Effects of strain and age on hepatic gene expression profiles in murine models of HFE-associated hereditary hemochromatosis.

Science.gov (United States)

Lee, Seung-Min; Loguinov, Alexandre; Fleming, Robert E; Vulpe, Christopher D

2015-01-01

Hereditary hemochromatosis is an iron overload disorder most commonly caused by a defect in the HFE gene. While the genetic defect is highly prevalent, the majority of individuals do not develop clinically significant iron overload, suggesting the importance of genetic modifiers. Murine hfe knockout models have demonstrated that strain background has a strong effect on the severity of iron loading. We noted that hepatic iron loading in hfe-/- mice occurs primarily over the first postnatal weeks (loading phase) followed by a timeframe of relatively static iron concentrations (plateau phase). We thus evaluated the effects of background strain and of age on hepatic gene expression in Hfe knockout mice (hfe-/-). Hepatic gene expression profiles were examined using cDNA microarrays in 4- and 8-week-old hfe-/- and wild-type mice on two different genetic backgrounds, C57BL/6J (C57) and AKR/J (AKR). Genes differentially regulated in all hfe-/- mice groups, compared with wild-type mice, including those involved in cell survival, stress and damage responses and lipid metabolism. AKR strain-specific changes in lipid metabolism genes and C57 strain-specific changes in cell adhesion and extracellular matrix protein genes were detected in hfe-/- mice. Mouse strain and age are each significantly associated with hepatic gene expression profiles in hfe-/- mice. These affects may underlie or reflect differences in iron loading in these mice.

Iron overload and HFE gene mutations in Czech patients with chronic liver diseases.

Science.gov (United States)

Dostalikova-Cimburova, Marketa; Kratka, Karolina; Stransky, Jaroslav; Putova, Ivana; Cieslarova, Blanka; Horak, Jiri

2012-01-01

The aim of the study was to identify the prevalence of HFE gene mutations in Czech patients with chronic liver diseases and the influence of the mutations on iron status. The presence of HFE gene mutations (C282Y, H63D, and S65C) analyzed by the PCR-RFLP method, presence of cirrhosis, and serum iron indices were compared among 454 patients with different chronic liver diseases (51 with chronic hepatitis B, 122 with chronic hepatitis C, 218 with alcoholic liver disease, and 63 patients with hemochromatosis). Chronic liver diseases patients other than hemochromatics did not have an increased frequency of HFE gene mutations compared to controls. Although 33.3% of patients with hepatitis B, 43% of patients with hepatitis C, and 73.2% of patients with alcoholic liver disease had elevated transferrin saturation or serum ferritin levels, the presence of HFE gene mutations was not significantly associated with iron overload in these patients. Additionally, patients with cirrhosis did not have frequencies of HFE mutations different from those without cirrhosis. This study emphasizes the importance, not only of C282Y, but also of the H63D homozygous genetic constellation in Czech hemochromatosis patients. Our findings show that increased iron indices are common in chronic liver diseases but {\\it HFE} mutations do not play an important role in the pathogenesis of chronic hepatitis B, chronic hepatitis C, and alcoholic liver disease.

HFE gene mutations in coronary atherothrombotic disease

Directory of Open Access Journals (Sweden)

Calado R.T.

2000-01-01

Full Text Available Although iron can catalyze the production of free radicals involved in LDL lipid peroxidation, the contribution of iron overload to atherosclerosis remains controversial. The description of two mutations in the HFE gene (Cys282Tyr and His63Asp related to hereditary hemochromatosis provides an opportunity to address the question of the association between iron overload and atherosclerosis. We investigated the prevalence of HFE mutations in 160 survivors of myocardial infarction with angiographically demonstrated severe coronary atherosclerotic disease, and in 160 age-, gender- and race-matched healthy control subjects. PCR amplification of genomic DNA followed by RsaI and BclI restriction enzyme digestion was used to determine the genotypes. The frequency of the mutant Cys282Tyr allele was identical among patients and controls (0.022; carrier frequency, 4.4%, whereas the mutant His63Asp allele had a frequency of 0.143 (carrier frequency, 27.5% in controls and of 0.134 (carrier frequency, 24.5% in patients. Compound heterozygotes were found in 2 of 160 (1.2% controls and in 1 of 160 (0.6% patients. The finding of a similar prevalence of Cys282Tyr and His63Asp mutations in the HFE gene among controls and patients with coronary atherothrombotic disease, indirectly questions the possibility of an association between hereditary hemochromatosis and atherosclerosis.

Iron overload and HFE gene mutations in Polish patients with liver cirrhosis.

Science.gov (United States)

Sikorska, Katarzyna; Romanowski, Tomasz; Stalke, Piotr; Iżycka-Świeszewska, Ewa; Bielawski, Krzysztof Piotr

2011-06-01

Increased liver iron stores may contribute to the progression of liver injury and fibrosis, and are associated with a higher risk of hepatocellular carcinoma development. Pre-transplant symptoms of iron overload in patients with liver cirrhosis are associated with higher risk of infectious and malignant complications in liver transplant recipients. HFE gene mutations may be involved in the pathogenesis of liver iron overload and influence the progression of chronic liver diseases of different origins. This study was designed to determine the prevalence of iron overload in relation to HFE gene mutations among Polish patients with liver cirrhosis. Sixty-one patients with liver cirrhosis included in the study were compared with a control group of 42 consecutive patients subjected to liver biopsy because of chronic liver diseases. Liver function tests and serum iron markers were assessed in both groups. All patients were screened for HFE mutations (C282Y, H63D, S65C). Thirty-six of 61 patients from the study group and all controls had liver biopsy performed with semiquantitative assessment of iron deposits in hepatocytes. The biochemical markers of iron overload and iron deposits in the liver were detected with a higher frequency (70% and 47% respectively) in patients with liver cirrhosis. There were no differences in the prevalence of all HFE mutations in both groups. In patients with a diagnosis of hepatocellular carcinoma, no significant associations with iron disorders and HFE gene mutations were found. Iron disorders were detected in patients with liver cirrhosis frequently but without significant association with HFE gene mutations. Only the homozygous C282Y mutation seems to occur more frequently in the selected population of patients with liver cirrhosis. As elevated biochemical iron indices accompanied liver iron deposits more frequently in liver cirrhosis compared to controls with chronic liver disease, there is a need for more extensive studies searching for

Hemochromatosis (HFE gene mutations in Brazilian chronic hemodialysis patients

Directory of Open Access Journals (Sweden)

F.V. Perícole

2005-09-01

Full Text Available Patients with chronic renal insufficiency (CRI have reduced hemoglobin levels, mostly as a result of decreased kidney production of erythropoietin, but the relation between renal insufficiency and the magnitude of hemoglobin reduction has not been well defined. Hereditary hemochromatosis is an inherited disorder of iron metabolism. The importance of the association of hemochromatosis with treatment for anemia among patients with CRI has not been well described. We analyzed the frequency of the C282Y and H63D mutations in the HFE gene in 201 Brazilian individuals with CRI undergoing hemodialysis. The analysis of the effects of HFE mutations on iron metabolism and anemia with biochemical parameters was possible in 118 patients of this study (hemoglobin, hematocrit, ferritin levels, transferrin saturation, and serum iron. A C282Y heterozygous mutation was found in 7/201 (3.4% and H63D homozygous and heterozygous mutation were found in 2/201 (1.0% and 46/201 (22.9%, respectively. The allelic frequencies of the HFE mutations (0.017 for C282Y mutation and 0.124 for H63D mutation did not differ between patients with CRI and healthy controls. Regarding the biochemical parameters, no differences were observed between HFE heterozygous and mutation-negative patients, although ferritin levels were not higher among patients with the H63D mutation (P = 0.08. From what we observed in our study, C282Y/H63D HFE gene mutations are not related to degrees of anemia or iron stores in CRI patients receiving intravenous iron supplementation (P > 0.10. Nevertheless, the present data suggest that the H63D mutation may have an important function as a modulating factor of iron overload in these patients.

Alternative Polyadenylation and Nonsense-Mediated Decay Coordinately Regulate the Human HFE mRNA Levels

Science.gov (United States)

Martins, Rute; Proença, Daniela; Silva, Bruno; Barbosa, Cristina; Silva, Ana Luísa; Faustino, Paula; Romão, Luísa

2012-01-01

Nonsense-mediated decay (NMD) is an mRNA surveillance pathway that selectively recognizes and degrades defective mRNAs carrying premature translation-termination codons. However, several studies have shown that NMD also targets physiological transcripts that encode full-length proteins, modulating their expression. Indeed, some features of physiological mRNAs can render them NMD-sensitive. Human HFE is a MHC class I protein mainly expressed in the liver that, when mutated, can cause hereditary hemochromatosis, a common genetic disorder of iron metabolism. The HFE gene structure comprises seven exons; although the sixth exon is 1056 base pairs (bp) long, only the first 41 bp encode for amino acids. Thus, the remaining downstream 1015 bp sequence corresponds to the HFE 3′ untranslated region (UTR), along with exon seven. Therefore, this 3′ UTR encompasses an exon/exon junction, a feature that can make the corresponding physiological transcript NMD-sensitive. Here, we demonstrate that in UPF1-depleted or in cycloheximide-treated HeLa and HepG2 cells the HFE transcripts are clearly upregulated, meaning that the physiological HFE mRNA is in fact an NMD-target. This role of NMD in controlling the HFE expression levels was further confirmed in HeLa cells transiently expressing the HFE human gene. Besides, we show, by 3′-RACE analysis in several human tissues that HFE mRNA expression results from alternative cleavage and polyadenylation at four different sites – two were previously described and two are novel polyadenylation sites: one located at exon six, which confers NMD-resistance to the corresponding transcripts, and another located at exon seven. In addition, we show that the amount of HFE mRNA isoforms resulting from cleavage and polyadenylation at exon seven, although present in both cell lines, is higher in HepG2 cells. These results reveal that NMD and alternative polyadenylation may act coordinately to control HFE mRNA levels, possibly varying its

A family with hereditary hemochromatosis carrying HFE gene splice site mutation: a case report

Directory of Open Access Journals (Sweden)

NING Huibin

2017-01-01

Full Text Available ObjectiveTo investigate a new type of HFE gene mutation in a family with hereditary hemochromatosis (HH. MethodsThe analysis of HFE gene was performed for one patient with a confirmed diagnosis of HH and five relatives. Blood genomic DNA was extracted and PCR multiplication was performed for the exon and intron splice sequences of related HFE, HJV, HAMP, transferrin receptor 2 (TfR2, and SLC40A1 genes. After agarose gel electrophoresis and purification, bi-directional direct sequencing was performed to detect mutation sites. ResultsThe proband had abnormal liver function and increases in serum iron, total iron binding capacity, serum ferritin, and transferrin saturation, as well as T→C homozygous mutation in the fourth base of intron 2 in the intervening sequence of the exon EXON2 of HFE gene (IVs 2+4T→C, C/C homozygous, splicing, abnormal. There were no abnormalities in HJV, HAMP, TfR2, and SLC40A1 genes. The proband′s son had the same homozygous mutation, three relatives had heterozygous mutations, and one relative had no abnormal mutations. ConclusionGene detection plays an important role in the diagnosis of hemochromatosis, and IVs 2+4T→C mutation may be a new pathogenic mutation for HH in China.

HFE gene C282Y variant is associated with colorectal cancer in Caucasians: a meta-analysis.

Science.gov (United States)

Chen, Weidong; Zhao, Hua; Li, Tiegang; Yao, Hongliang

2013-08-01

The HFE gene has been suggested to play an important role in the pathogenesis of colorectal cancer. However, the results have been conflicting. In this study, we performed a meta-analysis to clarify the association of HFE gene C282Y variant with colorectal cancer. PubMed and Embase were retrieved to identify the potential literature. Pooled odds ratio (OR) with 95 % confidence interval (CI) was calculated using fixed- or random-effects model. A total of eight papers including nine studies (7,588 colorectal cancer cases and 81,571 controls) for HFE gene C282Y variant were included in the meta-analysis. The result indicated that HFE gene C282Y variant was significantly associated with colorectal cancer under recessive model (OR = 2.00, 95 % CI = 1.32-3.04), with no evidence of between-study heterogeneity (I (2) = 0.2 %, p = 0.432). Further subgroup analysis by number of cases suggested the effect was significant in studies with more than 500 cases (OR = 2.51, 95 % CI = 1.58-3.98, I (2) = 0.0 %, p = 0.921), but not in studies with less than 500 cases (OR = 0.75, 95 % CI = 0.28-1.97, I (2) = 0.0 %, p = 0.622). The current meta-analysis supported the positive association of HFE gene C282Y variant with colorectal cancer. Further large-scale studies with the consideration for gene-gene/gene-environment interactions should be conducted to investigate the association.

Hemochromatosis (HFE) gene mutations and response to chloroquine in porphyria cutanea tarda.

Science.gov (United States)

Stölzel, Ulrich; Köstler, Erich; Schuppan, Detlef; Richter, Matthias; Wollina, Uwe; Doss, Manfred O; Wittekind, Christian; Tannapfel, Andrea

2003-03-01

To examine the role of hemochromatosis (HFE) gene mutations, which are associated with porphyria cutanea tarda (PCT), in the therapeutic response to chloroquine. We retrospectively analyzed a database (Excel version 2001 [Microsoft Excel, Redmond, Wash]; date range of search, 1985-1999) of chloroquine-treated patients with PCT on whether HFE mutations (C282Y and H63D) might have influenced the clinical response, urinary porphyrin excretion, liver enzyme activities, and serum iron markers. Serum samples and corresponding complete sets of data before and after therapy were available in 62 of 207 patients with PCT who were treated exclusively with chloroquine. Academic teaching hospital. For treatment, low-dose chloroquine diphosphate, 125 to 250 mg twice weekly, was used during a median time of 16 months (range, 12-26 months). Of the 62 German patients with PCT, 37 (60%) carries HFE mutations. Chloroquine therapy was accompanied by clinical remission and reduced urinary porphyrin excretion (P<.001) in the 24 patients (39%) with HFE wild type as well as in 35 HFE heterozygous patients with PCT (56%). Decreases of serum iron markers following chloroquine therapy were limited to patients with PCT and HFE wild type. All patients homozygous for the C282Y mutation (3 [5%] of 62) had high serum iron, ferritin, and transferrin saturation and failed to respond to chloroquine treatment. The therapeutic response to chloroquine was not compromised by C282Y heterozygosity and compound heterozygosity of HFE mutations. Because HFE C282Y homozygotes (+/+) did not respond to chloroquine and a decrease in serum iron concentration was limited to patients with PCT and HFE wild type, phlebotomy should be first-line therapy in patients with PCT and HFE mutations.

HFE gene variants and iron-induced oxygen radical generation in idiopathic pulmonary fibrosis.

Science.gov (United States)

Sangiuolo, Federica; Puxeddu, Ermanno; Pezzuto, Gabriella; Cavalli, Francesco; Longo, Giuliana; Comandini, Alessia; Di Pierro, Donato; Pallante, Marco; Sergiacomi, Gianluigi; Simonetti, Giovanni; Zompatori, Maurizio; Orlandi, Augusto; Magrini, Andrea; Amicosante, Massimo; Mariani, Francesca; Losi, Monica; Fraboni, Daniela; Bisetti, Alberto; Saltini, Cesare

2015-02-01

In idiopathic pulmonary fibrosis (IPF), lung accumulation of excessive extracellular iron and macrophage haemosiderin may suggest disordered iron homeostasis leading to recurring microscopic injury and fibrosing damage. The current study population comprised 89 consistent IPF patients and 107 controls. 54 patients and 11 controls underwent bronchoalveolar lavage (BAL). Haemosiderin was assessed by Perls' stain, BAL fluid malondialdehyde (MDA) by high-performance liquid chromatography, BAL cell iron-dependent oxygen radical generation by fluorimetry and the frequency of hereditary haemochromatosis HFE gene variants by reverse dot blot hybridisation. Macrophage haemosiderin, BAL fluid MDA and BAL cell unstimulated iron-dependent oxygen radical generation were all significantly increased above controls (pHFE allelic variants was markedly higher in IPF compared with controls (40.4% versus 22.4%, OR 2.35, p=0.008) and was associated with higher iron-dependent oxygen radical generation (HFE variant 107.4±56.0, HFE wild type (wt) 59.4±36.4 and controls 16.7±11.8 fluorescence units per 10(5) BAL cells; p=0.028 HFE variant versus HFE wt, p=0.006 HFE wt versus controls). The data suggest iron dysregulation associated with HFE allelic variants may play an important role in increasing susceptibility to environmental exposures, leading to recurring injury and fibrosis in IPF. Copyright ©ERS 2015.

Analysis of single nucleotide variants of HFE gene and association to survival in The Cancer Genome Atlas GBM data.

Science.gov (United States)

Lee, Sang Y; Zhu, Junjia; Salzberg, Anna C; Zhang, Bo; Liu, Dajiang J; Muscat, Joshua E; Langan, Sara T; Connor, James R

2017-01-01

Human hemochromatosis protein (HFE) is involved in iron metabolism. Two major HFE polymorphisms, H63D and C282Y, have been associated with an increased risk of cancers. Previously, we reported decreased gender effects in overall survival based on H63D or C282Y HFE polymorphisms patients with glioblastoma multiforme (GBM). However, the effect of other single nucleotide variation (SNV) in the HFE gene on the cancer development and progression has not been systematically studied. To expand our finding in a larger sample, and to identify other HFE SNV, we analyzed the frequency of somatic SNV in HFE gene and its relationship to survival in GBM patients using The Cancer Genome Atlas (TCGA) GBM (Caucasian only) database. We found 9 SNVs with increased frequency in blood normal of TCGA GBM patients compared to the 1000Genome. Among 9 SNVs, 7 SNVs were located in the intron and 2 SNVs (i.e., H63D, C282Y) in the exon of HFE gene. The statistical analysis demonstrated that blood normal samples of TCGA GBM have more H63D (p = 0.0002, 95% Confidence interval (CI): 0.2119-0.3223) or C282Y (p = 0.0129, 95% CI: 0.0474-0.1159) HFE polymorphisms than 1000Genome. The Kaplan-Meier survival curve for the 264 GBM samples revealed no difference between wild type (WT) HFE and H63D, and WT HFE and C282Y GBM patients. In addition, there was no difference in the survival of male/female GBM patients based on HFE genotype. There was no correlation between HFE expression and survival. In conclusion, the current results suggest that somatic HFE polymorphisms do not impact GBM patients' survival in the TCGA data set of GBM.

Analysis of single nucleotide variants of HFE gene and association to survival in The Cancer Genome Atlas GBM data.

Directory of Open Access Journals (Sweden)

Sang Y Lee

Full Text Available Human hemochromatosis protein (HFE is involved in iron metabolism. Two major HFE polymorphisms, H63D and C282Y, have been associated with an increased risk of cancers. Previously, we reported decreased gender effects in overall survival based on H63D or C282Y HFE polymorphisms patients with glioblastoma multiforme (GBM. However, the effect of other single nucleotide variation (SNV in the HFE gene on the cancer development and progression has not been systematically studied. To expand our finding in a larger sample, and to identify other HFE SNV, we analyzed the frequency of somatic SNV in HFE gene and its relationship to survival in GBM patients using The Cancer Genome Atlas (TCGA GBM (Caucasian only database. We found 9 SNVs with increased frequency in blood normal of TCGA GBM patients compared to the 1000Genome. Among 9 SNVs, 7 SNVs were located in the intron and 2 SNVs (i.e., H63D, C282Y in the exon of HFE gene. The statistical analysis demonstrated that blood normal samples of TCGA GBM have more H63D (p = 0.0002, 95% Confidence interval (CI: 0.2119-0.3223 or C282Y (p = 0.0129, 95% CI: 0.0474-0.1159 HFE polymorphisms than 1000Genome. The Kaplan-Meier survival curve for the 264 GBM samples revealed no difference between wild type (WT HFE and H63D, and WT HFE and C282Y GBM patients. In addition, there was no difference in the survival of male/female GBM patients based on HFE genotype. There was no correlation between HFE expression and survival. In conclusion, the current results suggest that somatic HFE polymorphisms do not impact GBM patients' survival in the TCGA data set of GBM.

HFE p.C282Y gene variant is associated with varicose veins in Russian population.

Science.gov (United States)

Sokolova, Ekaterina A; Shadrina, Alexandra S; Sevost'ianova, Kseniya S; Shevela, Andrey I; Soldatsky, Evgenii Yu; Seliverstov, Evgenii I; Demekhova, Marina Yu; Shonov, Oleg A; Ilyukhin, Evgenii A; Smetanina, Mariya A; Voronina, Elena N; Zolotukhin, Igor A; Filipenko, Maxim L

2016-08-01

Recently, the association of polymorphism rs1800562 (p.C282Y) in the hemochromatosis (HFE) gene with the increased risk of venous ulceration was shown. We hypothesized that HFE gene polymorphism might be involved not only in ulceration process, but also in susceptibility to primary varicose veins. We genotyped HFE p.C282Y (rs1800562) and p.H63D (rs1799945) variants in patients with primary varicose veins (n = 463) and in the control group (n = 754). In our study, p.282Y variant (rs1800562 A allele) was significantly associated with the risk of varicose veins (OR 1.79, 95 % CI = 1.11-2.89, P = 0.02). A borderline significant reverse association of p.63D variant (rs1799945 G allele) with venous leg ulcer development was revealed in Russians (OR 0.25, 95 % CI = 0.06-1.00, P = 0.05), but not in the meta-analysis (P = 0.56). We conclude that the HFE gene polymorphism can affect the risk of developing primary varicose veins.

Molecular basis of HFE-hemochromatosis

Directory of Open Access Journals (Sweden)

Maja eVujic Spasic

2014-03-01

Full Text Available Iron-overload disorders owing to genetic misregulation of iron acquisition are referred to as hereditary hemochromatosis (HH. The most prevalent genetic iron overload disorder in Caucasians is caused by mutations in the HFE gene, an atypical MHC class I molecule. Recent studies classified HFE/Hfe-hemochromatosis as a liver disease with the primarily failure in the production of the liver iron hormone hepcidin in hepatocytes. Inadequate hepcidin expression signals for excessive iron absorption from the diet and iron deposition in tissues causing multiple organ damage and failure. This review focuses on the molecular actions of the HFE/Hfe and hepcidin in maintaining systemic iron homeostasis and approaches undertaken so far to combat iron overload in HFE/Hfe-HH. In the light of the recent investigations, novel roles of extra-hepatocytic Hfe are discussed raising a question to the relevance of the multipurpose functions of Hfe for the understanding of HH associated pathologies.

Molecular basis of HFE-hemochromatosis.

Science.gov (United States)

Vujić, Maja

2014-01-01

Iron-overload disorders owing to genetic misregulation of iron acquisition are referred to as hereditary hemochromatosis (HH). The most prevalent genetic iron overload disorder in Caucasians is caused by mutations in the HFE gene, an atypical MHC class I molecule. Recent studies classified HFE/Hfe-HH as a liver disease with the primarily failure in the production of the liver iron hormone hepcidin in hepatocytes. Inadequate hepcidin expression signals for excessive iron absorption from the diet and iron deposition in tissues causing multiple organ damage and failure. This review focuses on the molecular actions of the HFE/Hfe and hepcidin in maintaining systemic iron homeostasis and approaches undertaken so far to combat iron overload in HFE/Hfe-HH. In the light of the recent investigations, novel roles of extra-hepatocytic Hfe are discussed raising a question to the relevance of the multipurpose functions of Hfe for the understanding of HH-associated pathologies.

HFE gene polymorphism defined by sequence-based typing of the Brazilian population and a standardized nomenclature for HFE allele sequences.

Science.gov (United States)

Campos, W N; Massaro, J D; Martinelli, A L C; Halliwell, J A; Marsh, S G E; Mendes-Junior, C T; Donadi, E A

2017-10-01

The HFE molecule controls iron uptake from gut, and defects in the molecule have been associated with iron overload, particularly in hereditary hemochromatosis. The HFE gene including both coding and boundary intronic regions were sequenced in 304 Brazilian individuals, encompassing healthy individuals and patients exhibiting hereditary or acquired iron overload. Six sites of variation were detected: (1) H63D C>G in exon 2, (2) IVS2 (+4) T>C in intron 2, (3) a C>G transversion in intron 3, (4) C282Y G>A in exon 4, (5) IVS4 (-44) T>C in intron 4, and (6) a new guanine deletion (G>del) in intron 5, which were used for haplotype inference. Nine HFE alleles were detected and six of these were officially named on the basis of the HLA Nomenclature, defined by the World Health Organization (WHO) Nomenclature Committee for Factors of the HLA System, and published via the IPD-IMGT/HLA website. Four alleles, HFE*001, *002, *003, and *004 exhibited variation within their exon sequences. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Association of HFE gene mutations with nonalcoholic fatty liver disease in the Iranian population.

Science.gov (United States)

Saremi, L; Lotfipanah, S; Mohammadi, M; Hosseinzadeh, H; Sayad, A; Saltanatpour, Z

2016-10-31

To determine whether the HFE gene variants H63D and C282Y are associated with NAFLD in persons with type 2 diabetes, we conducted a case-control study including 145 case of NAFLD patients with a history of type 2 diabetes and 145 matching control. The genomic DNA was extracted from the peripheral venous blood and the genotyping of HFE gene mutations was analyzed using the PCR-RFLP technique. Statistical analysis was performed using SPSS 12.0 software by χ2 test, t test and ANOVA (P<0.05). Data showed no increased frequency of HFE mutations in persons with type 2 diabetes and no association between H63D mutation and NAFLD in the study population. Also, we analyzed index of physiological variables including FBS, lipid profile (TC, TG, LDL-C, and HDL-C), BMI, HbA1c, and micro albuminuria and Cr levels). Data showed there are no relationship between these indexes and HFE gene mutations and either NAFLD as a complication of diabetes. But our results showed a relationship between C282Y mutation and NAFLD in persons with type 2 diabetes. C282Y mutation might be a genetic marker of NAFLD in Iranian population.

Reduction of Skeletal Muscle Power in Adolescent Males Carrying H63D Mutation in the HFE Gene.

Science.gov (United States)

Luszczyk, Marcin; Kaczorowska-Hac, Barbara; Milosz, Ewa; Adamkiewicz-Drozynska, Elzbieta; Ziemann, Ewa; Laskowski, Radoslaw; Flis, Damian; Rokicka-Hebel, Magdalena; Antosiewicz, Jedrzej

2017-01-01

Iron overload resulting from the mutation of genes involved in iron metabolism or excess dietary intake has been reported to negatively influence human physical performance. The aim of this study was to test the hypothesis that adolescents bearing a hemochromatosis gene (HFE) mutation in contrast to adults with the same mutation will not experience iron accumulation and their aerobic capacity will be similar to that of age-matched controls. Thirteen boys participated in the study. Seven of them are carriers of H63D mutation in the HFE gene and six were wild type. Fitness levels were assessed using the cardiopulmonary exercise test. In addition, iron status and inflammatory markers were determined. We observed that cardiovascular fitness was significantly lower in the group bearing the HFE mutation compared to the control group. Moreover, the HFE mutation group achieved lower maximal power output compared to the control group. There were no differences in blood ferritin concentrations between the two groups which indicates similar amounts of stored iron. Obtained data do not confirm our hypothesis. On the contrary, it was demonstrated that HFE mutation is associated with a lower level of aerobic capacity, even in the absence of iron accumulation.

A Mouse Model of Cardiomyopathy Induced by Mutations in the Hemochromatosis HFE Gene.

Science.gov (United States)

Djemai, Haidar; Thomasson, Rémi; Trzaskus, Yvan; Mougenot, Nathalie; Meziani, Amira; Toussaint, Jean-François; Noirez, Philippe; Vitiello, Damien

2017-07-01

The heart is 1 of the organs most affected by hereditary hemochromatosis (HH). The clinical impact of cardiomyopathy in patients with HH requires a particular diagnosis and less invasive treatments. We developed a model of cardiomyopathy in knockout (KO) mice for the high-Fe (HFE) gene and assessed left ventricular (LV) function and structure from 7-20 months. Male wild-type (WT) heterozygous and KO SV129 mice for the HFE gene were used in this study. Twenty-four mice were used to assess LV function and structure by echocardiography at 7, 14, 18, and 20 months. Evaluations of LV function and structure and myocardial fibrosis were performed at 7 and 20 months. The percent decrease of LV thickness-to-radius ratio between 7 and 20 months was higher in KO mice compared with WT mice (-30.2% ± 5.3% vs -10.5% ± 4.9%; P HFE-related hemochromatosis. Copyright © 2017 Canadian Cardiovascular Society. Published by Elsevier Inc. All rights reserved.

Haemochromatosis HFE gene polymorphisms as potential modifiers of hereditary nonpolyposis colorectal cancer risk and onset age.

Science.gov (United States)

Shi, Zumin; Johnstone, Daniel; Talseth-Palmer, Bente A; Evans, Tiffany-Jane; Spigelman, Allan D; Groombridge, Claire; Milward, Elizabeth A; Olynyk, John K; Suchy, Janina; Kurzawski, Grzegorz; Lubinski, Jan; Scott, Rodney J

2009-07-01

Hereditary nonpolyposis colorectal cancer (HNPCC) is characterized by germline mutations in DNA mismatch repair genes; however, variation in disease expression suggests that there are potential modifying factors. Polymorphisms of the HFE gene, which cause the iron overload disorder hereditary haemochromatosis, have been proposed as potential risk factors for the development of colorectal cancer (CRC). To understand the relationship between HNPCC disease phenotype and polymorphisms of the HFE gene, a total of 362 individuals from Australia and Poland with confirmed causative MMR gene mutations were genotyped for the HFE C282Y and H63D polymorphisms. A significantly increased risk of developing CRC was observed for H63D homozygotes when compared with combined wild-type homozygotes and heterozygotes (hazard ratio = 2.93, p = 0.007). Evidence for earlier CRC onset was also observed in H63D homozygotes with a median age of onset 6 years earlier than wild type or heterozygous participants (44 vs. 50 years of age). This effect was significant by all tests used (log-rank test p = 0.026, Wilcoxon p = 0.044, Tarone-Ware p = 0.035). No association was identified for heterozygosity of either polymorphism and limitations on power-prevented investigation of C282Y homozygosity or compound C282Y/H63D heterozygosity. In the Australian sample only, women had a significantly reduced risk of developing CRC when compared with men (hazard ratio = 0.58, p = 0.012) independent of HFE genotype for either single nucleotide polymorphisms. In conclusion, homozygosity for the HFE H63D polymorphism seems to be a genetic modifier of disease expression in HNPCC. Understanding the mechanisms by which HFE interrelates with colorectal malignancies could lead to reduction of disease risk in HNPCC.

A role for sex and a common HFE gene variant in brain iron uptake.

Science.gov (United States)

Duck, Kari A; Neely, Elizabeth B; Simpson, Ian A; Connor, James R

2018-03-01

HFE (high iron) is an essential protein for regulating iron transport into cells. Mutations of the HFE gene result in loss of this regulation causing accumulation of iron within the cell. The mutated protein has been found increasingly in numerous neurodegenerative disorders in which increased levels of iron in the brain are reported. Additionally, evidence that these mutations are associated with elevated brain iron challenges the paradigm that the brain is protected by the blood-brain barrier. While much has been studied regarding the role of HFE in cellular iron uptake, it has remained unclear what role the protein plays in the transport of iron into the brain. We investigated regulation of iron transport into the brain using a mouse model with a mutation in the HFE gene. We demonstrated that the rate of radiolabeled iron ( 59 Fe) uptake was similar between the two genotypes despite higher brain iron concentrations in the mutant. However, there were significant differences in iron uptake between males and females regardless of genotype. These data indicate that brain iron status is consistently maintained and tightly regulated at the level of the blood-brain barrier.

[CCR5, CCR2, apoe, p53, ITGB3 and HFE gene polymorphism in Western Siberia long-livers].

Science.gov (United States)

Ivanoshchuk, D E; Mikhaĭlova, S V; Kulikov, I V; Maksimov, V N; Voevoda, M I; Romashchenko, A G

2012-01-01

In order to estimate the distribution of some polymorphisms for the CCR5, CCR2, apoE, p53, ITGB3, and HFE genes in Russian long-livers from Western Siberia, a sample of 271 individuals (range 90-105 years) was examined. It was demonstrated that carriage of the delta32 polymorphism for the CCR5 gene, V64/polymorphism for the CCR2 gene, e2/e3/e4 for the apoE gene, L33P for the ITGB3 gene, as well as H63D and S65C polymorphisms for the HFE gene does not influence on predisposition to the longevity; carriage of the 282 Y allele for the HFE gene negatively influences on the longevity; carriage of the heterozygous genotype for the R72P polymorphism for the p53 gene correlates with the longevity of elderly people.

Reduction of Skeletal Muscle Power in Adolescent Males Carrying H63D Mutation in the HFE Gene

Directory of Open Access Journals (Sweden)

Marcin Luszczyk

2017-01-01

Full Text Available Iron overload resulting from the mutation of genes involved in iron metabolism or excess dietary intake has been reported to negatively influence human physical performance. The aim of this study was to test the hypothesis that adolescents bearing a hemochromatosis gene (HFE mutation in contrast to adults with the same mutation will not experience iron accumulation and their aerobic capacity will be similar to that of age-matched controls. Thirteen boys participated in the study. Seven of them are carriers of H63D mutation in the HFE gene and six were wild type. Fitness levels were assessed using the cardiopulmonary exercise test. In addition, iron status and inflammatory markers were determined. We observed that cardiovascular fitness was significantly lower in the group bearing the HFE mutation compared to the control group. Moreover, the HFE mutation group achieved lower maximal power output compared to the control group. There were no differences in blood ferritin concentrations between the two groups which indicates similar amounts of stored iron. Obtained data do not confirm our hypothesis. On the contrary, it was demonstrated that HFE mutation is associated with a lower level of aerobic capacity, even in the absence of iron accumulation.

Heterozygous Hfe gene deletion leads to impaired glucose homeostasis, but not liver injury in mice fed a high-calorie diet.

Science.gov (United States)

Britton, Laurence; Jaskowski, Lesley; Bridle, Kim; Santrampurwala, Nishreen; Reiling, Janske; Musgrave, Nick; Subramaniam, V Nathan; Crawford, Darrell

2016-06-01

Heterozygous mutations of the Hfe gene have been proposed as cofactors in the development and progression of nonalcoholic fatty liver disease (NAFLD). Homozygous Hfe deletion previously has been shown to lead to dysregulated hepatic lipid metabolism and accentuated liver injury in a dietary mouse model of NAFLD We sought to establish whether heterozygous deletion of Hfe is sufficient to promote liver injury when mice are exposed to a high-calorie diet (HCD). Eight-week-old wild-type and Hfe(+/-) mice received 8 weeks of a control diet or HCD Liver histology and pathways of lipid and iron metabolism were analyzed. Liver histology demonstrated that mice fed a HCD had increased NAFLD activity score (NAS), steatosis, and hepatocyte ballooning. However, liver injury was unaffected by Hfe genotype. Hepatic iron concentration (HIC) was increased in Hfe(+/-) mice of both dietary groups. HCD resulted in a hepcidin-independent reduction in HIC Hfe(+/-) mice demonstrated raised fasting serum glucose concentrations and HOMA-IR score, despite unaltered serum adiponectin concentrations. Downstream regulators of hepatic de novo lipogenesis (pAKT, SREBP-1, Fas, Scd1) and fatty acid oxidation (AdipoR2, Pparα, Cpt1) were largely unaffected by genotype. In summary, heterozygous Hfe gene deletion is associated with impaired iron and glucose metabolism. However, unlike homozygous Hfe deletion, heterozygous gene deletion did not affect lipid metabolism pathways or liver injury in this model. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

Molecular basis of HFE-hemochromatosis

OpenAIRE

Vujić, Maja

2014-01-01

Iron-overload disorders owing to genetic misregulation of iron acquisition are referred to as hereditary hemochromatosis (HH). The most prevalent genetic iron overload disorder in Caucasians is caused by mutations in the HFE gene, an atypical MHC class I molecule. Recent studies classified HFE/Hfe-hemochromatosis as a liver disease with the primarily failure in the production of the liver iron hormone hepcidin in hepatocytes. Inadequate hepcidin expression signals for excessive iron absorptio...

Prevalence of C282Y, H63D, and S65C mutations in hereditary HFE-hemochromatosis gene in Lithuanian population.

Science.gov (United States)

Kucinskas, Laimutis; Juzenas, Simonas; Sventoraityte, Jurgita; Cedaviciute, Ruta; Vitkauskiene, Astra; Kalibatas, Vytenis; Kondrackiene, Jurate; Kupcinskas, Limas

2012-04-01

HFE-hemochromatosis is a common autosomal recessive disease caused by HFE gene mutations and characterized as iron overload and failure of different organs. The aim of this study was to determine the prevalence of C282Y (c.845 G>A), H63D (c.187 C>G), and S65C (c.193A>T) alleles of HFE gene in the Lithuanian population. One thousand and eleven healthy blood donors of Lithuanian nationality were examined in four different ethnic Lithuanian regions to determine HFE gene alleles and genotype frequencies. The samples of DNA were analyzed for the presence of restriction fragment length polymorphism and validated by DNA sequencing. Among 1,011 blood donors tested, the frequency of C282Y, H63D, and S65C alleles were 2.6%, 15.9%, and 1.9%, respectively. One third of the tested subjects (n = 336) had at least one of the C282Y or H63D HFE gene mutations. The screening of Lithuanian blood donors has detected 13 (1.3%) subjects with a genotype C282Y/C282Y or C282Y/H63D responsible for the development of HFE-hemochromatosis. The prevalence of C282Y mutation was significantly higher among the inhabitants of Zemaitija (Somogitia) at the Baltic Sea area (5.9%) in comparison to the regions of continental part of Lithuania (2.4% in Dzukija, 2.3% in Aukstaitija, and 2% in Suvalkija, p HFE gene mutations in ethnic Lithuanians showed that the frequencies of H63D, C282Y, and S65C of HFE gene alleles are similar to the other North-Eastern Europeans, especially in the Baltic region (Estonia, Latvia), Poland, and part of Russia (Moscow region).

Analysis of HFE gene mutations and HLA-A alleles in Brazilian patients with iron overload

Directory of Open Access Journals (Sweden)

Rodolfo Delfini Cançado

Full Text Available CONTEXT AND OBJECTIVE: Hemochromatosis is a common inherited disorder of iron metabolism and one of the most important causes of iron overload. The objective was to analyze the presence of C282Y, H63D and S65C mutations in the HFE gene and HLA-A alleles for a group of Brazilian patients with iron overload, and to correlate genotype with clinical and laboratory variables. DESIGN AND SETTING: Prospective study, in Discipline of Hematology and Oncology, Faculdade de Ciências Médicas da Santa Casa de Misericórdia de São Paulo. METHODS: We studied 35 patients with iron overload seen at our outpatient unit between January 2001 and December 2003. Fasting levels of serum iron and ferritin, and total iron-binding capacity, were assayed using standard techniques. Determinations of C282Y, H63D and S65C mutations in the HFE gene and of HLA-A alleles were performed by polymerase chain reaction (PCR. RESULTS: Twenty-six out of 35 patients (74% presented at least one of the HFE gene mutations analyzed. Among these, five (14% were C282Y/C282Y, four (11% C282Y/H63D, one (3% H63D/H63D, six (17% C282Y/WT and ten (29% H63D/WT. No patients had the S65C mutation and nine (25% did not present any of the three HFE mutations. Four out of five patients with C282Y/C282Y genotype (80% and three out of four patients with C282Y/H63D genotype (75% were HLA A*03. CONCLUSION: Analysis of HFE gene mutations constitutes an important procedure in identifying patients with hereditary hemochromatosis, particularly for patients with iron overload.

C282Y polymorphism in the HFE gene is associated with risk of breast cancer.

Science.gov (United States)

Liu, Xiaoyan; Lv, Chunlei; Luan, Xiaorong; Lv, Ming

2013-10-01

The C282Y and H63D polymorphisms in the HFE gene have been implicated in susceptibility of breast cancer, but a number of studies have reported inconclusive results. The aim of this study is to investigate the association between the C282Y and H63D polymorphisms in the HFE gene and breast cancer risk by meta-analysis. We searched PubMed and Embase databases, covering all related studies until March 2, 2013. Statistical analysis was performed using STATA 10.0. A total of 7 studies including 1,720 cases and 18,296 controls for HFE C282Y polymorphism and 5 studies including 942 cases and 1,571 controls for HFE H63D polymorphism were included in the meta-analysis. The results showed that HFE C282Y polymorphism was significantly associated with increased risk of breast cancer under homozygotes vs. wild-type model (OR = 2.06, 95%CI = 1.19-3.58) and recessive model (OR = 1.98, 95%CI = 1.14-3.44) but not under heterozygotes vs. wild-type model (OR = 0.97, 95%CI = 0.70-1.35), dominant model (OR = 1.00, 95%CI = 0.72-1.40) and multiplicative model (OR = 1.04, 95%CI = 0.76-1.42). However, we did not find any association between HFE H63D polymorphism and breast cancer risk under all genetic models. This current meta-analysis suggested that C282Y polymorphism rather than H63D might be associated with increased risk of breast cancer.

Study of the HFE gene common polymorphisms in French patients with sporadic amyotrophic lateral sclerosis.

Science.gov (United States)

Praline, Julien; Blasco, Hélène; Vourc'h, Patrick; Rat, Valérian; Gendrot, Chantal; Camu, William; Andres, Christian R

2012-06-15

Our objective was to investigate whether the C282Y (p.Cys 282 Tyr) and H63D (p. His 63 Asp) HFE polymorphisms were associated with sporadic amyotrophic lateral sclerosis (SALS) in the French population. We searched for a relation of HFE polymorphisms with the clinical characteristics of the disease. The HFE polymorphisms were studied in 824 patients with SALS and 583 controls. We compared the frequency of the polymorphisms between SALS and controls groups by univariate and multivariate statistics, taking into account gender, site, age-at-onset and survival. We did not observe significant difference in the frequency of H63D polymorphism between SALS and control group. We observed a significant difference for C282Y between patients and controls with a low frequency of the Y allele in patients (3.2%) compared to our control group (5.9%). Disease duration, distribution of gender, site-of-onset, age-at-onset did not differ between groups taking into account genotypes of each polymorphism. Our results in this large cohort of ALS patients indicate that H63D polymorphism is not associated with SALS in the French population. This conclusion does not exclude a weak effect of the HFE gene polymorphisms in certain ALS populations, or an effect of other rare HFE gene variants. Copyright © 2012 Elsevier B.V. All rights reserved.

HFE mutations and hemochromatosis in Danish patients admitted for HFE genotyping

DEFF Research Database (Denmark)

Koefoed, P; Dalhoff, K; Dissing, J

2002-01-01

Analysis of the common C282Y and H63D mutations in the HFE gene is widely used to diagnose hereditary hemochromatosis (HH). The aim of this study was to evaluate the efficiency with which different hospitals and general practitioners select patients for HH genotype and to determine the distribution...... of HFE mutations in such patients. Nine hundred unrelated patients from Danish hospitals and general practitioners (group A) and 69 consecutive patients from a specialized liver unit (group B) were examined for HFE substitutions using multiplex real-time polymerase chain reaction. In group A we found 13...... in the H63D homozygotes or S65C heterozygotes. Moreover, 7 wild-type patients, 2 C282Y heterozygote patients and one H63D heterozygote patient fulfilled the criteria for HH. The significant enrichment of HH among associated genotype samples submitted for HFE testing indicates that the clinical selection...

Two novel mutations in the SLC40A1 and HFE genes implicated in iron overload in a Spanish man.

Science.gov (United States)

Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Alvarez-Sala-Walther, Luis-Antonio; Cuadrado-Grande, Nuria; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

2011-03-01

The most common form of hemochromatosis is caused by mutations in the HFE gene. Rare forms of the disease are caused by mutations in other genes. We present a patient with hyperferritinemia and iron overload, and facial flushing. Magnetic resonance imaging was performed to measure hepatic iron overload, and a molecular study of the genes involved in iron metabolism was undertaken. The iron overload was similar to that observed in HFE hemochromatosis, and the patient was double heterozygous for two novel mutations, c.-20G>A and c.718A>G (p.K240E), in the HFE and ferroportin (FPN1 or SLC40A1) genes, respectively. Hyperferritinemia and facial flushing improved after phlebotomy. Two of the patient's children were also studied, and the daughter was heterozygous for the mutation in the SLC40A1 gene, although she did not have hyperferritinemia. The patient presented a mild iron overload phenotype probably because of the two novel mutations in the HFE and SLC40A1 genes. © 2011 John Wiley & Sons A/S.

Serum hepcidin levels, iron status, and HFE gene alterations during the first year of life in healthy Spanish infants.

Science.gov (United States)

Aranda, Nuria; Bedmar, Cristina; Arija, Victoria; Jardí, Cristina; Jimenez-Feijoo, Rosa; Ferré, Natalia; Tous, Monica

2018-06-01

The aims of this study were to describe hepcidin levels and to assess their associations with iron status and the main variants in the HFE gene in healthy and full-term newborns during the first year of life, as a longitudinal study conducted on 140 infants. Anthropometric and biochemical parameters, hepcidin, hemoglobin (Hb), serum ferritin (SF), transferrin saturation (TS), mean corpuscular volume (MCV), and C-reactive protein (CRP), were assessed in 6- and 12-month-olds. Infants were genotyped for the three main HFE variants: C282Y, H63D, and S65C. Hepcidin levels increased from 6 to 12 months of age (43.7 ± 1.5 to 52.0 ± 1.5 ng/mL; p HFE gene (p = 0.046 and p = 0.048 in 6- and 12-month-olds, respectively). However, this association was not found in HFE-alteration-carrying infants. Hepcidin levels increased in healthy infants during the first year of life and were positively associated with iron levels only in infants with wild-type HFE gene, a situation that requires further investigation.

HJV and HFE Play Distinct Roles in Regulating Hepcidin.

Science.gov (United States)

Wu, Qian; Wang, Hao; An, Peng; Tao, Yunlong; Deng, Jiali; Zhang, Zhuzhen; Shen, Yuanyuan; Chen, Caiyong; Min, Junxia; Wang, Fudi

2015-05-20

Hereditary hemochromatosis (HH) is an iron overload disease that is caused by mutations in HFE, HJV, and several other genes. However, whether HFE-HH and HJV-HH share a common pathway via hepcidin regulation is currently unclear. Recently, some HH patients have been reported to carry concurrent mutations in both the HFE and HJV genes. To dissect the roles and molecular mechanisms of HFE and/or HJV in the pathogenesis of HH, we studied Hfe(-/-), Hjv(-/-), and Hfe(-/-)Hjv(-/-) double-knockout mouse models. Hfe(-/-)Hjv(-/-) mice developed iron overload in multiple organs at levels comparable to Hjv(-/-) mice. After an acute delivery of iron, the expression of hepcidin (i.e., Hamp1 mRNA) was increased in the livers of wild-type and Hfe(-/-) mice, but not in either Hjv(-/-) or Hfe(-/-)Hjv(-/-) mice. Furthermore, iron-induced phosphorylation of Smad1/5/8 was not detected in the livers of Hjv(-/-) or Hfe(-/-)Hjv(-/-) mice. We generated and phenotypically characterized Hfe(-/-)Hjv(-/-) double-knockout mice. In addition, because they faithfully phenocopy clinical HH patients, these mouse models are an invaluable tool for mechanistically dissecting how HFE and HJV regulate hepcidin expression. Based on our results, we conclude that HFE may depend on HJV for transferrin-dependent hepcidin regulation. The presence of residual hepcidin in the absence of HFE suggests either the presence of an unknown regulator (e.g., TFR2) that is synergistic with HJV or that HJV is sufficient to maintain basal levels of hepcidin.

Hepcidin regulation in wild-type and Hfe knockout mice in response to alcohol consumption: evidence for an alcohol-induced hypoxic response.

Science.gov (United States)

Heritage, Mandy L; Murphy, Therese L; Bridle, Kim R; Anderson, Gregory J; Crawford, Darrell H G; Fletcher, Linda M

2009-08-01

Expression of Hamp1, the gene encoding the iron regulatory peptide hepcidin, is inappropriately low in HFE-associated hereditary hemochromatosis and Hfe knockout mice (Hfe(-/-)). Since chronic alcohol consumption is also associated with disturbances in iron metabolism, we investigated the effects of alcohol consumption on hepcidin mRNA expression in Hfe(-/-) mice. Hfe(-/-) and C57BL/6 (wild-type) mice were pair-fed either an alcohol liquid diet or control diet for up to 8 weeks. The mRNA levels of hepcidin and ferroportin were measured at the mRNA level by RT-PCR and protein expression of hypoxia inducible factor-1 alpha (HIF-1alpha) was measured by western blot. Hamp1 mRNA expression was significantly decreased and duodenal ferroportin expression was increased in alcohol-fed wild-type mice at 8 weeks. Time course experiments showed that the decrease in hepcidin mRNA was not immediate, but was significant by 4 weeks. Consistent with the genetic defect, Hamp1 mRNA was decreased and duodenal ferroportin mRNA expression was increased in Hfe(-/-) mice fed on the control diet compared with wild-type animals and alcohol further exacerbated these effects. HIF-1alpha protein levels were elevated in alcohol-fed wild-type animals compared with controls. Alcohol may decrease Hamp1 gene expression independently of the HFE pathway possibly via alcohol-induced hypoxia.

Effect of HFE gene polymorphism on sustained virological response in patients with chronic hepatitis C and elevated serum ferritin.

Science.gov (United States)

Coelho-Borges, Silvia; Cheinquer, Hugo; Wolff, Fernando Herz; Cheinquer, Nelson; Krug, Luciano; Ashton-Prolla, Patricia

2012-01-01

Abnormal serum ferritin levels are found in approximately 20%-30% of the patients with chronic hepatitis C and are associated with a lower response rate to interferon therapy. To determine if the presence of HFE gene mutations had any effect on the sustained virological response rate to interferon based therapy in chronic hepatitis C patients with elevated serum ferritin. A total of 44 treatment naÏve patients with histologically demonstrated chronic hepatitis C, all infected with hepatitis C virus genotype non-1 (38 genotype 3; 6 genotype 2) and serum ferritin above 500 ng/mL were treated with interferon (3 MU, 3 times a week) and ribavirin (1.000 mg, daily) for 24 weeks. Sustained virological response was defined as negative qualitative HCV-RNA more than 24 weeks after the end of treatment. Serum HCV-RNA was measured by qualitative in house polymerase chain reaction with a limit of detection of 200 IU/mL. HFE gene mutation was detected using restriction-enzyme digestion with RsaI (C282Y mutation analysis) and BclI (H63D mutation analysis) in 16 (37%) patients, all heterozygous (11 H63D, 2 C282Y and 3 both). Sustained virological response was achieved in 0 of 16 patients with HFE gene mutations and 11 (41%) of 27 patients without HFE gene mutations (P = 0.002; exact Fisher test). Heterozigozity for H63D and/or C282Y HFE gene mutation predicts absence of sustained virological response to combination treatment with interferon and ribavirin in patients with chronic hepatitis C, non-1 genotype and serum ferritin levels above 500 ng/mL.

The relationship between selected VDR, HFE and ALAD gene polymorphisms and several basic toxicological parameters among persons occupationally exposed to lead

International Nuclear Information System (INIS)

Szymańska-Chabowska, Anna; Łaczmański, Łukasz; Jędrychowska, Iwona; Chabowski, Mariusz; Gać, Paweł; Janus, Agnieszka; Gosławska, Katarzyna; Smyk, Beata; Solska, Urszula; Mazur, Grzegorz; Poręba, Rafał

2015-01-01

The aim of this study was to find a relationship between polymorphisms of ALAD rs1805313, rs222808, rs1139488, VDR FokI and HFE C282Y and H63D and basic toxicological parameters (lead and ZnPP blood concentration) in people occupationally exposed to lead. We collected data of 101 workers (age 25–63 years) directly exposed to lead. The toxicological lab tests included blood lead, cadmium and ZnPP concentration measurement and arsenic urine concentration measurement. Workers were genotyped for ALAD (rs1805313, rs222808, rs1139488), HFE (C282Y, H63D) and VDR (FokI). Individuals with the lead exposure and coexisting F allel in the locus Fok-I of VDR gene are suspected of higher zinc protoporphyrins concentrations. Workers exposed to the lead with the Y allel in the locus C282Y of the HFE gene are predisposed to lower ZnPP levels and individuals with coexisting H allel in the locus H63D HFE gene are predisposed to lower Pb-B levels. The T allel in the locus rs1805313 of the ALAD gene determines lower Pb-B and ZnPP levels in lead–exposed individuals. The heterozigosity of the locus rs2228083 of the ALAD gene has a strong predilection to higher Pb-B levels. The carriage of the C allel in the locus rs1139488 of the ALAD gene might determine higher Pb-B levels and the heterozigosity of the locus rs1139488 of the ALAD gene might result in higher ZnPP levels. Conclusion. The study revealed relationship between VDR, HFE and ALAD genes polymorphism and basic toxicological parameters in occupationally exposed workers

Precipitating factors of porphyria cutanea tarda in Brazil with emphasis on hemochromatosis gene (HFE) mutations. Study of 60 patients.

Science.gov (United States)

Vieira, Fatima Mendonça Jorge; Nakhle, Maria Cristina; Abrantes-Lemos, Clarice Pires; Cançado, Eduardo Luiz Rachid; Reis, Vitor Manoel Silva dos

2013-01-01

Porphyria cutanea tarda is the most common form of porphyria, characterized by the decreased activity of the uroporphyrinogen decarboxylase enzyme. Several reports associated HFE gene mutations of hereditary hemochromatosis with porphyria cutanea tarda worldwide, although up to date only one study has been conducted in Brazil. Investigation of porphyria cutanea tarda association with C282Y and H63D mutations in the HFE gene. Identification of precipitating factors (hepatitis C, HIV, alcoholism and estrogen) and their link with HFE mutations. An ambispective study of 60 patients with PCT was conducted during the period from 2003 to 2012. Serological tests for hepatitis C and HIV were performed and histories of alcohol abuse and estrogen intake were investigated. HFE mutations were identified with real-time PCR. Porphyria cutanea tarda predominated in males and alcohol abuse was the main precipitating factor. Estrogen intake was the sole precipitating factor present in 25% of female patients. Hepatitis C was present in 41.7%. All HIV-positive patients (15.3%) had a history of alcohol abuse. Allele frequency for HFE mutations, i.e., C282Y (p = 0.0001) and H63D (p = 0.0004), were significantly higher in porphyria cutanea tarda patients, compared to control group. HFE mutations had no association with the other precipitating factors. Alcohol abuse, hepatitis C and estrogen intake are prevalent precipitating factors in our porphyria cutanea tarda population; however, hemochromatosis in itself can also contribute to the outbreak of porphyria cutanea tarda, which makes the research for HFE mutations necessary in these patients.

Effect of HFE gene polymorphism on sustained virological response in patients with chronic hepatitis C and elevated serum ferritin

Directory of Open Access Journals (Sweden)

Silvia Coelho-Borges

2012-03-01

Full Text Available CONTEXT: Abnormal serum ferritin levels are found in approximately 20%-30% of the patients with chronic hepatitis C and are associated with a lower response rate to interferon therapy. OBJECTIVE: To determine if the presence of HFE gene mutations had any effect on the sustained virological response rate to interferon based therapy in chronic hepatitis C patients with elevated serum ferritin. METHODS: A total of 44 treatment naÏve patients with histologically demonstrated chronic hepatitis C, all infected with hepatitis C virus genotype non-1 (38 genotype 3; 6 genotype 2 and serum ferritin above 500 ng/mL were treated with interferon (3 MU, 3 times a week and ribavirin (1.000 mg, daily for 24 weeks. RESULTS: Sustained virological response was defined as negative qualitative HCV-RNA more than 24 weeks after the end of treatment. Serum HCV-RNA was measured by qualitative in house polymerase chain reaction with a limit of detection of 200 IU/mL. HFE gene mutation was detected using restriction-enzyme digestion with RsaI (C282Y mutation analysis and BclI (H63D mutation analysis in 16 (37% patients, all heterozygous (11 H63D, 2 C282Y and 3 both. Sustained virological response was achieved in 0 of 16 patients with HFE gene mutations and 11 (41% of 27 patients without HFE gene mutations (P = 0.002; exact Fisher test. CONCLUSION: Heterozigozity for H63D and/or C282Y HFE gene mutation predicts absence of sustained virological response to combination treatment with interferon and ribavirin in patients with chronic hepatitis C, non-1 genotype and serum ferritin levels above 500 ng/mL.

HFE gene variants modify the association between maternal lead burden and infant birthweight: a prospective birth cohort study in Mexico City, Mexico.

Science.gov (United States)

Cantonwine, David; Hu, Howard; Téllez-Rojo, Martha Maria; Sánchez, Brisa N; Lamadrid-Figueroa, Héctor; Ettinger, Adrienne S; Mercado-García, Adriana; Hernández-Avila, Mauricio; Wright, Robert O

2010-07-26

Neonatal growth is a complex process involving genetic and environmental factors. Polymorphisms in the hemochromatosis (HFE) iron regulatory genes have been shown to modify transport and toxicity of lead which is known to affect birth weight. We investigated the role of HFE C282Y, HFE H63 D, and transferrin (TF) P570 S gene variants in modifying the association of lead and infant birthweight in a cohort of Mexican mother-infant pairs. Subjects were initially recruited between 1994-1995 from three maternity hospitals in Mexico City and 411 infants/565 mothers had archived blood available for genotyping. Multiple linear regression models, stratified by either maternal/infant HFE or TF genotype and then combined with interaction terms, were constructed examining the association of lead and birthweight after controlling for covariates. 3.1%, 16.8% and 17.5% of infants (N=390) and 1.9%, 14.5% and 18.9% of mothers (N=533) carried the HFE C282Y, HFE H63D, and TF P570 S variants, respectively. The presence of infant HFE H63 D variants predicted 110.3 g (95% CI -216.1, -4.6) decreases in birthweight while maternal HFE H63 D variants predicted reductions of 52.0 g (95% CI -147.3 to 43.2). Interaction models suggest that both maternal and infant HFE H63 D genotype may modify tibia lead's effect on infant birthweight in opposing ways. In our interaction models, maternal HFE H63 D variant carriers had a negative association between tibia lead and birthweight. These results suggest that the HFE H63 D genotype modifies lead's effects on infant birthweight in a complex fashion that may reflect maternal-fetal interactions with respect to the metabolism and transport of metals.

HFE gene mutations in patients with primary iron overload: is there a significant improvement in molecular diagnosis yield with HFE sequencing?

Science.gov (United States)

Santos, Paulo C J L; Pereira, Alexandre C; Cançado, Rodolfo D; Schettert, Isolmar T; Sobreira, Tiago J P; Oliveira, Paulo S L; Hirata, Rosario D C; Hirata, Mario H; Figueiredo, Maria Stella; Chiattone, Carlos S; Krieger, Jose E; Guerra-Shinohara, Elvira M

2010-12-15

Rare HFE variants have been shown to be associated with hereditary hemochromatosis (HH), an iron overload disease. The low frequency of the HFE p.C282Y mutation in HH-affected Brazilian patients may suggest that other HFE-related mutations may also be implicated in the pathogenesis of HH in this population. The main aim was to screen for new HFE mutations in Brazilian individuals with primary iron overload and to investigate their relationship with HH. Fifty Brazilian patients with primary iron overload (transferrin saturation>50% in females and 60% in males) were selected. Subsequent bidirectional sequencing for each HFE exon was performed. The effect of HFE mutations on protein structure were analyzed by molecular dynamics simulation and free binding energy calculations. p.C282Y in homozygosis or in heterozygosis with p.H63D were the most frequent genotypic combinations associated with HH in our sample population (present in 17 individuals, 34%). Thirty-six (72.0%) out of the 50 individuals presented at least one HFE mutation. The most frequent genotype associated with HH was the homozygous p.C282Y mutation (n=11, 22.0%). One novel mutation (p.V256I) was indentified in heterozygosis with the p.H63D mutation. In silico modeling analysis of protein behavior indicated that the p.V256I mutation does not reduce the binding affinity between HFE and β2-microglobulin (β2M) in the same way the p.C282Y mutation does compared with the native HFE protein. In conclusion, screening of HFE through direct sequencing, as compared to p.C282Y/p.H63D genotyping, was not able to increase the molecular diagnosis yield of HH. The novel p.V256I mutation could not be implicated in the molecular basis of the HH phenotype, although its role cannot be completely excluded in HH-phenotype development. Our molecular modeling analysis can help in the analysis of novel, previously undescribed, HFE mutations. Copyright © 2010 Elsevier Inc. All rights reserved.

The relationship between selected VDR, HFE and ALAD gene polymorphisms and several basic toxicological parameters among persons occupationally exposed to lead.

Science.gov (United States)

Szymańska-Chabowska, Anna; Łaczmański, Łukasz; Jędrychowska, Iwona; Chabowski, Mariusz; Gać, Paweł; Janus, Agnieszka; Gosławska, Katarzyna; Smyk, Beata; Solska, Urszula; Mazur, Grzegorz; Poręba, Rafał

2015-08-06

The aim of this study was to find a relationship between polymorphisms of ALAD rs1805313, rs222808, rs1139488, VDR FokI and HFE C282Y and H63D and basic toxicological parameters (lead and ZnPP blood concentration) in people occupationally exposed to lead. We collected data of 101 workers (age 25-63 years) directly exposed to lead. The toxicological lab tests included blood lead, cadmium and ZnPP concentration measurement and arsenic urine concentration measurement. Workers were genotyped for ALAD (rs1805313, rs222808, rs1139488), HFE (C282Y, H63D) and VDR (FokI). Individuals with the lead exposure and coexisting F allel in the locus Fok-I of VDR gene are suspected of higher zinc protoporphyrins concentrations. Workers exposed to the lead with the Y allel in the locus C282Y of the HFE gene are predisposed to lower ZnPP levels and individuals with coexisting H allel in the locus H63D HFE gene are predisposed to lower Pb-B levels. The T allel in the locus rs1805313 of the ALAD gene determines lower Pb-B and ZnPP levels in lead-exposed individuals. The heterozigosity of the locus rs2228083 of the ALAD gene has a strong predilection to higher Pb-B levels. The carriage of the C allel in the locus rs1139488 of the ALAD gene might determine higher Pb-B levels and the heterozigosity of the locus rs1139488 of the ALAD gene might result in higher ZnPP levels. The study revealed relationship between VDR, HFE and ALAD genes polymorphism and basic toxicological parameters in occupationally exposed workers. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Meta-analyses of HFE variants in coronary heart disease.

Science.gov (United States)

Lian, Jiangfang; Xu, Limin; Huang, Yi; Le, Yanping; Jiang, Danjie; Yang, Xi; Xu, Weifeng; Huang, Xiaoyan; Dong, Changzheng; Ye, Meng; Zhou, Jianqing; Duan, Shiwei

2013-09-15

HFE gene variants can cause hereditary hemochromatosis (HH) that often comes along with an increased risk of coronary heart disease (CHD). The goal of our study is to assess the contribution of four HFE gene variants to the risk of CHD. We conducted four meta-analyses of the studies examining the association between four HFE gene variants and the risk of CHD. A systematic search was conducted using MEDLINE, EMBASE, Web of Science and China National Knowledge Infrastructure (CNKI), Wanfang Chinese Periodical. Meta-analyses showed that HFE rs1799945-G allele was associated with a 6% increased risk of CHD (P=0.02, odds ratio (OR)=1.06, 95% confidence interval (CI)=1.01-1.11). However, no association between the other three HFE gene variants (rs1800562, rs1800730, and rs9366637) and CHD risk was observed by the meta-analyses (all P values>0.05). In addition, the results of our case-control study indicated that rs1800562 and rs1800730 were monomorphic, and that rs1799945 and rs9366637 were not associated with CHD in Han Chinese. Our meta-analysis suggested that a significant association existed between rs1799945 mutation and CHD, although this mutation was rare in Han Chinese. Copyright © 2013 Elsevier B.V. All rights reserved.

Genome-wide association study identifies TF as a significant modifier gene of iron metabolism in HFE hemochromatosis.

Science.gov (United States)

de Tayrac, Marie; Roth, Marie-Paule; Jouanolle, Anne-Marie; Coppin, Hélène; le Gac, Gérald; Piperno, Alberto; Férec, Claude; Pelucchi, Sara; Scotet, Virginie; Bardou-Jacquet, Edouard; Ropert, Martine; Bouvet, Régis; Génin, Emmanuelle; Mosser, Jean; Deugnier, Yves

2015-03-01

Hereditary hemochromatosis (HH) is the most common form of genetic iron loading disease. It is mainly related to the homozygous C282Y/C282Y mutation in the HFE gene that is, however, a necessary but not a sufficient condition to develop clinical and even biochemical HH. This suggests that modifier genes are likely involved in the expressivity of the disease. Our aim was to identify such modifier genes. We performed a genome-wide association study (GWAS) using DNA collected from 474 unrelated C282Y homozygotes. Associations were examined for both quantitative iron burden indices and clinical outcomes with 534,213 single nucleotide polymorphisms (SNP) genotypes, with replication analyses in an independent sample of 748 C282Y homozygotes from four different European centres. One SNP met genome-wide statistical significance for association with transferrin concentration (rs3811647, GWAS p value of 7×10(-9) and replication p value of 5×10(-13)). This SNP, located within intron 11 of the TF gene, had a pleiotropic effect on serum iron (GWAS p value of 4.9×10(-6) and replication p value of 3.2×10(-6)). Both serum transferrin and iron levels were associated with serum ferritin levels, amount of iron removed and global clinical stage (pHFE-associated HH (HFE-HH) patients, identified the rs3811647 polymorphism in the TF gene as the only SNP significantly associated with iron metabolism through serum transferrin and iron levels. Because these two outcomes were clearly associated with the biochemical and clinical expression of the disease, an indirect link between the rs3811647 polymorphism and the phenotypic presentation of HFE-HH is likely. Copyright © 2014 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Metabolic alterations, HFE gene mutations and atherogenic lipoprotein modifications in patients with primary iron overload.

Science.gov (United States)

Meroño, Tomás; Brites, Fernando; Dauteuille, Carolane; Lhomme, Marie; Menafra, Martín; Arteaga, Alejandra; Castro, Marcelo; Saez, María Soledad; Ballerga, Esteban González; Sorroche, Patricia; Rey, Jorge; Lesnik, Philippe; Sordá, Juan Andrés; Chapman, M John; Kontush, Anatol; Daruich, Jorge

2015-05-01

Iron overload (IO) has been associated with glucose metabolism alterations and increased risk of cardiovascular disease (CVD). Primary IO is associated with mutations in the HFE gene. To which extent HFE gene mutations and metabolic alterations contribute to the presence of atherogenic lipoprotein modifications in primary IO remains undetermined. The present study aimed to assess small, dense low-density lipoprotein (LDL) levels, chemical composition of LDL and high-density lipoprotein (HDL) particles, and HDL functionality in IO patients. Eighteen male patients with primary IO and 16 sex- and age-matched controls were recruited. HFE mutations (C282Y, H63D and S65C), measures of insulin sensitivity and secretion (calculated from the oral glucose tolerance test), chemical composition and distribution profile of LDL and HDL subfractions (isolated by gradient density ultracentrifugation) and HDL functionality (as cholesterol efflux and antioxidative activity) were studied. IO patients compared with controls exhibited insulin resistance (HOMA-IR (homoeostasis model assessment-estimated insulin resistance): +93%, PHFE genotypes. C282Y homozygotes (n=7) presented a reduced β-cell function and insulin secretion compared with non-C282Y patients (n=11) (-58% and -73%, respectively, PHFE gene mutations are involved in the presence of atherogenic lipoprotein modifications in primary IO. To what extent such alterations could account for an increase in CVD risk remains to be determined.

HFE gene variants, iron, and lipids: a novel connection in Alzheimer's disease.

Science.gov (United States)

Ali-Rahmani, Fatima; Schengrund, Cara-Lynne; Connor, James R

2014-01-01

Iron accumulation and associated oxidative stress in the brain have been consistently found in several neurodegenerative diseases. Multiple genetic studies have been undertaken to try to identify a cause of neurodegenerative diseases but direct connections have been rare. In the iron field, variants in the HFE gene that give rise to a protein involved in cellular iron regulation, are associated with iron accumulation in multiple organs including the brain. There is also substantial epidemiological, genetic, and molecular evidence of disruption of cholesterol homeostasis in several neurodegenerative diseases, in particular Alzheimer's disease (AD). Despite the efforts that have been made to identify factors that can trigger the pathological events associated with neurodegenerative diseases they remain mostly unknown. Because molecular phenotypes such as oxidative stress, synaptic failure, neuronal loss, and cognitive decline, characteristics associated with AD, have been shown to result from disruption of a number of pathways, one can easily argue that the phenotype seen may not arise from a linear sequence of events. Therefore, a multi-targeted approach is needed to understand a complex disorder like AD. This can be achieved only when knowledge about interactions between the different pathways and the potential influence of environmental factors on them becomes available. Toward this end, this review discusses what is known about the roles and interactions of iron and cholesterol in neurodegenerative diseases. It highlights the effects of gene variants of HFE (H63D- and C282Y-HFE) on iron and cholesterol metabolism and how they may contribute to understanding the etiology of complex neurodegenerative diseases.

The hepcidin gene promoter nc.-1010C > T; -582A > G haplotype modulates serum ferritin in individuals carrying the common H63D mutation in HFE gene.

Science.gov (United States)

Silva, Bruno; Pita, Lina; Gomes, Susana; Gonçalves, João; Faustino, Paula

2014-12-01

Hereditary hemochromatosis is an autosomal recessive disorder characterized by severe iron overload. It is usually associated with homozygosity for the HFE gene mutation c.845G > A; p.C282Y. However, in some cases, another HFE mutation (c.187C > G; p.H63D) seems to be associated with the disease. Its penetrance is very low, suggesting the possibility of other iron genetic modulators being involved. In this work, we have screened for HAMP promoter polymorphisms in 409 individuals presenting normal or increased serum ferritin levels together with normal or H63D-mutated HFE genotypes. Our results show that the hepcidin gene promoter TG haplotype, originated by linkage of the nc.-1010C > T and nc.-582A > G polymorphisms, is more frequent in the HFE_H63D individuals presenting serum ferritin levels higher than 300 μg/L than in those presenting the HFE_H63D mutation but with normal serum ferritin levels or in the normal control group.Moreover, it was observed that the TG haplotype was associated to increased serum ferritin levels in the overall pool of HFE_H63D individuals. Thus, our data suggest that screening for these polymorphisms could be of interest in order to explain the phenotype. However, this genetic condition seems to have no clinical significance.

Iron overload in HFE C282Y heterozygotes at first genetic testing: a strategy for identifying rare HFE variants.

Science.gov (United States)

Aguilar-Martinez, Patricia; Grandchamp, Bernard; Cunat, Séverine; Cadet, Estelle; Blanc, François; Nourrit, Marlène; Lassoued, Kaiss; Schved, Jean-François; Rochette, Jacques

2011-04-01

Heterozygotes for the p.Cys282Tyr (C282Y) mutation of the HFE gene do not usually express a hemochromatosis phenotype. Apart from the compound heterozygous state for C282Y and the widespread p.His63Asp (H63D) variant allele, other rare HFE mutations can be found in trans on chromosome 6. We performed molecular investigation of the genes implicated in hereditary hemochromatosis in six patients who presented with iron overload but were simple heterozygotes for the HFE C282Y mutation at first genetic testing. Functional impairment of new variants was deduced from computational methods including molecular modeling studies. We identified four rare HFE mutant alleles, three of which have not been previously described. One mutation is a 13-nucleotide deletion in exon 6 (c.1022_1034del13, p.His341_Ala345 > LeufsX119), which is predicted to lead to an elongated and unstable protein. The second one is a substitution of the last nucleotide of exon 2 (c.340G > A, p.Glu114Lys) which modifies the relative solvent accessibility in a loop interface. The third mutation, p.Arg67Cys, also lies in exon 2 and introduces a destabilization of the secondary structure within a loop of the α1 domain. We also found the previously reported c.548T > C (p.Leu183Pro) missense mutation in exon 3. No other known iron genes were mutated. We present an algorithm at the clinical and genetic levels for identifying patients deserving further investigation. Conclusions Our results suggest that additional mutations in HFE may have a clinical impact in C282Y carriers. In conjunction with results from previously described cases we conclude that an elevated transferrin saturation level and elevated hepatic iron index should indicate the utility of searching for further HFE mutations in C282Y heterozygotes prior to other iron gene studies.

Iron storage disease in Asia-Pacific populations: the importance of non-HFE mutations.

Science.gov (United States)

McDonald, Cameron J; Wallace, Daniel F; Crawford, Darrell H G; Subramaniam, V Nathan

2013-07-01

Hereditary hemochromatosis (HH) is a widely recognized and well-studied condition in European populations. This is largely due to the high prevalence of the C282Y mutation of HFE. Although less common than in Europe, HH cases have been reported in the Asia-Pacific region because of mutations in both HFE and non-HFE genes. Mutations in all of the currently known genes implicated in non-HFE HH (hemojuvelin, hepcidin, transferrin receptor 2, and ferroportin) have been reported in patients from the Asia-Pacific region. This review discusses the molecular basis of HH and the genes and mutations known to cause non-HFE HH with particular reference to the Asia-Pacific region. Challenges in the genetic diagnosis of non-HFE HH are also discussed and how new technologies such as next generation sequencing may be informative in the future. © 2013 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

Liver steatosis correlates with iron overload but not with HFE gene mutations in chronic hepatitis C.

Science.gov (United States)

Sikorska, Katarzyna; Stalke, Piotr; Romanowski, Tomasz; Rzepko, Robert; Bielawski, Krzysztof Piotr

2013-08-01

Liver steatosis and iron overload, which are frequently observed in chronic hepatitis C (CHC), may contribute to the progression of liver injury. This study aimed to evaluate the correlation between liver steatosis and iron overload in Polish patients with CHC compared to non-alcoholic fatty liver disease (NAFLD) and HFE-hereditary hemochromatosis (HH) patients. A total of 191 CHC patients were compared with 67 NAFLD and 21 HH patients. Liver function tests, serum markers of iron metabolism, cholesterol and triglycerides were assayed. The inflammatory activity, fibrosis, iron deposits and steatosis stages were assessed in liver specimens. HFE gene polymorphisms were investigated by PCR-RFLP. Liver steatosis was associated with obesity and diabetes mellitus. This disease was confirmed in 76/174 (44%) CHC patients, most of whom were infected with genotype 1. The average grade of steatosis was higher in NAFLD patients. CHC patients had significantly higher iron concentrations and transferrin saturations than NAFLD patients. Compared with CHC patients, HH patients had higher values of serum iron parameters and more intensive hepatocyte iron deposits without differences in the prevalence and intensity of liver steatosis. In the CHC group, lipids accumulation in hepatocytes was significantly associated with the presence of serum markers of iron overload. No correlation between the HFE gene polymorphism and liver steatosis in CHC patients was found. Liver steatosis was diagnosed in nearly half of CHC patients, most of whom were infected with genotype 1. The intensity of steatosis was lower in CHC patients than that in NAFLD patients because of a less frequent diagnosis of metabolic syndrome. Only in CHC patients were biochemical markers of iron accumulation positively correlated with liver steatosis; these findings were independent of HFE gene mutations.

Mutations in the HFE, TFR2, and SLC40A1 genes in patients with hemochromatosis.

Science.gov (United States)

Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Cuadrado-Grande, Nuria; Alvarez-Sala-Walther, Luis-Antonio; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

2012-10-15

Hereditary hemochromatosis causes iron overload and is associated with a variety of genetic and phenotypic conditions. Early diagnosis is important so that effective treatment can be administered and the risk of tissue damage avoided. Most patients are homozygous for the c.845G>A (p.C282Y) mutation in the HFE gene; however, rare forms of genetic iron overload must be diagnosed using a specific genetic analysis. We studied the genotype of 5 patients who had hyperferritinemia and an iron overload phenotype, but not classic mutations in the HFE gene. Two patients were undergoing phlebotomy and had no iron overload, 1 with metabolic syndrome and no phlebotomy had mild iron overload, and 2 patients had severe iron overload despite phlebotomy. The patients' first-degree relatives also underwent the analysis. We found 5 not previously published mutations: c.-408_-406delCAA in HFE, c.1118G>A (p.G373D), c.1473G>A (p.E491E) and c.2085G>C (p.S695S) in TFR2; and c.-428_-427GG>TT in SLC40A1. Moreover, we found 3 previously published mutations: c.221C>T (p.R71X) in HFE; c.1127C>A (p.A376D) in TFR2; and c.539T>C (p.I180T) in SLC40A1. Four patients were double heterozygous or compound heterozygous for the mutations mentioned above, and the patient with metabolic syndrome was heterozygous for a mutation in the TFR2 gene. Our findings show that hereditary hemochromatosis is clinically and genetically heterogeneous and that acquired factors may modify or determine the phenotype. Copyright © 2012. Published by Elsevier B.V.

Examination of HFE associations with childhood leukemia risk and extension to other iron regulatory genes.

Science.gov (United States)

Kennedy, Amy E; Kamdar, Kala Y; Lupo, Philip J; Okcu, M Fatih; Scheurer, Michael E; Baum, Marianna K; Dorak, M Tevfik

2014-09-01

Hereditary hemochromatosis (HFE) variants correlating with body iron levels have shown associations with cancer risk, including childhood acute lymphoblastic leukemia (ALL). Using a multi-ethnic sample of cases and controls from Houston, TX, we examined two HFE variants (rs1800562 and rs1799945), one transferrin receptor gene (TFRC) variant (rs3817672) and three additional iron regulatory gene (IRG) variants (SLC11A2 rs422982; TMPRSS6 rs855791 and rs733655) for their associations with childhood ALL. Being positive for either of the HFE variants yielded a modestly elevated odds ratio (OR) for childhood ALL risk in males (1.40, 95% CI=0.83-2.35), which increased to 2.96 (95% CI=1.29-6.80) in the presence of a particular TFRC genotype for rs3817672 (P interaction=0.04). The TFRC genotype also showed an ethnicity-specific association, with increased risk observed in non-Hispanic Whites (OR=2.54, 95% CI=1.05-6.12; P interaction with ethnicity=0.02). The three additional IRG SNPs all showed individual risk associations with childhood ALL in males (OR=1.52-2.60). A polygenic model based on the number of variant alleles in five IRG SNPs revealed a linear increase in risk among males with the increasing number of variants possessed (OR=2.0 per incremental change, 95% CI=1.29-3.12; P=0.002). Our results replicated previous HFE risk associations with childhood ALL in a US population and demonstrated novel associations for IRG SNPs, thereby strengthening the hypothesis that iron excess mediated by genetic variants contributes to childhood ALL risk. Copyright © 2014 Elsevier Ltd. All rights reserved.

HFE gene variants, iron, and lipids: a novel connection in Alzheimer’s disease

Science.gov (United States)

Ali-Rahmani, Fatima; Schengrund, Cara-Lynne; Connor, James R.

2014-01-01

Iron accumulation and associated oxidative stress in the brain have been consistently found in several neurodegenerative diseases. Multiple genetic studies have been undertaken to try to identify a cause of neurodegenerative diseases but direct connections have been rare. In the iron field, variants in the HFE gene that give rise to a protein involved in cellular iron regulation, are associated with iron accumulation in multiple organs including the brain. There is also substantial epidemiological, genetic, and molecular evidence of disruption of cholesterol homeostasis in several neurodegenerative diseases, in particular Alzheimer’s disease (AD). Despite the efforts that have been made to identify factors that can trigger the pathological events associated with neurodegenerative diseases they remain mostly unknown. Because molecular phenotypes such as oxidative stress, synaptic failure, neuronal loss, and cognitive decline, characteristics associated with AD, have been shown to result from disruption of a number of pathways, one can easily argue that the phenotype seen may not arise from a linear sequence of events. Therefore, a multi-targeted approach is needed to understand a complex disorder like AD. This can be achieved only when knowledge about interactions between the different pathways and the potential influence of environmental factors on them becomes available. Toward this end, this review discusses what is known about the roles and interactions of iron and cholesterol in neurodegenerative diseases. It highlights the effects of gene variants of HFE (H63D- and C282Y-HFE) on iron and cholesterol metabolism and how they may contribute to understanding the etiology of complex neurodegenerative diseases. PMID:25071582

Mutation in HFE gene decreases manganese accumulation and oxidative stress in the brain after olfactory manganese exposure.

Science.gov (United States)

Ye, Qi; Kim, Jonghan

2016-06-01

Increased accumulation of manganese (Mn) in the brain is significantly associated with neurobehavioral deficits and impaired brain function. Airborne Mn has a high systemic bioavailability and can be directly taken up into the brain, making it highly neurotoxic. While Mn transport is in part mediated by several iron transporters, the expression of these transporters is altered by the iron regulatory gene, HFE. Mutations in the HFE gene are the major cause of the iron overload disorder, hereditary hemochromatosis, one of the prevalent genetic diseases in humans. However, whether or not HFE mutation modifies Mn-induced neurotoxicity has not been evaluated. Therefore, our goal was to define the role of HFE mutation in Mn deposition in the brain and the resultant neurotoxic effects after olfactory Mn exposure. Mice carrying the H67D HFE mutation, which is homologous to the H63D mutation in humans, and their control, wild-type mice, were intranasally instilled with MnCl2 with different doses (0, 0.2, 1.0 and 5.0 mg kg(-1)) daily for 3 days. Mn levels in the blood, liver and brain were determined using inductively-coupled plasma mass spectrometry (ICP-MS). H67D mutant mice showed significantly lower Mn levels in the blood, liver, and most brain regions, especially in the striatum, while mice fed an iron-overload diet did not. Moreover, mRNA expression of ferroportin, an essential exporter of iron and Mn, was up-regulated in the striatum. In addition, the levels of isoprostane, a marker of lipid peroxidation, were increased in the striatum after Mn exposure in wild-type mice, but were unchanged in H67D mice. Together, our results suggest that the H67D mutation provides decreased susceptibility to Mn accumulation in the brain and neurotoxicity induced by inhaled Mn.

[The polymorphism of catechol-O-methyltransferase (COMT) and hemochromatosis (HFE) genes in the radiocontaminated regions residents with different chromosome aberration frequency].

Science.gov (United States)

Ivanova, T I; Kondrashova, T V; Krikunova, L I; Smirnova, I A; Shentereva, N I; Sychenkova, N I; Rykova, E V; Zharikova, I A; Khorokhorina, V A; Riabchenko, N I; Zamulaeva, I A

2010-01-01

The association between polymorphisms in genes COMT, HFE that takes part in oxidative stress regulation, and chromosome aberration frequency in lymphocytes was assessed in 278 female residents of radiation polluted regions of Central Russia: Bryansk (322 kBk/m2) and Tula Districts (137Cs - 171 kBk/m2). The C187G, G845A genotyping of HFE and G1947A (H/L) of COMT was done by means of polymerase chain reaction-restriction fragment length polymorphism. Studied population was divided into 3 subgroups by level of chromosome aberrations per cell (0-2, 3-4, >5). There was shown statistically significant difference in distribution of COMTand HFE genotypes between the groups. The high frequency of chromosome aberrations (> or = 5%) was associated with homozygotes of the high activity COMT G/G and HFE CC. Heterozygotes for G1947A COMT and C187G HFE reveal negative association with the high frequency of chromosome aberrations and correspond to "resistance factors".

Estudo das mutações C282Y, H63D e S65C do gene HFE em doentes brasileiros com sobrecarga de ferro Study of C282Y, H63D and S65C mutations in the HFE gene in Brazilian patients with iron overload

Directory of Open Access Journals (Sweden)

Rodolfo D. Cançado

2007-12-01

Full Text Available Hemocromatose é uma das doenças genéticas mais freqüentes no ser humano e uma das causas mais importantes de sobrecarga de ferro. Os objetivos deste estudo foram determinar a freqüência das mutações C282Y, H63D e S65C do gene HFE em doentes brasileiros com sobrecarga de ferro, verificar a coexistência de anemia hemolítica hereditária, hepatite C e consumo excessivo de bebida alcoólica nestes doentes e avaliar a influência destas variáveis sobre os depósitos de ferro do organismo. Saturação da transferrina, ferritina sérica e análise das mutações C282Y, H63D e S65C do gene HFE, pelo método da PCR, foram determinadas em cinqüenta doentes com sobrecarga de ferro atendidos no Hemocentro da Santa Casa de São Paulo entre janeiro de 2000 e maio de 2004. A freqüência de mutação do gene HFE nos doentes com sobrecarga de ferro foi de 76,0% (38/50. Saturação da transferrina e ferritina foram significativamente maiores nos doentes homozigotos para a mutação C282Y confirmando a correlação entre genótipo C282Y/C282Y e maior risco de sobrecarga de ferro. A coexistência de hepatite C, consumo excessivo de bebida alcoólica ou anemia hemolítica hereditária estão implicados em aumento dos estoques de ferro e constituem fator de risco adicional em pacientes com mutação do gene HFE para a condição de sobrecarga de ferro.Hemochromatosis is one of the most frequent genetic diseases in humans and one of the most important causes of iron overload. The aims of this study were to determine the frequency of C282Y, H63D and S65C mutations of the HFE gene in Brazilian patients with iron overload, to verify the coexistence of chronic hemolytic anemia, hepatitis C and excessive alcohol consumption and to evaluate the influence of these variables on body iron deposits. Transferrin saturation, serum ferritin and C282Y, H63D and S65C HFE gene mutations (by PCR method were determined in 50 patients with iron overload in the Hemocentro da

[Analysis of H63D mutation in hemochromatosis (HFE) gene in populations of central Eurasia].

Science.gov (United States)

Khusainova, R I; Khusnutdinova, N N; Litvinov, S S; Khusnutdinova, E K

2013-02-01

An analysis of the frequency of H63D (c. 187C>G) mutations in the HFEgene in 19 populations from Central Eurasia demonstrated that the distribution of the mutation in the region of interest was not uniform and that there were the areas of H63D accumulation. The investigation of three polymorphic variants, c.340+4T>C (rs2071303, IVS2(+4)T>C), c.893-44T>C (rs1800708, IVS4(-44)T>C), and c.1007-47G>A (rs1572982, IVS5(-47)A>G), in the HFE gene in individuals homozygous for H63D mutations in the HFE gene revealed the linkage of H63D with three haplotypes, *CTA, *TG, and *TTA. These findings indicated the partial spread of the mutation in Central Eurasia from Western Europe, as well as the possible repeated appearance of the mutation on the territory on interest.

Transferrin Level Before Treatment and Genetic Polymorphism in HFE Gene as Predictive Markers for Response to Adalimumab in Crohn's Disease Patients.

Science.gov (United States)

Repnik, Katja; Koder, Silvo; Skok, Pavel; Ferkolj, Ivan; Potočnik, Uroš

2016-08-01

Tumor necrosis factor α inhibitors (anti-TNF) have improved treatment of several complex diseases, including Crohn's disease (CD). However, the effect varies and approximately one-third of the patients do not respond. Since blood parameters as well as genetic factors have shown a great potential to predict response during treatment, the aim of the study was to evaluate response to anti-TNF treatment with adalimumab (ADA) between genes HFE and TF and haematological parameters in Slovenian refractory CD patients. Single nucleotide polymorphisms (SNPs) rs1799852 in gene TF and rs2071303 in gene HFE were genotyped in 68 refractory CD patients for which response has been measured using inflammatory bowel disease questionnaire (IBDQ) index. Haematological parameters and IBDQ index were determined before therapy and after 4, 12, 20 and 30 weeks. We found novel strong association between SNP rs2071303 in gene HFE and response to ADA treatment, particularly patients with G allele comparing to A allele had better response after 20 weeks (p = 0.008). Further, we found strong association between transferrin level at baseline and treatment response after 12, 20 and 30 weeks, where average transferrin level before therapy was lower in responders (2.38 g/L) compared to non-responders (2.89 g/L, p = 0.005). Association was found between transferrin level in week 30 and SNP rs1799852 (p = 0.023), and between MCHC level before treatment and SNP rs2071303 (p = 0.007). Our results suggest that SNP in gene HFE as well as haematological markers serve as promising prognostic markers of response to anti-TNF treatment in CD patients.

Hereditary hemochromatosis (HFE) genotypes in heart failure: relation to etiology and prognosis

DEFF Research Database (Denmark)

Møller, Daniel Vega; Pecini, Redi; Gustafsson, Finn

2010-01-01

It is believed that hereditary hemochromatosis (HH) might play a role in cardiac disease (heart failure (HF) and ischemia). Mutations within several genes are HH-associated, the most common being the HFE gene. In a large cohort of HF patients, we sought to determine the etiological role...... and the prognostic significance of HFE genotypes....

Pathophysiological consequences and benefits of HFE mutations: 20 years of research

Science.gov (United States)

Hollerer, Ina; Bachmann, André; Muckenthaler, Martina U.

2017-01-01

Mutations in the HFE (hemochromatosis) gene cause hereditary hemochromatosis, an iron overload disorder that is hallmarked by excessive accumulation of iron in parenchymal organs. The HFE mutation p.Cys282Tyr is pathologically most relevant and occurs in the Caucasian population with a carrier frequency of up to 1 in 8 in specific European regions. Despite this high prevalence, the mutation causes a clinically relevant phenotype only in a minority of cases. In this review, we summarize historical facts and recent research findings about hereditary hemochromatosis, and outline the pathological consequences of the associated gene defects. In addition, we discuss potential advantages of HFE mutations in asymptomatic carriers. PMID:28280078

Global transcriptional response to Hfe deficiency and dietary iron overload in mouse liver and duodenum.

Directory of Open Access Journals (Sweden)

Alejandra Rodriguez

2009-09-01

Full Text Available Iron is an essential trace element whose absorption is usually tightly regulated in the duodenum. HFE-related hereditary hemochromatosis (HH is characterized by abnormally low expression of the iron-regulatory hormone, hepcidin, which results in increased iron absorption. The liver is crucial for iron homeostasis as it is the main production site of hepcidin. The aim of this study was to explore and compare the genome-wide transcriptome response to Hfe deficiency and dietary iron overload in murine liver and duodenum. Illumina arrays containing over 47,000 probes were used to study global transcriptional changes. Quantitative RT-PCR (Q-RT-PCR was used to validate the microarray results. In the liver, the expression of 151 genes was altered in Hfe(-/- mice while dietary iron overload changed the expression of 218 genes. There were 173 and 108 differentially expressed genes in the duodenum of Hfe(-/- mice and mice with dietary iron overload, respectively. There was 93.5% concordance between the results obtained by microarray analysis and Q-RT-PCR. Overexpression of genes for acute phase reactants in the liver and a strong induction of digestive enzyme genes in the duodenum were characteristic of the Hfe-deficient genotype. In contrast, dietary iron overload caused a more pronounced change of gene expression responsive to oxidative stress. In conclusion, Hfe deficiency caused a previously unrecognized increase in gene expression of hepatic acute phase proteins and duodenal digestive enzymes.

Brain transcriptome perturbations in the Hfe(-/-) mouse model of genetic iron loading.

Science.gov (United States)

Johnstone, Daniel; Graham, Ross M; Trinder, Debbie; Delima, Roheeth D; Riveros, Carlos; Olynyk, John K; Scott, Rodney J; Moscato, Pablo; Milward, Elizabeth A

2012-04-11

Severe disruption of brain iron homeostasis can cause fatal neurodegenerative disease, however debate surrounds the neurologic effects of milder, more common iron loading disorders such as hereditary hemochromatosis, which is usually caused by loss-of-function polymorphisms in the HFE gene. There is evidence from both human and animal studies that HFE gene variants may affect brain function and modify risks of brain disease. To investigate how disruption of HFE influences brain transcript levels, we used microarray and real-time reverse transcription polymerase chain reaction to assess the brain transcriptome in Hfe(-/-) mice relative to wildtype AKR controls (age 10 weeks, n≥4/group). The Hfe(-/-) mouse brain showed numerous significant changes in transcript levels (pgenes relating to transcriptional regulation (FBJ osteosarcoma oncogene Fos, early growth response genes), neurotransmission (glutamate NMDA receptor Grin1, GABA receptor Gabbr1) and synaptic plasticity and memory (calcium/calmodulin-dependent protein kinase IIα Camk2a). As previously reported for dietary iron-supplemented mice, there were altered levels of transcripts for genes linked to neuronal ceroid lipofuscinosis, a disease characterized by excessive lipofuscin deposition. Labile iron is known to enhance lipofuscin generation which may accelerate brain aging. The findings provide evidence that iron loading disorders can considerably perturb levels of transcripts for genes essential for normal brain function and may help explain some of the neurologic signs and symptoms reported in hemochromatosis patients. Copyright © 2012 Elsevier B.V. All rights reserved.

The role of HFE genotype in macrophage phenotype.

Science.gov (United States)

Nixon, Anne M; Neely, Elizabeth; Simpson, Ian A; Connor, James R

2018-02-01

Iron regulation is essential for cellular energy production. Loss of cellular iron homeostasis has critical implications for both normal function and disease progression. The H63D variant of the HFE gene is the most common gene variant in Caucasians. The resulting mutant protein alters cellular iron homeostasis and is associated with a number of neurological diseases and cancer. In the brain, microglial and infiltrating macrophages are critical to maintaining iron homeostasis and modulating inflammation associated with the pathogenic process in multiple diseases. This study addresses whether HFE genotype affects macrophage function and the implications of these findings for disease processes. Bone marrow macrophages were isolated from wildtype and H67D HFE knock-in mice. The H67D gene variant in mice is the human equivalent of the H63D variant. Upon differentiation, the macrophages were used to analyze iron regulatory proteins, cellular iron release, migration, phagocytosis, and cytokine expression. The results of this study demonstrate that the H67D HFE genotype significantly impacts a number of critical macrophage functions. Specifically, fundamental activities such as proliferation in response to iron exposure, L-ferritin expression in response to iron loading, secretion of BMP6 and cytokines, and migration and phagocytic activity were all found to be impacted by genotype. Furthermore, we demonstrated that exposure to apo-Tf (iron-poor transferrin) can increase the release of iron from macrophages. In normal conditions, 70% of circulating transferrin is unsaturated. Therefore, the ability of apo-Tf to induce iron release could be a major regulatory mechanism for iron release from macrophages. These studies demonstrate that the HFE genotype impacts fundamental components of macrophage phenotype that could alter their role in degenerative and reparative processes in neurodegenerative disorders.

Mutations in HAMP and HJV genes and their impact on expression of clinical hemochromatosis in a cohort of 100 Spanish patients homozygous for the C282Y mutation of HFE gene.

Science.gov (United States)

Altès, Albert; Bach, Vanessa; Ruiz, Angels; Esteve, Anna; Felez, Jordi; Remacha, Angel F; Sardà, M Pilar; Baiget, Montserrat

2009-10-01

Most hereditary hemochromatosis (HH) patients are homozygous for the C282Y mutation of the HFE gene. Nevertheless, penetrance of the disease is very variable. In some patients, penetrance can be mediated by concomitant mutations in other iron master genes. We evaluated the clinical impact of hepcidin (HAMP) and hemojuvelin mutations in a cohort of 100 Spanish patients homozygous for the C282Y mutation of the HFE gene. HAMP and hemojuvelin mutations were evaluated in all patients by bidirectional direct cycle sequencing. Phenotype-genotype interactions were evaluated. A heterozygous mutation of the HAMP gene (G71D) was found in only one out of 100 cases. Following, we performed a study of several members of that family, and we observed several members had a digenic inheritance of the C282Y mutation of the HFE gene and the G71D mutation of the HAMP gene. This mutation in the HAMP gene did not modify the phenotype of the individuals who were homozygous for the C282Y mutation. One other patient presented a new polymorphism in the hemojuvelin gene, without consequences in iron load or clinical course of the disease. In conclusion, HAMP and hemojuvelin mutations are rare among Spanish HH patients, and their impact in this population is not significant.

HFE polymorphisms influence the response to chemotherapeutic agents via induction of p16INK4A.

Science.gov (United States)

Lee, Sang Y; Liu, Siying; Mitchell, Ryan M; Slagle-Webb, Becky; Hong, Young-Soo; Sheehan, Jonas M; Connor, James R

2011-11-01

HFE is a protein that impacts cellular iron uptake. HFE gene variants are identified as risk factors or modifiers for multiple diseases. Using HFE stably transfected human neuroblastoma cells, we found that cells carrying the C282Y HFE variant do not differentiate when exposed to retinoic acid. Therefore, we hypothesized HFE variants would impact response to therapeutic agents. Both the human neuroblastoma and glioma cells that express the C282Y HFE variant are resistant to Temodar, geldanamycin and γ-radiation. A gene array analysis revealed that p16INK4A (p16) expression was increased in association with C282Y expression. Decreasing p16 protein by siRNA resulted in increased vulnerability to all of the therapeutic agents suggesting that p16 is responsible for the resistance. Decreasing HFE expression by siRNA resulted in a 85% decrease in p16 expression in the neuroblastoma cells but not the astrocytoma cells. These data suggest a potential direct relationship between HFE and p16 that may be cell specific or mediated by different pathways in the different cell types. In conclusion, the C282Y HFE variant impacts the vulnerability of cancer cells to current treatment strategies apparently by increasing expression of p16. Although best known as a tumor suppressor, there are multiple reports that p16 is elevated in some forms of cancer. Given the frequency of the HFE gene variants, as high as 10% of the Caucasian population, these data provide compelling evidence that the C282Y HFE variant should be part of a pharmacogenetic strategy for evaluating treatment efficacy in cancer cells. Copyright © 2011 UICC.

HFE MUTATIONS AND IRON OVERLOAD IN PATIENTS WITH ALCOHOLIC LIVER DISEASE

Directory of Open Access Journals (Sweden)

Luis COSTA-MATOS

2013-03-01

Full Text Available Context Alcoholic liver disease (ALD is generally associated with iron overload, which may contribute to its pathogenesis, through increased oxidative stress and cellular damage. There are conflicting reports in literature about hemochromatosis (HFE gene mutations and the severity of liver disease in alcoholic patients. Objectives To compare the prevalence of mutations in the hemochromatosis (HFE gene between patients with ALD and healthy controls; to assess the relation of HFE mutations with liver iron stores and liver disease severity. Methods Liver biopsy specimens were obtained from 63 ALD patients (during routine treatment and 52 healthy controls (during elective cholecystectomy. All individuals underwent routine liver function tests and HFE genotyping (to detect wild-type sequences and C282Y, H63D, S65C, E168Q, E168X, V59M, H63H, P160delC, Q127H, Q283P, V53M and W164X mutations. Associations between HFE mutations and risk of excessive liver iron stores, abnormal serum ferritin, liver fibrosis, or necroinflammatory activity were assessed by multivariate logistic regression analysis. Results ALD patients had significantly higher serum ferritin and transferrin saturation than controls (both P<0.05, but the distribution of HFE mutations was similar between the two groups. For ALD patients, the odds ratio for having at least one HFE mutation and excessive liver iron stores was 17.23 (95% confidence interval (CI: 2.09-142.34, P = 0.008. However, the presence of at least one HFE mutation was not associated with an increased risk of liver fibrosis or necroinflammatory activity. Active alcohol ingestion showed the strongest association to increased serum ferritin (OR = 8.87, 95% CI: 2.11-34.78, P = 0.003. Conclusions ALD patients do not present with a differential profile of HFE mutations from healthy controls. In ALD patients, however, the presence of at least one HFE mutation increases the risk of having excessive liver iron stores but has no

Variation in the HFE gene is associated with the development of bleomycin-induced pulmonary toxicity in testicular cancer patients.

Science.gov (United States)

van der Schoot, Gabriela G F; Westerink, Nico-Derk L; Lubberts, Sjoukje; Nuver, Janine; Zwart, Nynke; Walenkamp, Annemiek M E; Wempe, Johan B; Meijer, Coby; Gietema, Jourik A

2016-05-01

Bleomycin and cisplatin are of key importance in testicular cancer treatment. Known potential serious adverse effects are bleomycin-induced pulmonary toxicity (BIP) and cisplatin-induced renal toxicity. Iron handling may play a role in development of this toxicity. Carriage of allelic variants of the HFE gene induces altered iron metabolism and may contribute to toxicity. We investigated the association between two common allelic variants of the HFE gene, H63D and C282Y, with development of pulmonary and renal toxicity during and after treatment with bleomycin- and cisplatin-containing chemotherapy. In 369 testicular cancer patients treated with bleomycin and cisplatin at the University Medical Center Groningen between 1978 and 2006, H63D and/or C282Y genotypes were determined with an allelic discrimination assay. Data were collected on development of BIP, pulmonary function parameters, renal function, and survival. BIP developed more frequently in patients who were heterozygote (16 in 75, 21%) and homozygote (2 in 4, 50%) for the H63D variant, compared with those who had the HFE wild-type gene (31 in 278, 11%) (p = 0.012). Overall survival, testicular cancer-related survival, and change in renal function were not associated with the H63D variant. We observed an association between presence of one or both H63D alleles and development of BIP in testicular cancer patients treated with bleomycin combination chemotherapy. In patients heterozygote and homozygote for the H63D variant, BIP occurred more frequently compared with wild-type patients. When validated and confirmed, HFE H63D genotyping may be used to identify patients with increased risk for pulmonary bleomycin toxicity. Copyright © 2016 Elsevier Ltd. All rights reserved.

HFE gene C282Y, H63D and S65C mutations frequency in the Transylvania region, Romania.

Science.gov (United States)

Trifa, Adrian P; Popp, Radu A; Militaru, Mariela S; Farcaş, Marius F; Crişan, Tania O; Gana, Ionuţ; Cucuianu, Andrei; Pop, Ioan V

2012-06-01

HFE-associated haemochromatosis is one of the most frequent autosomal recessive disorders in the Caucasian population. Although most of the cases are homozygous individuals for the C282Y mutation, another two mutations, H63D and S65C, have been reported to be associated with milder forms of the disease. This study was a first attempt to evaluate the distribution of these HFE gene mutations in the Transylvania region. Two-hundred and twenty-five healthy, unrelated volunteers originating from the Transylvania region, Romania, were screened for the HFE gene C282Y, H63D and S65C mutations, using molecular genetics assays (Polymerase Chain Reaction-Restriction Fragments Length Polymorphism). For the C282Y mutation, 7 heterozygotes (3.1%) were found, but no homozygous individual. In the case of the H63D mutation, 40 heterozygotes (17.8%) and 4 homozygotes (1.75%) for the mutant allele were evidenced. We found a compound heterozygous genotype (C282Y/H63D) in one individual (0.45%). Thus, the allele frequencies of the C282Y and H63D were 1.75% and 10.9%, respectively. Three individuals (1.3%) were found to harbour the S65C mutation in a heterozygous state, but none in a homozygous state: the allele frequency of the mutant allele was 0.75%. The distribution of the HFE gene C282Y, H63D and S65C mutations found in our group matches the tendencies observed in other European countries: a decreasing gradient from Northern to Southern Europe for the C282Y mutation; high frequency for the H63D mutation, and low frequency for the S65C mutation in most of the countries.

HFE Genotype Restricts the Response to Paraquat in a Mouse Model of Neurotoxicity.

Science.gov (United States)

Nixon, Anne M; Meadowcroft, Mark D; Neely, Elizabeth B; Snyder, Amanda M; Purnell, Carson J; Wright, Justin; Lamendella, Regina; Nandar, Wint; Huang, Xuemei; Connor, James R

2018-05-01

Parkinson's disease is marked clinically by motor dysfunction and pathologically by dopaminergic cell loss in the substantia nigra and iron accumulation in the substantia nigra. The driver underlying iron accumulation remains unknown and could be genetic or environmental. The HFE protein is critical for the regulation of cellular iron uptake. Mutations within this protein are associated with increased iron accumulation including in the brain. We have focused on the commonly occurring H63D variant of the HFE gene as a disease modifier in a number of neurodegenerative diseases. To investigate the role of H63D HFE genotype, we generated a mouse model in which the wild-type (WT) HFE gene is replaced by the H67D gene variant (mouse homolog of the human H63D gene variant). Using paraquat toxicity as the model for Parkinson's disease, we found that WT mice responded as expected with significantly greater motor function, loss of tyrosine hydroxylase staining and increase microglial staining in the substantia nigra, and an increase in R 2 relaxation rate within the substantia nigra of the paraquat-treated mice compared to their saline-treated counterparts. In contrast, the H67D mice showed a remarkable resistance to paraquat treatment; specifically differing from the WT mice with no changes in motor function or changes in R 2 relaxation rates following paraquat exposure. At baseline, there were differences between the H67D HFE mice and WT mice in gut microbiome profile and increased L-ferritin staining in the substantia nigra that could account for the resistance to paraquat. Of particular note, the H67D HFE mice regardless of whether or not they were treated with paraquat had significantly less tyrosine hydroxylase immunostaining than WT. Our results clearly demonstrate that the HFE genotype impacts the expression of tyrosine hydroxylase in the substantia nigra, the gut microbiome and the response to paraquat providing additional support that the HFE genotype is a disease

Hemocromatosis gene (HFE) mutations in patients with type 2 diabetes and their control group in an Iranian population

International Nuclear Information System (INIS)

Sharifi, F.; Esmaeilzadeh, A.; Zali, M.

2008-01-01

Objective was to assess the frequency of 2 different forms of hemochromatosis HFE gene mutations c282y and H63D mutations in a normal population in comparison with type 2 diabetic patients. This case control study was undertaken in Zanjan Diabetic Care Center, Zanjan, western Tehran, in 2005. Two hundred and two individuals were included in this study: 101 type 2 diabetes mellitus T2DM patients and 101 age and gender-matched controls. The patients were examined for mutations in the HFE gene. Nucleotide 845 C282Y and 187 H63D alleles were amplified by polymerase chain reaction PCR with lymphocyte deoxyribonucleic acid. The PCR products were analyzed by restriction enzyme digestion. Chi-square students test and Fisher's exact tests were used for comparison and odds ratio was calculated. Two hundred and two individuals were studied. The frequency of wild /C28Y alleles was 68.3/31.7% in diabetics p=0.08 and 73.4/26.3% in control subjects p=0.08. The distribution of genotypes was not statistically different. Based on our data, HFE mutations were not found in excess in patients with T2DM and there was no evidence that a population-based search for an excess of these alleles in type 2 diabetes was indicated. (author)

Analysis of HLA-A antigens and C282Y and H63D mutations of the HFE gene in Brazilian patients with hemochromatosis

Directory of Open Access Journals (Sweden)

Bittencourt P.L.

2002-01-01

Full Text Available The hemochromatosis gene, HFE, is located on chromosome 6 in close proximity to the HLA-A locus. Most Caucasian patients with hereditary hemochromatosis (HH are homozygous for HLA-A3 and for the C282Y mutation of the HFE gene, while a minority are compound heterozygotes for C282Y and H63D. The prevalence of these mutations in non-Caucasian patients with HH is lower than expected. The objective of the present study was to evaluate the frequencies of HLA-A antigens and the C282Y and H63D mutations of the HFE gene in Brazilian patients with HH and to compare clinical and laboratory profiles of C282Y-positive and -negative patients with HH. The frequencies of HLA-A and C282Y and H63D mutations were determined by PCR-based methods in 15 male patients (median age 44 (20-72 years with HH. Eight patients (53% were homozygous and one (7% was heterozygous for the C282Y mutation. None had compound heterozygosity for C282Y and H63D mutations. All but three C282Y homozygotes were positive for HLA-A3 and three other patients without C282Y were shown to be either heterozygous (N = 2 or homozygous (N = 1 for HLA-A3. Patients homozygous for the C282Y mutation had higher ferritin levels and lower age at onset, but the difference was not significant. The presence of C282Y homozygosity in roughly half of the Brazilian patients with HH, together with the findings of HLA-A homozygosity in C282Y-negative subjects, suggest that other mutations in the HFE gene or in other genes involved in iron homeostasis might also be linked to HH in Brazil.

Molecular epidemiology of HFE gene polymorphic variants (C282Y, H63D and S65C) in the population of Espírito Santo, Brazil.

Science.gov (United States)

Alves, L N R; Santos, E V W; Stur, E; Silva Conforti, A M A; Louro, I D

2016-04-27

Hereditary hemochromatosis (HH) is an autosomal recessive disorder that leads to progressive iron accumulation and may cause cirrhosis, hepatocellular carcinoma, diabetes, and heart failure. Most cases of HH have been linked to mutations in genes associated with iron homeostasis. There have been three major variants in the high Fe (HFE) gene associated with the disease: C282Y, H63D and S65C. In this context, we aimed to evaluate the prevalence of the polymorphic variants (C282Y, H63D and S65C) of the HFE gene in the population of the Espírito Santo State (ES), Brazil by analyzing three different groups: general population (N = 120), Pomeranian descendants (N = 59), and patients with HH (N = 20). Using genomic DNA extracted from peripheral blood, polymorphic variant identification was performed by polymerase chain reaction-restriction fragment length polymorphism. Statistically significant differences were observed for genotype distribution of C282Y (P HFE gene allele frequencies for the general population, Pomeranian subpopulation, and patients with HH of ES, Brazil.

HFE mRNA expression is responsive to intracellular and extracellular iron loading: short communication.

Science.gov (United States)

Mehta, Kosha J; Farnaud, Sebastien; Patel, Vinood B

2017-10-01

In liver hepatocytes, the HFE gene regulates cellular and systemic iron homeostasis by modulating cellular iron-uptake and producing the iron-hormone hepcidin in response to systemic iron elevation. However, the mechanism of iron-sensing in hepatocytes remain enigmatic. Therefore, to study the effect of iron on HFE and hepcidin (HAMP) expressions under distinct extracellular and intracellular iron-loading, we examined the effect of holotransferrin treatment (1, 2, 5 and 8 g/L for 6 h) on intracellular iron levels, and mRNA expressions of HFE and HAMP in wild-type HepG2 and previously characterized iron-loaded recombinant-TfR1 HepG2 cells. Gene expression was analyzed by real-time PCR and intracellular iron was measured by ferrozine assay. Data showed that in the wild-type cells, where intracellular iron content remained unchanged, HFE expression remained unaltered at low holotransferrin treatments but was upregulated upon 5 g/L (p HFE and HAMP expressions were elevated only at low 1 g/L treatment (p HFE (p HFE mRNA was independently elevated by extracellular and intracellular iron-excess. Thus, it may be involved in sensing both, extracellular and intracellular iron. Repression of HAMP expression under simultaneous intracellular and extracellular iron-loading resembles non-hereditary iron-excess pathologies.

Frequency of the Hemochromatosis Gene (HFE Variants in a Jordanian Arab Population and in Diabetics from the Same Region

Directory of Open Access Journals (Sweden)

Asem Alkhateeb

2009-01-01

Full Text Available Hereditary HFE-linked hemochromatosis is a frequent recessive disorder among individuals of northern European ancestry. The clinical characteristic of this disease is the gradual accumulation of iron in internal organs, which ultimately may lead to organ damage and death. Three allelic variants of HFE gene have been correlated with hereditary hemochromatosis: C282Y is significantly associated with hereditary hemochromatosis in populations of Celtic origin, H63D and S65C are associated with milder form of iron overload. In this study we performed mutation analysis to identify allele frequency of the three variants of HFE gene in Jordanian Arab population, to assess deviations of these frequencies from those detected elsewhere, and to determine if there is an increased frequency of these variants in a diabetic population (Type 2 diabetes from the same area. DNA was extracted from blood samples of 440 individuals attending King Abdullah University Hospital for ambulatory services. We used polymerase chain reaction (PCR to amplify exons 2 and 4 of the HFE gene then restriction fragment length polymorphism (RFLP method to detect the variants. There were neither homozygous nor heterozygous for C282Y variant. For the H63D variant, 0.68% were homozygous and 21.1% were heterozygous. For the S65C variant, there were no homozygous and 0.23% were heterozygous. Allelic frequencies were, 0%, 11.25%, and 0.11% for C282Y, H63D, and S65C, respectively. Our samples were subdivided into two categories of type 2 diabetic (89 cases and controls (blood donors, 204 cases and compared with regard to the H63D variant. Both groups did not have homozygous H63D variant. H63D heterozygous in diabetics were 23.60% and in blood donor controls 22.55%. Allelic frequency of the mutant H63D allele was 11.80% in diabetics and 11.27% for the blood donor controls. This is the first study to show the frequency of the three hemochromatosis gene variants in Jordan with the interesting

Association of HFE gene C282Y and H63D mutations with liver cirrhosis in the Lithuanian population

Directory of Open Access Journals (Sweden)

Simonas Juzėnas

2016-01-01

Conclusions: Heterozygous C282Y mutation of the HFE gene was associated with liver cirrhosis in the Lithuanian population. In gender-related analysis, heterozygous C282Y and homozygous H63D mutations were linked to liver cirrhosis in men, not in women.

Transgenic HFE-dependent induction of hepcidin in mice does not require transferrin receptor-2.

Science.gov (United States)

Schmidt, Paul J; Fleming, Mark D

2012-06-01

Hereditary hemochomatosis (HH) is caused by mutations in several genes, including HFE and transferrin receptor-2 (TFR2). Loss of either protein decreases expression of the iron regulatory hormone hepcidin by the liver, leading to inappropriately high iron uptake from the diet, and resulting in systemic iron overload. In tissue culture, overexpressed HFE and TFR2 physically interact. Hepatocellular overexpression of Hfe in vivo increases hepcidin expression, despite an associated decrease in Tfr2. On this basis, we hypothesized that Tfr2 would not be required for Hfe-dependent up-regulation of hepcidin. We show that hepatocellular overexpression of Hfe in Tfr2(Y245X/Y245X) mice leads to hepcidin induction eventuating in iron deficiency and a hypochromic, microcytic anemia. Furthermore, coimmunoprecipitation studies using liver lysates did not provide evidence for physical interaction between Hfe and Tfr2 in vivo. In conclusion, we demonstrate that Tfr2 is not essential for Hfe-mediated induction of hepcidin expression, supporting the possibility that TFR2 may regulate iron metabolism in an HFE-independent manner. Copyright © 2012 Wiley Periodicals, Inc.

HFE genotype affects exosome phenotype in cancer.

Science.gov (United States)

Mrowczynski, Oliver D; Madhankumar, A B; Slagle-Webb, Becky; Lee, Sang Y; Zacharia, Brad E; Connor, James R

2017-08-01

Neuroblastoma is the third most common childhood cancer, and timely diagnosis and sensitive therapeutic monitoring remain major challenges. Tumor progression and recurrence is common with little understanding of mechanisms. A major recent focus in cancer biology is the impact of exosomes on metastatic behavior and the tumor microenvironment. Exosomes have been demonstrated to contribute to the oncogenic effect on the surrounding tumor environment and also mediate resistance to therapy. The effect of genotype on exosomal phenotype has not yet been explored. We interrogated exosomes from human neuroblastoma cells that express wild-type or mutant forms of the HFE gene. HFE, one of the most common autosomal recessive polymorphisms in the Caucasian population, originally associated with hemochromatosis, has also been associated with increased tumor burden, therapeutic resistance boost, and negative impact on patient survival. Herein, we demonstrate that changes in genotype cause major differences in the molecular and functional properties of exosomes; specifically, HFE mutant derived exosomes have increased expression of proteins relating to invasion, angiogenesis, and cancer therapeutic resistance. HFE mutant derived exosomes were also shown to transfer this cargo to recipient cells and cause an increased oncogenic functionality in those recipient cells. Copyright © 2017. Published by Elsevier B.V.

The influence of iron status and genetic polymorphisms in the HFE gene on the risk for postoperative complications after bariatric surgery: a prospective cohort study in 1,064 patients

Directory of Open Access Journals (Sweden)

Freedman-Weiss Mollie

2011-01-01

Full Text Available Abstract Background Gastric bypass surgery is a highly effective therapy for long-term weight loss in severely obese patients, but carries significant perioperative risks including infection, wound dehiscence, and leaks from staple breakdown. Iron status can affect immune function and wound healing, thus may influence peri-operative complications. Common mutations in the HFE gene, the gene responsible for the iron overload disorder hereditary hemochromatosis, may impact iron status. Methods We analyzed 1064 extremely obese Caucasian individuals who underwent open and laparoscopic Roux-n-Y gastric bypass surgery at the Geisinger Clinic. Serum iron, ferritin, transferrin, and iron binding capacity were measured pre-operatively. All patients had intra-operative liver biopsies and were genotyped for the C282Y and H63D mutations in the HFE gene. Associations between surgical complications and serum iron measures, HFE gene status, and liver iron histology were determined. Results We found that increased serum iron and transferrin saturation were present in patients with any post-operative complication, and that increased serum ferritin was also increased in patients with major complications. Increased serum transferrin saturation was also associated with wound complications in open RYGB, and transferrin saturation and ferritin with prolonged lengths of stay. The presence of 2 or more HFE mutations was associated with overall complications as well as wound complications in open RYGB. No differences were found in complication rates between those with stainable liver iron and those without. Conclusion Serum iron status and HFE genotype may be associated with complications following RYGB surgery in the extremely obese.

HFE H63D mutation frequency shows an increase in Turkish women with breast cancer

Directory of Open Access Journals (Sweden)

Guler Emine

2006-02-01

Full Text Available Abstract Background The hereditary hemochromatosis gene HFE plays a pivotal role in iron homeostasis. The association between cancer and HFE hetero- or homozygosity has previously been shown including hepatocellular and nonhepatocellular malignancies. This study was performed to compare frequencies of HFE C282Y and H63D variants in Turkish women with breast cancer and healthy controls. Methods Archived DNA samples of Hacettepe University Oncology Institute were used in this study. The HFE gene was investigated by PCR-RFLP. Results All subjects studied were free from C282Y mutation. Thirty-nine patients had H63D mutation and were all heterozygous. H63D allele frequency was 22.2% (39/176 in the breast cancer patients, and 14% (28/200 in the healthy volunteers. Statistical analysis of cases with HFE H63D phenotype showed significant difference between breast cancer and healthy volunteers (P = 0.02. Conclusion Our results suggest that HFE H63D mutation frequencies were increased in the breast cancer patients in comparison to those in the general population. Also, odds ratios (odds ratio = 2.05 computed in this study suggest that H63D has a positive association with breast cancer.

Ancestral association between HLA and HFE H63D and C282Y gene mutations from northwest Colombia.

Science.gov (United States)

Rodriguez, Libia M; Giraldo, Mabel C; Velasquez, Laura I; Alvarez, Cristiam M; Garcia, Luis F; Jimenez-Del-Rio, Marlene; Velez-Pardo, Carlos

2015-03-01

A significant association between HFE gene mutations and the HLA-A*03-B*07 and HLA-A*29-B*44 haplotypes has been reported in the Spanish population. It has been proposed that these mutations are probably connected with Celtic and North African ancestry, respectively. We aimed to find the possible ancestral association between HLA alleles and haplotypes associated with the HFE gene (C282Y and H63D) mutations in 214 subjects from Antioquia, Colombia. These were 18 individuals with presumed hereditary hemochromatosis ("HH") and 196 controls. The HLA-B*07 allele was in linkage disequilibrium (LD) with C282Y, while HLA-A*23, A*29, HLA-B*44, and B*49 were in LD with H63D. Altogether, our results show that, although the H63D mutation is more common in the Antioquia population, it is not associated with any particular HLA haplotype, whereas the C282Y mutation is associated with HLA-A*03-B*07, this supporting a northern Spaniard ancestry.

Ancestral association between HLA and HFE H63D and C282Y gene mutations from northwest Colombia

Directory of Open Access Journals (Sweden)

Libia M Rodriguez

2015-03-01

Full Text Available A significant association between HFE gene mutations and the HLA-A*03-B*07 and HLA-A*29-B*44 haplotypes has been reported in the Spanish population. It has been proposed that these mutations are probably connected with Celtic and North African ancestry, respectively. We aimed to find the possible ancestral association between HLA alleles and haplotypes associated with the HFE gene (C282Y and H63D mutations in 214 subjects from Antioquia, Colombia. These were 18 individuals with presumed hereditary hemochromatosis (“HH” and 196 controls. The HLA-B*07 allele was in linkage disequilibrium (LD with C282Y, while HLA-A*23, A*29, HLA-B*44, and B*49 were in LD with H63D. Altogether, our results show that, although the H63D mutation is more common in the Antioquia population, it is not associated with any particular HLA haplotype, whereas the C282Y mutation is associated with HLA-A*03-B*07, this supporting a northern Spaniard ancestry.

HFE gene mutation and oxidative damage biomarkers in patients with myelodysplastic syndromes and its relation to transfusional iron overload: an observational cross-sectional study.

Science.gov (United States)

De Souza, Geane Felix; Ribeiro, Howard Lopes; De Sousa, Juliana Cordeiro; Heredia, Fabíola Fernandes; De Freitas, Rivelilson Mendes; Martins, Manoel Ricardo Alves; Gonçalves, Romélia Pinheiro; Pinheiro, Ronald Feitosa; Magalhães, Silvia Maria Meira

2015-04-03

A relation between transfusional IOL (iron overload), HFE status and oxidative damage was evaluated. An observational cross-sectional study involving 87 healthy individuals and 78 patients with myelodysplastic syndromes (MDS) with and without IOL, seen at University Hospital of the Federal University of Ceará, Brazil, between May 2010 and September 2011. IOL was defined using repeated measures of serum ferritin ≥1000 ng/mL. Variations in the HFE gene were investigated using PCR/restriction fragment length polymorphism (RFLP). The biomarkers of oxidative stress (plasmatic malonaldehyde (MDA), glutathione peroxidase (GPx) and superoxide dismutase (SOD)) were determined by spectrophotometry. The HFE gene variations were identified in 24 patients (30.77%) and 5 volunteers (5.74%). The H63D variant was observed in 35% and the C282Y variant as heterozygous in 5% of patients with MDS with IOL. One patient showed double heterozygous variant (C282Y/H63D) and serum ferritin of 11,649 ng/mL. In patients without IOL, the H63D variant was detected in 29.34%. Serum MDA levels were highest in patients with MDS with IOL, with a significant difference when compared with patients without IOL and healthy volunteers, pointing to the relationship between IOL and oxidative stress. The GPx and SOD were also significantly higher in these patients, indicating that lipid peroxidation increase was followed by an increase in antioxidant capacity. Higher ferritin levels were observed in patients with HFE gene variation. 95.7% of patients with MDS with the presence of HFE gene variations had received more of 20 transfusions. We observed a significant increase in MDA levels in patients with MDS and IOL, suggesting an increased lipid peroxidation in these patients. The accumulation of MDA alters the organisation of membrane phospholipids, contributing to the process of cellular degeneration. Results show that excess iron intensifies the process of cell damage through oxidative stress

Influence of HFE variants and cellular iron on monocyte chemoattractant protein-1

Directory of Open Access Journals (Sweden)

Simmons Zachary

2009-02-01

Full Text Available Abstract Background Polymorphisms in the MHC class 1-like gene known as HFE have been proposed as genetic modifiers of neurodegenerative diseases that include neuroinflammation as part of the disease process. Variants of HFE are relatively common in the general population and are most commonly associated with iron overload, but can promote subclinical cellular iron loading even in the absence of clinically identified disease. The effects of the variants as well as the resulting cellular iron dyshomeostasis potentially impact a number of disease-associated pathways. We tested the hypothesis that the two most common HFE variants, H63D and C282Y, would affect cellular secretion of cytokines and trophic factors. Methods We screened a panel of cytokines and trophic factors using a multiplexed immunoassay in human neuroblastoma SH-SY5Y cells expressing different variants of HFE. The influence of cellular iron secretion on the potent chemokine monocyte chemoattractant protein-1 (MCP-1 was assessed using ferric ammonium citrate and the iron chelator, desferroxamine. Additionally, an antioxidant, Trolox, and an anti-inflammatory, minocycline, were tested for their effects on MCP-1 secretion in the presence of HFE variants. Results Expression of the HFE variants altered the labile iron pool in SH-SY5Y cells. Of the panel of cytokines and trophic factors analyzed, only the release of MCP-1 was affected by the HFE variants. We further examined the relationship between iron and MCP-1 and found MCP-1 secretion tightly associated with intracellular iron status. A potential direct effect of HFE is considered because, despite having similar levels of intracellular iron, the association between HFE genotype and MCP-1 expression was different for the H63D and C282Y HFE variants. Moreover, HFE genotype was a factor in the effect of minocycline, a multifaceted antibiotic used in treating a number of neurologic conditions associated with inflammation, on MCP-1

The Study of HFE Genotypes and Its Expression Effect on Iron Status of Iranian Haemochromatosis, Iron Deficiency Anemia Patients, Iron-Taker and Non Iron-Taker Controls.

Science.gov (United States)

Beiranvand, Elham; Abediankenari, Saeid; Rostamian, Mosayeb; Beiranvand, Behnoush; Naazeri, Saeed

2015-01-01

The role of HFE gene mutations or its expression in regulation of iron metabolism of hereditary haemochromatosis (HH) patients is remained controversial. Therefore here the correlation between two common HFE genotype (p.C282Y, p.H63D) and HFE gene expression with iron status in HH, iron deficiency anemia (IDA) and healthy Iranian participants was studied. For this purpose genotype determination was done by polymerase chain reaction--restriction fragment length polymorphism (PCR-RFLP). Real-Time PCR was applied for evaluation of HFE gene expression. Biochemical parameters and iron consumption were also assessed. Homozygote p.H63D mutation was seen in all HH patients and p.C282Y was not observed in any member of the population. A significant correlation was observed between serum ferritin (SF) level and gender or age of HH patients. p.H63D homozygote was seen to be able to significantly increase SF and transferrin saturation (TS) level without affecting on liver function. Our results also showed that iron consumption affects on TS level increasing. HFE gene expression level of IDA patients was significantly higher than other groups. Also the HFE gene expression was negatively correlated with TS. Finally, the main result of our study showed that loss of HFE function in HH is not derived from its gene expression inhibition and much higher HFE gene expression might lead to IDA. However we propose repeating of the study for more approval of our finding.

HFE and Spherical Cryostats MC Study

International Nuclear Information System (INIS)

Brodsky, Jason P.

2016-01-01

The copper vessel containing the nEXO TPC is surrounded by a buffer of HFE, a liquid refrigerant with very low levels of radioactive element contamination. The HFE is contained within the cryostat's inner vessel, which is in turn inside the outer vessel. While some HFE may be necessary for stable cooling of nEXO, it is possible that using substantially more than necessary for thermal reasons will help reduce backgrounds originating in the cryostats. Using a larger amount of HFE is accomplished by making the cryostat vessels larger. By itself, increasing the cryostat size somewhat increases the background rate, as the thickness of the cryostat wall must increase at larger sizes. However, the additional space inside the cryostat will be filled with HFE which can absorb gamma rays headed for the TPC. As a result, increasing the HFE reduces the number of backgrounds reaching the TPC. The aim of this study was to determine the relationship between HFE thickness and background rate. Ultimately, this work should support choosing a cryostat and HFE size that satisfies nEXO's background budget. I have attempted to account for every consequence of changing the cryostat size, although naturally this remains a work in progress until a final design is achieved. At the moment, the scope of the study includes only the spherical cryostat design. This study concludes that increasing cryostat size reduces backgrounds, reaching neglible backgrounds originating from the cryostat at the largest sizes. It also shows that backgrounds originating from the inherent radioactivity of the HFE plateau quickly, so may be considered essentially fixed at any quantity of HFE.

Loss of hfe function reverses impaired recognition memory caused by olfactory manganese exposure in mice.

Science.gov (United States)

Ye, Qi; Kim, Jonghan

2015-03-01

Excessive manganese (Mn) in the brain promotes a variety of abnormal behaviors, including memory deficits, decreased motor skills and psychotic behavior resembling Parkinson's disease. Hereditary hemochromatosis (HH) is a prevalent genetic iron overload disorder worldwide. Dysfunction in HFE gene is the major cause of HH. Our previous study has demonstrated that olfactory Mn uptake is altered by HFE deficiency, suggesting that loss of HFE function could alter manganese-associated neurotoxicity. To test this hypothesis, Hfe-knockout (Hfe (-/-)) and wild-type (Hfe (+/+)) mice mice were intranasally-instilled with manganese chloride (MnCl2 5 mg/kg) or water daily for 3 weeks and examined for memory function. Olfactory Mn diminished both short-term recognition and spatial memory in Hfe (+/+) mice, as examined by novel object recognition task and Barnes maze test, respectively. Interestingly, Hfe (-/-) mice did not show impaired recognition memory caused by Mn exposure, suggesting a potential protective effect of Hfe deficiency against Mn-induced memory deficits. Since many of the neurotoxic effects of manganese are thought to result from increased oxidative stress, we quantified activities of anti-oxidant enzymes in the prefrontal cortex (PFC). Mn instillation decreased superoxide dismutase 1 (SOD1) activity in Hfe (+/+) mice, but not in Hfe (-/-) mice. In addition, Hfe deficiency up-regulated SOD1 and glutathione peroxidase activities. These results suggest a beneficial role of Hfe deficiency in attenuating Mn-induced oxidative stress in the PFC. Furthermore, Mn exposure reduced nicotinic acetylcholine receptor levels in the PFC, indicating that blunted acetylcholine signaling could contribute to impaired memory associated with intranasal manganese. Together, our model suggests that disrupted cholinergic system in the brain is involved in airborne Mn-induced memory deficits and loss of HFE function could in part prevent memory loss via a potential up-regulation of

Contribution of Hfe expression in macrophages to the regulation of hepatic hepcidin levels and iron loading

OpenAIRE

Makui, Hortence; Soares, Ricardo J.; Jiang, Wenlei; Constante, Marco; Santos, Manuela M.

2005-01-01

Hereditary hemochromatosis (HH), an iron overload disease associated with mutations in the HFE gene, is characterized by increased intestinal iron absorption and consequent deposition of excess iron, primarily in the liver. Patients with HH and Hfe-deficient (Hfe−/−) mice manifest inappropriate expression of the iron absorption regulator hepcidin, a peptide hormone produced by the liver in response to iron loading. In this study, we investigated the contribution of Hfe expression in macrophag...

Hereditary Hemochromatosis (HFE genotypes in heart failure: Relation to etiology and prognosis

Directory of Open Access Journals (Sweden)

Torp-Pedersen Christian

2010-07-01

Full Text Available Abstract Background It is believed that hereditary hemochromatosis (HH might play a role in cardiac disease (heart failure (HF and ischemia. Mutations within several genes are HH-associated, the most common being the HFE gene. In a large cohort of HF patients, we sought to determine the etiological role and the prognostic significance of HFE genotypes. Methods We studied 667 HF patients (72.7% men with depressed systolic function, enrolled in a multicentre trial with a follow-up period of up to 5 years. All were genotyped for the known HFE variants C282Y, H63D and S65C. Results The genotype and allele frequencies in the HF group were similar to the frequencies determined in the general Danish population. In multivariable analysis mortality was not predicted by C282Y-carrier status (HR 1.2, 95% CI: 0.8-1.7; H63D-carrier status (HR 1.0, 95% CI: 0.7-1.3; nor S65C-carrier status (HR 1.2, 95% CI: 0.7-2.0. We identified 27 (4.1% homozygous or compound heterozygous carriers of HFE variants. None of these carriers had a clinical presentation suggesting hemochromatosis, but hemoglobin and ferritin levels were higher than in the rest of the cohort. Furthermore, a trend towards reduced mortality was seen in this group in univariate analyses (HR 0.4, 95% CI: 0.2-0.9, p = 0.03, but not in multivariate (HR 0.5, 95% CI: 0.2-1.2. Conclusion HFE genotypes do not seem to be a significant contributor to the etiology of heart failure in Denmark. HFE variants do not affect mortality in HF.

Frequency of Hereditary Hemochromatosis (HFE) Gene Mutations in Egyptian Beta Thalassemia Patients and its Relation to Iron Overload.

Science.gov (United States)

Enein, Azza Aboul; El Dessouky, Nermine A; Mohamed, Khalda S; Botros, Shahira K A; Abd El Gawad, Mona F; Hamdy, Mona; Dyaa, Nehal

2016-06-15

This study aimed to detect the most common HFE gene mutations (C282Y, H63D, and S56C) in Egyptian beta thalassemia major patients and its relation to their iron status. The study included 50 beta thalassemia major patients and 30 age and sex matched healthy persons as a control group. Serum ferritin, serum iron and TIBC level were measured. Detection of the three HFE gene mutations (C282Y, H63D and S65C) was done by PCR-RFLP analysis. Confirmation of positive cases for the mutations was done by sequencing. Neither homozygote nor carrier status for the C282Y or S65C alleles was found. The H63D heterozygous state was detected in 5/50 (10%) thalassemic patients and in 1/30 (3.3%) controls with no statistically significant difference between patients and control groups (p = 0.22). Significantly higher levels of the serum ferritin and serum iron in patients with this mutation (p = 001). Our results suggest that there is an association between H63D mutation and the severity of iron overload in thalassemic patients.

Tmprss6 is a genetic modifier of the Hfe-hemochromatosis phenotype in mice

Science.gov (United States)

Whittlesey, Rebecca L.; Andrews, Nancy C.

2011-01-01

The hereditary hemochromatosis protein HFE promotes the expression of hepcidin, a circulating hormone produced by the liver that inhibits dietary iron absorption and macrophage iron release. HFE mutations are associated with impaired hepatic bone morphogenetic protein (BMP)/SMAD signaling for hepcidin production. TMPRSS6, a transmembrane serine protease mutated in iron-refractory iron deficiency anemia, inhibits hepcidin expression by dampening BMP/SMAD signaling. In the present study, we used genetic approaches in mice to examine the relationship between Hfe and Tmprss6 in the regulation of systemic iron homeostasis. Heterozygous loss of Tmprss6 in Hfe−/− mice reduced systemic iron overload, whereas homozygous loss caused systemic iron deficiency and elevated hepatic expression of hepcidin and other Bmp/Smad target genes. In contrast, neither genetic loss of Hfe nor hepatic Hfe overexpression modulated the hepcidin elevation and systemic iron deficiency of Tmprss6−/− mice. These results indicate that genetic loss of Tmprss6 increases Bmp/Smad signaling in an Hfe-independent manner that can restore Bmp/Smad signaling in Hfe−/− mice. Furthermore, these results suggest that natural genetic variation in the human ortholog TMPRSS6 might modify the clinical penetrance of HFE-associated hereditary hemochromatosis, raising the possibility that pharmacologic inhibition of TMPRSS6 could attenuate iron loading in this disorder. PMID:21355094

HFE Cys282Tyr homozygotes with serum ferritin concentrations below 1000 microg/L are at low risk of hemochromatosis.

Science.gov (United States)

Allen, Katrina J; Bertalli, Nadine A; Osborne, Nicholas J; Constantine, Clare C; Delatycki, Martin B; Nisselle, Amy E; Nicoll, Amanda J; Gertig, Dorota M; McLaren, Christine E; Giles, Graham G; Hopper, John L; Anderson, Gregory J; Olynyk, John K; Powell, Lawrie W; Gurrin, Lyle C

2010-09-01

Hemochromatosis gene (HFE)-associated hereditary hemochromatosis (HH) is a genetic predisposition to iron overload and subsequent signs and symptoms of disease that potentially affects approximately 80,000 persons in Australia and almost 1 million persons in the United States. Most clinical cases are homozygous for the Cys282Tyr (C282Y) mutation in the HFE gene, with serum ferritin (SF) concentration >1000 microg/L as the strongest predictor of cirrhosis. The optimal treatment regimen for those with SF concentrations above the normal range but aged 40-69 years. An HFE-stratified random sample of 1438 participants including all C282Y homozygotes with iron studies 12 years apart were examined by physicians blinded to participants' HFE genotype. All previously undiagnosed C282Y homozygotes (35 male, 67 female) and all HFE wild-types (131 male, 160 female) with baseline and follow-up SF concentrations age when disease would be expected to have developed. These observations have implications for the management of C282Y homozygotes.

Liquid density of HFE-7200 and HFE-7500 from T = (283 to 363) K at pressures up to 100 MPa

International Nuclear Information System (INIS)

Fang, Dan; Li, Ying; Meng, Xianyang; Wu, Jiangtao

2014-01-01

Highlights: • Liquid densities are reported for HFE-7200 and HFE-7500 at temperatures from (283 to 363) K, pressures up to 100 MPa. • The expanded uncertainty (k = 2) of density measurement for HFE-7200 and HFE-7500 were 0.04% and 0.03%, respectively. • Modified Tait equations were correlated with the experimental data. • The isobaric thermal expansivity and isothermal compressibility of HFE-7200 and HFE-7500 were calculated. -- Abstract: The liquid densities of HFE-7200 (1-ethoxy-1,1,2,2,3,3,4,4,4-nonafluorobutane, CAS Registry Number: 163702-05-4) and HFE-7500 (3-ethoxyperfluoro(2-methylhexane), CAS Registry Number: 297730-93-9) have been measured over the temperature range from (283 to 363) K and pressures up to 100 MPa by using a high pressure vibrating-tube densimeter. R134a has been used as a reference fluid to validate the densimeter. The uncertainty of each obtained datum was estimated, and the maximum expanded uncertainty with a level of confidence of 0.95 (k = 2) of density measurement for HFE-7200 and HFE-7500 were 0.04% and 0.03%, respectively. The measured liquid densities were correlated with the modified Tait equation and the maximum deviation is less than 0.03%. The isothermal compressibility and isobaric thermal expansivity were also calculated

Computational Profiling of Deleterious Non-Synonymous SNP’s in HFE

Directory of Open Access Journals (Sweden)

S. Sarath Raj

2017-12-01

Full Text Available Liver cirrhosis describes a condition where scar tissue gradually replaces healthy cells in liver. The main causes are sustained, excessive alcohol consumption, viral hepatitis B and C, and fatty liver disease - however, there are other possible causes. Hemochromatosis is most common form of iron overload disease. Three types of hemochromatosis are primary hemochromatosis, also called hereditary hemochromatosis; secondary hemochromatosis; and neonatal hemochromatosis. The HFE gene helps regulate the amount of iron absorbed from food and inherited genetic defects or mutation in HFE [C282Y] cause primary hemochromatosis. Computational approach is sought to determine other similar mutations in this gene. In-silico tools such as SIFT, Polyphen 2.0, and PROVEAN were employed to determine the various deleterious ns-SNPs of HFE that may influence cystic fibrosis.

Correlation between HFE gene polymorphisms and increased risk of coronary artery disease among patients with type 2 diabetes in Iran.

Science.gov (United States)

Saremi, Leila; Saremi, Marzieh; Lotfipanah, Shirin; İmani, Saber; Fu, Junjiang; Zhang, Tianyu

2016-04-19

Diabetes mellitus is a risk factor for cardiovascular diseases (CVDs), which are among the major causes of deaths in type 2 diabetes (T2D). The purpose of the present study was to determine the association of C282Y and H63D mutations in the HFE gene with increased risk of coronary artery disease (CAD) in T2D patients. Two hundred and ninety individuals were divided into two groups: a case group and a control group. Genomic DNA of peripheral venous blood cells was extracted and the HFE gene mutations were analyzed using the PCR-RFLP technique. Data analysis revealed a significant difference between the allele frequencies of H63D and C282Y mutations between the case group and the controls (P 0.05). Using a logistic regression model, BMI, FBS, HDL, and total cholesterol levels were significantly different with independent predictors of CVD (P < 0.05). Our results revealed a significant correlation between C282Y and H63D mutations and the development of CAD in T2D patients.

Intragenic haplotype analysis of common HFE mutations in the ...

Indian Academy of Sciences (India)

mutation <100 generations ago in the Celtic populations of mainland Europe, with a ... 0.9–5.8%, evidencing regional differences in distribution across the ..... and H63D alleles in the HFE gene among various Jewish ethnic groups in Israel: a ...

The expression of the soluble HFE corresponding transcript is up-regulated by intracellular iron and inhibits iron absorption in a duodenal cell model

OpenAIRE

Silva, Bruno; Ferreira, Joana; Santos, Vera; Baldaia, Cilénia; Serejo, Fátima; Faustino, Paula

2014-01-01

Background and aims: Dietary iron absorption regulation is a key-step for the maintenance of body iron homeostasis. Besides the HFE full-length protein, the HFE gene codes for alternative splicing variants responsible for the synthesis of a soluble form of HFE protein (sHFE). Here we aimed to determine whether sHFE transcript levels respond to different iron conditions in duodenal, macrophage and hepatic cell models, as well, in vivo, in the liver. Furthermore, we determined the functional ef...

HFE MUTATIONS AND IRON OVERLOAD IN PATIENTS WITH ALCOHOLIC LIVER DISEASE

Directory of Open Access Journals (Sweden)

Luís COSTA-MATOS

2013-03-01

Full Text Available Context Alcoholic liver disease (ALD is generally associated with iron overload, which may contribute to its pathogenesis, through increased oxidative stress and cellular damage. There are conflicting reports in literature about hemochromatosis (HFE gene mutations and the severity of liver disease in alcoholic patients. Objectives To compare the prevalence of mutations in the hemochromatosis (HFE gene between patients with ALD and healthy controls; to assess the relation of HFE mutations with liver iron stores and liver disease severity. Methods Liver biopsy specimens were obtained from 63 ALD patients (during routine treatment and 52 healthy controls (during elective cholecystectomy. All individuals underwent routine liver function tests and HFE genotyping (to detect wild-type sequences and C282Y, H63D, S65C, E168Q, E168X, V59M, H63H, P160delC, Q127H, Q283P, V53M and W164X mutations. Associations between HFE mutations and risk of excessive liver iron stores, abnormal serum ferritin, liver fibrosis, or necroinflammatory activity were assessed by multivariate logistic regression analysis. Results ALD patients had significantly higher serum ferritin and transferrin saturation than controls (both P Contexto A doença hepática alcoólica (DHA está geralmente associada à sobrecarga de ferro, que pode contribuir para a sua patogênese, através do aumento do estresse oxidativo e dano celular. As descrições existentes na literatura sobre a associação entre mutações HFE e a gravidade da DHA nem sempre são concordantes. Objetivos Comparar a prevalência de mutações HFE entre um grupo de pacientes com DHA e uma população de controle. Avaliar a relação entre mutações HFE e os depósitos de ferro hepático. Avaliar se a presença dessas mutações está associada com a gravidade da DHA. Métodos Compararam-se 63 pacientes com DHA que efetuaram biopsia hepática com 52 controles saudáveis. A genotipagem HFE (wild type, C282Y, H63D, S65C, E

Lack of evidence for the pathogenic role of iron and HFE gene mutations in Brazilian patients with nonalcoholic steatohepatitis

Directory of Open Access Journals (Sweden)

M.M. Deguti

2003-06-01

Full Text Available The hypothesis of the role of iron overload associated with HFE gene mutations in the pathogenesis of nonalcoholic steatohepatitis (NASH has been raised in recent years. In the present study, biochemical and histopathological evidence of iron overload and HFE mutations was investigated in NASH patients. Thirty-two NASH patients, 19 females (59%, average 49.2 years, 72% Caucasians, 12% Mulattoes and 12% Asians, were submitted to serum aminotransferase and iron profile determinations. Liver biopsies were analyzed for necroinflammatory activity, architectural damage and iron deposition. In 31 of the patients, C282Y and H63D mutations were tested by PCR-RFLP. Alanine aminotransferase levels were increased in 30 patients, 2.42 ± 1.12 times the upper normal limit on average. Serum iron concentration, transferrin saturation and ferritin averages were 99.4 ± 31.3 g/dl, 33.1 ± 12.7% and 219.8 ± 163.8 µg/dl, respectively, corresponding to normal values in 93.5, 68.7 and 78.1% of the patients. Hepatic siderosis was observed in three patients and was not associated with architectural damage (P = 0.53 or with necroinflammatory activity (P = 0.27. The allelic frequencies (N = 31 found were 1.6 and 14.1% for C282Y and H63D, respectively, which were compatible with those described for the local population. In conclusion, no evidence of an association of hepatic iron overload and HFE mutations with NASH was found. Brazilian NASH patients comprise a heterogeneous group with many associated conditions such as hyperinsulinism, environmental hepatotoxin exposure and drugs, but not hepatic iron overload, and their disease susceptibility could be related to genetic and environmental features other than HFE mutations.

Natural selection on HFE in Asian populations contributes to enhanced non-heme iron absorption.

Science.gov (United States)

Ye, Kaixiong; Cao, Chang; Lin, Xu; O'Brien, Kimberly O; Gu, Zhenglong

2015-06-10

HFE, a major regulator of iron (Fe) homeostasis, has been suggested to be under positive selection in both European and Asian populations. While the genetic variant under selection in Europeans (a non-synonymous mutation, C282Y) has been relatively well-studied, the adaptive variant in Asians and its functional consequences are still unknown. Identifying the adaptive HFE variants in Asians will not only elucidate the evolutionary history and the genetic basis of population difference in Fe status, but also assist the future practice of genome-informed dietary recommendation. Using data from the International HapMap Project, we confirmed the signatures of positive selection on HFE in Asian populations and identified a candidate adaptive haplotype that is common in Asians (52.35-54.71%) but rare in Europeans (5.98%) and Africans (4.35%). The T allele at tag SNP rs9366637 (C/T) captured 95.8% of this Asian-common haplotype. A significantly reduced HFE expression was observed in individuals carrying T/T at rs9366637 compared to C/C and C/T, indicating a possible role of gene regulation in adaptation. We recruited 57 women of Asian descent and measured Fe absorption using stable isotopes in those homozygous at rs9366637. We observed a 22% higher absorption in women homozygous for the Asian-common haplotype (T/T) compared to the control genotype (C/C). Additionally, compared with a group of age-matched Caucasian women, Asian women exhibited significantly elevated Fe absorption. Our results indicate parallel adaptation of HFE gene in Europeans and Asians with different genetic variants. Moreover, natural selection on HFE may have contributed to elevated Fe absorption in Asians. This study regarding population differences in Fe homeostasis has significant medical impact as high Fe level has been linked to an increased disease risk of metabolic syndromes.

Extreme expansion of NBS-encoding genes in Rosaceae.

Science.gov (United States)

Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

2015-05-03

Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

A mutation in the HFE gene is associated with altered brain iron profiles and increased oxidative stress in mice.

Science.gov (United States)

Nandar, Wint; Neely, Elizabeth B; Unger, Erica; Connor, James R

2013-06-01

Because of the increasing evidence that H63D HFE polymorphism appears in higher frequency in neurodegenerative diseases, we evaluated the neurological consequences of H63D HFE in vivo using mice that carry H67D HFE (homologous to human H63D). Although total brain iron concentration did not change significantly in the H67D mice, brain iron management proteins expressions were altered significantly. The 6-month-old H67D mice had increased HFE and H-ferritin expression. At 12 months, H67D mice had increased H- and L-ferritin but decreased transferrin expression suggesting increased iron storage and decreased iron mobilization. Increased L-ferritin positive microglia in H67D mice suggests that microglia increase iron storage to maintain brain iron homeostasis. The 6-month-old H67D mice had increased levels of GFAP, increased oxidatively modified protein levels, and increased cystine/glutamate antiporter (xCT) and hemeoxygenase-1 (HO-1) expression indicating increased metabolic and oxidative stress. By 12 months, there was no longer increased astrogliosis or oxidative stress. The decrease in oxidative stress at 12 months could be related to an adaptive response by nuclear factor E2-related factor 2 (Nrf2) that regulates antioxidant enzymes expression and is increased in the H67D mice. These findings demonstrate that the H63D HFE impacts brain iron homeostasis, and promotes an environment of oxidative stress and induction of adaptive mechanisms. These data, along with literature reports on humans with HFE mutations provide the evidence to overturn the traditional paradigm that the brain is protected from HFE mutations. The H67D knock-in mouse can be used as a model to evaluate how the H63D HFE mutation contributes to neurodegenerative diseases. Copyright © 2013 Elsevier B.V. All rights reserved.

Rare HFE variants are the most frequent cause of hemochromatosis in non-c282y homozygous patients with hemochromatosis.

Science.gov (United States)

Hamdi-Rozé, Houda; Beaumont-Epinette, Marie-Pascale; Ben Ali, Zeineb; Le Lan, Caroline; Loustaud-Ratti, Véronique; Causse, Xavier; Loreal, Olivier; Deugnier, Yves; Brissot, Pierre; Jouanolle, Anne-Marie; Bardou-Jacquet, Edouard

2016-12-01

p.Cys282Tyr (C282Y) homozygosity explains most cases of HFE-related hemochromatosis, but a significant number of patients presenting with typical type I hemochromatosis phenotype remain unexplained. We sought to describe the clinical relevance of rare HFE variants in non-C282Y homozygotes. Patients referred for hemochromatosis to the National Reference Centre for Rare Iron Overload Diseases from 2004 to 2010 were studied. Sequencing was performed for coding region and intronic flanking sequences of HFE, HAMP, HFE2, TFR2, and SLC40A1. Nine private HFE variants were identified in 13 of 206 unrelated patients. Among those, five have not been previously described: p.Leu270Argfs*4, p.Ala271Valfs*25, p.Tyr52*, p.Lys166Asn, and p.Asp141Tyr. Our results show that rare HFE variants are identified more frequently than variants in the other genes associated with iron overload. Rare HFE variants are therefore the most frequent cause of hemochromatosis in non-C282Y homozygote HFE patients. Am. J. Hematol. 91:1202-1205, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Mutations in the HFE gene and sporadic amyotrophic lateral sclerosis risk: a meta-analysis of observational studies

Directory of Open Access Journals (Sweden)

M. Li

2014-03-01

Full Text Available Iron homeostasis dysregulation has been regarded as an important mechanism in neurodegenerative diseases. The H63D and C282Y polymorphisms in the HFE gene may be involved in the development of sporadic amyotrophic lateral sclerosis (ALS through the disruption of iron homeostasis. However, studies investigating the relationship between ALS and these two polymorphisms have yielded contradictory outcomes. We performed a meta-analysis to assess the roles of the H63D and C282Y polymorphisms of HFE in ALS susceptibility. PubMed, MEDLINE, EMBASE, and Cochrane Library databases were systematically searched to identify relevant studies. Strict selection criteria and exclusion criteria were applied. Odds ratios (ORs with 95% confidence intervals (CIs were used to assess the strength of associations. A fixed- or random-effect model was selected, depending on the results of the heterogeneity test. Fourteen studies were included in the meta-analysis (six studies with 1692 cases and 8359 controls for C282Y; 14 studies with 5849 cases and 13,710 controls for H63D. For the C282Y polymorphism, significant associations were observed in the allele model (Y vs C: OR=0.76, 95%CI=0.62-0.92, P=0.005 and the dominant model (YY+CY vs CC: OR=0.75, 95%CI=0.61-0.92, P=0.006. No associations were found for any genetic model for the H63D polymorphism. The C282Y polymorphism in HFE could be a potential protective factor for ALS in Caucasians. However, the H63D polymorphism does not appear to be associated with ALS.

HFE gene mutation and iron overload in Egyptian pediatric acute lymphoblastic leukemia survivors: a single-center study.

Science.gov (United States)

El-Rashedi, Farida H; El-Hawy, Mahmoud A; El-Hefnawy, Sally M; Mohammed, Mona M

2017-08-01

Hereditary hemochromatosis gene (HFE) mutations have a role in iron overload in pediatric acute lymphoblastic leukemia (ALL) survivors. We aimed to evaluate the genotype frequency and allelic distribution of the two HFE gene mutations (C282Y and H63D) in a sample of Egyptian pediatric ALL survivors and to detect the impact of these two mutations on their iron profile. This study was performed on 35 ALL survivors during their follow-up visits to the Hematology and Oncology Unit, Pediatric Department, Menoufia University Hospitals. Thirty-five healthy children of matched age and sex were chosen as controls. After completing treatment course, ALL survivors were screened for the prevalence of these two mutations by polymerase chain reaction-restriction fragment length polymorphism. Serum ferritin levels were measured by an enzyme-linked immunosorbent assay technique (ELISA). C282Y mutation cannot be detected in any of the 35 survivors or the 35 controls. The H63D heterozygous state (CG) was detected in 28.6% of the survivors group and in 20% of controls, while the H63D homozygous (GG) state was detected in 17.1% of survivors. No compound heterozygosity (C282Y/H63D) was detected at both groups with high G allele frequency (31.4%) in survivors more than controls (10%). There were significant higher levels of iron parameters in homozygote survivors than heterozygotes and the controls. H63D mutation aggravates the iron overload status in pediatric ALL survivors.

Impact of HFE genetic testing on clinical presentation of hereditary hemochromatosis: new epidemiological data

Directory of Open Access Journals (Sweden)

Ka Chandran

2005-06-01

Full Text Available Abstract Background Hereditary hemochromatosis (HH is a common inherited disorder of iron metabolism in Northern European populations. The discovery of a candidate gene in 1996 (HFE, and of its main mutation (C282Y, has radically altered the way to diagnose this disease. The aim of this study was to assess the impact of the HFE gene discovery on the clinical presentation and epidemiology of HH. Methods We studied our cohort of 415 patients homozygous for the C282Y allele and included in a phlebotomy program in a blood centre in western Brittany, France. Results In this cohort, 56.9% of the patients were male and 21.9% began their phlebotomy program before the implementation of the genetic test. A significant decrease in the sex ratio was noticed following implementation of this DNA test, from 3.79 to 1.03 (p -5, meaning that the proportion of diagnosed females relatives to males greatly increased. The profile of HH patients at diagnosis changed after the DNA test became available. Serum ferritin and iron values were lower and there was a reduced frequency of clinical signs displayed at diagnosis, particularly skin pigmentation (20.1 vs. 40.4%, OR = 0.37, p Conclusion This study highlights the importance of the HFE gene discovery, which has simplified the diagnosis of HH and modified its clinical presentation and epidemiology. This study precisely measures these changes. Enhanced diagnosis of HFE-related HH at an early stage and implementation of phlebotomy treatment are anticipated to maintain normal life expectancy for these patients.

PREDICTION OF THE SPECTROSCOPIC PARAMETERS OF NEW IRON COMPOUNDS: HYDRIDE OF IRON CYANIDE/ISOCYANIDE, HFeCN/HFeNC

Energy Technology Data Exchange (ETDEWEB)

Redondo, Pilar; Barrientos, Carmen; Largo, Antonio, E-mail: predondo@qf.uva.es [Departamento de Química Física y Química Inorgánica Facultad de Ciencias, Universidad de Valladolid Campus Miguel Delibes Paseo de Belén 7, E-47011, Valladolid (Spain)

2016-09-01

Iron is the most abundant transition metal in space. Its abundance is similar to that of magnesium, and until today only, FeO and FeCN have been detected. However, magnesium-bearing compounds such as MgCN, MgNC, and HMgNC are found in IRC+10216. It seems that the hydrides of iron cyanide/isocyanide could be good candidates to be present in space. In the present work we carried out a characterization of the different minima on the quintet and triplet [C, Fe, H, N] potential energy surfaces, employing several theoretical approaches. The most stable isomers are predicted to be hydride of iron cyanide HFeCN, and isocyanide HFeNC, in their {sup 5}Δ states. Both isomers are found to be quasi-isoenergetics. The HFeNC isomer is predicted to lie about 0.5 kcal/mol below HFeCN. The barrier for the interconversion process is estimated to be around 6.0 kcal/mol, making this process unfeasible under low temperature conditions, such as those in the interstellar medium. Therefore, both HFeCN and HFeNC could be candidates for their detection. We report geometrical parameters, vibrational frequencies, and rotational constants that could help with their experimental characterization.

PREDICTION OF THE SPECTROSCOPIC PARAMETERS OF NEW IRON COMPOUNDS: HYDRIDE OF IRON CYANIDE/ISOCYANIDE, HFeCN/HFeNC

International Nuclear Information System (INIS)

Redondo, Pilar; Barrientos, Carmen; Largo, Antonio

2016-01-01

Iron is the most abundant transition metal in space. Its abundance is similar to that of magnesium, and until today only, FeO and FeCN have been detected. However, magnesium-bearing compounds such as MgCN, MgNC, and HMgNC are found in IRC+10216. It seems that the hydrides of iron cyanide/isocyanide could be good candidates to be present in space. In the present work we carried out a characterization of the different minima on the quintet and triplet [C, Fe, H, N] potential energy surfaces, employing several theoretical approaches. The most stable isomers are predicted to be hydride of iron cyanide HFeCN, and isocyanide HFeNC, in their 5 Δ states. Both isomers are found to be quasi-isoenergetics. The HFeNC isomer is predicted to lie about 0.5 kcal/mol below HFeCN. The barrier for the interconversion process is estimated to be around 6.0 kcal/mol, making this process unfeasible under low temperature conditions, such as those in the interstellar medium. Therefore, both HFeCN and HFeNC could be candidates for their detection. We report geometrical parameters, vibrational frequencies, and rotational constants that could help with their experimental characterization.

Reduced white matter MRI transverse relaxation rate in cognitively normal H63D-HFE human carriers and H67D-HFE mice.

Science.gov (United States)

Meadowcroft, Mark D; Wang, Jianli; Purnell, Carson J; Peters, Douglas G; Eslinger, Paul J; Neely, Elizabeth B; Gill, David J; Vasavada, Megha; Ali-Rahmani, Fatima; Yang, Qing X; Connor, James R

2016-12-01

Mutations within the HFE protein gene sequence have been associated with increased risk of developing a number of neurodegenerative disorders. To this effect, an animal model has been created which incorporates the mouse homologue to the human H63D-HFE mutation: the H67D-HFE knock-in mouse. These mice exhibit alterations in iron management proteins, have increased neuronal oxidative stress, and a disruption in cholesterol regulation. However, it remains undetermined how these differences translate to human H63D carriers in regards to white matter (WM) integrity. To this endeavor, MRI transverse relaxation rate (R 2 ) parametrics were employed to test the hypothesis that WM alterations are present in H63D human carriers and are recapitulated in the H67D mice. H63D carriers exhibit widespread reductions in brain R 2 compared to non-carriers within white matter association fibers in the brain. Similar R 2 decreases within white matter tracts were observed in the H67D mouse brain. Additionally, an exacerbation of age-related R 2 decrease is found in the H67D animal model in white matter regions of interest. The decrease in R 2 within white matter tracts of both species is speculated to be multifaceted. The R 2 changes are hypothesized to be due to alterations in axonal biochemical tissue composition. The R 2 changes observed in both the human-H63D and mouse-H67D data suggest that modified white matter myelination is occurring in subjects with HFE mutations, potentially increasing vulnerability to neurodegenerative disorders.

Lymphocyte gene expression signatures from patients and mouse models of hereditary hemochromatosis reveal a function of HFE as a negative regulator of CD8+ T-lymphocyte activation and differentiation in vivo.

Science.gov (United States)

Costa, Mónica; Cruz, Eugénia; Oliveira, Susana; Benes, Vladimir; Ivacevic, Tomi; Silva, Maria João; Vieira, Inês; Dias, Francisco; Fonseca, Sónia; Gonçalves, Marta; Lima, Margarida; Leitão, Catarina; Muckenthaler, Martina U; Pinto, Jorge; Porto, Graça

2015-01-01

Abnormally low CD8+ T-lymphocyte numbers is characteristic of some patients with hereditary hemochromatosis (HH), a MHC-linked disorder of iron overload. Both environmental and genetic components are known to influence CD8+ T-lymphocyte homeostasis but the role of the HH associated protein HFE is still insufficiently understood. Genome-wide expression profiling was performed in peripheral blood CD8+ T lymphocytes from HH patients selected according to CD8+ T-lymphocyte numbers and from Hfe-/- mice maintained either under normal or high iron diet conditions. In addition, T-lymphocyte apoptosis and cell cycle progression were analyzed by flow cytometry in HH patients. HH patients with low CD8+ T-lymphocyte numbers show a differential expression of genes related to lymphocyte differentiation and maturation namely CCR7, LEF1, ACTN1, NAA50, P2RY8 and FOSL2, whose expression correlates with the relative proportions of naïve, central and effector memory subsets. In addition, expression levels of LEF1 and P2RY8 in memory cells as well as the proportions of CD8+ T cells in G2/M cell cycle phase are significantly different in HH patients compared to controls. Hfe-/- mice do not show alterations in CD8+ T-lymphocyte numbers but differential gene response patterns. We found an increased expression of S100a8 and S100a9 that is most pronounced in high iron diet conditions. Similarly, CD8+ T lymphocytes from HH patients display higher S100a9 expression both at the mRNA and protein level. Altogether, our results support a role for HFE as a negative regulator of CD8+ T-lymphocyte activation. While the activation markers S100a8 and S100a9 are strongly increased in CD8+ T cells from both, Hfe-/- mice and HH patients, a differential profile of genes related to differentiation/maturation of CD8+ T memory cells is evident in HH patients only. This supports the notion that HFE contributes, at least in part, to the generation of low peripheral blood CD8+ T lymphocytes in HH.

Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population: A Preliminary Study

Directory of Open Access Journals (Sweden)

Selma Ünal

2014-09-01

Full Text Available OBJECTIVE: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group. METHODS: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6±6.1 years, range: 3-30 years with beta-thalassemia major (BTM and 13 beta-thalassemia intermedia (BTI patients (6 males and 7 females; mean age: 19.6±3.5 years, range: 13-26 years were included in the study. The control group comprised 100 healthy blood donors. RESULTS: Neither heterozygous nor homozygous HFE gene C282Y mutation was detected in patients with BTM or BTI, or in control group. CONCLUSION: The C282Y mutation, which is supposed to be responsible for the majority of hereditary hemochromatosis, was not found to have a role in the development of hemochromatosis in beta-thalassemia patients and was not detected in a healthy Turkish population. However, research on larger cohorts of individuals is required in order to determine the exact prevalence of the HFE gene mutation in Turkish populations from diverse ethnic origins and whether it would have an impact on iron loading in thalassemic populations.

Association of HFE gene C282Y and H63D mutations with liver cirrhosis in the Lithuanian population.

Science.gov (United States)

Juzėnas, Simonas; Kupčinskas, Juozas; Valantienė, Irena; Šumskienė, Jolanta; Petrenkienė, Vitalija; Kondrackienė, Jūrate; Kučinskas, Laimutis; Kiudelis, Gediminas; Skiecevičienė, Jurgita; Kupčinskas, Limas

2016-01-01

Liver cirrhosis is the end-stage disease of chronic liver injury. Due to differences in the natural course of chronic liver diseases, identification of genetic factors that influence individual outcomes is warranted. HFE-linked hereditary hemochromatosis (HH) predisposes disease progression to cirrhosis; however, the role of heterozygous C282Y or H63D mutations in the development of cirrhosis in the presence of other etiological factors is still debated. The aim of this study was to determine the association between heterozygous C282Y and H63D mutations and non-HH liver cirrhosis in Lithuanian population. The patient cohort consisted of 209 individuals. Diagnosis of cirrhosis was confirmed by clinical, laboratory parameters, liver biopsy, and radiological imaging. Control samples were obtained from 1005 randomly selected unrelated healthy individuals. HFE gene mutations were determined using the PCR-RFLP method. The most common causes of cirrhosis were hepatitis C (33.9%), hepatitis B (13.6%), and alcohol (25.8%). C282Y allele was associated with the presence of cirrhosis (OR=2.07; P=0.005); this was also observed under recessive model for C282Y (OR=2.06, P=0.008). The prevalence of C282Y allele was higher in cirrhotic men than in controls (7.0% vs. 2.8%, P=0.002). The carriage of H63D risk allele (OR=1.54; P=0.02), heterozygous C282Y/wt and homozygous H63D/H63D genotypes were associated with liver cirrhosis in males (OR=2.48, P=0.008, and OR=4.13, P=0.005, respectively). Heterozygous C282Y mutation of the HFE gene was associated with liver cirrhosis in the Lithuanian population. In gender-related analysis, heterozygous C282Y and homozygous H63D mutations were linked to liver cirrhosis in men, not in women. Copyright © 2016 The Lithuanian University of Health Sciences. Production and hosting by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

HFE p.H63D polymorphism does not influence ALS phenotype and survival.

Science.gov (United States)

Chiò, Adriano; Mora, Gabriele; Sabatelli, Mario; Caponnetto, Claudia; Lunetta, Christian; Traynor, Bryan J; Johnson, Janel O; Nalls, Mike A; Calvo, Andrea; Moglia, Cristina; Borghero, Giuseppe; Monsurrò, Maria Rosaria; La Bella, Vincenzo; Volanti, Paolo; Simone, Isabella; Salvi, Fabrizio; Logullo, Francesco O; Nilo, Riva; Giannini, Fabio; Mandrioli, Jessica; Tanel, Raffaella; Murru, Maria Rita; Mandich, Paola; Zollino, Marcella; Conforti, Francesca L; Penco, Silvana; Brunetti, Maura; Barberis, Marco; Restagno, Gabriella

2015-10-01

It has been recently reported that the p.His63Asp polymorphism of the HFE gene accelerates disease progression both in the SOD1 transgenic mouse and in amyotrophic lateral sclerosis (ALS) patients. We have evaluated the effect of HFE p.His63Asp polymorphism on the phenotype in 1351 Italian ALS patients (232 of Sardinian ancestry). Patients were genotyped for the HFE p.His63Asp polymorphism (CC, GC, and GG). All patients were also assessed for C9ORF72, TARDBP, SOD1, and FUS mutations. Of the 1351 ALS patients, 363 (29.2%) were heterozygous (GC) for the p.His63Asp polymorphism and 30 (2.2%) were homozygous for the minor allele (GG). Patients with CC, GC, and GG polymorphisms did not significantly differ by age at onset, site of onset of symptoms, and survival; however, in SOD1 patients with CG or GG polymorphism had a significantly longer survival than those with a CC polymorphism. Differently from what observed in the mouse model of ALS, the HFE p.His63Asp polymorphism has no effect on ALS phenotype in this large series of Italian ALS patients. Copyright © 2015 Elsevier Inc. All rights reserved.

Four variants in transferrin and HFE genes as potential markers of iron deficiency anaemia risk: an association study in menstruating women

Directory of Open Access Journals (Sweden)

Arroyo-Pardo Eduardo

2011-10-01

Full Text Available Abstract Background Iron deficiency anaemia is a worldwide health problem in which environmental, physiologic and genetic factors play important roles. The associations between iron status biomarkers and single nucleotide polymorphisms (SNPs known to be related to iron metabolism were studied in menstruating women. Methods A group of 270 Caucasian menstruating women, a population group at risk of iron deficiency anaemia, participated in the study. Haematological and biochemical parameters were analysed and 10 selected SNPs were genotyped by minisequencing assay. The associations between genetic and biochemical data were analysed by Bayesian Model Averaging (BMA test and decision trees. Dietary intake of a representative subgroup of these volunteers (n = 141 was assessed, and the relationship between nutrients and iron biomarkers was also determined by linear regression. Results Four variants, two in the transferrin gene (rs3811647, rs1799852 and two in the HFE gene (C282Y, H63D, explain 35% of the genetic variation or heritability of serum transferrin in menstruating women. The minor allele of rs3811647 was associated with higher serum transferrin levels and lower transferrin saturation, while the minor alleles of rs1799852 and the C282Y and H63D mutations of HFE were associated with lower serum transferrin levels. No association between nutrient intake and iron biomarkers was found. Conclusions In contrast to dietary intake, these four SNPs are strongly associated with serum transferrin. Carriers of the minor allele of rs3811647 present a reduction in iron transport to tissues, which might indicate higher iron deficiency anaemia risk, although the simultaneous presence of the minor allele of rs1799852 and HFE mutations appear to have compensatory effects. Therefore, it is suggested that these genetic variants might potentially be used as markers of iron deficiency anaemia risk.

CYBRD1 as a modifier gene that modulates iron phenotype in HFE p.C282Y homozygous patients.

Science.gov (United States)

Pelucchi, Sara; Mariani, Raffaella; Calza, Stefano; Fracanzani, Anna Ludovica; Modignani, Giulia Litta; Bertola, Francesca; Busti, Fabiana; Trombini, Paola; Fraquelli, Mirella; Forni, Gian Luca; Girelli, Domenico; Fargion, Silvia; Specchia, Claudia; Piperno, Alberto

2012-12-01

Most patients with hereditary hemochromatosis in the Caucasian population are homozygous for the p.C282Y mutation in the HFE gene. The penetrance and expression of hereditary hemochromatosis differ largely among cases of homozygous p.C282Y. Genetic factors might be involved in addition to environmental factors. In the present study, we analyzed 50 candidate genes involved in iron metabolism and evaluated the association between 214 single nucleotide polymorphisms in these genes and three phenotypic outcomes of iron overload (serum ferritin, iron removed and transferrin saturation) in a large group of 296 p.C282Y homozygous Italians. Polymorphisms were tested for genetic association with each single outcome using linear regression models adjusted for age, sex and alcohol consumption. We found a series of 17 genetic variants located in different genes with possible additive effects on the studied outcomes. In order to evaluate whether the selected polymorphisms could provide a predictive signature for adverse phenotype, we re-evaluated data by dividing patients in two extreme phenotype classes based on the three phenotypic outcomes. We found that only a small improvement in prediction could be achieved by adding genetic information to clinical data. Among the selected polymorphisms, a significant association was observed between rs3806562, located in the 5'UTR of CYBRD1, and transferrin saturation. This variant belongs to the same haplotype block that contains the CYBRD1 polymorphism rs884409, found to be associated with serum ferritin in another population of p.C282Y homozygotes, and able to modulate promoter activity. A luciferase assay indicated that rs3806562 does not have a significant functional role, suggesting that it is a genetic marker linked to the putative genetic modifier rs884409. While our results support the hypothesis that polymorphisms in genes regulating iron metabolism may modulate penetrance of HFE-hereditary hemochromatosis, with emphasis on

Mutant HFE H63D Protein Is Associated with Prolonged Endoplasmic Reticulum Stress and Increased Neuronal Vulnerability*

Science.gov (United States)

Liu, Yiting; Lee, Sang Y.; Neely, Elizabeth; Nandar, Wint; Moyo, Mthabisi; Simmons, Zachary; Connor, James R.

2011-01-01

A specific polymorphism in the hemochromatosis (HFE) gene, H63D, is over-represented in neurodegenerative disorders such as amyotrophic lateral sclerosis and Alzheimer disease. Mutations of HFE are best known as being associated with cellular iron overload, but the mechanism by which HFE H63D might increase the risk of neuron degeneration is unclear. Here, using an inducible expression cell model developed from a human neuronal cell line SH-SY5Y, we reported that the presence of the HFE H63D protein activated the unfolded protein response (UPR). This response was followed by a persistent endoplasmic reticulum (ER) stress, as the signals of UPR sensors attenuated and followed by up-regulation of caspase-3 cleavage and activity. Our in vitro findings were recapitulated in a transgenic mouse model carrying Hfe H67D, the mouse equivalent of the human H63D mutation. In this model, UPR activation was detected in the lumbar spinal cord at 6 months then declined at 12 months in association with increased caspase-3 cleavage. Moreover, upon the prolonged ER stress, the number of cells expressing HFE H63D in early apoptosis was increased moderately. Cell proliferation was decreased without increased cell death. Additionally, despite increased iron level in cells carrying HFE H63D, it appeared that ER stress was not responsive to the change of cellular iron status. Overall, our studies indicate that the HFE H63D mutant protein is associated with prolonged ER stress and chronically increased neuronal vulnerability. PMID:21349849

Regulation of HFE expression by poly(ADP-ribose) polymerase-1 (PARP1) through an inverted repeat DNA sequence in the distal promoter.

Science.gov (United States)

Pelham, Christopher; Jimenez, Tamara; Rodova, Marianna; Rudolph, Angela; Chipps, Elizabeth; Islam, M Rafiq

2013-12-01

Hereditary hemochromatosis (HH) is a common autosomal recessive disorder of iron overload among Caucasians of northern European descent. Over 85% of all cases with HH are due to mutations in the hemochromatosis protein (HFE) involved in iron metabolism. Although the importance in iron homeostasis is well recognized, the mechanism of sensing and regulating iron absorption by HFE, especially in the absence of iron response element in its gene, is not fully understood. In this report, we have identified an inverted repeat sequence (ATGGTcttACCTA) within 1700bp (-1675/+35) of the HFE promoter capable to form cruciform structure that binds PARP1 and strongly represses HFE promoter. Knockdown of PARP1 increases HFE mRNA and protein. Similarly, hemin or FeCl3 treatments resulted in increase in HFE expression by reducing nuclear PARP1 pool via its apoptosis induced cleavage, leading to upregulation of the iron regulatory hormone hepcidin mRNA. Thus, PARP1 binding to the inverted repeat sequence on the HFE promoter may serve as a novel iron sensing mechanism as increased iron level can trigger PARP1 cleavage and relief of HFE transcriptional repression. © 2013.

Implicating the H63D polymorphism in the HFE gene in increased incidence of solid cancers: a meta-analysis.

Science.gov (United States)

Shen, L L; Gu, D Y; Zhao, T T; Tang, C J; Xu, Y; Chen, J F

2015-10-29

A number of previous studies have demonstrated that the HFE H63D polymorphism is associated with increased risk of incidence multiple types of cancer, including colorectal cancer, breast cancer, liver cancer, pancreatic cancer, and gynecological malignant tumors. However, the clinical outcomes were inconsistent. Therefore, this meta-analysis was conducted to summarize the effect of the H63D variant on the incidence of solid tumor. PubMed and EMBASE databases were searched for articles associating the HFE H63D polymorphism with cancer risk. The relationships were evaluated by calculating the pooled odds ratios (ORs) with 95% confidence intervals (CIs). A total of 28 studies, including 7728 cancer cases and 11,895 controls, were identified. Statistically significant associations were identified between the HFE H63D polymorphism and solid cancer risk (CG vs CC, OR = 1.14, 95%CI = 1.07-1.23, P HFE H63D polymorphism may play a critical role in the increased aggressiveness of hepatocellular carcinoma and pancreatic cancer.

Association of HFE common mutations with Parkinson's disease, Alzheimer's disease and mild cognitive impairment in a Portuguese cohort

Directory of Open Access Journals (Sweden)

Morgadinho Ana S

2006-07-01

Full Text Available Abstract Background Pathological brain iron deposition has been implicated as a source of neurotoxic reactive oxygen species in Alzheimer (AD and Parkinson diseases (PD. Iron metabolism is associated with the gene hemochromatosis (HFE Human genome nomenclature committee ID:4886, and mutations in HFE are a cause of the iron mismetabolism disease, hemochromatosis. Several reports have tested the association of HFE variants with neurodegenerative diseases, such as AD and PD with conflicting results. Methods Genotypes were analysed for the two most common variants of HFE in a series of 130 AD, 55 Mild Cognitive Impairment (MCI and 132 PD patients. Additionally, a series of 115 healthy age-matched controls was also screened. Results A statistically significant association was found in the PD group when compared to controls, showing that the presence of the C282Y variant allele may confer higher risk for developing the disease. Conclusion Taken together these results suggest that the common variants in HFE may be a risk factor for PD, but not for AD in the Portuguese population.

[ALLELES C282Y AND H63D HFE GENE, INSULIN RESISTANCE AND SUSCEPTIBILITY TO DISTURBANCE OF PORPHYRIN METABOLISM IN NON-ALCOHOLIC FATTY LIVER DISEASE].

Science.gov (United States)

Krivosheev, A B; Maximov, V N; Voevoda, M I; Kuimov, A D; Kondratova, M A; Tuguleva, T A; Koval, O N; Bezrukova, A A; Bogorianova, P A; Rybina, O V

2015-01-01

The aim of the present work was to study the frequency of genotypes and alleles of C282Y and H63D HFE gene that may be associated with impaired porphyrin metabolism, as well as possible reasons for the formation of dysmetabolism porphyrins with NAFLD. The study involved 65 patients (52 men and 13 women) aged 21 to 69 years (mean age 48.5±1.5 years). Excretion uroporphyrin, coproporphyrin, 6-aminolevulinic acid of porphobilinogen in urine was determined by chromatography and spectrophotometry calculated total excretion of porphyrins. Allele frequencies C282Y and H63D were determined during the molecular genetic analysis of DNA using the polymerase chain reaction followed by analysis of length polymorphism restraktsionnyh fragments. Condition of carbohydrate metabolism was evaluated by the level of fasting blood glucose and standard glucose tolerance test. Diagnosis of insulin resistance was performed according to the criteria proposed by the European Group for the Study of insulin resistance (EGIR). Skill test for the C282Y mutation carriage and H63D in the HFE gene in 65 patients with non-alcoholic fatty liver disease. Disturbances in the metabolism of porphyrins were recorded in 43 (66.2%) patients. H63D and C282Y mutations were found in 18 (27.7%) patients, of whom 13 (72.2%) people with different options dismetabolism porphyrins and signs of insulin resistance. In 47 (72.3%) patients without mutations studied porphyrin metabolism disorders were detected in 30 (63.8 %), of which insulin resistance is registered only in 16 (34.0 %). Detection of mutations C282Y and H63D in the HFE gene in combination with disorders of porphyrin metabolism on the background of insulin resistance is likely to allow such patients considered as candidates for inclusion in the higher risk of formation of diabetes.

Population-based analysis of the frequency of HFE gene polymorphisms: Correlation with the susceptibility to develop hereditary hemochromatosis.

Science.gov (United States)

Katsarou, Martha-Spyridoula; Latsi, Rosana; Papasavva, Maria; Demertzis, Nikolaos; Kalogridis, Thodoris; Tsatsakis, Aristides M; Spandidos, Demetrios A; Drakoulis, Nikolaos

2016-07-01

Hereditary hemochromatosis (HH) is an autosomal recessive genetic disease, characterized by increased dietary iron absorption. Due to the absence of an effective excretory mechanism, the excess iron in the body may accumulate resulting in toxic effects. The HFE gene also affects the activity of hepcidin, a hormone which acts as a negative regulator of iron metabolism. In this study, we performed a population-based analysis of the distribution of three hemochromatosis-related polymorphisms in the HFE gene (rs1800562, rs1799945 and rs1800730). DNA from 1,446 non‑related individuals of Greek ethnicity was collected and analyzed, either from whole blood or buccal swabs. The frequency distribution of these HFE gene polymorphisms was then determined. The results revealed that in our Greek population cohort (gr) the frequencies of each polymorphism were as follows: rs1800562: GG (wild‑type)=97.0%, GA=1.5%, AA=1.5%; rs1799945: CC (wild‑type)=74.4%, CG=23.4%, GG=2.2%; rs1800730: AA (wild‑type)=98.1%, AT=1.5% and TT=0.4%. No association between the HFE polymorphisms rs1800562, rs1799945 and rs1800730 and gender could be established. As regards the rs1800562 polymorphism, the A allele (mutant) was ~1.8‑fold more frequent in the European population (eur) than in the Greek population [(gr)=2,3%<(eur)=4%]. As for the rs1799945 polymorphism, the G allele (mutant) was 1.2‑fold more frequent in the European population than in the Greek population [(gr)=13,9%<(eur)=17%]. As regards the rs1800730 polymorphism, the T allele (mutant) was ~1.7‑fold more frequent in the European population than in the Greek population [(gr)=1.2%<(eur)=2%]. However, these pathogenic mutations were found more frequently in the Greek population compared to the global population (gl) [rs1800562: (gl)=1%<(gr)=2,3%; rs1799945: (gl)=7%<(gr)=13,9%; rs1800730: (gl)=<1%<(gr)=1.2%]. This suggests that the Greek population may differ genetically from the northern European population

New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

DEFF Research Database (Denmark)

2010-01-01

dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

ENVIRONMENTAL RESEARCH BRIEF: THERMOPHYSICAL PROPERTIES OF HFE-125

Science.gov (United States)

Thermophysical properties of HFE-125 (pentafluorodimethylether) suggest that it could serve as an alternative non-ozone depleting refrigerant for certain low temperature applications. This Brief presents the thermophysical properties of HFE-125 (Tables 1-4) which have been obtai...

The effect of the hemochromatosis (HFE) genotype on lead load and iron metabolism among lead smelter workers.

Science.gov (United States)

Fan, Guangqin; Du, Guihua; Li, Huijun; Lin, Fen; Sun, Ziyong; Yang, Wei; Feng, Chang; Zhu, Gaochun; Li, Yanshu; Chen, Ying; Jiao, Huan; Zhou, Fankun

2014-01-01

Both an excess of toxic lead (Pb) and an essential iron disorder have been implicated in many diseases and public health problems. Iron metabolism genes, such as the hemochromatosis (HFE) gene, have been reported to be modifiers for lead absorption and storage. However, the HFE gene studies among the Asian population with occupationally high lead exposure are lacking. To explore the modifying effects of the HFE genotype (wild-type, H63D variant and C282Y variant) on the Pb load and iron metabolism among Asian Pb-workers with high occupational exposure. Seven hundred and seventy-one employees from a lead smelter manufacturing company were tested to determine their Pb intoxication parameters, iron metabolic indexes and identify the HFE genotype. Descriptive and multivariate analyses were conducted. Forty-five H63D variant carriers and no C282Y variant carrier were found among the 771 subjects. Compared with subjects with the wild-type genotype, H63D variant carriers had higher blood lead levels, even after controlling for factors such as age, sex, marriage, education, smoking and lead exposure levels. Multivariate analyses also showed that the H63D genotype modifies the associations between the blood lead levels and the body iron burden/transferrin. No C282Y variant was found in this Asian population. The H63D genotype modified the association between the lead and iron metabolism such that increased blood lead is associated with a higher body iron content or a lower transferrin in the H63D variant. It is indicated that H63D variant carriers may be a potentially highly vulnerable sub-population if they are exposed to high lead levels occupationally.

Evidence for the Influence of the Iron Regulatory MHC Class I Molecule HFE on Tumor Progression in Experimental Models and Clinical Populations

Science.gov (United States)

Weston, Cody; Connor, James

2014-01-01

Proteins involved in iron regulation are modifiers of cancer risk and progression. Of these, the HFE protein (high iron gene and its protein product) is of particular interest because of its interaction with both iron handling and immune function and the high rate of genetic polymorphisms resulting in a mutant protein. Clinical studies suggest that HFE polymorphisms increase the risk of certain cancers, but the inconsistent outcomes suggest a more nuanced effect, possibly interacting with other genetic or environmental factors. Some basic science research has been conducted to begin to understand the implications of variant HFE genotype on cancer, but the story is far from complete. In particular, putative mechanisms exist for HFE to affect tumor progression through its role in iron handling and its major histocompatibility complex class I structural features. In this review, the current understanding of the role of HFE in cancer is described and models for future directions are identified. PMID:25520556

Clinical penetrance in hereditary hemochromatosis: estimates of the cumulative incidence of severe liver disease among HFE C282Y homozygotes.

Science.gov (United States)

Grosse, Scott D; Gurrin, Lyle C; Bertalli, Nadine A; Allen, Katrina J

2018-04-01

Iron overload (hemochromatosis) can cause serious, symptomatic disease that is preventable if detected early and managed appropriately. The leading cause of hemochromatosis in populations of predominantly European ancestry is homozygosity of the C282Y variant in the HFE gene. Screening of adults for iron overload or associated genotypes is controversial, largely because of a belief that severe phenotypes are uncommon, although cascade testing of first-degree relatives of patients is widely endorsed. We contend that severe liver disease (cirrhosis or hepatocellular cancer) is not at all uncommon among older males with hereditary hemochromatosis. Our review of the published data from a variety of empirical sources indicates that roughly 1 in 10 male HFE C282Y homozygotes is likely to develop severe liver disease during his lifetime unless iron overload is detected early and treated. New evidence from a randomized controlled trial of treatment allows for evidence-based management of presymptomatic patients. Although population screening for HFE C282Y homozygosity faces multiple barriers, a potentially effective strategy for increasing the early detection and prevention of clinical iron overload and severe disease is to include HFE C282Y homozygosity in lists of medically actionable gene variants when reporting the results of genome or exome sequencing.

Frequency of the HFE C282Y and H63D mutations in Danish patients with clinical haemochromatosis initially diagnosed by phenotypic methods

DEFF Research Database (Denmark)

Milman, Nils; Koefoed, Pernille; Pedersen, Palle

2003-01-01

AIM: To assess the frequency of the C282Y and H63D mutations on the HFE gene in Danish patients with clinical hereditary haemochromatosis initially diagnosed by phenotypic methods. METHODS: In the period 1950-1985, an epidemiological survey in Denmark identified 179 patients with clinical...... diagnosis of clinical idiopathic haemochromatosis was made before blood samples were taken for HFE genotyping. The total series consisted of 58 patients (40 men and 18 women) with a median age of 60 yrs (range 18-74). HFE genotyping was performed by the polymerase chain reaction (PCR) technique. RESULTS...

The effect of the hemochromatosis (HFE genotype on lead load and iron metabolism among lead smelter workers.

Directory of Open Access Journals (Sweden)

Guangqin Fan

Full Text Available Both an excess of toxic lead (Pb and an essential iron disorder have been implicated in many diseases and public health problems. Iron metabolism genes, such as the hemochromatosis (HFE gene, have been reported to be modifiers for lead absorption and storage. However, the HFE gene studies among the Asian population with occupationally high lead exposure are lacking.To explore the modifying effects of the HFE genotype (wild-type, H63D variant and C282Y variant on the Pb load and iron metabolism among Asian Pb-workers with high occupational exposure.Seven hundred and seventy-one employees from a lead smelter manufacturing company were tested to determine their Pb intoxication parameters, iron metabolic indexes and identify the HFE genotype. Descriptive and multivariate analyses were conducted.Forty-five H63D variant carriers and no C282Y variant carrier were found among the 771 subjects. Compared with subjects with the wild-type genotype, H63D variant carriers had higher blood lead levels, even after controlling for factors such as age, sex, marriage, education, smoking and lead exposure levels. Multivariate analyses also showed that the H63D genotype modifies the associations between the blood lead levels and the body iron burden/transferrin.No C282Y variant was found in this Asian population. The H63D genotype modified the association between the lead and iron metabolism such that increased blood lead is associated with a higher body iron content or a lower transferrin in the H63D variant. It is indicated that H63D variant carriers may be a potentially highly vulnerable sub-population if they are exposed to high lead levels occupationally.

Sample-to-SNP kit: a reliable, easy and fast tool for the detection of HFE p.H63D and p.C282Y variations associated to hereditary hemochromatosis.

Science.gov (United States)

Nielsen, Peter B; Petersen, Maja S; Ystaas, Viviana; Andersen, Rolf V; Hansen, Karin M; Blaabjerg, Vibeke; Refstrup, Mette

2012-10-01

Classical hereditary hemochromatosis involves the HFE-gene and diagnostic analysis of the DNA variants HFE p.C282Y (c.845G>A; rs1800562) and HFE p.H63D (c.187C>G; rs1799945). The affected protein alters the iron homeostasis resulting in iron overload in various tissues. The aim of this study was to validate the TaqMan-based Sample-to-SNP protocol for the analysis of the HFE-p.C282Y and p.H63D variants with regard to accuracy, usefulness and reproducibility compared to an existing SNP protocol. The Sample-to-SNP protocol uses an approach where the DNA template is made accessible from a cell lysate followed by TaqMan analysis. Besides the HFE-SNPs other eight SNPs were used as well. These SNPs were: Coagulation factor II-gene F2 c.20210G>A, Coagulation factor V-gene F5 p.R506Q (c.1517G>A; rs121917732), Mitochondria SNP: mt7028 G>A, Mitochondria SNP: mt12308 A>G, Proprotein convertase subtilisin/kexin type 9-gene PCSK9 p.R46L (c.137G>T), Plutathione S-transferase pi 1-gene GSTP1 p.I105V (c313A>G; rs1695), LXR g.-171 A>G, ZNF202 g.-118 G>T. In conclusion the Sample-to-SNP kit proved to be an accurate, reliable, robust, easy to use and rapid TaqMan-based SNP detection protocol, which could be quickly implemented in a routine diagnostic or research facility. Copyright © 2012. Published by Elsevier B.V.

Mild iron overload in patients carrying the HFE S65C gene mutation: a retrospective study in patients with suspected iron overload and healthy controls

OpenAIRE

Holmström, P; Marmur, J; Eggertsen, G; Gåfvels, M; Stål, P

2002-01-01

Background and aims: The role of the HFE S65C mutation in the development of hepatic iron overload is unknown. The aim of the present study was: (A) to determine the HFE S65C frequency in a Northern European population; and (B) to evaluate whether the presence of the HFE S65C mutation would result in a significant hepatic iron overload.

HFE Genotyping in Patients with Elevated Serum Iron Indices and Liver Diseases

Directory of Open Access Journals (Sweden)

Andreia Silva Evangelista

2015-01-01

Full Text Available Iron abnormalities in chronic liver disease may be the result of genetic diseases or secondary factors. The present study aimed to identify subjects with HFE-HH in order to describe the frequency of clinical manifestations, identify risk factors for iron elevation, and compare the iron profile of HFE-HH to other genotypes in liver disease patients. A total of 108 individuals with hepatic disease, transferrin saturation (TS > 45%, and serum ferritin (SF > 350 ng/mL were tested for HFE mutations. Two groups were characterized: C282Y/C282Y or C282Y/H63D genotypes (n=16 were the HFE hereditary hemochromatosis (HFE-HH group; and C282Y and H63D single heterozygotes, the H63D/H63D genotype, and wild-type were considered group 2 (n=92. Nonalcoholic liver disease, alcoholism, and chronic hepatitis C were detected more frequently in group 2, whereas arthropathy, hepatocarcinoma, diabetes, and osteoporosis rates were significantly higher in the HFE-HH group. TS > 82%, SF > 2685 ng/mL, and serum iron > 178 μg/dL were the cutoffs for diagnosis of HFE-HH in patients with liver disease. Thus, in non-Caucasian populations with chronic liver disease, HFE-HH diagnosis is more predictable in those with iron levels higher than those proposed in current guidelines for the general population.

Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

DEFF Research Database (Denmark)

Krath, Britta N.; Hove-Jensen, Bjarne

1996-01-01

The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

Rapid duplication and loss of nbs-encoding genes in eurosids II

International Nuclear Information System (INIS)

Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

2015-01-01

Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

Haplotype analysis of the HFE gene among populations of Northern Eurasia, in patients with metabolic disorders or stomach cancer, and in long-lived people.

Science.gov (United States)

Mikhailova, S V; Babenko, V N; Ivanoshchuk, D E; Gubina, M A; Maksimov, V N; Solovjova, I G; Voevoda, M I

2016-06-17

Previously, it was shown that the HFE gene (associated with human hereditary hemochromatosis) has several haplotypes of intronic polymorphisms. Some haplotype frequencies are race specific and hence can be used in phylogenetic analysis. We assumed that analysis of Caucasoid patients-living now in Western Siberia and having diseases associated with dietary habits and metabolic rate-will allow us to understand the processes of possible selection during settling of the northern part of Asia. Haplotype analysis of Northern Eurasian native and recently settled ethnic groups was performed on polymorphisms rs1799945, rs1800730, rs1800562, rs2071303, rs1800708, rs1572982, rs2794719, rs807209, and rs2032451 of this gene. The CCA haplotype of the rs2071303, rs1800708, and rs1572982 was found to be associated with HLA-A2 (39 %) in Asian populations. Haplotype analysis for the rs1799945, rs1800730, rs1800562, rs2071303, rs1800708, and rs1572982 was performed on Russian patients with some metabolic disorders or stomach cancer and among long-lived people. Decreased frequencies of the TTA haplotype (T in rs2071303, T in rs1800708, and A in rs1572982) were observed in the groups of patients with diseases associated with overweight (fatty liver disease, type 2 diabetes mellitus, or metabolic syndrome + arterial hypertension) as compared with the control sample. We detected significant differences in this haplotype's frequency between the patients with type 2 diabetes mellitus and Russian adolescents, elderly citizens, and long-lived people (χ(2) P value = 0.003, 0.010, and 0.015, respectively). No significant differences in frequencies of the alleles with mutations in coding regions of the HFE gene (C282Y, H63D, and S65C) were detected between the analyzed patients (with stomach cancer, metabolic syndrome, fatty liver disease, or type 2 diabetes mellitus) and the control Caucasoid sample. Monophyletic origin of H63D (rs1799945) was confirmed in Caucasoids and Northern

MTHFR and HFE, but not preproghrelin and LBP, polymorphisms as risk factors for all-cause end-stage renal disease development.

Science.gov (United States)

Bloudíčková, S; Kuthanová, L; Hubáček, J A

2014-01-01

End-stage renal disease (ESRD) is a serious health problem worldwide. The high prevalence of cardiovascular diseases and chronic inflammation remains a major cause of morbidity and mortality in haemodialysed patients. Beside some external factors, genetic predisposition both to renal failure and poor prognosis has been assumed. We have collected a total of 1,014 haemodialysed patients and 2,559 unrelated healthy Caucasians. Single-nucleotide polymorphisms (SNPs) in genes for preproghrelin (GHRL), lipopolysaccharide-binding protein (LBP), HFE and MTHFR were genotyped. In the group of patients, significantly more carriers presented the MTHFR T667T (P = 0.002) and HFE Asp63Asp (P = 0.001) and Cys282Cys (P = 0.01) genotypes. The frequencies of individual SNPs within GHRL and LBP genes did not differ between the patients and controls. The trends in genotype frequencies did not differ between the subgroups of patients with different time on haemodialysis. Common variants in MTHFR and HFE could be a risk factor for all-cause ESRD development, but are not predictors for the survival on haemodialysis.

Iron regulation of hepcidin despite attenuated Smad1,5,8 signaling in mice without transferrin receptor 2 or Hfe

Science.gov (United States)

Corradini, Elena; Rozier, Molly; Meynard, Delphine; Odhiambo, Adam; Lin, Herbert Y.; Feng, Qi; Migas, Mary C.; Britton, Robert S.; Babitt, Jodie L.; Fleming, Robert E.

2011-01-01

Background & Aims HFE and transferrin receptor 2 (TFR2) are each necessary for the normal relationship between body iron status and liver hepcidin expression. In murine Hfe and Tfr2 knockout models of hereditary hemochromatosis (HH), signal transduction to hepcidin via the bone morphogenetic protein 6 (Bmp6)/Smad1,5,8 pathway is attenuated. We examined the effect of dietary iron on regulation of hepcidin expression via the Bmp6/Smad1,5,8 pathway using mice with targeted disruption of Tfr2, Hfe, or both genes. Methods Hepatic iron concentrations and mRNA expression of Bmp6 and hepcidin were compared with wild-type mice in each of the HH models on standard or iron-loading diets. Liver phospho-Smad (P-Smad)1,5,8 and Id1 mRNA levels were measured as markers of Bmp/Smad signaling. Results While Bmp6 expression was increased, liver hepcidin and Id1 expression were decreased in each of the HH models compared with wild-type mice. Each of the HH models also demonstrated attenuated P-Smad1,5,8 levels relative to liver iron status. Mice with combined Hfe/Tfr2 disruption were most affected. Dietary iron loading increased hepcidin and Id1 expression in each of the HH models. Compared with wild-type mice, HH mice demonstrated attenuated (Hfe knockout) or no increases in P-Smad1,5,8 levels in response to dietary iron loading. Conclusions These observations demonstrate that Tfr2 and Hfe are each required for normal signaling of iron status to hepcidin via Bmp6/Smad1,5,8 pathway. Mice with combined loss of Hfe and Tfr2 up-regulate hepcidin in response to dietary iron loading without increases in liver BMP6 mRNA or steady-state P-Smad1,5,8 levels. PMID:21745449

Genetic disruption of NRF2 promotes the development of necroinflammation and liver fibrosis in a mouse model of HFE-hereditary hemochromatosis.

Science.gov (United States)

Duarte, Tiago L; Caldas, Carolina; Santos, Ana G; Silva-Gomes, Sandro; Santos-Gonçalves, Andreia; Martins, Maria João; Porto, Graça; Lopes, José Manuel

2017-04-01

In hereditary hemochromatosis, iron deposition in the liver parenchyma may lead to fibrosis, cirrhosis and hepatocellular carcinoma. Most cases are ascribed to a common mutation in the HFE gene, but the extent of clinical expression is greatly influenced by the combined action of yet unidentified genetic and/or environmental modifying factors. In mice, transcription factor NRF2 is a critical determinant of hepatocyte viability during exposure to acute dietary iron overload. We evaluated if the genetic disruption of Nrf2 would prompt the development of liver damage in Hfe -/- mice (an established model of human HFE-hemochromatosis). Wild-type, Nrf2 -/- , Hfe -/- and double knockout (Hfe/Nrf2 -/- ) female mice on C57BL/6 genetic background were sacrificed at the age of 6 (young), 12-18 (middle-aged) or 24 months (old) for evaluation of liver pathology. Despite the parenchymal iron accumulation, Hfe -/- mice presented no liver injury. The combination of iron overload (Hfe -/- ) and defective antioxidant defences (Nrf2 -/- ) increased the number of iron-related necroinflammatory lesions (sideronecrosis), possibly due to the accumulation of toxic oxidation products such as 4-hydroxy-2-nonenal-protein adducts. The engulfment of dead hepatocytes led to a gradual accumulation of iron within macrophages, featuring large aggregates. Myofibroblasts recruited towards the injury areas produced substantial amounts of collagen fibers involving the liver parenchyma of double-knockout animals with increased hepatic fibrosis in an age-dependent manner. The genetic disruption of Nrf2 promotes the transition from iron accumulation (siderosis) to liver injury in Hfe -/- mice, representing the first demonstration of spontaneous hepatic fibrosis in the long term in a mouse model of hereditary hemochromatosis displaying mildly elevated liver iron. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

The association between the C282Y and H63D polymorphisms of HFE gene and the risk of Parkinson's disease: A meta-analysis.

Science.gov (United States)

Xia, Jianjian; Xu, Huamin; Jiang, Hong; Xie, Junxia

2015-05-19

Impaired brain iron homeostasis has been considered as an important mechanism in Parkinson's diseases (PD). There are indications that C282Y and H63D polymorphisms of HFE genes involved in iron metabolism might contribute to the pathogenesis of PD in some cases. However, the investigation of the relationship between PD and the two polymorphisms had produced contradictory results. We performed a meta-analysis to assess the C282Y and H63D polymorphisms of HFE in PD susceptibility. PubMed, EMBASE and Web of Science were systematically searched to identify relevant researches. The strict selection criteria and exclusion standard were applied. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of associations. A fixed-effect or random-effect model was selected, depending on the results of the heterogeneity test. Fifteen studies were included in the meta-analysis (eight studies with 1631 cases and 4548 controls for C282Y; seven studies with 1192 cases and 4065 controls for H63D). For the C282Y polymorphism, significant associations were observed in the Recessive model (YY vs CY+CC: OR=0.22, 95% CI=0.09-0.57, P=0.002). This indicated that the C282Y polymorphism in HFE might be a potential protective factor for PD. However, no significant associations were found for any genetic model for the H63D polymorphism, suggesting that the H63D polymorphism might not be associated with PD. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

A deep auto-encoder model for gene expression prediction.

Science.gov (United States)

Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

2017-11-17

Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

Human Factors Engineering (HFE) insights for advanced reactors based upon operating experience

International Nuclear Information System (INIS)

Higgins, J.; Nasta, K.

1997-01-01

The NRC Human Factors Engineering Program Review Model (HFE PRM, NUREG-0711) was developed to support a design process review for advanced reactor design certification under 10CFR52. The HFE PRM defines ten fundamental elements of a human factors engineering program. An Operating Experience Review (OER) is one of these elements. The main purpose of an OER is to identify potential safety issues from operating plant experience and ensure that they are addressed in a new design. Broad-based experience reviews have typically been performed in the past by reactor designers. For the HFE PRM the intent is to have a more focussed OER that concentrates on HFE issues or experience that would be relevant to the human-system interface (HSI) design process for new advanced reactors. This document provides a detailed list of HFE-relevant operating experience pertinent to the HSI design process for advanced nuclear power plants. This document is intended to be used by NRC reviewers as part of the HFE PRM review process in determining the completeness of an OER performed by an applicant for advanced reactor design certification. 49 refs

Carriers of the Complex Allele HFE c.[187C>G;340+4T>C] Have Increased Risk of Iron Overload in São Miguel Island Population (Azores, Portugal).

Science.gov (United States)

Branco, Claudia C; Gomes, Cidália T; De Fez, Laura; Bulhões, Sara; Brilhante, Maria José; Pereirinha, Tânia; Cabral, Rita; Rego, Ana Catarina; Fraga, Cristina; Miguel, António G; Brasil, Gracinda; Macedo, Paula; Mota-Vieira, Luisa

2015-01-01

Iron overload is associated with acquired and genetic conditions, the most common being hereditary hemochromatosis (HH) type-I, caused by HFE mutations. Here, we conducted a hospital-based case-control study of 41 patients from the São Miguel Island (Azores, Portugal), six belonging to a family with HH type-I pseudodominant inheritance, and 35 unrelated individuals fulfilling the biochemical criteria of iron overload compatible with HH type-I. For this purpose, we analyzed the most common HFE mutations- c.845G>A [p.Cys282Tyr], c.187C>G [p.His63Asp], and c.193A>T [p.Ser65Cys]. Results revealed that the family's HH pseudodominant pattern is due to consanguineous marriage of HFE-c.845G>A carriers, and to marriage with a genetically unrelated spouse that is a -c.187G carrier. Regarding unrelated patients, six were homozygous for c.845A, and three were c.845A/c.187G compound heterozygous. We then performed sequencing of HFE exons 2, 4, 5 and their intron-flanking regions. No other mutations were observed, but we identified the -c.340+4C [IVS2+4C] splice variant in 26 (74.3%) patients. Functionally, the c.340+4C may generate alternative splicing by HFE exon 2 skipping and consequently, a protein missing the α1-domain essential for HFE/ transferrin receptor-1 interactions. Finally, we investigated HFE mutations configuration with iron overload by determining haplotypes and genotypic profiles. Results evidenced that carriers of HFE-c.187G allele also carry -c.340+4C, suggesting in-cis configuration. This data is corroborated by the association analysis where carriers of the complex allele HFE-c.[187C>G;340+4T>C] have an increased iron overload risk (RR = 2.08, 95% CI = 1.40-2.94, poverload because they will produce two altered proteins--the p.63Asp [c.187G], and the protein lacking 88 amino acids encoded by exon 2. In summary, we provide evidence that the complex allele HFE-c.[187C>G;340+4T>C] has a role, as genetic predisposition factor, on iron overload in the S�

Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

Science.gov (United States)

Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

2014-01-03

Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

Cloning of human genes encoding novel G protein-coupled receptors

Energy Technology Data Exchange (ETDEWEB)

Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

1994-10-01

We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

A novel homozygous stop-codon mutation in human HFE responsible for nonsense-mediated mRNA decay.

Science.gov (United States)

Padula, Maria Carmela; Martelli, Giuseppe; Larocca, Marilena; Rossano, Rocco; Olivieri, Attilio

2014-09-01

HFE-hemochromatosis (HH) is an autosomal disease characterized by excessive iron absorption. Homozygotes for H63D variant, and still less H63D heterozygotes, generally do not express HH phenotype. The data collected in our previous study in the province of Matera (Basilicata, Italy) underlined that some H63D carriers showed altered iron metabolism, without additional factors. In this study, we selected a cohort of 10/22 H63D carriers with severe biochemical iron overload (BIO). Additional analysis was performed for studying HFE exons, exon-intron boundaries, and untranslated regions (UTRs) by performing DNA extraction, PCR amplification and sequencing. The results showed a novel substitution (NM_000410.3:c.847C>T) in a patient exon 4 (GenBankJQ478433); it introduces a premature stop-codon (PTC). RNA extraction and reverse-transcription were also performed. Quantitative real-time PCR was carried out for verifying if our aberrant mRNA is targeted for nonsense-mediated mRNA decay (NMD); we observed that patient HFE mRNA was expressed much less than calibrator, suggesting that the mutated HFE protein cannot play its role in iron metabolism regulation, resulting in proband BIO. Our finding is the first evidence of a variation responsible for a PTC in iron cycle genes. The genotype-phenotype correlation observed in our cases could be related to the additional mutation. Copyright © 2014 Elsevier Inc. All rights reserved.

Gender and plasma iron biomarkers, but not HFE gene mutations, increase the risk of colorectal cancer and polyps.

Science.gov (United States)

Castiella, Agustin; Múgica, Fernando; Zapata, Eva; Zubiaurre, Leire; Iribarren, Arantxa; de Juan, M Dolores; Alzate, Luis; Gil, Ines; Urdapilleta, Gregorio; Otazua, Pedro; Emparanza, José Ignacio

2015-09-01

A cohort study of patients included in the Basque Country colorectal cancer (CRC) screening programme was carried out to assess the risk of adenomatous polyps and CRC (P-CRC) associated with HFE gene mutations, with gender and with iron biomarkers (serum ferritin (SF), iron (Fe) and transferrin saturation index (TSI)). Among 432 included patients (mean age 59.8 years), 263 were men (60.9 %) and 169 women (39.1 %). P-CRC were identified in 221 patients (51.2 %) and no polyps (NP) in 211 patients (48.8 %). HFE mutations were identified in 43.8 % of the patients. C282Y/wt genotypic frequency was 6.8 % in the P-CRC group and 1.4 % in the NP group (p < 0.05). The allelic frequency was 3.8 versus 1.2 % (p < 0.05). For laboratory, all three iron biomarkers showed a statistically significant difference: mean Fe, 91.29 ± 34 for P-CRC and 80.81 ± 30.59 for NP group. Mean TSI for P-CRC was 24.95 ± 8.90 and 22.74 ± 8.79 for NP group. Mean SF 308.09 ± 536.32 for P-CRC and 177.55 ± 159.95 for NP group. In a multivariate logistic regression analysis, only male gender (odds ratio (OR) = 2.04, 1.29-3.22), SF (OR = 1.001, 1.0004-1.003) and Fe (OR = 1.01, 1.004-1.02) were related with the presence of CRC and adenoma. Men gender and raised serum iron biomarkers increase the risk of P-CRC.

Effect of Hfe Deficiency on Memory Capacity and Motor Coordination after Manganese Exposure by Drinking Water in Mice.

Science.gov (United States)

Alsulimani, Helal Hussain; Ye, Qi; Kim, Jonghan

2015-12-01

Excess manganese (Mn) is neurotoxic. Increased manganese stores in the brain are associated with a number of behavioral problems, including motor dysfunction, memory loss and psychiatric disorders. We previously showed that the transport and neurotoxicity of manganese after intranasal instillation of the metal are altered in Hfe-deficient mice, a mouse model of the iron overload disorder hereditary hemochromatosis (HH). However, it is not fully understood whether loss of Hfe function modifies Mn neurotoxicity after ingestion. To investigate the role of Hfe in oral Mn toxicity, we exposed Hfe-knockout (Hfe (-/-)) and their control wild-type (Hfe (+/+)) mice to MnCl2 in drinking water (5 mg/mL) for 5 weeks. Motor coordination and spatial memory capacity were determined by the rotarod test and the Barnes maze test, respectively. Brain and liver metal levels were analyzed by inductively coupled plasma mass spectrometry. Compared with the water-drinking group, mice drinking Mn significantly increased Mn concentrations in the liver and brain of both genotypes. Mn exposure decreased iron levels in the liver, but not in the brain. Neither Mn nor Hfe deficiency altered tissue concentrations of copper or zinc. The rotarod test showed that Mn exposure decreased motor skills in Hfe (+/+) mice, but not in Hfe (-/-) mice (p = 0.023). In the Barns maze test, latency to find the target hole was not altered in Mn-exposed Hfe (+/+) compared with water-drinking Hfe (+/+) mice. However, Mn-exposed Hfe (-/-) mice spent more time to find the target hole than Mn-drinking Hfe (+/+) mice (p = 0.028). These data indicate that loss of Hfe function impairs spatial memory upon Mn exposure in drinking water. Our results suggest that individuals with hemochromatosis could be more vulnerable to memory deficits induced by Mn ingestion from our environment. The pathophysiological role of HFE in manganese neurotoxicity should be carefully examined in patients with HFE-associated hemochromatosis and

Factors affecting the appreciation generated through applying human factors/ergonomics (HFE) principles to systems of work.

Science.gov (United States)

So, R H Y; Lam, S T

2014-01-01

This retrospective study examined the levels of appreciation (applause) given by clients to Human Factors/Ergonomic (HFE) specialists after they have modified the systems of work. Thirteen non-academic projects were chosen because the HFE interventions involved changed the way workers work at their workplaces. Companies involved range from multi-national corporations and military organizations with thousands of employees to small trading companies with less than 10 employees. In 5 cases the HFE recommendations were fully adopted and well appreciated. In 4 they were largely ignored and not appreciated, with partial adoption and some appreciation in the other 4 cases. Three factors that predict appreciation were identified: (i) alignment between the benefits HFE can provide and the project's key performance indices; (ii) awareness of HFE among the client's senior management; and (iii) a team organization appropriate for applying HFE recommendations. Having an HFE specialist on the client's side can greatly increase levels of appreciation, but lack of such a specialist will not affect levels of appreciation. A clear contractual requirement for HFE intervention does not promote appreciation significantly, but its absence can greatly reduce levels of appreciation. These relationships are discussed using the Kano's model of quality. Means to generate greater appreciation of the benefits of HFE are discussed. Copyright © 2013 Elsevier Ltd and The Ergonomics Society. All rights reserved.

Genome-wide identification of structural variants in genes encoding drug targets

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

2012-01-01

The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

Trends in HFE Methods and Tools and Their Applicability to Safety Reviews

Energy Technology Data Exchange (ETDEWEB)

O' Hara, J.M.; Plott, C.; Milanski, J.; Ronan, A.; Scheff, S.; Laux, L.; and Bzostek, J.

2009-09-30

The U.S. Nuclear Regulatory Commission's (NRC) conducts human factors engineering (HFE) safety reviews of applicant submittals for new plants and for changes to existing plants. The reviews include the evaluation of the methods and tools (M&T) used by applicants as part of their HFE program. The technology used to perform HFE activities has been rapidly evolving, resulting in a whole new generation of HFE M&Ts. The objectives of this research were to identify the current trends in HFE methods and tools, determine their applicability to NRC safety reviews, and identify topics for which the NRC may need additional guidance to support the NRC's safety reviews. We conducted a survey that identified over 100 new HFE M&Ts. The M&Ts were assessed to identify general trends. Seven trends were identified: Computer Applications for Performing Traditional Analyses, Computer-Aided Design, Integration of HFE Methods and Tools, Rapid Development Engineering, Analysis of Cognitive Tasks, Use of Virtual Environments and Visualizations, and Application of Human Performance Models. We assessed each trend to determine its applicability to the NRC's review by considering (1) whether the nuclear industry is making use of M&Ts for each trend, and (2) whether M&Ts reflecting the trend can be reviewed using the current design review guidance. We concluded that M&T trends that are applicable to the commercial nuclear industry and are expected to impact safety reviews may be considered for review guidance development. Three trends fell into this category: Analysis of Cognitive Tasks, Use of Virtual Environments and Visualizations, and Application of Human Performance Models. The other trends do not need to be addressed at this time.

Trends in HFE Methods and Tools and Their Applicability to Safety Reviews

International Nuclear Information System (INIS)

O'Hara, J.M.; Plott, C.; Milanski, J.; Ronan, A.; Scheff, S.; Laux, L.; Bzostek, J.

2009-01-01

The U.S. Nuclear Regulatory Commission's (NRC) conducts human factors engineering (HFE) safety reviews of applicant submittals for new plants and for changes to existing plants. The reviews include the evaluation of the methods and tools (M and T) used by applicants as part of their HFE program. The technology used to perform HFE activities has been rapidly evolving, resulting in a whole new generation of HFE M and Ts. The objectives of this research were to identify the current trends in HFE methods and tools, determine their applicability to NRC safety reviews, and identify topics for which the NRC may need additional guidance to support the NRC's safety reviews. We conducted a survey that identified over 100 new HFE M and Ts. The M and Ts were assessed to identify general trends. Seven trends were identified: Computer Applications for Performing Traditional Analyses, Computer-Aided Design, Integration of HFE Methods and Tools, Rapid Development Engineering, Analysis of Cognitive Tasks, Use of Virtual Environments and Visualizations, and Application of Human Performance Models. We assessed each trend to determine its applicability to the NRC's review by considering (1) whether the nuclear industry is making use of M and Ts for each trend, and (2) whether M and Ts reflecting the trend can be reviewed using the current design review guidance. We concluded that M and T trends that are applicable to the commercial nuclear industry and are expected to impact safety reviews may be considered for review guidance development. Three trends fell into this category: Analysis of Cognitive Tasks, Use of Virtual Environments and Visualizations, and Application of Human Performance Models. The other trends do not need to be addressed at this time.

Frequency of the hemochromatosis HFE mutations C282Y, H63D, and S65C in blood donors in the Faroe Islands

DEFF Research Database (Denmark)

Milman, Nils; á Steig, Torkil; Koefoed, Pernille

2004-01-01

on the HFE gene was assessed by genotyping using the polymerase chain reaction (PCR) technique and calculated from direct allele counting. We found no C282Y homozygous subjects; 28 (14.0%) subjects were C282Y heterozygous and four subjects were C282Y/H63D compound heterozygous (2.0%). The C282Y allele......The aim of the study was to assess the frequencies of the hereditary hemochromatosis HFE mutations C282Y, H63D, and S65C in the population in the Faroe Islands. The series comprised 200 randomly selected blood donors of Faroese heritage. The frequency of the C282Y, H63D, and S65C mutations.......6%. Screening of larger groups of the Faroese population for HFE mutations especially C282Y should be considered in order to establish the penetrance....

Characteristics of gene mutation in Chinese patients with hereditary hemochromatosis

Directory of Open Access Journals (Sweden)

LYU Tingxia

2016-08-01

Full Text Available ObjectiveTo investigate the characteristics of gene mutation in Chinese patients with hereditary hemochromatosis (HH. MethodsA total of 9 patients with HH who visited Beijing Friendship Hospital, Capital Medical University from January 2013 to December 2015 were enrolled. The genomic DNA was extracted, and PCR amplification and Sanger sequencing were performed for all the exons of four genotypes of HH, i.e., HFE (type Ⅰ, HJV (type ⅡA, HAMP (type ⅡB, TFR2 (type Ⅲ, and SLC40A1 (type Ⅳ to analyze gene mutations. A total of 50 healthy subjects were enrolled as control group to analyze the prevalence of identified gene mutations in a healthy population. ResultsOf all patients, 2 had H63D mutation of HFE gene in type Ⅰ HH, 1 had E3D mutation of HJV gene in type ⅡA HH, 2 had I238M mutation of TFR2 gene in type Ⅲ HH, and 1 had IVS 3+10 del GTT splice mutation of SLC40A1 gene in type Ⅳ HH. No patients had C282Y mutation of HFE gene in type Ⅰ HH which was commonly seen in European and American populations. Five patients had no missense mutation or splice mutation. In addition, it was found in a family that a HH patient had E3D mutation of HJV gene, H63D mutation of HFE gene, and I238M mutation of TFR2 gene, but the healthy brother and sister carrying two of these mutations did not had the phenotype of HH. ConclusionHH gene mutations vary significantly across patients of different races, and non-HFE-HH is dominant in the Chinese population. There may be HH genes which are different from known genes, and further investigation is needed.

Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

Science.gov (United States)

Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

2012-09-01

Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

Science.gov (United States)

Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

[High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

Science.gov (United States)

Piscopo, Sara-Pier; Drouin, Guy

2014-05-01

Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

Differing impact of the deletion of hemochromatosis-associated molecules HFE and transferrin receptor-2 on the iron phenotype of mice lacking bone morphogenetic protein 6 or hemojuvelin.

Science.gov (United States)

Latour, Chloé; Besson-Fournier, Céline; Meynard, Delphine; Silvestri, Laura; Gourbeyre, Ophélie; Aguilar-Martinez, Patricia; Schmidt, Paul J; Fleming, Mark D; Roth, Marie-Paule; Coppin, Hélène

2016-01-01

Hereditary hemochromatosis, which is characterized by inappropriately low levels of hepcidin, increased dietary iron uptake, and systemic iron accumulation, has been associated with mutations in the HFE, transferrin receptor-2 (TfR2), and hemojuvelin (HJV) genes. However, it is still not clear whether these molecules intersect in vivo with bone morphogenetic protein 6 (BMP6)/mothers against decapentaplegic (SMAD) homolog signaling, the main pathway up-regulating hepcidin expression in response to elevated hepatic iron. To answer this question, we produced double knockout mice for Bmp6 and β2-microglobulin (a surrogate for the loss of Hfe) and for Bmp6 and Tfr2, and we compared their phenotype (hepcidin expression, Bmp/Smad signaling, hepatic and extrahepatic tissue iron accumulation) with that of single Bmp6-deficient mice and that of mice deficient for Hjv, alone or in combination with Hfe or Tfr2. Whereas the phenotype of Hjv-deficient females was not affected by loss of Hfe or Tfr2, that of Bmp6-deficient females was considerably worsened, with decreased Smad5 phosphorylation, compared with single Bmp6-deficient mice, further repression of hepcidin gene expression, undetectable serum hepcidin, and massive iron accumulation not only in the liver but also in the pancreas, the heart, and the kidneys. These results show that (1) BMP6 does not require HJV to transduce signal to hepcidin in response to intracellular iron, even if the loss of HJV partly reduces this signal, (2) another BMP ligand can replace BMP6 and significantly induce hepcidin expression in response to extracellular iron, and (3) BMP6 alone is as efficient at inducing hepcidin as the other BMPs in association with the HJV/HFE/TfR2 complex; they provide an explanation for the compensatory effect of BMP6 treatment on the molecular defect underlying Hfe hemochromatosis in mice. © 2015 by the American Association for the Study of Liver Diseases.

Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

Directory of Open Access Journals (Sweden)

Sher L Hendrickson

2010-09-01

Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

Development of a HFE program for an operating NPP: Balancing between existing design practices and human factors standards

International Nuclear Information System (INIS)

Salo, Leena; Savioja, Paula

2014-01-01

This paper describes HFE program development project conducted at a Finnish power company Fortum. The aim of developing a formal HFE program was to improve integration of human factors issues in design of technical systems and to systematically document the HFE process of the company. As Fortum has a long tradition of designing control room solutions, the starting point of the HFE program development was the existing own design practices. On the other hand, the aim was to create a program which would comply with international guidelines such as NUREG-0711. The program development was conducted by tracing the HFE design practices in an on-going I and C modernization project. This empirical work was carried out by interviews of designers and other HFE key stake holders. After the explication of the current practices, the gaps, overlaps and differences in relation to the international standards and guidelines were identified. Based on an analysis of current practices and guidelines and standards a new HFE process model was created. The design process model can be followed in modifications which concern systems with human user interfaces of any kind. The model consists of five separate phases which comply with the general engineering design process model utilized at the company. The HFE program is intended to be both a practical guide on how to take human factors issues into consideration in the design of NPP systems and also a tool for the management of HFE activities

Prevalence of C282Y and H63D mutations in the HFE gene of Brazilian individuals with clinical suspicion of hereditary hemochromatosis Prevalência das mutações C282Y e H63D no gene HFE em indivíduos brasileiros com suspeita clínica de hemocromatose hereditária

Directory of Open Access Journals (Sweden)

Alessandro C. S. Ferreira

2008-10-01

Full Text Available Classical hereditary hemochromatosis is a recessive autosomal disease related to a systemic iron overload that is frequently related to C282Y and H63D mutations in the HFE gene. In Brazil, reports on HFE gene mutation frequencies are rare, mainly in regards to a representative sample population. This study intended to determine the prevalence of C282Y and H63D mutations among individuals with clinical suspicion of hereditary hemochromatosis. A total of 1955 patients were studied with C282Y and H63D mutations being detected by the polymerase chain reaction technique followed by enzymatic restriction. The sample consisted of 76.6% men and 23.4% women. The highest percentage of analyzed individuals (56.9% was concentrated in the 41 to 60-year-old age group. Although there were no genic or genotypic differences between genders, a higher number of over 60-year-old women was observed. The C282Y mutation was found as homozygous in 2.9% of the cases and as heterozygous in 10.1%, while the H63D was homozygous in 4.3% and heterozygous in 30.6%. The C282Y and H63D mutant allele frequencies were 0.079 and 0.196, respectively. The highest frequency was observed for H63D which was in genetic equilibrium. This work is important to determine the genetic profile of the population with hereditary hemochromatosis in Brazi.A hemocromatose hereditária clássica (HH é uma doença autossômica recessiva caracterizada por uma sobrecarga sistêmica de ferro, a qual está freqüentemente relacionada às mutações C282Y e H63D no gene HFE. No Brasil, registros das freqüências das mutações no gene HFE são raros, principalmente envolvendo uma amostra representativa da população. Este estudo teve como objetivo a determinação da prevalência das mutações C282Y e H63D em indivíduos com suspeita clínica de HH. Para isto, foram estudados 1955 pacientes para os quais as mutações C282Y e H63D foram pesquisadas pela técnica de Reação em Cadeia da Polimerase

Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

Science.gov (United States)

Jordan, I K; Sutter, B A; McClure, M A

2000-01-01

Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

A highly divergent gene cluster in honey bees encodes a novel silk family.

Science.gov (United States)

Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

2006-11-01

The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

Hereditary hemochromatosis: genetic complexity and new diagnostic approaches.

NARCIS (Netherlands)

Swinkels, D.W.; Janssen, M.C.H.; Bergmans, J.; Marx, J.J.M.

2006-01-01

Since the discovery of the hemochromatosis gene (HFE) in 1996, several novel gene defects have been detected, explaining the mechanism and diversity of iron-overload diseases. At least 4 main types of hereditary hemochromatosis (HH) have been identified. Surprisingly, genes involved in HH encode for

Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

DEFF Research Database (Denmark)

Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

1995-01-01

Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

Association of mutations in the hemochromatosis gene with shorter life expectancy

DEFF Research Database (Denmark)

Bathum, L; Christiansen, L; Nybo, H

2001-01-01

BACKGROUND: To investigate whether the frequency of carriers of mutations in the HFE gene associated with hereditary hemochromatosis diminishes with age as an indication that HFE mutations are associated with increased mortality. It is of value in the debate concerning screening for hereditary...... hemochromatosis to determine the significance of heterozygosity. METHODS: Genotyping for mutations in exons 2 and 4 of the HFE gene using denaturing gradient gel electrophoresis in 1784 participants aged 45 to 100 years from 4 population-based studies: all 183 centenarians from the Danish Centenarian Study, 601...... in the distribution of mutations in exon 2 in the different age groups. CONCLUSIONS: In a high-carrier frequency population like Denmark, mutations in HFE show an age-related reduction in the frequency of heterozygotes for C282Y, which suggests that carrier status is associated with shorter life expectancy....

Escherichia coli rpiA gene encoding ribose phosphate isomerase A

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne; Maigaard, Marianne

1993-01-01

The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

Effects of deoxycycline induced lentivirus encoding FasL gene on ...

African Journals Online (AJOL)

Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

The hemochromatosis protein HFE 20 years later: An emerging role in antigen presentation and in the immune system.

Science.gov (United States)

Reuben, Alexandre; Chung, Jacqueline W; Lapointe, Réjean; Santos, Manuela M

2017-09-01

Since its discovery, the hemochromatosis protein HFE has been primarily defined by its role in iron metabolism and homeostasis, and its involvement in the genetic disease termed hereditary hemochromatosis (HH). While HH patients are typically afflicted by dysregulated iron levels, many are also affected by several immune defects and increased incidence of autoimmune diseases that have thereby implicated HFE in the immune response. Growing evidence has supported an immunological role for HFE with recent studies describing HFE specifically as it relates to MHC I antigen presentation. Here, we present a comprehensive overview of the relationship between iron metabolism, HFE, and the immune system to better understand the origin and cause of immune defects in HH patients. We further describe the role of HFE in MHC I antigen presentation and its potential to impair autoimmune responses in homeostatic conditions, a mechanism which may be exploited by tumors to evade immune surveillance. Overall, this increased understanding of the role of HFE in the immune response sets the stage for better treatment and management of HH and other iron-related diseases, as well as of the immune defects related to this condition. © 2017 The Authors. Immunity, Inflammation and Disease Published by John Wiley & Sons Ltd.

Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

Science.gov (United States)

Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

2017-11-23

The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

Science.gov (United States)

Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

1999-01-01

Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

Heat transfer and entropy generation analysis of HFE 7000 based nanorefrigerants

OpenAIRE

Helvaci, H.; Khan, Zulfiqar Ahmad

2017-01-01

In this study, two dimensional numerical simulations of forced convection flow of HFE 7000 based nanofluids in a horizontal circular tube subjected to a constant and uniform heat flux in laminar flow was performed by using single phase homogeneous model. Four different nanofluids considered in the present study are Al2O3, CuO, SiO2 and MgO nanoparticles dispersed in pure HFE 7000. The simulations were performed with particle volumetric concentrations of 0, 1, 4 and 6% and Reynolds number of 4...

Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

Science.gov (United States)

Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

2017-09-01

Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

Cloning, expression and characterisation of a novel gene encoding ...

African Journals Online (AJOL)

微软用户

2012-01-12

Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

Science.gov (United States)

Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

2014-03-05

The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

Science.gov (United States)

Grohmann, L; Brennicke, A; Schuster, W

1992-01-01

The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

NARCIS (Netherlands)

Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

1996-01-01

Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

DEFF Research Database (Denmark)

Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

2000-01-01

establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

Expression of iron-related genes in human brain and brain tumors

Directory of Open Access Journals (Sweden)

Britton Robert S

2009-04-01

Full Text Available Abstract Background Defective iron homeostasis may be involved in the development of some diseases within the central nervous system. Although the expression of genes involved in normal iron balance has been intensively studied in other tissues, little is known about their expression in the brain. We investigated the mRNA levels of hepcidin (HAMP, HFE, neogenin (NEO1, transferrin receptor 1 (TFRC, transferrin receptor 2 (TFR2, and hemojuvelin (HFE2 in normal human brain, brain tumors, and astrocytoma cell lines. The specimens included 5 normal brain tissue samples, 4 meningiomas, one medulloblastoma, 3 oligodendrocytic gliomas, 2 oligoastrocytic gliomas, 8 astrocytic gliomas, and 3 astrocytoma cell lines. Results Except for hemojuvelin, all genes studied had detectable levels of mRNA. In most tumor types, the pattern of gene expression was diverse. Notable findings include high expression of transferrin receptor 1 in the hippocampus and medulla oblongata compared to other brain regions, low expression of HFE in normal brain with elevated HFE expression in meningiomas, and absence of hepcidin mRNA in astrocytoma cell lines despite expression in normal brain and tumor specimens. Conclusion These results indicate that several iron-related genes are expressed in normal brain, and that their expression may be dysregulated in brain tumors.

Spent nuclear fuel project, Cold Vacuum Drying Facility human factors engineering (HFE) analysis: Results and findings

International Nuclear Information System (INIS)

Garvin, L.J.

1998-01-01

This report presents the background, methodology, and findings of a human factors engineering (HFE) analysis performed in May, 1998, of the Spent Nuclear Fuels (SNF) Project Cold Vacuum Drying Facility (CVDF), to support its Preliminary Safety Analysis Report (PSAR), in responding to the requirements of Department of Energy (DOE) Order 5480.23 (DOE 1992a) and drafted to DOE-STD-3009-94 format. This HFE analysis focused on general environment, physical and computer workstations, and handling devices involved in or directly supporting the technical operations of the facility. This report makes no attempt to interpret or evaluate the safety significance of the HFE analysis findings. The HFE findings presented in this report, along with the results of the CVDF PSAR Chapter 3, Hazards and Accident Analyses, provide the technical basis for preparing the CVDF PSAR Chapter 13, Human Factors Engineering, including interpretation and disposition of findings. The findings presented in this report allow the PSAR Chapter 13 to fully respond to HFE requirements established in DOE Order 5480.23. DOE 5480.23, Nuclear Safety Analysis Reports, Section 8b(3)(n) and Attachment 1, Section-M, require that HFE be analyzed in the PSAR for the adequacy of the current design and planned construction for internal and external communications, operational aids, instrumentation and controls, environmental factors such as heat, light, and noise and that an assessment of human performance under abnormal and emergency conditions be performed (DOE 1992a)

A systematic review of human factors and ergonomics (HFE)-based healthcare system redesign for quality of care and patient safety.

Science.gov (United States)

Xie, Anping; Carayon, Pascale

2015-01-01

Healthcare systems need to be redesigned to provide care that is safe, effective and efficient, and meets the multiple needs of patients. This systematic review examines how human factors and ergonomics (HFE) is applied to redesign healthcare work systems and processes and improve quality and safety of care. We identified 12 projects representing 23 studies and addressing different physical, cognitive and organisational HFE issues in a variety of healthcare systems and care settings. Some evidence exists for the effectiveness of HFE-based healthcare system redesign in improving process and outcome measures of quality and safety of care. We assessed risk of bias in 16 studies reporting the impact of HFE-based healthcare system redesign and found varying quality across studies. Future research should further assess the impact of HFE on quality and safety of care, and clearly define the mechanisms by which HFE-based system redesign can improve quality and safety of care.

Bacteriophage-encoded shiga toxin gene in atypical bacterial host

Directory of Open Access Journals (Sweden)

Casas Veronica

2011-07-01

Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

Identification and characterization of a gene encoding a putative ...

Indian Academy of Sciences (India)

2012-10-30

Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

Science.gov (United States)

Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

2016-06-28

In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

HFE C282Y/H63D Compound Heterozygotes Are at Low Risk of Hemochromatosis-Related Morbidity

OpenAIRE

Gurrin, Lyle C.; Bertalli, Nadine A.; Dalton, Gregory W.; Osborne, Nicholas J.; Constantine, Clare C.; McLaren, Christine E.; English, Dallas R.; Gertig, Dorota M.; Delatycki, Martin B.; Nicoll, Amanda J.; Southey, Melissa C.; Hopper, John L.; Giles, Graham G.; Anderson, Gregory J.; Olynyk, John K.

2009-01-01

The risk of hemochromatosis-related morbidity is unknown among HFE compound heterozygotes (C282Y/H63D). We used a prospective population-based cohort study to estimate the prevalence of elevated iron indices and hemochromatosis-related morbidity for compound heterozygotes. In all, 31,192 subjects of northern European descent were genotyped for HFE C282Y and H63D. An HFE-genotype stratified random sample of 1,438 subjects, followed for an average of 12 years to a mean age of 65 years, complete...

HFE p.C282Y homozygosity predisposes to rapid serum ferritin rise after menopause: A genotype-stratified cohort study of hemochromatosis in Australian women.

Science.gov (United States)

Warne, Charles D; Zaloumis, Sophie G; Bertalli, Nadine A; Delatycki, Martin B; Nicoll, Amanda J; McLaren, Christine E; Hopper, John L; Giles, Graham G; Anderson, Greg J; Olynyk, John K; Powell, Lawrie W; Allen, Katrina J; Gurrin, Lyle C

2017-04-01

Women who are homozygous for the p.C282Y mutation in the HFE gene are at much lower risk of iron overload-related disease than p.C282Y homozygous men, presumably because of the iron-depleting effects of menstruation and pregnancy. We used data from a population cohort study to model the impact of menstruation cessation at menopause on serum ferritin (SF) levels in female p.C282Y homozygotes, with p.C282Y/p.H63D simple or compound heterozygotes and those with neither p.C282Y nor p.H63D mutations (HFE wild types) as comparison groups. A sample of the Melbourne Collaborative Cohort Study was selected for the "HealthIron" study (n = 1438) including all HFE p.C282Y homozygotes plus a random sample stratified by HFE-genotype (p.C282Y and p.H63D). The relationship between the natural logarithm of SF and time since menopause was examined using linear mixed models incorporating spline smoothing. For p.C282Y homozygotes, SF increased by a factor of 3.6 (95% CI (1.8, 7.0), P HFE genotype groups increase more gradually and did not show a distinction between premenopausal and postmenopausal SF levels. Only p.C282Y homozygotes had predicted SF exceeding 200 μg/L postmenopause, but the projected SF did not increase the risk of iron overload-related disease. These data provide the first documented evidence that physiological blood loss is a major factor in determining the marked gender difference in expression of p.C282Y homozygosity. © 2016 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.

Transcriptional modulation of genes encoding nitrate reductase in ...

African Journals Online (AJOL)

The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

Science.gov (United States)

Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

1993-01-01

Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

2016-11-09

Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

OpenAIRE

Hays, Shan M; Swanson, Johanna; Selker, Eric U

2002-01-01

We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

NARCIS (Netherlands)

Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

Environmental cycle of antibiotic resistance encoded genes: A systematic review

Directory of Open Access Journals (Sweden)

R. ghanbari

2017-12-01

Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

Fungicidal activity of peptides encoded by immunoglobulin genes

OpenAIRE

Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

2017-01-01

Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

CSIR Research Space (South Africa)

Labuschagne, M

2007-01-01

Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

Science.gov (United States)

Laing, E; Pretorius, I S

1993-05-01

A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

NARCIS (Netherlands)

Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

1983-01-01

The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

Science.gov (United States)

Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

2017-01-01

In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

Associations of iron metabolism genes with blood manganese levels: a population-based study with validation data from animal models

Directory of Open Access Journals (Sweden)

Claus Henn Birgit

2011-11-01

Full Text Available Abstract Background Given mounting evidence for adverse effects from excess manganese exposure, it is critical to understand host factors, such as genetics, that affect manganese metabolism. Methods Archived blood samples, collected from 332 Mexican women at delivery, were analyzed for manganese. We evaluated associations of manganese with functional variants in three candidate iron metabolism genes: HFE [hemochromatosis], TF [transferrin], and ALAD [δ-aminolevulinic acid dehydratase]. We used a knockout mouse model to parallel our significant results as a novel method of validating the observed associations between genotype and blood manganese in our epidemiologic data. Results Percentage of participants carrying at least one copy of HFE C282Y, HFE H63D, TF P570S, and ALAD K59N variant alleles was 2.4%, 17.7%, 20.1%, and 6.4%, respectively. Percentage carrying at least one copy of either C282Y or H63D allele in HFE gene was 19.6%. Geometric mean (geometric standard deviation manganese concentrations were 17.0 (1.5 μg/l. Women with any HFE variant allele had 12% lower blood manganese concentrations than women with no variant alleles (β = -0.12 [95% CI = -0.23 to -0.01]. TF and ALAD variants were not significant predictors of blood manganese. In animal models, Hfe-/- mice displayed a significant reduction in blood manganese compared with Hfe+/+ mice, replicating the altered manganese metabolism found in our human research. Conclusions Our study suggests that genetic variants in iron metabolism genes may contribute to variability in manganese exposure by affecting manganese absorption, distribution, or excretion. Genetic background may be critical to consider in studies that rely on environmental manganese measurements.

The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1998-01-01

The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

ERAD defects and the HFE-H63D variant are associated with increased risk of liver damages in Alpha 1-Antitrypsin Deficiency

Science.gov (United States)

Di Martino, Julie; Ruiz, Mathias; Garin, Roman; Restier, Lioara; Belmalih, Abdelouahed; Marchal, Christelle; Cullin, Christophe; Arveiler, Benoit; Fergelot, Patricia; Gitler, Aaron D.; Lachaux, Alain; Couthouis, Julien

2017-01-01

Background The most common and severe disease causing allele of Alpha 1-Antitrypsin Deficiency (1ATD) is Z-1AT. This protein aggregates in the endoplasmic reticulum, which is the main cause of liver disease in childhood. Based on recent evidences and on the frequency of liver disease occurrence in Z-1AT patients, it seems that liver disease progression is linked to still unknown genetic factors. Methods We used an innovative approach combining yeast genetic screens with next generation exome sequencing to identify and functionally characterize the genes involved in 1ATD associated liver disease. Results Using yeast genetic screens, we identified HRD1, an Endoplasmic Reticulum Associated Degradation (ERAD) associated protein, as an inducer of Z-mediated toxicity. Whole exome sequencing of 1ATD patients resulted in the identification of two variants associated with liver damages in Z-1AT homozygous cases: HFE H63D and HERPUD1 R50H. Functional characterization in Z-1AT model cell lines demonstrated that impairment of the ERAD machinery combined with the HFE H63D variant expression decreased both cell proliferation and cell viability, while Unfolded Protein Response (UPR)-mediated cell death was hyperstimulated. Conclusion This powerful experimental pipeline allowed us to identify and functionally validate two genes involved in Z-1AT-mediated severe liver toxicity. This pilot study moves forward our understanding on genetic modifiers involved in 1ATD and highlights the UPR pathway as a target for the treatment of liver diseases associated with 1ATD. Finally, these findings support a larger scale screening for HERPUD1 R50H and HFE H63D variants in the sub-group of 1ATD patients developing significant chronic hepatic injuries (hepatomegaly, chronic cholestasis, elevated liver enzymes) and at risk developing liver cirrhosis. PMID:28617828

Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1994-01-01

Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

Horse cDNA clones encoding two MHC class I genes

Energy Technology Data Exchange (ETDEWEB)

Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

An Excel Macro to Plot the HFE-Diagram to Identify Sea Water Intrusion Phases.

Science.gov (United States)

Giménez-Forcada, Elena; Sánchez San Román, F Javier

2015-01-01

A hydrochemical facies evolution diagram (HFE-D) is a multirectangular diagram, which is a useful tool in the interpretation of sea water intrusion processes. This method note describes a simple method for generating an HFE-D plot using the spreadsheet software package, Microsoft Excel. The code was applied to groundwater from the alluvial coastal plain of Grosseto (Tuscany, Italy), which is characterized by a complex salinization process in which sea water mixes with sulfate or bicarbonate recharge water. © 2014, National GroundWater Association.

Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

International Nuclear Information System (INIS)

Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

1988-01-01

This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

International Nuclear Information System (INIS)

Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

1988-01-01

Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

Directory of Open Access Journals (Sweden)

LUCIA KUSUMAWATI

2013-09-01

Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

Science.gov (United States)

Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

Science.gov (United States)

Li, Shengjie; Bai, Junjie; Wang, Lin

2008-08-01

Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

Science.gov (United States)

Auerbach, Raymond K; Chen, Bin; Butte, Atul J

2013-08-01

Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

DEFF Research Database (Denmark)

Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

1995-01-01

The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

Directory of Open Access Journals (Sweden)

Abbas Ali Imani Fooladi

2014-02-01

Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

OpenAIRE

Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

2005-01-01

We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

Directory of Open Access Journals (Sweden)

Leontina GURGU

2012-12-01

Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

DEFF Research Database (Denmark)

Kjaerulff, S; Davey, William John; Nielsen, O

1994-01-01

We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

Detailed analysis of putative genes encoding small proteins in legume genomes

Directory of Open Access Journals (Sweden)

Gabriel eGuillén

2013-06-01

Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

Science.gov (United States)

Furlan, João Pedro Rueda; Stehling, Eliana Guedes

2018-01-10

β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

Science.gov (United States)

Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

2016-06-01

In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

Science.gov (United States)

Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

2018-03-01

Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

Directory of Open Access Journals (Sweden)

Seabra Ana R

2010-08-01

Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

International Nuclear Information System (INIS)

Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

2007-01-01

The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

Prevalence of H63D, S65C, and C282Y hereditary hemochromatosis gene variants in Madeira Island (Portugal).

Science.gov (United States)

Spínola, Carla; Brehm, António; Spínola, Hélder

2011-01-01

Hereditary HFE Hemochromatosis is an inherited disorder of iron metabolism that results from mutations in the HFE gene. Almost all patients with hereditary hemochromatosis show a C282Y mutation in homozygosity or in compound heterozygosity with H63D. Also, the mutation S65C has been shown to be associated to a milder iron overload. Since allele and genotype frequencies of these three variants of the HFE gene vary between populations, the determination of their prevalence in Madeira Island will clarify the population susceptibility to hereditary hemochromatosis. One hundred and fifty-four samples from Madeira Island were genotyped for the three most common HFE gene mutations, H63D, C282Y, and S65C, by polymerase chain reaction followed by restriction fragment length polymorphism analysis. Results have shown a prevalence of 20.5%, 0.33%, and 1% for H63D, C282Y, and S65C, respectively. Accordingly to our estimates, both genotypes associated to hereditary hemochromatosis, C282Y homozygotes and C282/H63D compound heterozygotes, could be present in Madeira Island population in 1,648 individuals, which represents 0.65% of the total population.

Variations in CCR5, but not HFE, ELMO1, or SLC12A3, are associated with susceptibility to kidney disease in north Indian individuals with type 2 diabetes.

Science.gov (United States)

Yadav, Ashok K; Kumar, Vinod; Dutta, Pinaki; Bhansali, Anil; Jha, Vivekanand

2014-11-01

Diabetic nephropathy (DN), the leading cause of end-stage renal disease worldwide, may have a genetic component. In the present study, we investigated variations in a set of genes with susceptibility to DN in a north Indian population. Four genes (HFE, ELMO1, SLC12A3, and CCR5) were selected on the basis of reported association with type 2 diabetes and nephropathy. In all, 417 diabetic subjects (215 without kidney disease [DM] and 202 with DN) and 197 healthy controls (HC) were evaluated for variations in HFE (845 G>A and 187G>C), SLC12A3 (g.34372G>A), CCR5 (59029A>G), and ELMO1 (+9170 G>A). Polymorphism analysis was performed by polymerase chain reaction-restriction fragment length polymorphism and Taqman allele discrimination assays. Significant differences were found in genotype and allelic frequency in SLC12A3 (g.34372G>A) between diabetic subjects and HC (P A (AA+GA) genotype between diabetic subjects with and without nephropathy. However, the CCR5 59029AA genotype and A allele were significantly more frequent in diabetics compared with the HC (P = 0.01 and 0.03, respectively) and subjects with DN versus DM (P = 0.002 and 0.01, respectively). For ELMO1 (+9170 G>A), the GG genotype frequency was higher in the diabetic versus HC group. There were no differences in the frequency of HFE-845 G>A and HFE-187G>C among the groups. This study shows that the CCR5 AA genotype is over-represented in subjects with kidney disease due to type 2 diabetes. The CCR5 59029G>A and ELMO1 (+9170 G>A) loci are more frequent, and the SLC12A3 34372 AA genotype is associated with a reduced risk of diabetes. © 2014 Ruijin Hospital, Shanghai Jiaotong University School of Medicine and Wiley Publishing Asia Pty Ltd.

Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

Science.gov (United States)

Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

2016-01-01

Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

Science.gov (United States)

Yusuf, Y.; Hidayati, W.

2018-01-01

The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

Directory of Open Access Journals (Sweden)

Yannick Pauchet

Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

Effects of TCDD on the expression of nuclear encoded mitochondrial genes

International Nuclear Information System (INIS)

Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

2010-01-01

Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

Science.gov (United States)

van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

1992-01-01

Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

Energy Technology Data Exchange (ETDEWEB)

Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

1990-01-01

Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

Directory of Open Access Journals (Sweden)

Clarke Robert

2006-05-01

Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

Science.gov (United States)

Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

2017-01-01

'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

HFE C282Y/H63D compound heterozygotes are at low risk of hemochromatosis-related morbidity.

Science.gov (United States)

Gurrin, Lyle C; Bertalli, Nadine A; Dalton, Gregory W; Osborne, Nicholas J; Constantine, Clare C; McLaren, Christine E; English, Dallas R; Gertig, Dorota M; Delatycki, Martin B; Nicoll, Amanda J; Southey, Melissa C; Hopper, John L; Giles, Graham G; Anderson, Gregory J; Olynyk, John K; Powell, Lawrie W; Allen, Katrina J

2009-07-01

The risk of hemochromatosis-related morbidity is unknown among HFE compound heterozygotes (C282Y/H63D). We used a prospective population-based cohort study to estimate the prevalence of elevated iron indices and hemochromatosis-related morbidity for compound heterozygotes. In all, 31,192 subjects of northern European descent were genotyped for HFE C282Y and H63D. An HFE-genotype stratified random sample of 1,438 subjects, followed for an average of 12 years to a mean age of 65 years, completed questionnaires and gave blood. Clinical examinations were blinded to HFE genotype. A total of 180 (84 males) clinically examined C282Y/H63D participants were compared with 330 (149 males) controls with neither HFE mutation; 132 (65 males) and 270 (122 males), respectively, had serum iron measures at both timepoints. Mean serum ferritin (SF) and transferrin saturation (TS) were significantly greater for male and female compound heterozygotes than for wild-types at baseline and follow-up (all P females who were premenopausal at baseline, where SF was similar in both genotype groups. For subjects with serum measures from both baseline and follow-up, mean SF and TS levels did not change significantly for men or for postmenopausal women, but for premenopausal women SF levels increased from 43 to 109 microg/L for compound heterozygotes and from 35 to 64 microg/L for wild-types (both P female compound heterozygotes had a similar prevalence of hemochromatosis-related morbidity to wild-types. One of 82 males and zero of 95 females had documented iron overload-related disease. For male compound heterozygotes, mean iron indices do not change during middle age but for female compound heterozygotes menopause results in increased mean SF. Although compound heterozygotes might maintain elevated iron indices during middle age, documented iron overload-related disease is rare.

Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

Science.gov (United States)

Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

2018-04-18

This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

NARCIS (Netherlands)

Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

2008-01-01

Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

Hereditary hemochromatosis

Directory of Open Access Journals (Sweden)

Stephen A. Geller

2015-03-01

Full Text Available Hereditary hemochromatosis (HH is the most commonly identified autosomal recessive genetic disorder in the white population, characterized by increased intestinal iron absorption and secondary abnormal accumulation in parenchymal organs, not infrequently accompanied by functional impairment. This entity is associated with mutations of the HFE gene (located on the short arm of chromosome 6 at location 6p22.2; closely linked to the HLA-A3 locus, which encodes the HFE protein, a membrane protein thought to regulate iron absorption by affecting the interaction between transferrin receptor and transferrin.

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

Science.gov (United States)

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

DEFF Research Database (Denmark)

Kovacs, J A; Powell, F; Edman, J C

1993-01-01

hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

Association between the HFE C282Y, H63D Polymorphisms and the Risks of Non-Alcoholic Fatty Liver Disease, Liver Cirrhosis and Hepatocellular Carcinoma: An Updated Systematic Review and Meta-Analysis of 5,758 Cases and 14,741 Controls

Science.gov (United States)

Yin, Wei-Li; Wang, Feng-Mei; Han, Tao

2016-01-01

Background Conflicting results have been obtained for the association between two common polymorphisms (C282Y, H63D) of human HFE (hereditary hemochromatosis) gene and the risks of the liver diseases, including non-alcoholic fatty liver disease (NAFLD), liver cirrhosis and hepatocellular carcinoma (HCC). Methods An updated systematic review and meta-analysis was conducted to evaluate the potential role of HFE polymorphisms in the susceptibility to NAFLD, liver cirrhosis and HCC. After retrieving articles from online databases, eligible studies were enrolled according to the selection criteria. Stata/SE 12.0 software was utilized to perform the statistical analysis. Results In total, 43 articles with 5,758 cases and 14,741 controls were selected. Compared with the control group, a significantly increased risk of NAFLD was observed for the C282Y polymorphism in the Caucasian population under all genetic models and for the H63D polymorphism under the allele, heterozygote and dominant models (all OR>1, PassociationHFE C282Y and H63D (all Passociation>0.05). In addition, we found that HFE C282Y was statistically associated with increased HCC susceptibility in the overall population, while H63D increased the odds of developing non-cirrhotic HCC in the African population (all OR>1, PassociationHFE C282Y and H63D polymorphisms confer increased genetic susceptibility to NAFLD and HCC but not liver cirrhosis. Additional well-powered studies are required to confirm our conclusion. PMID:27657935

WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

Science.gov (United States)

Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

2016-06-01

The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

Science.gov (United States)

Sugimura; Sawabe; Ezura

2000-01-01

The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

International Nuclear Information System (INIS)

Nebohacova, M.

2000-01-01

Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

Directory of Open Access Journals (Sweden)

B Kazemi

2009-12-01

Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

Directory of Open Access Journals (Sweden)

Nordlund Henri R

2005-03-01

Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

Science.gov (United States)

Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

2011-10-07

Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

Directory of Open Access Journals (Sweden)

Bertin Stéphane

2011-10-01

Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

Science.gov (United States)

Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

2011-03-01

Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

Directory of Open Access Journals (Sweden)

Alimuddin Alimuddin

2008-12-01

Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

Science.gov (United States)

This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

DEFF Research Database (Denmark)

Christensen, P U; Davey, William John; Nielsen, O

1997-01-01

In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

[Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

Science.gov (United States)

Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

2016-12-04

Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

Science.gov (United States)

Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

2016-02-17

Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

Science.gov (United States)

Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

2012-07-10

The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

Science.gov (United States)

Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

1997-06-01

Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

NARCIS (Netherlands)

Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

2000-01-01

We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

International Nuclear Information System (INIS)

Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

1990-01-01

The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

Directory of Open Access Journals (Sweden)

Jie Lei

2018-03-01

Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

DEFF Research Database (Denmark)

Kristensen, Michael; Lok, Finn; Planchot, Véronique

1999-01-01

with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

Science.gov (United States)

Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

2015-09-01

Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

Science.gov (United States)

Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

2016-01-01

Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Typing of Panton-Valentine Leukocidin-encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China

Directory of Open Access Journals (Sweden)

Huanqiang Zhao

2016-08-01

Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

Directory of Open Access Journals (Sweden)

Baiquan Ma

2015-11-01

Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

Science.gov (United States)

Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

2007-09-01

The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

Science.gov (United States)

Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

1994-05-03

Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

Maternal hemochromatosis gene H63D single-nucleotide polymorphism and lead levels of placental tissue, maternal and umbilical cord blood

Energy Technology Data Exchange (ETDEWEB)

Kayaalti, Zeliha, E-mail: kayaalti@ankara.edu.tr [Ankara University, Institute of Forensic Sciences, Ankara (Turkey); Kaya-Akyüzlü, Dilek [Ankara University, Institute of Forensic Sciences, Ankara (Turkey); Söylemez, Esma [Ankara University, Institute of Forensic Sciences, Ankara (Turkey); Middle Black Sea Passage Generation of Agricultural Research Station Director, Tokat (Turkey); Söylemezoğlu, Tülin [Ankara University, Institute of Forensic Sciences, Ankara (Turkey)

2015-07-15

Human hemochromatosis protein (HFE), a major histocompatibility complex class I-like integral membrane protein, participates in the down regulation of intestinal iron absorption by binding to transferrin receptor (TR). HFE competes with transferrin-bound iron for the TR and thus reduces uptake of iron into cells. On the other hand, a lack of HFE increases the intestinal absorption of iron similarly to iron deficiency associated with increasing in absorption and deposition of lead. During pregnancy, placenta cannot prevent transfer lead to the fetus; even low-level lead poisoning causes neurodevelopmental toxicity in children. The aim of this study was to determine the association between the maternal HFE H63D single-nucleotide polymorphism and lead levels in placental tissue, maternal blood and umbilical cord bloods. The study population comprised 93 mother–placenta pairs. Venous blood from mother was collected to investigate lead levels and HFE polymorphism that was detected by standard PCR–RFLP technique. Cord bloods and placentas were collected for lead levels which were analyzed by dual atomic absorption spectrometer system. The HFE H63D genotype frequencies of mothers were found as 75.3% homozygote typical (HH), 23.6% heterozygote (HD) and 1.1% homozygote atypical (DD). Our study results showed that the placental tissue, umbilical cord and maternal blood lead levels of mothers with HD+DD genotypes were significantly higher than those with HH genotype (p<0.05). The present study indicated for the first time that mothers with H63D gene variants have higher lead levels of their newborn's placentas and umbilical cord bloods. - Highlights: • Mothers with H63D gene variants have higher lead levels of their newborn's umbilical cord blood. • Unborn child of women with HD+DD genotypes may be at increased risk of internal exposure to lead. • Maternal HFE status may have an effect on increased placenta, maternal and cord blood lead levels. �

Maternal hemochromatosis gene H63D single-nucleotide polymorphism and lead levels of placental tissue, maternal and umbilical cord blood

International Nuclear Information System (INIS)

Kayaalti, Zeliha; Kaya-Akyüzlü, Dilek; Söylemez, Esma; Söylemezoğlu, Tülin

2015-01-01

Human hemochromatosis protein (HFE), a major histocompatibility complex class I-like integral membrane protein, participates in the down regulation of intestinal iron absorption by binding to transferrin receptor (TR). HFE competes with transferrin-bound iron for the TR and thus reduces uptake of iron into cells. On the other hand, a lack of HFE increases the intestinal absorption of iron similarly to iron deficiency associated with increasing in absorption and deposition of lead. During pregnancy, placenta cannot prevent transfer lead to the fetus; even low-level lead poisoning causes neurodevelopmental toxicity in children. The aim of this study was to determine the association between the maternal HFE H63D single-nucleotide polymorphism and lead levels in placental tissue, maternal blood and umbilical cord bloods. The study population comprised 93 mother–placenta pairs. Venous blood from mother was collected to investigate lead levels and HFE polymorphism that was detected by standard PCR–RFLP technique. Cord bloods and placentas were collected for lead levels which were analyzed by dual atomic absorption spectrometer system. The HFE H63D genotype frequencies of mothers were found as 75.3% homozygote typical (HH), 23.6% heterozygote (HD) and 1.1% homozygote atypical (DD). Our study results showed that the placental tissue, umbilical cord and maternal blood lead levels of mothers with HD+DD genotypes were significantly higher than those with HH genotype (p<0.05). The present study indicated for the first time that mothers with H63D gene variants have higher lead levels of their newborn's placentas and umbilical cord bloods. - Highlights: • Mothers with H63D gene variants have higher lead levels of their newborn's umbilical cord blood. • Unborn child of women with HD+DD genotypes may be at increased risk of internal exposure to lead. • Maternal HFE status may have an effect on increased placenta, maternal and cord blood lead levels. �

Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

Directory of Open Access Journals (Sweden)

Nadja Knoll

Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

OpenAIRE

Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

1994-01-01

Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

Directory of Open Access Journals (Sweden)

Muscariello Lidia

2006-05-01

Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

Science.gov (United States)

Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

2016-10-01

Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

Directory of Open Access Journals (Sweden)

Bingzhi Chen

Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

Directory of Open Access Journals (Sweden)

Borchardt Stephanie M

2006-07-01

Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

Loss of Hfe Leads to Progression of Tumor Phenotype in Primary Retinal Pigment Epithelial Cells

Science.gov (United States)

Gnana-Prakasam, Jaya P.; Veeranan-Karmegam, Rajalakshmi; Coothankandaswamy, Veena; Reddy, Sushma K.; Martin, Pamela M.; Thangaraju, Muthusamy; Smith, Sylvia B.; Ganapathy, Vadivel

2013-01-01

Purpose. Hemochromatosis is a disorder of iron overload arising mostly from mutations in HFE. HFE is expressed in retinal pigment epithelium (RPE), and Hfe−/− mice develop age-related iron accumulation and retinal degeneration associated with RPE hyperproliferation. Here, the mechanism underlying the hyperproliferative phenotype in RPE was investigated. Methods. Cellular senescence was monitored by β-galactosidase activity. Gene expression was monitored by real-time PCR. Survivin was analyzed by Western blot and immunofluorescence. Migration and invasion were monitored using appropriate kits. Glucose transporters (GLUTs) were monitored by 3-O-methyl-D-glucose uptake. Histone deacetylases (HDACs) were studied by monitoring catalytic activity and acetylation status of histones H3/H4. Results. Hfe−/− RPE cells exhibited slower senescence rate and higher survivin expression than wild type cells. Hfe−/− cells migrated faster and showed greater glucose uptake and increased expression of GLUTs. The expression of HDACs and DNA methyltransferase (DNMTs) also was increased. Similarly, RPE cells from hemojuvelin (Hjv)-knockout mice, another model of hemochromatosis, also had increased expression of GLUTs, HDACs, and DNMTs. The expression of Slc5a8 was decreased in Hfe−/− RPE cells, but treatment with a DNA methylation inhibitor restored the transporter expression, indicating involvement of DNA methylation in the silencing of Slc5a8 in Hfe−/− cells. Conclusions. RPE cells from iron-overloaded mice exhibit several features of tumor cells: decreased senescence, enhanced migration, increased glucose uptake, and elevated levels of HDACs and DNMTs. These features are seen in Hfe−/− RPE cells as well as in Hjv−/− RPE cells, providing a molecular basis for the hyperproliferative phenotype of Hfe−/− and Hjv−/− RPE cells. PMID:23169885

Risk factors for development of dementia in a unique six-year cohort study. I. An exploratory, pilot study of involvement of the E4 allele of apolipoprotein E, mutations of the hemochromatosis-HFE gene, type 2 diabetes, and stroke.

Science.gov (United States)

Percy, Maire; Somerville, Martin J; Hicks, Mark; Garcia, Angeles; Colelli, Teresa; Wright, Emily; Kitaygorodsky, Julia; Jiang, Amy; Ho, Valerie; Parpia, Alyssa; Wong, Michael K

2014-01-01

Risk factors for dementia development are not well-defined. We evaluated several factors alone and in combination in a unique cohort of Caucasian volunteers over an approximately 6-year observation window using a nested case/control design. Factors included: apolipoprotein E (ApoE) gene variants (the E4 allele is the strongest confirmed genetic predisposing factor for Alzheimer's disease), the hemochromatosis-HFE gene mutations (H63D and C282Y), diabetes, and stroke. At study entry, subjects were ≥65 years of age (M ± SD = 73.0 ± 4.9), had an MMSE score ≥24, and no evidence of cerebrovascular disease or current depression. Genotyping was completed on 163 available DNA samples from three different groups at the study end: those who still had normal cognitive function; those who had developed dementia; and those with Mild Cognitive Impairment (MCI). Analyses were interpreted at the 95% confidence level without Bonferroni corrections. In the subgroup with dementia, all cases of diabetes were type 2 and present at study entry, whereas all strokes occurred during the study. The results highlight apparently synergistic interactions between genetic and medical risk factors for dementia development, gender differences in risk factors, and involvement of HFE mutations. Having E4 (i.e., either of E3/4 or E4/4), C282Y, H63D, diabetes, or stroke alone did not attain significance. Significant predisposing factors with post-hoc power ≥80% were: E4 homozygosity (E4/4)males+females, odds ratio (OR) = 56.0); E4+diabetes (males+females, OR = 13.7; E4+H63D+diabetes (females, OR = 52.0); E4+stroke (males, OR = 46.5). The importance of preventing diabetes and stroke to ward off dementia and the possible role of iron dysmetabolism in dementia are discussed.

Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

International Nuclear Information System (INIS)

Woloschak, G.E.; Chang-Liu, Chin-Mei

1994-01-01

Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

Science.gov (United States)

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

Directory of Open Access Journals (Sweden)

Berkhout Ben

2006-12-01

Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

Science.gov (United States)

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

DEFF Research Database (Denmark)

Abildgaard, L; Engberg, RM; Pedersen, Karl

2009-01-01

The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

International Nuclear Information System (INIS)

Hayat, S.; Cheng, Z.; Chen, X.

2016-01-01

The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

Directory of Open Access Journals (Sweden)

Ghaffari Novin M.

2015-06-01

Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

Directory of Open Access Journals (Sweden)

Jacqueline Schmuckli-Maurer

Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

Using iron studies to predict HFE mutations in New Zealand: implications for laboratory testing.

Science.gov (United States)

O'Toole, Rebecca; Romeril, Kenneth; Bromhead, Collette

2017-04-01

The diagnosis of hereditary haemochromatosis (HH) is not straightforward because symptoms are often absent or non-specific. Biochemical markers of iron-overloading may be affected by other conditions. To measure the correlation between iron studies and HFE genotype to inform evidence-based recommendations for laboratory testing in New Zealand. Results from 2388 patients genotyped for C282Y, H63D and S65C in Wellington, New Zealand from 2007 to 2013 were compared with their biochemical phenotype as quantified by serum ferritin (SF), transferrin saturation (TS), serum iron (SI) and serum transferrin (ST). The predictive power of these markers was evaluated by receiver operator characteristic (ROC) curve analysis, and if a statistically significant association for a variable was seen, sensitivity, specificity and predictive values were calculated. Test ordering patterns showed that 62% of HFE genotyping tests were ordered because of an elevated SF alone and only 11% of these had a C-reactive protein test to rule out an acute phase reaction. The association between SF and significant HFE genotypes SF was low. However, TS values ≥45% predicted HH mutations with the highest sensitivity and specificity. A SF of >1000 µg/L was found in one at-risk patient (C282Y homozygote) who had a TS <45%. Our analysis highlights the need for clear guidelines for investigation of hyperferritinaemia and HH in New Zealand. Using our findings, we developed an evidence-based laboratory testing algorithm based on a TS ≥45%, a SF ≥1000 µg/L and/or a family history of HH which identified all C282Y homozygotes in this study. © 2016 Royal Australasian College of Physicians.

Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

2017-01-01

The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

An evolutionarily conserved gene family encodes proton-selective ion channels.

Science.gov (United States)

Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

2018-03-02

Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

Science.gov (United States)

Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

1992-01-01

Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

Directory of Open Access Journals (Sweden)

Bryan D Moyer

Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

Directory of Open Access Journals (Sweden)

Kouji Shimoda

2002-01-01

Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

Investigation of the role of genes encoding zinc exporters zntA, zitB, and fieF during Salmonella typhimurium infection

DEFF Research Database (Denmark)

Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.

2018-01-01

The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...

Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

Science.gov (United States)

Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

Science.gov (United States)

Pyne, C; Bognar, A L

1992-03-01

The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

Science.gov (United States)

Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

2017-12-26

The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

Hemochromatosis C282Y gene mutation as a potential susceptibility ...

African Journals Online (AJOL)

G.M. Mokhtar

2017-08-12

Aug 12, 2017 ... Background: Hereditary hemochromatosis is the most frequent cause of primary iron overload that is associated with HFE gene's mutation especially the C282Y mutation. The interaction between hemoglo- bin chain synthesis' disorders and the C282Y mutation may worsen the clinical picture of beta-.

Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

Science.gov (United States)

Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

2013-01-01

The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

Directory of Open Access Journals (Sweden)

Linda J Savage

Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

NARCIS (Netherlands)

Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

2015-01-01

Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

Effect of Hereditary Hemochromatosis Gene H63D and C282Y Mutations on Iron Overload in Sickle Cell Disease Patients

Directory of Open Access Journals (Sweden)

Yunus Kasım Terzi

2016-12-01

Full Text Available Objective: Hemochromatosis is an autosomal recessive disease that is one of the most important reasons for iron overload. Sickle cell disease is a hemoglobinopathy that occurs as a result of a homozygous mutation in the hemoglobin gene. Erythrocyte transfusion is frequently used in the treatment of this disease. Iron overload as a result of transfusion is important in the mortality and morbidity of sickle cell anemia patients as well as in other hemoglobinopathies. In this study, the effect of hemochromatosis gene (HFE p.H63D and p.C282Y mutations on transfusion-related cardiac and liver iron overload in sickle cell disease patients who carry homozygous hemoglobin S mutation has been investigated. Materials and Methods: This is a prospective single-center crosssectional study in patients with homozygous hemoglobin S mutation between the years 2008 and 2013. The patients were divided into two groups. The first group (group A, n=31 was receiving chelation therapy and the second group (group B, n=13 was not. Direct and indirect iron loads were analyzed by magnetic resonance imaging and biochemically, respectively. HFE gene mutations were analyzed by polymerase chain reaction-restriction fragment length polymorphism method. Statistical analyses were performed by independent samples t-test. Results: p.H63D mutation was detected in 10 (32.3% patients in group A and in only 1 patient (7.7% in group B. When the 2 groups were compared for iron overload, iron deposition in the liver was significantly higher in group B (p=0.046. In addition, in group A, iron deposition was significantly higher in HFE mutation carriers compared to patients without the mutation (p=0.05. Conclusion: Results of this study showed that HFE gene mutations are important in iron deposition in the liver in patients with sickle cell disease.

Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

NARCIS (Netherlands)

Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

A study on the functions of ubiquitin metabolic system related gene FBG2 in gastric cancer cell line

Directory of Open Access Journals (Sweden)

Wu Benyan

2009-06-01

Full Text Available Abstract Background FBG2 (F-BOX6 gene is an important member in ubiquitin metabolic system F-BOX family, and forms E3 complex with the other members in the family. But its role in gastric cancer is still not clear. In the present study, we intended to investigate the influence of FBG2 on the growth, proliferation, apoptosis, invasion and cell cycle of the gastric cancer line MKN45 and gastric cell line HFE145. Methods As a critical component of ubiquitin-protein ligase complex, FBG2 cDNA was subcloned into a constitutive vector PCDNA3.1 followed by transfection in MKN45 and HFE145 by using liposome. Then stable transfectants were selected and appraised. The apoptosis and cell cycles of these clones were analyzed by using flow cytometry. The growth and proliferation were analyzed by cell growth curves and colony-forming assay respectively. The invasion of these clones was tested by using cancer cell migration assay. The FBG2 stable expression clones(MKN-FBG2 and HFE-FBG2 and their control groups were detected and compared respectively. Results MKN-FBG2 grew faster than MKN45 and MKN-PC(MKN45 transfected with PCDNA3.1 vector. HFE-FBG2 grew faster than HFE145 and HFE-PC(HFE145 transfected with PCDNA3.1 vector. The cell counts of MKN-FBG2 in the forth, fifth, sixth and seventh days were significantly more than those of others (P Conclusion FBG2 can promote the growth and proliferation of gastric cancer cells and normal gastric cells. It can help tumor cell maintain malignant phenotype too. But it can have a negative influence on the apoptosis or the ability of invasion of gastric cancer cells.

Detection, Characterization, and In Vitro and In Vivo Expression of Genes Encoding S-Proteins in Lactobacillus gallinarum Strains Isolated from Chicken Crops

Science.gov (United States)

Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.

2005-01-01

Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691

Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

Science.gov (United States)

Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

2004-10-01

The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

Molecular Diagnostic and Pathogenesis of Hereditary Hemochromatosis

Directory of Open Access Journals (Sweden)

Paulo C. J. L. Santos

2012-02-01

Full Text Available Hereditary hemochromatosis (HH is an autosomal recessive disorder characterized by enhanced intestinal absorption of dietary iron. Without therapeutic intervention, iron overload leads to multiple organ damage such as liver cirrhosis, cardiomyopathy, diabetes, arthritis, hypogonadism and skin pigmentation. Most HH patients carry HFE mutant genotypes: homozygosity for p.Cys282Tyr or p.Cys282Tyr/p.His63Asp compound heterozygosity. In addition to HFE gene, mutations in the genes that encode hemojuvelin (HJV, hepcidin (HAMP, transferrin receptor 2 (TFR2 and ferroportin (SLC40A1 have been associated with regulation of iron homeostasis and development of HH. The aim of this review was to identify the main gene mutations involved in the pathogenesis of type 1, 2, 3 and 4 HH and their genetic testing indication. HFE testing for the two main mutations (p.Cys282Tyr and p.His63Asp should be performed in all patients with primary iron overload and unexplained increased transferrin saturation and/or serum ferritin values. The evaluation of the HJV p.Gly320Val mutation must be the molecular test of choice in suspected patients with juvenile hemochromatosis with less than 30 years and cardiac or endocrine manifestations. In conclusion, HH is an example that genetic testing can, in addition to performing the differential diagnostic with secondary iron overload, lead to more adequate and faster treatment.

A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

DEFF Research Database (Denmark)

Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel

2016-01-01

genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

Science.gov (United States)

Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

2015-01-01

This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

Science.gov (United States)

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2014-12-12

The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

Directory of Open Access Journals (Sweden)

Meng Sun

2014-12-01

Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

OpenAIRE

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2014-01-01

The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

Directory of Open Access Journals (Sweden)

Ashley L Waldron

Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

NARCIS (Netherlands)

van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

1991-01-01

Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

Science.gov (United States)

Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

1994-09-01

The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

Directory of Open Access Journals (Sweden)

Yuepeng eHan

2015-04-01

Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

Loss of functional K+ channels encoded by ether-à-go-go-related genes in mouse myometrium prior to labour onset

Science.gov (United States)

Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S

2009-01-01

There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483

Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

Directory of Open Access Journals (Sweden)

Catalina Sanz

Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

Association between the HFE C282Y, H63D Polymorphisms and the Risks of Non-Alcoholic Fatty Liver Disease, Liver Cirrhosis and Hepatocellular Carcinoma: An Updated Systematic Review and Meta-Analysis of 5,758 Cases and 14,741 Controls.

Directory of Open Access Journals (Sweden)

Qing Ye

Full Text Available Conflicting results have been obtained for the association between two common polymorphisms (C282Y, H63D of human HFE (hereditary hemochromatosis gene and the risks of the liver diseases, including non-alcoholic fatty liver disease (NAFLD, liver cirrhosis and hepatocellular carcinoma (HCC.An updated systematic review and meta-analysis was conducted to evaluate the potential role of HFE polymorphisms in the susceptibility to NAFLD, liver cirrhosis and HCC. After retrieving articles from online databases, eligible studies were enrolled according to the selection criteria. Stata/SE 12.0 software was utilized to perform the statistical analysis.In total, 43 articles with 5,758 cases and 14,741 controls were selected. Compared with the control group, a significantly increased risk of NAFLD was observed for the C282Y polymorphism in the Caucasian population under all genetic models and for the H63D polymorphism under the allele, heterozygote and dominant models (all OR>1, Passociation0.05. In addition, we found that HFE C282Y was statistically associated with increased HCC susceptibility in the overall population, while H63D increased the odds of developing non-cirrhotic HCC in the African population (all OR>1, Passociation<0.05. Moreover, a positive association between compound heterozygosity for C282Y/H63D and the risk of NAFLD and HCC, but not liver cirrhosis, was observed.Our meta-analysis provides evidence that the HFE C282Y and H63D polymorphisms confer increased genetic susceptibility to NAFLD and HCC but not liver cirrhosis. Additional well-powered studies are required to confirm our conclusion.

RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

International Nuclear Information System (INIS)

Reynolds, P.; Weber, S.; Prakash, L.

1985-01-01

The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

DEFF Research Database (Denmark)

Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

2004-01-01

Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....

AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

Science.gov (United States)

Lu, Y P; Li, Z S; Rea, P A

1997-07-22

Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

Science.gov (United States)

Kim, K S; Farrand, S K

1996-06-01

Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.

The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

Directory of Open Access Journals (Sweden)

Elías Trujillo-Esquivel

2017-09-01

Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

DEFF Research Database (Denmark)

Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

2015-01-01

at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

THE EFFECT OF HAEMOCHROMATOSIS MUTATION ON IRON OVERLOAD IN THALASSAEMIA MAJOR PATIENTS

Directory of Open Access Journals (Sweden)

Tapas Ranjan Behera

2016-11-01

Full Text Available BACKGROUND Haemochromatosis is a genetic form of iron overload due to a defective HFE gene. Secondary iron overload is the main complication in transfusion-dependent thalassaemia major patients. This study aims at evaluating the degree of iron overload in β-thalassaemia major patients with and without HFE mutations (C282Y, H63D and S65C. MATERIALS AND METHODS A descriptive observational study was conducted including fifty diagnosed -thalassaemia major cases. Detailed clinical history and iron profile was estimated. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS After DNA analysis of all the thalassaemia major cases, two groups were identified, one with HFE gene mutation and other without HFE gene mutation. Iron profile of both the groups (with and without HFE gene mutation was estimated and compared. Only H63D mutation (out of three HFE gene mutations was detected in 16% cases (8 out of 50 cases, which comprised the group with mutation. Comparison of iron parameters between two groups (with and without HFE gene mutation showed significant difference in percent transferrin saturation (p=0.02, while other iron parameters (serum iron and serum ferritin did not show significant difference. CONCLUSION No significant difference between serum ferritin values (a marker of iron overload of groups with and without mutation (mean ferritin level 4641±2166 ng/mL and 4170±2461 ng/mL, respectively was found (p=0.61, in a patient population in whom transfusion protocol and proper chelation regimen was followed.

Lack of association of C282Y and H63D mutations in the hemochromatosis (HFE) gene with diabetes mellitus type 2 in a case-control study of women in Brazil.

Science.gov (United States)

Gomes, K B; Carvalho, M G; Coelho, F F; Rodrigues, I F; Soares, A L; Guimarães, D A; Fernandes, A P

2009-10-27

Hereditary hemochromatosis is one of the most common autosomal recessive diseases; it is characterized by excess absorption of iron. Clinically, the major challenge is to diagnose increased iron deposition before irreversible tissue damage has occurred. C282Y and H63D are the main mutations related to hereditary hemochromatosis; these mutations have been reported to be associated with increased risk of developing diabetes mellitus type 2 (DM2). We investigated whether these mutations are associated with increased risk for the development of DM2 in women in Brazil. Seventy-two women with clinical diagnosis of DM2 under treatment with hypoglycemic agents and a control group composed of 72 women with no clinical history of diabetes were studied. The C282Y and H63D mutations were determined by PCR-RFLP. Significant differences were not observed for C282Y and H63D, when we compared diabetic and non-diabetic women. We suggest that mutations C282Y and H63D in the HFE gene are not significant risk factors for the development of DM2 in Brazilian women.

Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

Science.gov (United States)

Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

2002-05-25

All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

Science.gov (United States)

Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

2012-01-01

We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

[Effect of melafen on expression of Elip1 and Elip2 genes encoding chloroplast light-induced stress proteins in barley].

Science.gov (United States)

Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P

2008-01-01

The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.

Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei)

NARCIS (Netherlands)

Stricker, A.R.; Mach, R.L.; Graaff, de L.H.

2008-01-01

The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.

Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

Directory of Open Access Journals (Sweden)

Aris Haryanto

2016-01-01

Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

Directory of Open Access Journals (Sweden)

Lukasz Michal Szafron

Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

Science.gov (United States)

Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

2015-01-01

For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

Transcriptome Analysis Revealed Highly Expressed Genes Encoding Secondary Metabolite Pathways and Small Cysteine-Rich Proteins in the Sclerotium of Lignosus rhinocerotis.

Directory of Open Access Journals (Sweden)

Hui-Yeng Y Yap

Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.

The IRC7 gene encodes cysteine desulphydrase activity and confers on yeast the ability to grow on cysteine as a nitrogen source.

Science.gov (United States)

Santiago, Margarita; Gardner, Richard C

2015-07-01

Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.

Biosynthesis of actinorhodin and related antibiotics: discovery of alternative routes for quinone formation encoded in the act gene cluster.

Science.gov (United States)

Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji

2009-02-27

All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.

Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

You Wanhui

2012-04-01

Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

Open reading frame 176 in the photosynthesis gene cluster of Rhodobacter capsulatus encodes idi, a gene for isopentenyl diphosphate isomerase.

OpenAIRE

Hahn, F M; Baker, J A; Poulter, C D

1996-01-01

Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...

Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

Science.gov (United States)

Tornow, J; Santangelo, G M

1994-06-01

A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

Promoter for the late gene encoding Vp5 of herpes simplex virus type 1 is recognized by cell extracts derived from uninfected cells

International Nuclear Information System (INIS)

Chisholm, G.E.; Summers, W.C.

1986-01-01

The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters

The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds

NARCIS (Netherlands)

Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.

2002-01-01

The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.

Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

Science.gov (United States)

van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

2016-01-01

Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

NARCIS (Netherlands)

Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

2006-01-01

Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

Directory of Open Access Journals (Sweden)

Řičicová Markéta

2010-04-01

Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

The KL24 gene cluster and a genomic island encoding a Wzy polymerase contribute genes needed for synthesis of the K24 capsular polysaccharide by the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51.

Science.gov (United States)

Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

2017-03-01

The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.

Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide.

Science.gov (United States)

Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K

2016-06-01

The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.

Hereditary Hemochromatosis

Science.gov (United States)

... hemochromatosis occurs when a child inherits a mutated HFE gene from his or her parents. This mutated gene ... a special test to look for an abnormal HFE gene. This test would tell their doctor if they ...

Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

Science.gov (United States)

Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

2003-08-01

ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

Science.gov (United States)

Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

2011-01-01

Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

The number of genes encoding repeat domain-containing proteins positively correlates with genome size in amoebal giant viruses

Science.gov (United States)

Shukla, Avi; Chatterjee, Anirvan

2018-01-01

Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275

Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

International Nuclear Information System (INIS)

Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

1988-01-01

Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

Directory of Open Access Journals (Sweden)

Mignon A Keaton

2011-03-01

Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

White blood cells and subtypes in HFE p.C282Y and wild-type homozygotes in the Hemochromatosis and Iron Overload Screening Study.

Science.gov (United States)

Barton, James C; Barton, J Clayborn; Acton, Ronald T

2017-03-01

The major histocompatibility complex is linked to white blood cell (WBC) and lymphocyte counts in subjects unselected for HFE genotypes. We compared age, sex, body mass index, total WBC and subtypes (neutrophils, lymphocytes, monocytes, eosinophils, basophils) (Beckman Coulter® Gen-S), transferrin saturation, and serum ferritin of HFE p.C282Y and wild-type (p.C282Y, p.H63D negative) homozygotes without acquired conditions that influence WBC counts. We performed regressions on WBC and subtypes. There were 161 p.C282Y homozygotes (45.3% men) and 221 wild-type homozygotes (40.3% men). Mean WBC of men and women and between HFE genotypes were similar. Mean lymphocytes were higher in male p.C282Y homozygotes: 1.6×10 9 /L [95% confidence interval: 1.5,1.7] vs. 1.4 [1.3,1.5], p=0.0002. Mean lymphocytes and basophils were higher in female p.C282Y homozygotes: 1.6 [1.5,1.7] vs. 1.4 [1.3,1.5], p=0.0002; and 0.065 [0.059,0.071] vs. 0.052 [0.051,0.054], p=0.0001, respectively. Transferrin saturation was associated with neutrophils (negative; p=0.0163). Age was associated with lymphocytes (negative; p=0.0003) and monocytes (positive; p<0.0001). Regressions on lymphocytes and basophils revealed positive associations with p.C282Y homozygosity (p=0.0043 and 0.0003, respectively). There were significant positive associations of neutrophils, lymphocytes, monocytes, and eosinophils. We conclude that HFE p.C282Y homozygosity is significantly associated with lymphocyte and basophil counts. Copyright © 2016 Elsevier Inc. All rights reserved.

The ArcD1 and ArcD2 arginine/ornithine exchangers encoded in the arginine deiminase (ADI) pathway gene cluster of Lactococcus lactis

NARCIS (Netherlands)

Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S

2015-01-01

The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of

A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

Science.gov (United States)

Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

2015-07-01

The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.

Science.gov (United States)

O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe

2013-01-01

Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.

The ANGULATA7 gene encodes a DnaJ-like zinc finger-domain protein involved in chloroplast function and leaf development in Arabidopsis.

Science.gov (United States)

Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis

2017-03-01

The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Cloning an artificial gene encoding angiostatic anginex: From designed peptide to functional recombinant protein

International Nuclear Information System (INIS)

Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.

2005-01-01

Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach

The Correlation of Cardiac and Hepatic Hemosiderosis as Measured by T2*MRI Technique with Ferritin Levels and Hemochromatosis Gene Mutations in Iranian Patients with Beta Thalassemia Major

Directory of Open Access Journals (Sweden)

Mohammad Soleiman Soltanpour

2018-01-01

Full Text Available Objectives: Organ-specific hemosiderosis and iron overload complications are more serious and more frequent in some patients with beta thalassemia major (BTM compared with others. We investigated whether coinheritance of HFE H63D or C282Y gene mutations in patients with BTM contributes to the phenotypic variation of iron overload complications and assessed the correlation of cardiac and hepatic hemosiderosis with plasma ferritin levels. Methods: We studied 60 patients with BTM with a mean age of 17.5±9.1 years from the Northwest of Iran. HFE gene mutations were analyzed using the polymerase chain reaction-restriction fragment length polymorphism method. Cardiac and hepatic hemosiderosis was assessed using T2*magnetic resonance imaging (MRI. Ferritin levels were measured using the enzyme immunoassay method. Results: Ferritin levels showed a strong inverse correlation with hepatic T2*MRI values (r = -0.631, p = 0.001 but a poor correlation with cardiac T2*MRI values (r = -0.297, p = 0.044. The correlation between cardiac T2*MRI values and hepatic T2*MRI values was poor and insignificant (r = 0.287, p = 0.058. Genotype and allele distribution of HFE H63D and C282Y mutation did not differ significantly between patients with and without hepatic or cardiac hemosiderosis (p > 0.050. However, carriers of HFE 63D allele had significantly higher ferritin levels compared with non-carriers (1 903±993 vs. 992±683, p < 0.001. Conclusions: Cardiac T2*MRI values showed a poor correlation with hepatic T2*MRI values and ferritin levels. Accurate assessment of cardiac iron overload in patients with BTM can only be done using the T2*MRI technique. Additionally, HFE H63D is a significant determinant factor for elevated ferritin levels in BTM patients.

aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

Directory of Open Access Journals (Sweden)

Tuffery Pierre

2009-12-01

Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera,Apidae

Directory of Open Access Journals (Sweden)

Moysés Elias-Neto

2013-06-01

Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.

Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

Directory of Open Access Journals (Sweden)

Utut Widyastuti Suharsono

2008-11-01

Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene.

Science.gov (United States)

Sudagidan, Mert; Aydin, Ali

2010-04-15

In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.

MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

Science.gov (United States)

Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

2006-01-24

Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

The short mRNA isoform of the immunoglobulin superfamily, member 1 gene encodes an intracellular glycoprotein.

Directory of Open Access Journals (Sweden)

Ying Wang

Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.

Cloning of araA Gene Encoding L-Arabinose Isomerase from Marine Geobacillus stearothermophilus Isolated from Tanjung Api, Poso, Indonesia

Directory of Open Access Journals (Sweden)

DEWI FITRIANI

2010-06-01

Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.

Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

OpenAIRE

Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

2017-01-01

‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

DEFF Research Database (Denmark)

Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

2014-01-01

OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

Directory of Open Access Journals (Sweden)

Melanie Brunsch

Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

Progress of Design Improvements for APR1400 Computerized Procedure System from HFE V and V results and Design Experience

International Nuclear Information System (INIS)

Lee, Sungjin; Seong, Nokyu

2015-01-01

This study shows major already improved design features from the above three processes and a design proposal for to-be-improving items. APR1400 CPS has been verified and validated by the HFE process, internal design review and site acceptance tests. APR1400 Computerized Procedure System (CPS) has been applied to Shin-Kori Nuclear Power Plant (SKN) 3 and 4 units, Shin-Hanul Nuclear Power Plant (SHN) 1 and 2 units and Baraka Nuclear Power Plant (BNPP) 1, 2, 3 and 4 units. Since APR1400 CPS is a first-of-a-kind (FOAK) human machine interface (HMI) for executing a computerized procedure in the nuclear power plant's main control room in South Korea, it has been continuously improved through a) the human factor engineering (HFE) verification and validation (V and V), b) the internal design review and c) prototype tests. Human engineering discrepancies (HEDs) can be identified by the HFE V and V activity. Some HEDs of APR1400 CPS for SKN 3 and 4 and SHN 1 and 2 have been adopted as a role of design improvement in the CPS system while others were regarded as an operator training requirement or part of task contents. Various requests for improving the CPS have been collected from those results. A HMI system should be improved continuously for removing potential defects. Some of introduced design features in this paper has been adopted for APR1400 nuclear power plants. Some of them are under the review in the CPS design team of KHNP

Expression analysis of the Arabidopsis thaliana AtSpen2 gene, and its relationship with other plant genes encoding Spen proteins

OpenAIRE

Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel

2017-01-01

Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...

Structure of genes for dermaseptins B, antimicrobial peptides from frog skin. Exon 1-encoded prepropeptide is conserved in genes for peptides of highly different structures and activities.

Science.gov (United States)

Vouille, V; Amiche, M; Nicolas, P

1997-09-01

We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.

Genetics Home Reference: hereditary hemochromatosis

Science.gov (United States)

... Type 1 hemochromatosis results from mutations in the HFE gene, and type 2 hemochromatosis results from mutations in ... about the genes associated with hereditary hemochromatosis HAMP HFE HJV PNPLA3 SLC40A1 TFR2 Related Information What is a gene? What is a gene mutation and how do ...

aldB, an RpoS-dependent gene in Escherichia coli encoding an aldehyde dehydrogenase that is repressed by Fis and activated by Crp.

OpenAIRE

Xu, J; Johnson, R C

1995-01-01

Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...

Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B

Directory of Open Access Journals (Sweden)

Riley Laura M

2012-03-01

Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.

Dissemination of Genes Encoding Aminoglycoside-Modifying Enzymes and armA Among Enterobacteriaceae Isolates in Northwest Iran.

Science.gov (United States)

Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda

2017-10-01

Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.

Antimicrobial resistance and detection of the mecA gene besides enterotoxin-encoding genes among coagulase-negative Staphylococci isolated from clam meat of Anomalocardia brasiliana.

Science.gov (United States)

Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor

2013-12-01

The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.

Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

Directory of Open Access Journals (Sweden)

Craxton Molly

2007-07-01

Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

Gene Disruption in Scedosporium aurantiacum: Proof of Concept with the Disruption of SODC Gene Encoding a Cytosolic Cu,Zn-Superoxide Dismutase.

Science.gov (United States)

Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine

2018-02-01

Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.

Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013