signature data inherently influences QFASA results in important and typically beneficial ways. However, predator and prey signatures may contain additional, hidden structure that investigators either choose not to incorporate into an analysis or of which they are unaware, being caused by unknown ecological mechanisms. Hidden structure also influences QFASA results, most often negatively. We developed a new method to explore signature data for hidden structure, called divisive magnetic clustering (DIMAC). Our DIMAC approach is based on the same distance measure used in diet estimation, closely linking methods of data exploration and parameter estimation, and it does not require data transformation or distributional assumptions, as do many multivariate ordination methods in common use. We investigated the potential benefits of the DIMAC method to detect and subsequently exploit hidden structure in signature data using two prey signature libraries with quite different characteristics. We found that the existence of hidden structure in prey signatures can increase the confusion between prey types and thereby reduce the accuracy and precision of QFASA diet estimates. Conversely, the detection and exploitation of hidden structure represent a potential opportunity to improve predator diet estimates and may lead to new

  17. Nonintentional behavioural responses to psi : hidden targets and hidden observers


    Anderson, Mary-Jane Charlotte


    Psi is the phenomenon of apparently responding to or receiving information by means other than the recognised senses. Psi information may influence human behaviour, without the individual intending this or even being aware of it. This thesis seeks to investigate nonintentional behavioural responses to psi. We present five empirical studies that investigated nonintentional behavioural responses to psi information. In each study, the psi information was hidden from participants, ...

  18. Holocene environment changes around the Sara Us River, northern China, revealed by optical dating of lacustrine-aeolian sediments (United States)

    Zhao, Hui; Sheng, Yongwei; Li, Bo; Fan, Yuxin


    The Sara Us River is located along the boundary of the Mu Us Desert and the Chinese Loess Plateau in northern China. The river has cut down through Quaternary sediments creating 70-80 m deep valleys with thick lacustrine/aeolian sequences exposed. We applied optical stimulated luminescence on sediments from a Holocene section of aeolian sand/lacustrine deposits in the top of the river valley. The dating results show that a humid period existed from 7.1 to 2.0 ka ago as evidenced by two layers of peat and lacustrine sediments. However, compared to other published Holocene sections in the Sara Us River valleys close to the section under studying, the local environment experienced very complicated changes during the Holocene. All of the sections recorded a period with drought and/or cold before the Holocene at around 13 ka, and an episode of aridity after about 2 ka ago as evidenced by the layers of aeolian sand. However, the ages of the lacustrine and peat layers in these sections are substantially different. Geomorphological analysis by digital elevation models does not support the existence of a mega lake covering the study area at 2 ka. The intricate environmental changes may have been caused by the meandering of the Sara Us River. Environmental changes also strongly affected human migration in this area, which is documented by Chinese historical records.

  19. SARA: a self-adaptive and resource-aware approach towards secure wireless ad hoc and sensor networks (United States)

    Chigan, Chunxiao; Li, Leiyuan


    Providing security is essential for mission critical Wireless Ad Hoc and Sensor Networks (WAHSN) applications. Often a highly secure mechanism inevitably consumes a rather large amount of system resources, which in turn may unintentionally cause a Security Service Denial of Service (SSDoS) attack. This paper proposes a self-adaptive resource-aware (SARA) security provisioning approach for WAHSNs. For resource scarce WAHSNs, SARA strives to provide the optimal tradeoff between the sufficient security (which is reflected by the Security Index (SI)) and the acceptable network performance degradation (which is reflected by the Performance Index (PI)). With the support of the offline optimal secure protocol selection module and the online self-adaptive security control module, SARA is capable of employing different combinations of secure protocol sets to satisfy different security need at different condition for different applications. To determine the security index SI of a secure protocol set, a heuristic cross-layer security-service mapping mechanism is presented. Furthermore, we evaluate performance index PI of a secure protocol set via simulation followed by Analysis of Variance (ANOVA). Consequently, the proposed self-adaptive security provisioning based on both SI and PI achieves the maximum overall network security services and network performance services, without causing the SSDoS attack. Furthermore, this self-adaptive mechanism is capable of switching from one secure protocol set to another while keeping similar level of security and performance, it thus provides additional security by security service hopping.

  20. Saras Cranes in Palwal District in Southern Haryana are Asking for Immediate Attention for Their Last Rescue Effort

    Directory of Open Access Journals (Sweden)

    Tirshem Kumar Kaushik


    Full Text Available Saras Cranes Grus antigone are endangered birds of open wetlands with highly worrying depletion trends being witnessed related with disappearance of marshy and shallow perennial, expansive wetlands throughout northern India. Alongside, massive hunting in 18th, 19th and 20th centuries and even today is another serious cause for their worrisome deterioration. Also, destruction of nests, eggs, fledglings and adults by aboriginals indeliberately or deliberately is causing these cranes to perish sooner than latter, completely. Now, Saras Cranes are found in limited number and domain as four populations in the entire world including India, China, Burma, South East Asia and northern Australia. The population of Indian Saras Crane is pitiably restricted to Etawa and Mainpuri districts of Uttar Pradesh. Stray birds of this species are restricted to Kanha National Park in Madhya Pradesh and in some parts of Gujarat and Assam. It is interesting to note that few pairs have been seen in Faridabad and Palwal districts in southern Haryana, India. These need to be protected and conserved.

  1. Studying the Lunar-Solar Wind Interaction with the SARA Experiment aboard the Indian Lunar Mission Chandrayaan-1

    CERN Document Server

    Bhardwaj, Anil; Dhanya, M B; Wieser, Martin; Yoshifumi, Futaana; Holmstrom, Mats; Sridharan, R; Wurz, Peter; Schaufelberger, Audrey; Kazushi, Asamura; 10.1063/1.3395916


    The first Indian lunar mission Chandrayaan-1 was launched on 22 October 2008. The Sub-keV Atom Reflecting Analyzer (SARA) instrument onboard Chandrayaan-1 consists of an energetic neutral atom (ENA) imaging mass analyzer called CENA (Chandrayaan-1 Energetic Neutrals Analyzer), and an ion-mass analyzer called SWIM (Solar wind Monitor). CENA performed the first ever experiment to study the solar wind-planetary surface interaction via detection of sputtered neutral atoms and neutralized backscattered solar wind protons in the energy range ~0.01-3.0 keV. SWIM measures solar wind ions, magnetosheath and magnetotail ions, as well as ions scattered from lunar surface in the ~0.01-15 keV energy range. The neutral atom sensor uses conversion of the incoming neutrals to positive ions, which are then analyzed via surface interaction technique. The ion mass analyzer is based on similar principle. This paper presents the SARA instrument and the first results obtained by the SWIM and CENA sensors. SARA observations suggest...

  2. Hidden realities inside PBL design processes

    DEFF Research Database (Denmark)

    Pihl, Ole Verner


    Design Process, but is a group-based architecture and design education better than that which is individually based? How does PBL affect space, form, and creative processes? Hans Kiib, professor and one of the founders of the Department of Architecture and Design in Aalborg, describes his intentions...... within the group work, as it is closer related to the actual PBL process”. Is the Integrated Design Process (Knudstrup 2004) and is Colb (1975) still current and valid? Can we still use these methodologies when we must create “learning for an unknown future,” as Ronald Barnett (2004) claims that we...... investigates the creative processes of the collective and the individual and clarifies some of the hidden realities behind the PBL-based creative processes, both through an inquiry with the students and a more methodological and theoretical approach. The paper also explores how to integrate artistic...


    NARCIS (Netherlands)



    Populations, such as heroin and cocaine users, the homeless and the like (hidden populations), are among the most difficult populations to which to apply classic random sampling procedures. A frequently used data collection method for these hidden populations is the snowball procedure. The prerequis

  4. TRADE instructional materials for SARA/OSHA training. Volume 2, Managers and supervisors training

    Energy Technology Data Exchange (ETDEWEB)


    This document provides instructional materials for an eight-hour training course for managers and supervisors of hazardous waste sites. It is one of three volumes of course materials TRADE is preparing to help DOE contractor training staff comply with 29 CFR 1910.120, the Occupational Health and Safety Administration (OSHA) rule that implements Title I of the Superfund Amendments and Reauthorization Act (SARA) of 1986. OSHA`s final rule for hazardous waste operators was published in the Federal Register of March 6, 1989 (54 FR 9294). Combined with the materials in Volumes I and III and with appropriate site-specific information, these materials will help DOE contractors to meet the requirements of 1910.120 (e) that ``on-site management and supervisors directly responsible for, or who supervise employees engaged in, hazardous waste operations`` receive the same initial training as that of the employees they supervise and at least eight additional hours of specialized training in managing hazardous waste operations.

  5. La difesa della donna ebrea: Sara Copio Sullam e Debora Ascarelli

    Directory of Open Access Journals (Sweden)

    Umberto Fortis


    Full Text Available Sara Copio Sullam and Debora Ascarelli, the best-known Jewish women poets of the age of the Italian ghetto, have often been studied with a focus on the distinctive features of their writing: the former as a translator of sacred texts, the latter as the author of original verses, sometimes written as a risposta per le rime (reply through rhymes or in defence of her orthodoxy. They share, however, a common theme, which has often been neglected: the defence of the Jewish woman, which is overt in some of Copio’s sonnets and prose, whereas it has not yet been properly pointed out in some of Ascarelli’s verses. This paper aims at bringing this theme to the fore not only in Copio, through a rereading of some passages of her Manifesto, but also in Debora Ascarelli, through an analysis of her few original verses. These hendecasyllables certainly reflect the Petrarchan and classicistic atmosphere of the late 16th century in Rome, but they are far from the mainstream modes of women’s poetry of the age. They allow us, therefore, to highlight, besides the differences, the similarities between the two poetesses; their commitment, in the late 16th and early 17th century, to the intellectual and moral defence of the Jewish woman, in a context of general depreciation of women, but also in the background of the claim to the “nobility and excellence of women”.

  6. On quantum algorithms for noncommutative hidden subgroups

    Energy Technology Data Exchange (ETDEWEB)

    Ettinger, M. [Los Alamos National Lab., NM (United States); Hoeyer, P. [Odense Univ. (Denmark)


    Quantum algorithms for factoring and discrete logarithm have previously been generalized to finding hidden subgroups of finite Abelian groups. This paper explores the possibility of extending this general viewpoint to finding hidden subgroups of noncommutative groups. The authors present a quantum algorithm for the special case of dihedral groups which determines the hidden subgroup in a linear number of calls to the input function. They also explore the difficulties of developing an algorithm to process the data to explicitly calculate a generating set for the subgroup. A general framework for the noncommutative hidden subgroup problem is discussed and they indicate future research directions.

  7. Hidden Variable Theories and Quantum Nonlocality (United States)

    Boozer, A. D.


    We clarify the meaning of Bell's theorem and its implications for the construction of hidden variable theories by considering an example system consisting of two entangled spin-1/2 particles. Using this example, we present a simplified version of Bell's theorem and describe several hidden variable theories that agree with the predictions of…

  8. Estimating an Activity Driven Hidden Markov Model


    Meyer, David A.; Shakeel, Asif


    We define a Hidden Markov Model (HMM) in which each hidden state has time-dependent $\\textit{activity levels}$ that drive transitions and emissions, and show how to estimate its parameters. Our construction is motivated by the problem of inferring human mobility on sub-daily time scales from, for example, mobile phone records.

  9. Insight: Exploring Hidden Roles in Collaborative Play

    Directory of Open Access Journals (Sweden)

    Tricia Shi


    Full Text Available This paper looks into interaction modes between players in co-located, collaborative games. In particular, hidden traitor games, in which one or more players is secretly working against the group mission, has the effect of increasing paranoia and distrust between players, so this paper looks into the opposite of a hidden traitor – a hidden benefactor. Rather than sabotaging the group mission, the hidden benefactor would help the group achieve the end goal while still having a reason to stay hidden. The paper explores what games with such a role can look like and how the role changes player interactions. Finally, the paper addresses the divide between video game and board game interaction modes; hidden roles are not common within video games, but they are of growing prevalence in board games. This fact, combined with the exploration of hidden benefactors, reveals that hidden roles is a mechanic that video games should develop into in order to match board games’ complexity of player interaction modes.

  10. Identification and characterization of msa (SA1233), a gene involved in expression of SarA and several virulence factors in Staphylococcus aureus. (United States)

    Sambanthamoorthy, Karthik; Smeltzer, Mark S; Elasri, Mohamed O


    The staphylococcal accessory regulator (sarA) plays a central role in the regulation of virulence in Staphylococcus aureus. To date, studies involving sarA have focused on its activity as a global regulator that modulates transcription of a wide variety of genes (>100) and its role in virulence. However, there is also evidence to suggest the existence of accessory elements that modulate SarA production and/or function. A reporter system was developed to identify such elements, and a new gene, msa (SA1233), mutation of which results in reduced expression of SarA, was identified and characterized. Additionally, it was shown that mutation of msa resulted in altered transcription of the accessory gene regulator (agr) and the genes encoding several virulence factors including alpha toxin (hla) and protein A (spa). However, the impact of mutating msa was different in the laboratory strain RN6390 and the clinical isolate UAMS-1. For instance, mutation of msa caused a decrease in spa and hla transcription in RN6390 but had a different effect in UAMS-1. The strain-dependent effects of the msa mutation were similar to those observed previously, which suggests that msa may modulate the production of specific virulence factors through its impact on sarA. Interestingly, sequence analysis of Msa suggests that it is a putative membrane protein with three membrane-spanning regions, indicating that Msa might interact with the environment. The findings show that msa is involved in the expression of SarA and several virulence factors.

  11. Helioscope bounds on hidden sector photons

    Energy Technology Data Exchange (ETDEWEB)

    Redondo, J.


    The flux of hypothetical ''hidden photons'' from the Sun is computed under the assumption that they interact with normal matter only through kinetic mixing with the ordinary standard model photon. Requiring that the exotic luminosity is smaller than the standard photon luminosity provides limits for the mixing parameter down to {chi} hidden photon mass. Furthermore, it is pointed point out that helioscopes looking for solar axions are also sensitive to hidden photons. The recent results of the CAST collaboration are used to further constrain the mixing parameter {chi} at low masses (m{sub {gamma}}{sub '}<1 eV) where the luminosity bound is weaker. In this regime the solar hidden photon ux has a sizable contribution of longitudinally polarized hidden photons of low energy which are invisible for current helioscopes. (orig.)

  12. Heating up the Galaxy with hidden photons

    Energy Technology Data Exchange (ETDEWEB)

    Dubovsky, Sergei [Center for Cosmology and Particle Physics, Department of Physics, New York University,New York, NY, 10003 (United States); Hernández-Chifflet, Guzmán [Center for Cosmology and Particle Physics, Department of Physics, New York University,New York, NY, 10003 (United States); Instituto de Física, Facultad de Ingeniería, Universidad de la República,Montevideo, 11300 (Uruguay)


    We elaborate on the dynamics of ionized interstellar medium in the presence of hidden photon dark matter. Our main focus is the ultra-light regime, where the hidden photon mass is smaller than the plasma frequency in the Milky Way. We point out that as a result of the Galactic plasma shielding direct detection of ultra-light photons in this mass range is especially challenging. However, we demonstrate that ultra-light hidden photon dark matter provides a powerful heating source for the ionized interstellar medium. This results in a strong bound on the kinetic mixing between hidden and regular photons all the way down to the hidden photon masses of order 10{sup −20} eV.

  13. Helioscope bounds on hidden sector photons

    Energy Technology Data Exchange (ETDEWEB)

    Redondo, J.


    The flux of hypothetical ''hidden photons'' from the Sun is computed under the assumption that they interact with normal matter only through kinetic mixing with the ordinary standard model photon. Requiring that the exotic luminosity is smaller than the standard photon luminosity provides limits for the mixing parameter down to {chi} hidden photon mass. Furthermore, it is pointed point out that helioscopes looking for solar axions are also sensitive to hidden photons. The recent results of the CAST collaboration are used to further constrain the mixing parameter {chi} at low masses (m{sub {gamma}}{sub '}<1 eV) where the luminosity bound is weaker. In this regime the solar hidden photon ux has a sizable contribution of longitudinally polarized hidden photons of low energy which are invisible for current helioscopes. (orig.)

  14. Hidden Web信息获取

    Institute of Scientific and Technical Information of China (English)

    陈珂; 陈小英; 徐科


    如今Web上越来越多的信息可以通过查询接口获得,但为了获取某Hidden Web站点的页面,用户不得不键入一系列的关键词.由于没有直接指向Hidden Web页面的静态链接,当前大多搜索引擎不能发现和索引这些页面.然而,研究表明,由Hidden Web站点提供的高质量的信息对许多用户来说非常有价值.文章通过研究针对特定类型的表单,建立一个有效的Hidden Web爬虫,以便获取Hidden Web后台数据库信息.


    Ross, James C.; Díaz, Alejandro A.; Okajima, Yuka; Wassermann, Demian; Washko, George R.; Dy, Jennifer; San José Estépar, Raúl


    We present a novel airway labeling algorithm based on a Hidden Markov Tree Model (HMTM). We obtain a collection of discrete points along the segmented airway tree using particles sampling [1] and establish topology using Kruskal’s minimum spanning tree algorithm. Following this, our HMTM algorithm probabilistically assigns labels to each point. While alternative methods label airway branches out to the segmental level, we describe a general method and demonstrate its performance out to the subsubsegmental level (two generations further than previously published approaches). We present results on a collection of 25 computed tomography (CT) datasets taken from a Chronic Obstructive Pulmonary Disease (COPD) study. PMID:25436039

  16. Hidden scale invariance of metals

    DEFF Research Database (Denmark)

    Hummel, Felix; Kresse, Georg; Dyre, Jeppe C.


    available. Hidden scale invariance is demonstrated in detail for magnesium by showing invariance of structure and dynamics. Computed melting curves of period three metals follow curves with invariance (isomorphs). The experimental structure factor of magnesium is predicted by assuming scale invariant...... of metals making the condensed part of the thermodynamic phase diagram effectively one dimensional with respect to structure and dynamics. DFT computed density scaling exponents, related to the Grüneisen parameter, are in good agreement with experimental values for the 16 elements where reliable data were......Density functional theory (DFT) calculations of 58 liquid elements at their triple point show that most metals exhibit near proportionality between the thermal fluctuations of the virial and the potential energy in the isochoric ensemble. This demonstrates a general “hidden” scale invariance...

  17. Hidden scale in quantum mechanics

    CERN Document Server

    Giri, Pulak Ranjan


    We show that the intriguing localization of a free particle wave-packet is possible due to a hidden scale present in the system. Self-adjoint extensions (SAE) is responsible for introducing this scale in quantum mechanical models through the nontrivial boundary conditions. We discuss a couple of classically scale invariant free particle systems to illustrate the issue. In this context it has been shown that a free quantum particle moving on a full line may have localized wave-packet around the origin. As a generalization, it has also been shown that particles moving on a portion of a plane or on a portion of a three dimensional space can have unusual localized wave-packet.

  18. Hidden torsion, 3-manifolds, and homology cobordism

    CERN Document Server

    Cha, Jae Choon


    This paper continues our exploration of homology cobordism of 3-manifolds using our recent results on Cheeger-Gromov rho-invariants associated to amenable representations. We introduce a new type of torsion in 3-manifold groups we call hidden torsion, and an algebraic approximation we call local hidden torsion. We construct infinitely many hyperbolic 3-manifolds which have local hidden torsion in the transfinite lower central subgroup. By realizing Cheeger-Gromov invariants over amenable groups, we show that our hyperbolic 3-manifolds are not pairwise homology cobordant, yet remain indistinguishable by any prior known homology cobordism invariants.

  19. A survey of hidden-variables theories

    CERN Document Server

    Belinfante, F J


    A Survey of Hidden-Variables Theories is a three-part book on the hidden-variable theories, referred in this book as """"theories of the first kind"""". Part I reviews the motives in developing different types of hidden-variables theories. The quest for determinism led to theories of the first kind; the quest for theories that look like causal theories when applied to spatially separated systems that interacted in the past led to theories of the second kind. Parts II and III further describe the theories of the first kind and second kind, respectively. This book is written to make the literat

  20. Visible Effects of Invisible Hidden Valley Radiation

    CERN Document Server

    Carloni, Lisa


    Assuming there is a new gauge group in a Hidden Valley, and a new type of radiation, can we observe it through its effect on the kinematic distributions of recoiling visible particles? Specifically, what are the collider signatures of radiation in a hidden sector? We address these questions using a generic SU(N)-like Hidden Valley model that we implement in Pythia. We find that in both the e+e- and the LHC cases the kinematic distributions of the visible particles can be significantly affected by the valley radiation. Without a proper understanding of such effects, inferred masses of "communicators" and of invisible particles can be substantially off.

  1. Pushing and Pulling Sara: A Case Study of the Contrasting Influences of High School and University Experiences on Engineering Agency, Identity, and Participation (United States)

    Godwin, Allison; Potvin, Geoff


    This manuscript reports a longitudinal case study of how one woman, Sara, who had previously considered dropping out of high school, authored strong mathematics and science identities and purposefully exhibited agency through her experiences in high school science. These experiences empowered her to choose an engineering major in college; however,…

  2. Impact of individual extracellular proteases on Staphylococcus aureus biofilm formation in diverse clinical isolates and their isogenic sarA mutants. (United States)

    Loughran, Allister J; Atwood, Danielle N; Anthony, Allison C; Harik, Nada S; Spencer, Horace J; Beenken, Karen E; Smeltzer, Mark S


    We demonstrate that the purified Staphylococcus aureus extracellular proteases aureolysin, ScpA, SspA, and SspB limit biofilm formation, with aureolysin having the greatest impact. Using protease-deficient derivatives of LAC, we confirmed that this is due to the individual proteases themselves. Purified aureolysin, and to a lesser extent ScpA and SspB, also promoted dispersal of an established biofilm. Mutation of the genes encoding these proteases also only partially restored biofilm formation in an FPR3757 sarA mutant and had little impact on restoring virulence in a murine bacteremia model. In contrast, eliminating the production of all of these proteases fully restored both biofilm formation and virulence in a sarA mutant generated in the closely related USA300 strain LAC. These results confirm an important role for multiple extracellular proteases in S. aureus pathogenesis and the importance of sarA in repressing their production. Moreover, purified aureolysin limited biofilm formation in 14 of 15 methicillin-resistant isolates and 11 of 15 methicillin-susceptible isolates, while dispersin B had little impact in UAMS-1, LAC, or 29 of 30 contemporary isolates of S. aureus. This suggests that the role of sarA and its impact on protease production is important in diverse strains of S. aureus irrespective of their methicillin resistance status.

  3. Hidden systematics of fission channels

    Directory of Open Access Journals (Sweden)

    Schmidt Karl-Heinz


    of the fissioning system obey a hidden systematics that can be explained by the number of states in the vicinity of the outer fission barrier as a function of mass asymmetry, if the potential is constructed as the sum of the macroscopic contribution of the compound nucleus and empirically determined fragment shells. This hidden systematics also explains the transition from asymmetric to symmetric fission around 226Th and around 258Fm.

  4. Coding with partially hidden Markov models

    DEFF Research Database (Denmark)

    Forchhammer, Søren; Rissanen, J.


    Partially hidden Markov models (PHMM) are introduced. They are a variation of the hidden Markov models (HMM) combining the power of explicit conditioning on past observations and the power of using hidden states. (P)HMM may be combined with arithmetic coding for lossless data compression. A general...... 2-part coding scheme for given model order but unknown parameters based on PHMM is presented. A forward-backward reestimation of parameters with a redefined backward variable is given for these models and used for estimating the unknown parameters. Proof of convergence of this reestimation is given....... The PHMM structure and the conditions of the convergence proof allows for application of the PHMM to image coding. Relations between the PHMM and hidden Markov models (HMM) are treated. Results of coding bi-level images with the PHMM coding scheme is given. The results indicate that the PHMM can adapt...

  5. UV Photography Shows Hidden Sun Damage (United States)

    ... mcat1=de12", ]; for (var c = 0; c UV photography shows hidden sun damage A UV photograph gives ... developing skin cancer and prematurely aged skin. Normal photography UV photography 18 months of age: This boy's ...

  6. Faddeev-Jackiw approach to hidden symmetries

    CERN Document Server

    Wotzasek, C


    The study of hidden symmetries within Dirac's formalism does not possess a systematic procedure due to the lack of first-class constraints to act as symmetry generators. On the other hand, in the Faddeev-Jackiw approach, gauge and reparametrization symmetries are generated by the null eigenvectors of the sympletic matrix and not by constraints, suggesting the possibility of dealing systematically with hidden symmetries through this formalism. It is shown in this paper that indeed hidden symmetries of noninvariant or gauge fixed systems are equally well described by null eigenvectors of the sympletic matrix, just as the explicit invariances. The Faddeev-Jackiw approach therefore provide a systematic algorithm for treating all sorts of symmetries in an unified way. This technique is illustrated here by the SL(2,R) Kac-Moody current algebra of the 2-D induced gravity proposed by Polyakov, which is a hidden symmetry in the canonical approach of constrained systems via Dirac's method, after conformal and reparamet...

  7. Fibroid Tumors in Women: A Hidden Epidemic? (United States)

    ... Issue Past Issues Fibroid Tumors in Women: A Hidden Epidemic? Past Issues / Spring 2007 Table of Contents ... , or visit our Web site: . You may also write ...

  8. Hidden Regular Variation: Detection and Estimation

    CERN Document Server

    Mitra, Abhimanyu


    Hidden regular variation defines a subfamily of distributions satisfying multivariate regular variation on $\\mathbb{E} = [0, \\infty]^d \\backslash \\{(0,0, ..., 0) \\} $ and models another regular variation on the sub-cone $\\mathbb{E}^{(2)} = \\mathbb{E} \\backslash \\cup_{i=1}^d \\mathbb{L}_i$, where $\\mathbb{L}_i$ is the $i$-th axis. We extend the concept of hidden regular variation to sub-cones of $\\mathbb{E}^{(2)}$ as well. We suggest a procedure of detecting the presence of hidden regular variation, and if it exists, propose a method of estimating the limit measure exploiting its semi-parametric structure. We exhibit examples where hidden regular variation yields better estimates of probabilities of risk sets.

  9. Hidden figures are ever present. (United States)

    Mens, L H; Leeuwenberg, E L


    Preference judgments about alternative interpretations of unambiguous patterns can be explained in terms of a rivalry between a preferred and a second-best interpretation (cf. Leeuwenberg & Buffart, 1983). We tested whether this second-best interpretation corresponds to a suppressed but concurrently present interpretation or whether it merely reflects an alternative view that happens to be preferred less often. Two patterns were present immediately following each other with a very short onset asynchrony: a complete pattern and one out of three possible subpatterns of it, corresponding to the best, the second best, or an odd interpretation of the complete pattern. Subjects indicated which subpattern was presented by choosing among the three subpatterns shown after each trial. The scores, corrected for response-bias effects, indicated a relative facilitation of the second-best interpretation, in agreement with its predicted "hidden" presence. This result is more in line with theories that capitalize on the quality of the finally selected representation than with processing models aimed at reaching one single solution as fast and as economically as possible.

  10. Hidden Local Symmetry and Beyond

    CERN Document Server

    Yamawaki, Koichi


    Gerry Brown was a godfather of our hidden local symmetry (HLS) for the vector meson from the birth of the theory throughout his life. The HLS is originated from very nature of the nonlinear realization of the symmetry G based on the manifold G/H, and thus is universal to any physics based on the nonlinear realization. Here I focus on the Higgs Lagrangian of the Standard Model (SM), which is shown to be equivalent to the nonlinear sigma model based on G/H= SU(2)_L x SU(2)_R/SU(2)_V with additional symmetry, the nonlinearly realized scale symmetry. Then the SM does have a dynamical gauge boson of the SU(2)_V HLS, "SM rho meson", in addition to the Higgs as a pseudo dilaton as well as the NG bosons to be absorbed into the W and Z. Based on the recent work done with S. Matsuzaki and H. Ohki, I discuss a novel possibility that the SM rho meson acquires kinetic term by the SM dynamics itself, which then stabilizes the skyrmion dormant in the SM as a viable candidate for the dark matter, what we call "Dark SM skyrmi...

  11. Hidden local symmetry and beyond (United States)

    Yamawaki, Koichi

    Gerry Brown was a godfather of our hidden local symmetry (HLS) for the vector meson from the birth of the theory throughout his life. The HLS is originated from very nature of the nonlinear realization of the symmetry G based on the manifold G/H, and thus is universal to any physics based on the nonlinear realization. Here, I focus on the Higgs Lagrangian of the Standard Model (SM), which is shown to be equivalent to the nonlinear sigma model based on G/H = SU(2)L × SU(2)R/SU(2)V with additional symmetry, the nonlinearly-realized scale symmetry. Then, the SM does have a dynamical gauge boson of the SU(2)V HLS, "SM ρ meson", in addition to the Higgs as a pseudo-dilaton as well as the NG bosons to be absorbed in to the W and Z. Based on the recent work done with Matsuzaki and Ohki, I discuss a novel possibility that the SM ρ meson acquires kinetic term by the SM dynamics itself, which then stabilizes the skyrmion dormant in the SM as a viable candidate for the dark matter, what we call "dark SM skyrmion (DSMS)".

  12. Constraining solar hidden photons using HPGe detector

    Energy Technology Data Exchange (ETDEWEB)

    Horvat, R.; Kekez, D., E-mail:; Krčmar, M.; Krečak, Z.; Ljubičić, A.


    In this Letter we report on the results of our search for photons from a U(1) gauge factor in the hidden sector of the full theory. With our experimental setup we observe the single spectrum in a HPGe detector arising as a result of the photoelectric-like absorption of hidden photons emitted from the Sun on germanium atoms inside the detector. The main ingredient of the theory used in our analysis, a severely constrained kinetic mixing from the two U(1) gauge factors and massive hidden photons, entails both photon into hidden state oscillations and a minuscule coupling of hidden photons to visible matter, of which the latter our experimental setup has been designed to observe. On a theoretical side, full account was taken of the effects of refraction and damping of photons while propagating in Sun's interior as well as in the detector. We exclude hidden photons with kinetic couplings χ>(2.2×10{sup −13}–3×10{sup −7}) in the mass region 0.2 eV≲m{sub γ{sup ′}}≲30 keV. Our constraints on the mixing parameter χ in the mass region from 20 eV up to 15 keV prove even slightly better then those obtained recently by using data from the CAST experiment, albeit still somewhat weaker than those obtained from solar and HB stars lifetime arguments.

  13. Jim Shaw's The Hidden World as a Book of Poetry

    DEFF Research Database (Denmark)

    Sørensen, Bent

    documents, ’found’ in pulp publications, in thrift stores, on billboards, and on the Internet. These documents are mostly word-image hybrids, and their original functions may have been as commercials or advertisements, religious propaganda, doomsday prophecies, or other forms of naïve “didactic art...... a book of poetry. Drawing on genre theory, as well as recent work by, among others, Martin Glaz Serup and Thomas Hvid Kromann, I propose to read The Hidden World against its own grain, as it were, as a collection of conceptual poetry, participating in the discourses of belief and testimony....

  14. Exhibiting eugenics: response and resistance to a hidden history. (United States)

    Brave, Ralph; Sylva, Kathryn


    Human Plants, Human Harvest: The Hidden History of California Eugenics is the first-ever exhibition on the history of eugenics in California. The disappearance of this history for half a century, and the consequent absence of a "collective menory", were the primary factors determining the exhibit's sttrcture and content. Responses to the exhibit confirmed that most visitors "never knew" about this history. The exhibit is described in some detail, with selected imagery from the exhibit reproduced. After the initial exhibition, responses of other museums and foundation officials revealed a continuing resistance to this history being publicly displayed, though the sources of resistance varied.

  15. Memoria de la guerra civil española. Entre el sol y la tormenta de Sara Berenguer

    Directory of Open Access Journals (Sweden)

    Helena López


    Full Text Available En este artículo pretendo analizar dos cuestiones en relación con las memorias de guerra de la militante anarquista Sara Berenguer. En primer lugar, quiero atender a las estrategias discursivas (clase, género, sexualidad de construcción de la subjetividad en este texto. Además, me interesa indagar cómo estos discursos se interseccionan con la posición espacio-temporal (tiempo de la memoria y tiempo-espacio del exilio del sujeto autobiográfico. Mi objetivo principal es proponer una problematización de los conceptos de “memoria colectiva” y de “experiencia femenina” y reivindicar, por lo tanto, la relevancia tanto teórica como política de análisis críticos basados en narrativas personales.

  16. Probing hidden sector photons through the Higgs window

    Energy Technology Data Exchange (ETDEWEB)

    Ahlers, M. [Oxford Univ. (United Kingdom). Rudolf Peierls Centre for Theoretical Physics; Jaeckel, J. [Durham Univ. (United Kingdom). Inst. for Particle Physics and Phenomenology; Redondo, J.; Ringwald, A. [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)


    We investigate the possibility that a (light) hidden sector extra photon receives its mass via spontaneous symmetry breaking of a hidden sector Higgs boson, the so-called hidden-Higgs. The hidden-photon can mix with the ordinary photon via a gauge kinetic mixing term. The hidden-Higgs can couple to the Standard Model Higgs via a renormalizable quartic term - sometimes called the Higgs Portal. We discuss the implications of this light hidden-Higgs in the context of laser polarization and light-shining-through-the-wall experiments as well as cosmological, astrophysical, and non-Newtonian force measurements. For hidden-photons receiving their mass from a hidden-Higgs we find in the small mass regime significantly stronger bounds than the bounds on massive hidden sector photons alone. (orig.)

  17. Disease surveillance using a hidden Markov model

    Directory of Open Access Journals (Sweden)

    Wright Graeme


    Full Text Available Abstract Background Routine surveillance of disease notification data can enable the early detection of localised disease outbreaks. Although hidden Markov models (HMMs have been recognised as an appropriate method to model disease surveillance data, they have been rarely applied in public health practice. We aimed to develop and evaluate a simple flexible HMM for disease surveillance which is suitable for use with sparse small area count data and requires little baseline data. Methods A Bayesian HMM was designed to monitor routinely collected notifiable disease data that are aggregated by residential postcode. Semi-synthetic data were used to evaluate the algorithm and compare outbreak detection performance with the established Early Aberration Reporting System (EARS algorithms and a negative binomial cusum. Results Algorithm performance varied according to the desired false alarm rate for surveillance. At false alarm rates around 0.05, the cusum-based algorithms provided the best overall outbreak detection performance, having similar sensitivity to the HMMs and a shorter average time to detection. At false alarm rates around 0.01, the HMM algorithms provided the best overall outbreak detection performance, having higher sensitivity than the cusum-based Methods and a generally shorter time to detection for larger outbreaks. Overall, the 14-day HMM had a significantly greater area under the receiver operator characteristic curve than the EARS C3 and 7-day negative binomial cusum algorithms. Conclusion Our findings suggest that the HMM provides an effective method for the surveillance of sparse small area notifiable disease data at low false alarm rates. Further investigations are required to evaluation algorithm performance across other diseases and surveillance contexts.

  18. Now That We've Found the "Hidden Web," What Can We Do with It? (United States)

    Cole, Timothy W.; Kaczmarek, Joanne; Marty, Paul F.; Prom, Christopher J.; Sandore, Beth; Shreeves, Sarah

    The Open Archives Initiative (OAI) Protocol for Metadata Harvesting (PMH) is designed to facilitate discovery of the "hidden web" of scholarly information, such as that contained in databases, finding aids, and XML documents. OAI-PMH supports standardized exchange of metadata describing items in disparate collections, of such as those…

  19. Lepton mixing from the hidden sector

    CERN Document Server

    Ludl, P O


    Experimental results indicate a possible relation between the lepton and quark mixing matrices of the form U_PMNS \\approx V_CKM^\\dagger U_X, where U_X is a matrix with special structure related to the mechanism of neutrino mass generation. We propose a framework which can realize such a relation. The main ingredients of the framework are the double seesaw mechanism, SO(10) Grand Unification and a hidden sector of theory. The latter is composed of singlets (fermions and bosons) of the GUT symmetry with masses between the GUT and Planck scale. The interactions in this sector obey certain symmetries G_hidden. We explore the conditions under which symmetries G_hidden can produce flavour structures in the visible sector. Here the key elements are the basis-fixing symmetry and mediators which communicate information about properties of the hidden sector to the visible one. The interplay of SO(10) symmetry, basis-fixing symmetry identified as Z2 x Z2 and G_hidden can lead to the required form of U_X. A different kin...

  20. Fitting Hidden Markov Models to Psychological Data

    Directory of Open Access Journals (Sweden)

    Ingmar Visser


    Full Text Available Markov models have been used extensively in psychology of learning. Applications of hidden Markov models are rare however. This is partially due to the fact that comprehensive statistics for model selection and model assessment are lacking in the psychological literature. We present model selection and model assessment statistics that are particularly useful in applying hidden Markov models in psychology. These statistics are presented and evaluated by simulation studies for a toy example. We compare AIC, BIC and related criteria and introduce a prediction error measure for assessing goodness-of-fit. In a simulation study, two methods of fitting equality constraints are compared. In two illustrative examples with experimental data we apply selection criteria, fit models with constraints and assess goodness-of-fit. First, data from a concept identification task is analyzed. Hidden Markov models provide a flexible approach to analyzing such data when compared to other modeling methods. Second, a novel application of hidden Markov models in implicit learning is presented. Hidden Markov models are used in this context to quantify knowledge that subjects express in an implicit learning task. This method of analyzing implicit learning data provides a comprehensive approach for addressing important theoretical issues in the field.

  1. Probing Hidden Sector Photons through the Higgs Window.


    Ahlers, M.; Jaeckel, J; Redondo, J.; Ringwald, A.


    We investigate the possibility that a (light) hidden sector extra photon receives its mass via spontaneous symmetry breaking of a hidden sector Higgs boson, the so-called hidden-Higgs. The hidden-photon can mix with the ordinary photon via a gauge kinetic mixing term. The hidden-Higgs can couple to the Standard Model Higgs via a renormalizable quartic term - sometimes called the Higgs Portal. We discuss the implications of this light hidden-Higgs in the context of laser polarization and light...

  2. Comparative Study of Hidden Node Problem and Solution Using Different Techniques and Protocols

    CERN Document Server

    Kapadia, Viral V; Jhaveri, Rutvij H


    Hidden nodes in a wireless network refer to nodes that are out of range of other nodes or a collection of nodes. We will discuss a few problems introduced by the RTS/CTS mechanism of collision avoidance and focus on the virtual jamming problem, which allows a malicious node to effectively jam a large fragment of a wireless network at minimum expense of power. We have also discussed WiCCP (Wireless Central Coordinated Protocol) which is a protocol booster that also provides good solution to hidden nodes.

  3. A Search for Hidden Photon CDM in a Multi-Cathode Counter (MCC) data

    CERN Document Server

    Kopylov, A; Petukhov, V


    A search for hidden photon cold dark matter in a mass range from 5 to 500 eV in data collected during 60 days in November and December, 2015 by a Multi-Cathode Counter (MCC) is reported. From the analyses of this data we found no evidence for the existence of HP CDM and set an upper limit on the photon-HP mixing parameter $\\chi$. This is the first result obtained by direct measurements in this mass range for hidden photon CDM using a single electron event in MCC as a signature.

  4. Supersymmetric leptogenesis and light hidden sectors

    CERN Document Server

    Weniger, Christoph


    Thermal leptogenesis and supergravity are attractive scenarios for physics beyond the standard model. However, it is well known that the super-weak interaction of the gravitino often leads to problems with primordial nucleosynthesis in the standard scenario of matter parity conserving MSSM + three right-handed neutrinos. We will present and compare two related solutions to these problems: 1) The conflict between BBN and leptogenesis can be avoided in presence of a hidden sector with light supersymmetric particles which open new decay channels for the dangerous long-lived particles. 2) If there is a condensate in the hidden sector, such additional decay channels can be alternatively opened by dynamical breaking of matter parity in the hidden sector.

  5. Hidden Markov models estimation and control

    CERN Document Server

    Elliott, Robert J; Moore, John B


    As more applications are found, interest in Hidden Markov Models continues to grow. Following comments and feedback from colleagues, students and other working with Hidden Markov Models the corrected 3rd printing of this volume contains clarifications, improvements and some new material, including results on smoothing for linear Gaussian dynamics. In Chapter 2 the derivation of the basic filters related to the Markov chain are each presented explicitly, rather than as special cases of one general filter. Furthermore, equations for smoothed estimates are given. The dynamics for the Kalman filte

  6. Hidden simplicity of gauge theory amplitudes

    Energy Technology Data Exchange (ETDEWEB)

    Drummond, J M, E-mail: drummond@lapp.in2p3.f [LAPTH, Universite de Savoie, CNRS, B.P. 110, F-74941 Annecy-le-Vieux, Cedex (France)


    These notes were given as lectures at the CERN Winter School on Supergravity, Strings and Gauge Theory 2010. We describe the structure of scattering amplitudes in gauge theories, focussing on the maximally supersymmetric theory to highlight the hidden symmetries which appear. Using the Britto, Cachzo, Feng and Witten (BCFW) recursion relations we solve the tree-level S-matrix in N=4 super Yang-Mills theory and describe how it produces a sum of invariants of a large symmetry algebra. We review amplitudes in the planar theory beyond tree level, describing the connection between amplitudes and Wilson loops, and discuss the implications of the hidden symmetries.

  7. Hidden simplicity of gauge theory amplitudes (United States)

    Drummond, J. M.


    These notes were given as lectures at the CERN Winter School on Supergravity, Strings and Gauge Theory 2010. We describe the structure of scattering amplitudes in gauge theories, focussing on the maximally supersymmetric theory to highlight the hidden symmetries which appear. Using the Britto, Cachzo, Feng and Witten (BCFW) recursion relations we solve the tree-level S-matrix in \\ {N}=4 super Yang-Mills theory and describe how it produces a sum of invariants of a large symmetry algebra. We review amplitudes in the planar theory beyond tree level, describing the connection between amplitudes and Wilson loops, and discuss the implications of the hidden symmetries.

  8. Hidden neural networks: application to speech recognition

    DEFF Research Database (Denmark)

    Riis, Søren Kamaric


    We evaluate the hidden neural network HMM/NN hybrid on two speech recognition benchmark tasks; (1) task independent isolated word recognition on the Phonebook database, and (2) recognition of broad phoneme classes in continuous speech from the TIMIT database. It is shown how hidden neural networks...... (HNNs) with much fewer parameters than conventional HMMs and other hybrids can obtain comparable performance, and for the broad class task it is illustrated how the HNN can be applied as a purely transition based system, where acoustic context dependent transition probabilities are estimated by neural...

  9. Dark Radiation from a hidden U(1)

    CERN Document Server

    Vogel, Hendrik


    We discuss the impact of a hidden sector consisting of Minicharged Particles (MCPs) and massless hidden photons on the expansion history of our Universe. We present parameter scans for the amount of extra relativistic particles (Neff) and the abundance of light nuclei for fermionic MCPs with masses between ~100 keV and 10 GeV and minicharges in the range 10^(-11)-1. Current CMB and BBN data significantly constrain the available parameter space of MCPs. The shown results are a valuable indicator for future experimental searches and are presented in a flexible way so that more accurate results on Neff can be easily interpreted.

  10. Hidden Symmetries, Central Charges and All That

    CERN Document Server

    de Wit, Bernard; Wit, Bernard de; Nicolai, Hermann


    In this review we discuss hidden symmetries of toroidal compactifications of eleven-dimensional supergravity. We recall alternative versions of this theory which exhibit traces of the hidden symmetries when still retaining the massive Kaluza-Klein states. We reconsider them in the broader perspective of M-theory which incorporates a more extended variety of BPS states. We also argue for a new geometry that may underly these theories. All our arguments point towards an extension of the number of space-time coordinates beyond eleven.

  11. Hidden Subgroup States are Almost Orthogonal

    CERN Document Server

    Ettinger, M; Knill, E H; Ettinger, Mark; Hoyer, Peter; Knill, Emanuel


    It is well known that quantum computers can efficiently find a hidden subgroup $H$ of a finite Abelian group $G$. This implies that after only a polynomial (in $\\log |G|$) number of calls to the oracle function, the states corresponding to different candidate subgroups have exponentially small inner product. We show that this is true for noncommutative groups also. We present a quantum algorithm which identifies a hidden subgroup of an arbitrary finite group $G$ in only a linear (in $\\log |G|$) number of calls to the oracle function. This is exponentially better than the best classical algorithm. However our quantum algorithm requires an exponential amount of time, as in the classical case.

  12. Searching for hidden sectors in multiparticle production at the LHC

    CERN Document Server

    Sanchis-Lozano, Miguel-Angel; Moreno-Picot, Salvador


    We study the impact of a hidden sector beyond the Standard Model, e.g. a Hidden Valley model, on factorial moments and cumulants of multiplicity distributions in multiparticle production with a special emphasis on the prospects for LHC results.

  13. Entropy Rate for Hidden Markov Chains with rare transitions



    We consider Hidden Markov Chains obtained by passing a Markov Chain with rare transitions through a noisy memoryless channel. We obtain asymptotic estimates for the entropy of the resulting Hidden Markov Chain as the transition rate is reduced to zero.

  14. The Corporate Illiterates: The Hidden Illiterates of Silicon Valley. (United States)

    Chase, Sharon


    Describes the writing and business communication problems of college-educated workers in Silicon Valley. Discusses hidden illiterates in the universities and in the workplace. Offers solutions for professors and managers faced with the problem of hidden illiterates. (PRA)

  15. sarA negatively regulates Staphylococcus epidermidis biofilm formation by modulating expression of 1 MDa extracellular matrix binding protein and autolysis‐dependent release of eDNA

    DEFF Research Database (Denmark)

    Christner, Martin; Heinze, Constanze; Busch, Michael;


    Biofilm formation is essential for Staphylococcus epidermidis pathogenicity in implant‐associated infections. Nonetheless, large proportions of invasive Staphylococcus epidermidis isolates fail to form a biofilm in vitro. We here tested the hypothesis that this apparent paradox is related...... virulence. Genetic analysis revealed that inactivation of sarA induced biofilm formation via overexpression of the giant 1 MDa extracellular matrix binding protein (Embp), serving as an intercellular adhesin. In addition to Embp, increased extracellular DNA (eDNA) release significantly contributed...

  16. Beaudrie, Sara, Ducar, Cynthia, & Potowski, Kim (2014). Heritage language teaching: Research and practice. New York State, New York: McGraw Hill.


    Florencia Henshaw


    This review introduces readers to Heritage language teaching: Research and practice, by Sara Beaudrie, Cynthia Ducar, and Kim Potowski, which is part of the “Directions in Second Language Learning” series. This handbook offers a comprehensive overview of key concepts, research findings, and pedagogical strategies to better meet the needs of heritage learners, and it underscores the importance of sociolinguistic issues and phenomena in heritage language instruction.

  17. Beaudrie, Sara, Ducar, Cynthia, & Potowski, Kim (2014. Heritage language teaching: Research and practice. New York State, New York: McGraw Hill.

    Directory of Open Access Journals (Sweden)

    Florencia Henshaw


    Full Text Available This review introduces readers to Heritage language teaching: Research and practice, by Sara Beaudrie, Cynthia Ducar, and Kim Potowski, which is part of the “Directions in Second Language Learning” series. This handbook offers a comprehensive overview of key concepts, research findings, and pedagogical strategies to better meet the needs of heritage learners, and it underscores the importance of sociolinguistic issues and phenomena in heritage language instruction.

  18. Design and Implementation of Domain based Semantic Hidden Web Crawler


    Manvi; Bhatia, Komal Kumar; Dixit, Ashutosh


    Web is a wide term which mainly consists of surface web and hidden web. One can easily access the surface web using traditional web crawlers, but they are not able to crawl the hidden portion of the web. These traditional crawlers retrieve contents from web pages, which are linked by hyperlinks ignoring the information hidden behind form pages, which cannot be extracted using simple hyperlink structure. Thus, they ignore large amount of data hidden behind search forms. This paper emphasizes o...

  19. Women Empowerment in the Realms of Institutionalized Religion and Patriarchy: El Saadawi’s Firdaus and Yezierska’s Sara as Examples

    Directory of Open Access Journals (Sweden)

    Abdullah K. Shehabat


    Full Text Available This paper explains how the two protagonists, Firdaus and Sara, successfully paved their own ways in search of self-liberation despite the authoritarian patriarchy and institutionalized religions that plagued them. El Saadawi's Woman at Point Zero and Yezierska’s Bread Givers represent the fruitful struggle these protagonists experienced as they come to forge an identity and be themselves. The paper argues that the protagonists manage to free themselves, establish their own spiritual homes at their own homes and assert the potentials of their femininity despite their endings. Empowered by the powers of reading, strong will and meticulous work, the protagonists were able to realize their own material independence and achieve their lifelong ambitions. However, through Firdaus' and Sara's journeys of breaking their silence, they were subject to different patterns of self-annihilation. While Firdaus was sentenced to death for killing a pimp, Sara embraced living under the hegemony of an authoritarian husband.      Keywords: Women empowerment, authoritarian patriarchy, institutionalized and/or gendered religion, spiritual feminist homes


    Directory of Open Access Journals (Sweden)

    Djoni Haryadi Setiabudi


    Full Text Available Hidden surface removal is an algorithm used to hide part of the object which is blocked by the object in front of it. If there are two plane crossed each other displayed without Hidden surface removal algorithm, the crossing section is invisible, because one object will block another object without crossing. The crossing sections can be displayed using Hidden surface removal algorithm. Z buffer algorithm implements Hidden Surface Removal by entering color and depth of the visible plane into the buffer, then displays the result on the screen. Scan Line algorithm will scanning the screen row by row of each object surface in three dimension and then displays on the screen after each row scanning. Both of the algorithms will be compared based on the memory usage dan time needed to execute. The experiment shows that Scanline algorithm uses less memory compared with Z-Buffer algoritm. Furthermore, based on the speed, the Scanline is better than the Z-Buffer if the object is collected on the y row, but the Z-Buffer is better than the Scanline if the object scattered and used all rows on the drawing plane and has more surface do displayed. Abstract in Bahasa Indonesia : Hidden surface removal adalah suatu algoritma yang digunakan untuk menghilangkan penampilan bagian yang tertutup oleh objek yang didepannya. Apabila ada dua bidang yang berpotongan, apabila ditampilkan biasa tanpa menggunakan algoritma Hidden surface removal maka bagian yang berpotongan itu akan tidak kelihatan, oleh karena bidang yang satu ditutupi oleh bagian yang lain tanpa memotong. Oleh karena itu untuk menampilkan bidang perpotongan, diperlukan Algoritma Hidden surface removal. Algoritma Z buffer melaksanakan proses Hidden Surface Removal dengan memasukkan warna dan kedalaman bidang permukaan yang tampak ke dalam buffer, dan kemudian setelah selesai hasilnya ditampilkan ke layar. Algoritma Scan Line melakukan scanning untuk setiap baris dari layar bidang gambar untuk setiap

  1. Variational Hidden Conditional Random Fields with Coupled Dirichlet Process Mixtures

    NARCIS (Netherlands)

    Bousmalis, K.; Zafeiriou, S.; Morency, L.P.; Pantic, Maja; Ghahramani, Z.


    Hidden Conditional Random Fields (HCRFs) are discriminative latent variable models which have been shown to successfully learn the hidden structure of a given classification problem. An infinite HCRF is an HCRF with a countably infinite number of hidden states, which rids us not only of the necessit

  2. Perceptual consequences of "hidden" hearing loss. (United States)

    Plack, Christopher J; Barker, Daphne; Prendergast, Garreth


    Dramatic results from recent animal experiments show that noise exposure can cause a selective loss of high-threshold auditory nerve fibers without affecting absolute sensitivity permanently. This cochlear neuropathy has been described as hidden hearing loss, as it is not thought to be detectable using standard measures of audiometric threshold. It is possible that hidden hearing loss is a common condition in humans and may underlie some of the perceptual deficits experienced by people with clinically normal hearing. There is some evidence that a history of noise exposure is associated with difficulties in speech discrimination and temporal processing, even in the absence of any audiometric loss. There is also evidence that the tinnitus experienced by listeners with clinically normal hearing is associated with cochlear neuropathy, as measured using Wave I of the auditory brainstem response. To date, however, there has been no direct link made between noise exposure, cochlear neuropathy, and perceptual difficulties. Animal experiments also reveal that the aging process itself, in the absence of significant noise exposure, is associated with loss of auditory nerve fibers. Evidence from human temporal bone studies and auditory brainstem response measures suggests that this form of hidden loss is common in humans and may have perceptual consequences, in particular, regarding the coding of the temporal aspects of sounds. Hidden hearing loss is potentially a major health issue, and investigations are ongoing to identify the causes and consequences of this troubling condition.

  3. The structural strength of glass: hidden damage

    NARCIS (Netherlands)

    Veer, F.A.; Rodichev, Y.M.


    We discuss “hidden damage” of glass by the rolling process, which results in heterogeneous distribution of microcracks on the edge surface of glass element, which are the fracture source deteriorating glass element strength. It is shown that removal of this damage on the edges of glass elements

  4. Discovering Hidden Treasures with GPS Technology (United States)

    Nagel, Paul; Palmer, Roger


    "I found it!" Addison proudly proclaimed, as she used an iPhone and Global Positioning System (GPS) software to find the hidden geocache along the riverbank. Others in Lisa Bostick's fourth grade class were jealous, but there would be other geocaches to find. With the excitement of movies like "Pirates of the Caribbean" and…

  5. Hidden Markov Models for Human Genes

    DEFF Research Database (Denmark)

    Baldi, Pierre; Brunak, Søren; Chauvin, Yves


    We analyse the sequential structure of human genomic DNA by hidden Markov models. We apply models of widely different design: conventional left-right constructs and models with a built-in periodic architecture. The models are trained on segments of DNA sequences extracted such that they cover...

  6. Dermatologic hazards from hidden contacts with penicillin

    Energy Technology Data Exchange (ETDEWEB)

    Boonk, W.J.


    The unbridled use of penicillin after its discovery by Fleming has resulted in possible hazards to human health due to traces of the drug being present in food and other hidden sources. These hazards may include toxic effects, hypersensitivity reactions and possibly a raising of the frequency and duration of allergy to penicillin.

  7. The structural strength of glass: hidden damage

    NARCIS (Netherlands)

    Veer, F.A.; Rodichev, Y.M.


    We discuss “hidden damage” of glass by the rolling process, which results in heterogeneous distribution of microcracks on the edge surface of glass element, which are the fracture source deteriorating glass element strength. It is shown that removal of this damage on the edges of glass elements incr

  8. Computerized Testing: The Hidden Figures Test. (United States)

    Jacobs, Ronald L.; And Others


    This study adapted the Hidden Figures Test for use on PLATO and determined the reliability of the computerized version compared to the paper and pencil version. Results indicate the test was successfully adapted with some modifications, and it was judged reliable although it may be measuring additional constructs. (MBR)

  9. Towards gauge unified, supersymmetric hidden strong dynamics

    CERN Document Server

    Chiang, Cheng-Wei; Ye, Fang


    We consider a class of models with extra complex scalars that are charged under both the Standard Model and a hidden strongly coupled $SU(N)_H$ gauge sector, and discuss the scenarios where the new scalars are identified as the messenger fields that mediate the spontaneously broken supersymmetries from the hidden sector to the visible sector. The new scalars are embedded into 5-plets and 10-plets of an $SU(5)_V$ gauge group that potentially unifies the Standard Model gauge groups. They also form a tower of bound states via hidden strong dynamics around the TeV scale. The Higgs bosons remain as elementary particles. Quadratically divergent contributions to the Higgs mass from the Standard Model fermions are canceled by the new scalar contributions to alleviate the fine-tuning problem. We also discuss a supersymmetrized version of this class of models, consisting of the minimal supersymmetric Standard Model plus extra chiral multiplets where the new scalars reside. Due to the hidden strong force, the new low-en...

  10. Hidden Costs and Challenges of Servitization

    DEFF Research Database (Denmark)

    Yang, Yifan; Slepniov, Dmitrij

    of these labels, the potential benefits of servitization are often overshadowed by costs associated with it. By using the cases of Chinese and Danish manufacturing firms, this study takes a closer look at possible hidden costs of servitization and contributes to our understanding of servitization performance...

  11. Quantum Discord, CHSH Inequality and Hidden Variables -- Critical reassessment of hidden-variables models

    CERN Document Server

    Fujikawa, Kazuo


    Hidden-variables models are critically reassessed. It is first examined if the quantum discord is classically described by the hidden-variable model of Bell in the Hilbert space with $d=2$. The criterion of vanishing quantum discord is related to the notion of reduction and, surprisingly, the hidden-variable model in $d=2$, which has been believed to be consistent so far, is in fact inconsistent and excluded by the analysis of conditional measurement and reduction. The description of the full contents of quantum discord by the deterministic hidden-variables models is not possible. We also re-examine CHSH inequality. It is shown that the well-known prediction of CHSH inequality $|B|\\leq 2$ for the CHSH operator $B$ introduced by Cirel'son is not unique. This non-uniqueness arises from the failure of linearity condition in the non-contextual hidden-variables model in $d=4$ used by Bell and CHSH, in agreement with Gleason's theorem which excludes $d=4$ non-contextual hidden-variables models. If one imposes the l...

  12. Alle soglie dell'osceno. Poetiche della profanazione in Sara de Ibáñez e Alejandra Pizarnik

    Directory of Open Access Journals (Sweden)

    Luca Salvi


    Full Text Available Moving from Adorno’s statement about the enigmatic nature of modern aesthetics, this paper aims to analyse the forms the enigma takes in the works of the Uruguayan and Argentinian poets Sara de Ibáñez and Alejandra Pizarnik. The essay will consider the figures and the shapes of the enigma as they appear in both poetries. Proper of the revelation of the enigma through its profanation by the poetic language is, in fact, the never-ending and mutual reflection of two different states of the being. Through Martin Heidegger and Giorgio Agamben’s studies on language and negativity, the way in which the enigmatic word appears continuously in its constitutive suspension between infancy and adulthood, absence of time and history, language and silence, the Self and the Other will be revealed. Through the resulting dichotomy of matter and form, emerging from a passage of Agostino’s De natura boni, it will be possible, in conclusion, to recognise in the silent form of the enigma the embryonic proposal of a poetical ethics of writing.

  13. Discussion of the classification concept and definition of the hidden accident%事故隐患分级概念与定义商榷

    Institute of Scientific and Technical Information of China (English)

    史宗保; 史聪聪; 冯文刚; 张椿婷


    针对安全隐患与事故隐患概念的理解各不同的问题,对安全隐患和事故隐患进行了准确定义。认为在实际的安全生产和安全监管工作中,为实现安全关口前移,实现早防早治,把事故隐患和安全隐患统称为安全隐患是比较合适的。对安全隐患分级提出了更为合理的分级标准。%Aiming at the problem that the concept of the hidden danger and the hidden acci-dent was differently understood,this paper accurately defined the hidden danger and the hidden accident.It was appropriate that the hidden accident and hidden danger were collectively referred to as the hidden danger to achieve safety gate moved forward as well as early prevention and treatment at the work of the actual safety production and safety supervision.The more reasonable classification standard of the hidden danger was proposed.

  14. Employing Second-Order Circular Suprasegmental Hidden Markov Models to Enhance Speaker Identification Performance in Shouted Talking Environments

    Directory of Open Access Journals (Sweden)

    Ismail Shahin


    Full Text Available Speaker identification performance is almost perfect in neutral talking environments. However, the performance is deteriorated significantly in shouted talking environments. This work is devoted to proposing, implementing, and evaluating new models called Second-Order Circular Suprasegmental Hidden Markov Models (CSPHMM2s to alleviate the deteriorated performance in the shouted talking environments. These proposed models possess the characteristics of both Circular Suprasegmental Hidden Markov Models (CSPHMMs and Second-Order Suprasegmental Hidden Markov Models (SPHMM2s. The results of this work show that CSPHMM2s outperform each of First-Order Left-to-Right Suprasegmental Hidden Markov Models (LTRSPHMM1s, Second-Order Left-to-Right Suprasegmental Hidden Markov Models (LTRSPHMM2s, and First-Order Circular Suprasegmental Hidden Markov Models (CSPHMM1s in the shouted talking environments. In such talking environments and using our collected speech database, average speaker identification performance based on LTRSPHMM1s, LTRSPHMM2s, CSPHMM1s, and CSPHMM2s is 74.6%, 78.4%, 78.7%, and 83.4%, respectively. Speaker identification performance obtained based on CSPHMM2s is close to that obtained based on subjective assessment by human listeners.

  15. Hidden penis release: adjunctive suprapubic lipectomy. (United States)

    Horton, C E; Vorstman, B; Teasley, D; Winslow, B


    We believe the hidden penis may be caused and concealed by a prominent suprapubic fat pad in addition to the restrictive fibrous bands of the dartos fascia fixing the shaft of the penis proximally while loose skin folds prolapse distally over the phallus. A penis of inadequate length or appearance may affect body image. Patients with this problem often require psychological support. Hidden penis may be distinguished from micropenis by palpating adequate corpora and showing a stretched penile length within 2 SD of normal. Excision of suprapubic fat with sectioning of the tethering dartos bands will release and increase the length of the penis. Suprapubic fat pad resection may also be helpful to elongate a short penis in cases of adult microphallus, or after partial penectomy because of trauma or cancer. Circumcision is contraindicated.

  16. Laser experiments explore the hidden sector

    CERN Document Server

    Ahlers, M; Jaeckel, J; Redondo, J; Ringwald, A


    Recently, the laser experiments BMV and GammeV, searching for light shining through walls, have published data and calculated new limits on the allowed masses and couplings for axion-like particles. In this note we point out that these experiments can serve to constrain a much wider variety of hidden-sector particles such as, e.g., minicharged particles and hidden-sector photons. The new experiments improve the existing bounds from the older BFRT experiment by a factor of two. Moreover, we use the new PVLAS constraints on a possible rotation and ellipticity of light after it has passed through a strong magnetic field to constrain pure minicharged particle models. For masses <~0.05 eV, the charge is now restricted to be less than (3-4)x10^(-7) times the electron electric charge. This is the best laboratory bound and comparable to bounds inferred from the energy spectrum of the cosmic microwave background.

  17. Extended abstract of a hidden agenda

    Energy Technology Data Exchange (ETDEWEB)

    Goguen, J.; Malcolm, G. [Oxford Univ. (United Kingdom)


    The initial goal of our hidden research programme was both straightforward and ambitious: give a semantics for software engineering, and in particular for the object paradigm, supporting correctness proofs that are as simple and mechanical as possible. This emphasizes proofs rather than models, and thus suggests an equational approach, rather than one based on higher order logic, denotational semantics, or any kind of model, because equational proofs achieve maximal simplicity and mechanization, and yet are fully expressive. We introduce powerful coinduction techniques for proving behavioral properties of complex systems. We make the no doubt outrageous claim that our hidden approach gives simpler proofs than other formalisms; this is because we exploit algebraic structure that most other approaches discard.

  18. Hidden geometric correlations in real multiplex networks (United States)

    Kleineberg, Kaj-Kolja; Boguñá, Marián; Ángeles Serrano, M.; Papadopoulos, Fragkiskos


    Real networks often form interacting parts of larger and more complex systems. Examples can be found in different domains, ranging from the Internet to structural and functional brain networks. Here, we show that these multiplex systems are not random combinations of single network layers. Instead, they are organized in specific ways dictated by hidden geometric correlations between the layers. We find that these correlations are significant in different real multiplexes, and form a key framework for answering many important questions. Specifically, we show that these geometric correlations facilitate the definition and detection of multidimensional communities, which are sets of nodes that are simultaneously similar in multiple layers. They also enable accurate trans-layer link prediction, meaning that connections in one layer can be predicted by observing the hidden geometric space of another layer. And they allow efficient targeted navigation in the multilayer system using only local knowledge, outperforming navigation in the single layers only if the geometric correlations are sufficiently strong.

  19. Binary hidden Markov models and varieties

    CERN Document Server

    Critch, Andrew J


    The technological applications of hidden Markov models have been extremely diverse and successful, including natural language processing, gesture recognition, gene sequencing, and Kalman filtering of physical measurements. HMMs are highly non-linear statistical models, and just as linear models are amenable to linear algebraic techniques, non-linear models are amenable to commutative algebra and algebraic geometry. This paper examines closely those HMMs in which all the random variables, called nodes, are binary. Its main contributions are (1) minimal defining equations for the 4-node model, comprising 21 quadrics and 29 cubics, which were computed using Gr\\"obner bases in the cumulant coordinates of Sturmfels and Zwiernik, and (2) a birational parametrization for every binary HMM, with an explicit inverse for recovering the hidden parameters in terms of observables. The new model parameters in (2) are hence rationally identifiable in the sense of Sullivant, Garcia-Puente, and Spielvogel, and each model's Zar...

  20. LHCb - Search for hidden-sector bosons at LHCb

    CERN Multimedia

    Mauri, Andrea


    A search is presented for a hidden-sector boson, $\\chi$, produced in the decay $B^0 \\rightarrow K^* (892)^0 \\chi$, with $K^* (892)^0 \\rightarrow K^+ \\pi^-$ and $\\chi \\rightarrow \\mu^+ \\mu^-$ . The search is performed using a $pp$-collision data sample collected at $\\sqrt{s}=7$ and 8 TeV with the LHCb detector, corresponding to integrated luminosities of 1 and 2 fb$^{-1}$ respectively. No significant signal is observed in the mass range $214 \\le m_\\chi \\le 4350$ MeV, and upper limits are placed on the branching fraction product $\\mathcal{B}(B^0 \\rightarrow K^* (892)^0 \\chi) \\times \\mathcal{B}(\\chi \\rightarrow \\mu^+ \\mu^- )$ as a function of the mass and lifetime of the $\\chi$ boson. These limits place the most stringent constraints to date on many theories that predict the existence of additional low-mass dark bosons.

  1. The Hidden Gifts of Quiet Kids (United States)

    Trierweiler, Hannah


    The author relates that she was an introvert child. It has always taken her time and energy to find her place in a group. As a grown-up, she still needed quiet time to regroup during a busy day. In this article, the author presents an interview with Marti Olsen Laney, author of "The Hidden Gifts of the Introverted Child." During the interview,…

  2. Finite State Transducers Approximating Hidden Markov Models

    CERN Document Server

    Kempe, A


    This paper describes the conversion of a Hidden Markov Model into a sequential transducer that closely approximates the behavior of the stochastic model. This transformation is especially advantageous for part-of-speech tagging because the resulting transducer can be composed with other transducers that encode correction rules for the most frequent tagging errors. The speed of tagging is also improved. The described methods have been implemented and successfully tested on six languages.

  3. Hidden symmetries in dilaton-axion gravity

    CERN Document Server

    Kechkin, O V


    Four--dimensional Einstein--Maxwell--dilaton--axion system restricted to space--times with one non--null Killing symmetry is formulated as the three--dimensional gravity coupled sigma--model. Several alternative representations are discussed and the associated hidden symmetries are revealed. The action of target space isometries on the initial set of (non--dualized ) variables is found. New mulicenter solutions are obtained via generating technique based on the formulation in terms of the non--dualized variables.

  4. Caldera rim collapse: A hidden volcanic hazard


    Merle, Olivier; Michon, Laurent; Bachèlery, Patrick


    International audience; Following the emblematic flank collapse of Mount St Helens in 1981, numerous models of flank sliding have been proposed. These models have allowed to largely improve the understanding of mechanisms involved in such landslides, which represent a tremendous risk for populations living around volcanoes. In this article, a new mode of landslide formation, related to buried calderas, is described. The model emphasizes the paramount importance of the hidden ring fault that, ...

  5. Killing and letting die: hidden value assumptions. (United States)

    Atkinson, G


    In this paper I argue for several related theses: first, that the distinction between killing and letting die, as it is drawn by ordinary persons in ordinary contexts, is more complex than is generally understood; second, that the key feature of this complexity lies in the presence of a hidden normative component in what appears to be a straightforwardly descriptive distinction; and, third, that this complexity renders the killing/letting die distinction an inadequate and hazardous guide for moral reasoning.

  6. Online Learning in Discrete Hidden Markov Models


    Alamino, Roberto C.; Caticha, Nestor


    We present and analyse three online algorithms for learning in discrete Hidden Markov Models (HMMs) and compare them with the Baldi-Chauvin Algorithm. Using the Kullback-Leibler divergence as a measure of generalisation error we draw learning curves in simplified situations. The performance for learning drifting concepts of one of the presented algorithms is analysed and compared with the Baldi-Chauvin algorithm in the same situations. A brief discussion about learning and symmetry breaking b...

  7. Lepton mixing from the hidden sector (United States)

    Ludl, P. O.; Smirnov, A. Yu.


    Experimental results indicate a possible relation between the lepton and quark mixing matrices of the form UPMNS≈VCKM†UX , where UX is a matrix with special structure related to the mechanism of neutrino mass generation. We propose a framework which can realize such a relation. The main ingredients of the framework are the double seesaw mechanism, SO(10) grand unification and a hidden sector of theory. The latter is composed of singlets (fermions and bosons) of the grand unified theory (GUT) symmetry with masses between the GUT and Planck scale. The interactions in this sector obey certain symmetries Ghidden. We explore the conditions under which symmetries Ghidden can produce flavor structures in the visible sector. Here the key elements are the basis-fixing symmetry and mediators which communicate information about properties of the hidden sector to the visible one. The interplay of SO(10) symmetry, basis-fixing symmetry identified as Z2×Z2 and Ghidden can lead to the required form of UX. A different kind of new physics is responsible for generation of the CKM mixing. We present the simplest realizations of the framework which differ by nature of the mediators and by symmetries of the hidden sector.

  8. Otoendoscopic treatment of hidden lesions in otomastoiditis

    Institute of Scientific and Technical Information of China (English)

    LIU Yang; SUN Jian-jun; LIN Yong-sheng; ZHAO Dan-heng; ZHAO Jing; LEI Fei


    Background Surgical treatments for chronic suppurative and cholesteatoma otitis media have been discussed for several decades, but recurrences still occur because of the complex dissection required and hidden lesions associated with otomastoiditis. This study investigated the technology and strategy behind the use of otoendoscopic-assisted otosurgery.Methods We reported on hidden lesions in 32 ears of patients with otomastoiditis between November 2006 and January 2009. All the patients were treated with the aid of an otoendoscope. The advantages of otoendoscopy, including multi-angle light scattering, aperture illumination, and magnification of the local operative field, were utilized in otologic microsurgery, and otoendoscopic operative techniques were introduced for operative sites such as the epitympanum, aditus of the antrum, facial recess, sinus tympani and the mastoid tip.Results All patients were followed up from 3 months to 2 years after surgery. All patients recovered well within 3 months following surgery, except for one case of epithelialization of the mastoid cavity occurring 6 months after surgery for cholesteatoma on the cerebellar surface and another case with Bezold's abscess, hyperplastic granulation tissue developed at the antrum.Conclusions Otoendoscopy can overcome the technical deficiency of rectilinearity of the visual axis associated with otomicroscopic illumination, which presents a problem when dealing with otomastoiditis lesions in hidden areas. This technique allows such lesions within the complex three-dimensional structure to be visualized and cleaned. Otoendoscopy thus has significant potential for improving the quality of surgery and reducing the risk of postoperative recurrence.

  9. Dark matter in the hidden gauge theory

    CERN Document Server

    Yamanaka, Nodoka; Gongyo, Shinya; Iida, Hideaki


    The cosmological scenario of the dark matter generated in the hidden gauge theory based on the grand unification is discussed. It is found that the stability of the dark matter halo of our Galaxy and the cosmic ray observation constrain, respectively, the dark matter mass and the unification scale between the standard model and the hidden gauge theory sectors. To obtain a phenomenologically consistent thermal evolution, the entropy of the standard model sector needs to be increased. We therefore propose a scenario where the mini-inflation is induced from the potential coupled to the Standard model sector, in particular the Higgs sector. This scenario makes consistent the current dark matter density as well as the baryon-to-photon ratio for the case of pion dark matter. For the glueball or heavy pion of hidden gauge theory, an additional mini-inflation in the standard model sector before the leptogenesis is required. We also propose the possibility to confirm this scenario by known prospective experimental app...

  10. Hidden laser communications through matter. An application of meV-scale hidden photons

    Energy Technology Data Exchange (ETDEWEB)

    Jaeckel, Joerg [Durham Univ. (United Kingdom). Inst. for Particle Physics and Phenomenology; Redondo, Javier; Ringwald, Andreas [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)


    Currently, there are a number of light-shining-through-walls experiments searching for hidden photons - light, sub-eV-scale, abelian gauge bosons beyond the standard model which mix kinetically with the standard photon. We show that in the case that one of these experiments finds evidence for hidden photons, laser communications through matter, using methods from free-space optics, can be realized in the very near future, with a channel capacity of more than 1 bit per second, for a distance up to the Earth's diameter. (orig.)

  11. Beta-lactams interfering with PBP1 induce Panton-Valentine leukocidin expression by triggering sarA and rot global regulators of Staphylococcus aureus. (United States)

    Dumitrescu, Oana; Choudhury, Priya; Boisset, Sandrine; Badiou, Cédric; Bes, Michele; Benito, Yvonne; Wolz, Christiane; Vandenesch, François; Etienne, Jerome; Cheung, Ambrose L; Bowden, Maria Gabriela; Lina, Gerard


    Previous articles reported that beta-lactam antibiotics increase the expression of Staphylococcus aureus Panton-Valentine leukocidin (PVL) by activating its transcription. We investigated the mechanisms underlying the inductor effect of beta-lactams on PVL expression by determining targets and regulatory pathways possibly implicated in this process. We measured PVL production in the presence of oxacillin (nonselective), imipenem (penicillin-binding protein 1 [PBP1] selective), cefotaxime (PBP2 selective), cefaclore (PBP3 selective), and cefoxitin (PBP4 selective). In vitro, we observed increased PVL production consistent with luk-PV mRNA levels that were 20 to 25 times higher for community-acquired methicillin-resistant S. aureus (CA-MRSA) cultures treated with PBP1-binding oxacillin and imipenem than for cultures treated with other beta-lactams or no antibiotic at all. This effect was also observed in vivo, with increased PVL mRNA levels in lung tissues from CA-MRSA-infected mice treated with imipenem but not cefoxitin. To confirm the involvement of PBP1 inhibition in this pathway, PBP1 depletion by use of an inducible pbp1 antisense RNA showed a dose-dependent relationship between the level of pbp1 antisense RNA and the luk-PV mRNA level. Upon imipenem treatment of exponential-phase cultures, we observed an increased sarA mRNA level after 30 min of incubation followed by a decreased rot mRNA level after 1 to 4 h of incubation. Unlike the agr and saeRS positive regulators, which were nonessential for PVL induction by beta-lactams, the sarA (positive) and rot (negative) PVL regulators were necessary for PVL induction by imipenem. Our results suggest that antibiotics binding to PBP1 increase PVL expression by modulating sarA and rot, which are essential mediators of the inductor effect of beta-lactams on PVL expression.

  12. β-Lactams Interfering with PBP1 Induce Panton-Valentine Leukocidin Expression by Triggering sarA and rot Global Regulators of Staphylococcus aureus ▿ (United States)

    Dumitrescu, Oana; Choudhury, Priya; Boisset, Sandrine; Badiou, Cédric; Bes, Michele; Benito, Yvonne; Wolz, Christiane; Vandenesch, François; Etienne, Jerome; Cheung, Ambrose L.; Bowden, Maria Gabriela; Lina, Gerard


    Previous articles reported that beta-lactam antibiotics increase the expression of Staphylococcus aureus Panton-Valentine leukocidin (PVL) by activating its transcription. We investigated the mechanisms underlying the inductor effect of beta-lactams on PVL expression by determining targets and regulatory pathways possibly implicated in this process. We measured PVL production in the presence of oxacillin (nonselective), imipenem (penicillin-binding protein 1 [PBP1] selective), cefotaxime (PBP2 selective), cefaclore (PBP3 selective), and cefoxitin (PBP4 selective). In vitro, we observed increased PVL production consistent with luk-PV mRNA levels that were 20 to 25 times higher for community-acquired methicillin-resistant S. aureus (CA-MRSA) cultures treated with PBP1-binding oxacillin and imipenem than for cultures treated with other beta-lactams or no antibiotic at all. This effect was also observed in vivo, with increased PVL mRNA levels in lung tissues from CA-MRSA-infected mice treated with imipenem but not cefoxitin. To confirm the involvement of PBP1 inhibition in this pathway, PBP1 depletion by use of an inducible pbp1 antisense RNA showed a dose-dependent relationship between the level of pbp1 antisense RNA and the luk-PV mRNA level. Upon imipenem treatment of exponential-phase cultures, we observed an increased sarA mRNA level after 30 min of incubation followed by a decreased rot mRNA level after 1 to 4 h of incubation. Unlike the agr and saeRS positive regulators, which were nonessential for PVL induction by beta-lactams, the sarA (positive) and rot (negative) PVL regulators were necessary for PVL induction by imipenem. Our results suggest that antibiotics binding to PBP1 increase PVL expression by modulating sarA and rot, which are essential mediators of the inductor effect of beta-lactams on PVL expression. PMID:21502633

  13. The comparison of naturally weathered oil and artificially photo-degraded oil at the molecular level by a combination of SARA fractionation and FT-ICR MS

    Energy Technology Data Exchange (ETDEWEB)

    Islam, Ananna; Cho, Yunju [Kyungpook National University, Department of Chemistry, Daegu 702-701 (Korea, Republic of); Yim, Un Hyuk; Shim, Won Joon [Oil and POPs Research Group, Korea Institute of Ocean Science and Technology, Geoje 656-834 (Korea, Republic of); Kim, Young Hwan [Division of Mass Spectrometry Research and Center for Analytical Research in Disease Sciences, Korea Basic Science Institute, Ochang 863-883 (Korea, Republic of); Graduate School of Analytical Science and Technology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Kim, Sunghwan, E-mail: [Kyungpook National University, Department of Chemistry, Daegu 702-701 (Korea, Republic of); Division of Mass Spectrometry Research and Center for Analytical Research in Disease Sciences, Korea Basic Science Institute, Ochang 863-883 (Korea, Republic of)


    Highlights: • Weathered oils from the Hebei Spirit oil spill and photo degraded oils are compared. • We investigate changes of polar species at the molecular level by 15T FT-ICR MS. • Significant reduction of sulfur class compounds in saturates fraction is observed. • The relative abundance of protonated compounds (presumably basic nitrogen compounds) increase after degradation. • Changes of polar compounds occurred by natural and photo degradation are similar. -- Abstract: Two sets of oil samples, one obtained from different weathering stages of the M/V Hebei Spirit oil spill site and the other prepared by an in vitro photo-degradation experiment, were analyzed and compared at the molecular level by atmospheric pressure photo-ionization coupled with Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR MS). For a more detailed comparison at the molecular level, the oil samples were separated into saturate, aromatic, resin, and asphaltene (SARA) fractions before MS analysis. Gravimetric analysis of the SARA fractions revealed a decreased weight percentage of the aromatic fraction and an increased resin fraction in both sets of samples. Molecular-level investigations of the SARA fractions showed a significant reduction in the S{sub 1} class in the saturate fraction and increase of S{sub 1}O{sub 1} class compounds with high DBE values in resin fraction. Levels of N{sub 1} and N{sub 1}O{sub 1} class compounds resulting in protonated ions (presumably basic nitrogen compounds) increased after degradation compared to compounds generating molecular ions (presumably non-basic nitrogen compounds). This study revealed changes occurring in heteroatom polar species of crude oils such as sulfur and nitrogen containing compounds that have not been easily detected with conventional GC based techniques.

  14. Fault detection and diagnosis in a food pasteurization process with Hidden Markov Models


    Tokatlı, Figen; Cinar, Ali


    Hidden Markov Models (HMM) are used to detect abnormal operation of dynamic processes and diagnose sensor and actuator faults. The method is illustrated by monitoring the operation of a pasteurization plant and diagnosing causes of abnormal operation. Process data collected under the influence of faults of different magnitude and duration in sensors and actuators are used to illustrate the use of HMM in the detection and diagnosis of process faults. Case studies with experimental data from a ...


    Directory of Open Access Journals (Sweden)

    Criveanu Maria


    Full Text Available Hidden costs are present in the activity of any company, hardly identified in the traditional administrative accounting. The high levels of the hidden costs and their unknown presence have serious consequences on the decisions made by the managers. This paper aims at presenting some aspects related to the hidden costs that occur in the activity of the companies in the baking industry and the possibilities to reduce their level.

  16. Hidden History: A Mobile Application for Discovering Surrounding Landscapes



    This thesis work describes the design, development and evaluation of a mobile application called Hidden History. This application lets users discover and explore three types of landscapes (Historic, Scenic and Cultural) using three different modes of discovery (Route, Explore and Tour). Before designing Hidden History, the feature set of other applications that help users explore surrounding landscapes were identified and analyzed. Hidden History was then designed to implement the best fea...





    In this era of digital tsunami of information on the web, everyone is completely dependent on the WWW for information retrieval. This has posed a challenging problem in extracting relevant data. Traditional web crawlers focus only on the surface web while the deep web keeps expanding behind the scene. The web databases are hidden behind the query interfaces. In this paper, we propose a Hidden Web Extractor (HWE) that can automatically discover and download data from the Hidden Web databases. ...


    Directory of Open Access Journals (Sweden)

    A. V. Tkachenia


    Full Text Available An on-line unsupervised algorithm for estimating the hidden Markov models (HMM parame-ters is presented. The problem of hidden Markov models adaptation to emotional speech is solved. To increase the reliability of estimated HMM parameters, a mechanism of forgetting and updating is proposed. A functional block diagram of the hidden Markov models adaptation algorithm is also provided with obtained results, which improve the efficiency of emotional speech recognition.

  19. Hidden Photons in Aharonov-Bohm-Type Experiments


    Arias, Paola; Diaz, Christian; Diaz, Marco Aurelio; Jaeckel, Joerg; Koch, Benjamin; Redondo, Javier


    We discuss the Aharonov-Bohm effect in the presence of hidden photons kinetically mixed with the ordinary electromagnetic photons. The hidden photon field causes a slight phase shift in the observable interference pattern. It is then shown how the limited sensitivity of this experiment can be largely improved. The key observation is that the hidden photon field causes a leakage of the ordinary magnetic field into the supposedly field-free region. The direct measurement of this magnetic field ...



    Criveanu Maria; Ţaicu Marian


    Hidden costs are present in the activity of any company, hardly identified in the traditional administrative accounting. The high levels of the hidden costs and their unknown presence have serious consequences on the decisions made by the managers. This paper aims at presenting some aspects related to the hidden costs that occur in the activity of the companies in the baking industry and the possibilities to reduce their level.

  1. Making Archival and Special Collections More Accessible (United States)

    Renspie, Melissa, Comp.; Shepard, Linda, Comp.; Childress, Eric, Comp.


    Revealing hidden assets stewarded by research institutions so they can be made available for research and learning locally and globally is a prime opportunity for libraries to create and deliver new value. "Making Archival and Special Collections More Accessible" collects important work OCLC Research has done to help achieve the…

  2. Simple estimates of the hidden beauty pentaquarks masses

    CERN Document Server

    Kopeliovich, Vladimir


    The masses of cryptoexotic pentaquarks with hidden beauty are estimated phenomenologically using the results by the LHCb collaboration which discovered recently the cryptoexotic pentaquarks with hidden charm. The expected masses of the hidden beauty pentaquarks are about $10.8\\, GeV$ and $10.7\\,GeV$ in the limit of some kind of heavy quark symmetry. The states with hidden strangeness considered in similar way have masses above $2\\, Gev$, by several hundreds of $MeV$ higher than states discussed previously in connection with the relatively light positive strangeness pentaquark $\\theta^+$.

  3. Critical scaling in hidden state inference for linear Langevin dynamics


    Bravi, Barbara; Sollich, Peter


    We consider the problem of inferring the dynamics of unknown (i.e. hidden) nodes from a set of observed trajectories and we study analytically the average prediction error given by the Extended Plefka Expansion applied to it, as presented in [1]. We focus on a stochastic linear dynamics of continuous degrees of freedom interacting via random Gaussian couplings in the infinite network size limit. The expected error on the hidden time courses can be found as the equal-time hidden-to-hidden cova...

  4. Called to respond: The potential of unveiling hiddens

    Directory of Open Access Journals (Sweden)

    Alison L Black


    Full Text Available Interested in exploring how personal stories and aesthetic modes of representing experiences can nudge open academic and educational spaces, this article/collection of particles seeks to document our encounters of being affected and called to respond to things the other has written and represented. As a way of engaging with questions about what research and research data might be and become, our attention has been drawn to stories and images from our lives that we have not shaken off – and to how, as we have opened these to the other, making once private moments public, our hiddens have morphed tenderly into a shared knowing and being. As we have acted on the call we have felt to respond we have found ourselves entering spaces of collaboration, communion, contemplation, and conversation – spaces illuminated by what we have not been able to – and cannot – set aside. Using visual and poetic materials we explore heartfelt and heartbroken aspects of our educational worlds and lives, to be present with each other and our (reemerging personal and professional meanings. We see the shared body (of work, of writing, of image that develops from the taking of brave steps and the risky slipping off of academic masks and language, as a manifestation of the trusted and nurturing spaces that can be generated through collaborative opportunities to gather together. These steps towards unveiling hiddens are producing in us and of us a friendship, fluency, and fluidity as we write new ways of becoming. In turn, we hope the uncovering and revealing of our dialogue in the public gathering of this journal might supports readers’ telling of their own life stories through what calls them to respond.

  5. Error statistics of hidden Markov model and hidden Boltzmann model results

    Directory of Open Access Journals (Sweden)

    Newberg Lee A


    Full Text Available Abstract Background Hidden Markov models and hidden Boltzmann models are employed in computational biology and a variety of other scientific fields for a variety of analyses of sequential data. Whether the associated algorithms are used to compute an actual probability or, more generally, an odds ratio or some other score, a frequent requirement is that the error statistics of a given score be known. What is the chance that random data would achieve that score or better? What is the chance that a real signal would achieve a given score threshold? Results Here we present a novel general approach to estimating these false positive and true positive rates that is significantly more efficient than are existing general approaches. We validate the technique via an implementation within the HMMER 3.0 package, which scans DNA or protein sequence databases for patterns of interest, using a profile-HMM. Conclusion The new approach is faster than general naïve sampling approaches, and more general than other current approaches. It provides an efficient mechanism by which to estimate error statistics for hidden Markov model and hidden Boltzmann model results.

  6. Error statistics of hidden Markov model and hidden Boltzmann model results (United States)

    Newberg, Lee A


    Background Hidden Markov models and hidden Boltzmann models are employed in computational biology and a variety of other scientific fields for a variety of analyses of sequential data. Whether the associated algorithms are used to compute an actual probability or, more generally, an odds ratio or some other score, a frequent requirement is that the error statistics of a given score be known. What is the chance that random data would achieve that score or better? What is the chance that a real signal would achieve a given score threshold? Results Here we present a novel general approach to estimating these false positive and true positive rates that is significantly more efficient than are existing general approaches. We validate the technique via an implementation within the HMMER 3.0 package, which scans DNA or protein sequence databases for patterns of interest, using a profile-HMM. Conclusion The new approach is faster than general naïve sampling approaches, and more general than other current approaches. It provides an efficient mechanism by which to estimate error statistics for hidden Markov model and hidden Boltzmann model results. PMID:19589158

  7. Evolving the structure of hidden Markov Models

    DEFF Research Database (Denmark)

    won, K. J.; Prugel-Bennett, A.; Krogh, A.


    A genetic algorithm (GA) is proposed for finding the structure of hidden Markov Models (HMMs) used for biological sequence analysis. The GA is designed to preserve biologically meaningful building blocks. The search through the space of HMM structures is combined with optimization of the emission...... and transition probabilities using the classic Baum-Welch algorithm. The system is tested on the problem of finding the promoter and coding region of C. jejuni. The resulting HMM has a superior discrimination ability to a handcrafted model that has been published in the literature....

  8. OFDM System Channel Estimation with Hidden Pilot

    Institute of Scientific and Technical Information of China (English)

    YANG Feng; LIN Cheng-yu; ZHANG Wen-jun


    Channel estimation using pilot is common used in OFDM system. The pilot is usually time division multiplexed with the informative sequence. One of the main drawbacks is bandwidth losing. In this paper, a new method was proposed to perform channel estimation in OFDM system. The pilot is arithmetically added to the output of OFDM modulator. Receiver uses the hidden pilot to get an accurate estimation of the channel. Then pilot is removed after channel estimation. The Cramer-Rao lower bound for this method was deprived. The performance of the algorithm is then shown. Compared with traditional methods, the proposed algorithm increases the bandwidth efficiency dramatically.

  9. Pruning Boltzmann networks and hidden Markov models

    DEFF Research Database (Denmark)

    Pedersen, Morten With; Stork, D.


    We present sensitivity-based pruning algorithms for general Boltzmann networks. Central to our methods is the efficient calculation of a second-order approximation to the true weight saliencies in a cross-entropy error. Building upon previous work which shows a formal correspondence between linear...... Boltzmann chains and hidden Markov models (HMMs), we argue that our method can be applied to HMMs as well. We illustrate pruning on Boltzmann zippers, which are equivalent to two HMMs with cross-connection links. We verify that our second-order approximation preserves the rank ordering of weight saliencies...

  10. Hidden photon CDM search at Tokyo

    CERN Document Server

    Suzuki, Jun'ya; Horie, Tomoki; Minowa, Makoto


    We report on a search for hidden photon cold dark matter (HP CDM) using a novel technique with a dish antenna. We constructed two independent apparatus: one is aiming at the detection of the HP with a mass of $\\sim\\,\\rm{eV}$ which employs optical instruments, and the other is for a mass of $\\sim5\\times10^{-5}\\, \\rm{eV}$ utilizing a commercially available parabolic antenna facing on a plane reflector. From the result of the measurements, we found no evidence for the existence of HP CDM and set upper limits on the photon-HP mixing parameter $\\chi$.

  11. Die Beharrlichkeit im Verborgenen Hidden Persistence

    Directory of Open Access Journals (Sweden)

    Paula-Irene Villa


    Full Text Available Karin Flaake geht in ihrer psychoanalytischen Interpretation innerfamilialer Konstellationen der Frage nach, wie das Zur-Frau-Werden von jungen Frauen erlebt wird. Dabei kommt den körperliche Wandlungsprozessen der Pubertät und den darin eingelagerten expliziten sowie verborgenen Deutungen des Weiblichen – vor allem des weiblichen Körpers – durch die Eltern eine prominente Rolle zu.Karin Flaake’s psychoanalytical intepretations of family constellations explore how young women experience their coming of age and entering womanhood. Her analysis focuses on the bodily changes which women undergo during puberty and the explicit as well as hidden meanings assigned to them by the parents.

  12. Scaling dimensions in hidden Kerr/CFT

    CERN Document Server

    Lowe, David A; Skanata, Antun


    It has been proposed that a hidden conformal field theory (CFT) governs the dynamics of low frequency scattering in a general Kerr black hole background. We further investigate this correspondence by mapping higher order corrections to the massless wave equations in a Kerr background to an expansion within the CFT in terms of higher dimension operators. This implies the presence of infinite towers of CFT primary operators with positive conformal dimensions compatible with unitarity. The exact Kerr background softly breaks the conformal symmetry and the scaling dimensions of these operators run with frequency. The scale-invariant fixed point is dual to a degenerate case of flat spacetime.

  13. Hidden Kerr/CFT at finite frequencies

    CERN Document Server

    Lowe, David A; Skanata, Antun


    Massless fields propagating in a generic Kerr black hole background enjoy a hidden SL(2,R)xSL(2,R) symmetry. We determine how the exact mode functions decompose into representations of this symmetry group. This extends earlier results on the low frequency limit of the massless scalar case to finite frequencies and general spin. As an application, we numerically determine the parameters of the representations that appear in quasinormal modes. These results represent a first step to formulating a more precise mapping to a holographic dual conformal field theory for generic black holes.

  14. A New Hidden Web Crawling Approach


    L.Saoudi; A.Boukerram; S.Mhamedi


    Traditional search engines deal with the Surface Web which is a set of Web pages directly accessible through hyperlinks and ignores a large part of the Web called hidden Web which is a great amount of valuable information of online database which is “hidden” behind the query forms. To access to those information the crawler have to fill the forms with a valid data, for this reason we propose a new approach which use SQLI technique in order to find the most promising keywords of a specific dom...

  15. Hidden Scale Invariance in Condensed Matter

    DEFF Research Database (Denmark)

    Dyre, J. C.


    . This means that the phase diagram becomes effectively one-dimensional with regard to several physical properties. Liquids and solids with isomorphs include most or all van der Waals bonded systems and metals, as well as weakly ionic or dipolar systems. On the other hand, systems with directional bonding...... (hydrogen bonds or covalent bonds) or strong Coulomb forces generally do not exhibit hidden scale invariance. The article reviews the theory behind this picture of condensed matter and the evidence for it coming from computer simulations and experiments...

  16. Genetic Algorithms Principles Towards Hidden Markov Model

    Directory of Open Access Journals (Sweden)

    Nabil M. Hewahi


    Full Text Available In this paper we propose a general approach based on Genetic Algorithms (GAs to evolve Hidden Markov Models (HMM. The problem appears when experts assign probability values for HMM, they use only some limited inputs. The assigned probability values might not be accurate to serve in other cases related to the same domain. We introduce an approach based on GAs to find
    out the suitable probability values for the HMM to be mostly correct in more cases than what have been used to assign the probability values.

  17. Fifty Years After, Hidden Children Speak

    Directory of Open Access Journals (Sweden)

    Léa Marcou


    Full Text Available “For fifty years, I have not spoken of my childhood years in France during the second world war. A hidden child, I lived under a false name amongst unknown people, being careful – as I had been taught – not to reveal, by a gesture or by a word, that I was Jewish. I knew I was in danger, still not understanding why and I was constantly afraid. I didn't know whether I would see again one day my parents from whom I had been suddenly taken away. Nonetheless what were my pains compared to those of...

  18. Detecting Structural Breaks using Hidden Markov Models

    DEFF Research Database (Denmark)

    Ntantamis, Christos

    Testing for structural breaks and identifying their location is essential for econometric modeling. In this paper, a Hidden Markov Model (HMM) approach is used in order to perform these tasks. Breaks are defined as the data points where the underlying Markov Chain switches from one state to another....... The locations of the breaks are subsequently obtained by assigning states to data points according to the Maximum Posterior Mode (MPM) algorithm. The Integrated Classification Likelihood-Bayesian Information Criterion (ICL-BIC) allows for the determination of the number of regimes by taking into account...... in the monetary policy of United States, the dierent functional form being variants of the Taylor (1993) rule....

  19. Uncovering the Hidden Costs of Offshoring

    DEFF Research Database (Denmark)

    Larsen, Marcus M.; Manning, Stephan; Pedersen, Torben


    This study investigates estimation errors due to hidden costs—the costs of implementation that are neglected in strategic decision-making processes—in the context of services offshoring. Based on data from the Offshoring Research Network, we find that decision makers are more likely to make cost......-estimation errors given increasing configuration and task complexity in captive offshoring and offshore outsourcing, respectively. Moreover, we show that experience and a strong orientation toward organizational design in the offshoring strategy reduce the cost-estimation errors that follow from complexity. Our...

  20. Atlas of solar hidden photon emission

    Energy Technology Data Exchange (ETDEWEB)

    Redondo, Javier [Departamento de Física Teórica, Universidad de Zaragoza,Pedro Cerbuna 12, E-50009, Zaragoza (Spain); Max-Planck-Institut für Physik, Werner-Heisenberg-Institut,Föhringer Ring 6, 80805 München (Germany)


    Hidden photons, gauge bosons of a U(1) symmetry of a hidden sector, can constitute the dark matter of the universe and a smoking gun for large volume compactifications of string theory. In the sub-eV mass range, a possible discovery experiment consists on searching the copious flux of these particles emitted from the Sun in a helioscope setup à la Sikivie. In this paper, we compute in great detail the flux of HPs from the Sun, a necessary ingredient for interpreting such experiments. We provide a detailed exposition of transverse photon-HP oscillations in inhomogenous media, with special focus on resonance oscillations, which play a leading role in many cases. The region of the Sun emitting HPs resonantly is a thin spherical shell for which we justify an averaged-emission formula and which implies a distinctive morphology of the angular distribution of HPs on Earth in many cases. Low mass HPs with energies in the visible and IR have resonances very close to the photosphere where the solar plasma is not fully ionised and requires building a detailed model of solar refraction and absorption. We present results for a broad range of HP masses (from 0–1 keV) and energies (from the IR to the X-ray range), the most complete atlas of solar HP emission to date.

  1. Epitope discovery with phylogenetic hidden Markov models.

    LENUS (Irish Health Repository)

    Lacerda, Miguel


    Existing methods for the prediction of immunologically active T-cell epitopes are based on the amino acid sequence or structure of pathogen proteins. Additional information regarding the locations of epitopes may be acquired by considering the evolution of viruses in hosts with different immune backgrounds. In particular, immune-dependent evolutionary patterns at sites within or near T-cell epitopes can be used to enhance epitope identification. We have developed a mutation-selection model of T-cell epitope evolution that allows the human leukocyte antigen (HLA) genotype of the host to influence the evolutionary process. This is one of the first examples of the incorporation of environmental parameters into a phylogenetic model and has many other potential applications where the selection pressures exerted on an organism can be related directly to environmental factors. We combine this novel evolutionary model with a hidden Markov model to identify contiguous amino acid positions that appear to evolve under immune pressure in the presence of specific host immune alleles and that therefore represent potential epitopes. This phylogenetic hidden Markov model provides a rigorous probabilistic framework that can be combined with sequence or structural information to improve epitope prediction. As a demonstration, we apply the model to a data set of HIV-1 protein-coding sequences and host HLA genotypes.

  2. Atlas of solar hidden photon emission

    CERN Document Server

    Redondo, Javier


    Hidden photons, gauge bosons of a U(1) symmetry of a hidden sector, can constitute the dark matter of the universe and a smoking gun for large volume compactifications of string theory. In the sub-eV mass range, a possible discovery experiment consists on searching the copious flux of these particles emitted from the Sun in a helioscope setup \\`a la Sikivie. In this paper, we compute the flux of transversely polarised HPs from the Sun, a necessary ingredient for interpreting such experiments. We provide a detailed exposition of photon-HP oscillations in inhomogenous media, with special focus on resonance oscillations, which play a leading role in many cases. The region of the Sun emitting HPs resonantly is a thin spherical shell for which we justify an averaged-emission formula and which implies a distinctive morphology of the angular distribution of HPs on Earth in many cases. Low mass HPs with energies in the visible and IR have resonances very close to the photosphere where the solar plasma is not fully io...

  3. Quantum Hidden Subgroup Problems A Mathematical Perspective

    CERN Document Server

    Lomonaco, S J; Lomonaco, Samuel J.; Kauffman, Louis H.


    The ultimate objective of this paper is to create a stepping stone to the development of new quantum algorithms. The strategy chosen is to begin by focusing on the class of abelian quantum hidden subgroup algorithms, i.e., the class of abelian algorithms of the Shor/Simon genre. Our strategy is to make this class of algorithms as mathematically transparent as possible. By the phrase "mathematically transparent" we mean to expose, to bring to the surface, and to make explicit the concealed mathematical structures that are inherently and fundamentally a part of such algorithms. In so doing, we create symbolic abelian quantum hidden subgroup algorithms that are analogous to the those symbolic algorithms found within such software packages as Axiom, Cayley, Maple, Mathematica, and Magma. As a spin-off of this effort, we create three different generalizations of Shor's quantum factoring algorithm to free abelian groups of finite rank. We refer to these algorithms as wandering (or vintage Z_Q) Shor algorithms. They...

  4. ESO's Hidden Treasures Brought to Light (United States)


    ESO's Hidden Treasures 2010 astrophotography competition attracted nearly 100 entries, and ESO is delighted to announce the winners. Hidden Treasures gave amateur astronomers the opportunity to search ESO's vast archives of astronomical data for a well-hidden cosmic gem. Astronomy enthusiast Igor Chekalin from Russia won the first prize in this difficult but rewarding challenge - the trip of a lifetime to ESO's Very Large Telescope at Paranal, Chile. The pictures of the Universe that can be seen in ESO's releases are impressive. However, many hours of skilful work are required to assemble the raw greyscale data captured by the telescopes into these colourful images, correcting them for distortions and unwanted signatures of the instrument, and enhancing them so as to bring out the details contained in the astronomical data. ESO has a team of professional image processors, but for the ESO's Hidden Treasures 2010 competition, the experts decided to give astronomy and photography enthusiasts the opportunity to show the world what they could do with the mammoth amount of data contained in ESO's archives. The enthusiasts who responded to the call submitted nearly 100 entries in total - far exceeding initial expectations, given the difficult nature of the challenge. "We were completely taken aback both by the quantity and the quality of the images that were submitted. This was not a challenge for the faint-hearted, requiring both an advanced knowledge of data processing and an artistic eye. We are thrilled to have discovered so many talented people," said Lars Lindberg Christensen, Head of ESO's education and Public Outreach Department. Digging through many terabytes of professional astronomical data, the entrants had to identify a series of greyscale images of a celestial object that would reveal the hidden beauty of our Universe. The chance of a great reward for the lucky winner was enough to spur on the competitors; the first prize being a trip to ESO's Very Large

  5. Hidden Markov Model for Stock Selection

    Directory of Open Access Journals (Sweden)

    Nguyet Nguyen


    Full Text Available The hidden Markov model (HMM is typically used to predict the hidden regimes of observation data. Therefore, this model finds applications in many different areas, such as speech recognition systems, computational molecular biology and financial market predictions. In this paper, we use HMM for stock selection. We first use HMM to make monthly regime predictions for the four macroeconomic variables: inflation (consumer price index (CPI, industrial production index (INDPRO, stock market index (S&P 500 and market volatility (VIX. At the end of each month, we calibrate HMM’s parameters for each of these economic variables and predict its regimes for the next month. We then look back into historical data to find the time periods for which the four variables had similar regimes with the forecasted regimes. Within those similar periods, we analyze all of the S&P 500 stocks to identify which stock characteristics have been well rewarded during the time periods and assign scores and corresponding weights for each of the stock characteristics. A composite score of each stock is calculated based on the scores and weights of its features. Based on this algorithm, we choose the 50 top ranking stocks to buy. We compare the performances of the portfolio with the benchmark index, S&P 500. With an initial investment of $100 in December 1999, over 15 years, in December 2014, our portfolio had an average gain per annum of 14.9% versus 2.3% for the S&P 500.

  6. Hidden charm molecules in finite volume

    CERN Document Server

    Albaladejo, Miguel; Nieves, Juan; Oset, Eulogio


    In the present paper we address the interaction of pairs of charmed mesons with hidden charm in a finite box. We use the interaction from a recent model based on heavy quark spin symmetry that predicts molecules of hidden charm in the infinite volume. The energy levels in the box are generated within this model, and from them some synthetic data are generated. These data are then employed to study the inverse problem of getting the energies of the bound states and phase shifts for $D \\bar D$ or $D^* {\\bar D}^*$. Different strategies are investigated using the lowest two levels for different values of the box size, carrying a study of the errors produced. Starting from the upper level, fits to the synthetic data are carried out to determine the scattering length and effective range plus the binding energy of the ground state. A similar strategy using the effective range formula is considered with a simultaneous fit to the two levels, one above and the other one below threshold. This method turns out to be more...

  7. Laser experiments explore the hidden sector

    Energy Technology Data Exchange (ETDEWEB)

    Ahlers, M. [Oxford Univ. (United Kingdom). Rudolf Peierls Centre for Theoretical Physics; Gies, H. [Heidelberg Univ. (Germany). Inst. fuer Theoretische Physik; Jaeckel, J. [Heidelberg Univ. (Germany). Inst. fuer Theoretische Physik]|[Durham Univ. (United Kingdom). Inst. for Particle Physics Phenomenology; Redondo, J.; Ringwald, A. [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)


    Recently, the laser experiments BMV and GammeV, searching for light shining through walls, have published data and calculated new limits on the allowed masses and couplings for axion-like particles. In this note we point out that these experiments can serve to constrain a much wider variety of hidden-sector particles such as, e.g., minicharged particles and hidden-sector photons. The new experiments improve the existing bounds from the older BFRT experiment by a factor of two. Moreover, we use the new PVLAS constraints on a possible rotation and ellipticity of light after it has passed through a strong magnetic field to constrain pure minicharged particle models. For masses

  8. Bayesian structural inference for hidden processes. (United States)

    Strelioff, Christopher C; Crutchfield, James P


    We introduce a Bayesian approach to discovering patterns in structurally complex processes. The proposed method of Bayesian structural inference (BSI) relies on a set of candidate unifilar hidden Markov model (uHMM) topologies for inference of process structure from a data series. We employ a recently developed exact enumeration of topological ε-machines. (A sequel then removes the topological restriction.) This subset of the uHMM topologies has the added benefit that inferred models are guaranteed to be ε-machines, irrespective of estimated transition probabilities. Properties of ε-machines and uHMMs allow for the derivation of analytic expressions for estimating transition probabilities, inferring start states, and comparing the posterior probability of candidate model topologies, despite process internal structure being only indirectly present in data. We demonstrate BSI's effectiveness in estimating a process's randomness, as reflected by the Shannon entropy rate, and its structure, as quantified by the statistical complexity. We also compare using the posterior distribution over candidate models and the single, maximum a posteriori model for point estimation and show that the former more accurately reflects uncertainty in estimated values. We apply BSI to in-class examples of finite- and infinite-order Markov processes, as well to an out-of-class, infinite-state hidden process.

  9. Quantum algorithm for identifying hidden polynomial function graphs

    NARCIS (Netherlands)

    Decker, T.; Draisma, J.; Wocjan, P.


    We consider a natural generalization of an abelian Hidden Subgroup Problem where the subgroups and their cosets correspond to graphs of linear functions over a finite field F with d elements. The hidden functions of the generalized problem are not restricted to be linear but can also be m-variate po

  10. Hidden attractor in the Rabinovich system, Chua circuits and PLL (United States)

    Kuznetsov, N. V.; Leonov, G. A.; Mokaev, T. N.; Seledzhi, S. M.


    In this report the existence of hidden attractors in Rabinovich system, phase-locked loop and coupled Chua circuits is considered. It is shown that the existence of hidden attractors may complicate the analysis of the systems and significantly affect the synchronization.

  11. Hidden Curriculum as One of Current Issue of Curriculum (United States)

    Alsubaie, Merfat Ayesh


    There are several issues in the education system, especially in the curriculum field that affect education. Hidden curriculum is one of current controversial curriculum issues. Many hidden curricular issues are the result of assumptions and expectations that are not formally communicated, established, or conveyed within the learning environment.…

  12. Searching for hidden sector in multiparticle production at LHC

    Directory of Open Access Journals (Sweden)

    Miguel-Angel Sanchis-Lozano


    Full Text Available We study the impact of a hidden sector beyond the Standard Model, e.g. a Hidden Valley model, on factorial moments and cumulants of multiplicity distributions in multiparticle production with a special emphasis on the prospects for LHC results.

  13. Secret Codes: The Hidden Curriculum of Semantic Web Technologies (United States)

    Edwards, Richard; Carmichael, Patrick


    There is a long tradition in education of examination of the hidden curriculum, those elements which are implicit or tacit to the formal goals of education. This article draws upon that tradition to open up for investigation the hidden curriculum and assumptions about students and knowledge that are embedded in the coding undertaken to facilitate…

  14. Secret Codes: The Hidden Curriculum of Semantic Web Technologies (United States)

    Edwards, Richard; Carmichael, Patrick


    There is a long tradition in education of examination of the hidden curriculum, those elements which are implicit or tacit to the formal goals of education. This article draws upon that tradition to open up for investigation the hidden curriculum and assumptions about students and knowledge that are embedded in the coding undertaken to facilitate…

  15. Seuss's Butter Battle Book: Is There Hidden Harm? (United States)

    Van Cleaf, David W.; Martin, Rita J.


    Examines whether elementary school children relate to the "harmful hidden message" about nuclear war in Dr. Seuss's THE BUTTER BATTLE BOOK. After ascertaining the children's cognitive level, they participated in activities to find hidden meanings in stories, including Seuss's book. Students failed to identify the nuclear war message in Seuss's…

  16. An introduction to hidden Markov models for biological sequences

    DEFF Research Database (Denmark)

    Krogh, Anders Stærmose


    A non-matematical tutorial on hidden Markov models (HMMs) plus a description of one of the applications of HMMs: gene finding.......A non-matematical tutorial on hidden Markov models (HMMs) plus a description of one of the applications of HMMs: gene finding....

  17. Detecting Hidden Hierarchy of Non Hierarchical Terrorist Networks

    DEFF Research Database (Denmark)

    Memon, Nasrullah

    to analyze terrorist networks and prioritize their targets. Applying recently introduced mathematical methods for constructing the hidden hierarchy of "nonhierarchical" terrorist networks; we present case studies of the terrorist attacks occurred / planned in the past, in order to identify hidden hierarchy...

  18. Free energy and hidden barriers of the β-sheet structure of prion protein. (United States)

    Paz, S Alexis; Abrams, Cameron F


    On-the-fly free-energy parametrization is a new collective variable biasing approach akin to metadynamics with one important distinction: rather than acquiring an accelerated distribution via a history-dependent bias potential, sampling on this distribution is achieved from the beginning of the simulation using temperature-accelerated molecular dynamics. In the present work, we compare the performance of both approaches to compute the free-energy profile along a scalar collective variable measuring the H-bond registry of the β-sheet structure of the mouse Prion protein. Both methods agree on the location of the free-energy minimum, but free-energy profiles from well-tempered metadynamics are subject to a much higher degree of statistical noise due to hidden barriers. The sensitivity of metadynamics to hidden barriers is shown to be a consequence of the history dependence of the bias potential, and we detail the nature of these barriers for the prion β-sheet. In contrast, on-the-fly parametrization is much less sensitive to these barriers and thus displays improved convergence behavior relative to that of metadynamics. While hidden barriers are a frequent and central issue in free-energy methods, on-the-fly free-energy parametrization appears to be a robust and preferable method to confront this issue.

  19. Analyzing Hidden Semantics in Social Bookmarking of Open Educational Resources (United States)

    Minguillón, Julià

    Web 2.0 services such as social bookmarking allow users to manage and share the links they find interesting, adding their own tags for describing them. This is especially interesting in the field of open educational resources, as delicious is a simple way to bridge the institutional point of view (i.e. learning object repositories) with the individual one (i.e. personal collections), thus promoting the discovering and sharing of such resources by other users. In this paper we propose a methodology for analyzing such tags in order to discover hidden semantics (i.e. taxonomies and vocabularies) that can be used to improve descriptions of learning objects and make learning object repositories more visible and discoverable. We propose the use of a simple statistical analysis tool such as principal component analysis to discover which tags create clusters that can be semantically interpreted. We will compare the obtained results with a collection of resources related to open educational resources, in order to better understand the real needs of people searching for open educational resources.

  20. Systematic detection of hidden complexities in the unfolding mechanism of a cytosine-rich DNA strand (United States)

    Smiatek, Jens; Janssen-Müller, Daniel; Friedrich, Rudolf; Heuer, Andreas


    We investigate the unfolding pathway of a cytosine-rich DNA structure via molecular dynamics simulations. By the study of the essential dynamics, we are able to identify a hidden complexity in the description of the dynamics in terms of the first two eigenvectors which are used as collective variables. This complexity can be mainly explained by non-Gaussian fluctuations due to contributions arising from the disregarded set of eigenvectors. We introduce the local non-Gaussian parameter as a tool for the detection of hidden complexities. The usage of this parameter allows a fast and reliable investigation for the determination of the important minimal number of eigenvectors which is needed for a sufficient description of molecular unfolding motion.

  1. Statistical Inference in Hidden Markov Models Using k-Segment Constraints. (United States)

    Titsias, Michalis K; Holmes, Christopher C; Yau, Christopher


    Hidden Markov models (HMMs) are one of the most widely used statistical methods for analyzing sequence data. However, the reporting of output from HMMs has largely been restricted to the presentation of the most-probable (MAP) hidden state sequence, found via the Viterbi algorithm, or the sequence of most probable marginals using the forward-backward algorithm. In this article, we expand the amount of information we could obtain from the posterior distribution of an HMM by introducing linear-time dynamic programming recursions that, conditional on a user-specified constraint in the number of segments, allow us to (i) find MAP sequences, (ii) compute posterior probabilities, and (iii) simulate sample paths. We collectively call these recursions k-segment algorithms and illustrate their utility using simulated and real examples. We also highlight the prospective and retrospective use of k-segment constraints for fitting HMMs or exploring existing model fits. Supplementary materials for this article are available online.

  2. A Radio for Hidden-Photon Dark Matter Detection

    CERN Document Server

    Chaudhuri, Saptarshi; Irwin, Kent; Mardon, Jeremy; Rajendran, Surjeet; Zhao, Yue


    We propose a resonant electromagnetic detector to search for hidden-photon dark matter over an extensive range of masses. Hidden-photon dark matter can be described as a weakly coupled "hidden electric field," oscillating at a frequency fixed by the mass, and able to penetrate any shielding. At low frequencies (compared to the inverse size of the shielding), we find that observable effect of the hidden photon inside any shielding is a real, oscillating magnetic field. We outline experimental setups designed to search for hidden-photon dark matter, using a tunable, resonant LC circuit designed to couple to this magnetic field. Our "straw man" setups take into consideration resonator design, readout architecture and noise estimates. At high frequencies,there is an upper limit to the useful size of a single resonator set by $1/\

  3. Secluded Dark Matter Coupled to a Hidden CFT

    CERN Document Server

    von Harling, Benedict


    Models of secluded dark matter offer a variant on the standard WIMP picture and can modify our expectations for hidden sector phenomenology and detection. In this work we extend a minimal model of secluded dark matter, comprised of a U(1)'-charged dark matter candidate, to include a confining hidden-sector CFT. This provides a technically natural explanation for the hierarchically small mediator-scale, with hidden-sector confinement generating m_{gamma'}>0. Furthermore, the thermal history of the universe can differ markedly from the WIMP picture due to (i) new annihilation channels, (ii) a (potentially) large number of hidden-sector degrees of freedom, and (iii) a hidden-sector phase transition at temperatures T << M_{dm} after freeze out. The mediator allows both the dark matter and the Standard Model to communicate with the CFT, thus modifying the low-energy phenomenology and cosmic-ray signals from the secluded sector.

  4. Abelian Hidden Sectors at a GeV

    Energy Technology Data Exchange (ETDEWEB)

    Morrissey, David E.; Poland, David; /Harvard U.; Zurek, Kathryn; /Fermilab /Michigan U.


    We discuss mechanisms for naturally generating GeV-scale hidden sectors in the context of weak-scale supersymmetry. Such low mass scales can arise when hidden sectors are more weakly coupled to supersymmetry breaking than the visible sector, as happens when supersymmetry breaking is communicated to the visible sector by gauge interactions under which the hidden sector is uncharged, or if the hidden sector is sequestered from gravity-mediated supersymmetry breaking. We study these mechanisms in detail in the context of gauge and gaugino mediation, and present specific models of Abelian GeV-scale hidden sectors. In particular, we discuss kinetic mixing of a U(1){sub x} gauge force with hypercharge, singlets or bi-fundamentals which couple to both sectors, and additional loop effects. Finally, we investigate the possible relevance of such sectors for dark matter phenomenology, as well as for low- and high-energy collider searches.


    Directory of Open Access Journals (Sweden)



    Full Text Available In this era of digital tsunami of information on the web, everyone is completely dependent on the WWW for information retrieval. This has posed a challenging problem in extracting relevant data. Traditional web crawlers focus only on the surface web while the deep web keeps expanding behind the scene. The web databases are hidden behind the query interfaces. In this paper, we propose a Hidden Web Extractor (HWE that can automatically discover and download data from the Hidden Web databases. Since the only “entry point” to a Hidden Web site is a query interface, the main challenge that a Hidden WebExtractor has to face is how to automatically generate meaningful queries for the unlimited number of website pages.

  6. Gauge Coupling Unification with Hidden Photon, and Minicharged Dark Matter

    CERN Document Server

    Daido, Ryuji; Yokozaki, Norimi


    We show that gauge coupling unification is realized with a greater accuracy in the presence of a massless hidden photon which has a large kinetic mixing with hypercharge. We solve the renormalization group equations at two-loop level and find that the GUT unification scale is around $10^{16.5}$ GeV which sufficiently suppresses the proton decay rate, and that the unification depends only on the kinetic mixing, but not on the hidden gauge coupling nor the presence of vector-like matter fields charged under U(1)$_H$ and/or SU(5). Matter fields charged under the unbroken hidden U(1)$_H$ are stable and they contribute to dark matter. Interestingly, they become minicharged dark matter which carries a small but non-zero electric charge, if the hidden gauge coupling is tiny. The minicharged dark matter is a natural outcome of the gauge coupling unification with a hidden photon.

  7. A Hidden-Removal Model of Dam Perspective Drawing

    Institute of Scientific and Technical Information of China (English)

    WANG Zi-ru; ZHOU Hui-cheng; LI Ming-qiu


    Aming at water conservancy project visualization, a hidden-removal method of dam perspective drawings is realized by building a hidden-removal mathematical model for overlapping points location to set up the hidden relationship among point and plane, plane and plane in space. On this basis, as an example of panel rockfill dam, a dam hidden-removal perspective drawing is generated in different directions and different visual angles through adapting VC++ and OpenGL visualizing technology. The results show that the data construction of the model is simple which can overcome the disadvantages of considerable and complicated calculation. This method also provides the new means to draw hidden-removal perspective drawings for those landforms and ground objects.

  8. Identifying hidden sexual bridging communities in Chicago. (United States)

    Youm, Yoosik; Mackesy-Amiti, Mary Ellen; Williams, Chyvette T; Ouellet, Lawrence J


    Bridge populations can play a central role in the spread of human immunodeficiency virus (HIV) by providing transmission links between higher and lower prevalence populations. While social network methods are well suited to the study of bridge populations, analyses tend to focus on dyads (i.e., risk between drug and/or sex partners) and ignore bridges between distinct subpopulations. This study takes initial steps toward moving the analysis of sexual network linkages beyond individual and risk group levels to a community level in which Chicago's 77 community areas are examined as subpopulations for the purpose of identifying potential bridging communities. Of particular interest are "hidden" bridging communities; that is, areas with above-average levels of sexual ties with other areas but whose below-average AIDS prevalence may hide their potential importance for HIV prevention. Data for this analysis came from the first wave of recruiting at the Chicago Sexual Acquisition and Transmission of HIV Cooperative Agreement Program site. Between August 2005 through October 2006, respondent-driven sampling was used to recruit users of heroin, cocaine, or methamphetamine, men who have sex with men regardless of drug use, the sex partners of these two groups, and sex partners of the sex partners. In this cross-sectional study of the sexual transmission of HIV, participants completed a network-focused computer-assisted self-administered interview, which included questions about the geographic locations of sexual contacts with up to six recent partners. Bridging scores for each area were determined using a matrix representing Chicago's 77 community areas and were assessed using two measures: non-redundant ties and flow betweenness. Bridging measures and acquired immunodeficiency syndrome (AIDS) case prevalence rates were plotted for each community area on charts representing four conditions: below-average bridging and AIDS prevalence, below-average bridging and above

  9. The staphylococcal accessory regulator, SarA, is an RNA-binding protein that modulates the mRNA turnover properties of late-exponential and stationary phase Staphylococcus aureus cells

    Directory of Open Access Journals (Sweden)

    John M Morrison


    Full Text Available The modulation of mRNA turnover is gaining recognition as a mechanism by which Staphylococcus aureus regulates gene expression, but the factors that orchestrate alterations in transcript degradation are poorly understood. In that regard, we previously found that 138 mRNA species, including the virulence factors protein A (spa and collagen binding protein (cna, are stabilized in a sarA-dependent manner during exponential phase growth, suggesting that SarA protein may directly or indirectly effect the RNA turnover properties of these transcripts. Herein, we expanded our characterization of the effects of sarA on mRNA turnover during late exponential and stationary phases of growth. Results revealed that the locus affects the RNA degradation properties of cells during both growth phases. Further, using gel mobility shift assays and RIP-ChIP, it was found that SarA protein is capable of binding mRNA species that it stabilizes both in vitro and within bacterial cells. Taken together, these results suggest that SarA post-transcriptionally regulates S. aureus gene expression in a manner that involves binding to and consequently altering the mRNA turnover properties of target transcripts.

  10. Magneto-Radar Hidden Metal Detector

    Energy Technology Data Exchange (ETDEWEB)

    McEwan, Thomas E. (Las Vegas, NV)


    A varying magnetic field excites slight vibrations in an object and a radar sensor detects the vibrations at a harmonic of the excitation frequency. The synergy of the magnetic excitation and radar detection provides increased detection range compared to conventional magnetic metal detectors. The radar rejects background clutter by responding only to reflecting objects that are vibrating at a harmonic excitation field, thereby significantly improving detection reliability. As an exemplary arrangement, an ultra-wideband micropower impulse radar (MIR) is capable of being employed to provide superior materials penetration while providing range information. The magneto-radar may be applied to pre-screening magnetic resonance imaging (MRI) patients, landmine detection and finding hidden treasures.

  11. Effect of Noise on hidden data

    Directory of Open Access Journals (Sweden)

    Garima Tomar


    Full Text Available This paper simulates an effective data hiding technique i.e. steganography based on LSB insertion and RSA encryption in order to provide seven million times better security than the previous work. The Main idea of proposed scheme is to encrypt secret data by RSA 1024 algorithm, convert it in to binary sequence bit and then embedded into each cover pixels by modifying the least significant bits (LSBs of cover pixels. The result image is also known as steganography image. The PSNR value of this steganography image is 54.34 db. In this paper Baboon image is used for experimental purpous.This steganography image is transmitted through AWGN channel, and performance is simulated. The image and hidden data are reconstructed with the SNR level ≥9 dB.

  12. Sending Hidden Data via Google Suggest

    CERN Document Server

    Bialczak, Piotr; Szczypiorski, Krzysztof


    Google Suggest is a service incorporated within Google Web Search which was created to help user find the right search phrase by proposing the autocompleting popular phrases while typing. The paper presents a new network steganography method called StegSuggest which utilizes suggestions generated by Google Suggest as a hidden data carrier. The detailed description of the method's idea is backed up with the analysis of the network traffic generated by the Google Suggest to prove its feasibility. The traffic analysis was also performed to discover the occurrence of two TCP options: Window Scale and Timestamp which StegSuggest uses to operate. Estimation of method steganographic bandwidth proves that it is possible to insert 100 bits of steganogram into every suggestions list sent by Google Suggest service.

  13. Grand unified hidden-sector dark matter (United States)

    Lonsdale, Stephen J.; Volkas, Raymond R.


    We explore G×G unified theories with the visible and the hidden or dark sectors paired under a Z2 symmetry. Developing a system of "asymmetric symmetry breaking" we motivate such models on the basis of their ability to generate dark baryons that are confined with a mass scale just above that of the proton, as motivated by asymmetric dark matter. This difference is achieved from the distinct but related confinement scales that develop in unified theories that have the two factors of G spontaneously breaking in an asymmetric manner. We show how Higgs potentials that admit different gauge group breaking chains in each sector can be constructed, and demonstrate the capacity for generating different fermion mass scales. Lastly we discuss supersymmetric extensions of such schemes.

  14. Hidden caries’ challenge diagnosis: case report

    Directory of Open Access Journals (Sweden)

    Fernanda Mara de Paiva Bertoli


    Full Text Available Introduction: Hidden caries is a term used to describe occlusal dentine caries that is missed on a visual examination, but is large and demineralised enough to be detected by another exam for example, radiographs. Case report: This article reports a case of large dentine caries, which presented as to be a small pit-and-fissure carious lesion on the occlusal surface of the right mandibular permanent first molar in a 10-year-old girl. The treatment included root canal treatment and the sealing of the cavity with composite resin. Conclusion: Careful visual examination, with cleaning and drying of teeth, associated to bitewing radiographs may improve occlusal caries detection. Dentists should examine bitewing radiographs carefully for proximal caries and occlusal demineralization. Radiographs are an effective method of caries diagnosis that can avoid large destruction and allows less invasive treatment.

  15. Hidden expectations within the Danish VET system

    DEFF Research Database (Denmark)

    Hjort-Madsen, Peder

    Researching the pressing retention and dropout problems of the Danish VET system (app. 20 pct. of a year group never achieve an upper secondary education) this paper takes its point of departure in the hypothesis that low performing students are kept in a marginal position (at the risk of dropping...... out) within the VET system, because of hidden expectations related to e.g. individualized responsibility, a certain student behavior (sitting still, participating actively), etc. By approaching the VET system as a cultural context (cultural praxis) the subtle reproductive mechanisms of the VET system...... are shown. With empirical examples from different introductory VET courses, it is shown how the school, the teachers and the students themselves are reproducing poor school performance and student background – being it gendered, ethnical or social – and hereby proving to the students, that school...

  16. Hidden expectations within the Danish VET system

    DEFF Research Database (Denmark)

    Hjort-Madsen, Peder


    Researching the pressing retention and dropout problems of the Danish VET system (app. 20 pct. of a year group never achieve an upper secondary education) this paper takes its point of departure in the hypothesis that low performing students are kept in a marginal position (at the risk of dropping...... out) within the VET system, because of hidden expectations related to e.g. individualized responsibility, a certain student behavior (sitting still, participating actively), etc. By approaching the VET system as a cultural context (cultural praxis) the subtle reproductive mechanisms of the VET system...... are shown. With empirical examples from different introductory VET courses, it is shown how the school, the teachers and the students themselves are reproducing poor school performance and student background – being it gendered, ethnical or social – and hereby proving to the students, that school...

  17. Nuclear scissors modes and hidden angular momenta

    CERN Document Server

    Balbutsev, E B; Schuck, P


    The coupled dynamics of low lying modes and various giant resonances are studied with the help of the Wigner Function Moments method generalized to take into account spin degrees of freedom and pair correlations simultaneously. The method is based on Time Dependent Hartree-Fock-Bogoliubov equations. The model of the harmonic oscillator including spin-orbit potential plus quadrupole-quadrupole and spin-spin interactions is considered. New low lying spin dependent modes are analyzed. Special attention is paid to the scissors modes. A new source of nuclear magnetism, connected with counter-rotation of spins up and down around the symmetry axis (hidden angular momenta), is discovered. Its inclusion into the theory allows one to improve substantially the agreement with experimental data in the description of energies and transition probabilities of scissors modes.

  18. Hidden expectations within the Danish VET system

    DEFF Research Database (Denmark)

    Hjort-Madsen, Peder


    out) within the VET system, because of hidden expectations related to e.g. individualized responsibility, a certain student behavior (sitting still, participating actively), etc. By approaching the VET system as a cultural context (cultural praxis) the subtle reproductive mechanisms of the VET system...... are shown. With empirical examples from different introductory VET courses, it is shown how the school, the teachers and the students themselves are reproducing poor school performance and student background – being it gendered, ethnical or social – and hereby proving to the students, that school......Researching the pressing retention and dropout problems of the Danish VET system (app. 20 pct. of a year group never achieve an upper secondary education) this paper takes its point of departure in the hypothesis that low performing students are kept in a marginal position (at the risk of dropping...

  19. Hidden baryons: The physics of Compton composites (United States)

    Mayer, Frederick J.


    A large fraction of the mass-energy of the Universe appears to be composed of Compton composites. How is it then that these composites are not frequently observed in experiments? This paper addresses this question, and others, by reviewing recent publications that: 1) introduced Compton composites, 2) showed how and where they are formed and 3) explained how they interact with other systems. Though ubiquitous in many physical situations, Compton composites are almost completely hidden in experiments due to their unique interaction characteristics. Still, their presence has been indirectly observed, though not interpreted as such until recently. Looking to the future, direct-detection experiments are proposed that could verify the composites' components. It is with deep sadness that I dedicate this paper to my mentor, collaborator, and friend, Dr. John R. Reitz, who passed away within days of the publication of our paper “Compton Composites Late in the Early Universe”.

  20. Aluminium Diphosphamethanides: Hidden Frustrated Lewis Pairs. (United States)

    Styra, Steffen; Radius, Michael; Moos, Eric; Bihlmeier, Angela; Breher, Frank


    The synthesis and characterisation of two aluminium diphosphamethanide complexes, [Al(tBu)2 {κ(2) P,P'-Mes*PCHPMes*}] (3) and [Al(C6 F5 )2 {κ(2) P,P'-Mes*PCHPMes*}] (4), and the silylated analogue, Mes*PCHP(SiMe3 )Mes* (5), are reported. The aluminium complexes feature four-membered PCPAl core structures consisting of diphosphaallyl ligands. The silylated phosphine 5 was found to be a valuable precursor for the synthesis of 4 as it cleanly reacts with the diaryl aluminium chloride [(C6 F5 )2 AlCl]2 . The aluminium complex 3 reacts with molecular dihydrogen at room temperature under formation of the acyclic σ(2) λ(3) ,σ(3) λ(3) -diphosphine Mes*PCHP(H)Mes* and the corresponding dialkyl aluminium hydride [tBu2 AlH]3 . Thus, 3 belongs to the family of so-called hidden frustrated Lewis pairs.

  1. Wavelet domain hidden markovian bayesian document segmentation

    Institute of Scientific and Technical Information of China (English)

    Sun Junxi; Xiao Changyan; Zhang Su; Chen Yazhu


    A novel algorithm for Bayesian document segmentation is proposed based on the wavelet domain hidden Markov tree (HMT) model. Once the parameters of model are known, according to the sequential maximum a posterior probability (SMAP) rule, firstly, the likelihood probability of HMT model for each pattern is computed from fine to coarse procedure. Then, the interscale state transition probability is solved using Expectation Maximum (EM) algorithm based on hybrid-quadtree and multiscale context information is fused from coarse to fine procedure. In order to get pixellevel segmentation, the redundant wavelet domain Gaussian mixture model (GMM) is employed to formulate pixel-level statistical property. The experiment results show that the proposed scheme is feasible and robust.

  2. The Detection of Hidden Periodicities in EEG

    Institute of Scientific and Technical Information of China (English)

    YOU Rong-yi


    Abstract.A novel method for detecting the hidden periodicities in EEG is proposed.By using a width-varying window in the time domain, the structure function of EEG time series is defined. It is found that the minima of the structure function, within a finite window width, can be found regularly, which indicate that there are some certain periodicities associated with EEG time series. Based on the structure function, a further quadratic structure function of EEG time series is defined. By quadratic structure function, it can be seen that the periodicities of EEG become more obvious, moreover, the period of EEG can be determined accurately. These results will be meaningful for studying the neuron activity inside the human brain.

  3. Hidden fungi, emergent properties: endophytes and microbiomes. (United States)

    Porras-Alfaro, Andrea; Bayman, Paul


    Endophytes are microorganisms that live within plant tissues without causing symptoms of disease. They are important components of plant microbiomes. Endophytes interact with, and overlap in function with, other core microbial groups that colonize plant tissues, e.g., mycorrhizal fungi, pathogens, epiphytes, and saprotrophs. Some fungal endophytes affect plant growth and plant responses to pathogens, herbivores, and environmental change; others produce useful or interesting secondary metabolites. Here, we focus on new techniques and approaches that can provide an integrative understanding of the role of fungal endophytes in the plant microbiome. Clavicipitaceous endophytes of grasses are not considered because they have unique properties distinct from other endophytes. Hidden from view and often overlooked, endophytes are emerging as their diversity, importance for plant growth and survival, and interactions with other organisms are revealed.

  4. A New Hidden Web Crawling Approach

    Directory of Open Access Journals (Sweden)



    Full Text Available Traditional search engines deal with the Surface Web which is a set of Web pages directly accessible through hyperlinks and ignores a large part of the Web called hidden Web which is a great amount of valuable information of online database which is “hidden” behind the query forms. To access to those information the crawler have to fill the forms with a valid data, for this reason we propose a new approach which use SQLI technique in order to find the most promising keywords of a specific domain for automatic form submission. The effectiveness of proposed framework has been evaluated through experiments using real web sites and encouraging preliminary results were obtained

  5. Probabilistic Resilience in Hidden Markov Models (United States)

    Panerati, Jacopo; Beltrame, Giovanni; Schwind, Nicolas; Zeltner, Stefan; Inoue, Katsumi


    Originally defined in the context of ecological systems and environmental sciences, resilience has grown to be a property of major interest for the design and analysis of many other complex systems: resilient networks and robotics systems other the desirable capability of absorbing disruption and transforming in response to external shocks, while still providing the services they were designed for. Starting from an existing formalization of resilience for constraint-based systems, we develop a probabilistic framework based on hidden Markov models. In doing so, we introduce two new important features: stochastic evolution and partial observability. Using our framework, we formalize a methodology for the evaluation of probabilities associated with generic properties, we describe an efficient algorithm for the computation of its essential inference step, and show that its complexity is comparable to other state-of-the-art inference algorithms.

  6. Identifying Exotic Hidden-Charm Pentaquarks. (United States)

    Chen, Rui; Liu, Xiang; Li, Xue-Qian; Zhu, Shi-Lin


    The LHCb Collaboration at the Large Hadron Collider at CERN discovered two pentaquark states P_{c}(4380) and P_{c}(4450). These two hidden-charm states are interpreted as the loosely bound Σ_{c}(2455)D^{*} and Σ_{c}^{*}(2520)D^{*} molecular states in the boson exchange interaction model, which provides an explanation for why the experimental width of P_{c}(4450) is much narrower than that of P_{c}(4380). The discovery of the new resonances P_{c}(4380) and P_{c}(4450), indeed, opens a new page for hadron physics. The partners of P_{c}(4380) and P_{c}(4450) should be pursued in future experiments.

  7. Using HPGe detector for a solar hidden-photons search

    CERN Document Server

    Horvat, R; Krcmar, M; Krecak, Z; Ljubicic, A


    In this paper we report on the results of our search for photons from a U(1) gauge factor in the hidden sector of the full theory, by observing the single spectrum in a HPGe detector arising as a result of the photoelectric-like absorption of hidden photons emitted from the Sun on germanium atoms inside the detector. The main ingredient of the theory used in our analysis, a severely constrained kinetic mixing from the two U(1) gauge factors and massive hidden photons, leads to both photon into hidden states oscillations and to a minuscule coupling of hidden photons to visible matter, of which the latter our experimental setup has been designed to observe. On a theoretical side, full account was taken of the effects of refraction and damping of photons while propagating in the Sun's interior. We exclude hidden photons with kinetic couplings chi > (1.5x10^{-6}-2.6x10^{-11}) for the mass region 1.7x10^{-4} eV < m_\\gamma' < 3.4 eV. Our constraints on the mixing parameter chi at sub-eV hidden-photon masses p...

  8. Hidden photon dark matter search with large metallic mirror

    Energy Technology Data Exchange (ETDEWEB)

    Doebrich, Babette; Lindner, Axel [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Daumiller, Kai; Engel, Ralph; Roth, Markus [Karlsruher Institut fuer Technologie (KIT), Karlsruhe (Germany); Kowalski, Marek [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Humboldt-Universitaet, Berlin (Germany). Inst. fuer Physik; Redondo, Javier [Zaragoza Univ. (Spain)


    If Dark Matter is composed of hidden-sector photons that kinetically mix with photons of the visible sector, then Dark Matter has a tiny oscillating electric field component. Its presence would lead to a small amount of visible radiation being emitted from a conducting surface, with the photon frequency given approximately by the mass of the hidden photon. Here, we report on experimental efforts that have started recently to search for such hidden photon Dark Matter in the (sub-)eV regime with a prototype mirror for the Auger fluorescence detector at the Karlsruhe Institute for Technology.

  9. Suppressing the QCD axion abundance by hidden monopoles

    Energy Technology Data Exchange (ETDEWEB)

    Kawasaki, Masahiro [Tokyo Univ., Chiba (Japan). Inst. for Cosmic Ray Research; Tokyo Univ., Chiba (Japan). Kavli IPMU (WPI), UTIAS; Takahashi, Fuminobu [Tokyo Univ., Miyagi (Japan). Dept. of Physics; Tokyo Univ., Chiba (Japan). Kavli IPMU (WPI), UTIAS; Yamada, Masaki [Tokyo Univ., Chiba (Japan). Inst. for Cosmic Ray Research; Tokyo Univ., Chiba (Japan). Kavli IPMU (WPI), UTIAS; DESY Hamburg (Germany)


    We study the Witten effect of hidden monopoles on the QCD axion dynamics, and show that its abundance as well as isocurvature perturbations can be significantly suppressed if there is a sufficient amount of hidden monopoles. When the hidden monopoles make up a significant fraction of dark matter, the Witten effect suppresses the abundance of axion with the decay constant smaller than 10{sup 12} GeV. The cosmological domain wall problem of the QCD axion can also be avoided, relaxing the upper bound on the decay constant when the Peccei-Quinn symmetry is spontaneously broken after inflation.

  10. Suppressing the QCD axion abundance by hidden monopoles

    Directory of Open Access Journals (Sweden)

    Masahiro Kawasaki


    Full Text Available We study the Witten effect of hidden monopoles on the QCD axion dynamics, and show that its abundance as well as isocurvature perturbations can be significantly suppressed if there is a sufficient amount of hidden monopoles. When the hidden monopoles make up a significant fraction of dark matter, the Witten effect suppresses the abundance of axion with the decay constant smaller than 1012GeV. The cosmological domain wall problem of the QCD axion can also be avoided, relaxing the upper bound on the decay constant when the Peccei–Quinn symmetry is spontaneously broken after inflation.

  11. Naturally light hidden photons in LARGE volume string compactifications

    Energy Technology Data Exchange (ETDEWEB)

    Goodsell, M. [LPTHE, Univ. Pierre et Marie Curie, Paris (France); Jaeckel, J. [Inst. for Particle Physics Phenomenology, Univ. Durham (United Kingdom); Redondo, J.; Ringwald, A. [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)


    Extra ''hidden'' U(1) gauge factors are a generic feature of string theory that is of particular phenomenological interest. They can kinetically mix with the Standard Model photon and are thereby accessible to a wide variety of astrophysical and cosmological observations and laboratory experiments. In this paper we investigate the masses and the kinetic mixing of hidden U(1)s in LARGE volume compactifications of string theory. We find that in these scenarios the hidden photons can be naturally light and that their kinetic mixing with the ordinary electromagnetic photon can be of a size interesting for near future experiments and observations. (orig.)

  12. Experience of Using a Multi-Cathode Counter (MCC) in a Search for Hidden Photon CDM

    CERN Document Server

    Kopylov, A V; Petukhov, V V


    We report on a new technique of a Multi-Cathode Counter (MCC) developed to search for hidden photon (HP) cold dark matter (CDM) with a mass from 5 to 500 eV. The method suggested in the assumption that hidden photons of the mass greater than a work function of the metal, the cathode of the counter is fabricated induce emission of single electrons from a cathode. Three configurations of the same counter are used to measure the count rates R1, R2 and R3 of the single electron events during several weeks. As a measure of the effect from HP the difference R1-(R2-D3/D2xR3) has been used. Some preliminary results have been obtained on a first try to search for HP with a mass from 5 to 500 eV. The upper limit for mixing parameter X has been set on the level of 3.3x10-10 for hidden photon mass from 9 to 100 eV. In our plans is to refine the procedure of data treatment and to continue the measurements to collect more data.

  13. Influential factors on learning through the hidden curriculum in the perspective of undergraduate baccalaureate nursing students

    Directory of Open Access Journals (Sweden)



    Full Text Available Introduction: Nursing curriculum is not always overt; it can also exist covertly in the form of a hidden curriculum. This study aims to explain the factors influencing learning through the hidden curriculum in the perspective of undergraduate baccalaureate nursing students. Method: This qualitative study was conducted through purposeful sampling strategy on 24 undergraduate baccalaureate nursing students studying in the first to the fourth years of their education. The data were collected using semistructured interviews and this process continued until data saturation and categories’ emergence. Inductive content analysis was used for data analysis. Results: Professional promotion as a learning factor, impact of personal characteristics on learning, educator’s behavior as a learning stimulus, and feedback as a learning stimulus are the main categories emerged in this study; some of them included sub-categories as well. Conclusion: Professional promotion, personal characteristics, educator’s behavior and feedback were the main influencing factors on learning through the hidden curriculum in undergraduate baccalaureate nursing students. The findings of this study can be used for developing strategies to promote nursing education and as a result patient care. Further studies are recommended to identify other factors.

  14. Landmine detection using discrete hidden Markov models with Gabor features (United States)

    Frigui, Hichem; Missaoui, Oualid; Gader, Paul


    We propose a general method for detecting landmine signatures in vehicle mounted ground penetrating radar (GPR) using discrete hidden Markov models and Gabor wavelet features. Observation vectors are constructed based on the expansion of the signature's B-scan using a bank of scale and orientation selective Gabor filters. This expansion provides localized frequency description that gets encoded in the observation sequence. These observations do not impose an explicit structure on the mine model, and are used to naturally model the time-varying signatures produced by the interaction of the GPR and the landmines as the vehicle moves. The proposed method is evaluated on real data collected by a GPR mounted on a moving vehicle at three different geographical locations that include several lanes. The model parameters are optimized using the BaumWelch algorithm, and lane-based cross-validation, in which each mine lane is in turn treated as a test set with the rest of the lanes used for training, is used to train and test the model. Preliminary results show that observations encoded with Gabor wavelet features perform better than observation encoded with gradient-based edge features.

  15. Optical character recognition of handwritten Arabic using hidden Markov models

    Energy Technology Data Exchange (ETDEWEB)

    Aulama, Mohannad M. [University of Jordan; Natsheh, Asem M. [University of Jordan; Abandah, Gheith A. [University of Jordan; Olama, Mohammed M [ORNL


    The problem of optical character recognition (OCR) of handwritten Arabic has not received a satisfactory solution yet. In this paper, an Arabic OCR algorithm is developed based on Hidden Markov Models (HMMs) combined with the Viterbi algorithm, which results in an improved and more robust recognition of characters at the sub-word level. Integrating the HMMs represents another step of the overall OCR trends being currently researched in the literature. The proposed approach exploits the structure of characters in the Arabic language in addition to their extracted features to achieve improved recognition rates. Useful statistical information of the Arabic language is initially extracted and then used to estimate the probabilistic parameters of the mathematical HMM. A new custom implementation of the HMM is developed in this study, where the transition matrix is built based on the collected large corpus, and the emission matrix is built based on the results obtained via the extracted character features. The recognition process is triggered using the Viterbi algorithm which employs the most probable sequence of sub-words. The model was implemented to recognize the sub-word unit of Arabic text raising the recognition rate from being linked to the worst recognition rate for any character to the overall structure of the Arabic language. Numerical results show that there is a potentially large recognition improvement by using the proposed algorithms.

  16. Optical character recognition of handwritten Arabic using hidden Markov models (United States)

    Aulama, Mohannad M.; Natsheh, Asem M.; Abandah, Gheith A.; Olama, Mohammed M.


    The problem of optical character recognition (OCR) of handwritten Arabic has not received a satisfactory solution yet. In this paper, an Arabic OCR algorithm is developed based on Hidden Markov Models (HMMs) combined with the Viterbi algorithm, which results in an improved and more robust recognition of characters at the sub-word level. Integrating the HMMs represents another step of the overall OCR trends being currently researched in the literature. The proposed approach exploits the structure of characters in the Arabic language in addition to their extracted features to achieve improved recognition rates. Useful statistical information of the Arabic language is initially extracted and then used to estimate the probabilistic parameters of the mathematical HMM. A new custom implementation of the HMM is developed in this study, where the transition matrix is built based on the collected large corpus, and the emission matrix is built based on the results obtained via the extracted character features. The recognition process is triggered using the Viterbi algorithm which employs the most probable sequence of sub-words. The model was implemented to recognize the sub-word unit of Arabic text raising the recognition rate from being linked to the worst recognition rate for any character to the overall structure of the Arabic language. Numerical results show that there is a potentially large recognition improvement by using the proposed algorithms.

  17. The perception of the hidden curriculum on medical education: an exploratory study

    Directory of Open Access Journals (Sweden)

    Murakami Manabu


    Full Text Available Abstract Background Major curriculum reform of undergraduate medical education occurred during the past decades in the United Kingdom (UK; however, the effects of the hidden curriculum, which influence the choice of primary care as a career, have not been sufficiently recognized. While Japan, where traditionally few institutions systematically foster primary care physicians and very few have truly embraced family medicine as their guiding discipline, has also experienced meaningful curriculum reform, the effect of the hidden curriculum is not well known. The aim of this study is to identify themes pertaining to the students' perceptions of the hidden curriculum affecting undergraduate medical education in bedside learning in Japan. Methods Semi-structured interviews with thematic content analysis were implemented. Undergraduate year-5 students from a Japanese medical school at a Japanese teaching hospital were recruited. Interview were planned to last between 30 to 60 minutes each, over an 8-month period in 2007. The interviewees' perceptions concerning the quality of teaching in their bedside learning and related experiences were collected and analysed thematically. Results Twenty five medical students (18 males and 7 females, mean age 25 years old consented to participate in the interviews, and seven main themes emerged: "the perception of education as having a low priority," "the prevalence of positive/negative role models," "the persistence of hierarchy and exclusivity," "the existence of gender issues," "an overburdened medical knowledge," "human relationships with colleagues and medical team members," and "first experience from the practical wards and their patients." Conclusions Both similarities and differences were found when comparing the results to those of previous studies in the UK. Some effects of the hidden curriculum in medical education likely exist in common between the UK and Japan, despite the differences in their demographic

  18. Isovector and hidden-beauty partners of the X(3872)

    Energy Technology Data Exchange (ETDEWEB)

    Høgaasen, Hallstein, E-mail: [Department of Physics, University of Oslo, Box 1048, NO-0316 Oslo (Norway); Kou, Emi, E-mail: [Laboratoire de l' Accélérateur Linéaire, Université Paris-Sud, IN2P3-CNRS, Centre Scientifique d' Orsay, 91898 Orsay Cedex (France); Richard, Jean-Marc, E-mail: [Université de Lyon, Institut de Physique Nucléaire de Lyon, UCBL–IN2P3-CNRS, 4, rue Enrico Fermi, 69622 Villeurbanne Cedex (France); Sorba, Paul, E-mail: [LAPTh, Laboratoire d' Annecy-le-Vieux de Physique Théorique, CNRS, Université de Savoie, BP 110, 74941 Annecy-le-Vieux Cedex (France)


    The isovector partners of the X(3872), recently found at BES III, Belle and CLEO-c were predicted in a simple model based on the chromomagnetic interaction among quarks. The extension to the hidden-beauty sector is discussed.

  19. Local clustering in scale-free networks with hidden variables. (United States)

    van der Hofstad, Remco; Janssen, A J E M; van Leeuwaarden, Johan S H; Stegehuis, Clara


    We investigate the presence of triangles in a class of correlated random graphs in which hidden variables determine the pairwise connections between vertices. The class rules out self-loops and multiple edges. We focus on the regime where the hidden variables follow a power law with exponent τ∈(2,3), so that the degrees have infinite variance. The natural cutoff h_{c} characterizes the largest degrees in the hidden variable models, and a structural cutoff h_{s} introduces negative degree correlations (disassortative mixing) due to the infinite-variance degrees. We show that local clustering decreases with the hidden variable (or degree). We also determine how the average clustering coefficient C scales with the network size N, as a function of h_{s} and h_{c}. For scale-free networks with exponent 2vanish only for networks as large as N=10^{9}.

  20. A Bell-type Theorem Without Hidden Variables

    CERN Document Server

    Stapp, Henry P


    Bell's theorem rules out local hidden-variable theories. The locality condition is the demand that what an experimenter freely chooses to measure in one space-time region has no influence in a second space-time region that is spacelike separated from the first. The hidden-variable stipulation means that this demand is implemented through requirements on an assumed-to-exist substructure involving hidden variables. The question thus arises whether the locality condition itself fails, or only its implementation by means of the assumed hidden-variable structure. This paper shows that any theory that satisfies two generally accepted features of orthodox quantum theory and that yields certain predictions of quantum theory cannot satisfy the afore-mentioned locality condition. These two features are that the choices made by the experimenters can be treated as localized free variables and that such free choices do not affect outcomes that have already occurred.

  1. Modelling proteins' hidden conformations to predict antibiotic resistance (United States)

    Hart, Kathryn M.; Ho, Chris M. W.; Dutta, Supratik; Gross, Michael L.; Bowman, Gregory R.


    TEM β-lactamase confers bacteria with resistance to many antibiotics and rapidly evolves activity against new drugs. However, functional changes are not easily explained by differences in crystal structures. We employ Markov state models to identify hidden conformations and explore their role in determining TEM's specificity. We integrate these models with existing drug-design tools to create a new technique, called Boltzmann docking, which better predicts TEM specificity by accounting for conformational heterogeneity. Using our MSMs, we identify hidden states whose populations correlate with activity against cefotaxime. To experimentally detect our predicted hidden states, we use rapid mass spectrometric footprinting and confirm our models' prediction that increased cefotaxime activity correlates with reduced Ω-loop flexibility. Finally, we design novel variants to stabilize the hidden cefotaximase states, and find their populations predict activity against cefotaxime in vitro and in vivo. Therefore, we expect this framework to have numerous applications in drug and protein design.

  2. Recent Applications of Hidden Markov Models in Computational Biology

    Institute of Scientific and Technical Information of China (English)

    Khar Heng Choo; Joo Chuan Tong; Louxin Zhang


    This paper examines recent developments and applications of Hidden Markov Models (HMMs) to various problems in computational biology, including multiple sequence alignment, homology detection, protein sequences classification, and genomic annotation.

  3. Self-similarity of complex networks and hidden metric spaces

    CERN Document Server

    Serrano, M Angeles; Boguna, Marian


    We demonstrate that the self-similarity of some scale-free networks with respect to a simple degree-thresholding renormalization scheme finds a natural interpretation in the assumption that network nodes exist in hidden metric spaces. Clustering, i.e., cycles of length three, plays a crucial role in this framework as a topological reflection of the triangle inequality in the hidden geometry. We prove that a class of hidden variable models with underlying metric spaces are able to accurately reproduce the self-similarity properties that we measured in the real networks. Our findings indicate that hidden geometries underlying these real networks are a plausible explanation for their observed topologies and, in particular, for their self-similarity with respect to the degree-based renormalization.

  4. Search for hidden particles with the SHiP experiment

    Energy Technology Data Exchange (ETDEWEB)

    Hagner, Caren; Bick, Daniel; Bieschke, Stefan; Ebert, Joachim; Schmidt-Parzefall, Walter [Universitaet Hamburg, Institut fuer Experimentalphysik, Luruper Chaussee 149, 22761 Hamburg (Germany)


    Many theories beyond the standard model predict long lived neutral (hidden) particles. There might be a whole Hidden Sector (HS) of weakly interacting particles, which cannot be detected in existing high energy experiments. The SHiP experiment (Search for Hidden Particles) requires a high intensity beam dump, which could be realized by a new facility at the CERN SPS accelerator. New superweakly interacting particles with masses below O(10) GeV could be produced in the beam dump and detected in a general purpose Hidden Sector (HS) detector. In addition there will be a dedicated tau neutrino subdetector. I present the major requirements and technical challenges for the HS detector and discuss how the HS can be accessed through several portals: neutrino portal, scalar portal, vector portal and many more.

  5. Dark matter in the nonabelian hidden gauge theory

    CERN Document Server

    Yamanaka, Nodoka; Gongyo, Shinya; Iida, Hideaki


    We discuss the dark matter in the hidden gauge theory. We propose a scenario where the mini-inflation dilutes the dark matter density. This scenario is consistent with the current baryon number asymmetry.

  6. Hidden Symmetry from Supersymmetry in One-Dimensional Quantum Mechanics

    Directory of Open Access Journals (Sweden)

    Alexander A. Andrianov


    Full Text Available When several inequivalent supercharges form a closed superalgebra in Quantum Mechanics it entails the appearance of hidden symmetries of a Super-Hamiltonian. We examine this problem in one-dimensional QM for the case of periodic potentials and potentials with finite number of bound states. After the survey of the results existing in the subject the algebraic and analytic properties of hidden-symmetry differential operators are rigorously elaborated in the Theorems and illuminated by several examples.

  7. Stabilization of stochastic systems with hidden Markovian jumps

    Institute of Scientific and Technical Information of China (English)


    This paper considers the adaptive control of discrete-time hybrid stochastic systems with unknown randomly jumping parameters described by a finite-state hidden Markov chain. An intuitive yet longstanding conjecture in this area is that such hybrid systems can be adaptively stabilized whenever the rate of transition of the hidden Markov chain is small enough. This paper provides a rigorous positive answer to this conjecture by establishing the global stability of a gradient-algorithm-based adaptive linear-quadratic control.

  8. Extracting hidden trails and roads under canopy using LIDAR


    Krougios, Prokopios


    The field of Remote Sensing has been greatly benefited by the development of LIDAR. The extraction of bare earth under tree canopies and especially the identification of hidden trails are important tools for military and civilian operations in dense forests. LIDAR data from Sequoia National Park in California (2008) and Fort Belvoir Military Base in Virginia (2007) were two areas that were selected for analysis. Quick Terrain Modeler software was used in order to recognize hidden trails....

  9. Physical nature of a hidden mass in the Universe

    Energy Technology Data Exchange (ETDEWEB)

    Doroshkevich, A.G.; Khlopov, M.Yu. (AN SSSR, Moscow. Inst. Prikladnoj Matematiki)


    The problem of an origin of the hidden mass of the Universe is discussed. Observation astronomic data on large-scale Universe structure and hidden mass distribution within the framework of the adiabatic theory of galaxies formation point out the dominance in nowadays Universe of weakly-interacting particles with 15-60 eV mass. Restrictions are obtained for a possible admixture of other relict particles.

  10. Hidden Markov Models with Factored Gaussian Mixtures Densities

    Institute of Scientific and Technical Information of China (English)

    LI Hao-zheng; LIU Zhi-qiang; ZHU Xiang-hua


    We present a factorial representation of Gaussian mixture models for observation densities in Hidden Markov Models(HMMs), which uses the factorial learning in the HMM framework. We derive the reestimation formulas for estimating the factorized parameters by the Expectation Maximization (EM) algorithm. We conduct several experiments to compare the performance of this model structure with Factorial Hidden Markov Models(FHMMs) and HMMs, some conclusions and promising empirical results are presented.

  11. Aligning the Hidden Curriculum of Management Education With PRME

    DEFF Research Database (Denmark)

    Blasco, Maribel


    This article argues that mainstreaming responsible management education in line with the Principles of Responsible Management Education (PRME) requires close attention to the hidden curriculum (HC), that is, the implicit dimensions of educational experiences. Altering formal curricular goals...... combined with transformative learning and communities of practice theory, the article offers an inquiry-based framework for PRME implementation that takes these moral learning and socialization processes into account. It provides suggestions for how to address the hidden curriculum both in the diagnostic...

  12. Reduced-Rank Hidden Markov Models

    CERN Document Server

    Siddiqi, Sajid M; Gordon, Geoffrey J


    We introduce the Reduced-Rank Hidden Markov Model (RR-HMM), a generalization of HMMs that can model smooth state evolution as in Linear Dynamical Systems (LDSs) as well as non-log-concave predictive distributions as in continuous-observation HMMs. RR-HMMs assume an m-dimensional latent state and n discrete observations, with a transition matrix of rank k <= m. This implies the dynamics evolve in a k-dimensional subspace, while the shape of the set of predictive distributions is determined by m. Latent state belief is represented with a k-dimensional state vector and inference is carried out entirely in R^k, making RR-HMMs as computationally efficient as k-state HMMs yet more expressive. To learn RR-HMMs, we relax the assumptions of a recently proposed spectral learning algorithm for HMMs (Hsu, Kakade and Zhang 2009) and apply it to learn k-dimensional observable representations of rank-k RR-HMMs. The algorithm is consistent and free of local optima, and we extend its performance guarantees to cover the RR-...

  13. Search algorithms, hidden labour and information control

    Directory of Open Access Journals (Sweden)

    Paško Bilić


    Full Text Available The paper examines some of the processes of the closely knit relationship between Google’s ideologies of neutrality and objectivity and global market dominance. Neutrality construction comprises an important element sustaining the company’s economic position and is reflected in constant updates, estimates and changes to utility and relevance of search results. Providing a purely technical solution to these issues proves to be increasingly difficult without a human hand in steering algorithmic solutions. Search relevance fluctuates and shifts through continuous tinkering and tweaking of the search algorithm. The company also uses third parties to hire human raters for performing quality assessments of algorithmic updates and adaptations in linguistically and culturally diverse global markets. The adaptation process contradicts the technical foundations of the company and calculations based on the initial Page Rank algorithm. Annual market reports, Google’s Search Quality Rating Guidelines, and reports from media specialising in search engine optimisation business are analysed. The Search Quality Rating Guidelines document provides a rare glimpse into the internal architecture of search algorithms and the notions of utility and relevance which are presented and structured as neutral and objective. Intertwined layers of ideology, hidden labour of human raters, advertising revenues, market dominance and control are discussed throughout the paper.

  14. A hidden classical symmetry of QCD

    CERN Document Server

    Glozman, L Ya


    The classical part of the QCD partition function (the integrand) has, ignoring irrelevant exact zero modes of the Dirac operator, a local SU(2N_F) \\supset SU(N_F)_L \\times SU(N_F)_R \\times U(1)_A symmetry which is absent at the Lagrangian level. This symmetry is broken anomalously and spontaneously. Effects of spontaneous breaking of chiral symmetry are contained in the near-zero modes of the Dirac operator. If physics of anomaly is also encoded in the same near-zero modes, then their truncation on the lattice should recover a hidden classical SU(2N_F) symmetry in correlators and spectra. This naturally explains observation on the lattice of a large degeneracy of hadrons, that is higher than the SU(N_F)_L \\times SU(N_F)_R \\times U(1)_A chiral symmetry, upon elimination by hands of the lowest-lying modes of the Dirac operator. We also discuss an implication of this symmetry for the high temperature QCD.

  15. Seiberg duality versus hidden local symmetry

    CERN Document Server

    Abel, Steven


    It is widely believed that the emergent magnetic gauge symmetry of SQCD is analogous to a hidden local symmetry (HLS). We explore this idea in detail, deriving the entire (spontaneously broken) magnetic theory by applying the HLS formalism to spontaneously broken SU(N) SQCD. We deduce the K\\"ahler potential in the HLS description, and show that gauge and flavour symmetry are smoothly restored along certain scaling directions in moduli space. We propose that it is these symmetry restoring directions, associated with the R-symmetry of the theory, that allow full Seiberg duality. Reconsidering the origin of the magnetic gauge bosons as the rho-mesons of the electric theory, colour-flavour locking allows a simple determination of the parameter "a". Its value continuously interpolates between a=2 on the baryonic branch of moduli space - corresponding to "vector meson dominance" - and a=1 on the mesonic branch. Both limiting values are consistent with previous results in the literature. The HLS formalism is further...

  16. Natural inflation with hidden scale invariance

    Directory of Open Access Journals (Sweden)

    Neil D. Barrie


    Full Text Available We propose a new class of natural inflation models based on a hidden scale invariance. In a very generic Wilsonian effective field theory with an arbitrary number of scalar fields, which exhibits scale invariance via the dilaton, the potential necessarily contains a flat direction in the classical limit. This flat direction is lifted by small quantum corrections and inflation is realised without need for an unnatural fine-tuning. In the conformal limit, the effective potential becomes linear in the inflaton field, yielding to specific predictions for the spectral index and the tensor-to-scalar ratio, being respectively: ns−1≈−0.025(N⋆60−1 and r≈0.0667(N⋆60−1, where N⋆≈30–65 is a number of efolds during observable inflation. This predictions are in reasonable agreement with cosmological measurements. Further improvement of the accuracy of these measurements may turn out to be critical in falsifying our scenario.

  17. Search algorithms, hidden labour and information control

    Directory of Open Access Journals (Sweden)

    Paško Bilić


    Full Text Available The paper examines some of the processes of the closely knit relationship between Google’s ideologies of neutrality and objectivity and global market dominance. Neutrality construction comprises an important element sustaining the company’s economic position and is reflected in constant updates, estimates and changes to utility and relevance of search results. Providing a purely technical solution to these issues proves to be increasingly difficult without a human hand in steering algorithmic solutions. Search relevance fluctuates and shifts through continuous tinkering and tweaking of the search algorithm. The company also uses third parties to hire human raters for performing quality assessments of algorithmic updates and adaptations in linguistically and culturally diverse global markets. The adaptation process contradicts the technical foundations of the company and calculations based on the initial Page Rank algorithm. Annual market reports, Google’s Search Quality Rating Guidelines, and reports from media specialising in search engine optimisation business are analysed. The Search Quality Rating Guidelines document provides a rare glimpse into the internal architecture of search algorithms and the notions of utility and relevance which are presented and structured as neutral and objective. Intertwined layers of ideology, hidden labour of human raters, advertising revenues, market dominance and control are discussed throughout the paper.

  18. Natural Inflation with Hidden Scale Invariance

    CERN Document Server

    Barrie, Neil D; Liang, Shelley


    We propose a new class of natural inflation models based on a hidden scale invariance. In a very generic Wilsonian effective field theory with an arbitrary number of scalar fields, which exhibits scale invariance via the dilaton, the potential necessarily contains a flat direction in the classical limit. This flat direction is lifted by small quantum corrections and inflation is realised without need for an unnatural fine-tuning. In the conformal limit, the effective potential becomes linear in the inflaton field, yielding to specific predictions for the spectral index and the tensor-to-scalar ratio, being respectively: $n_s-1\\approx 0.025\\left(\\frac{N_{\\star}}{60}\\right)^{-1}$ and $r\\approx 0.0667\\left(\\frac{N_{\\star}}{60}\\right)^{-1}$, where $N_{\\star}\\approx 30-65$ is a number of efolds during observable inflation. This predictions are in reasonable agreement with cosmological measurements. Further improvement of the accuracy of these measurements may turn out to be critical in falsifying our scenario.

  19. Hidden Markov models in automatic speech recognition (United States)

    Wrzoskowicz, Adam


    This article describes a method for constructing an automatic speech recognition system based on hidden Markov models (HMMs). The author discusses the basic concepts of HMM theory and the application of these models to the analysis and recognition of speech signals. The author provides algorithms which make it possible to train the ASR system and recognize signals on the basis of distinct stochastic models of selected speech sound classes. The author describes the specific components of the system and the procedures used to model and recognize speech. The author discusses problems associated with the choice of optimal signal detection and parameterization characteristics and their effect on the performance of the system. The author presents different options for the choice of speech signal segments and their consequences for the ASR process. The author gives special attention to the use of lexical, syntactic, and semantic information for the purpose of improving the quality and efficiency of the system. The author also describes an ASR system developed by the Speech Acoustics Laboratory of the IBPT PAS. The author discusses the results of experiments on the effect of noise on the performance of the ASR system and describes methods of constructing HMM's designed to operate in a noisy environment. The author also describes a language for human-robot communications which was defined as a complex multilevel network from an HMM model of speech sounds geared towards Polish inflections. The author also added mandatory lexical and syntactic rules to the system for its communications vocabulary.

  20. Stochastic precipitation generator with hidden state covariates (United States)

    Kim, Yongku; Lee, GyuWon


    Time series of daily weather such as precipitation, minimum temperature and maximum temperature are commonly required for various fields. Stochastic weather generators constitute one of the techniques to produce synthetic daily weather. The recently introduced approach for stochastic weather generators is based on generalized linear modeling (GLM) with covariates to account for seasonality and teleconnections (e.g., with the El Niño). In general, stochastic weather generators tend to underestimate the observed interannual variance of seasonally aggregated variables. To reduce this overdispersion, we incorporated time series of seasonal dry/wet indicators in the GLM weather generator as covariates. These seasonal time series were local (or global) decodings obtained by a hidden Markov model of seasonal total precipitation and implemented in the weather generator. The proposed method is applied to time series of daily weather from Seoul, Korea and Pergamino, Argentina. This method provides a straightforward translation of the uncertainty of the seasonal forecast to the corresponding conditional daily weather statistics.

  1. Academic mobbing: hidden health hazard at workplace. (United States)

    Khoo, Sb


    Academic mobbing is a non-violent, sophisticated, 'ganging up' behaviour adopted by academicians to "wear and tear" a colleague down emotionally through unjustified accusation, humiliation, general harassment and emotional abuse. These are directed at the target under a veil of lies and justifications so that they are "hidden" to others and difficult to prove. Bullies use mobbing activities to hide their own weaknesses and incompetence. Targets selected are often intelligent, innovative high achievers, with good integrity and principles. Mobbing activities appear trivial and innocuous on its own but the frequency and pattern of their occurrence over long period of time indicates an aggressive manipulation to "eliminate" the target. Mobbing activities typically progress through five stereotypical phases that begins with an unsolved minor conflict between two workers and ultimately escalates into a senseless mobbing whereby the target is stigmatized and victimized to justify the behaviours of the bullies. The result is always physical, mental, social distress or illness and, most often, expulsion of target from the workplace. Organizations are subjected to great financial loss, loss of key workers and a tarnished public image and reputation. Public awareness, education, effective counselling, establishment of anti-bullying policies and legislations at all levels are necessary to curb academic mobbing. General practitioners (GPs) play an important role in supporting patients subjected to mental and physical health injury caused by workplace bullying and mobbing.

  2. Coulomb gauge model for hidden charm tetraquarks (United States)

    Xie, W.; Mo, L. Q.; Wang, Ping; Cotanch, Stephen R.


    The spectrum of tetraquark states with hidden charm is studied within an effective Coulomb gauge Hamiltonian approach. Of the four independent color schemes, two are investigated, the (qcbar)1(cqbar)1 singlet-singlet (molecule) and the (qc)3(qbarcbar)3 triplet-triplet (diquark), for selected JPC states using a variational method. The predicted masses of triplet-triplet tetraquarks are roughly a GeV heavier than the singlet-singlet states. There is also an interesting flavor dependence with (qqbar)1 (ccbar1) states about half a GeV lighter than (qcbar)1(qbarc)1. The lightest 1++ and 1-- predictions are in agreement with the observed X (3872) and Y (4008) masses suggesting they are molecules with ωJ / ψ and ηhc, rather than D*Dbar* and DDbar, type structure, respectively. Similarly, the lightest isovector 1++ molecule, having a ρJ / ψ flavor composition, has mass near the recently observed charged Zc (3900) value. These flavor configurations are consistent with observed X, Y and Zc decays to ππJ / ψ.

  3. Hidden topological angles and Lefschetz thimbles

    CERN Document Server

    Behtash, Alireza; Schaefer, Thomas; Unsal, Mithat


    We demonstrate the existence of hidden topological angles (HTAs) in a large class of quantum field theories and quantum mechanical systems. HTAs are distinct from theta-parameters in the lagrangian. They arise as invariant angle associated with saddle points of the complexified path integral and their descent manifolds (Lefschetz thimbles). Physical effects of HTAs become most transparent upon analytic continuation in $n_f$ to non-integer number of flavors, reducing in the integer $n_f$ limit to a $\\mathbb Z_2$ valued phase difference between dominant saddles. In ${\\cal N}=1$ super Yang-Mills theory we demonstrate the microscopic mechanism for the vanishing of the gluon condensate. The same effect leads to an anomalously small condensate in a QCD-like $SU(N)$ gauge theory with fermions in the two-index representation. The basic phenomenon is that, contrary to folklore, the gluon condensate can receive both positive and negative contributions in a semi-classical expansion. In quantum mechanics, a HTA leads to ...

  4. Detecting hidden sources-STUK/HUT team

    Energy Technology Data Exchange (ETDEWEB)

    Nikkinen, M.; Aarnio, P. [Helsinki Univ. of Technology, Espoo (Finland); Honkamaa, T.; Tiilikainen, H. [Finnish Centre for Radiation and Nuclear Safety, Helsinki (Finland)


    The task of the team was to locate and to identify hidden sources in a specified area in Padasjoki Auttoinen village. The team used AB-420 helicopter of the Finnish Frontier Guard. The team had two measuring systems: HPGe system (relative efficiency 18%) and 5`x5` NaI system. The team found two sources in real-time and additional two sources after 24 h analysis time. After the locations and characteristics of the sources were announced it was found out that altogether six sources would have been possible to find using the measured data. The total number of sources was ten. The NaI detector was good at detecting and locating the sources and HPGe was most useful in identification and calculation of the activity estimates. The following development should be made: 1) larger detectors are needed, 2) the software has to be improved. (This has been performed after the exercise) and 3) the navigation must be based on DGPS. visual navigation causes easily gaps between the flight lines and some sources may not be detected. (au).

  5. Hidden Web Data Extraction Using Dynamic Rule Generation

    Directory of Open Access Journals (Sweden)



    Full Text Available World Wide Web is a global information medium of interlinked hypertext documents accessed via computers connected to the internet. Most of the users rely on traditional search engines to search theinformation on the web. These search engines deal with the Surface Web which is a set of Web pages directly accessible through hyperlinks and ignores a large part of the Web called Hidden Web which is hidden to present-day search engines. It lies behind search forms and this part of the web containing an almost endless amount of sources providing high quality information stored in specialized databases can be found in the depths of the WWW. A large amount of this Hidden web is structured i.e Hidden websites contain the information in the form of lists and tables. However visiting dozens of these sites and analyzing the results is very much time consuming task for user. Hence, it is desirable to build a prototype which will minimize user’s effort and give him high quality information in integrated form. This paper proposes a novel method that extracts the data records from the lists and tables of various hidden web sites of same domain using dynamic rule generation and forms a repository which is used for later searching. By searching the data from this repository, user will find the desired data at one place. It reduces the user’s effort to look at various result pages of different hidden websites.

  6. Market-oriented management method of coalmine accident hidden dangers

    Institute of Scientific and Technical Information of China (English)

    LIU Zhao-xia; LI Xing-dong; LU Ying; REN Da-wei


    By analyzing the problems which exist currently in the accident hidden dangers management of the coal mine, this paper proposed a new kind of management method-"simulating the market", in which an operation pattern of simulating the market to transact hidden troubles was constructed. This method introduces "Market Mechanism"into safe management, and adopts measurable value to describe the hidden dangers such as" human behavior, technique, environment, equipments etc.". It regards the hidden dangers as "the goods produced by labor" which are found out by the safety managers and the security inspectors, then sells as "commodity". By the process of disposing, counterchecking, re-selling, and redisposing. It forms a set of market-oriented closed-form management pattern of coalmine accident hidden dangers. This kind of management method changes the past traditional methods in which the wageworkers treat safety management passively, but to encourage and restrict them to participate in the check-up and improvement of the hidden dangers.

  7. QCD sum rule study of hidden-charm pentaquarks

    CERN Document Server

    Chen, Hua-Xing; Chen, Wei; Steele, T G; Liu, Xiang; Zhu, Shi-Lin


    We study the mass spectra of hidden-charm pentaquarks having spin $J = {1\\over2},{3\\over2},{5\\over2}$ and quark contents $uud c \\bar c$. We systematically construct all the relevant local hidden-charm pentaquark currents, and select some of them to perform QCD sum rule analyses. We find that the $P_c(4380)$ and $P_c(4450)$ can be identified as hidden-charm pentaquark states composed of an anti-charmed meson and a charmed baryon. We also find the lowest-lying hidden-charm $J^P = 1/2^-$ pentaquark state of mass $4.33^{+0.17}_{-0.13}$ GeV, while the $J^P = 1/2^+$ mass prediction of 4.7--4.9 GeV is significantly higher. Similarly, the lowest-lying hidden-charm $J^P = 3/2^-$ pentaquark state mass is $4.37^{+0.18}_{-0.13}$ GeV, consistent with the $J^P = 3/2^-$ $P_c(4380)$, while the $J^P = 3/2^+$ is also significantly higher with a mass above 4.6 GeV. The hidden-charm $J^P = 5/2^-$ pentaquark state mass is 4.5--4.6 GeV, slightly larger than the $J^P = 5/2^+$ $P_c(4450)$.


    Institute of Scientific and Technical Information of China (English)


    A new feature extraction method based on 2D-hidden Markov model(HMM) is proposed.Meanwhile the time index and frequency index are introduced to represent the new features. The new feature extraction strategy is tested by the experimental data that collected from Bently rotor experiment system. The results show that this methodology is very effective to extract the feature of vibration signals in the rotor speed-up course and can be extended to other non-stationary signal analysis fields in the future.




    Monthly counts of industrial machine part errors are modeled using a two-state Hidden Markov Model (HMM) in order to describe the effect of machine part error correction and the amount of time spent on the error correction on the likelihood of the machine part to be in a “defective” or “non-defective” state. The number of machine parts errors were collected from a thermo plastic injection molding machine in a car bumper auto parts manufacturer in Liberec city, Czech Re...

  10. Was ist das Hidden Web? Die Entstehung, Eigenschaften und gesellschaftliche Bedeutung von anonymer Kommunikation im Hidden Web.


    Papsdorf, Christian


    More than two-and-a-half million people currently use the Tor network to communicate anonymously via the Internet and gain access to online media that are not accessible using standard Internet technology. This sphere of communication can be described as the hidden web. In part because this phenomenon is very recent, the subject has scarcely been studied in the social sciences. It is therefore the purpose of this paper to answer four fundamental questions: What is the hidden web? What charact...

  11. 'Hidden messages' emerging from Afrocentric management perspectives

    Directory of Open Access Journals (Sweden)

    H. Van den Heuvel


    Full Text Available Purpose: This paper aims to examine how 'African management' discourse has emerged in South Africa. Altogether, it has stimulated debates - sometimes in controversial ways - on 'taboo issues', e.g. relating to 'cultural diversity' and 'ethnicity'. The stimulation of such debates within organisations is probably a more valuable contribution than a static, essentialised 'African identity' that it proclaims. Design/Methodology/Approach: The paper draws on a qualitative research project conducted in South Africa in 2003-2004. Its relevance lies in gaining in-depth insights into ('non-western' local management discourse. It seeks to contribute to the body of knowledge on political and cultural contexts in which South African organizations operate, and how they impact on local management perspectives, and vice versa. Findings: The research findings make clear how and under what circumstances 'African management' discourse has come about in South Africa, and how it could be interpreted. Implications: 'African management' advocates allegedly attempt to revise dominant management thinking and promote 'humane-ness' and participatory decision-making in South African organisations, in search of a contextualised management approach. Amongst others, it has produced new meanings of 'Africanness' and has opened up space for 'hidden messages', resentments and aspirations to become openly articulated. This throws another light on phenomena such as cultural diversity and ethnicity that usually tend to be 'neutralised'. This may turn out to be far healthier for blooming organisational cultures in South Africa than relentlessly hammering on prescribed 'corporate values'. Originality/Value: This paper informs the reader in detail about the emergence and evolvement of 'African management' discourse in South Africa. It is a unique attempt to develop an interpretative viewpoint on this intriguing phenomenon that offers a potentially valuable contribution in reading

  12. Foundational Forces & Hidden Variables in Technology Commercialization (United States)

    Barnett, Brandon


    The science of physics seems vastly different from the process of technology commercialization. Physics strives to understand our world through the experimental deduction of immutable laws and dependent variables and the resulting macro-scale phenomenon. In comparison, the~goal of business is to make a profit by addressing the needs, preferences, and whims of individuals in a market. It may seem that this environment is too dynamic to identify all the hidden variables and deduct the foundational forces that impact a business's ability to commercialize innovative technologies. One example of a business ``force'' is found in the semiconductor industry. In 1965, Intel co-founder Gordon Moore predicted that the number of transistors incorporated in a chip will approximately double every 24 months. Known as Moore's Law, this prediction has become the guiding principle for the semiconductor industry for the last 40 years. Of course, Moore's Law is not really a law of nature; rather it is the result of efforts by Intel and the entire semiconductor industry. A closer examination suggests that there are foundational principles of business that underlie the macro-scale phenomenon of Moore's Law. Principles of profitability, incentive, and strategic alignment have resulted in a coordinated influx of resources that has driven technologies to market, increasing the profitability of the semiconductor industry and optimizing the fitness of its participants. New innovations in technology are subject to these same principles. So, in addition to traditional market forces, these often unrecognized forces and variables create challenges for new technology commercialization. In this talk, I will draw from ethnographic research, complex adaptive theory, and industry data to suggest a framework with which to think about new technology commercialization. Intel's bio-silicon initiative provides a case study.

  13. Landmine detection using mixture of discrete hidden Markov models (United States)

    Frigui, Hichem; Hamdi, Anis; Missaoui, Oualid; Gader, Paul


    We propose a landmine detection algorithm that uses a mixture of discrete hidden Markov models. We hypothesize that the data are generated by K models. These different models reflect the fact that mines and clutter objects have different characteristics depending on the mine type, soil and weather conditions, and burial depth. Model identification could be achieved through clustering in the parameters space or in the feature space. However, this approach is inappropriate as it is not trivial to define a meaningful distance metric for model parameters or sequence comparison. Our proposed approach is based on clustering in the log-likelihood space, and has two main steps. First, one HMM is fit to each of the R individual sequence. For each fitted model, we evaluate the log-likelihood of each sequence. This will result in an R×R log-likelihood distance matrix that will be partitioned into K groups using a hierarchical clustering algorithm. In the second step, we pool the sequences, according to which cluster they belong, into K groups, and we fit one HMM to each group. The mixture of these K HMMs would be used to build a descriptive model of the data. An artificial neural networks is then used to fuse the output of the K models. Results on large and diverse Ground Penetrating Radar data collections show that the proposed method can identify meaningful and coherent HMM models that describe different properties of the data. Each HMM models a group of alarm signatures that share common attributes such as clutter, mine type, and burial depth. Our initial experiments have also indicated that the proposed mixture model outperform the baseline HMM that uses one model for the mine and one model for the background.

  14. 'Hidden identities': perceptions of sexual identity in Beijing. (United States)

    Miles-Johnson, Toby; Wang, Yurong


    This article draws upon responses given by volunteers who work in the Beijing LGBT Centre regarding perceptions of sexual identity, and how Chinese culture affects hidden or open sexual identities of Chinese lesbian and gay people in this region. The insights gained from those working carefully to create social change offers an important and original contribution to the field of gay and lesbian studies in China. The findings indicate the volunteers at the Beijing LGBT Centre are frustrated by the lack of acceptance of non-heterosexual relationships among Chinese culture and society, and by the disregard of lesbian gay and bisexual (LGB) people by the Chinese government. The findings also illustrate stigmatization of homosexuality in China is enacted in structural terms (such as in the lack of policy, legislation and positive endorsement by governmental and socio-political organizations), public expression (such as negative attitudes, beliefs or reactions towards LGB people) and internalized repression (through fear of stigmatization, and subsequent abuse due to negative societal attitudes and discrimination). Influenced by the Chinese tradition of conforming to group values, the findings from this study show that volunteers at the Beijing LGBT Centre believe LGB people in China are generally hesitant to disclose their sexual identities, and reject the idea that there had been a collective shift in Chinese culture regarding increased acceptance of LGB people. It also finds volunteers at the LGBT Centre in Beijing blame Chinese culture for its lack of acceptance of non-heterosexual relationships, and state stigmatization of homosexuality in China is due to deep-rooted cultural homophobia. © London School of Economics and Political Science 2017.

  15. Hidden Gauge Structure of Supersymmetric Free Differential Algebras

    CERN Document Server

    Andrianopoli, L; Ravera, L


    The aim of this paper is to clarify the role of the nilpotent fermionic generator Q' introduced in Ref. [3] and appearing in the hidden supergroup underlying the free differential algebra (FDA) of D=11 supergravity. We give a physical explanation of its role by looking at the gauge properties of the theory. We find that its presence is necessary, in order that the extra 1-forms of the hidden supergroup give rise to the correct gauge transformations of the p-forms of the FDA. This interpretation is actually valid for any supergravity containing antisymmetric tensor fields, and any supersymmetric FDA can always be traded for a hidden Lie superalgebra containing extra fermionic nilpotent generators. As an interesting example we construct the hidden superalgebra associated with the FDA of N=2, D=7 supergravity. In this case we are able to parametrize the mutually non local 2- and 3-form B^(2) and B^(3) in terms of hidden 1-forms and find that supersymmetry and gauge invariance require in general the presence of t...

  16. Evidence Feed Forward Hidden Markov Model: A New Type of Hidden Markov Model

    CERN Document Server

    DelRose, Michael; Frederick, Philip; 10.5121/ijaia.2011.2101


    The ability to predict the intentions of people based solely on their visual actions is a skill only performed by humans and animals. The intelligence of current computer algorithms has not reached this level of complexity, but there are several research efforts that are working towards it. With the number of classification algorithms available, it is hard to determine which algorithm works best for a particular situation. In classification of visual human intent data, Hidden Markov Models (HMM), and their variants, are leading candidates. The inability of HMMs to provide a probability in the observation to observation linkages is a big downfall in this classification technique. If a person is visually identifying an action of another person, they monitor patterns in the observations. By estimating the next observation, people have the ability to summarize the actions, and thus determine, with pretty good accuracy, the intention of the person performing the action. These visual cues and linkages are important...

  17. Hidden Statistics Approach to Quantum Simulations (United States)

    Zak, Michail


    Recent advances in quantum information theory have inspired an explosion of interest in new quantum algorithms for solving hard computational (quantum and non-quantum) problems. The basic principle of quantum computation is that the quantum properties can be used to represent structure data, and that quantum mechanisms can be devised and built to perform operations with this data. Three basic non-classical properties of quantum mechanics superposition, entanglement, and direct-product decomposability were main reasons for optimism about capabilities of quantum computers that promised simultaneous processing of large massifs of highly correlated data. Unfortunately, these advantages of quantum mechanics came with a high price. One major problem is keeping the components of the computer in a coherent state, as the slightest interaction with the external world would cause the system to decohere. That is why the hardware implementation of a quantum computer is still unsolved. The basic idea of this work is to create a new kind of dynamical system that would preserve the main three properties of quantum physics superposition, entanglement, and direct-product decomposability while allowing one to measure its state variables using classical methods. In other words, such a system would reinforce the advantages and minimize limitations of both quantum and classical aspects. Based upon a concept of hidden statistics, a new kind of dynamical system for simulation of Schroedinger equation is proposed. The system represents a modified Madelung version of Schroedinger equation. It preserves superposition, entanglement, and direct-product decomposability while allowing one to measure its state variables using classical methods. Such an optimal combination of characteristics is a perfect match for simulating quantum systems. The model includes a transitional component of quantum potential (that has been overlooked in previous treatment of the Madelung equation). The role of the

  18. Riboswitch Detection Using Profile Hidden Markov Models

    Directory of Open Access Journals (Sweden)

    Krishnamachari A


    Full Text Available Abstract Background Riboswitches are a type of noncoding RNA that regulate gene expression by switching from one structural conformation to another on ligand binding. The various classes of riboswitches discovered so far are differentiated by the ligand, which on binding induces a conformational switch. Every class of riboswitch is characterized by an aptamer domain, which provides the site for ligand binding, and an expression platform that undergoes conformational change on ligand binding. The sequence and structure of the aptamer domain is highly conserved in riboswitches belonging to the same class. We propose a method for fast and accurate identification of riboswitches using profile Hidden Markov Models (pHMM. Our method exploits the high degree of sequence conservation that characterizes the aptamer domain. Results Our method can detect riboswitches in genomic databases rapidly and accurately. Its sensitivity is comparable to the method based on the Covariance Model (CM. For six out of ten riboswitch classes, our method detects more than 99.5% of the candidates identified by the much slower CM method while being several hundred times faster. For three riboswitch classes, our method detects 97-99% of the candidates relative to the CM method. Our method works very well for those classes of riboswitches that are characterized by distinct and conserved sequence motifs. Conclusion Riboswitches play a crucial role in controlling the expression of several prokaryotic genes involved in metabolism and transport processes. As more and more new classes of riboswitches are being discovered, it is important to understand the patterns of their intra and inter genomic distribution. Understanding such patterns will enable us to better understand the evolutionary history of these genetic regulatory elements. However, a complete picture of the distribution pattern of riboswitches will emerge only after accurate identification of riboswitches across genomes

  19. Hidden beauty baryon states in the local hidden gauge approach with heavy quark spin symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Xiao, C.W.; Oset, E. [Centro Mixto Universidad de Valencia-CSIC, Institutos de Investigacion de Paterna, Departamento de Fisica Teorica and IFIC, Valencia (Spain)


    Using a coupled-channel unitary approach, combining the heavy quark spin symmetry and the dynamics of the local hidden gauge, we investigate the meson-baryon interaction with hidden beauty and obtain several new states of N around 11 GeV. We consider the basis of states {eta}{sub b} N, {Upsilon};N, B {Lambda}{sub b}, B {Sigma}{sub b}, B{sup *}{Lambda}{sub b}, B{sup *}{Sigma}{sub b}, B{sup *}{Sigma}{sub b}{sup *} and find four basic bound states which correspond to B {Sigma}{sub b}, B {Sigma}{sub b}{sup *}, B{sup *}{Sigma}{sub b} and B{sup *}{Sigma}{sub b}{sup *}, decaying mostly into {eta}{sub b} N and {Upsilon}N and with a binding energy about 50-130 MeV with respect to the thresholds of the corresponding channel. All of them have isospin I = 1/2, and we find no bound states or resonances in I = 3/2. The B {Sigma}{sub b} state appears in J = 1/2, the B {Sigma}{sub b}{sup *} in J = 3/2, the B{sup *}{Sigma}{sub b} appears nearly degenerate in J = 1/2, 3/2 and the B{sup *}{Sigma}{sub b}{sup *} appears nearly degenerate in J = 1/2, 3/2, 5/2. These states have a width from 2-110 MeV, with conservative estimates of uncertainties, except for the one in J = 5/2 which has zero width since it cannot decay into any of the states of the basis chosen. We make generous estimates of the uncertainties and find that within very large margins these states appear bound. (orig.)

  20. Evidence Feed Forward Hidden Markov Model: A New Type Of Hidden Markov Model

    Directory of Open Access Journals (Sweden)

    Michael Del Rose


    Full Text Available The ability to predict the intentions of people based solely on their visual actions is a skill only performed by humans and animals. The intelligence of current computer algorithms has not reached this level of complexity, but there are several research efforts that are working towards it. With the number of classification algorithms available, it is hard to determine which algorithm works best for a particular situation. In classification of visual human intent data, Hidden Markov Models (HMM, and their variants, are leading candidates. The inability of HMMs to provide a probability in the observation to observation linkages is a big downfall in this classification technique. If a person is visually identifying an action of another person, they monitor patterns in the observations. By estimating the next observation, people have the ability to summarize the actions, and thus determine, with pretty good accuracy, the intention of the person performing the action. These visual cues and linkages are important in creating intelligent algorithms for determining human actions based on visual observations. The Evidence Feed Forward Hidden Markov Model is a newly developed algorithm which provides observation to observation linkages. The following research addresses the theory behind Evidence Feed Forward HMMs, provides mathematical proofs of their learning of these parameters to optimize the likelihood of observations with a Evidence Feed Forwards HMM, which is important in all computational intelligence algorithm, and gives comparative examples with standard HMMs in classification of both visual action data and measurement data; thus providing a strong base for Evidence Feed Forward HMMs in classification of many types of problems.