WorldWideScience

Sample records for hfe c282y mutation

  1. HFE gene C282Y, H63D and S65C mutations frequency in the Transylvania region, Romania.

    Science.gov (United States)

    Trifa, Adrian P; Popp, Radu A; Militaru, Mariela S; Farcaş, Marius F; Crişan, Tania O; Gana, Ionuţ; Cucuianu, Andrei; Pop, Ioan V

    2012-06-01

    HFE-associated haemochromatosis is one of the most frequent autosomal recessive disorders in the Caucasian population. Although most of the cases are homozygous individuals for the C282Y mutation, another two mutations, H63D and S65C, have been reported to be associated with milder forms of the disease. This study was a first attempt to evaluate the distribution of these HFE gene mutations in the Transylvania region. Two-hundred and twenty-five healthy, unrelated volunteers originating from the Transylvania region, Romania, were screened for the HFE gene C282Y, H63D and S65C mutations, using molecular genetics assays (Polymerase Chain Reaction-Restriction Fragments Length Polymorphism). For the C282Y mutation, 7 heterozygotes (3.1%) were found, but no homozygous individual. In the case of the H63D mutation, 40 heterozygotes (17.8%) and 4 homozygotes (1.75%) for the mutant allele were evidenced. We found a compound heterozygous genotype (C282Y/H63D) in one individual (0.45%). Thus, the allele frequencies of the C282Y and H63D were 1.75% and 10.9%, respectively. Three individuals (1.3%) were found to harbour the S65C mutation in a heterozygous state, but none in a homozygous state: the allele frequency of the mutant allele was 0.75%. The distribution of the HFE gene C282Y, H63D and S65C mutations found in our group matches the tendencies observed in other European countries: a decreasing gradient from Northern to Southern Europe for the C282Y mutation; high frequency for the H63D mutation, and low frequency for the S65C mutation in most of the countries.

  2. Prevalence of C282Y, H63D, and S65C mutations in hereditary HFE-hemochromatosis gene in Lithuanian population.

    Science.gov (United States)

    Kucinskas, Laimutis; Juzenas, Simonas; Sventoraityte, Jurgita; Cedaviciute, Ruta; Vitkauskiene, Astra; Kalibatas, Vytenis; Kondrackiene, Jurate; Kupcinskas, Limas

    2012-04-01

    HFE-hemochromatosis is a common autosomal recessive disease caused by HFE gene mutations and characterized as iron overload and failure of different organs. The aim of this study was to determine the prevalence of C282Y (c.845 G>A), H63D (c.187 C>G), and S65C (c.193A>T) alleles of HFE gene in the Lithuanian population. One thousand and eleven healthy blood donors of Lithuanian nationality were examined in four different ethnic Lithuanian regions to determine HFE gene alleles and genotype frequencies. The samples of DNA were analyzed for the presence of restriction fragment length polymorphism and validated by DNA sequencing. Among 1,011 blood donors tested, the frequency of C282Y, H63D, and S65C alleles were 2.6%, 15.9%, and 1.9%, respectively. One third of the tested subjects (n = 336) had at least one of the C282Y or H63D HFE gene mutations. The screening of Lithuanian blood donors has detected 13 (1.3%) subjects with a genotype C282Y/C282Y or C282Y/H63D responsible for the development of HFE-hemochromatosis. The prevalence of C282Y mutation was significantly higher among the inhabitants of Zemaitija (Somogitia) at the Baltic Sea area (5.9%) in comparison to the regions of continental part of Lithuania (2.4% in Dzukija, 2.3% in Aukstaitija, and 2% in Suvalkija, p HFE gene mutations in ethnic Lithuanians showed that the frequencies of H63D, C282Y, and S65C of HFE gene alleles are similar to the other North-Eastern Europeans, especially in the Baltic region (Estonia, Latvia), Poland, and part of Russia (Moscow region).

  3. Frequency of the hemochromatosis HFE mutations C282Y, H63D, and S65C in blood donors in the Faroe Islands

    DEFF Research Database (Denmark)

    Milman, Nils; á Steig, Torkil; Koefoed, Pernille

    2004-01-01

    on the HFE gene was assessed by genotyping using the polymerase chain reaction (PCR) technique and calculated from direct allele counting. We found no C282Y homozygous subjects; 28 (14.0%) subjects were C282Y heterozygous and four subjects were C282Y/H63D compound heterozygous (2.0%). The C282Y allele......The aim of the study was to assess the frequencies of the hereditary hemochromatosis HFE mutations C282Y, H63D, and S65C in the population in the Faroe Islands. The series comprised 200 randomly selected blood donors of Faroese heritage. The frequency of the C282Y, H63D, and S65C mutations.......6%. Screening of larger groups of the Faroese population for HFE mutations especially C282Y should be considered in order to establish the penetrance....

  4. Analysis of HLA-A antigens and C282Y and H63D mutations of the HFE gene in Brazilian patients with hemochromatosis

    Directory of Open Access Journals (Sweden)

    Bittencourt P.L.

    2002-01-01

    Full Text Available The hemochromatosis gene, HFE, is located on chromosome 6 in close proximity to the HLA-A locus. Most Caucasian patients with hereditary hemochromatosis (HH are homozygous for HLA-A3 and for the C282Y mutation of the HFE gene, while a minority are compound heterozygotes for C282Y and H63D. The prevalence of these mutations in non-Caucasian patients with HH is lower than expected. The objective of the present study was to evaluate the frequencies of HLA-A antigens and the C282Y and H63D mutations of the HFE gene in Brazilian patients with HH and to compare clinical and laboratory profiles of C282Y-positive and -negative patients with HH. The frequencies of HLA-A and C282Y and H63D mutations were determined by PCR-based methods in 15 male patients (median age 44 (20-72 years with HH. Eight patients (53% were homozygous and one (7% was heterozygous for the C282Y mutation. None had compound heterozygosity for C282Y and H63D mutations. All but three C282Y homozygotes were positive for HLA-A3 and three other patients without C282Y were shown to be either heterozygous (N = 2 or homozygous (N = 1 for HLA-A3. Patients homozygous for the C282Y mutation had higher ferritin levels and lower age at onset, but the difference was not significant. The presence of C282Y homozygosity in roughly half of the Brazilian patients with HH, together with the findings of HLA-A homozygosity in C282Y-negative subjects, suggest that other mutations in the HFE gene or in other genes involved in iron homeostasis might also be linked to HH in Brazil.

  5. Association of HFE gene C282Y and H63D mutations with liver cirrhosis in the Lithuanian population

    Directory of Open Access Journals (Sweden)

    Simonas Juzėnas

    2016-01-01

    Conclusions: Heterozygous C282Y mutation of the HFE gene was associated with liver cirrhosis in the Lithuanian population. In gender-related analysis, heterozygous C282Y and homozygous H63D mutations were linked to liver cirrhosis in men, not in women.

  6. Iron overload in HFE C282Y heterozygotes at first genetic testing: a strategy for identifying rare HFE variants.

    Science.gov (United States)

    Aguilar-Martinez, Patricia; Grandchamp, Bernard; Cunat, Séverine; Cadet, Estelle; Blanc, François; Nourrit, Marlène; Lassoued, Kaiss; Schved, Jean-François; Rochette, Jacques

    2011-04-01

    Heterozygotes for the p.Cys282Tyr (C282Y) mutation of the HFE gene do not usually express a hemochromatosis phenotype. Apart from the compound heterozygous state for C282Y and the widespread p.His63Asp (H63D) variant allele, other rare HFE mutations can be found in trans on chromosome 6. We performed molecular investigation of the genes implicated in hereditary hemochromatosis in six patients who presented with iron overload but were simple heterozygotes for the HFE C282Y mutation at first genetic testing. Functional impairment of new variants was deduced from computational methods including molecular modeling studies. We identified four rare HFE mutant alleles, three of which have not been previously described. One mutation is a 13-nucleotide deletion in exon 6 (c.1022_1034del13, p.His341_Ala345 > LeufsX119), which is predicted to lead to an elongated and unstable protein. The second one is a substitution of the last nucleotide of exon 2 (c.340G > A, p.Glu114Lys) which modifies the relative solvent accessibility in a loop interface. The third mutation, p.Arg67Cys, also lies in exon 2 and introduces a destabilization of the secondary structure within a loop of the α1 domain. We also found the previously reported c.548T > C (p.Leu183Pro) missense mutation in exon 3. No other known iron genes were mutated. We present an algorithm at the clinical and genetic levels for identifying patients deserving further investigation. Conclusions Our results suggest that additional mutations in HFE may have a clinical impact in C282Y carriers. In conjunction with results from previously described cases we conclude that an elevated transferrin saturation level and elevated hepatic iron index should indicate the utility of searching for further HFE mutations in C282Y heterozygotes prior to other iron gene studies.

  7. Association of HFE gene C282Y and H63D mutations with liver cirrhosis in the Lithuanian population.

    Science.gov (United States)

    Juzėnas, Simonas; Kupčinskas, Juozas; Valantienė, Irena; Šumskienė, Jolanta; Petrenkienė, Vitalija; Kondrackienė, Jūrate; Kučinskas, Laimutis; Kiudelis, Gediminas; Skiecevičienė, Jurgita; Kupčinskas, Limas

    2016-01-01

    Liver cirrhosis is the end-stage disease of chronic liver injury. Due to differences in the natural course of chronic liver diseases, identification of genetic factors that influence individual outcomes is warranted. HFE-linked hereditary hemochromatosis (HH) predisposes disease progression to cirrhosis; however, the role of heterozygous C282Y or H63D mutations in the development of cirrhosis in the presence of other etiological factors is still debated. The aim of this study was to determine the association between heterozygous C282Y and H63D mutations and non-HH liver cirrhosis in Lithuanian population. The patient cohort consisted of 209 individuals. Diagnosis of cirrhosis was confirmed by clinical, laboratory parameters, liver biopsy, and radiological imaging. Control samples were obtained from 1005 randomly selected unrelated healthy individuals. HFE gene mutations were determined using the PCR-RFLP method. The most common causes of cirrhosis were hepatitis C (33.9%), hepatitis B (13.6%), and alcohol (25.8%). C282Y allele was associated with the presence of cirrhosis (OR=2.07; P=0.005); this was also observed under recessive model for C282Y (OR=2.06, P=0.008). The prevalence of C282Y allele was higher in cirrhotic men than in controls (7.0% vs. 2.8%, P=0.002). The carriage of H63D risk allele (OR=1.54; P=0.02), heterozygous C282Y/wt and homozygous H63D/H63D genotypes were associated with liver cirrhosis in males (OR=2.48, P=0.008, and OR=4.13, P=0.005, respectively). Heterozygous C282Y mutation of the HFE gene was associated with liver cirrhosis in the Lithuanian population. In gender-related analysis, heterozygous C282Y and homozygous H63D mutations were linked to liver cirrhosis in men, not in women. Copyright © 2016 The Lithuanian University of Health Sciences. Production and hosting by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  8. Ancestral association between HLA and HFE H63D and C282Y gene mutations from northwest Colombia.

    Science.gov (United States)

    Rodriguez, Libia M; Giraldo, Mabel C; Velasquez, Laura I; Alvarez, Cristiam M; Garcia, Luis F; Jimenez-Del-Rio, Marlene; Velez-Pardo, Carlos

    2015-03-01

    A significant association between HFE gene mutations and the HLA-A*03-B*07 and HLA-A*29-B*44 haplotypes has been reported in the Spanish population. It has been proposed that these mutations are probably connected with Celtic and North African ancestry, respectively. We aimed to find the possible ancestral association between HLA alleles and haplotypes associated with the HFE gene (C282Y and H63D) mutations in 214 subjects from Antioquia, Colombia. These were 18 individuals with presumed hereditary hemochromatosis ("HH") and 196 controls. The HLA-B*07 allele was in linkage disequilibrium (LD) with C282Y, while HLA-A*23, A*29, HLA-B*44, and B*49 were in LD with H63D. Altogether, our results show that, although the H63D mutation is more common in the Antioquia population, it is not associated with any particular HLA haplotype, whereas the C282Y mutation is associated with HLA-A*03-B*07, this supporting a northern Spaniard ancestry.

  9. Ancestral association between HLA and HFE H63D and C282Y gene mutations from northwest Colombia

    Directory of Open Access Journals (Sweden)

    Libia M Rodriguez

    2015-03-01

    Full Text Available A significant association between HFE gene mutations and the HLA-A*03-B*07 and HLA-A*29-B*44 haplotypes has been reported in the Spanish population. It has been proposed that these mutations are probably connected with Celtic and North African ancestry, respectively. We aimed to find the possible ancestral association between HLA alleles and haplotypes associated with the HFE gene (C282Y and H63D mutations in 214 subjects from Antioquia, Colombia. These were 18 individuals with presumed hereditary hemochromatosis (“HH” and 196 controls. The HLA-B*07 allele was in linkage disequilibrium (LD with C282Y, while HLA-A*23, A*29, HLA-B*44, and B*49 were in LD with H63D. Altogether, our results show that, although the H63D mutation is more common in the Antioquia population, it is not associated with any particular HLA haplotype, whereas the C282Y mutation is associated with HLA-A*03-B*07, this supporting a northern Spaniard ancestry.

  10. Estudo das mutações C282Y, H63D e S65C do gene HFE em doentes brasileiros com sobrecarga de ferro Study of C282Y, H63D and S65C mutations in the HFE gene in Brazilian patients with iron overload

    Directory of Open Access Journals (Sweden)

    Rodolfo D. Cançado

    2007-12-01

    Full Text Available Hemocromatose é uma das doenças genéticas mais freqüentes no ser humano e uma das causas mais importantes de sobrecarga de ferro. Os objetivos deste estudo foram determinar a freqüência das mutações C282Y, H63D e S65C do gene HFE em doentes brasileiros com sobrecarga de ferro, verificar a coexistência de anemia hemolítica hereditária, hepatite C e consumo excessivo de bebida alcoólica nestes doentes e avaliar a influência destas variáveis sobre os depósitos de ferro do organismo. Saturação da transferrina, ferritina sérica e análise das mutações C282Y, H63D e S65C do gene HFE, pelo método da PCR, foram determinadas em cinqüenta doentes com sobrecarga de ferro atendidos no Hemocentro da Santa Casa de São Paulo entre janeiro de 2000 e maio de 2004. A freqüência de mutação do gene HFE nos doentes com sobrecarga de ferro foi de 76,0% (38/50. Saturação da transferrina e ferritina foram significativamente maiores nos doentes homozigotos para a mutação C282Y confirmando a correlação entre genótipo C282Y/C282Y e maior risco de sobrecarga de ferro. A coexistência de hepatite C, consumo excessivo de bebida alcoólica ou anemia hemolítica hereditária estão implicados em aumento dos estoques de ferro e constituem fator de risco adicional em pacientes com mutação do gene HFE para a condição de sobrecarga de ferro.Hemochromatosis is one of the most frequent genetic diseases in humans and one of the most important causes of iron overload. The aims of this study were to determine the frequency of C282Y, H63D and S65C mutations of the HFE gene in Brazilian patients with iron overload, to verify the coexistence of chronic hemolytic anemia, hepatitis C and excessive alcohol consumption and to evaluate the influence of these variables on body iron deposits. Transferrin saturation, serum ferritin and C282Y, H63D and S65C HFE gene mutations (by PCR method were determined in 50 patients with iron overload in the Hemocentro da

  11. Hemochromatosis C282Y gene mutation as a potential susceptibility ...

    African Journals Online (AJOL)

    G.M. Mokhtar

    2017-08-12

    Aug 12, 2017 ... Background: Hereditary hemochromatosis is the most frequent cause of primary iron overload that is associated with HFE gene's mutation especially the C282Y mutation. The interaction between hemoglo- bin chain synthesis' disorders and the C282Y mutation may worsen the clinical picture of beta-.

  12. HFE Mutations C282Y and H63D in Iranian Population With Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    Golchin

    2015-04-01

    Full Text Available Background Type 2 diabetes (T2D is a common metabolic disease caused by insulin secretion defects, which is associated with a variety of complications such as retinopathy, nephropathy, and neuropathy. Objectives Regarding the relationship between type 2 diabetes and hereditary chromatists, we conducted a genetic analysis on two previously reported mutations C282Y and H63D related to the HFE gene in our population. Patients and Methods Altogether, 145 patients with type 2 diabetes and 145 healthy controls were examined. A genotyping assay performed using electrophoresis of the DNA digestion products from MboI and RsaI for H63D and C282Y, respectively. Results Results showed a significant difference between case and controls regarding C282Y (P value < 0.001 and H63D genotypes (P value = 0.013. We also found a relationship between both mutations and nephropathy. Moreover, the difference between C282Y genotypes of patients with retinopathy and healthy controls were statistically significant (P value = 0.020 while there was no association between H63D and retinopathy. In addition, observed differences of both mutations were significant when nephropathic patients compared to the controls. Conclusions Our study showed a significant association between H63D and C282Y mutations and the risk of type 2 diabetes in Iranian population.

  13. Mutations in HAMP and HJV genes and their impact on expression of clinical hemochromatosis in a cohort of 100 Spanish patients homozygous for the C282Y mutation of HFE gene.

    Science.gov (United States)

    Altès, Albert; Bach, Vanessa; Ruiz, Angels; Esteve, Anna; Felez, Jordi; Remacha, Angel F; Sardà, M Pilar; Baiget, Montserrat

    2009-10-01

    Most hereditary hemochromatosis (HH) patients are homozygous for the C282Y mutation of the HFE gene. Nevertheless, penetrance of the disease is very variable. In some patients, penetrance can be mediated by concomitant mutations in other iron master genes. We evaluated the clinical impact of hepcidin (HAMP) and hemojuvelin mutations in a cohort of 100 Spanish patients homozygous for the C282Y mutation of the HFE gene. HAMP and hemojuvelin mutations were evaluated in all patients by bidirectional direct cycle sequencing. Phenotype-genotype interactions were evaluated. A heterozygous mutation of the HAMP gene (G71D) was found in only one out of 100 cases. Following, we performed a study of several members of that family, and we observed several members had a digenic inheritance of the C282Y mutation of the HFE gene and the G71D mutation of the HAMP gene. This mutation in the HAMP gene did not modify the phenotype of the individuals who were homozygous for the C282Y mutation. One other patient presented a new polymorphism in the hemojuvelin gene, without consequences in iron load or clinical course of the disease. In conclusion, HAMP and hemojuvelin mutations are rare among Spanish HH patients, and their impact in this population is not significant.

  14. Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population: A Preliminary Study

    Directory of Open Access Journals (Sweden)

    Selma Ünal

    2014-09-01

    Full Text Available OBJECTIVE: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group. METHODS: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6±6.1 years, range: 3-30 years with beta-thalassemia major (BTM and 13 beta-thalassemia intermedia (BTI patients (6 males and 7 females; mean age: 19.6±3.5 years, range: 13-26 years were included in the study. The control group comprised 100 healthy blood donors. RESULTS: Neither heterozygous nor homozygous HFE gene C282Y mutation was detected in patients with BTM or BTI, or in control group. CONCLUSION: The C282Y mutation, which is supposed to be responsible for the majority of hereditary hemochromatosis, was not found to have a role in the development of hemochromatosis in beta-thalassemia patients and was not detected in a healthy Turkish population. However, research on larger cohorts of individuals is required in order to determine the exact prevalence of the HFE gene mutation in Turkish populations from diverse ethnic origins and whether it would have an impact on iron loading in thalassemic populations.

  15. C282Y-HFE gene variant affects cholesterol metabolism in human neuroblastoma cells.

    Science.gov (United States)

    Ali-Rahmani, Fatima; Huang, Michael A; Schengrund, C-L; Connor, James R; Lee, Sang Y

    2014-01-01

    Although disruptions in the maintenance of iron and cholesterol metabolism have been implicated in several cancers, the association between variants in the HFE gene that is associated with cellular iron uptake and cholesterol metabolism has not been studied. The C282Y-HFE variant is a risk factor for different cancers, is known to affect sphingolipid metabolism, and to result in increased cellular iron uptake. The effect of this variant on cholesterol metabolism and its possible relevance to cancer phenotype was investigated using wild type (WT) and C282Y-HFE transfected human neuroblastoma SH-SY5Y cells. Expression of C282Y-HFE in SH-SY5Y cells resulted in a significant increase in total cholesterol as well as increased transcription of a number of genes involved in its metabolism compared to cells expressing WT-HFE. The marked increase in expression of NPC1L1 relative to that of most other genes, was accompanied by a significant increase in expression of NPC1, a protein that functions in cholesterol uptake by cells. Because inhibitors of cholesterol metabolism have been proposed to be beneficial for treating certain cancers, their effect on the viability of C282Y-HFE neuroblastoma cells was ascertained. C282Y-HFE cells were significantly more sensitive than WT-HFE cells to U18666A, an inhibitor of desmosterol Δ24-reductase the enzyme catalyzing the last step in cholesterol biosynthesis. This was not seen for simvastatin, ezetimibe, or a sphingosine kinase inhibitor. These studies indicate that cancers presenting in carriers of the C282Y-HFE allele might be responsive to treatment designed to selectively reduce cholesterol content in their tumor cells.

  16. HFE p.C282Y homozygosity predisposes to rapid serum ferritin rise after menopause: A genotype-stratified cohort study of hemochromatosis in Australian women.

    Science.gov (United States)

    Warne, Charles D; Zaloumis, Sophie G; Bertalli, Nadine A; Delatycki, Martin B; Nicoll, Amanda J; McLaren, Christine E; Hopper, John L; Giles, Graham G; Anderson, Greg J; Olynyk, John K; Powell, Lawrie W; Allen, Katrina J; Gurrin, Lyle C

    2017-04-01

    Women who are homozygous for the p.C282Y mutation in the HFE gene are at much lower risk of iron overload-related disease than p.C282Y homozygous men, presumably because of the iron-depleting effects of menstruation and pregnancy. We used data from a population cohort study to model the impact of menstruation cessation at menopause on serum ferritin (SF) levels in female p.C282Y homozygotes, with p.C282Y/p.H63D simple or compound heterozygotes and those with neither p.C282Y nor p.H63D mutations (HFE wild types) as comparison groups. A sample of the Melbourne Collaborative Cohort Study was selected for the "HealthIron" study (n = 1438) including all HFE p.C282Y homozygotes plus a random sample stratified by HFE-genotype (p.C282Y and p.H63D). The relationship between the natural logarithm of SF and time since menopause was examined using linear mixed models incorporating spline smoothing. For p.C282Y homozygotes, SF increased by a factor of 3.6 (95% CI (1.8, 7.0), P HFE genotype groups increase more gradually and did not show a distinction between premenopausal and postmenopausal SF levels. Only p.C282Y homozygotes had predicted SF exceeding 200 μg/L postmenopause, but the projected SF did not increase the risk of iron overload-related disease. These data provide the first documented evidence that physiological blood loss is a major factor in determining the marked gender difference in expression of p.C282Y homozygosity. © 2016 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.

  17. C282Y polymorphism in the HFE gene is associated with risk of breast cancer.

    Science.gov (United States)

    Liu, Xiaoyan; Lv, Chunlei; Luan, Xiaorong; Lv, Ming

    2013-10-01

    The C282Y and H63D polymorphisms in the HFE gene have been implicated in susceptibility of breast cancer, but a number of studies have reported inconclusive results. The aim of this study is to investigate the association between the C282Y and H63D polymorphisms in the HFE gene and breast cancer risk by meta-analysis. We searched PubMed and Embase databases, covering all related studies until March 2, 2013. Statistical analysis was performed using STATA 10.0. A total of 7 studies including 1,720 cases and 18,296 controls for HFE C282Y polymorphism and 5 studies including 942 cases and 1,571 controls for HFE H63D polymorphism were included in the meta-analysis. The results showed that HFE C282Y polymorphism was significantly associated with increased risk of breast cancer under homozygotes vs. wild-type model (OR = 2.06, 95%CI = 1.19-3.58) and recessive model (OR = 1.98, 95%CI = 1.14-3.44) but not under heterozygotes vs. wild-type model (OR = 0.97, 95%CI = 0.70-1.35), dominant model (OR = 1.00, 95%CI = 0.72-1.40) and multiplicative model (OR = 1.04, 95%CI = 0.76-1.42). However, we did not find any association between HFE H63D polymorphism and breast cancer risk under all genetic models. This current meta-analysis suggested that C282Y polymorphism rather than H63D might be associated with increased risk of breast cancer.

  18. Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis.

    Science.gov (United States)

    Bittencourt, Paulo Lisboa; Marin, Maria Lúcia Carnevale; Couto, Cláudia Alves; Cançado, Eduardo Luiz Rachid; Carrilho, Flair José; Goldberg, Anna Carla

    2009-01-01

    Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH) are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2) and ferroportin 1 (SCL40A1). To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. Nineteen male subjects (median age 42 [range: 20-72] years) with HH were evaluated using the Haemochromatosis StripAssay A. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. In our cohort, nine (47%) patients were homozygous for the C282Y mutation, two (11%) were heterozygous for the H63D mutation, and one each (5%) was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.

  19. Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis

    Directory of Open Access Journals (Sweden)

    Paulo Lisboa Bittencourt

    2009-01-01

    Full Text Available BACKGROUND: Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2 and ferroportin 1 (SCL40A1. AIMS: To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. PATIENTS AND METHODS: Nineteen male subjects (median age 42 [range: 20-72] years with HH were evaluated using the Haemochromatosis StripAssay A®. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. RESULTS: In our cohort, nine (47% patients were homozygous for the C282Y mutation, two (11% were heterozygous for the H63D mutation, and one each (5% was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. CONCLUSIONS: One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.

  20. Frequency of the HFE C282Y and H63D mutations in Danish patients with clinical haemochromatosis initially diagnosed by phenotypic methods

    DEFF Research Database (Denmark)

    Milman, Nils; Koefoed, Pernille; Pedersen, Palle

    2003-01-01

    AIM: To assess the frequency of the C282Y and H63D mutations on the HFE gene in Danish patients with clinical hereditary haemochromatosis initially diagnosed by phenotypic methods. METHODS: In the period 1950-1985, an epidemiological survey in Denmark identified 179 patients with clinical...... diagnosis of clinical idiopathic haemochromatosis was made before blood samples were taken for HFE genotyping. The total series consisted of 58 patients (40 men and 18 women) with a median age of 60 yrs (range 18-74). HFE genotyping was performed by the polymerase chain reaction (PCR) technique. RESULTS...

  1. Association between C282Y and H63D mutations of the HFE gene with hepatocellular carcinoma in European populations: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Shen Xi-Zhong

    2010-03-01

    Full Text Available Abstract Background Hereditary hemochromatosis (HH is an autosomal recessive disorder mainly associated with homozygosity for the C282Y and H63D mutations in the hemochromatosis (HFE gene. The reports about the C282Y and H63D mutations and hepatocellular carninoma (HCC were controversial. To clarify the relationship between C282Y and H63D mutations and HCC, a meta-analysis including nine studies (1102 HCC cases and 3766 controls, mainly came from European populations was performed. Methods The association was measured using random-effect (RE or fixed-effect (FE odds ratios (ORs combined with 95% confidence intervals (CIs according to the studies' heterogeneity. Results Meta-analysis of nine studies showed that Y allele of C282Y was associated with HCC risk: RE OR reached 1.50 (95%CI: 1.05-2.14, p for heterogeneity = 0.02, I2 = 0.57. Subgroup analysis of seven studies also showed Y allele was associated with HCC risk in healthy populations: RE OR reached 1.61 (95%CI: 1.08-2.39, p for heterogeneity = 0.04, I2 = 0.55. We further did subgroup analysis in alcoholic liver cirrhosis (LC patients of four studies (224 cases and 380 controls and found that both the dominant model and Y allele of C282Y were associated with HCC risk (FE OR reached 4.06, 95%CI: 2.08-7.92 and 3.41, 95%CI: 1.81-6.41, respectively. There was no distinct heterogeneity among the studies (I2 = 0. Sensitivity analyses showed the results were robust in the subgroup analysis of alcoholic LC patients. Conclusions C282Y mutation was associated with HCC in European alcoholic LC patients.

  2. Prevalence of H63D, S65C and C282Y hereditary hemochromatosis gene mutations in Slovenian population by an improved high-throughput genotyping assay

    Directory of Open Access Journals (Sweden)

    Rupreht Ruth

    2007-11-01

    Full Text Available Abstract Background Hereditary hemochromatosis (HH is a common genetic disease characterized by excessive iron overload that leads to multi-organ failure. Although the most prevalent genotype in HH is homozygosity for C282Y mutation of the HFE gene, two additional mutations, H63D and S65C, appear to be associated with a milder form of HH. The aim of this study was to develop a high-throughput assay for HFE mutations screening based on TaqMan technology and to determine the frequencies of HFE mutations in the Slovenian population. Methods Altogether, 1282 randomly selected blood donors from different Slovenian regions and 21 HH patients were analyzed for the presence of HFE mutations by an in-house developed real-time PCR assay based on TaqMan technology using shorter non-interfering fluorescent single nucleotide polymorphism (SNP-specific MGB probes. The assay was validated by RFLP analysis and DNA sequencing. Results The genotyping assay of the H63D, S65C and C282Y mutations in the HFE gene, based on TaqMan technology proved to be fast, reliable, with a high-throughput capability and 100% concordant with genotypes obtained by RFLP and DNA sequencing. The observed frequency of C282Y homozygotes in the group of HH patients was only 48%, others were of the heterogeneous HFE genotype. Among 1282 blood donors tested, the observed H63D, S65C and C282Y allele frequency were 12.8% (95% confidence interval (CI 11.5 – 14.2%, 1.8% (95% CI 1.4 – 2.5% and 3.6% (95% CI 3.0 – 4.5%, respectively. Approximately 33% of the tested subjects had at least one of the three HH mutations, and 1% of them were C282Y homozygotes or compound heterozygotes C282Y/H63D or C282Y/S65C, presenting an increased risk for iron overload disease. A significant variation in H63D allele frequency was observed for one of the Slovenian regions. Conclusion The improved real-time PCR assay for H63D, S65C and C282Y mutations detection is accurate, fast, cost-efficient and ready for

  3. HFE gene mutations and iron status of Brazilian blood donors.

    Science.gov (United States)

    Santos, P C J L; Cançado, R D; Terada, C T; Rostelato, S; Gonzales, I; Hirata, R D C; Hirata, M H; Chiattone, C S; Guerra-Shinohara, E M

    2010-01-01

    Mutations of the HFE and TFR2 genes have been associated with iron overload. HFE and TFR2 mutations were assessed in blood donors, and the relationship with iron status was evaluated. Subjects (N = 542) were recruited at the Hemocentro da Santa Casa de São Paulo, São Paulo, Brazil. Iron status was not influenced by HFE mutations in women and was independent of blood donation frequency. In contrast, men carrying the HFE 282CY genotype had lower total iron-binding capacity (TIBC) than HFE 282CC genotype carriers. Men who donated blood for the first time and were carriers of the HFE 282CY genotype had higher transferrin saturation values and lower TIBC concentrations than those with the homozygous wild genotype for the HFE C282Y mutation. Moreover, in this group of blood donors, carriers of HFE 63DD plus 63HD genotypes had higher serum ferritin values than those with the homozygous wild genotype for HFE H63D mutation. Multiple linear regression analysis showed that HFE 282CY leads to a 17.21% increase (P = 0.018) and a 83.65% decrease (P = 0.007) in transferrin saturation and TIBC, respectively. In addition, serum ferritin is influenced by age (3.91%, P = 0.001) and the HFE 63HD plus DD genotype (55.84%, P = 0.021). In conclusion, the HFE 282Y and 65C alleles were rare, while the HFE 63D allele was frequent in Brazilian blood donors. The HFE C282Y and H63D mutations were associated with alterations in iron status in blood donors in a gender-dependent manner.

  4. HFE gene mutations and iron status of Brazilian blood donors

    Directory of Open Access Journals (Sweden)

    P.C.J.L. Santos

    2010-01-01

    Full Text Available Mutations of the HFE and TFR2 genes have been associated with iron overload. HFE and TFR2 mutations were assessed in blood donors, and the relationship with iron status was evaluated. Subjects (N = 542 were recruited at the Hemocentro da Santa Casa de São Paulo, São Paulo, Brazil. Iron status was not influenced by HFE mutations in women and was independent of blood donation frequency. In contrast, men carrying the HFE 282CY genotype had lower total iron-binding capacity (TIBC than HFE 282CC genotype carriers. Men who donated blood for the first time and were carriers of the HFE 282CY genotype had higher transferrin saturation values and lower TIBC concentrations than those with the homozygous wild genotype for the HFE C282Y mutation. Moreover, in this group of blood donors, carriers of HFE 63DD plus 63HD genotypes had higher serum ferritin values than those with the homozygous wild genotype for HFE H63D mutation. Multiple linear regression analysis showed that HFE 282CY leads to a 17.21% increase (P = 0.018 and a 83.65% decrease (P = 0.007 in transferrin saturation and TIBC, respectively. In addition, serum ferritin is influenced by age (3.91%, P = 0.001 and the HFE 63HD plus DD genotype (55.84%, P = 0.021. In conclusion, the HFE 282Y and 65C alleles were rare, while the HFE 63D allele was frequent in Brazilian blood donors. The HFE C282Y and H63D mutations were associated with alterations in iron status in blood donors in a gender-dependent manner.

  5. HFE p.C282Y gene variant is associated with varicose veins in Russian population.

    Science.gov (United States)

    Sokolova, Ekaterina A; Shadrina, Alexandra S; Sevost'ianova, Kseniya S; Shevela, Andrey I; Soldatsky, Evgenii Yu; Seliverstov, Evgenii I; Demekhova, Marina Yu; Shonov, Oleg A; Ilyukhin, Evgenii A; Smetanina, Mariya A; Voronina, Elena N; Zolotukhin, Igor A; Filipenko, Maxim L

    2016-08-01

    Recently, the association of polymorphism rs1800562 (p.C282Y) in the hemochromatosis (HFE) gene with the increased risk of venous ulceration was shown. We hypothesized that HFE gene polymorphism might be involved not only in ulceration process, but also in susceptibility to primary varicose veins. We genotyped HFE p.C282Y (rs1800562) and p.H63D (rs1799945) variants in patients with primary varicose veins (n = 463) and in the control group (n = 754). In our study, p.282Y variant (rs1800562 A allele) was significantly associated with the risk of varicose veins (OR 1.79, 95 % CI = 1.11-2.89, P = 0.02). A borderline significant reverse association of p.63D variant (rs1799945 G allele) with venous leg ulcer development was revealed in Russians (OR 0.25, 95 % CI = 0.06-1.00, P = 0.05), but not in the meta-analysis (P = 0.56). We conclude that the HFE gene polymorphism can affect the risk of developing primary varicose veins.

  6. Prevalence of C282Y and H63D mutations in the HFE gene of Brazilian individuals with clinical suspicion of hereditary hemochromatosis Prevalência das mutações C282Y e H63D no gene HFE em indivíduos brasileiros com suspeita clínica de hemocromatose hereditária

    Directory of Open Access Journals (Sweden)

    Alessandro C. S. Ferreira

    2008-10-01

    Full Text Available Classical hereditary hemochromatosis is a recessive autosomal disease related to a systemic iron overload that is frequently related to C282Y and H63D mutations in the HFE gene. In Brazil, reports on HFE gene mutation frequencies are rare, mainly in regards to a representative sample population. This study intended to determine the prevalence of C282Y and H63D mutations among individuals with clinical suspicion of hereditary hemochromatosis. A total of 1955 patients were studied with C282Y and H63D mutations being detected by the polymerase chain reaction technique followed by enzymatic restriction. The sample consisted of 76.6% men and 23.4% women. The highest percentage of analyzed individuals (56.9% was concentrated in the 41 to 60-year-old age group. Although there were no genic or genotypic differences between genders, a higher number of over 60-year-old women was observed. The C282Y mutation was found as homozygous in 2.9% of the cases and as heterozygous in 10.1%, while the H63D was homozygous in 4.3% and heterozygous in 30.6%. The C282Y and H63D mutant allele frequencies were 0.079 and 0.196, respectively. The highest frequency was observed for H63D which was in genetic equilibrium. This work is important to determine the genetic profile of the population with hereditary hemochromatosis in Brazi.A hemocromatose hereditária clássica (HH é uma doença autossômica recessiva caracterizada por uma sobrecarga sistêmica de ferro, a qual está freqüentemente relacionada às mutações C282Y e H63D no gene HFE. No Brasil, registros das freqüências das mutações no gene HFE são raros, principalmente envolvendo uma amostra representativa da população. Este estudo teve como objetivo a determinação da prevalência das mutações C282Y e H63D em indivíduos com suspeita clínica de HH. Para isto, foram estudados 1955 pacientes para os quais as mutações C282Y e H63D foram pesquisadas pela técnica de Reação em Cadeia da Polimerase

  7. HFE C282Y/H63D Compound Heterozygotes Are at Low Risk of Hemochromatosis-Related Morbidity

    OpenAIRE

    Gurrin, Lyle C.; Bertalli, Nadine A.; Dalton, Gregory W.; Osborne, Nicholas J.; Constantine, Clare C.; McLaren, Christine E.; English, Dallas R.; Gertig, Dorota M.; Delatycki, Martin B.; Nicoll, Amanda J.; Southey, Melissa C.; Hopper, John L.; Giles, Graham G.; Anderson, Gregory J.; Olynyk, John K.

    2009-01-01

    The risk of hemochromatosis-related morbidity is unknown among HFE compound heterozygotes (C282Y/H63D). We used a prospective population-based cohort study to estimate the prevalence of elevated iron indices and hemochromatosis-related morbidity for compound heterozygotes. In all, 31,192 subjects of northern European descent were genotyped for HFE C282Y and H63D. An HFE-genotype stratified random sample of 1,438 subjects, followed for an average of 12 years to a mean age of 65 years, complete...

  8. Rare HFE variants are the most frequent cause of hemochromatosis in non-c282y homozygous patients with hemochromatosis.

    Science.gov (United States)

    Hamdi-Rozé, Houda; Beaumont-Epinette, Marie-Pascale; Ben Ali, Zeineb; Le Lan, Caroline; Loustaud-Ratti, Véronique; Causse, Xavier; Loreal, Olivier; Deugnier, Yves; Brissot, Pierre; Jouanolle, Anne-Marie; Bardou-Jacquet, Edouard

    2016-12-01

    p.Cys282Tyr (C282Y) homozygosity explains most cases of HFE-related hemochromatosis, but a significant number of patients presenting with typical type I hemochromatosis phenotype remain unexplained. We sought to describe the clinical relevance of rare HFE variants in non-C282Y homozygotes. Patients referred for hemochromatosis to the National Reference Centre for Rare Iron Overload Diseases from 2004 to 2010 were studied. Sequencing was performed for coding region and intronic flanking sequences of HFE, HAMP, HFE2, TFR2, and SLC40A1. Nine private HFE variants were identified in 13 of 206 unrelated patients. Among those, five have not been previously described: p.Leu270Argfs*4, p.Ala271Valfs*25, p.Tyr52*, p.Lys166Asn, and p.Asp141Tyr. Our results show that rare HFE variants are identified more frequently than variants in the other genes associated with iron overload. Rare HFE variants are therefore the most frequent cause of hemochromatosis in non-C282Y homozygote HFE patients. Am. J. Hematol. 91:1202-1205, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  9. HFE gene C282Y variant is associated with colorectal cancer in Caucasians: a meta-analysis.

    Science.gov (United States)

    Chen, Weidong; Zhao, Hua; Li, Tiegang; Yao, Hongliang

    2013-08-01

    The HFE gene has been suggested to play an important role in the pathogenesis of colorectal cancer. However, the results have been conflicting. In this study, we performed a meta-analysis to clarify the association of HFE gene C282Y variant with colorectal cancer. PubMed and Embase were retrieved to identify the potential literature. Pooled odds ratio (OR) with 95 % confidence interval (CI) was calculated using fixed- or random-effects model. A total of eight papers including nine studies (7,588 colorectal cancer cases and 81,571 controls) for HFE gene C282Y variant were included in the meta-analysis. The result indicated that HFE gene C282Y variant was significantly associated with colorectal cancer under recessive model (OR = 2.00, 95 % CI = 1.32-3.04), with no evidence of between-study heterogeneity (I (2) = 0.2 %, p = 0.432). Further subgroup analysis by number of cases suggested the effect was significant in studies with more than 500 cases (OR = 2.51, 95 % CI = 1.58-3.98, I (2) = 0.0 %, p = 0.921), but not in studies with less than 500 cases (OR = 0.75, 95 % CI = 0.28-1.97, I (2) = 0.0 %, p = 0.622). The current meta-analysis supported the positive association of HFE gene C282Y variant with colorectal cancer. Further large-scale studies with the consideration for gene-gene/gene-environment interactions should be conducted to investigate the association.

  10. Prevalence of H63D, S65C, and C282Y hereditary hemochromatosis gene variants in Madeira Island (Portugal).

    Science.gov (United States)

    Spínola, Carla; Brehm, António; Spínola, Hélder

    2011-01-01

    Hereditary HFE Hemochromatosis is an inherited disorder of iron metabolism that results from mutations in the HFE gene. Almost all patients with hereditary hemochromatosis show a C282Y mutation in homozygosity or in compound heterozygosity with H63D. Also, the mutation S65C has been shown to be associated to a milder iron overload. Since allele and genotype frequencies of these three variants of the HFE gene vary between populations, the determination of their prevalence in Madeira Island will clarify the population susceptibility to hereditary hemochromatosis. One hundred and fifty-four samples from Madeira Island were genotyped for the three most common HFE gene mutations, H63D, C282Y, and S65C, by polymerase chain reaction followed by restriction fragment length polymorphism analysis. Results have shown a prevalence of 20.5%, 0.33%, and 1% for H63D, C282Y, and S65C, respectively. Accordingly to our estimates, both genotypes associated to hereditary hemochromatosis, C282Y homozygotes and C282/H63D compound heterozygotes, could be present in Madeira Island population in 1,648 individuals, which represents 0.65% of the total population.

  11. ASSOCIATION OF HFE GENE MUTATION IN THALASSEMIA MAJOR PATIENTS

    Directory of Open Access Journals (Sweden)

    Amit Kumar Tiwari

    2016-11-01

    Full Text Available BACKGROUND Thalassemia major patients are dependent on frequent blood transfusion and consequently develop iron overload. HFE gene mutations (C282Y, H63D and S65C in hereditary haemochromatosis has been shown to be associated with iron overload. The study aims at finding the association of HFE gene mutations in β-thalassemia major patients. MATERIALS AND METHODS A descriptive observational pilot study was conducted including fifty diagnosed -thalassemia major cases. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS Only H63D mutation (out of three HFE gene mutations was detected in 8 out of 50 cases. Observed frequency of H63D mutation was 16%. While frequency of C282Y and S65C were 0% each. CONCLUSION The frequency of HFE mutation in -thalassemia major is not very common.

  12. HFE C282Y/H63D compound heterozygotes are at low risk of hemochromatosis-related morbidity.

    Science.gov (United States)

    Gurrin, Lyle C; Bertalli, Nadine A; Dalton, Gregory W; Osborne, Nicholas J; Constantine, Clare C; McLaren, Christine E; English, Dallas R; Gertig, Dorota M; Delatycki, Martin B; Nicoll, Amanda J; Southey, Melissa C; Hopper, John L; Giles, Graham G; Anderson, Gregory J; Olynyk, John K; Powell, Lawrie W; Allen, Katrina J

    2009-07-01

    The risk of hemochromatosis-related morbidity is unknown among HFE compound heterozygotes (C282Y/H63D). We used a prospective population-based cohort study to estimate the prevalence of elevated iron indices and hemochromatosis-related morbidity for compound heterozygotes. In all, 31,192 subjects of northern European descent were genotyped for HFE C282Y and H63D. An HFE-genotype stratified random sample of 1,438 subjects, followed for an average of 12 years to a mean age of 65 years, completed questionnaires and gave blood. Clinical examinations were blinded to HFE genotype. A total of 180 (84 males) clinically examined C282Y/H63D participants were compared with 330 (149 males) controls with neither HFE mutation; 132 (65 males) and 270 (122 males), respectively, had serum iron measures at both timepoints. Mean serum ferritin (SF) and transferrin saturation (TS) were significantly greater for male and female compound heterozygotes than for wild-types at baseline and follow-up (all P females who were premenopausal at baseline, where SF was similar in both genotype groups. For subjects with serum measures from both baseline and follow-up, mean SF and TS levels did not change significantly for men or for postmenopausal women, but for premenopausal women SF levels increased from 43 to 109 microg/L for compound heterozygotes and from 35 to 64 microg/L for wild-types (both P female compound heterozygotes had a similar prevalence of hemochromatosis-related morbidity to wild-types. One of 82 males and zero of 95 females had documented iron overload-related disease. For male compound heterozygotes, mean iron indices do not change during middle age but for female compound heterozygotes menopause results in increased mean SF. Although compound heterozygotes might maintain elevated iron indices during middle age, documented iron overload-related disease is rare.

  13. HFE gene mutations in patients with primary iron overload: is there a significant improvement in molecular diagnosis yield with HFE sequencing?

    Science.gov (United States)

    Santos, Paulo C J L; Pereira, Alexandre C; Cançado, Rodolfo D; Schettert, Isolmar T; Sobreira, Tiago J P; Oliveira, Paulo S L; Hirata, Rosario D C; Hirata, Mario H; Figueiredo, Maria Stella; Chiattone, Carlos S; Krieger, Jose E; Guerra-Shinohara, Elvira M

    2010-12-15

    Rare HFE variants have been shown to be associated with hereditary hemochromatosis (HH), an iron overload disease. The low frequency of the HFE p.C282Y mutation in HH-affected Brazilian patients may suggest that other HFE-related mutations may also be implicated in the pathogenesis of HH in this population. The main aim was to screen for new HFE mutations in Brazilian individuals with primary iron overload and to investigate their relationship with HH. Fifty Brazilian patients with primary iron overload (transferrin saturation>50% in females and 60% in males) were selected. Subsequent bidirectional sequencing for each HFE exon was performed. The effect of HFE mutations on protein structure were analyzed by molecular dynamics simulation and free binding energy calculations. p.C282Y in homozygosis or in heterozygosis with p.H63D were the most frequent genotypic combinations associated with HH in our sample population (present in 17 individuals, 34%). Thirty-six (72.0%) out of the 50 individuals presented at least one HFE mutation. The most frequent genotype associated with HH was the homozygous p.C282Y mutation (n=11, 22.0%). One novel mutation (p.V256I) was indentified in heterozygosis with the p.H63D mutation. In silico modeling analysis of protein behavior indicated that the p.V256I mutation does not reduce the binding affinity between HFE and β2-microglobulin (β2M) in the same way the p.C282Y mutation does compared with the native HFE protein. In conclusion, screening of HFE through direct sequencing, as compared to p.C282Y/p.H63D genotyping, was not able to increase the molecular diagnosis yield of HH. The novel p.V256I mutation could not be implicated in the molecular basis of the HH phenotype, although its role cannot be completely excluded in HH-phenotype development. Our molecular modeling analysis can help in the analysis of novel, previously undescribed, HFE mutations. Copyright © 2010 Elsevier Inc. All rights reserved.

  14. Molecular epidemiology of HFE gene polymorphic variants (C282Y, H63D and S65C) in the population of Espírito Santo, Brazil.

    Science.gov (United States)

    Alves, L N R; Santos, E V W; Stur, E; Silva Conforti, A M A; Louro, I D

    2016-04-27

    Hereditary hemochromatosis (HH) is an autosomal recessive disorder that leads to progressive iron accumulation and may cause cirrhosis, hepatocellular carcinoma, diabetes, and heart failure. Most cases of HH have been linked to mutations in genes associated with iron homeostasis. There have been three major variants in the high Fe (HFE) gene associated with the disease: C282Y, H63D and S65C. In this context, we aimed to evaluate the prevalence of the polymorphic variants (C282Y, H63D and S65C) of the HFE gene in the population of the Espírito Santo State (ES), Brazil by analyzing three different groups: general population (N = 120), Pomeranian descendants (N = 59), and patients with HH (N = 20). Using genomic DNA extracted from peripheral blood, polymorphic variant identification was performed by polymerase chain reaction-restriction fragment length polymorphism. Statistically significant differences were observed for genotype distribution of C282Y (P HFE gene allele frequencies for the general population, Pomeranian subpopulation, and patients with HH of ES, Brazil.

  15. Lack of association of C282Y and H63D mutations in the hemochromatosis (HFE) gene with diabetes mellitus type 2 in a case-control study of women in Brazil.

    Science.gov (United States)

    Gomes, K B; Carvalho, M G; Coelho, F F; Rodrigues, I F; Soares, A L; Guimarães, D A; Fernandes, A P

    2009-10-27

    Hereditary hemochromatosis is one of the most common autosomal recessive diseases; it is characterized by excess absorption of iron. Clinically, the major challenge is to diagnose increased iron deposition before irreversible tissue damage has occurred. C282Y and H63D are the main mutations related to hereditary hemochromatosis; these mutations have been reported to be associated with increased risk of developing diabetes mellitus type 2 (DM2). We investigated whether these mutations are associated with increased risk for the development of DM2 in women in Brazil. Seventy-two women with clinical diagnosis of DM2 under treatment with hypoglycemic agents and a control group composed of 72 women with no clinical history of diabetes were studied. The C282Y and H63D mutations were determined by PCR-RFLP. Significant differences were not observed for C282Y and H63D, when we compared diabetic and non-diabetic women. We suggest that mutations C282Y and H63D in the HFE gene are not significant risk factors for the development of DM2 in Brazilian women.

  16. C282Y and H63D Mutation Frequencies in a Population from Central Spain

    Directory of Open Access Journals (Sweden)

    S. Alvarez

    2001-01-01

    Full Text Available Objectives: To determine the frequency of hereditary hemochromatosis gene mutations, C282Y and H63D, from 125 autochthonous blood donors originating from a Central region of Spain, to provide epidemiological data about HFE gene in the Iberian Peninsula.

  17. [ALLELES C282Y AND H63D HFE GENE, INSULIN RESISTANCE AND SUSCEPTIBILITY TO DISTURBANCE OF PORPHYRIN METABOLISM IN NON-ALCOHOLIC FATTY LIVER DISEASE].

    Science.gov (United States)

    Krivosheev, A B; Maximov, V N; Voevoda, M I; Kuimov, A D; Kondratova, M A; Tuguleva, T A; Koval, O N; Bezrukova, A A; Bogorianova, P A; Rybina, O V

    2015-01-01

    The aim of the present work was to study the frequency of genotypes and alleles of C282Y and H63D HFE gene that may be associated with impaired porphyrin metabolism, as well as possible reasons for the formation of dysmetabolism porphyrins with NAFLD. The study involved 65 patients (52 men and 13 women) aged 21 to 69 years (mean age 48.5±1.5 years). Excretion uroporphyrin, coproporphyrin, 6-aminolevulinic acid of porphobilinogen in urine was determined by chromatography and spectrophotometry calculated total excretion of porphyrins. Allele frequencies C282Y and H63D were determined during the molecular genetic analysis of DNA using the polymerase chain reaction followed by analysis of length polymorphism restraktsionnyh fragments. Condition of carbohydrate metabolism was evaluated by the level of fasting blood glucose and standard glucose tolerance test. Diagnosis of insulin resistance was performed according to the criteria proposed by the European Group for the Study of insulin resistance (EGIR). Skill test for the C282Y mutation carriage and H63D in the HFE gene in 65 patients with non-alcoholic fatty liver disease. Disturbances in the metabolism of porphyrins were recorded in 43 (66.2%) patients. H63D and C282Y mutations were found in 18 (27.7%) patients, of whom 13 (72.2%) people with different options dismetabolism porphyrins and signs of insulin resistance. In 47 (72.3%) patients without mutations studied porphyrin metabolism disorders were detected in 30 (63.8 %), of which insulin resistance is registered only in 16 (34.0 %). Detection of mutations C282Y and H63D in the HFE gene in combination with disorders of porphyrin metabolism on the background of insulin resistance is likely to allow such patients considered as candidates for inclusion in the higher risk of formation of diabetes.

  18. HFE mutations and hemochromatosis in Danish patients admitted for HFE genotyping

    DEFF Research Database (Denmark)

    Koefoed, P; Dalhoff, K; Dissing, J

    2002-01-01

    Analysis of the common C282Y and H63D mutations in the HFE gene is widely used to diagnose hereditary hemochromatosis (HH). The aim of this study was to evaluate the efficiency with which different hospitals and general practitioners select patients for HH genotype and to determine the distribution...... of HFE mutations in such patients. Nine hundred unrelated patients from Danish hospitals and general practitioners (group A) and 69 consecutive patients from a specialized liver unit (group B) were examined for HFE substitutions using multiplex real-time polymerase chain reaction. In group A we found 13...... in the H63D homozygotes or S65C heterozygotes. Moreover, 7 wild-type patients, 2 C282Y heterozygote patients and one H63D heterozygote patient fulfilled the criteria for HH. The significant enrichment of HH among associated genotype samples submitted for HFE testing indicates that the clinical selection...

  19. Hemochromatosis C282Y gene mutation as a potential susceptibility factor for iron-overload in Egyptian beta-thalassemia patients

    Directory of Open Access Journals (Sweden)

    G.M. Mokhtar

    2018-04-01

    Full Text Available Background: Hereditary hemochromatosis is the most frequent cause of primary iron overload that is associated with HFE gene’s mutation especially the C282Y mutation. The interaction between hemoglobin chain synthesis’ disorders and the C282Y mutation may worsen the clinical picture of beta-thalassemia major (β-TM. Aim: To establish the prevalence of the C282Y mutations in Egyptian β-TM patients and to address its adverse effects. Methods: Two-hundred and five β-TM patients were recruited and divided into two groups based on their serum ferritin (SF; group I (N = 125 (SF ≤ 2500 ng/dl and group II (N = 80 (SF > 2500 ng/dl. All patients were subjected to clinical and laboratory assessment with special emphasis on iron overload complications. Genotyping was assessed by polymerase chain reaction for detection of C282Y mutation in HFE gene. Results: The C282Y mutation was not detected in the studied β-TM neither in homozygous nor heterozygous state. There were several iron overload complications including cardiac complication (9.1%, liver disease (36.6%, delayed puberty (56.6%, primary (35.71% and secondary amenorrhea (21.42%, short stature (27.3%, diabetes (3.4%, neutropenia (9.7%, arthralgia (10.2%, gastrointestinal (21.1%, depression (2.9% and others (12.05%. Group I showed a statistically significant lower rate of taking iron-rich diet when compared to group II. Group II showed significant longer mean duration of disease, higher total transfusion rate per life, lower mean HbF% level, higher mean HbA% level, and higher rate of elevated liver enzymes than patients with SF ≤ 2500 ng/dl. Conclusion: The C282Y mutation was not detected in the studied cohort of Egyptian β-TM patients neither in homozygous nor heterozygous state in spite of manifestations of iron overload complications. Keywords: Beta-thalassemia major, Hereditary hemochromatosis, The C282Y mutation, Iron overload complications, Egyptian

  20. Analysis of HFE gene mutations and HLA-A alleles in Brazilian patients with iron overload

    Directory of Open Access Journals (Sweden)

    Rodolfo Delfini Cançado

    Full Text Available CONTEXT AND OBJECTIVE: Hemochromatosis is a common inherited disorder of iron metabolism and one of the most important causes of iron overload. The objective was to analyze the presence of C282Y, H63D and S65C mutations in the HFE gene and HLA-A alleles for a group of Brazilian patients with iron overload, and to correlate genotype with clinical and laboratory variables. DESIGN AND SETTING: Prospective study, in Discipline of Hematology and Oncology, Faculdade de Ciências Médicas da Santa Casa de Misericórdia de São Paulo. METHODS: We studied 35 patients with iron overload seen at our outpatient unit between January 2001 and December 2003. Fasting levels of serum iron and ferritin, and total iron-binding capacity, were assayed using standard techniques. Determinations of C282Y, H63D and S65C mutations in the HFE gene and of HLA-A alleles were performed by polymerase chain reaction (PCR. RESULTS: Twenty-six out of 35 patients (74% presented at least one of the HFE gene mutations analyzed. Among these, five (14% were C282Y/C282Y, four (11% C282Y/H63D, one (3% H63D/H63D, six (17% C282Y/WT and ten (29% H63D/WT. No patients had the S65C mutation and nine (25% did not present any of the three HFE mutations. Four out of five patients with C282Y/C282Y genotype (80% and three out of four patients with C282Y/H63D genotype (75% were HLA A*03. CONCLUSION: Analysis of HFE gene mutations constitutes an important procedure in identifying patients with hereditary hemochromatosis, particularly for patients with iron overload.

  1. Hemochromatosis (HFE gene mutations in Brazilian chronic hemodialysis patients

    Directory of Open Access Journals (Sweden)

    F.V. Perícole

    2005-09-01

    Full Text Available Patients with chronic renal insufficiency (CRI have reduced hemoglobin levels, mostly as a result of decreased kidney production of erythropoietin, but the relation between renal insufficiency and the magnitude of hemoglobin reduction has not been well defined. Hereditary hemochromatosis is an inherited disorder of iron metabolism. The importance of the association of hemochromatosis with treatment for anemia among patients with CRI has not been well described. We analyzed the frequency of the C282Y and H63D mutations in the HFE gene in 201 Brazilian individuals with CRI undergoing hemodialysis. The analysis of the effects of HFE mutations on iron metabolism and anemia with biochemical parameters was possible in 118 patients of this study (hemoglobin, hematocrit, ferritin levels, transferrin saturation, and serum iron. A C282Y heterozygous mutation was found in 7/201 (3.4% and H63D homozygous and heterozygous mutation were found in 2/201 (1.0% and 46/201 (22.9%, respectively. The allelic frequencies of the HFE mutations (0.017 for C282Y mutation and 0.124 for H63D mutation did not differ between patients with CRI and healthy controls. Regarding the biochemical parameters, no differences were observed between HFE heterozygous and mutation-negative patients, although ferritin levels were not higher among patients with the H63D mutation (P = 0.08. From what we observed in our study, C282Y/H63D HFE gene mutations are not related to degrees of anemia or iron stores in CRI patients receiving intravenous iron supplementation (P > 0.10. Nevertheless, the present data suggest that the H63D mutation may have an important function as a modulating factor of iron overload in these patients.

  2. Hemochromatosis (HFE) gene mutations and response to chloroquine in porphyria cutanea tarda.

    Science.gov (United States)

    Stölzel, Ulrich; Köstler, Erich; Schuppan, Detlef; Richter, Matthias; Wollina, Uwe; Doss, Manfred O; Wittekind, Christian; Tannapfel, Andrea

    2003-03-01

    To examine the role of hemochromatosis (HFE) gene mutations, which are associated with porphyria cutanea tarda (PCT), in the therapeutic response to chloroquine. We retrospectively analyzed a database (Excel version 2001 [Microsoft Excel, Redmond, Wash]; date range of search, 1985-1999) of chloroquine-treated patients with PCT on whether HFE mutations (C282Y and H63D) might have influenced the clinical response, urinary porphyrin excretion, liver enzyme activities, and serum iron markers. Serum samples and corresponding complete sets of data before and after therapy were available in 62 of 207 patients with PCT who were treated exclusively with chloroquine. Academic teaching hospital. For treatment, low-dose chloroquine diphosphate, 125 to 250 mg twice weekly, was used during a median time of 16 months (range, 12-26 months). Of the 62 German patients with PCT, 37 (60%) carries HFE mutations. Chloroquine therapy was accompanied by clinical remission and reduced urinary porphyrin excretion (P<.001) in the 24 patients (39%) with HFE wild type as well as in 35 HFE heterozygous patients with PCT (56%). Decreases of serum iron markers following chloroquine therapy were limited to patients with PCT and HFE wild type. All patients homozygous for the C282Y mutation (3 [5%] of 62) had high serum iron, ferritin, and transferrin saturation and failed to respond to chloroquine treatment. The therapeutic response to chloroquine was not compromised by C282Y heterozygosity and compound heterozygosity of HFE mutations. Because HFE C282Y homozygotes (+/+) did not respond to chloroquine and a decrease in serum iron concentration was limited to patients with PCT and HFE wild type, phlebotomy should be first-line therapy in patients with PCT and HFE mutations.

  3. HFE C282Y and H63D in adults with malignancies in a community medical oncology practice

    International Nuclear Information System (INIS)

    Barton, James C; Bertoli, Luigi F; Acton, Ronald T

    2004-01-01

    We sought to compare frequencies of HFE C282Y and H63D alleles and associated odds ratios (OR) in 100 consecutive unrelated white adults with malignancy to those in 318 controls. Data from patients with more than one malignancy were analyzed according to each primary malignancy. For the present study, OR ≥2.0 or ≤0.5 was defined to be increased or decreased, respectively. There were 110 primary malignancies (52 hematologic neoplasms, 58 carcinomas) in the 100 adult patients. Allele frequencies were similar in patients and controls (C282Y: 0.0850 vs. 0.0896, respectively (OR = 0.9); H63D: 0.1400 vs. 0.1447, respectively (OR = 0.9)). Two patients had hemochromatosis and C282Y homozygosity. With C282Y, increased OR occurred in non-Hodgkin lymphoma, myeloproliferative disorders, and adenocarcinoma of prostate (2.0, 2.8, and 3.4, respectively); OR was decreased in myelodysplasia (0.4). With H63D, increased OR occurred in myeloproliferative disorders and adenocarcinomas of breast and prostate (2.4, 2.0, and 2.0, respectively); OR was decreased in non-Hodgkin lymphoma and B-chronic lymphocytic leukemia (0.5 and 0.4, respectively). In 100 consecutive adults with malignancy evaluated in a community medical oncology practice, frequencies of HFE C282Y or H63D were similar to those in the general population. This suggests that C282Y or H63D is not associated with an overall increase in cancer risk. However, odds ratios computed in the present study suggest that increased (or decreased) risk for developing specific types of malignancy may be associated with the inheritance of HFE C282Y or H63D. Study of more patients with these specific types of malignancies is needed to determine if trends described herein would remain and yield significant differences

  4. HFE Cys282Tyr homozygotes with serum ferritin concentrations below 1000 microg/L are at low risk of hemochromatosis.

    Science.gov (United States)

    Allen, Katrina J; Bertalli, Nadine A; Osborne, Nicholas J; Constantine, Clare C; Delatycki, Martin B; Nisselle, Amy E; Nicoll, Amanda J; Gertig, Dorota M; McLaren, Christine E; Giles, Graham G; Hopper, John L; Anderson, Gregory J; Olynyk, John K; Powell, Lawrie W; Gurrin, Lyle C

    2010-09-01

    Hemochromatosis gene (HFE)-associated hereditary hemochromatosis (HH) is a genetic predisposition to iron overload and subsequent signs and symptoms of disease that potentially affects approximately 80,000 persons in Australia and almost 1 million persons in the United States. Most clinical cases are homozygous for the Cys282Tyr (C282Y) mutation in the HFE gene, with serum ferritin (SF) concentration >1000 microg/L as the strongest predictor of cirrhosis. The optimal treatment regimen for those with SF concentrations above the normal range but aged 40-69 years. An HFE-stratified random sample of 1438 participants including all C282Y homozygotes with iron studies 12 years apart were examined by physicians blinded to participants' HFE genotype. All previously undiagnosed C282Y homozygotes (35 male, 67 female) and all HFE wild-types (131 male, 160 female) with baseline and follow-up SF concentrations age when disease would be expected to have developed. These observations have implications for the management of C282Y homozygotes.

  5. Clinical penetrance in hereditary hemochromatosis: estimates of the cumulative incidence of severe liver disease among HFE C282Y homozygotes.

    Science.gov (United States)

    Grosse, Scott D; Gurrin, Lyle C; Bertalli, Nadine A; Allen, Katrina J

    2018-04-01

    Iron overload (hemochromatosis) can cause serious, symptomatic disease that is preventable if detected early and managed appropriately. The leading cause of hemochromatosis in populations of predominantly European ancestry is homozygosity of the C282Y variant in the HFE gene. Screening of adults for iron overload or associated genotypes is controversial, largely because of a belief that severe phenotypes are uncommon, although cascade testing of first-degree relatives of patients is widely endorsed. We contend that severe liver disease (cirrhosis or hepatocellular cancer) is not at all uncommon among older males with hereditary hemochromatosis. Our review of the published data from a variety of empirical sources indicates that roughly 1 in 10 male HFE C282Y homozygotes is likely to develop severe liver disease during his lifetime unless iron overload is detected early and treated. New evidence from a randomized controlled trial of treatment allows for evidence-based management of presymptomatic patients. Although population screening for HFE C282Y homozygosity faces multiple barriers, a potentially effective strategy for increasing the early detection and prevention of clinical iron overload and severe disease is to include HFE C282Y homozygosity in lists of medically actionable gene variants when reporting the results of genome or exome sequencing.

  6. HFE Gene Mutations and Iron Status in 100 Healthy Polish Children.

    Science.gov (United States)

    Kaczorowska-Hac, Barbara; Luszczyk, Marcin; Antosiewicz, Jedrzej; Ziolkowski, Wieslaw; Adamkiewicz-Drozynska, Elzbieta; Mysliwiec, Malgorzata; Milosz, Ewa; Kaczor, Jan J

    2017-07-01

    Iron participates in oxygen transport, energetic, metabolic, and immunologic processes. There are 2 main causes of iron overload: hereditary hemochromatosis which is a primary cause, is a metabolic disorder caused by mutations of genes that control iron metabolism and secondary hemochromatosis caused by multitransfusions, chronic hemolysis, and intake of iron rich food. The most common type of hereditary hemochromatosis is caused by HFE gene mutation. In this study, we analyzed iron metabolism in 100 healthy Polish children in relation to their HFE gene status. The wild-type HFE gene was predominant being observed in 60 children (60%). Twenty-five children (25%), presented with heterozygotic H63D mutation, and 15 children (15%), presented with other mutations (heterozygotic C282Y and S65C mutation, compound heterozygotes C282Y/S65C, C282Y/H63D, H63D homozygote). The mean concentration of iron, the level of ferritin, and transferrin saturation were statistically higher in the group of HFE variants compared with the wild-type group. H63D carriers presented with higher mean concentration of iron, ferritin levels, and transferrin saturation compared with the wild-type group. Male HFE carriers presented with higher iron concentration, transferrin saturation, and ferritin levels than females. This preliminary investigation demonstrates allelic impact on potential disease progression from childhood.

  7. White blood cells and subtypes in HFE p.C282Y and wild-type homozygotes in the Hemochromatosis and Iron Overload Screening Study.

    Science.gov (United States)

    Barton, James C; Barton, J Clayborn; Acton, Ronald T

    2017-03-01

    The major histocompatibility complex is linked to white blood cell (WBC) and lymphocyte counts in subjects unselected for HFE genotypes. We compared age, sex, body mass index, total WBC and subtypes (neutrophils, lymphocytes, monocytes, eosinophils, basophils) (Beckman Coulter® Gen-S), transferrin saturation, and serum ferritin of HFE p.C282Y and wild-type (p.C282Y, p.H63D negative) homozygotes without acquired conditions that influence WBC counts. We performed regressions on WBC and subtypes. There were 161 p.C282Y homozygotes (45.3% men) and 221 wild-type homozygotes (40.3% men). Mean WBC of men and women and between HFE genotypes were similar. Mean lymphocytes were higher in male p.C282Y homozygotes: 1.6×10 9 /L [95% confidence interval: 1.5,1.7] vs. 1.4 [1.3,1.5], p=0.0002. Mean lymphocytes and basophils were higher in female p.C282Y homozygotes: 1.6 [1.5,1.7] vs. 1.4 [1.3,1.5], p=0.0002; and 0.065 [0.059,0.071] vs. 0.052 [0.051,0.054], p=0.0001, respectively. Transferrin saturation was associated with neutrophils (negative; p=0.0163). Age was associated with lymphocytes (negative; p=0.0003) and monocytes (positive; p<0.0001). Regressions on lymphocytes and basophils revealed positive associations with p.C282Y homozygosity (p=0.0043 and 0.0003, respectively). There were significant positive associations of neutrophils, lymphocytes, monocytes, and eosinophils. We conclude that HFE p.C282Y homozygosity is significantly associated with lymphocyte and basophil counts. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Association of HFE gene mutations with nonalcoholic fatty liver disease in the Iranian population.

    Science.gov (United States)

    Saremi, L; Lotfipanah, S; Mohammadi, M; Hosseinzadeh, H; Sayad, A; Saltanatpour, Z

    2016-10-31

    To determine whether the HFE gene variants H63D and C282Y are associated with NAFLD in persons with type 2 diabetes, we conducted a case-control study including 145 case of NAFLD patients with a history of type 2 diabetes and 145 matching control. The genomic DNA was extracted from the peripheral venous blood and the genotyping of HFE gene mutations was analyzed using the PCR-RFLP technique. Statistical analysis was performed using SPSS 12.0 software by χ2 test, t test and ANOVA (P<0.05). Data showed no increased frequency of HFE mutations in persons with type 2 diabetes and no association between H63D mutation and NAFLD in the study population. Also, we analyzed index of physiological variables including FBS, lipid profile (TC, TG, LDL-C, and HDL-C), BMI, HbA1c, and micro albuminuria and Cr levels). Data showed there are no relationship between these indexes and HFE gene mutations and either NAFLD as a complication of diabetes. But our results showed a relationship between C282Y mutation and NAFLD in persons with type 2 diabetes. C282Y mutation might be a genetic marker of NAFLD in Iranian population.

  9. CYBRD1 as a modifier gene that modulates iron phenotype in HFE p.C282Y homozygous patients.

    Science.gov (United States)

    Pelucchi, Sara; Mariani, Raffaella; Calza, Stefano; Fracanzani, Anna Ludovica; Modignani, Giulia Litta; Bertola, Francesca; Busti, Fabiana; Trombini, Paola; Fraquelli, Mirella; Forni, Gian Luca; Girelli, Domenico; Fargion, Silvia; Specchia, Claudia; Piperno, Alberto

    2012-12-01

    Most patients with hereditary hemochromatosis in the Caucasian population are homozygous for the p.C282Y mutation in the HFE gene. The penetrance and expression of hereditary hemochromatosis differ largely among cases of homozygous p.C282Y. Genetic factors might be involved in addition to environmental factors. In the present study, we analyzed 50 candidate genes involved in iron metabolism and evaluated the association between 214 single nucleotide polymorphisms in these genes and three phenotypic outcomes of iron overload (serum ferritin, iron removed and transferrin saturation) in a large group of 296 p.C282Y homozygous Italians. Polymorphisms were tested for genetic association with each single outcome using linear regression models adjusted for age, sex and alcohol consumption. We found a series of 17 genetic variants located in different genes with possible additive effects on the studied outcomes. In order to evaluate whether the selected polymorphisms could provide a predictive signature for adverse phenotype, we re-evaluated data by dividing patients in two extreme phenotype classes based on the three phenotypic outcomes. We found that only a small improvement in prediction could be achieved by adding genetic information to clinical data. Among the selected polymorphisms, a significant association was observed between rs3806562, located in the 5'UTR of CYBRD1, and transferrin saturation. This variant belongs to the same haplotype block that contains the CYBRD1 polymorphism rs884409, found to be associated with serum ferritin in another population of p.C282Y homozygotes, and able to modulate promoter activity. A luciferase assay indicated that rs3806562 does not have a significant functional role, suggesting that it is a genetic marker linked to the putative genetic modifier rs884409. While our results support the hypothesis that polymorphisms in genes regulating iron metabolism may modulate penetrance of HFE-hereditary hemochromatosis, with emphasis on

  10. Study of the effect of HFE gene mutations on iron overload in ...

    African Journals Online (AJOL)

    Background: HFE gene mutations have been shown to be responsible for hereditary hemochromatosis. Their effect on iron load in β-thalassemia patients and carriers remains controversial. Objectives: We aimed to determine the prevalence of HFE gene mutations (C282Y and H63D) in β-thalassemia patients and carriers ...

  11. Iron overload and HFE gene mutations in Czech patients with chronic liver diseases.

    Science.gov (United States)

    Dostalikova-Cimburova, Marketa; Kratka, Karolina; Stransky, Jaroslav; Putova, Ivana; Cieslarova, Blanka; Horak, Jiri

    2012-01-01

    The aim of the study was to identify the prevalence of HFE gene mutations in Czech patients with chronic liver diseases and the influence of the mutations on iron status. The presence of HFE gene mutations (C282Y, H63D, and S65C) analyzed by the PCR-RFLP method, presence of cirrhosis, and serum iron indices were compared among 454 patients with different chronic liver diseases (51 with chronic hepatitis B, 122 with chronic hepatitis C, 218 with alcoholic liver disease, and 63 patients with hemochromatosis). Chronic liver diseases patients other than hemochromatics did not have an increased frequency of HFE gene mutations compared to controls. Although 33.3% of patients with hepatitis B, 43% of patients with hepatitis C, and 73.2% of patients with alcoholic liver disease had elevated transferrin saturation or serum ferritin levels, the presence of HFE gene mutations was not significantly associated with iron overload in these patients. Additionally, patients with cirrhosis did not have frequencies of HFE mutations different from those without cirrhosis. This study emphasizes the importance, not only of C282Y, but also of the H63D homozygous genetic constellation in Czech hemochromatosis patients. Our findings show that increased iron indices are common in chronic liver diseases but {\\it HFE} mutations do not play an important role in the pathogenesis of chronic hepatitis B, chronic hepatitis C, and alcoholic liver disease.

  12. The association between the C282Y and H63D polymorphisms of HFE gene and the risk of Parkinson's disease: A meta-analysis.

    Science.gov (United States)

    Xia, Jianjian; Xu, Huamin; Jiang, Hong; Xie, Junxia

    2015-05-19

    Impaired brain iron homeostasis has been considered as an important mechanism in Parkinson's diseases (PD). There are indications that C282Y and H63D polymorphisms of HFE genes involved in iron metabolism might contribute to the pathogenesis of PD in some cases. However, the investigation of the relationship between PD and the two polymorphisms had produced contradictory results. We performed a meta-analysis to assess the C282Y and H63D polymorphisms of HFE in PD susceptibility. PubMed, EMBASE and Web of Science were systematically searched to identify relevant researches. The strict selection criteria and exclusion standard were applied. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of associations. A fixed-effect or random-effect model was selected, depending on the results of the heterogeneity test. Fifteen studies were included in the meta-analysis (eight studies with 1631 cases and 4548 controls for C282Y; seven studies with 1192 cases and 4065 controls for H63D). For the C282Y polymorphism, significant associations were observed in the Recessive model (YY vs CY+CC: OR=0.22, 95% CI=0.09-0.57, P=0.002). This indicated that the C282Y polymorphism in HFE might be a potential protective factor for PD. However, no significant associations were found for any genetic model for the H63D polymorphism, suggesting that the H63D polymorphism might not be associated with PD. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  13. Metabolic alterations, HFE gene mutations and atherogenic lipoprotein modifications in patients with primary iron overload.

    Science.gov (United States)

    Meroño, Tomás; Brites, Fernando; Dauteuille, Carolane; Lhomme, Marie; Menafra, Martín; Arteaga, Alejandra; Castro, Marcelo; Saez, María Soledad; Ballerga, Esteban González; Sorroche, Patricia; Rey, Jorge; Lesnik, Philippe; Sordá, Juan Andrés; Chapman, M John; Kontush, Anatol; Daruich, Jorge

    2015-05-01

    Iron overload (IO) has been associated with glucose metabolism alterations and increased risk of cardiovascular disease (CVD). Primary IO is associated with mutations in the HFE gene. To which extent HFE gene mutations and metabolic alterations contribute to the presence of atherogenic lipoprotein modifications in primary IO remains undetermined. The present study aimed to assess small, dense low-density lipoprotein (LDL) levels, chemical composition of LDL and high-density lipoprotein (HDL) particles, and HDL functionality in IO patients. Eighteen male patients with primary IO and 16 sex- and age-matched controls were recruited. HFE mutations (C282Y, H63D and S65C), measures of insulin sensitivity and secretion (calculated from the oral glucose tolerance test), chemical composition and distribution profile of LDL and HDL subfractions (isolated by gradient density ultracentrifugation) and HDL functionality (as cholesterol efflux and antioxidative activity) were studied. IO patients compared with controls exhibited insulin resistance (HOMA-IR (homoeostasis model assessment-estimated insulin resistance): +93%, PHFE genotypes. C282Y homozygotes (n=7) presented a reduced β-cell function and insulin secretion compared with non-C282Y patients (n=11) (-58% and -73%, respectively, PHFE gene mutations are involved in the presence of atherogenic lipoprotein modifications in primary IO. To what extent such alterations could account for an increase in CVD risk remains to be determined.

  14. HFE H63D mutation frequency shows an increase in Turkish women with breast cancer

    Directory of Open Access Journals (Sweden)

    Guler Emine

    2006-02-01

    Full Text Available Abstract Background The hereditary hemochromatosis gene HFE plays a pivotal role in iron homeostasis. The association between cancer and HFE hetero- or homozygosity has previously been shown including hepatocellular and nonhepatocellular malignancies. This study was performed to compare frequencies of HFE C282Y and H63D variants in Turkish women with breast cancer and healthy controls. Methods Archived DNA samples of Hacettepe University Oncology Institute were used in this study. The HFE gene was investigated by PCR-RFLP. Results All subjects studied were free from C282Y mutation. Thirty-nine patients had H63D mutation and were all heterozygous. H63D allele frequency was 22.2% (39/176 in the breast cancer patients, and 14% (28/200 in the healthy volunteers. Statistical analysis of cases with HFE H63D phenotype showed significant difference between breast cancer and healthy volunteers (P = 0.02. Conclusion Our results suggest that HFE H63D mutation frequencies were increased in the breast cancer patients in comparison to those in the general population. Also, odds ratios (odds ratio = 2.05 computed in this study suggest that H63D has a positive association with breast cancer.

  15. Iron overload and HFE gene mutations in Polish patients with liver cirrhosis.

    Science.gov (United States)

    Sikorska, Katarzyna; Romanowski, Tomasz; Stalke, Piotr; Iżycka-Świeszewska, Ewa; Bielawski, Krzysztof Piotr

    2011-06-01

    Increased liver iron stores may contribute to the progression of liver injury and fibrosis, and are associated with a higher risk of hepatocellular carcinoma development. Pre-transplant symptoms of iron overload in patients with liver cirrhosis are associated with higher risk of infectious and malignant complications in liver transplant recipients. HFE gene mutations may be involved in the pathogenesis of liver iron overload and influence the progression of chronic liver diseases of different origins. This study was designed to determine the prevalence of iron overload in relation to HFE gene mutations among Polish patients with liver cirrhosis. Sixty-one patients with liver cirrhosis included in the study were compared with a control group of 42 consecutive patients subjected to liver biopsy because of chronic liver diseases. Liver function tests and serum iron markers were assessed in both groups. All patients were screened for HFE mutations (C282Y, H63D, S65C). Thirty-six of 61 patients from the study group and all controls had liver biopsy performed with semiquantitative assessment of iron deposits in hepatocytes. The biochemical markers of iron overload and iron deposits in the liver were detected with a higher frequency (70% and 47% respectively) in patients with liver cirrhosis. There were no differences in the prevalence of all HFE mutations in both groups. In patients with a diagnosis of hepatocellular carcinoma, no significant associations with iron disorders and HFE gene mutations were found. Iron disorders were detected in patients with liver cirrhosis frequently but without significant association with HFE gene mutations. Only the homozygous C282Y mutation seems to occur more frequently in the selected population of patients with liver cirrhosis. As elevated biochemical iron indices accompanied liver iron deposits more frequently in liver cirrhosis compared to controls with chronic liver disease, there is a need for more extensive studies searching for

  16. Precipitating factors of porphyria cutanea tarda in Brazil with emphasis on hemochromatosis gene (HFE) mutations. Study of 60 patients.

    Science.gov (United States)

    Vieira, Fatima Mendonça Jorge; Nakhle, Maria Cristina; Abrantes-Lemos, Clarice Pires; Cançado, Eduardo Luiz Rachid; Reis, Vitor Manoel Silva dos

    2013-01-01

    Porphyria cutanea tarda is the most common form of porphyria, characterized by the decreased activity of the uroporphyrinogen decarboxylase enzyme. Several reports associated HFE gene mutations of hereditary hemochromatosis with porphyria cutanea tarda worldwide, although up to date only one study has been conducted in Brazil. Investigation of porphyria cutanea tarda association with C282Y and H63D mutations in the HFE gene. Identification of precipitating factors (hepatitis C, HIV, alcoholism and estrogen) and their link with HFE mutations. An ambispective study of 60 patients with PCT was conducted during the period from 2003 to 2012. Serological tests for hepatitis C and HIV were performed and histories of alcohol abuse and estrogen intake were investigated. HFE mutations were identified with real-time PCR. Porphyria cutanea tarda predominated in males and alcohol abuse was the main precipitating factor. Estrogen intake was the sole precipitating factor present in 25% of female patients. Hepatitis C was present in 41.7%. All HIV-positive patients (15.3%) had a history of alcohol abuse. Allele frequency for HFE mutations, i.e., C282Y (p = 0.0001) and H63D (p = 0.0004), were significantly higher in porphyria cutanea tarda patients, compared to control group. HFE mutations had no association with the other precipitating factors. Alcohol abuse, hepatitis C and estrogen intake are prevalent precipitating factors in our porphyria cutanea tarda population; however, hemochromatosis in itself can also contribute to the outbreak of porphyria cutanea tarda, which makes the research for HFE mutations necessary in these patients.

  17. Frequency of Hereditary Hemochromatosis (HFE) Gene Mutations in Egyptian Beta Thalassemia Patients and its Relation to Iron Overload.

    Science.gov (United States)

    Enein, Azza Aboul; El Dessouky, Nermine A; Mohamed, Khalda S; Botros, Shahira K A; Abd El Gawad, Mona F; Hamdy, Mona; Dyaa, Nehal

    2016-06-15

    This study aimed to detect the most common HFE gene mutations (C282Y, H63D, and S56C) in Egyptian beta thalassemia major patients and its relation to their iron status. The study included 50 beta thalassemia major patients and 30 age and sex matched healthy persons as a control group. Serum ferritin, serum iron and TIBC level were measured. Detection of the three HFE gene mutations (C282Y, H63D and S65C) was done by PCR-RFLP analysis. Confirmation of positive cases for the mutations was done by sequencing. Neither homozygote nor carrier status for the C282Y or S65C alleles was found. The H63D heterozygous state was detected in 5/50 (10%) thalassemic patients and in 1/30 (3.3%) controls with no statistically significant difference between patients and control groups (p = 0.22). Significantly higher levels of the serum ferritin and serum iron in patients with this mutation (p = 001). Our results suggest that there is an association between H63D mutation and the severity of iron overload in thalassemic patients.

  18. Effect of HFE gene polymorphism on sustained virological response in patients with chronic hepatitis C and elevated serum ferritin.

    Science.gov (United States)

    Coelho-Borges, Silvia; Cheinquer, Hugo; Wolff, Fernando Herz; Cheinquer, Nelson; Krug, Luciano; Ashton-Prolla, Patricia

    2012-01-01

    Abnormal serum ferritin levels are found in approximately 20%-30% of the patients with chronic hepatitis C and are associated with a lower response rate to interferon therapy. To determine if the presence of HFE gene mutations had any effect on the sustained virological response rate to interferon based therapy in chronic hepatitis C patients with elevated serum ferritin. A total of 44 treatment naÏve patients with histologically demonstrated chronic hepatitis C, all infected with hepatitis C virus genotype non-1 (38 genotype 3; 6 genotype 2) and serum ferritin above 500 ng/mL were treated with interferon (3 MU, 3 times a week) and ribavirin (1.000 mg, daily) for 24 weeks. Sustained virological response was defined as negative qualitative HCV-RNA more than 24 weeks after the end of treatment. Serum HCV-RNA was measured by qualitative in house polymerase chain reaction with a limit of detection of 200 IU/mL. HFE gene mutation was detected using restriction-enzyme digestion with RsaI (C282Y mutation analysis) and BclI (H63D mutation analysis) in 16 (37%) patients, all heterozygous (11 H63D, 2 C282Y and 3 both). Sustained virological response was achieved in 0 of 16 patients with HFE gene mutations and 11 (41%) of 27 patients without HFE gene mutations (P = 0.002; exact Fisher test). Heterozigozity for H63D and/or C282Y HFE gene mutation predicts absence of sustained virological response to combination treatment with interferon and ribavirin in patients with chronic hepatitis C, non-1 genotype and serum ferritin levels above 500 ng/mL.

  19. Iron storage disease in Asia-Pacific populations: the importance of non-HFE mutations.

    Science.gov (United States)

    McDonald, Cameron J; Wallace, Daniel F; Crawford, Darrell H G; Subramaniam, V Nathan

    2013-07-01

    Hereditary hemochromatosis (HH) is a widely recognized and well-studied condition in European populations. This is largely due to the high prevalence of the C282Y mutation of HFE. Although less common than in Europe, HH cases have been reported in the Asia-Pacific region because of mutations in both HFE and non-HFE genes. Mutations in all of the currently known genes implicated in non-HFE HH (hemojuvelin, hepcidin, transferrin receptor 2, and ferroportin) have been reported in patients from the Asia-Pacific region. This review discusses the molecular basis of HH and the genes and mutations known to cause non-HFE HH with particular reference to the Asia-Pacific region. Challenges in the genetic diagnosis of non-HFE HH are also discussed and how new technologies such as next generation sequencing may be informative in the future. © 2013 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

  20. Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population: A Preliminary Study

    OpenAIRE

    Selma Ünal; Günay Balta; Fatma Gümrük

    2014-01-01

    Objective: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group. Materials and Methods: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6?6.1 years, range: 3-30 years) with beta-thalassemia major (BTM) and 13 beta-thalassemia intermedia (BTI) patients (6 males and 7 females; ...

  1. Effect of HFE gene polymorphism on sustained virological response in patients with chronic hepatitis C and elevated serum ferritin

    Directory of Open Access Journals (Sweden)

    Silvia Coelho-Borges

    2012-03-01

    Full Text Available CONTEXT: Abnormal serum ferritin levels are found in approximately 20%-30% of the patients with chronic hepatitis C and are associated with a lower response rate to interferon therapy. OBJECTIVE: To determine if the presence of HFE gene mutations had any effect on the sustained virological response rate to interferon based therapy in chronic hepatitis C patients with elevated serum ferritin. METHODS: A total of 44 treatment naÏve patients with histologically demonstrated chronic hepatitis C, all infected with hepatitis C virus genotype non-1 (38 genotype 3; 6 genotype 2 and serum ferritin above 500 ng/mL were treated with interferon (3 MU, 3 times a week and ribavirin (1.000 mg, daily for 24 weeks. RESULTS: Sustained virological response was defined as negative qualitative HCV-RNA more than 24 weeks after the end of treatment. Serum HCV-RNA was measured by qualitative in house polymerase chain reaction with a limit of detection of 200 IU/mL. HFE gene mutation was detected using restriction-enzyme digestion with RsaI (C282Y mutation analysis and BclI (H63D mutation analysis in 16 (37% patients, all heterozygous (11 H63D, 2 C282Y and 3 both. Sustained virological response was achieved in 0 of 16 patients with HFE gene mutations and 11 (41% of 27 patients without HFE gene mutations (P = 0.002; exact Fisher test. CONCLUSION: Heterozigozity for H63D and/or C282Y HFE gene mutation predicts absence of sustained virological response to combination treatment with interferon and ribavirin in patients with chronic hepatitis C, non-1 genotype and serum ferritin levels above 500 ng/mL.

  2. HFE MUTATIONS AND IRON OVERLOAD IN PATIENTS WITH ALCOHOLIC LIVER DISEASE

    Directory of Open Access Journals (Sweden)

    Luis COSTA-MATOS

    2013-03-01

    Full Text Available Context Alcoholic liver disease (ALD is generally associated with iron overload, which may contribute to its pathogenesis, through increased oxidative stress and cellular damage. There are conflicting reports in literature about hemochromatosis (HFE gene mutations and the severity of liver disease in alcoholic patients. Objectives To compare the prevalence of mutations in the hemochromatosis (HFE gene between patients with ALD and healthy controls; to assess the relation of HFE mutations with liver iron stores and liver disease severity. Methods Liver biopsy specimens were obtained from 63 ALD patients (during routine treatment and 52 healthy controls (during elective cholecystectomy. All individuals underwent routine liver function tests and HFE genotyping (to detect wild-type sequences and C282Y, H63D, S65C, E168Q, E168X, V59M, H63H, P160delC, Q127H, Q283P, V53M and W164X mutations. Associations between HFE mutations and risk of excessive liver iron stores, abnormal serum ferritin, liver fibrosis, or necroinflammatory activity were assessed by multivariate logistic regression analysis. Results ALD patients had significantly higher serum ferritin and transferrin saturation than controls (both P<0.05, but the distribution of HFE mutations was similar between the two groups. For ALD patients, the odds ratio for having at least one HFE mutation and excessive liver iron stores was 17.23 (95% confidence interval (CI: 2.09-142.34, P = 0.008. However, the presence of at least one HFE mutation was not associated with an increased risk of liver fibrosis or necroinflammatory activity. Active alcohol ingestion showed the strongest association to increased serum ferritin (OR = 8.87, 95% CI: 2.11-34.78, P = 0.003. Conclusions ALD patients do not present with a differential profile of HFE mutations from healthy controls. In ALD patients, however, the presence of at least one HFE mutation increases the risk of having excessive liver iron stores but has no

  3. Association between the HFE C282Y, H63D Polymorphisms and the Risks of Non-Alcoholic Fatty Liver Disease, Liver Cirrhosis and Hepatocellular Carcinoma: An Updated Systematic Review and Meta-Analysis of 5,758 Cases and 14,741 Controls

    Science.gov (United States)

    Yin, Wei-Li; Wang, Feng-Mei; Han, Tao

    2016-01-01

    Background Conflicting results have been obtained for the association between two common polymorphisms (C282Y, H63D) of human HFE (hereditary hemochromatosis) gene and the risks of the liver diseases, including non-alcoholic fatty liver disease (NAFLD), liver cirrhosis and hepatocellular carcinoma (HCC). Methods An updated systematic review and meta-analysis was conducted to evaluate the potential role of HFE polymorphisms in the susceptibility to NAFLD, liver cirrhosis and HCC. After retrieving articles from online databases, eligible studies were enrolled according to the selection criteria. Stata/SE 12.0 software was utilized to perform the statistical analysis. Results In total, 43 articles with 5,758 cases and 14,741 controls were selected. Compared with the control group, a significantly increased risk of NAFLD was observed for the C282Y polymorphism in the Caucasian population under all genetic models and for the H63D polymorphism under the allele, heterozygote and dominant models (all OR>1, PassociationHFE C282Y and H63D (all Passociation>0.05). In addition, we found that HFE C282Y was statistically associated with increased HCC susceptibility in the overall population, while H63D increased the odds of developing non-cirrhotic HCC in the African population (all OR>1, PassociationHFE C282Y and H63D polymorphisms confer increased genetic susceptibility to NAFLD and HCC but not liver cirrhosis. Additional well-powered studies are required to confirm our conclusion. PMID:27657935

  4. Was the C282Y mutation an Irish Gaelic mutation that the Vikings helped disseminate?

    DEFF Research Database (Denmark)

    Olsson, Karl Sigvard; Konar, Jan; Dufva, Inge Hoegh

    2011-01-01

    The HLA-related hemochromatosis mutation C282Y is thought to have originated in Ireland in a person with HLA-A3-B14 and was spread by Vikings. Irish people with two HLA-A3 alleles had a high risk of hemochromatosis. In this study, from west Sweden, we wanted to test these hypotheses.......The HLA-related hemochromatosis mutation C282Y is thought to have originated in Ireland in a person with HLA-A3-B14 and was spread by Vikings. Irish people with two HLA-A3 alleles had a high risk of hemochromatosis. In this study, from west Sweden, we wanted to test these hypotheses....

  5. Association Studies of HFE C282Y and H63D Variants with Oral Cancer Risk and Iron Homeostasis Among Whites and Blacks

    Directory of Open Access Journals (Sweden)

    Nathan R. Jones

    2015-12-01

    Full Text Available Background: Polymorphisms in the hemochromatosis (HFE gene are associated with excessive iron absorption from the diet, and pro-oxidant effects of iron accumulation are thought to be a risk factor for several types of cancer. Methods: The C282Y (rs1800562 and H63D (rs1799945 polymorphisms were genotyped in 301 oral cancer cases and 437 controls and analyzed in relation to oral cancer risk, and serum iron biomarker levels from a subset of 130 subjects. Results: Individuals with the C282Y allele had lower total iron binding capacity (TIBC (321.2 ± 37.2 µg/dL vs. 397.7 ± 89.0 µg/dL, p = 0.007 and higher percent transferrin saturation (22.0 ± 8.7 vs. 35.6 ± 22.9, p = 0.023 than wild type individuals. Iron and ferritin levels approached significantly higher levels for the C282Y allele (p = 0.0632 and p = 0.0588, respectively. Conclusions: Iron biomarker levels were elevated by the C282Y allele, but neither (rs1800562 nor (rs1799945 was associated with oral cancer risk in blacks and whites.

  6. Effect of Hereditary Hemochromatosis Gene H63D and C282Y Mutations on Iron Overload in Sickle Cell Disease Patients

    Directory of Open Access Journals (Sweden)

    Yunus Kasım Terzi

    2016-12-01

    Full Text Available Objective: Hemochromatosis is an autosomal recessive disease that is one of the most important reasons for iron overload. Sickle cell disease is a hemoglobinopathy that occurs as a result of a homozygous mutation in the hemoglobin gene. Erythrocyte transfusion is frequently used in the treatment of this disease. Iron overload as a result of transfusion is important in the mortality and morbidity of sickle cell anemia patients as well as in other hemoglobinopathies. In this study, the effect of hemochromatosis gene (HFE p.H63D and p.C282Y mutations on transfusion-related cardiac and liver iron overload in sickle cell disease patients who carry homozygous hemoglobin S mutation has been investigated. Materials and Methods: This is a prospective single-center crosssectional study in patients with homozygous hemoglobin S mutation between the years 2008 and 2013. The patients were divided into two groups. The first group (group A, n=31 was receiving chelation therapy and the second group (group B, n=13 was not. Direct and indirect iron loads were analyzed by magnetic resonance imaging and biochemically, respectively. HFE gene mutations were analyzed by polymerase chain reaction-restriction fragment length polymorphism method. Statistical analyses were performed by independent samples t-test. Results: p.H63D mutation was detected in 10 (32.3% patients in group A and in only 1 patient (7.7% in group B. When the 2 groups were compared for iron overload, iron deposition in the liver was significantly higher in group B (p=0.046. In addition, in group A, iron deposition was significantly higher in HFE mutation carriers compared to patients without the mutation (p=0.05. Conclusion: Results of this study showed that HFE gene mutations are important in iron deposition in the liver in patients with sickle cell disease.

  7. Hemocromatosis gene (HFE) mutations in patients with type 2 diabetes and their control group in an Iranian population

    International Nuclear Information System (INIS)

    Sharifi, F.; Esmaeilzadeh, A.; Zali, M.

    2008-01-01

    Objective was to assess the frequency of 2 different forms of hemochromatosis HFE gene mutations c282y and H63D mutations in a normal population in comparison with type 2 diabetic patients. This case control study was undertaken in Zanjan Diabetic Care Center, Zanjan, western Tehran, in 2005. Two hundred and two individuals were included in this study: 101 type 2 diabetes mellitus T2DM patients and 101 age and gender-matched controls. The patients were examined for mutations in the HFE gene. Nucleotide 845 C282Y and 187 H63D alleles were amplified by polymerase chain reaction PCR with lymphocyte deoxyribonucleic acid. The PCR products were analyzed by restriction enzyme digestion. Chi-square students test and Fisher's exact tests were used for comparison and odds ratio was calculated. Two hundred and two individuals were studied. The frequency of wild /C28Y alleles was 68.3/31.7% in diabetics p=0.08 and 73.4/26.3% in control subjects p=0.08. The distribution of genotypes was not statistically different. Based on our data, HFE mutations were not found in excess in patients with T2DM and there was no evidence that a population-based search for an excess of these alleles in type 2 diabetes was indicated. (author)

  8. HFE gene mutation and iron overload in Egyptian pediatric acute lymphoblastic leukemia survivors: a single-center study.

    Science.gov (United States)

    El-Rashedi, Farida H; El-Hawy, Mahmoud A; El-Hefnawy, Sally M; Mohammed, Mona M

    2017-08-01

    Hereditary hemochromatosis gene (HFE) mutations have a role in iron overload in pediatric acute lymphoblastic leukemia (ALL) survivors. We aimed to evaluate the genotype frequency and allelic distribution of the two HFE gene mutations (C282Y and H63D) in a sample of Egyptian pediatric ALL survivors and to detect the impact of these two mutations on their iron profile. This study was performed on 35 ALL survivors during their follow-up visits to the Hematology and Oncology Unit, Pediatric Department, Menoufia University Hospitals. Thirty-five healthy children of matched age and sex were chosen as controls. After completing treatment course, ALL survivors were screened for the prevalence of these two mutations by polymerase chain reaction-restriction fragment length polymorphism. Serum ferritin levels were measured by an enzyme-linked immunosorbent assay technique (ELISA). C282Y mutation cannot be detected in any of the 35 survivors or the 35 controls. The H63D heterozygous state (CG) was detected in 28.6% of the survivors group and in 20% of controls, while the H63D homozygous (GG) state was detected in 17.1% of survivors. No compound heterozygosity (C282Y/H63D) was detected at both groups with high G allele frequency (31.4%) in survivors more than controls (10%). There were significant higher levels of iron parameters in homozygote survivors than heterozygotes and the controls. H63D mutation aggravates the iron overload status in pediatric ALL survivors.

  9. HFE Genotyping in Patients with Elevated Serum Iron Indices and Liver Diseases

    Directory of Open Access Journals (Sweden)

    Andreia Silva Evangelista

    2015-01-01

    Full Text Available Iron abnormalities in chronic liver disease may be the result of genetic diseases or secondary factors. The present study aimed to identify subjects with HFE-HH in order to describe the frequency of clinical manifestations, identify risk factors for iron elevation, and compare the iron profile of HFE-HH to other genotypes in liver disease patients. A total of 108 individuals with hepatic disease, transferrin saturation (TS > 45%, and serum ferritin (SF > 350 ng/mL were tested for HFE mutations. Two groups were characterized: C282Y/C282Y or C282Y/H63D genotypes (n=16 were the HFE hereditary hemochromatosis (HFE-HH group; and C282Y and H63D single heterozygotes, the H63D/H63D genotype, and wild-type were considered group 2 (n=92. Nonalcoholic liver disease, alcoholism, and chronic hepatitis C were detected more frequently in group 2, whereas arthropathy, hepatocarcinoma, diabetes, and osteoporosis rates were significantly higher in the HFE-HH group. TS > 82%, SF > 2685 ng/mL, and serum iron > 178 μg/dL were the cutoffs for diagnosis of HFE-HH in patients with liver disease. Thus, in non-Caucasian populations with chronic liver disease, HFE-HH diagnosis is more predictable in those with iron levels higher than those proposed in current guidelines for the general population.

  10. The natural history of serum iron indices for HFE C282Y homozygosity associated with hereditary hemochromatosis.

    Science.gov (United States)

    Gurrin, Lyle C; Osborne, Nicholas J; Constantine, Clare C; McLaren, Christine E; English, Dallas R; Gertig, Dorota M; Delatycki, Martin B; Southey, Melissa C; Hopper, John L; Giles, Graham G; Anderson, Gregory J; Olynyk, John K; Powell, Laurie W; Allen, Katrina J

    2008-12-01

    There are few longitudinal studies of serum ferritin (SF) and transferrin saturation (TS) levels in individuals homozygous for the C282Y mutation. We characterized the development of elevated iron measures in C282Y homozygotes followed for 12 years. From 31,192 people aged 40-69 years at baseline, we identified 203 C282Y homozygotes (95 males), of whom 116 had SF and fasting TS levels measured at baseline (mean age, 55 years) and 86 were untreated and had iron measures at follow-up (mean, 12 years later). The probabilities of SF at follow-up exceeding clinical thresholds were predicted from baseline SF and TS under a multivariate normal model. For C282Y homozygotes, at baseline, 84% of males and 65% of females had elevated SF and 37% of males and 3% of females had SF >1000 microg/L. For males with SF 300-1000 microg/L at baseline, the predicted probability of progressing to SF >1000 microg/L at follow-up was between 13% and 35% and, for females, between 16% and 22%. For C282Y homozygotes with normal baseline SF, 1000 microg/L if left untreated. The majority of C282Y homozygotes who are likely to develop SF levels sufficient to place them at risk of iron overload-related disease will have done so by mean age 55 years. TS >95% at mean age 55 years in males increases the likelihood that SF levels will be elevated at mean age 65 years, but this effect is absent in females, most likely because of physiologic blood loss associated with menstruation.

  11. Sample-to-SNP kit: a reliable, easy and fast tool for the detection of HFE p.H63D and p.C282Y variations associated to hereditary hemochromatosis.

    Science.gov (United States)

    Nielsen, Peter B; Petersen, Maja S; Ystaas, Viviana; Andersen, Rolf V; Hansen, Karin M; Blaabjerg, Vibeke; Refstrup, Mette

    2012-10-01

    Classical hereditary hemochromatosis involves the HFE-gene and diagnostic analysis of the DNA variants HFE p.C282Y (c.845G>A; rs1800562) and HFE p.H63D (c.187C>G; rs1799945). The affected protein alters the iron homeostasis resulting in iron overload in various tissues. The aim of this study was to validate the TaqMan-based Sample-to-SNP protocol for the analysis of the HFE-p.C282Y and p.H63D variants with regard to accuracy, usefulness and reproducibility compared to an existing SNP protocol. The Sample-to-SNP protocol uses an approach where the DNA template is made accessible from a cell lysate followed by TaqMan analysis. Besides the HFE-SNPs other eight SNPs were used as well. These SNPs were: Coagulation factor II-gene F2 c.20210G>A, Coagulation factor V-gene F5 p.R506Q (c.1517G>A; rs121917732), Mitochondria SNP: mt7028 G>A, Mitochondria SNP: mt12308 A>G, Proprotein convertase subtilisin/kexin type 9-gene PCSK9 p.R46L (c.137G>T), Plutathione S-transferase pi 1-gene GSTP1 p.I105V (c313A>G; rs1695), LXR g.-171 A>G, ZNF202 g.-118 G>T. In conclusion the Sample-to-SNP kit proved to be an accurate, reliable, robust, easy to use and rapid TaqMan-based SNP detection protocol, which could be quickly implemented in a routine diagnostic or research facility. Copyright © 2012. Published by Elsevier B.V.

  12. The hepcidin gene promoter nc.-1010C > T; -582A > G haplotype modulates serum ferritin in individuals carrying the common H63D mutation in HFE gene.

    Science.gov (United States)

    Silva, Bruno; Pita, Lina; Gomes, Susana; Gonçalves, João; Faustino, Paula

    2014-12-01

    Hereditary hemochromatosis is an autosomal recessive disorder characterized by severe iron overload. It is usually associated with homozygosity for the HFE gene mutation c.845G > A; p.C282Y. However, in some cases, another HFE mutation (c.187C > G; p.H63D) seems to be associated with the disease. Its penetrance is very low, suggesting the possibility of other iron genetic modulators being involved. In this work, we have screened for HAMP promoter polymorphisms in 409 individuals presenting normal or increased serum ferritin levels together with normal or H63D-mutated HFE genotypes. Our results show that the hepcidin gene promoter TG haplotype, originated by linkage of the nc.-1010C > T and nc.-582A > G polymorphisms, is more frequent in the HFE_H63D individuals presenting serum ferritin levels higher than 300 μg/L than in those presenting the HFE_H63D mutation but with normal serum ferritin levels or in the normal control group.Moreover, it was observed that the TG haplotype was associated to increased serum ferritin levels in the overall pool of HFE_H63D individuals. Thus, our data suggest that screening for these polymorphisms could be of interest in order to explain the phenotype. However, this genetic condition seems to have no clinical significance.

  13. Association between the HFE C282Y, H63D Polymorphisms and the Risks of Non-Alcoholic Fatty Liver Disease, Liver Cirrhosis and Hepatocellular Carcinoma: An Updated Systematic Review and Meta-Analysis of 5,758 Cases and 14,741 Controls.

    Directory of Open Access Journals (Sweden)

    Qing Ye

    Full Text Available Conflicting results have been obtained for the association between two common polymorphisms (C282Y, H63D of human HFE (hereditary hemochromatosis gene and the risks of the liver diseases, including non-alcoholic fatty liver disease (NAFLD, liver cirrhosis and hepatocellular carcinoma (HCC.An updated systematic review and meta-analysis was conducted to evaluate the potential role of HFE polymorphisms in the susceptibility to NAFLD, liver cirrhosis and HCC. After retrieving articles from online databases, eligible studies were enrolled according to the selection criteria. Stata/SE 12.0 software was utilized to perform the statistical analysis.In total, 43 articles with 5,758 cases and 14,741 controls were selected. Compared with the control group, a significantly increased risk of NAFLD was observed for the C282Y polymorphism in the Caucasian population under all genetic models and for the H63D polymorphism under the allele, heterozygote and dominant models (all OR>1, Passociation0.05. In addition, we found that HFE C282Y was statistically associated with increased HCC susceptibility in the overall population, while H63D increased the odds of developing non-cirrhotic HCC in the African population (all OR>1, Passociation<0.05. Moreover, a positive association between compound heterozygosity for C282Y/H63D and the risk of NAFLD and HCC, but not liver cirrhosis, was observed.Our meta-analysis provides evidence that the HFE C282Y and H63D polymorphisms confer increased genetic susceptibility to NAFLD and HCC but not liver cirrhosis. Additional well-powered studies are required to confirm our conclusion.

  14. HFE gene variants affect iron in the brain.

    Science.gov (United States)

    Nandar, Wint; Connor, James R

    2011-04-01

    Iron accumulation in the brain and increased oxidative stress are consistent observations in many neurodegenerative diseases. Thus, we have begun examination into gene mutations or allelic variants that could be associated with loss of iron homeostasis. One of the mechanisms leading to iron overload is a mutation in the HFE gene, which is involved in iron metabolism. The 2 most common HFE gene variants are C282Y (1.9%) and H63D (8.9%). The C282Y HFE variant is more commonly associated with hereditary hemochromatosis, which is an autosomal recessive disorder, characterized by iron overload in a number of systemic organs. The H63D HFE variant appears less frequently associated with hemochromatosis, but its role in the neurodegenerative diseases has received more attention. At the cellular level, the HFE mutant protein resulting from the H63D HFE gene variant is associated with iron dyshomeostasis, increased oxidative stress, glutamate release, tau phosphorylation, and alteration in inflammatory response, each of which is under investigation as a contributing factor to neurodegenerative diseases. Therefore, the HFE gene variants are proposed to be genetic modifiers or a risk factor for neurodegenerative diseases by establishing an enabling milieu for pathogenic agents. This review will discuss the current knowledge of the association of the HFE gene variants with neurodegenerative diseases: amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's disease, and ischemic stroke. Importantly, the data herein also begin to dispel the long-held view that the brain is protected from iron accumulation associated with the HFE mutations.

  15. Using iron studies to predict HFE mutations in New Zealand: implications for laboratory testing.

    Science.gov (United States)

    O'Toole, Rebecca; Romeril, Kenneth; Bromhead, Collette

    2017-04-01

    The diagnosis of hereditary haemochromatosis (HH) is not straightforward because symptoms are often absent or non-specific. Biochemical markers of iron-overloading may be affected by other conditions. To measure the correlation between iron studies and HFE genotype to inform evidence-based recommendations for laboratory testing in New Zealand. Results from 2388 patients genotyped for C282Y, H63D and S65C in Wellington, New Zealand from 2007 to 2013 were compared with their biochemical phenotype as quantified by serum ferritin (SF), transferrin saturation (TS), serum iron (SI) and serum transferrin (ST). The predictive power of these markers was evaluated by receiver operator characteristic (ROC) curve analysis, and if a statistically significant association for a variable was seen, sensitivity, specificity and predictive values were calculated. Test ordering patterns showed that 62% of HFE genotyping tests were ordered because of an elevated SF alone and only 11% of these had a C-reactive protein test to rule out an acute phase reaction. The association between SF and significant HFE genotypes SF was low. However, TS values ≥45% predicted HH mutations with the highest sensitivity and specificity. A SF of >1000 µg/L was found in one at-risk patient (C282Y homozygote) who had a TS <45%. Our analysis highlights the need for clear guidelines for investigation of hyperferritinaemia and HH in New Zealand. Using our findings, we developed an evidence-based laboratory testing algorithm based on a TS ≥45%, a SF ≥1000 µg/L and/or a family history of HH which identified all C282Y homozygotes in this study. © 2016 Royal Australasian College of Physicians.

  16. HFE gene mutations in coronary atherothrombotic disease

    Directory of Open Access Journals (Sweden)

    Calado R.T.

    2000-01-01

    Full Text Available Although iron can catalyze the production of free radicals involved in LDL lipid peroxidation, the contribution of iron overload to atherosclerosis remains controversial. The description of two mutations in the HFE gene (Cys282Tyr and His63Asp related to hereditary hemochromatosis provides an opportunity to address the question of the association between iron overload and atherosclerosis. We investigated the prevalence of HFE mutations in 160 survivors of myocardial infarction with angiographically demonstrated severe coronary atherosclerotic disease, and in 160 age-, gender- and race-matched healthy control subjects. PCR amplification of genomic DNA followed by RsaI and BclI restriction enzyme digestion was used to determine the genotypes. The frequency of the mutant Cys282Tyr allele was identical among patients and controls (0.022; carrier frequency, 4.4%, whereas the mutant His63Asp allele had a frequency of 0.143 (carrier frequency, 27.5% in controls and of 0.134 (carrier frequency, 24.5% in patients. Compound heterozygotes were found in 2 of 160 (1.2% controls and in 1 of 160 (0.6% patients. The finding of a similar prevalence of Cys282Tyr and His63Asp mutations in the HFE gene among controls and patients with coronary atherothrombotic disease, indirectly questions the possibility of an association between hereditary hemochromatosis and atherosclerosis.

  17. HFE MUTATIONS AND IRON OVERLOAD IN PATIENTS WITH ALCOHOLIC LIVER DISEASE

    Directory of Open Access Journals (Sweden)

    Luís COSTA-MATOS

    2013-03-01

    Full Text Available Context Alcoholic liver disease (ALD is generally associated with iron overload, which may contribute to its pathogenesis, through increased oxidative stress and cellular damage. There are conflicting reports in literature about hemochromatosis (HFE gene mutations and the severity of liver disease in alcoholic patients. Objectives To compare the prevalence of mutations in the hemochromatosis (HFE gene between patients with ALD and healthy controls; to assess the relation of HFE mutations with liver iron stores and liver disease severity. Methods Liver biopsy specimens were obtained from 63 ALD patients (during routine treatment and 52 healthy controls (during elective cholecystectomy. All individuals underwent routine liver function tests and HFE genotyping (to detect wild-type sequences and C282Y, H63D, S65C, E168Q, E168X, V59M, H63H, P160delC, Q127H, Q283P, V53M and W164X mutations. Associations between HFE mutations and risk of excessive liver iron stores, abnormal serum ferritin, liver fibrosis, or necroinflammatory activity were assessed by multivariate logistic regression analysis. Results ALD patients had significantly higher serum ferritin and transferrin saturation than controls (both P Contexto A doença hepática alcoólica (DHA está geralmente associada à sobrecarga de ferro, que pode contribuir para a sua patogênese, através do aumento do estresse oxidativo e dano celular. As descrições existentes na literatura sobre a associação entre mutações HFE e a gravidade da DHA nem sempre são concordantes. Objetivos Comparar a prevalência de mutações HFE entre um grupo de pacientes com DHA e uma população de controle. Avaliar a relação entre mutações HFE e os depósitos de ferro hepático. Avaliar se a presença dessas mutações está associada com a gravidade da DHA. Métodos Compararam-se 63 pacientes com DHA que efetuaram biopsia hepática com 52 controles saudáveis. A genotipagem HFE (wild type, C282Y, H63D, S65C, E

  18. Lack of evidence for the pathogenic role of iron and HFE gene mutations in Brazilian patients with nonalcoholic steatohepatitis

    Directory of Open Access Journals (Sweden)

    M.M. Deguti

    2003-06-01

    Full Text Available The hypothesis of the role of iron overload associated with HFE gene mutations in the pathogenesis of nonalcoholic steatohepatitis (NASH has been raised in recent years. In the present study, biochemical and histopathological evidence of iron overload and HFE mutations was investigated in NASH patients. Thirty-two NASH patients, 19 females (59%, average 49.2 years, 72% Caucasians, 12% Mulattoes and 12% Asians, were submitted to serum aminotransferase and iron profile determinations. Liver biopsies were analyzed for necroinflammatory activity, architectural damage and iron deposition. In 31 of the patients, C282Y and H63D mutations were tested by PCR-RFLP. Alanine aminotransferase levels were increased in 30 patients, 2.42 ± 1.12 times the upper normal limit on average. Serum iron concentration, transferrin saturation and ferritin averages were 99.4 ± 31.3 g/dl, 33.1 ± 12.7% and 219.8 ± 163.8 µg/dl, respectively, corresponding to normal values in 93.5, 68.7 and 78.1% of the patients. Hepatic siderosis was observed in three patients and was not associated with architectural damage (P = 0.53 or with necroinflammatory activity (P = 0.27. The allelic frequencies (N = 31 found were 1.6 and 14.1% for C282Y and H63D, respectively, which were compatible with those described for the local population. In conclusion, no evidence of an association of hepatic iron overload and HFE mutations with NASH was found. Brazilian NASH patients comprise a heterogeneous group with many associated conditions such as hyperinsulinism, environmental hepatotoxin exposure and drugs, but not hepatic iron overload, and their disease susceptibility could be related to genetic and environmental features other than HFE mutations.

  19. An extensive analysis of the hereditary hemochromatosis gene HFE and neighboring histone genes: associations with childhood leukemia.

    Science.gov (United States)

    Davis, Charronne F; Dorak, M Tevfik

    2010-04-01

    The most common mutation of the HFE gene C282Y has shown a risk association with childhood acute lymphoblastic leukemia (ALL) in Welsh and Scottish case-control studies. This finding has not been replicated outside Britain. Here, we present a thorough analysis of the HFE gene in a panel of HLA homozygous reference cell lines and in the original population sample from South Wales (117 childhood ALL cases and 414 newborn controls). The 21 of 24 variants analyzed were from the HFE gene region extending 52 kb from the histone gene HIST1H1C to HIST1H1T. We identified the single-nucleotide polymorphism (SNP) rs807212 as a tagging SNP for the most common HFE region haplotype, which contains wild-type alleles of all HFE variants examined. This intergenic SNP rs807212 yielded a strong male-specific protective association (per allele OR = 0.38, 95% CI = 0.22-0.64, P (trend) = 0.0002; P = 0.48 in females), which accounted for the original C282Y risk association. In the HapMap project data, rs807212 was in strong linkage disequilibrium with 25 other SNPs spanning 151 kb around HFE. Minor alleles of these 26 SNPs characterized the most common haplotype for the HFE region, which lacked all disease-associated HFE variants. The HapMap data suggested positive selection in this region even in populations where the HFE C282Y mutation is absent. These results have implications for the sex-specific associations observed in this region and suggest the inclusion of rs807212 in future studies of the HFE gene and the extended HLA class I region.

  20. Decreased iron burden in overweight C282Y homozygous women: Putative role of increased hepcidin production.

    Science.gov (United States)

    Desgrippes, Romain; Lainé, Fabrice; Morcet, Jeff; Perrin, Michèle; Manet, Ghislain; Jezequel, Caroline; Bardou-Jacquet, Edouard; Ropert, Martine; Deugnier, Yves

    2013-05-01

    An excess of visceral adipose tissue could be involved as a modulator of the penetrance of HFE hemochromatosis since fat mass is associated with overexpression of hepcidin and low transferrin saturation was found to be associated with being overweight in women. This study was aimed at assessing the relationship between body mass index (BMI), a surrogate marker of insulin resistance, and iron burden in HFE hemochromatosis. In all, 877 patients from a cohort of C282Y homozygotes were included in the study when BMI at diagnosis and amount of iron removed (AIR) by phlebotomy were available. No relationship between AIR and BMI was found in men, whereas 15.1% (52/345) of women with AIR lean (7.9 mmoL/L ± 4.3) women (P = 0.0005). In C282Y homozygous women, BMI ≥28 kg/m(2) is independently associated with a lower amount of iron removed by phlebotomy. BMI is likely a modulator factor of the phenotypic expression of C282Y homozygosity, likely through an increase of circulating levels of hepcidin. Copyright © 2013 American Association for the Study of Liver Diseases.

  1. The evolutionary adaptation of the C282Y mutation to culture and climate during the European Neolithic.

    Science.gov (United States)

    Heath, Kathleen M; Axton, Jacob H; McCullough, John M; Harris, Nathan

    2016-05-01

    The C282Y allele is the major cause of hemochromatosis as a result of excessive iron absorption. The mutation arose in continental Europe no earlier than 6,000 years ago, coinciding with the arrival of the Neolithic agricultural revolution. Here we hypothesize that this new Neolithic diet, which originated in the sunny warm and dry climates of the Middle East, was carried by migrating farmers into the chilly and damp environments of Europe where iron is a critical micronutrient for effective thermoregulation. We argue that the C282Y allele was an adaptation to this novel environment. To address our hypothesis, we compiled C282Y allele frequencies, known Neolithic sites in Europe and climatic data on temperature and rainfall for statistical analysis. Our findings indicate that the geographic cline for C282Y frequency in Europe increases as average temperatures decrease below 16°C, a critical threshold for thermoregulation, with rainy days intensifying the trend. The results indicate that the deleterious C282Y allele, responsible for most cases of hemochromatosis, may have evolved as a selective advantage to culture and climate during the European Neolithic. © 2016 The Authors American Journal of Physical Anthropology Published by Wiley Periodicals, Inc.

  2. Mutations in the HFE, TFR2, and SLC40A1 genes in patients with hemochromatosis.

    Science.gov (United States)

    Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Cuadrado-Grande, Nuria; Alvarez-Sala-Walther, Luis-Antonio; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

    2012-10-15

    Hereditary hemochromatosis causes iron overload and is associated with a variety of genetic and phenotypic conditions. Early diagnosis is important so that effective treatment can be administered and the risk of tissue damage avoided. Most patients are homozygous for the c.845G>A (p.C282Y) mutation in the HFE gene; however, rare forms of genetic iron overload must be diagnosed using a specific genetic analysis. We studied the genotype of 5 patients who had hyperferritinemia and an iron overload phenotype, but not classic mutations in the HFE gene. Two patients were undergoing phlebotomy and had no iron overload, 1 with metabolic syndrome and no phlebotomy had mild iron overload, and 2 patients had severe iron overload despite phlebotomy. The patients' first-degree relatives also underwent the analysis. We found 5 not previously published mutations: c.-408_-406delCAA in HFE, c.1118G>A (p.G373D), c.1473G>A (p.E491E) and c.2085G>C (p.S695S) in TFR2; and c.-428_-427GG>TT in SLC40A1. Moreover, we found 3 previously published mutations: c.221C>T (p.R71X) in HFE; c.1127C>A (p.A376D) in TFR2; and c.539T>C (p.I180T) in SLC40A1. Four patients were double heterozygous or compound heterozygous for the mutations mentioned above, and the patient with metabolic syndrome was heterozygous for a mutation in the TFR2 gene. Our findings show that hereditary hemochromatosis is clinically and genetically heterogeneous and that acquired factors may modify or determine the phenotype. Copyright © 2012. Published by Elsevier B.V.

  3. Pathophysiological consequences and benefits of HFE mutations: 20 years of research

    Science.gov (United States)

    Hollerer, Ina; Bachmann, André; Muckenthaler, Martina U.

    2017-01-01

    Mutations in the HFE (hemochromatosis) gene cause hereditary hemochromatosis, an iron overload disorder that is hallmarked by excessive accumulation of iron in parenchymal organs. The HFE mutation p.Cys282Tyr is pathologically most relevant and occurs in the Caucasian population with a carrier frequency of up to 1 in 8 in specific European regions. Despite this high prevalence, the mutation causes a clinically relevant phenotype only in a minority of cases. In this review, we summarize historical facts and recent research findings about hereditary hemochromatosis, and outline the pathological consequences of the associated gene defects. In addition, we discuss potential advantages of HFE mutations in asymptomatic carriers. PMID:28280078

  4. Correlation between HFE gene polymorphisms and increased risk of coronary artery disease among patients with type 2 diabetes in Iran.

    Science.gov (United States)

    Saremi, Leila; Saremi, Marzieh; Lotfipanah, Shirin; İmani, Saber; Fu, Junjiang; Zhang, Tianyu

    2016-04-19

    Diabetes mellitus is a risk factor for cardiovascular diseases (CVDs), which are among the major causes of deaths in type 2 diabetes (T2D). The purpose of the present study was to determine the association of C282Y and H63D mutations in the HFE gene with increased risk of coronary artery disease (CAD) in T2D patients. Two hundred and ninety individuals were divided into two groups: a case group and a control group. Genomic DNA of peripheral venous blood cells was extracted and the HFE gene mutations were analyzed using the PCR-RFLP technique. Data analysis revealed a significant difference between the allele frequencies of H63D and C282Y mutations between the case group and the controls (P 0.05). Using a logistic regression model, BMI, FBS, HDL, and total cholesterol levels were significantly different with independent predictors of CVD (P < 0.05). Our results revealed a significant correlation between C282Y and H63D mutations and the development of CAD in T2D patients.

  5. Mutations in the HFE gene and sporadic amyotrophic lateral sclerosis risk: a meta-analysis of observational studies

    Directory of Open Access Journals (Sweden)

    M. Li

    2014-03-01

    Full Text Available Iron homeostasis dysregulation has been regarded as an important mechanism in neurodegenerative diseases. The H63D and C282Y polymorphisms in the HFE gene may be involved in the development of sporadic amyotrophic lateral sclerosis (ALS through the disruption of iron homeostasis. However, studies investigating the relationship between ALS and these two polymorphisms have yielded contradictory outcomes. We performed a meta-analysis to assess the roles of the H63D and C282Y polymorphisms of HFE in ALS susceptibility. PubMed, MEDLINE, EMBASE, and Cochrane Library databases were systematically searched to identify relevant studies. Strict selection criteria and exclusion criteria were applied. Odds ratios (ORs with 95% confidence intervals (CIs were used to assess the strength of associations. A fixed- or random-effect model was selected, depending on the results of the heterogeneity test. Fourteen studies were included in the meta-analysis (six studies with 1692 cases and 8359 controls for C282Y; 14 studies with 5849 cases and 13,710 controls for H63D. For the C282Y polymorphism, significant associations were observed in the allele model (Y vs C: OR=0.76, 95%CI=0.62-0.92, P=0.005 and the dominant model (YY+CY vs CC: OR=0.75, 95%CI=0.61-0.92, P=0.006. No associations were found for any genetic model for the H63D polymorphism. The C282Y polymorphism in HFE could be a potential protective factor for ALS in Caucasians. However, the H63D polymorphism does not appear to be associated with ALS.

  6. Porfiria cutánea tarda: asociación con mutaciones HFE, hepatitis virales, alcohol y otros factores de riesgo en Guipúzcoa, País Vasco Porphyria cutanea tarda: An analysis of HFE gene mutations, hepatitis viruses, alcohol intake, and other risk factors in 54 patients from Guipúzcoa, Basque Country, Spain

    Directory of Open Access Journals (Sweden)

    A. Castiella

    2008-12-01

    Full Text Available Objetivo: estudiar la frecuencia de las mutaciones en el gen HFE (C282Y, H63D, S65C en un grupo de 54 pacientes con porfiria cutánea tarda (PCT y en un grupo de controles sanos (donantes de sangre en Guipúzcoa. También analizar su relación con los virus de la hepatitis B y C (VHB, VHC, alcohol y otros factores de riesgo reconocidos. Métodos: el análisis de las mutaciones se hizo mediante PCR. Se compararon las frecuencias alélicas y genotípicas. Se determinaron la probabilidad y el test de Chi cuadrado. Resultados: no encontramos asociación entre C282Y y PCT (5,76 vs. 5% controles. Se observó una alta frecuencia alélica en la mutación H63D en PCT (34,25%, pero sin ser estadísticamente significativa (controles 29,31%, debido a la alta prevalencia de esta mutación en la población vasca. La mutación S65C fue menor en PCT que en controles. Encontramos una idéntica presencia de H63D en heterocigosis en ambos grupos (38,8 vs. 38,8%. La asociación con el VHC se objetivó en el 35,18% de los pacientes y la infección por VHB en el 7,4%. Un 55,55% de los pacientes tenía un hábito alcohólico de más de 60 g etanol día. Todos eran negativos para el virus de la inmunodeficiencia humana (VIH y 1 de las 5 mujeres con PCT tomaba estrógenos. Conclusión: las mutaciones C282Y y H63D no tienen un papel relevante en los pacientes con PCT en Guipúzcoa. Los factores externos (consumo importante de alcohol y VHC parecen jugar un papel fundamental en el desarrollo de la PCT en nuestra población.Aim: to study the frequency of HFE gene mutations (C282Y, H63D, S65C in a group of 54 sporadic PCT patients and in a group of healthy controls (blood donors from Guipúzcoa, Spain. We studied the association of PCT with HCV, HBV, alcohol abuse, and other established risk factors. Methods: the analysis of mutations was made by PCR. Allelic and genotypic frequencies were compared. Probability was determined and a Chi-squared test was performed. Results

  7. Association of HFE common mutations with Parkinson's disease, Alzheimer's disease and mild cognitive impairment in a Portuguese cohort

    Directory of Open Access Journals (Sweden)

    Morgadinho Ana S

    2006-07-01

    Full Text Available Abstract Background Pathological brain iron deposition has been implicated as a source of neurotoxic reactive oxygen species in Alzheimer (AD and Parkinson diseases (PD. Iron metabolism is associated with the gene hemochromatosis (HFE Human genome nomenclature committee ID:4886, and mutations in HFE are a cause of the iron mismetabolism disease, hemochromatosis. Several reports have tested the association of HFE variants with neurodegenerative diseases, such as AD and PD with conflicting results. Methods Genotypes were analysed for the two most common variants of HFE in a series of 130 AD, 55 Mild Cognitive Impairment (MCI and 132 PD patients. Additionally, a series of 115 healthy age-matched controls was also screened. Results A statistically significant association was found in the PD group when compared to controls, showing that the presence of the C282Y variant allele may confer higher risk for developing the disease. Conclusion Taken together these results suggest that the common variants in HFE may be a risk factor for PD, but not for AD in the Portuguese population.

  8. Haemochromatosis HFE gene polymorphisms as potential modifiers of hereditary nonpolyposis colorectal cancer risk and onset age.

    Science.gov (United States)

    Shi, Zumin; Johnstone, Daniel; Talseth-Palmer, Bente A; Evans, Tiffany-Jane; Spigelman, Allan D; Groombridge, Claire; Milward, Elizabeth A; Olynyk, John K; Suchy, Janina; Kurzawski, Grzegorz; Lubinski, Jan; Scott, Rodney J

    2009-07-01

    Hereditary nonpolyposis colorectal cancer (HNPCC) is characterized by germline mutations in DNA mismatch repair genes; however, variation in disease expression suggests that there are potential modifying factors. Polymorphisms of the HFE gene, which cause the iron overload disorder hereditary haemochromatosis, have been proposed as potential risk factors for the development of colorectal cancer (CRC). To understand the relationship between HNPCC disease phenotype and polymorphisms of the HFE gene, a total of 362 individuals from Australia and Poland with confirmed causative MMR gene mutations were genotyped for the HFE C282Y and H63D polymorphisms. A significantly increased risk of developing CRC was observed for H63D homozygotes when compared with combined wild-type homozygotes and heterozygotes (hazard ratio = 2.93, p = 0.007). Evidence for earlier CRC onset was also observed in H63D homozygotes with a median age of onset 6 years earlier than wild type or heterozygous participants (44 vs. 50 years of age). This effect was significant by all tests used (log-rank test p = 0.026, Wilcoxon p = 0.044, Tarone-Ware p = 0.035). No association was identified for heterozygosity of either polymorphism and limitations on power-prevented investigation of C282Y homozygosity or compound C282Y/H63D heterozygosity. In the Australian sample only, women had a significantly reduced risk of developing CRC when compared with men (hazard ratio = 0.58, p = 0.012) independent of HFE genotype for either single nucleotide polymorphisms. In conclusion, homozygosity for the HFE H63D polymorphism seems to be a genetic modifier of disease expression in HNPCC. Understanding the mechanisms by which HFE interrelates with colorectal malignancies could lead to reduction of disease risk in HNPCC.

  9. HFE polymorphisms influence the response to chemotherapeutic agents via induction of p16INK4A.

    Science.gov (United States)

    Lee, Sang Y; Liu, Siying; Mitchell, Ryan M; Slagle-Webb, Becky; Hong, Young-Soo; Sheehan, Jonas M; Connor, James R

    2011-11-01

    HFE is a protein that impacts cellular iron uptake. HFE gene variants are identified as risk factors or modifiers for multiple diseases. Using HFE stably transfected human neuroblastoma cells, we found that cells carrying the C282Y HFE variant do not differentiate when exposed to retinoic acid. Therefore, we hypothesized HFE variants would impact response to therapeutic agents. Both the human neuroblastoma and glioma cells that express the C282Y HFE variant are resistant to Temodar, geldanamycin and γ-radiation. A gene array analysis revealed that p16INK4A (p16) expression was increased in association with C282Y expression. Decreasing p16 protein by siRNA resulted in increased vulnerability to all of the therapeutic agents suggesting that p16 is responsible for the resistance. Decreasing HFE expression by siRNA resulted in a 85% decrease in p16 expression in the neuroblastoma cells but not the astrocytoma cells. These data suggest a potential direct relationship between HFE and p16 that may be cell specific or mediated by different pathways in the different cell types. In conclusion, the C282Y HFE variant impacts the vulnerability of cancer cells to current treatment strategies apparently by increasing expression of p16. Although best known as a tumor suppressor, there are multiple reports that p16 is elevated in some forms of cancer. Given the frequency of the HFE gene variants, as high as 10% of the Caucasian population, these data provide compelling evidence that the C282Y HFE variant should be part of a pharmacogenetic strategy for evaluating treatment efficacy in cancer cells. Copyright © 2011 UICC.

  10. Effect of C282Y genotype on self-reported musculoskeletal complications in hereditary hemochromatosis.

    Science.gov (United States)

    Camacho, António; Funck-Brentano, Thomas; Simão, Márcio; Cancela, Leonor; Ottaviani, Sébastien; Cohen-Solal, Martine; Richette, Pascal

    2015-01-01

    Arthropathy that mimics osteoarthritis (OA) and osteoporosis (OP) is considered a complication of hereditary hemochromatosis (HH). We have limited data comparing OA and OP prevalence among HH patients with different hemochromatosis type 1 (HFE) genotypes. We investigated the prevalence of OA and OP in patients with HH by C282Y homozygosity and compound heterozygosity (C282Y/H63D) genotype. A total of 306 patients with HH completed a questionnaire. Clinical and demographic characteristics and presence of OA, OP and related complications were compared by genotype, adjusting for age, sex, body mass index (BMI), current smoking and menopausal status. In total, 266 of the 306 patients (87%) were homozygous for C282Y, and 40 (13%) were compound heterozygous. The 2 groups did not differ by median age [60 (interquartile range [IQR] 53 to 68) vs. 61 (55 to 67) years, P=0.8], sex (female: 48.8% vs. 37.5%, P=0.18) or current smoking habits (12.4% vs. 10%, P=0.3). As compared with compound heterozygous patients, C282Y homozygous patients had higher median serum ferritin concentration at diagnosis [1090 (IQR 610 to 2210) vs. 603 (362 to 950) µg/L, P<0.001], higher median transferrin saturation [80% (IQR 66 to 91%) vs. 63% (55 to 72%), P<0.001]) and lower median BMI [24.8 (22.1 to 26.9) vs. 26.2 (23.5 to 30.3) kg/m2, P<0.003]. The overall prevalence of self-reported OA was significantly higher with C282Y homozygosity than compound heterozygosity (53.4% vs. 32.5%; adjusted odds ratio [aOR] 2.4 [95% confidence interval 1.2-5.0]), as was self-reported OP (25.6% vs. 7.5%; aOR 3.5 [1.1-12.1]). Patients with C282Y homozygosity may be at increased risk of musculoskeletal complications of HH.

  11. Analysis of single nucleotide variants of HFE gene and association to survival in The Cancer Genome Atlas GBM data.

    Science.gov (United States)

    Lee, Sang Y; Zhu, Junjia; Salzberg, Anna C; Zhang, Bo; Liu, Dajiang J; Muscat, Joshua E; Langan, Sara T; Connor, James R

    2017-01-01

    Human hemochromatosis protein (HFE) is involved in iron metabolism. Two major HFE polymorphisms, H63D and C282Y, have been associated with an increased risk of cancers. Previously, we reported decreased gender effects in overall survival based on H63D or C282Y HFE polymorphisms patients with glioblastoma multiforme (GBM). However, the effect of other single nucleotide variation (SNV) in the HFE gene on the cancer development and progression has not been systematically studied. To expand our finding in a larger sample, and to identify other HFE SNV, we analyzed the frequency of somatic SNV in HFE gene and its relationship to survival in GBM patients using The Cancer Genome Atlas (TCGA) GBM (Caucasian only) database. We found 9 SNVs with increased frequency in blood normal of TCGA GBM patients compared to the 1000Genome. Among 9 SNVs, 7 SNVs were located in the intron and 2 SNVs (i.e., H63D, C282Y) in the exon of HFE gene. The statistical analysis demonstrated that blood normal samples of TCGA GBM have more H63D (p = 0.0002, 95% Confidence interval (CI): 0.2119-0.3223) or C282Y (p = 0.0129, 95% CI: 0.0474-0.1159) HFE polymorphisms than 1000Genome. The Kaplan-Meier survival curve for the 264 GBM samples revealed no difference between wild type (WT) HFE and H63D, and WT HFE and C282Y GBM patients. In addition, there was no difference in the survival of male/female GBM patients based on HFE genotype. There was no correlation between HFE expression and survival. In conclusion, the current results suggest that somatic HFE polymorphisms do not impact GBM patients' survival in the TCGA data set of GBM.

  12. Analysis of single nucleotide variants of HFE gene and association to survival in The Cancer Genome Atlas GBM data.

    Directory of Open Access Journals (Sweden)

    Sang Y Lee

    Full Text Available Human hemochromatosis protein (HFE is involved in iron metabolism. Two major HFE polymorphisms, H63D and C282Y, have been associated with an increased risk of cancers. Previously, we reported decreased gender effects in overall survival based on H63D or C282Y HFE polymorphisms patients with glioblastoma multiforme (GBM. However, the effect of other single nucleotide variation (SNV in the HFE gene on the cancer development and progression has not been systematically studied. To expand our finding in a larger sample, and to identify other HFE SNV, we analyzed the frequency of somatic SNV in HFE gene and its relationship to survival in GBM patients using The Cancer Genome Atlas (TCGA GBM (Caucasian only database. We found 9 SNVs with increased frequency in blood normal of TCGA GBM patients compared to the 1000Genome. Among 9 SNVs, 7 SNVs were located in the intron and 2 SNVs (i.e., H63D, C282Y in the exon of HFE gene. The statistical analysis demonstrated that blood normal samples of TCGA GBM have more H63D (p = 0.0002, 95% Confidence interval (CI: 0.2119-0.3223 or C282Y (p = 0.0129, 95% CI: 0.0474-0.1159 HFE polymorphisms than 1000Genome. The Kaplan-Meier survival curve for the 264 GBM samples revealed no difference between wild type (WT HFE and H63D, and WT HFE and C282Y GBM patients. In addition, there was no difference in the survival of male/female GBM patients based on HFE genotype. There was no correlation between HFE expression and survival. In conclusion, the current results suggest that somatic HFE polymorphisms do not impact GBM patients' survival in the TCGA data set of GBM.

  13. Preliminary investigation of bottlenose dolphins (Tursiops truncatus) for hfe gene-related hemochromatosis.

    Science.gov (United States)

    Phillips, Brianne E; Venn-Watson, Stephanie; Archer, Linda L; Nollens, Hendrik H; Wellehan, James F X

    2014-10-01

    Hemochromatosis (iron storage disease) has been reported in diverse mammals including bottlenose dolphins (Tursiops truncatus). The primary cause of excessive iron storage in humans is hereditary hemochromatosis. Most human hereditary hemochromatosis cases (up to 90%) are caused by a point mutation in the hfe gene, resulting in a C282Y substitution leading to iron accumulation. To evaluate the possibility of a hereditary hemochromatosis-like genetic predisposition in dolphins, we sequenced the bottlenose dolphin hfe gene, using reverse transcriptase-PCR and hfe primers designed from the dolphin genome, from liver of affected and healthy control dolphins. Sample size included two case animals and five control animals. Although isotype diversity was evident, no coding differences were identified in the hfe gene between any of the animals examined. Because our sample size was small, we cannot exclude the possibility that hemochromatosis in dolphins is due to a coding mutation in the hfe gene. Other potential causes of hemochromatosis, including mutations in different genes, diet, primary liver disease, and insulin resistance, should be evaluated.

  14. АЛЛЕЛИ 282Y И H63D ГЕНА HFE И ПРЕДРАСПОЛОЖЕННОСТЬ К СИНДРОМУ ХРОНИЧЕСКОЙ ПЕРЕГРУЗКИ ЖЕЛЕЗОМ И НАРУШЕНИЮ ПОРФИРИНОВОГО ОБМЕНА ПРИ НЕАЛКОГОЛЬНОЙ ЖИРОВОЙ БОЛЕЗНИ ПЕЧЕНИ

    Directory of Open Access Journals (Sweden)

    А. Б. Кривошеев

    2012-01-01

    Full Text Available Testing for carriers of mutations C282Y and H63D HFE gene in 57 patients with nonalcoholic fatty liver disease was completed. Abnormalities in the metabolism of porphyrins were detected in 39 (68.4% patients, mutations C282Y and H63D were detected in 16 (28.1% patients, of whom 12 patients with metabolic disorders of porphyrins and symptoms of the syndrome of chronic iron overload. In 41 (71.9% patients without the mutations found disorders metabolism of porphyrins were in 27 (65.8% patients. They had no symptoms of the syndrome of chronic iron overload. Detection of C282Y and H63D mutations in the gene HFE in conjunction with disorders of porphyrin metabolism in association with the syndrome of chronic iron overload, but the probability will consider these patients as candidates for inclusion in the higher risk of formation of liver fibrosis.

  15. Computational Profiling of Deleterious Non-Synonymous SNP’s in HFE

    Directory of Open Access Journals (Sweden)

    S. Sarath Raj

    2017-12-01

    Full Text Available Liver cirrhosis describes a condition where scar tissue gradually replaces healthy cells in liver. The main causes are sustained, excessive alcohol consumption, viral hepatitis B and C, and fatty liver disease - however, there are other possible causes. Hemochromatosis is most common form of iron overload disease. Three types of hemochromatosis are primary hemochromatosis, also called hereditary hemochromatosis; secondary hemochromatosis; and neonatal hemochromatosis. The HFE gene helps regulate the amount of iron absorbed from food and inherited genetic defects or mutation in HFE [C282Y] cause primary hemochromatosis. Computational approach is sought to determine other similar mutations in this gene. In-silico tools such as SIFT, Polyphen 2.0, and PROVEAN were employed to determine the various deleterious ns-SNPs of HFE that may influence cystic fibrosis.

  16. Genome-wide association study identifies TF as a significant modifier gene of iron metabolism in HFE hemochromatosis.

    Science.gov (United States)

    de Tayrac, Marie; Roth, Marie-Paule; Jouanolle, Anne-Marie; Coppin, Hélène; le Gac, Gérald; Piperno, Alberto; Férec, Claude; Pelucchi, Sara; Scotet, Virginie; Bardou-Jacquet, Edouard; Ropert, Martine; Bouvet, Régis; Génin, Emmanuelle; Mosser, Jean; Deugnier, Yves

    2015-03-01

    Hereditary hemochromatosis (HH) is the most common form of genetic iron loading disease. It is mainly related to the homozygous C282Y/C282Y mutation in the HFE gene that is, however, a necessary but not a sufficient condition to develop clinical and even biochemical HH. This suggests that modifier genes are likely involved in the expressivity of the disease. Our aim was to identify such modifier genes. We performed a genome-wide association study (GWAS) using DNA collected from 474 unrelated C282Y homozygotes. Associations were examined for both quantitative iron burden indices and clinical outcomes with 534,213 single nucleotide polymorphisms (SNP) genotypes, with replication analyses in an independent sample of 748 C282Y homozygotes from four different European centres. One SNP met genome-wide statistical significance for association with transferrin concentration (rs3811647, GWAS p value of 7×10(-9) and replication p value of 5×10(-13)). This SNP, located within intron 11 of the TF gene, had a pleiotropic effect on serum iron (GWAS p value of 4.9×10(-6) and replication p value of 3.2×10(-6)). Both serum transferrin and iron levels were associated with serum ferritin levels, amount of iron removed and global clinical stage (pHFE-associated HH (HFE-HH) patients, identified the rs3811647 polymorphism in the TF gene as the only SNP significantly associated with iron metabolism through serum transferrin and iron levels. Because these two outcomes were clearly associated with the biochemical and clinical expression of the disease, an indirect link between the rs3811647 polymorphism and the phenotypic presentation of HFE-HH is likely. Copyright © 2014 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  17. Effects of highly conserved major histocompatibility complex (MHC extended haplotypes on iron and low CD8+ T lymphocyte phenotypes in HFE C282Y homozygous hemochromatosis patients from three geographically distant areas.

    Directory of Open Access Journals (Sweden)

    Mónica Costa

    Full Text Available Hereditary Hemochromatosis (HH is a recessively inherited disorder of iron overload occurring commonly in subjects homozygous for the C282Y mutation in HFE gene localized on chromosome 6p21.3 in linkage disequilibrium with the human leukocyte antigen (HLA-A locus. Although its genetic homogeneity, the phenotypic expression is variable suggesting the presence of modifying factors. One such genetic factor, a SNP microhaplotype named A-A-T, was recently found to be associated with a more severe phenotype and also with low CD8(+T-lymphocyte numbers. The present study aimed to test whether the predictive value of the A-A-T microhaplotype remained in other population settings. In this study of 304 HH patients from 3 geographically distant populations (Porto, Portugal 65; Alabama, USA 57; Nord-Trøndelag, Norway 182, the extended haplotypes involving A-A-T were studied in 608 chromosomes and the CD8(+ T-lymphocyte numbers were determined in all subjects. Patients from Porto had a more severe phenotype than those from other settings. Patients with A-A-T seemed on average to have greater iron stores (p = 0.021, but significant differences were not confirmed in the 3 separate populations. Low CD8(+ T-lymphocytes were associated with HLA-A*03-A-A-T in Porto and Alabama patients but not in the greater series from Nord-Trøndelag. Although A-A-T may signal a more severe iron phenotype, this study was unable to prove such an association in all population settings, precluding its use as a universal predictive marker of iron overload in HH. Interestingly, the association between A-A-T and CD8(+ T-lymphocytes, which was confirmed in Porto and Alabama patients, was not observed in Nord-Trøndelag patients, showing that common HLA haplotypes like A*01-B*08 or A*03-B*07 segregating with HFE/C282Y in the three populations may carry different messages. These findings further strengthen the relevance of HH as a good disease model to search for novel candidate loci

  18. The Study of HFE Genotypes and Its Expression Effect on Iron Status of Iranian Haemochromatosis, Iron Deficiency Anemia Patients, Iron-Taker and Non Iron-Taker Controls.

    Science.gov (United States)

    Beiranvand, Elham; Abediankenari, Saeid; Rostamian, Mosayeb; Beiranvand, Behnoush; Naazeri, Saeed

    2015-01-01

    The role of HFE gene mutations or its expression in regulation of iron metabolism of hereditary haemochromatosis (HH) patients is remained controversial. Therefore here the correlation between two common HFE genotype (p.C282Y, p.H63D) and HFE gene expression with iron status in HH, iron deficiency anemia (IDA) and healthy Iranian participants was studied. For this purpose genotype determination was done by polymerase chain reaction--restriction fragment length polymorphism (PCR-RFLP). Real-Time PCR was applied for evaluation of HFE gene expression. Biochemical parameters and iron consumption were also assessed. Homozygote p.H63D mutation was seen in all HH patients and p.C282Y was not observed in any member of the population. A significant correlation was observed between serum ferritin (SF) level and gender or age of HH patients. p.H63D homozygote was seen to be able to significantly increase SF and transferrin saturation (TS) level without affecting on liver function. Our results also showed that iron consumption affects on TS level increasing. HFE gene expression level of IDA patients was significantly higher than other groups. Also the HFE gene expression was negatively correlated with TS. Finally, the main result of our study showed that loss of HFE function in HH is not derived from its gene expression inhibition and much higher HFE gene expression might lead to IDA. However we propose repeating of the study for more approval of our finding.

  19. Hereditary Hemochromatosis (HFE genotypes in heart failure: Relation to etiology and prognosis

    Directory of Open Access Journals (Sweden)

    Torp-Pedersen Christian

    2010-07-01

    Full Text Available Abstract Background It is believed that hereditary hemochromatosis (HH might play a role in cardiac disease (heart failure (HF and ischemia. Mutations within several genes are HH-associated, the most common being the HFE gene. In a large cohort of HF patients, we sought to determine the etiological role and the prognostic significance of HFE genotypes. Methods We studied 667 HF patients (72.7% men with depressed systolic function, enrolled in a multicentre trial with a follow-up period of up to 5 years. All were genotyped for the known HFE variants C282Y, H63D and S65C. Results The genotype and allele frequencies in the HF group were similar to the frequencies determined in the general Danish population. In multivariable analysis mortality was not predicted by C282Y-carrier status (HR 1.2, 95% CI: 0.8-1.7; H63D-carrier status (HR 1.0, 95% CI: 0.7-1.3; nor S65C-carrier status (HR 1.2, 95% CI: 0.7-2.0. We identified 27 (4.1% homozygous or compound heterozygous carriers of HFE variants. None of these carriers had a clinical presentation suggesting hemochromatosis, but hemoglobin and ferritin levels were higher than in the rest of the cohort. Furthermore, a trend towards reduced mortality was seen in this group in univariate analyses (HR 0.4, 95% CI: 0.2-0.9, p = 0.03, but not in multivariate (HR 0.5, 95% CI: 0.2-1.2. Conclusion HFE genotypes do not seem to be a significant contributor to the etiology of heart failure in Denmark. HFE variants do not affect mortality in HF.

  20. Carriers of the Complex Allele HFE c.[187C>G;340+4T>C] Have Increased Risk of Iron Overload in São Miguel Island Population (Azores, Portugal).

    Science.gov (United States)

    Branco, Claudia C; Gomes, Cidália T; De Fez, Laura; Bulhões, Sara; Brilhante, Maria José; Pereirinha, Tânia; Cabral, Rita; Rego, Ana Catarina; Fraga, Cristina; Miguel, António G; Brasil, Gracinda; Macedo, Paula; Mota-Vieira, Luisa

    2015-01-01

    Iron overload is associated with acquired and genetic conditions, the most common being hereditary hemochromatosis (HH) type-I, caused by HFE mutations. Here, we conducted a hospital-based case-control study of 41 patients from the São Miguel Island (Azores, Portugal), six belonging to a family with HH type-I pseudodominant inheritance, and 35 unrelated individuals fulfilling the biochemical criteria of iron overload compatible with HH type-I. For this purpose, we analyzed the most common HFE mutations- c.845G>A [p.Cys282Tyr], c.187C>G [p.His63Asp], and c.193A>T [p.Ser65Cys]. Results revealed that the family's HH pseudodominant pattern is due to consanguineous marriage of HFE-c.845G>A carriers, and to marriage with a genetically unrelated spouse that is a -c.187G carrier. Regarding unrelated patients, six were homozygous for c.845A, and three were c.845A/c.187G compound heterozygous. We then performed sequencing of HFE exons 2, 4, 5 and their intron-flanking regions. No other mutations were observed, but we identified the -c.340+4C [IVS2+4C] splice variant in 26 (74.3%) patients. Functionally, the c.340+4C may generate alternative splicing by HFE exon 2 skipping and consequently, a protein missing the α1-domain essential for HFE/ transferrin receptor-1 interactions. Finally, we investigated HFE mutations configuration with iron overload by determining haplotypes and genotypic profiles. Results evidenced that carriers of HFE-c.187G allele also carry -c.340+4C, suggesting in-cis configuration. This data is corroborated by the association analysis where carriers of the complex allele HFE-c.[187C>G;340+4T>C] have an increased iron overload risk (RR = 2.08, 95% CI = 1.40-2.94, poverload because they will produce two altered proteins--the p.63Asp [c.187G], and the protein lacking 88 amino acids encoded by exon 2. In summary, we provide evidence that the complex allele HFE-c.[187C>G;340+4T>C] has a role, as genetic predisposition factor, on iron overload in the S

  1. Predicting C282Y Homozygote Genotype for Hemochromatosis Using Serum Ferritin and Transferrin Saturation Values from 44,809 Participants of the HEIRS Study

    Directory of Open Access Journals (Sweden)

    Andrew Lim

    2014-01-01

    Full Text Available INTRODUCTION: The simultaneous interpretation of serum ferritin level and transferrin saturation has been used as a clinical guide to diagnose genetic hemochromatosis. The Hemochromatosis and Iron Overload Screening (HEIRS Study screened 101,168 North American participants for serum ferritin level and transferrin saturation, and C282Y genotyping for the HFE gene.

  2. The evolutionary adaptation of the C282Y mutation to culture and climate during the European Neolithic

    OpenAIRE

    Heath, Kathleen M.; Axton, Jacob H.; McCullough, John M.; Harris, Nathan

    2016-01-01

    ABSTRACT Objectives The C282Y allele is the major cause of hemochromatosis as a result of excessive iron absorption. The mutation arose in continental Europe no earlier than 6,000 years ago, coinciding with the arrival of the Neolithic agricultural revolution. Here we hypothesize that this new Neolithic diet, which originated in the sunny warm and dry climates of the Middle East, was carried by migrating farmers into the chilly and damp environments of Europe where iron is a critical micronut...

  3. Association of mutations in the hemochromatosis gene with shorter life expectancy

    DEFF Research Database (Denmark)

    Bathum, L; Christiansen, L; Nybo, H

    2001-01-01

    BACKGROUND: To investigate whether the frequency of carriers of mutations in the HFE gene associated with hereditary hemochromatosis diminishes with age as an indication that HFE mutations are associated with increased mortality. It is of value in the debate concerning screening for hereditary...... hemochromatosis to determine the significance of heterozygosity. METHODS: Genotyping for mutations in exons 2 and 4 of the HFE gene using denaturing gradient gel electrophoresis in 1784 participants aged 45 to 100 years from 4 population-based studies: all 183 centenarians from the Danish Centenarian Study, 601...... in the distribution of mutations in exon 2 in the different age groups. CONCLUSIONS: In a high-carrier frequency population like Denmark, mutations in HFE show an age-related reduction in the frequency of heterozygotes for C282Y, which suggests that carrier status is associated with shorter life expectancy....

  4. Mutaciones del gen de la Hemocromatosis en donantes de sangre voluntarios y en pacientes con Porfiria cutánea tarda en Chile Mutations of hemochromatosis gene in volunteer blood donors and Chilean porphyria cutanea tarda patients

    Directory of Open Access Journals (Sweden)

    Carlos Wolff F

    2006-10-01

    Full Text Available La acumulación de hierro hepático asociada a mutaciones en el gen HFE de la hemocromatosis hereditaria (HH en los pacientes con porfiria cutánea tarda (PCT podría tener un papel en la etiología y en la expresión clínica de esta enfermedad. Se estudió la frecuencia de las mutaciones H63D y C282Y en un grupo de pacientes con PCT y se la comparó con la observada en un grupo de donantes voluntarios de sangre. Los pacientes con PCT fueron catalogados como portadores de la forma hereditaria o adquirida de la enfermedad, según presentaran o no mutaciones en el gen uroporfirinógeno decarboxilasa (UROD. El 50% de los pacientes con PCT eran portadores de la forma genética de la enfermedad, porcentaje significativamente mayor que lo informado en otras series. El 23% de los donantes voluntarios de sangre eran portadores de la mutación H63D y 2.4% lo era de la mutación C282Y. Frecuencias similares a lo encontrado por otros autores en población chilena de etnia blanca, en población argentina y española, pero significativamente más alta que lo encontrado en estudios en población aborigen araucana. Esto tiene, probablemente, relación con el predominio de ascendencia española en la población blanca chilena. La frecuencia de mutación en el gen HFE en pacientes con PCT no fue significativamente diferente que la observada en donantes voluntarios de sangre. Tampoco hubo diferencias significativas en la frecuencia de estas mutaciones entre los casos con PCT adquirida respecto de aquellos en que ésta era de origen genético. Los resultados obtenidos no permiten afirmar que exista asociación entre la PCT y la condición de portador de mutaciones del gen HFE de la hemocromatosis hereditaria.In patients with porphyria cutanea tarda (PCT, hepatic iron accumulation associated to hereditary hemochromatosis (HH could play a role in the etiology and in the clinical expression of the disease. The H63D and C282Y mutations of the HFE gene frequency were

  5. HFE gene mutations and Wilson's disease in Sardinia.

    Science.gov (United States)

    Sorbello, Orazio; Sini, Margherita; Civolani, Alberto; Demelia, Luigi

    2010-03-01

    Hypocaeruloplasminaemia can lead to tissue iron storage in Wilson's disease and the possibility of iron overload in long-term overtreated patients should be considered. The HFE gene encodes a protein that is intimately involved in intestinal iron absorption. The aim of this study was to determine the prevalence of the HFE gene mutation, its role in iron metabolism of Wilson's disease patients and the interplay of therapy in copper and iron homeostasis. The records of 32 patients with Wilson's disease were reviewed for iron and copper indices, HFE gene mutations and liver biopsy. Twenty-six patients were negative for HFE gene mutations and did not present significant alterations of iron metabolism. The HFE mutation was significantly associated with increased hepatic iron content (PHFE gene wild-type. The HFE gene mutations may be an addictional factor in iron overload in Wilson's disease. Our results showed that an adjustment of dosage of drugs could prevent further iron overload induced by overtreatment only in patients HFE wild-type. 2009. Published by Elsevier Ltd.

  6. Frequency of the Hemochromatosis Gene (HFE Variants in a Jordanian Arab Population and in Diabetics from the Same Region

    Directory of Open Access Journals (Sweden)

    Asem Alkhateeb

    2009-01-01

    Full Text Available Hereditary HFE-linked hemochromatosis is a frequent recessive disorder among individuals of northern European ancestry. The clinical characteristic of this disease is the gradual accumulation of iron in internal organs, which ultimately may lead to organ damage and death. Three allelic variants of HFE gene have been correlated with hereditary hemochromatosis: C282Y is significantly associated with hereditary hemochromatosis in populations of Celtic origin, H63D and S65C are associated with milder form of iron overload. In this study we performed mutation analysis to identify allele frequency of the three variants of HFE gene in Jordanian Arab population, to assess deviations of these frequencies from those detected elsewhere, and to determine if there is an increased frequency of these variants in a diabetic population (Type 2 diabetes from the same area. DNA was extracted from blood samples of 440 individuals attending King Abdullah University Hospital for ambulatory services. We used polymerase chain reaction (PCR to amplify exons 2 and 4 of the HFE gene then restriction fragment length polymorphism (RFLP method to detect the variants. There were neither homozygous nor heterozygous for C282Y variant. For the H63D variant, 0.68% were homozygous and 21.1% were heterozygous. For the S65C variant, there were no homozygous and 0.23% were heterozygous. Allelic frequencies were, 0%, 11.25%, and 0.11% for C282Y, H63D, and S65C, respectively. Our samples were subdivided into two categories of type 2 diabetic (89 cases and controls (blood donors, 204 cases and compared with regard to the H63D variant. Both groups did not have homozygous H63D variant. H63D heterozygous in diabetics were 23.60% and in blood donor controls 22.55%. Allelic frequency of the mutant H63D allele was 11.80% in diabetics and 11.27% for the blood donor controls. This is the first study to show the frequency of the three hemochromatosis gene variants in Jordan with the interesting

  7. HFE gene: Structure, function, mutations, and associated iron abnormalities.

    Science.gov (United States)

    Barton, James C; Edwards, Corwin Q; Acton, Ronald T

    2015-12-15

    The hemochromatosis gene HFE was discovered in 1996, more than a century after clinical and pathologic manifestations of hemochromatosis were reported. Linked to the major histocompatibility complex (MHC) on chromosome 6p, HFE encodes the MHC class I-like protein HFE that binds beta-2 microglobulin. HFE influences iron absorption by modulating the expression of hepcidin, the main controller of iron metabolism. Common HFE mutations account for ~90% of hemochromatosis phenotypes in whites of western European descent. We review HFE mapping and cloning, structure, promoters and controllers, and coding region mutations, HFE protein structure, cell and tissue expression and function, mouse Hfe knockouts and knockins, and HFE mutations in other mammals with iron overload. We describe the pertinence of HFE and HFE to mechanisms of iron homeostasis, the origin and fixation of HFE polymorphisms in European and other populations, and the genetic and biochemical basis of HFE hemochromatosis and iron overload. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Impact of HFE genetic testing on clinical presentation of hereditary hemochromatosis: new epidemiological data

    Directory of Open Access Journals (Sweden)

    Ka Chandran

    2005-06-01

    Full Text Available Abstract Background Hereditary hemochromatosis (HH is a common inherited disorder of iron metabolism in Northern European populations. The discovery of a candidate gene in 1996 (HFE, and of its main mutation (C282Y, has radically altered the way to diagnose this disease. The aim of this study was to assess the impact of the HFE gene discovery on the clinical presentation and epidemiology of HH. Methods We studied our cohort of 415 patients homozygous for the C282Y allele and included in a phlebotomy program in a blood centre in western Brittany, France. Results In this cohort, 56.9% of the patients were male and 21.9% began their phlebotomy program before the implementation of the genetic test. A significant decrease in the sex ratio was noticed following implementation of this DNA test, from 3.79 to 1.03 (p -5, meaning that the proportion of diagnosed females relatives to males greatly increased. The profile of HH patients at diagnosis changed after the DNA test became available. Serum ferritin and iron values were lower and there was a reduced frequency of clinical signs displayed at diagnosis, particularly skin pigmentation (20.1 vs. 40.4%, OR = 0.37, p Conclusion This study highlights the importance of the HFE gene discovery, which has simplified the diagnosis of HH and modified its clinical presentation and epidemiology. This study precisely measures these changes. Enhanced diagnosis of HFE-related HH at an early stage and implementation of phlebotomy treatment are anticipated to maintain normal life expectancy for these patients.

  9. Study of the HFE gene common polymorphisms in French patients with sporadic amyotrophic lateral sclerosis.

    Science.gov (United States)

    Praline, Julien; Blasco, Hélène; Vourc'h, Patrick; Rat, Valérian; Gendrot, Chantal; Camu, William; Andres, Christian R

    2012-06-15

    Our objective was to investigate whether the C282Y (p.Cys 282 Tyr) and H63D (p. His 63 Asp) HFE polymorphisms were associated with sporadic amyotrophic lateral sclerosis (SALS) in the French population. We searched for a relation of HFE polymorphisms with the clinical characteristics of the disease. The HFE polymorphisms were studied in 824 patients with SALS and 583 controls. We compared the frequency of the polymorphisms between SALS and controls groups by univariate and multivariate statistics, taking into account gender, site, age-at-onset and survival. We did not observe significant difference in the frequency of H63D polymorphism between SALS and control group. We observed a significant difference for C282Y between patients and controls with a low frequency of the Y allele in patients (3.2%) compared to our control group (5.9%). Disease duration, distribution of gender, site-of-onset, age-at-onset did not differ between groups taking into account genotypes of each polymorphism. Our results in this large cohort of ALS patients indicate that H63D polymorphism is not associated with SALS in the French population. This conclusion does not exclude a weak effect of the HFE gene polymorphisms in certain ALS populations, or an effect of other rare HFE gene variants. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Mild iron overload in patients carrying the HFE S65C gene mutation: a retrospective study in patients with suspected iron overload and healthy controls

    OpenAIRE

    Holmström, P; Marmur, J; Eggertsen, G; Gåfvels, M; Stål, P

    2002-01-01

    Background and aims: The role of the HFE S65C mutation in the development of hepatic iron overload is unknown. The aim of the present study was: (A) to determine the HFE S65C frequency in a Northern European population; and (B) to evaluate whether the presence of the HFE S65C mutation would result in a significant hepatic iron overload.

  11. A family with hereditary hemochromatosis carrying HFE gene splice site mutation: a case report

    Directory of Open Access Journals (Sweden)

    NING Huibin

    2017-01-01

    Full Text Available ObjectiveTo investigate a new type of HFE gene mutation in a family with hereditary hemochromatosis (HH. MethodsThe analysis of HFE gene was performed for one patient with a confirmed diagnosis of HH and five relatives. Blood genomic DNA was extracted and PCR multiplication was performed for the exon and intron splice sequences of related HFE, HJV, HAMP, transferrin receptor 2 (TfR2, and SLC40A1 genes. After agarose gel electrophoresis and purification, bi-directional direct sequencing was performed to detect mutation sites. ResultsThe proband had abnormal liver function and increases in serum iron, total iron binding capacity, serum ferritin, and transferrin saturation, as well as T→C homozygous mutation in the fourth base of intron 2 in the intervening sequence of the exon EXON2 of HFE gene (IVs 2+4T→C, C/C homozygous, splicing, abnormal. There were no abnormalities in HJV, HAMP, TfR2, and SLC40A1 genes. The proband′s son had the same homozygous mutation, three relatives had heterozygous mutations, and one relative had no abnormal mutations. ConclusionGene detection plays an important role in the diagnosis of hemochromatosis, and IVs 2+4T→C mutation may be a new pathogenic mutation for HH in China.

  12. THE EFFECT OF HAEMOCHROMATOSIS MUTATION ON IRON OVERLOAD IN THALASSAEMIA MAJOR PATIENTS

    Directory of Open Access Journals (Sweden)

    Tapas Ranjan Behera

    2016-11-01

    Full Text Available BACKGROUND Haemochromatosis is a genetic form of iron overload due to a defective HFE gene. Secondary iron overload is the main complication in transfusion-dependent thalassaemia major patients. This study aims at evaluating the degree of iron overload in β-thalassaemia major patients with and without HFE mutations (C282Y, H63D and S65C. MATERIALS AND METHODS A descriptive observational study was conducted including fifty diagnosed -thalassaemia major cases. Detailed clinical history and iron profile was estimated. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS After DNA analysis of all the thalassaemia major cases, two groups were identified, one with HFE gene mutation and other without HFE gene mutation. Iron profile of both the groups (with and without HFE gene mutation was estimated and compared. Only H63D mutation (out of three HFE gene mutations was detected in 16% cases (8 out of 50 cases, which comprised the group with mutation. Comparison of iron parameters between two groups (with and without HFE gene mutation showed significant difference in percent transferrin saturation (p=0.02, while other iron parameters (serum iron and serum ferritin did not show significant difference. CONCLUSION No significant difference between serum ferritin values (a marker of iron overload of groups with and without mutation (mean ferritin level 4641±2166 ng/mL and 4170±2461 ng/mL, respectively was found (p=0.61, in a patient population in whom transfusion protocol and proper chelation regimen was followed.

  13. Introduction of Molecular Diagnosis of Hemochromatosis Type 1 in Cuba

    Directory of Open Access Journals (Sweden)

    Ismael Aramís Cervera García

    2013-06-01

    Full Text Available Background: hemochromatosis type 1 is an autosomal recessive genetic disorder, which should be diagnosed during its preclinical phase in order to prevent severe organ damage. Objective: to establish the diagnosis of hemochromatosis type 1 in Cuba, and calculate its frequencies in patients with hepatopathies. Methods: an analytic cross-sectional study was conducted including 65 patients with liver disease, who were referred to the laboratory of Molecular Biology of the National Medical Genetics Center by clinical geneticists. A PCR-RFLP analysis was used for detecting the C282Y and H63D mutations in the HFE gene. Results: PCR-RFLP analysis was standardized for the detection of C282Y and H63D mutations. Frequencies of C282Y and H63D mutations in the HFE gene in patients with hepatopathies were 6.3% and 18.2% respectively. Conclusions: molecular diagnosis of C282Y and H63D mutations in the HFE gene causing hemochromatosis type 1 contributed to the identification of 28 carriers in the 65 patients who were studied, as well as a homozygous individual for the H63D mutation, which shows the high prevalence of these mutations in Cuban patients with liver disease.

  14. Coinheritance of hereditary spherocytosis and reversibility of cirrhosis in a young female patient with hereditary hemochromatosis.

    Science.gov (United States)

    Höblinger, A; Erdmann, C; Strassburg, C P; Sauerbruch, T; Lammert, F

    2009-04-16

    Here we report a 33-years-old woman with hereditary spherocytosis and hemochromatosis due to homozygosity for the C282Y mutation of the HFE gene. The coinheritance of both conditions led to severe iron overload and liver cirrhosis at young age. The patient was treated by repeated phlebotomy, and reversibility of cirrhosis was documented by transient elastography. This report discusses the pathophysiology of iron accumulation in patients with hemolytic anemia combined with HFE C282Y homozygosity. The case indicates that patients with hematological disorders characterized by increased erythropoetic activity should be screened for HFE mutations.

  15. Influence of HFE variants and cellular iron on monocyte chemoattractant protein-1

    Directory of Open Access Journals (Sweden)

    Simmons Zachary

    2009-02-01

    Full Text Available Abstract Background Polymorphisms in the MHC class 1-like gene known as HFE have been proposed as genetic modifiers of neurodegenerative diseases that include neuroinflammation as part of the disease process. Variants of HFE are relatively common in the general population and are most commonly associated with iron overload, but can promote subclinical cellular iron loading even in the absence of clinically identified disease. The effects of the variants as well as the resulting cellular iron dyshomeostasis potentially impact a number of disease-associated pathways. We tested the hypothesis that the two most common HFE variants, H63D and C282Y, would affect cellular secretion of cytokines and trophic factors. Methods We screened a panel of cytokines and trophic factors using a multiplexed immunoassay in human neuroblastoma SH-SY5Y cells expressing different variants of HFE. The influence of cellular iron secretion on the potent chemokine monocyte chemoattractant protein-1 (MCP-1 was assessed using ferric ammonium citrate and the iron chelator, desferroxamine. Additionally, an antioxidant, Trolox, and an anti-inflammatory, minocycline, were tested for their effects on MCP-1 secretion in the presence of HFE variants. Results Expression of the HFE variants altered the labile iron pool in SH-SY5Y cells. Of the panel of cytokines and trophic factors analyzed, only the release of MCP-1 was affected by the HFE variants. We further examined the relationship between iron and MCP-1 and found MCP-1 secretion tightly associated with intracellular iron status. A potential direct effect of HFE is considered because, despite having similar levels of intracellular iron, the association between HFE genotype and MCP-1 expression was different for the H63D and C282Y HFE variants. Moreover, HFE genotype was a factor in the effect of minocycline, a multifaceted antibiotic used in treating a number of neurologic conditions associated with inflammation, on MCP-1

  16. Haemochromatosis gene mutation H63D is a risk factor for iron ...

    African Journals Online (AJOL)

    Introduction: Iron overload is the main cause of morbidity and mortality in patients with β-thalassemia. The Aim: The aim of this study was to evaluate the prevalence of genetic markers (HFE mutations C282Y and H63D) among Egyptian β-thalassemic. Children and its effect on their iron status. Patients and Methods: 59 ...

  17. The relationship between selected VDR, HFE and ALAD gene polymorphisms and several basic toxicological parameters among persons occupationally exposed to lead

    International Nuclear Information System (INIS)

    Szymańska-Chabowska, Anna; Łaczmański, Łukasz; Jędrychowska, Iwona; Chabowski, Mariusz; Gać, Paweł; Janus, Agnieszka; Gosławska, Katarzyna; Smyk, Beata; Solska, Urszula; Mazur, Grzegorz; Poręba, Rafał

    2015-01-01

    The aim of this study was to find a relationship between polymorphisms of ALAD rs1805313, rs222808, rs1139488, VDR FokI and HFE C282Y and H63D and basic toxicological parameters (lead and ZnPP blood concentration) in people occupationally exposed to lead. We collected data of 101 workers (age 25–63 years) directly exposed to lead. The toxicological lab tests included blood lead, cadmium and ZnPP concentration measurement and arsenic urine concentration measurement. Workers were genotyped for ALAD (rs1805313, rs222808, rs1139488), HFE (C282Y, H63D) and VDR (FokI). Individuals with the lead exposure and coexisting F allel in the locus Fok-I of VDR gene are suspected of higher zinc protoporphyrins concentrations. Workers exposed to the lead with the Y allel in the locus C282Y of the HFE gene are predisposed to lower ZnPP levels and individuals with coexisting H allel in the locus H63D HFE gene are predisposed to lower Pb-B levels. The T allel in the locus rs1805313 of the ALAD gene determines lower Pb-B and ZnPP levels in lead–exposed individuals. The heterozigosity of the locus rs2228083 of the ALAD gene has a strong predilection to higher Pb-B levels. The carriage of the C allel in the locus rs1139488 of the ALAD gene might determine higher Pb-B levels and the heterozigosity of the locus rs1139488 of the ALAD gene might result in higher ZnPP levels. Conclusion. The study revealed relationship between VDR, HFE and ALAD genes polymorphism and basic toxicological parameters in occupationally exposed workers

  18. Risk of iron overload in carriers of genetic mutations associated with hereditary haemochromatosis: UK Food Standards Agency workshop.

    Science.gov (United States)

    Singh, Mamta; Ashwell, Margaret; Sanderson, Peter; Cade, Janet; Moreton, Jennifer; Fairweather-Tait, Susan; Roe, Mark; Marx, Joannes J M; Worwood, Mark; Cook, James D

    2006-10-01

    The UK Food Standards Agency convened a group of expert scientists to review current research investigating diet and carriers of genetic mutations associated with hereditary haemochromatosis. The workshop concluded that individuals who are heterozygous for the C282Y mutation of the HFE gene do not appear to respond abnormally to dietary Fe and therefore do not need to change their diet to prevent accumulation of body Fe.

  19. H63D mutation in HFE gene is common in Indians and is associated ...

    Indian Academy of Sciences (India)

    HH affects predominantly people of northern European origin and is often ... mutation with the C282Y mutation is a known risk factor for iron overload ... or has low allele frequencies in non-Caucasian populations,. i.e. African ... who were ascertained through self-reported questionnaire. ... confidence limits of the D statistic.

  20. HFE gene polymorphism defined by sequence-based typing of the Brazilian population and a standardized nomenclature for HFE allele sequences.

    Science.gov (United States)

    Campos, W N; Massaro, J D; Martinelli, A L C; Halliwell, J A; Marsh, S G E; Mendes-Junior, C T; Donadi, E A

    2017-10-01

    The HFE molecule controls iron uptake from gut, and defects in the molecule have been associated with iron overload, particularly in hereditary hemochromatosis. The HFE gene including both coding and boundary intronic regions were sequenced in 304 Brazilian individuals, encompassing healthy individuals and patients exhibiting hereditary or acquired iron overload. Six sites of variation were detected: (1) H63D C>G in exon 2, (2) IVS2 (+4) T>C in intron 2, (3) a C>G transversion in intron 3, (4) C282Y G>A in exon 4, (5) IVS4 (-44) T>C in intron 4, and (6) a new guanine deletion (G>del) in intron 5, which were used for haplotype inference. Nine HFE alleles were detected and six of these were officially named on the basis of the HLA Nomenclature, defined by the World Health Organization (WHO) Nomenclature Committee for Factors of the HLA System, and published via the IPD-IMGT/HLA website. Four alleles, HFE*001, *002, *003, and *004 exhibited variation within their exon sequences. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. The relationship between selected VDR, HFE and ALAD gene polymorphisms and several basic toxicological parameters among persons occupationally exposed to lead.

    Science.gov (United States)

    Szymańska-Chabowska, Anna; Łaczmański, Łukasz; Jędrychowska, Iwona; Chabowski, Mariusz; Gać, Paweł; Janus, Agnieszka; Gosławska, Katarzyna; Smyk, Beata; Solska, Urszula; Mazur, Grzegorz; Poręba, Rafał

    2015-08-06

    The aim of this study was to find a relationship between polymorphisms of ALAD rs1805313, rs222808, rs1139488, VDR FokI and HFE C282Y and H63D and basic toxicological parameters (lead and ZnPP blood concentration) in people occupationally exposed to lead. We collected data of 101 workers (age 25-63 years) directly exposed to lead. The toxicological lab tests included blood lead, cadmium and ZnPP concentration measurement and arsenic urine concentration measurement. Workers were genotyped for ALAD (rs1805313, rs222808, rs1139488), HFE (C282Y, H63D) and VDR (FokI). Individuals with the lead exposure and coexisting F allel in the locus Fok-I of VDR gene are suspected of higher zinc protoporphyrins concentrations. Workers exposed to the lead with the Y allel in the locus C282Y of the HFE gene are predisposed to lower ZnPP levels and individuals with coexisting H allel in the locus H63D HFE gene are predisposed to lower Pb-B levels. The T allel in the locus rs1805313 of the ALAD gene determines lower Pb-B and ZnPP levels in lead-exposed individuals. The heterozigosity of the locus rs2228083 of the ALAD gene has a strong predilection to higher Pb-B levels. The carriage of the C allel in the locus rs1139488 of the ALAD gene might determine higher Pb-B levels and the heterozigosity of the locus rs1139488 of the ALAD gene might result in higher ZnPP levels. The study revealed relationship between VDR, HFE and ALAD genes polymorphism and basic toxicological parameters in occupationally exposed workers. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  2. Natural selection on HFE in Asian populations contributes to enhanced non-heme iron absorption.

    Science.gov (United States)

    Ye, Kaixiong; Cao, Chang; Lin, Xu; O'Brien, Kimberly O; Gu, Zhenglong

    2015-06-10

    HFE, a major regulator of iron (Fe) homeostasis, has been suggested to be under positive selection in both European and Asian populations. While the genetic variant under selection in Europeans (a non-synonymous mutation, C282Y) has been relatively well-studied, the adaptive variant in Asians and its functional consequences are still unknown. Identifying the adaptive HFE variants in Asians will not only elucidate the evolutionary history and the genetic basis of population difference in Fe status, but also assist the future practice of genome-informed dietary recommendation. Using data from the International HapMap Project, we confirmed the signatures of positive selection on HFE in Asian populations and identified a candidate adaptive haplotype that is common in Asians (52.35-54.71%) but rare in Europeans (5.98%) and Africans (4.35%). The T allele at tag SNP rs9366637 (C/T) captured 95.8% of this Asian-common haplotype. A significantly reduced HFE expression was observed in individuals carrying T/T at rs9366637 compared to C/C and C/T, indicating a possible role of gene regulation in adaptation. We recruited 57 women of Asian descent and measured Fe absorption using stable isotopes in those homozygous at rs9366637. We observed a 22% higher absorption in women homozygous for the Asian-common haplotype (T/T) compared to the control genotype (C/C). Additionally, compared with a group of age-matched Caucasian women, Asian women exhibited significantly elevated Fe absorption. Our results indicate parallel adaptation of HFE gene in Europeans and Asians with different genetic variants. Moreover, natural selection on HFE may have contributed to elevated Fe absorption in Asians. This study regarding population differences in Fe homeostasis has significant medical impact as high Fe level has been linked to an increased disease risk of metabolic syndromes.

  3. The effect of the hemochromatosis (HFE) genotype on lead load and iron metabolism among lead smelter workers.

    Science.gov (United States)

    Fan, Guangqin; Du, Guihua; Li, Huijun; Lin, Fen; Sun, Ziyong; Yang, Wei; Feng, Chang; Zhu, Gaochun; Li, Yanshu; Chen, Ying; Jiao, Huan; Zhou, Fankun

    2014-01-01

    Both an excess of toxic lead (Pb) and an essential iron disorder have been implicated in many diseases and public health problems. Iron metabolism genes, such as the hemochromatosis (HFE) gene, have been reported to be modifiers for lead absorption and storage. However, the HFE gene studies among the Asian population with occupationally high lead exposure are lacking. To explore the modifying effects of the HFE genotype (wild-type, H63D variant and C282Y variant) on the Pb load and iron metabolism among Asian Pb-workers with high occupational exposure. Seven hundred and seventy-one employees from a lead smelter manufacturing company were tested to determine their Pb intoxication parameters, iron metabolic indexes and identify the HFE genotype. Descriptive and multivariate analyses were conducted. Forty-five H63D variant carriers and no C282Y variant carrier were found among the 771 subjects. Compared with subjects with the wild-type genotype, H63D variant carriers had higher blood lead levels, even after controlling for factors such as age, sex, marriage, education, smoking and lead exposure levels. Multivariate analyses also showed that the H63D genotype modifies the associations between the blood lead levels and the body iron burden/transferrin. No C282Y variant was found in this Asian population. The H63D genotype modified the association between the lead and iron metabolism such that increased blood lead is associated with a higher body iron content or a lower transferrin in the H63D variant. It is indicated that H63D variant carriers may be a potentially highly vulnerable sub-population if they are exposed to high lead levels occupationally.

  4. Relationship of Baseline Hemoglobin Level with Serum Ferritin, Postphlebotomy Hemoglobin Changes, and Phlebotomy Requirements among HFE C282Y Homozygotes

    Directory of Open Access Journals (Sweden)

    Seyed Ali Mousavi

    2015-01-01

    Full Text Available Objectives. We aimed to examine whether baseline hemoglobin levels in C282Y-homozygous patients are related to the degree of serum ferritin (SF elevation and whether patients with different baseline hemoglobin have different phlebotomy requirements. Methods. A total of 196 patients (124 males and 72 females who had undergone therapeutic phlebotomy and had SF and both pre- and posttreatment hemoglobin values were included in the study. Results. Bivariate correlation analysis suggested that baseline SF explains approximately 6 to 7% of the variation in baseline hemoglobin. The results also showed that males who had higher (≥150 g/L baseline hemoglobin levels had a significantly greater reduction in their posttreatment hemoglobin despite requiring fewer phlebotomies to achieve iron depletion than those who had lower (<150 g/L baseline hemoglobin, regardless of whether baseline SF was below or above 1000 µg/L. There were no significant differences between hemoglobin subgroups regarding baseline and treatment characteristics, except for transferrin saturation between male subgroups with SF above 1000 µg/L. Similar differences were observed when females with higher (≥138 g/L baseline hemoglobin were compared with those with lower (<138 g/L baseline hemoglobin. Conclusion. Dividing C282Y-homozygous patients into just two subgroups according to the degree of baseline SF elevation may obscure important subgroup variations.

  5. Relationship of Baseline Hemoglobin Level with Serum Ferritin, Postphlebotomy Hemoglobin Changes, and Phlebotomy Requirements among HFE C282Y Homozygotes

    Science.gov (United States)

    Mousavi, Seyed Ali; Mahmood, Faiza; Aandahl, Astrid; Knutsen, Teresa Risopatron; Llohn, Abid Hussain

    2015-01-01

    Objectives. We aimed to examine whether baseline hemoglobin levels in C282Y-homozygous patients are related to the degree of serum ferritin (SF) elevation and whether patients with different baseline hemoglobin have different phlebotomy requirements. Methods. A total of 196 patients (124 males and 72 females) who had undergone therapeutic phlebotomy and had SF and both pre- and posttreatment hemoglobin values were included in the study. Results. Bivariate correlation analysis suggested that baseline SF explains approximately 6 to 7% of the variation in baseline hemoglobin. The results also showed that males who had higher (≥150 g/L) baseline hemoglobin levels had a significantly greater reduction in their posttreatment hemoglobin despite requiring fewer phlebotomies to achieve iron depletion than those who had lower (baseline hemoglobin, regardless of whether baseline SF was below or above 1000 µg/L. There were no significant differences between hemoglobin subgroups regarding baseline and treatment characteristics, except for transferrin saturation between male subgroups with SF above 1000 µg/L. Similar differences were observed when females with higher (≥138 g/L) baseline hemoglobin were compared with those with lower (baseline hemoglobin. Conclusion. Dividing C282Y-homozygous patients into just two subgroups according to the degree of baseline SF elevation may obscure important subgroup variations. PMID:26380265

  6. Four variants in transferrin and HFE genes as potential markers of iron deficiency anaemia risk: an association study in menstruating women

    Directory of Open Access Journals (Sweden)

    Arroyo-Pardo Eduardo

    2011-10-01

    Full Text Available Abstract Background Iron deficiency anaemia is a worldwide health problem in which environmental, physiologic and genetic factors play important roles. The associations between iron status biomarkers and single nucleotide polymorphisms (SNPs known to be related to iron metabolism were studied in menstruating women. Methods A group of 270 Caucasian menstruating women, a population group at risk of iron deficiency anaemia, participated in the study. Haematological and biochemical parameters were analysed and 10 selected SNPs were genotyped by minisequencing assay. The associations between genetic and biochemical data were analysed by Bayesian Model Averaging (BMA test and decision trees. Dietary intake of a representative subgroup of these volunteers (n = 141 was assessed, and the relationship between nutrients and iron biomarkers was also determined by linear regression. Results Four variants, two in the transferrin gene (rs3811647, rs1799852 and two in the HFE gene (C282Y, H63D, explain 35% of the genetic variation or heritability of serum transferrin in menstruating women. The minor allele of rs3811647 was associated with higher serum transferrin levels and lower transferrin saturation, while the minor alleles of rs1799852 and the C282Y and H63D mutations of HFE were associated with lower serum transferrin levels. No association between nutrient intake and iron biomarkers was found. Conclusions In contrast to dietary intake, these four SNPs are strongly associated with serum transferrin. Carriers of the minor allele of rs3811647 present a reduction in iron transport to tissues, which might indicate higher iron deficiency anaemia risk, although the simultaneous presence of the minor allele of rs1799852 and HFE mutations appear to have compensatory effects. Therefore, it is suggested that these genetic variants might potentially be used as markers of iron deficiency anaemia risk.

  7. Gender and plasma iron biomarkers, but not HFE gene mutations, increase the risk of colorectal cancer and polyps.

    Science.gov (United States)

    Castiella, Agustin; Múgica, Fernando; Zapata, Eva; Zubiaurre, Leire; Iribarren, Arantxa; de Juan, M Dolores; Alzate, Luis; Gil, Ines; Urdapilleta, Gregorio; Otazua, Pedro; Emparanza, José Ignacio

    2015-09-01

    A cohort study of patients included in the Basque Country colorectal cancer (CRC) screening programme was carried out to assess the risk of adenomatous polyps and CRC (P-CRC) associated with HFE gene mutations, with gender and with iron biomarkers (serum ferritin (SF), iron (Fe) and transferrin saturation index (TSI)). Among 432 included patients (mean age 59.8 years), 263 were men (60.9 %) and 169 women (39.1 %). P-CRC were identified in 221 patients (51.2 %) and no polyps (NP) in 211 patients (48.8 %). HFE mutations were identified in 43.8 % of the patients. C282Y/wt genotypic frequency was 6.8 % in the P-CRC group and 1.4 % in the NP group (p < 0.05). The allelic frequency was 3.8 versus 1.2 % (p < 0.05). For laboratory, all three iron biomarkers showed a statistically significant difference: mean Fe, 91.29 ± 34 for P-CRC and 80.81 ± 30.59 for NP group. Mean TSI for P-CRC was 24.95 ± 8.90 and 22.74 ± 8.79 for NP group. Mean SF 308.09 ± 536.32 for P-CRC and 177.55 ± 159.95 for NP group. In a multivariate logistic regression analysis, only male gender (odds ratio (OR) = 2.04, 1.29-3.22), SF (OR = 1.001, 1.0004-1.003) and Fe (OR = 1.01, 1.004-1.02) were related with the presence of CRC and adenoma. Men gender and raised serum iron biomarkers increase the risk of P-CRC.

  8. [Analysis of H63D mutation in hemochromatosis (HFE) gene in populations of central Eurasia].

    Science.gov (United States)

    Khusainova, R I; Khusnutdinova, N N; Litvinov, S S; Khusnutdinova, E K

    2013-02-01

    An analysis of the frequency of H63D (c. 187C>G) mutations in the HFEgene in 19 populations from Central Eurasia demonstrated that the distribution of the mutation in the region of interest was not uniform and that there were the areas of H63D accumulation. The investigation of three polymorphic variants, c.340+4T>C (rs2071303, IVS2(+4)T>C), c.893-44T>C (rs1800708, IVS4(-44)T>C), and c.1007-47G>A (rs1572982, IVS5(-47)A>G), in the HFE gene in individuals homozygous for H63D mutations in the HFE gene revealed the linkage of H63D with three haplotypes, *CTA, *TG, and *TTA. These findings indicated the partial spread of the mutation in Central Eurasia from Western Europe, as well as the possible repeated appearance of the mutation on the territory on interest.

  9. The influence of iron status and genetic polymorphisms in the HFE gene on the risk for postoperative complications after bariatric surgery: a prospective cohort study in 1,064 patients

    Directory of Open Access Journals (Sweden)

    Freedman-Weiss Mollie

    2011-01-01

    Full Text Available Abstract Background Gastric bypass surgery is a highly effective therapy for long-term weight loss in severely obese patients, but carries significant perioperative risks including infection, wound dehiscence, and leaks from staple breakdown. Iron status can affect immune function and wound healing, thus may influence peri-operative complications. Common mutations in the HFE gene, the gene responsible for the iron overload disorder hereditary hemochromatosis, may impact iron status. Methods We analyzed 1064 extremely obese Caucasian individuals who underwent open and laparoscopic Roux-n-Y gastric bypass surgery at the Geisinger Clinic. Serum iron, ferritin, transferrin, and iron binding capacity were measured pre-operatively. All patients had intra-operative liver biopsies and were genotyped for the C282Y and H63D mutations in the HFE gene. Associations between surgical complications and serum iron measures, HFE gene status, and liver iron histology were determined. Results We found that increased serum iron and transferrin saturation were present in patients with any post-operative complication, and that increased serum ferritin was also increased in patients with major complications. Increased serum transferrin saturation was also associated with wound complications in open RYGB, and transferrin saturation and ferritin with prolonged lengths of stay. The presence of 2 or more HFE mutations was associated with overall complications as well as wound complications in open RYGB. No differences were found in complication rates between those with stainable liver iron and those without. Conclusion Serum iron status and HFE genotype may be associated with complications following RYGB surgery in the extremely obese.

  10. HFE gene mutation is a risk factor for tissue iron accumulation in hemodialysis patients.

    Science.gov (United States)

    Turkmen, Ercan; Yildirim, Tolga; Yilmaz, Rahmi; Hazirolan, Tuncay; Eldem, Gonca; Yilmaz, Engin; Aybal Kutlugun, Aysun; Altindal, Mahmut; Altun, Bulent

    2017-07-01

    HFE gene mutations are responsible from iron overload in general population. Studies in hemodialysis patients investigated the effect of presence of HFE gene mutations on serum ferritin and transferrin saturation (TSAT) with conflicting results. However effect of HFE mutations on iron overload in hemodialysis patients was not previously extensively studied. 36 hemodialysis patients (age 51.3 ± 15.6, (18/18) male/female) and 44 healthy control subjects included in this cross sectional study. Hemoglobin, ferritin, TSAT in the preceding 2 years were recorded. Iron and erythropoietin (EPO) administered during this period were calculated. Iron accumulation in heart and liver was detected by MRI. Relationship between HFE gene mutation, hemoglobin, iron parameters and EPO doses, and tissue iron accumulation were determined. Iron overload was detected in nine (25%) patients. Hemoglobin, iron parameters, weekly EPO doses, and monthly iron doses of patients with and without iron overload were similar. There was no difference between control group and hemodialysis patients with respect to the prevalence of HFE gene mutations. Iron overload was detected in five of eight patients who had HFE gene mutations, but iron overload was present in 4 of 28 patients who had no mutations (P = 0.01). Hemoglobin, iron parameters, erythropoietin, and iron doses were similar in patients with and without gene mutations. HFE gene mutations remained the main determinant of iron overload after multivariate logistic regression analysis (P = 0.02; OR, 11.6). Serum iron parameters were not adequate to detect iron overload and HFE gene mutation was found to be an important risk factor for iron accumulation. © 2017 International Society for Hemodialysis.

  11. The effect of the hemochromatosis (HFE genotype on lead load and iron metabolism among lead smelter workers.

    Directory of Open Access Journals (Sweden)

    Guangqin Fan

    Full Text Available Both an excess of toxic lead (Pb and an essential iron disorder have been implicated in many diseases and public health problems. Iron metabolism genes, such as the hemochromatosis (HFE gene, have been reported to be modifiers for lead absorption and storage. However, the HFE gene studies among the Asian population with occupationally high lead exposure are lacking.To explore the modifying effects of the HFE genotype (wild-type, H63D variant and C282Y variant on the Pb load and iron metabolism among Asian Pb-workers with high occupational exposure.Seven hundred and seventy-one employees from a lead smelter manufacturing company were tested to determine their Pb intoxication parameters, iron metabolic indexes and identify the HFE genotype. Descriptive and multivariate analyses were conducted.Forty-five H63D variant carriers and no C282Y variant carrier were found among the 771 subjects. Compared with subjects with the wild-type genotype, H63D variant carriers had higher blood lead levels, even after controlling for factors such as age, sex, marriage, education, smoking and lead exposure levels. Multivariate analyses also showed that the H63D genotype modifies the associations between the blood lead levels and the body iron burden/transferrin.No C282Y variant was found in this Asian population. The H63D genotype modified the association between the lead and iron metabolism such that increased blood lead is associated with a higher body iron content or a lower transferrin in the H63D variant. It is indicated that H63D variant carriers may be a potentially highly vulnerable sub-population if they are exposed to high lead levels occupationally.

  12. Characteristics of gene mutation in Chinese patients with hereditary hemochromatosis

    Directory of Open Access Journals (Sweden)

    LYU Tingxia

    2016-08-01

    Full Text Available ObjectiveTo investigate the characteristics of gene mutation in Chinese patients with hereditary hemochromatosis (HH. MethodsA total of 9 patients with HH who visited Beijing Friendship Hospital, Capital Medical University from January 2013 to December 2015 were enrolled. The genomic DNA was extracted, and PCR amplification and Sanger sequencing were performed for all the exons of four genotypes of HH, i.e., HFE (type Ⅰ, HJV (type ⅡA, HAMP (type ⅡB, TFR2 (type Ⅲ, and SLC40A1 (type Ⅳ to analyze gene mutations. A total of 50 healthy subjects were enrolled as control group to analyze the prevalence of identified gene mutations in a healthy population. ResultsOf all patients, 2 had H63D mutation of HFE gene in type Ⅰ HH, 1 had E3D mutation of HJV gene in type ⅡA HH, 2 had I238M mutation of TFR2 gene in type Ⅲ HH, and 1 had IVS 3+10 del GTT splice mutation of SLC40A1 gene in type Ⅳ HH. No patients had C282Y mutation of HFE gene in type Ⅰ HH which was commonly seen in European and American populations. Five patients had no missense mutation or splice mutation. In addition, it was found in a family that a HH patient had E3D mutation of HJV gene, H63D mutation of HFE gene, and I238M mutation of TFR2 gene, but the healthy brother and sister carrying two of these mutations did not had the phenotype of HH. ConclusionHH gene mutations vary significantly across patients of different races, and non-HFE-HH is dominant in the Chinese population. There may be HH genes which are different from known genes, and further investigation is needed.

  13. Risk factors for development of dementia in a unique six-year cohort study. I. An exploratory, pilot study of involvement of the E4 allele of apolipoprotein E, mutations of the hemochromatosis-HFE gene, type 2 diabetes, and stroke.

    Science.gov (United States)

    Percy, Maire; Somerville, Martin J; Hicks, Mark; Garcia, Angeles; Colelli, Teresa; Wright, Emily; Kitaygorodsky, Julia; Jiang, Amy; Ho, Valerie; Parpia, Alyssa; Wong, Michael K

    2014-01-01

    Risk factors for dementia development are not well-defined. We evaluated several factors alone and in combination in a unique cohort of Caucasian volunteers over an approximately 6-year observation window using a nested case/control design. Factors included: apolipoprotein E (ApoE) gene variants (the E4 allele is the strongest confirmed genetic predisposing factor for Alzheimer's disease), the hemochromatosis-HFE gene mutations (H63D and C282Y), diabetes, and stroke. At study entry, subjects were ≥65 years of age (M ± SD = 73.0 ± 4.9), had an MMSE score ≥24, and no evidence of cerebrovascular disease or current depression. Genotyping was completed on 163 available DNA samples from three different groups at the study end: those who still had normal cognitive function; those who had developed dementia; and those with Mild Cognitive Impairment (MCI). Analyses were interpreted at the 95% confidence level without Bonferroni corrections. In the subgroup with dementia, all cases of diabetes were type 2 and present at study entry, whereas all strokes occurred during the study. The results highlight apparently synergistic interactions between genetic and medical risk factors for dementia development, gender differences in risk factors, and involvement of HFE mutations. Having E4 (i.e., either of E3/4 or E4/4), C282Y, H63D, diabetes, or stroke alone did not attain significance. Significant predisposing factors with post-hoc power ≥80% were: E4 homozygosity (E4/4)males+females, odds ratio (OR) = 56.0); E4+diabetes (males+females, OR = 13.7; E4+H63D+diabetes (females, OR = 52.0); E4+stroke (males, OR = 46.5). The importance of preventing diabetes and stroke to ward off dementia and the possible role of iron dysmetabolism in dementia are discussed.

  14. The Correlation of Cardiac and Hepatic Hemosiderosis as Measured by T2*MRI Technique with Ferritin Levels and Hemochromatosis Gene Mutations in Iranian Patients with Beta Thalassemia Major

    Directory of Open Access Journals (Sweden)

    Mohammad Soleiman Soltanpour

    2018-01-01

    Full Text Available Objectives: Organ-specific hemosiderosis and iron overload complications are more serious and more frequent in some patients with beta thalassemia major (BTM compared with others. We investigated whether coinheritance of HFE H63D or C282Y gene mutations in patients with BTM contributes to the phenotypic variation of iron overload complications and assessed the correlation of cardiac and hepatic hemosiderosis with plasma ferritin levels. Methods: We studied 60 patients with BTM with a mean age of 17.5±9.1 years from the Northwest of Iran. HFE gene mutations were analyzed using the polymerase chain reaction-restriction fragment length polymorphism method. Cardiac and hepatic hemosiderosis was assessed using T2*magnetic resonance imaging (MRI. Ferritin levels were measured using the enzyme immunoassay method. Results: Ferritin levels showed a strong inverse correlation with hepatic T2*MRI values (r = -0.631, p = 0.001 but a poor correlation with cardiac T2*MRI values (r = -0.297, p = 0.044. The correlation between cardiac T2*MRI values and hepatic T2*MRI values was poor and insignificant (r = 0.287, p = 0.058. Genotype and allele distribution of HFE H63D and C282Y mutation did not differ significantly between patients with and without hepatic or cardiac hemosiderosis (p > 0.050. However, carriers of HFE 63D allele had significantly higher ferritin levels compared with non-carriers (1 903±993 vs. 992±683, p < 0.001. Conclusions: Cardiac T2*MRI values showed a poor correlation with hepatic T2*MRI values and ferritin levels. Accurate assessment of cardiac iron overload in patients with BTM can only be done using the T2*MRI technique. Additionally, HFE H63D is a significant determinant factor for elevated ferritin levels in BTM patients.

  15. HFE gene mutation and oxidative damage biomarkers in patients with myelodysplastic syndromes and its relation to transfusional iron overload: an observational cross-sectional study.

    Science.gov (United States)

    De Souza, Geane Felix; Ribeiro, Howard Lopes; De Sousa, Juliana Cordeiro; Heredia, Fabíola Fernandes; De Freitas, Rivelilson Mendes; Martins, Manoel Ricardo Alves; Gonçalves, Romélia Pinheiro; Pinheiro, Ronald Feitosa; Magalhães, Silvia Maria Meira

    2015-04-03

    A relation between transfusional IOL (iron overload), HFE status and oxidative damage was evaluated. An observational cross-sectional study involving 87 healthy individuals and 78 patients with myelodysplastic syndromes (MDS) with and without IOL, seen at University Hospital of the Federal University of Ceará, Brazil, between May 2010 and September 2011. IOL was defined using repeated measures of serum ferritin ≥1000 ng/mL. Variations in the HFE gene were investigated using PCR/restriction fragment length polymorphism (RFLP). The biomarkers of oxidative stress (plasmatic malonaldehyde (MDA), glutathione peroxidase (GPx) and superoxide dismutase (SOD)) were determined by spectrophotometry. The HFE gene variations were identified in 24 patients (30.77%) and 5 volunteers (5.74%). The H63D variant was observed in 35% and the C282Y variant as heterozygous in 5% of patients with MDS with IOL. One patient showed double heterozygous variant (C282Y/H63D) and serum ferritin of 11,649 ng/mL. In patients without IOL, the H63D variant was detected in 29.34%. Serum MDA levels were highest in patients with MDS with IOL, with a significant difference when compared with patients without IOL and healthy volunteers, pointing to the relationship between IOL and oxidative stress. The GPx and SOD were also significantly higher in these patients, indicating that lipid peroxidation increase was followed by an increase in antioxidant capacity. Higher ferritin levels were observed in patients with HFE gene variation. 95.7% of patients with MDS with the presence of HFE gene variations had received more of 20 transfusions. We observed a significant increase in MDA levels in patients with MDS and IOL, suggesting an increased lipid peroxidation in these patients. The accumulation of MDA alters the organisation of membrane phospholipids, contributing to the process of cellular degeneration. Results show that excess iron intensifies the process of cell damage through oxidative stress

  16. HFE gene variants modify the association between maternal lead burden and infant birthweight: a prospective birth cohort study in Mexico City, Mexico.

    Science.gov (United States)

    Cantonwine, David; Hu, Howard; Téllez-Rojo, Martha Maria; Sánchez, Brisa N; Lamadrid-Figueroa, Héctor; Ettinger, Adrienne S; Mercado-García, Adriana; Hernández-Avila, Mauricio; Wright, Robert O

    2010-07-26

    Neonatal growth is a complex process involving genetic and environmental factors. Polymorphisms in the hemochromatosis (HFE) iron regulatory genes have been shown to modify transport and toxicity of lead which is known to affect birth weight. We investigated the role of HFE C282Y, HFE H63 D, and transferrin (TF) P570 S gene variants in modifying the association of lead and infant birthweight in a cohort of Mexican mother-infant pairs. Subjects were initially recruited between 1994-1995 from three maternity hospitals in Mexico City and 411 infants/565 mothers had archived blood available for genotyping. Multiple linear regression models, stratified by either maternal/infant HFE or TF genotype and then combined with interaction terms, were constructed examining the association of lead and birthweight after controlling for covariates. 3.1%, 16.8% and 17.5% of infants (N=390) and 1.9%, 14.5% and 18.9% of mothers (N=533) carried the HFE C282Y, HFE H63D, and TF P570 S variants, respectively. The presence of infant HFE H63 D variants predicted 110.3 g (95% CI -216.1, -4.6) decreases in birthweight while maternal HFE H63 D variants predicted reductions of 52.0 g (95% CI -147.3 to 43.2). Interaction models suggest that both maternal and infant HFE H63 D genotype may modify tibia lead's effect on infant birthweight in opposing ways. In our interaction models, maternal HFE H63 D variant carriers had a negative association between tibia lead and birthweight. These results suggest that the HFE H63 D genotype modifies lead's effects on infant birthweight in a complex fashion that may reflect maternal-fetal interactions with respect to the metabolism and transport of metals.

  17. [Molecular genetic diagnostics and screening of hereditary hemochromatosis].

    Science.gov (United States)

    Zlocha, J; Kovács, L; Pozgayová, S; Kupcová, V; Durínová, S

    2006-06-01

    Hereditary hemochromatosis is considered one of the most common hereditary diseases in population of Caucasian origin. In recent years, a candidate gene for HLA-linked hemochromatosis, HFE, has been cloned, and a single G-to-A mutation resulting in a cysteine-to-tyrosine substitution (C282Y) has been identified in up to 80% of study patients with type 1 hereditary hemochromatosis. The purpose of the paper was to confirm the importance of genetic testing for HFE mutations in making the diagnosis of hemochromatosis and find out a suitable diagnostic algorithm for the indication of this form of diagnostics in patients suspected of hereditary hemochromatosis. The examination of C282Y mutation was conducted in 500 subjects. The most frequent indications for DNA analysis were hepatopathy of unknown ethiology, liver cirrhosis, diabetes mellitus, bronze skin pigmentation in connection with high serum iron concentration, elevated transferrin saturation and elevated serum ferritin levels. In our group of patients, 29 homozygotes and 75 heterozygotes for C282Y mutation were identified, 10 patients carried both C282Y and H63D mutations of HFE gene (compound heterozygotes), whereas in 386 subjects the mutation was not found. The genotype-phenotype correlation showed that 22 homozygotes had liver affection proved by imaging and/or histologic methods. Except the liver disorders, the most common symptoms of these patients were type 2 diabetes mellitus or glucose tolerance disorder (10 patients), arthritis or joint pain (9 patients) and cardiovascular disorders, such as cardiomyopathy (2 patients). Bronze skin pigmentation was present in 9 homozygotes. Transferin saturation values were significantly higher in homozygotes for C282Y mutation as compared to C282Y heterozygotes (p diagnostics of this severe, but in early recognition curable disease. Early detection and phlebotomy treatment prior to the onset of cirrhosis can reduce morbidity and normalize life expectancy. It is readily

  18. Two novel mutations in the SLC40A1 and HFE genes implicated in iron overload in a Spanish man.

    Science.gov (United States)

    Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Alvarez-Sala-Walther, Luis-Antonio; Cuadrado-Grande, Nuria; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

    2011-03-01

    The most common form of hemochromatosis is caused by mutations in the HFE gene. Rare forms of the disease are caused by mutations in other genes. We present a patient with hyperferritinemia and iron overload, and facial flushing. Magnetic resonance imaging was performed to measure hepatic iron overload, and a molecular study of the genes involved in iron metabolism was undertaken. The iron overload was similar to that observed in HFE hemochromatosis, and the patient was double heterozygous for two novel mutations, c.-20G>A and c.718A>G (p.K240E), in the HFE and ferroportin (FPN1 or SLC40A1) genes, respectively. Hyperferritinemia and facial flushing improved after phlebotomy. Two of the patient's children were also studied, and the daughter was heterozygous for the mutation in the SLC40A1 gene, although she did not have hyperferritinemia. The patient presented a mild iron overload phenotype probably because of the two novel mutations in the HFE and SLC40A1 genes. © 2011 John Wiley & Sons A/S.

  19. Identification of novel mutations in HFE, HFE2, TfR2, and SLC40A1 genes in Chinese patients affected by hereditary hemochromatosis.

    Science.gov (United States)

    Wang, Yongwei; Du, Yali; Liu, Gang; Guo, Shanshan; Hou, Bo; Jiang, Xianyong; Han, Bing; Chang, Yanzhong; Nie, Guangjun

    2017-04-01

    Hereditary hemochromatosis (HH) is a group of inherited iron-overload disorders associated with pathogenic defects in the genes encoding hemochromatosis (HFE), hemojuvelin (HJV/HFE2), hepcidin (HAMP), transferrin receptor 2 (TfR2), and ferroportin (FPN1/SLC40A1) proteins, and the clinical features are well described. However, there have been only a few detailed reports of HH in Chinese populations. Thus, there is insufficient patient information for population-based analyses in Chinese populations or comparative studies among different ethical groups. In the current work, we describe eight Chinese cases of hereditary hemochromatosis. Gene sequencing results revealed eight mutations (five novel mutations) in HFE, HFE2, TfR2, and SLC40A1 genes in these Chinese HH patients. In addition, we used Polymorphism Phenotyping v2 (Polyphen), Sorting Intolerant From Tolerant (SIFT), and a sequence alignment program to predict the molecular consequences of missense mutations.

  20. HLA haplotype map of river valley populations with hemochromatosis traced through five centuries in Central Sweden.

    Science.gov (United States)

    Olsson, K Sigvard; Ritter, Bernd; Hansson, Norbeth; Chowdhury, Ruma R

    2008-07-01

    The hemochromatosis mutation, C282Y of the HFE gene, seems to have originated from a single event which once occurred in a person living in the north west of Europe carrying human leukocyte antigen (HLA)-A3-B7. In descendants of this ancestor also other haplotypes appear probably caused by local recombinations and founder effects. The background of these associations is unknown. Isolated river valley populations may be fruitful for the mapping of genetic disorders such as hemochromatosis. In this study, we try to test this hypothesis in a study from central Sweden where the haplotyope A1-B8 was common. HLA haplotypes and HFE mutations were studied in hemochromatosis patients with present or past parental origin in a sparsely populated (1/km(2)) rural district (n = 8366 in the year of 2005), in central Sweden. Pedigrees were constructed from the Swedish church book registry. Extended haplotypes were studied to evaluate origin of recombinations. There were 87 original probands, 36 females and 51 males identified during 30 yr, of whom 86% carried C282Y/C282Y and 14% C282Y/H63D. Of 32 different HLA haplotypes A1-B8 was the most common (34%), followed by A3-B7 (16%), both in strong linkage disequilibrium with controls, (P females. River valley populations may contain HLA haplotypes reflecting their demographic history. This study has demonstrated that the resistance against recombinations between HLA-A and HFE make HLA haplotypes excellent markers for population movements. Founder effects and genetic drift from bottleneck populations (surviving the plague?) may explain the commonness of the mutation in central Scandinavia. The intergenerational time difference >30 yr was greater than expected and means that the age of the original mutation may be underestimated.

  1. Allele frequencies of hemojuvelin gene (HJV I222N and G320V missense mutations in white and African American subjects from the general Alabama population

    Directory of Open Access Journals (Sweden)

    Bohannon Sean B

    2004-12-01

    Full Text Available Abstract Background Homozygosity or compound heterozygosity for coding region mutations of the hemojuvelin gene (HJV in whites is a cause of early age-of-onset iron overload (juvenile hemochromatosis, and of hemochromatosis phenotypes in some young or middle-aged adults. HJV coding region mutations have also been identified recently in African American primary iron overload and control subjects. Primary iron overload unexplained by typical hemochromatosis-associated HFE genotypes is common in white and black adults in Alabama, and HJV I222N and G320V were detected in a white Alabama juvenile hemochromatosis index patient. Thus, we estimated the frequency of the HJV missense mutations I222N and G320V in adult whites and African Americans from Alabama general population convenience samples. Methods We evaluated the genomic DNA of 241 Alabama white and 124 African American adults who reported no history of hemochromatosis or iron overload to detect HJV missense mutations I222N and G320V using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP technique. Analysis for HJV I222N was performed in 240 whites and 124 African Americans. Analysis for HJV G320V was performed in 241 whites and 118 African Americans. Results One of 240 white control subjects was heterozygous for HJV I222N; she was also heterozygous for HFE C282Y, but had normal serum iron measures and bone marrow iron stores. HJV I222N was not detected in 124 African American subjects. HJV G320V was not detected in 241 white or 118 African American subjects. Conclusions HJV I222N and G320V are probably uncommon causes or modifiers of primary iron overload in adult whites and African Americans in Alabama. Double heterozygosity for HJV I222N and HFE C282Y may not promote increased iron absorption.

  2. Reduction of Skeletal Muscle Power in Adolescent Males Carrying H63D Mutation in the HFE Gene.

    Science.gov (United States)

    Luszczyk, Marcin; Kaczorowska-Hac, Barbara; Milosz, Ewa; Adamkiewicz-Drozynska, Elzbieta; Ziemann, Ewa; Laskowski, Radoslaw; Flis, Damian; Rokicka-Hebel, Magdalena; Antosiewicz, Jedrzej

    2017-01-01

    Iron overload resulting from the mutation of genes involved in iron metabolism or excess dietary intake has been reported to negatively influence human physical performance. The aim of this study was to test the hypothesis that adolescents bearing a hemochromatosis gene (HFE) mutation in contrast to adults with the same mutation will not experience iron accumulation and their aerobic capacity will be similar to that of age-matched controls. Thirteen boys participated in the study. Seven of them are carriers of H63D mutation in the HFE gene and six were wild type. Fitness levels were assessed using the cardiopulmonary exercise test. In addition, iron status and inflammatory markers were determined. We observed that cardiovascular fitness was significantly lower in the group bearing the HFE mutation compared to the control group. Moreover, the HFE mutation group achieved lower maximal power output compared to the control group. There were no differences in blood ferritin concentrations between the two groups which indicates similar amounts of stored iron. Obtained data do not confirm our hypothesis. On the contrary, it was demonstrated that HFE mutation is associated with a lower level of aerobic capacity, even in the absence of iron accumulation.

  3. FAMILY ANAMNESIS OF CHILDREN WITH MUTATION OF THE INHERITED HEMOCHROMATOSIS

    Directory of Open Access Journals (Sweden)

    S.I. Polyakova

    2010-01-01

    Full Text Available The inherited burdened is studied on diseases, associated with an overload iron in 41 children with frequent mutations of the inherited hemochromatosis (IG of a 1 type (C282y, H63d, S65c. Control group was made by 27 children with undiscovered frequent mutations of NG. Frequencies of iron-associated diseases are compared for 560 members of families which have children with mutations of IG and 390 members of families which have children without IG mutations. Some features of medical-genealogical anamnesis, which can be conditioned of siderosis, are exposed, and indirectly specify in the presence of mutations in the gene of HFE. So, the high frequency of oncologic diseases, diabetes mellitus, hepatocirrhosis and deaths of relatives under the age of 50 years are the foundation for research of exchange of iron and holding of molecular-genetic research of the inherited hemochromatosis. Key words: inherited hemochromatosis, heredity, children. (Pediatric Pharmacology. – 2010; 7(3:52-56

  4. Reduction of Skeletal Muscle Power in Adolescent Males Carrying H63D Mutation in the HFE Gene

    Directory of Open Access Journals (Sweden)

    Marcin Luszczyk

    2017-01-01

    Full Text Available Iron overload resulting from the mutation of genes involved in iron metabolism or excess dietary intake has been reported to negatively influence human physical performance. The aim of this study was to test the hypothesis that adolescents bearing a hemochromatosis gene (HFE mutation in contrast to adults with the same mutation will not experience iron accumulation and their aerobic capacity will be similar to that of age-matched controls. Thirteen boys participated in the study. Seven of them are carriers of H63D mutation in the HFE gene and six were wild type. Fitness levels were assessed using the cardiopulmonary exercise test. In addition, iron status and inflammatory markers were determined. We observed that cardiovascular fitness was significantly lower in the group bearing the HFE mutation compared to the control group. Moreover, the HFE mutation group achieved lower maximal power output compared to the control group. There were no differences in blood ferritin concentrations between the two groups which indicates similar amounts of stored iron. Obtained data do not confirm our hypothesis. On the contrary, it was demonstrated that HFE mutation is associated with a lower level of aerobic capacity, even in the absence of iron accumulation.

  5. Liver steatosis correlates with iron overload but not with HFE gene mutations in chronic hepatitis C.

    Science.gov (United States)

    Sikorska, Katarzyna; Stalke, Piotr; Romanowski, Tomasz; Rzepko, Robert; Bielawski, Krzysztof Piotr

    2013-08-01

    Liver steatosis and iron overload, which are frequently observed in chronic hepatitis C (CHC), may contribute to the progression of liver injury. This study aimed to evaluate the correlation between liver steatosis and iron overload in Polish patients with CHC compared to non-alcoholic fatty liver disease (NAFLD) and HFE-hereditary hemochromatosis (HH) patients. A total of 191 CHC patients were compared with 67 NAFLD and 21 HH patients. Liver function tests, serum markers of iron metabolism, cholesterol and triglycerides were assayed. The inflammatory activity, fibrosis, iron deposits and steatosis stages were assessed in liver specimens. HFE gene polymorphisms were investigated by PCR-RFLP. Liver steatosis was associated with obesity and diabetes mellitus. This disease was confirmed in 76/174 (44%) CHC patients, most of whom were infected with genotype 1. The average grade of steatosis was higher in NAFLD patients. CHC patients had significantly higher iron concentrations and transferrin saturations than NAFLD patients. Compared with CHC patients, HH patients had higher values of serum iron parameters and more intensive hepatocyte iron deposits without differences in the prevalence and intensity of liver steatosis. In the CHC group, lipids accumulation in hepatocytes was significantly associated with the presence of serum markers of iron overload. No correlation between the HFE gene polymorphism and liver steatosis in CHC patients was found. Liver steatosis was diagnosed in nearly half of CHC patients, most of whom were infected with genotype 1. The intensity of steatosis was lower in CHC patients than that in NAFLD patients because of a less frequent diagnosis of metabolic syndrome. Only in CHC patients were biochemical markers of iron accumulation positively correlated with liver steatosis; these findings were independent of HFE gene mutations.

  6. Best practice guidelines for the molecular genetic diagnosis of Type 1 (HFE-related hereditary haemochromatosis

    Directory of Open Access Journals (Sweden)

    Barton David E

    2006-11-01

    Full Text Available Abstract Background Hereditary haemochromatosis (HH is a recessively-inherited disorder of iron over-absorption prevalent in Caucasian populations. Affected individuals for Type 1 HH are usually either homozygous for a cysteine to tyrosine amino acid substitution at position 282 (C282Y of the HFE gene, or compound heterozygotes for C282Y and for a histidine to aspartic acid change at position 63 (H63D. Molecular genetic testing for these two mutations has become widespread in recent years. With diverse testing methods and reporting practices in use, there was a clear need for agreed guidelines for haemochromatosis genetic testing. The UK Clinical Molecular Genetics Society has elaborated a consensus process for the development of disease-specific best practice guidelines for genetic testing. Methods A survey of current practice in the molecular diagnosis of haemochromatosis was conducted. Based on the results of this survey, draft guidelines were prepared using the template developed by UK Clinical Molecular Genetics Society. A workshop was held to develop the draft into a consensus document. The consensus document was then posted on the Clinical Molecular Genetics Society website for broader consultation and amendment. Results Consensus or near-consensus was achieved on all points in the draft guidelines. The consensus and consultation processes worked well, and outstanding issues were documented in an appendix to the guidelines. Conclusion An agreed set of best practice guidelines were developed for diagnostic, predictive and carrier testing for hereditary haemochromatosis and for reporting the results of such testing.

  7. Serum hepcidin levels, iron status, and HFE gene alterations during the first year of life in healthy Spanish infants.

    Science.gov (United States)

    Aranda, Nuria; Bedmar, Cristina; Arija, Victoria; Jardí, Cristina; Jimenez-Feijoo, Rosa; Ferré, Natalia; Tous, Monica

    2018-06-01

    The aims of this study were to describe hepcidin levels and to assess their associations with iron status and the main variants in the HFE gene in healthy and full-term newborns during the first year of life, as a longitudinal study conducted on 140 infants. Anthropometric and biochemical parameters, hepcidin, hemoglobin (Hb), serum ferritin (SF), transferrin saturation (TS), mean corpuscular volume (MCV), and C-reactive protein (CRP), were assessed in 6- and 12-month-olds. Infants were genotyped for the three main HFE variants: C282Y, H63D, and S65C. Hepcidin levels increased from 6 to 12 months of age (43.7 ± 1.5 to 52.0 ± 1.5 ng/mL; p HFE gene (p = 0.046 and p = 0.048 in 6- and 12-month-olds, respectively). However, this association was not found in HFE-alteration-carrying infants. Hepcidin levels increased in healthy infants during the first year of life and were positively associated with iron levels only in infants with wild-type HFE gene, a situation that requires further investigation.

  8. Association study between four polymorphisms in the HFE, TF and TFR genes and Parkinson's disease in southern Italy.

    Science.gov (United States)

    Greco, Valentina; De Marco, Elvira Valeria; Rocca, Francesca Emanuela; Annesi, Ferdinanda; Civitelli, Donatella; Provenzano, Giovanni; Tarantino, Patrizia; Scornaienchi, Vittorio; Pucci, Franco; Salsone, Maria; Novellino, Fabiana; Morelli, Maurizio; Paglionico, Sandra; Gambardella, Antonio; Quattrone, Aldo; Annesi, Grazia

    2011-06-01

    Iron overload may lead to neurodegenerative disorders such as Parkinson's disease (PD) and alterations of iron-related genes might be involved in the pathogenesis of this disease. The gene of haemochromatosis (HFE) encodes the HFE protein which interacts with the transferrin receptor (TFR), lowering its affinity for iron-bound transferrin (TF). We examined four known polymorphisms, C282Y and H63D in the HFE gene, G258S in the TF gene and S82G in the TFR gene, in 181 sporadic PD patients and 180 controls from Southern Italy to investigate their possible role in susceptibility to PD. No significant differences were found in genotype and allele frequencies between PD and controls for all the polymorphisms studied, suggesting that these variants do not contribute significantly to the risk of PD.

  9. Intragenic haplotype analysis of common HFE mutations in the ...

    Indian Academy of Sciences (India)

    mutation <100 generations ago in the Celtic populations of mainland Europe, with a ... 0.9–5.8%, evidencing regional differences in distribution across the ..... and H63D alleles in the HFE gene among various Jewish ethnic groups in Israel: a ...

  10. Frekvensen af haemokromatoseassocierede mutationer i haemokromatosegenet i den danske befolkning. ØsterbroundersØgelsen

    DEFF Research Database (Denmark)

    Larsen, Lisbeth Enggaard; Ellervik, Christina; Appleyard, Merete

    2002-01-01

    INTRODUCTION: Hereditary haemochromatosis is an autosomal recessive condition characterised by systemic iron overload. In Northern Europe, 85-90% of patients with haemochromatosis are homozygous for the C282Y mutation in the HFE gene. In the present study, we determined the prevalence...

  11. A novel homozygous stop-codon mutation in human HFE responsible for nonsense-mediated mRNA decay.

    Science.gov (United States)

    Padula, Maria Carmela; Martelli, Giuseppe; Larocca, Marilena; Rossano, Rocco; Olivieri, Attilio

    2014-09-01

    HFE-hemochromatosis (HH) is an autosomal disease characterized by excessive iron absorption. Homozygotes for H63D variant, and still less H63D heterozygotes, generally do not express HH phenotype. The data collected in our previous study in the province of Matera (Basilicata, Italy) underlined that some H63D carriers showed altered iron metabolism, without additional factors. In this study, we selected a cohort of 10/22 H63D carriers with severe biochemical iron overload (BIO). Additional analysis was performed for studying HFE exons, exon-intron boundaries, and untranslated regions (UTRs) by performing DNA extraction, PCR amplification and sequencing. The results showed a novel substitution (NM_000410.3:c.847C>T) in a patient exon 4 (GenBankJQ478433); it introduces a premature stop-codon (PTC). RNA extraction and reverse-transcription were also performed. Quantitative real-time PCR was carried out for verifying if our aberrant mRNA is targeted for nonsense-mediated mRNA decay (NMD); we observed that patient HFE mRNA was expressed much less than calibrator, suggesting that the mutated HFE protein cannot play its role in iron metabolism regulation, resulting in proband BIO. Our finding is the first evidence of a variation responsible for a PTC in iron cycle genes. The genotype-phenotype correlation observed in our cases could be related to the additional mutation. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Variation in the HFE gene is associated with the development of bleomycin-induced pulmonary toxicity in testicular cancer patients.

    Science.gov (United States)

    van der Schoot, Gabriela G F; Westerink, Nico-Derk L; Lubberts, Sjoukje; Nuver, Janine; Zwart, Nynke; Walenkamp, Annemiek M E; Wempe, Johan B; Meijer, Coby; Gietema, Jourik A

    2016-05-01

    Bleomycin and cisplatin are of key importance in testicular cancer treatment. Known potential serious adverse effects are bleomycin-induced pulmonary toxicity (BIP) and cisplatin-induced renal toxicity. Iron handling may play a role in development of this toxicity. Carriage of allelic variants of the HFE gene induces altered iron metabolism and may contribute to toxicity. We investigated the association between two common allelic variants of the HFE gene, H63D and C282Y, with development of pulmonary and renal toxicity during and after treatment with bleomycin- and cisplatin-containing chemotherapy. In 369 testicular cancer patients treated with bleomycin and cisplatin at the University Medical Center Groningen between 1978 and 2006, H63D and/or C282Y genotypes were determined with an allelic discrimination assay. Data were collected on development of BIP, pulmonary function parameters, renal function, and survival. BIP developed more frequently in patients who were heterozygote (16 in 75, 21%) and homozygote (2 in 4, 50%) for the H63D variant, compared with those who had the HFE wild-type gene (31 in 278, 11%) (p = 0.012). Overall survival, testicular cancer-related survival, and change in renal function were not associated with the H63D variant. We observed an association between presence of one or both H63D alleles and development of BIP in testicular cancer patients treated with bleomycin combination chemotherapy. In patients heterozygote and homozygote for the H63D variant, BIP occurred more frequently compared with wild-type patients. When validated and confirmed, HFE H63D genotyping may be used to identify patients with increased risk for pulmonary bleomycin toxicity. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. The role of genetic factors in patients with hepatocellular carcinoma and iron overload - a prospective series of 234 patients.

    Science.gov (United States)

    Funakoshi, Natalie; Chaze, Iphigénie; Alary, Anne-Sophie; Tachon, Gaëlle; Cunat, Séverine; Giansily-Blaizot, Muriel; Bismuth, Michael; Larrey, Dominique; Pageaux, Georges-Philippe; Schved, Jean-François; Donnadieu-Rigole, Hélène; Blanc, Pierre; Aguilar-Martinez, Patricia

    2016-05-01

    Iron overload (IO) in HFE-related hereditary haemochromatosis is associated with increased risk of liver cancer. This study aimed to investigate the role of other genes involved in hereditary IO among patients with hepatocellular carcinoma (HCC). Patients with HCC diagnosed in our institution were included in this prospective study. Those with ferritin levels ≥300 μg/L (males) or ≥200 μg/L (females) and/or transferrin saturation ≥50% (males) or ≥45% (females) had liver iron concentration (LIC) evaluated by MRI. HFE C282Y and H63D mutations were screened. Genetic analyses of genes involved in hereditary IO (HFE, HJV/HFE2, HAMP, TFR2, SLC40A1, GNPAT) were performed in patients with increased LIC. A total of 234 patients were included; 215 (92%) had common acquired risk factors of HCC (mainly alcoholism or chronic viral hepatitis). 119 patients had abnormal iron parameters. Twelve (5.1%) were C282Y homozygotes, three were compound C282Y/H63D heterozygotes. LIC was measured by MRI in 100 patients. Thirteen patients with a LIC>70 μmol/g were enrolled in further genetic analyses: two unrelated patients bore the HAMP:c.-153C>T mutation at the heterozygous state, which is associated with increased risk of IO and severe haemochromatosis. Specific haplotypes of SLC40A1 were also studied. Additional genetic risk factors of IO were found in 18 patients (7.7%) among a large series of 234 HCC patients. Screening for IO and the associated at-risk genotypes in patients who have developed HCC, is useful for both determining etiologic diagnosis and enabling family screening and possibly primary prevention in relatives. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. [CCR5, CCR2, apoe, p53, ITGB3 and HFE gene polymorphism in Western Siberia long-livers].

    Science.gov (United States)

    Ivanoshchuk, D E; Mikhaĭlova, S V; Kulikov, I V; Maksimov, V N; Voevoda, M I; Romashchenko, A G

    2012-01-01

    In order to estimate the distribution of some polymorphisms for the CCR5, CCR2, apoE, p53, ITGB3, and HFE genes in Russian long-livers from Western Siberia, a sample of 271 individuals (range 90-105 years) was examined. It was demonstrated that carriage of the delta32 polymorphism for the CCR5 gene, V64/polymorphism for the CCR2 gene, e2/e3/e4 for the apoE gene, L33P for the ITGB3 gene, as well as H63D and S65C polymorphisms for the HFE gene does not influence on predisposition to the longevity; carriage of the 282 Y allele for the HFE gene negatively influences on the longevity; carriage of the heterozygous genotype for the R72P polymorphism for the p53 gene correlates with the longevity of elderly people.

  15. Mutation in HFE gene decreases manganese accumulation and oxidative stress in the brain after olfactory manganese exposure.

    Science.gov (United States)

    Ye, Qi; Kim, Jonghan

    2016-06-01

    Increased accumulation of manganese (Mn) in the brain is significantly associated with neurobehavioral deficits and impaired brain function. Airborne Mn has a high systemic bioavailability and can be directly taken up into the brain, making it highly neurotoxic. While Mn transport is in part mediated by several iron transporters, the expression of these transporters is altered by the iron regulatory gene, HFE. Mutations in the HFE gene are the major cause of the iron overload disorder, hereditary hemochromatosis, one of the prevalent genetic diseases in humans. However, whether or not HFE mutation modifies Mn-induced neurotoxicity has not been evaluated. Therefore, our goal was to define the role of HFE mutation in Mn deposition in the brain and the resultant neurotoxic effects after olfactory Mn exposure. Mice carrying the H67D HFE mutation, which is homologous to the H63D mutation in humans, and their control, wild-type mice, were intranasally instilled with MnCl2 with different doses (0, 0.2, 1.0 and 5.0 mg kg(-1)) daily for 3 days. Mn levels in the blood, liver and brain were determined using inductively-coupled plasma mass spectrometry (ICP-MS). H67D mutant mice showed significantly lower Mn levels in the blood, liver, and most brain regions, especially in the striatum, while mice fed an iron-overload diet did not. Moreover, mRNA expression of ferroportin, an essential exporter of iron and Mn, was up-regulated in the striatum. In addition, the levels of isoprostane, a marker of lipid peroxidation, were increased in the striatum after Mn exposure in wild-type mice, but were unchanged in H67D mice. Together, our results suggest that the H67D mutation provides decreased susceptibility to Mn accumulation in the brain and neurotoxicity induced by inhaled Mn.

  16. Eighty percent of French sport winners in Olympic, World and Europeans competitions have mutations in the hemochromatosis HFE gene.

    Science.gov (United States)

    Hermine, Olivier; Dine, Gérard; Genty, Vincent; Marquet, Laurie-Anne; Fumagalli, Gabriela; Tafflet, Muriel; Guillem, Flavia; Van Lierde, Françoise; Rousseaux-Blanchi, Marie-Philippe; Palierne, Christian; Lapostolle, Jean-Claude; Cervetti, Jean-Pierre; Frey, Alain; Jouven, Xavier; Noirez, Philippe; Toussaint, Jean-François

    2015-12-01

    The HFE gene encodes a protein involved in iron homeostasis; individuals with mutations in both alleles develop hemochromatosis. 27% of the French population is heterozygous for mutations in this gene. We found that 80% of the French athletes who won international competitions in rowing, Nordic skiing and judo display mutations in one allele of HFE, thus demonstrating the existence of a favourable phenotype linked to this heterozygosity. Copyright © 2015. Published by Elsevier B.V.

  17. Transgenic HFE-dependent induction of hepcidin in mice does not require transferrin receptor-2.

    Science.gov (United States)

    Schmidt, Paul J; Fleming, Mark D

    2012-06-01

    Hereditary hemochomatosis (HH) is caused by mutations in several genes, including HFE and transferrin receptor-2 (TFR2). Loss of either protein decreases expression of the iron regulatory hormone hepcidin by the liver, leading to inappropriately high iron uptake from the diet, and resulting in systemic iron overload. In tissue culture, overexpressed HFE and TFR2 physically interact. Hepatocellular overexpression of Hfe in vivo increases hepcidin expression, despite an associated decrease in Tfr2. On this basis, we hypothesized that Tfr2 would not be required for Hfe-dependent up-regulation of hepcidin. We show that hepatocellular overexpression of Hfe in Tfr2(Y245X/Y245X) mice leads to hepcidin induction eventuating in iron deficiency and a hypochromic, microcytic anemia. Furthermore, coimmunoprecipitation studies using liver lysates did not provide evidence for physical interaction between Hfe and Tfr2 in vivo. In conclusion, we demonstrate that Tfr2 is not essential for Hfe-mediated induction of hepcidin expression, supporting the possibility that TFR2 may regulate iron metabolism in an HFE-independent manner. Copyright © 2012 Wiley Periodicals, Inc.

  18. Influence of Diet, Menstruation and Genetic Factors on Iron Status: A Cross-Sectional Study in Spanish Women of Childbearing Age

    Directory of Open Access Journals (Sweden)

    Ruth Blanco-Rojo

    2014-03-01

    Full Text Available The aim of this study was to investigate the combined influence of diet, menstruation and genetic factors on iron status in Spanish menstruating women (n = 142. Dietary intake was assessed by a 72-h detailed dietary report and menstrual blood loss by a questionnaire, to determine a Menstrual Blood Loss Coefficient (MBLC. Five selected SNPs were genotyped: rs3811647, rs1799852 (Tf gene; rs1375515 (CACNA2D3 gene; and rs1800562 and rs1799945 (HFE gene, mutations C282Y and H63D, respectively. Iron biomarkers were determined and cluster analysis was performed. Differences among clusters in dietary intake, menstrual blood loss parameters and genotype frequencies distribution were studied. A categorical regression was performed to identify factors associated with cluster belonging. Three clusters were identified: women with poor iron status close to developing iron deficiency anemia (Cluster 1, n = 26; women with mild iron deficiency (Cluster 2, n = 59 and women with normal iron status (Cluster 3, n = 57. Three independent factors, red meat consumption, MBLC and mutation C282Y, were included in the model that better explained cluster belonging (R2 = 0.142, p < 0.001. In conclusion, the combination of high red meat consumption, low menstrual blood loss and the HFE C282Y mutation may protect from iron deficiency in women of childbearing age. These findings could be useful to implement adequate strategies to prevent iron deficiency anemia.

  19. Influence of diet, menstruation and genetic factors on iron status: a cross-sectional study in Spanish women of childbearing age.

    Science.gov (United States)

    Blanco-Rojo, Ruth; Toxqui, Laura; López-Parra, Ana M; Baeza-Richer, Carlos; Pérez-Granados, Ana M; Arroyo-Pardo, Eduardo; Vaquero, M Pilar

    2014-03-06

    The aim of this study was to investigate the combined influence of diet, menstruation and genetic factors on iron status in Spanish menstruating women (n = 142). Dietary intake was assessed by a 72-h detailed dietary report and menstrual blood loss by a questionnaire, to determine a Menstrual Blood Loss Coefficient (MBLC). Five selected SNPs were genotyped: rs3811647, rs1799852 (Tf gene); rs1375515 (CACNA2D3 gene); and rs1800562 and rs1799945 (HFE gene, mutations C282Y and H63D, respectively). Iron biomarkers were determined and cluster analysis was performed. Differences among clusters in dietary intake, menstrual blood loss parameters and genotype frequencies distribution were studied. A categorical regression was performed to identify factors associated with cluster belonging. Three clusters were identified: women with poor iron status close to developing iron deficiency anemia (Cluster 1, n = 26); women with mild iron deficiency (Cluster 2, n = 59) and women with normal iron status (Cluster 3, n = 57). Three independent factors, red meat consumption, MBLC and mutation C282Y, were included in the model that better explained cluster belonging (R2 = 0.142, p < 0.001). In conclusion, the combination of high red meat consumption, low menstrual blood loss and the HFE C282Y mutation may protect from iron deficiency in women of childbearing age. These findings could be useful to implement adequate strategies to prevent iron deficiency anemia.

  20. A mutation in the HFE gene is associated with altered brain iron profiles and increased oxidative stress in mice.

    Science.gov (United States)

    Nandar, Wint; Neely, Elizabeth B; Unger, Erica; Connor, James R

    2013-06-01

    Because of the increasing evidence that H63D HFE polymorphism appears in higher frequency in neurodegenerative diseases, we evaluated the neurological consequences of H63D HFE in vivo using mice that carry H67D HFE (homologous to human H63D). Although total brain iron concentration did not change significantly in the H67D mice, brain iron management proteins expressions were altered significantly. The 6-month-old H67D mice had increased HFE and H-ferritin expression. At 12 months, H67D mice had increased H- and L-ferritin but decreased transferrin expression suggesting increased iron storage and decreased iron mobilization. Increased L-ferritin positive microglia in H67D mice suggests that microglia increase iron storage to maintain brain iron homeostasis. The 6-month-old H67D mice had increased levels of GFAP, increased oxidatively modified protein levels, and increased cystine/glutamate antiporter (xCT) and hemeoxygenase-1 (HO-1) expression indicating increased metabolic and oxidative stress. By 12 months, there was no longer increased astrogliosis or oxidative stress. The decrease in oxidative stress at 12 months could be related to an adaptive response by nuclear factor E2-related factor 2 (Nrf2) that regulates antioxidant enzymes expression and is increased in the H67D mice. These findings demonstrate that the H63D HFE impacts brain iron homeostasis, and promotes an environment of oxidative stress and induction of adaptive mechanisms. These data, along with literature reports on humans with HFE mutations provide the evidence to overturn the traditional paradigm that the brain is protected from HFE mutations. The H67D knock-in mouse can be used as a model to evaluate how the H63D HFE mutation contributes to neurodegenerative diseases. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Molecular basis of HFE-hemochromatosis

    Directory of Open Access Journals (Sweden)

    Maja eVujic Spasic

    2014-03-01

    Full Text Available Iron-overload disorders owing to genetic misregulation of iron acquisition are referred to as hereditary hemochromatosis (HH. The most prevalent genetic iron overload disorder in Caucasians is caused by mutations in the HFE gene, an atypical MHC class I molecule. Recent studies classified HFE/Hfe-hemochromatosis as a liver disease with the primarily failure in the production of the liver iron hormone hepcidin in hepatocytes. Inadequate hepcidin expression signals for excessive iron absorption from the diet and iron deposition in tissues causing multiple organ damage and failure. This review focuses on the molecular actions of the HFE/Hfe and hepcidin in maintaining systemic iron homeostasis and approaches undertaken so far to combat iron overload in HFE/Hfe-HH. In the light of the recent investigations, novel roles of extra-hepatocytic Hfe are discussed raising a question to the relevance of the multipurpose functions of Hfe for the understanding of HH associated pathologies.

  2. Molecular basis of HFE-hemochromatosis.

    Science.gov (United States)

    Vujić, Maja

    2014-01-01

    Iron-overload disorders owing to genetic misregulation of iron acquisition are referred to as hereditary hemochromatosis (HH). The most prevalent genetic iron overload disorder in Caucasians is caused by mutations in the HFE gene, an atypical MHC class I molecule. Recent studies classified HFE/Hfe-HH as a liver disease with the primarily failure in the production of the liver iron hormone hepcidin in hepatocytes. Inadequate hepcidin expression signals for excessive iron absorption from the diet and iron deposition in tissues causing multiple organ damage and failure. This review focuses on the molecular actions of the HFE/Hfe and hepcidin in maintaining systemic iron homeostasis and approaches undertaken so far to combat iron overload in HFE/Hfe-HH. In the light of the recent investigations, novel roles of extra-hepatocytic Hfe are discussed raising a question to the relevance of the multipurpose functions of Hfe for the understanding of HH-associated pathologies.

  3. The prevalence of primary hereditary hemochromatosis in central Anatolia.

    Science.gov (United States)

    Karaca, Halit; Güven, Kadri; Önal, Müge; Gürsoy, Şebnem; Başkol, Mevlüt; Özkul, Yusuf

    2013-01-01

    Hereditary hemochromatosis is an autosomal recessive disorder associated with the HFE genes. Early identification and diagnosis is important as end stage organ damage may occur if treatment is delayed.. This study aimed to identify the prevalence of hereditary hemochromatosis in Kayseri and surroundings known as Central Anatolia. 2304 participants (1220 males, 1084 females) who were older then the age of 17 were included in the study conducted between December 2005 and December 2006 in Kayseri, Turkey. Transferin saturation was measured from overnight fasting blood samples. Serum iron, total iron binding capacity, and transferin saturation were measured. Serum ferritin levels and hereditary hemochromatosis genetic analysis were also performed after an overnight fasting blood samples from participants whose transferin saturation results were more than 50% in man and more than 45% in women. The homozygote C282Y mutation and heterozygote C282Y mutation prevalences were found as 0.08% (1/1220) and 0.08% (1/1220) in male participants, respectively. The heterozygote H63D mutation prevalence was found in 0.09% (1/1084) of female participants. Calculated prevalences in general population are as follows; The homozygote C282Y mutation prevalence is 0.043% (1/2304), the heterozygote C282Y mutation prevalence is 0.043% (1/2304) and the heterozygote H63D mutation prevalence is 0.043% (1/2304). The prevalence of hereditary hemochromatosis in Central Anatolia is 0.043% (1/2304). Because of the relatively low frequency, population screening studies are not cost-effective.

  4. Ethnic and genetic factors of iron status in women of reproductive age.

    Science.gov (United States)

    Gordeuk, Victor R; Brannon, Patsy M

    2017-12-01

    Background: African Americans are at increased risk of iron deficiency (ID) but also have higher serum ferritin (SF) concentrations than those of the general population. The Hemochromatosis and Iron Overload Screening (HEIRS) Study was a multicenter study of ethnically diverse participants that tested for the hemochromatosis ( HFE ) C282Y genotype and iron status. Objective: We sought to determine the prevalence and predictors of ID (SF concentration ≤15 μg/L) and elevated iron stores (SF concentration >300 μg/L) in HEIRS women of reproductive age (25-44 y). Design: The HEIRS Study was a cross-sectional study of iron status and HFE mutations in primary care patients at 5 centers in the United States and Canada. We analyzed data for women of reproductive age according to whether or not they were pregnant or breastfeeding at the time of the study. Results: ID was present in 12.5% of 20,080 nonpregnant and nonbreastfeeding women compared with 19.2% of 1962 pregnant or breastfeeding women ( P iron stores were shown in 1.7% of nonpregnant and nonbreastfeeding women compared with 0.7% of pregnant or breastfeeding women ( P = 0.001). HFE C282Y homozygosity had the most marked independent association with elevated iron stores in nonpregnant and nonbreastfeeding women and in pregnant or breastfeeding women (OR >49.0; P iron stores in both groups of women (OR >2.0; P iron stores in nonpregnant and nonbreastfeeding women. Conclusions: Both ID and elevated iron stores are present in women of reproductive age and are influenced by ethnicity and HFE C282Y. Efforts to optimize iron status should keep these findings in view. This study was registered at clinicaltrials.gov as NCT03276247. © 2017 American Society for Nutrition.

  5. Molecular basis of HFE-hemochromatosis

    OpenAIRE

    Vujić, Maja

    2014-01-01

    Iron-overload disorders owing to genetic misregulation of iron acquisition are referred to as hereditary hemochromatosis (HH). The most prevalent genetic iron overload disorder in Caucasians is caused by mutations in the HFE gene, an atypical MHC class I molecule. Recent studies classified HFE/Hfe-hemochromatosis as a liver disease with the primarily failure in the production of the liver iron hormone hepcidin in hepatocytes. Inadequate hepcidin expression signals for excessive iron absorptio...

  6. Highly sensitivity adhesion molecules detection in hereditary haemochromatosis patients reveals altered expression.

    LENUS (Irish Health Repository)

    Norris, S

    2012-02-01

    Several abnormalities in the immune status of patients with hereditary haemochromatosis (HH) have been reported, suggesting an imbalance in their immune function. This may include persistent production of, or exposure to, altered immune signalling contributing to the pathogenesis of this disorder. Adhesion molecules L-, E- and P-Selectin, intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1) are some of the major regulators of the immune processes and altered levels of these proteins have been found in pathological states including cardiovascular diseases, arthritis and liver cancer. The aim of this study was to assess L-, E- and P-Selectin, ICAM-1 and VCAM-1 expression in patients with HH and correlate these results with HFE mutation status and iron indexes. A total of 139 subjects were diagnosed with HH (C282Y homozygotes = 87, C282Y\\/H63D = 26 heterozygotes, H63D homozygotes = 26), 27 healthy control subjects with no HFE mutation (N\\/N), 18 normal subjects heterozygous for the H63D mutation served as age-sex-matched controls. We observed a significant decrease in L-selectin (P = 0.0002) and increased E-selectin and ICAM-1 (P = 0.0006 and P = 0.0059) expression in HH patients compared with healthy controls. This study observes for the first time that an altered adhesion molecules profile occurs in patients with HH that is associated with specific HFE genetic component for iron overload, suggesting that differential expression of adhesion molecules may play a role in the pathogenesis of HH.

  7. HJV and HFE Play Distinct Roles in Regulating Hepcidin.

    Science.gov (United States)

    Wu, Qian; Wang, Hao; An, Peng; Tao, Yunlong; Deng, Jiali; Zhang, Zhuzhen; Shen, Yuanyuan; Chen, Caiyong; Min, Junxia; Wang, Fudi

    2015-05-20

    Hereditary hemochromatosis (HH) is an iron overload disease that is caused by mutations in HFE, HJV, and several other genes. However, whether HFE-HH and HJV-HH share a common pathway via hepcidin regulation is currently unclear. Recently, some HH patients have been reported to carry concurrent mutations in both the HFE and HJV genes. To dissect the roles and molecular mechanisms of HFE and/or HJV in the pathogenesis of HH, we studied Hfe(-/-), Hjv(-/-), and Hfe(-/-)Hjv(-/-) double-knockout mouse models. Hfe(-/-)Hjv(-/-) mice developed iron overload in multiple organs at levels comparable to Hjv(-/-) mice. After an acute delivery of iron, the expression of hepcidin (i.e., Hamp1 mRNA) was increased in the livers of wild-type and Hfe(-/-) mice, but not in either Hjv(-/-) or Hfe(-/-)Hjv(-/-) mice. Furthermore, iron-induced phosphorylation of Smad1/5/8 was not detected in the livers of Hjv(-/-) or Hfe(-/-)Hjv(-/-) mice. We generated and phenotypically characterized Hfe(-/-)Hjv(-/-) double-knockout mice. In addition, because they faithfully phenocopy clinical HH patients, these mouse models are an invaluable tool for mechanistically dissecting how HFE and HJV regulate hepcidin expression. Based on our results, we conclude that HFE may depend on HJV for transferrin-dependent hepcidin regulation. The presence of residual hepcidin in the absence of HFE suggests either the presence of an unknown regulator (e.g., TFR2) that is synergistic with HJV or that HJV is sufficient to maintain basal levels of hepcidin.

  8. HFE gene variants, iron, and lipids: a novel connection in Alzheimer's disease.

    Science.gov (United States)

    Ali-Rahmani, Fatima; Schengrund, Cara-Lynne; Connor, James R

    2014-01-01

    Iron accumulation and associated oxidative stress in the brain have been consistently found in several neurodegenerative diseases. Multiple genetic studies have been undertaken to try to identify a cause of neurodegenerative diseases but direct connections have been rare. In the iron field, variants in the HFE gene that give rise to a protein involved in cellular iron regulation, are associated with iron accumulation in multiple organs including the brain. There is also substantial epidemiological, genetic, and molecular evidence of disruption of cholesterol homeostasis in several neurodegenerative diseases, in particular Alzheimer's disease (AD). Despite the efforts that have been made to identify factors that can trigger the pathological events associated with neurodegenerative diseases they remain mostly unknown. Because molecular phenotypes such as oxidative stress, synaptic failure, neuronal loss, and cognitive decline, characteristics associated with AD, have been shown to result from disruption of a number of pathways, one can easily argue that the phenotype seen may not arise from a linear sequence of events. Therefore, a multi-targeted approach is needed to understand a complex disorder like AD. This can be achieved only when knowledge about interactions between the different pathways and the potential influence of environmental factors on them becomes available. Toward this end, this review discusses what is known about the roles and interactions of iron and cholesterol in neurodegenerative diseases. It highlights the effects of gene variants of HFE (H63D- and C282Y-HFE) on iron and cholesterol metabolism and how they may contribute to understanding the etiology of complex neurodegenerative diseases.

  9. EMQN best practice guidelines for the molecular genetic diagnosis of hereditary hemochromatosis (HH)

    Science.gov (United States)

    Porto, Graça; Brissot, Pierre; Swinkels, Dorine W; Zoller, Heinz; Kamarainen, Outi; Patton, Simon; Alonso, Isabel; Morris, Michael; Keeney, Steve

    2016-01-01

    Molecular genetic testing for hereditary hemochromatosis (HH) is recognized as a reference test to confirm the diagnosis of suspected HH or to predict its risk. The vast majority (typically >90%) of patients with clinically characterized HH are homozygous for the p.C282Y variant in the HFE gene, referred to as HFE-related HH. Since 1996, HFE genotyping was implemented in diagnostic algorithms for suspected HH, allowing its early diagnosis and prevention. However, the penetrance of disease in p.C282Y homozygotes is incomplete. Hence, homozygosity for p.C282Y is not sufficient to diagnose HH. Neither is p.C282Y homozygosity required for diagnosis as other rare forms of HH exist, generally referred to as non-HFE-related HH. These pose significant challenges when defining criteria for referral, testing protocols, interpretation of test results and reporting practices. We present best practice guidelines for the molecular genetic diagnosis of HH where recommendations are classified, as far as possible, according to the level and strength of evidence. For clarification, the guidelines' recommendations are preceded by a detailed description of the methodology and results obtained with a series of actions taken in order to achieve a wide expert consensus, namely: (i) a survey on the current practices followed by laboratories offering molecular diagnosis of HH; (ii) a systematic literature search focused on some identified controversial topics; (iii) an expert Best Practice Workshop convened to achieve consensus on the practical recommendations included in the guidelines. PMID:26153218

  10. Mutant HFE H63D Protein Is Associated with Prolonged Endoplasmic Reticulum Stress and Increased Neuronal Vulnerability*

    Science.gov (United States)

    Liu, Yiting; Lee, Sang Y.; Neely, Elizabeth; Nandar, Wint; Moyo, Mthabisi; Simmons, Zachary; Connor, James R.

    2011-01-01

    A specific polymorphism in the hemochromatosis (HFE) gene, H63D, is over-represented in neurodegenerative disorders such as amyotrophic lateral sclerosis and Alzheimer disease. Mutations of HFE are best known as being associated with cellular iron overload, but the mechanism by which HFE H63D might increase the risk of neuron degeneration is unclear. Here, using an inducible expression cell model developed from a human neuronal cell line SH-SY5Y, we reported that the presence of the HFE H63D protein activated the unfolded protein response (UPR). This response was followed by a persistent endoplasmic reticulum (ER) stress, as the signals of UPR sensors attenuated and followed by up-regulation of caspase-3 cleavage and activity. Our in vitro findings were recapitulated in a transgenic mouse model carrying Hfe H67D, the mouse equivalent of the human H63D mutation. In this model, UPR activation was detected in the lumbar spinal cord at 6 months then declined at 12 months in association with increased caspase-3 cleavage. Moreover, upon the prolonged ER stress, the number of cells expressing HFE H63D in early apoptosis was increased moderately. Cell proliferation was decreased without increased cell death. Additionally, despite increased iron level in cells carrying HFE H63D, it appeared that ER stress was not responsive to the change of cellular iron status. Overall, our studies indicate that the HFE H63D mutant protein is associated with prolonged ER stress and chronically increased neuronal vulnerability. PMID:21349849

  11. HFE gene variants, iron, and lipids: a novel connection in Alzheimer’s disease

    Science.gov (United States)

    Ali-Rahmani, Fatima; Schengrund, Cara-Lynne; Connor, James R.

    2014-01-01

    Iron accumulation and associated oxidative stress in the brain have been consistently found in several neurodegenerative diseases. Multiple genetic studies have been undertaken to try to identify a cause of neurodegenerative diseases but direct connections have been rare. In the iron field, variants in the HFE gene that give rise to a protein involved in cellular iron regulation, are associated with iron accumulation in multiple organs including the brain. There is also substantial epidemiological, genetic, and molecular evidence of disruption of cholesterol homeostasis in several neurodegenerative diseases, in particular Alzheimer’s disease (AD). Despite the efforts that have been made to identify factors that can trigger the pathological events associated with neurodegenerative diseases they remain mostly unknown. Because molecular phenotypes such as oxidative stress, synaptic failure, neuronal loss, and cognitive decline, characteristics associated with AD, have been shown to result from disruption of a number of pathways, one can easily argue that the phenotype seen may not arise from a linear sequence of events. Therefore, a multi-targeted approach is needed to understand a complex disorder like AD. This can be achieved only when knowledge about interactions between the different pathways and the potential influence of environmental factors on them becomes available. Toward this end, this review discusses what is known about the roles and interactions of iron and cholesterol in neurodegenerative diseases. It highlights the effects of gene variants of HFE (H63D- and C282Y-HFE) on iron and cholesterol metabolism and how they may contribute to understanding the etiology of complex neurodegenerative diseases. PMID:25071582

  12. Dietary Iron Intake and Serum Ferritin Concentration in 213 Patients Homozygous for the HFEC282Y Hemochromatosis Mutation

    Directory of Open Access Journals (Sweden)

    Victor R Gordeuk

    2012-01-01

    Full Text Available BACKGROUND: HFEC282Y homozygotes have an increased risk for developing increased iron stores and related disorders. It is controversial whether dietary iron restrictions should be recommended to such individuals.

  13. Homozygosity For The C282Y Substitution In The HFE Gene: The Incomplete Penetrance And Variable Expressivity

    Directory of Open Access Journals (Sweden)

    Dilum Ekanayake

    2015-01-01

    Full Text Available The syndrome of hepatic cirrhosis diabetes and skin pigmentation (‘Bronze diabetes’ has been well documented, including its propensity to lead to hepatocellular cancer. However, this picture of advanced disease is much less common nowadays with increased awareness and early diagnosis. However, in addition to this, it has been increasingly recognised that in contrast to other diseases inherited as autosomal recessive traits, subjects carrying the genetic predisposition infrequently develop overt disease. This is due only in part to physiological and pathological blood loss, and further relevant genetic mutations have been anticipated. Indeed, an international consortium has recently identified that the genetic variant ( GNPAT has been identified as predisposing to iron overload related disease. Further mutations can be anticipated and will assist in early diagnosis and treatment as well as identifying subjects predisposed to significant iron overload.

  14. Meta-analyses of HFE variants in coronary heart disease.

    Science.gov (United States)

    Lian, Jiangfang; Xu, Limin; Huang, Yi; Le, Yanping; Jiang, Danjie; Yang, Xi; Xu, Weifeng; Huang, Xiaoyan; Dong, Changzheng; Ye, Meng; Zhou, Jianqing; Duan, Shiwei

    2013-09-15

    HFE gene variants can cause hereditary hemochromatosis (HH) that often comes along with an increased risk of coronary heart disease (CHD). The goal of our study is to assess the contribution of four HFE gene variants to the risk of CHD. We conducted four meta-analyses of the studies examining the association between four HFE gene variants and the risk of CHD. A systematic search was conducted using MEDLINE, EMBASE, Web of Science and China National Knowledge Infrastructure (CNKI), Wanfang Chinese Periodical. Meta-analyses showed that HFE rs1799945-G allele was associated with a 6% increased risk of CHD (P=0.02, odds ratio (OR)=1.06, 95% confidence interval (CI)=1.01-1.11). However, no association between the other three HFE gene variants (rs1800562, rs1800730, and rs9366637) and CHD risk was observed by the meta-analyses (all P values>0.05). In addition, the results of our case-control study indicated that rs1800562 and rs1800730 were monomorphic, and that rs1799945 and rs9366637 were not associated with CHD in Han Chinese. Our meta-analysis suggested that a significant association existed between rs1799945 mutation and CHD, although this mutation was rare in Han Chinese. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Mutation Spectrum and Phenotypic Features in Noonan Syndrome with PTPN11 Mutations: Definition of Two Novel Mutations.

    Science.gov (United States)

    Atik, Tahir; Aykut, Ayca; Hazan, Filiz; Onay, Huseyin; Goksen, Damla; Darcan, Sukran; Tukun, Ajlan; Ozkinay, Ferda

    2016-06-01

    To evaluate the spectrum of PTPN11 gene mutations in Noonan syndrome patients and to study the genotype-phenotype associations. In this study, twenty Noonan syndrome patients with PTPN11 mutations were included. The patients underwent a detailed clinical and physical evaluation. To identify inherited cases, parents of all mutation positive patients were analyzed. Thirteen different PTPN11 mutations, two of them being novel, were detected in the study group. These mutations included eleven missense mutations: p.G60A, p.D61N, p.Y62D, p.Y63C, p.E69Q, p.Q79R, p.Y279C,p.N308D, p.N308S, p.M504V, p.Q510R and two novel missense mutations: p.I56V and p.I282M. The frequency of cardiac abnormalities and short stature were found to be 80 % and 80 %, respectively. Mental retardation was not observed in patients having exon 8 mutations. No significant correlations were detected between other phenotypic features and genotypes. By identifying genotype-phenotype correlations, this study provides information on phenotypes observed in NS patients with different PTPN11 mutations.

  16. Hemochromatosis

    Directory of Open Access Journals (Sweden)

    Onur Albayrak

    2009-08-01

    Full Text Available Hemochromatosis is the most common form of iron overload disease. Iron builds up in the body’s organs and damages them. Hemochromatosis is presented with arthropathy, cirrhosis of the liver, melanoderma, heart failure, diabetes mellitus and other endocrine deficiencies. There are two type of this disease. Primary hemochromatosis is known as an inherited disease. Herediter hemochromatosis is caused by the mutations of HFE gene. The most common mutations are H63D (Histidine- Aspartat and C282Y (Cysteine-Tyrosine on the gene. Secondary hemochromatosis is caused by anemia, alcoholism, and some of the other disorders. [Archives Medical Review Journal 2009; 18(4.000: 268-275

  17. Visão atual da hemocromatose hereditária Current approach to hereditary hemochromatosis

    Directory of Open Access Journals (Sweden)

    Rodolfo Delfini Cançado

    2010-01-01

    Full Text Available A hemocromatose hereditária (HH está relacionada a diversos distúrbios do metabolismo do ferro que ocasionam sua sobrecarga tecidual. A HH clássica está associada às mutações do gene HFE (homozigose para C282Y ou duplo heterozigose para C282Y/H63D, sendo encontrada quase exclusivamente em descendentes do norte Europeu. A hemocromatose hereditária, quando não relacionada ao gene HFE, é causada por mutações de outros genes, recentemente identificados, envolvidos no metabolismo do ferro. Hepcedina é o hormônio regulador do ferro que inibe a ferroportina, proteína exportadora de ferro dos enterócitos e dos macrófagos; um defeito na expressão do gene da hepcedina ou na sua função costuma ser a causa da maioria dos tipos de hemocromatose hereditária. Os alvos acometidos pela HH são órgãos e tecidos - fígado, coração, pâncreas, articulações e pele -, sendo a cirrose e o diabetes melito os sinais tardios da doença em pacientes com expressivo aumento da concentração hepática de ferro. Pacientes com diagnóstico estabelecido de hemocromatose hereditária e sobrecarga de ferro devem ser tratados com flebotomia para a obtenção de depleção do ferro do organismo; em seguida, com flebotomia de manutenção. As causas mais frequentes de morte por hemocromatose hereditária são câncer hepático, cirrose, miocardiopatia e diabete; entretanto, pacientes submetidos à depleção do ferro de maneira satisfatória e antes do desenvolvimento da cirrose ou da diabete podem ter sobrevida normal.Hereditary hemochromatosis refers to several inherited disorders of the iron metabolism that lead to tissue iron overload. Classical hereditary hemochromatosis is associated with mutations of the HFE gene (C282Y homozygotes or C282Y/H63D compound heterozygotes and is almost exclusively found in populations of northern European descent. Non-HFE-associated hereditary hemochromatosis is caused by mutations in other recently identified genes

  18. Dicty_cDB: SLH282 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLH282 (Link to dictyBase) - - - Contig-U10985-1 | Contig-U15908-1 SLH2...82P (Link to Original site) SLH282F 506 SLH282Z 455 SLH282P 961 - - Show SLH282 Library SL (Link to library) Clone ID SLH2...85-1 | Contig-U15908-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-D/SLH2...82Q.Seq.d/ Representative seq. ID SLH282P (Link to Original site) Representative DNA sequence >SLH282 (SLH2...82Q) /CSM/SL/SLH2-D/SLH282Q.Seq.d/ GGTTTTTAAAACTATTGATACTGAAGAGAATGGAATTATATCAATAACACAATTAAGACA

  19. Haplotype analysis of the HFE gene among populations of Northern Eurasia, in patients with metabolic disorders or stomach cancer, and in long-lived people.

    Science.gov (United States)

    Mikhailova, S V; Babenko, V N; Ivanoshchuk, D E; Gubina, M A; Maksimov, V N; Solovjova, I G; Voevoda, M I

    2016-06-17

    Previously, it was shown that the HFE gene (associated with human hereditary hemochromatosis) has several haplotypes of intronic polymorphisms. Some haplotype frequencies are race specific and hence can be used in phylogenetic analysis. We assumed that analysis of Caucasoid patients-living now in Western Siberia and having diseases associated with dietary habits and metabolic rate-will allow us to understand the processes of possible selection during settling of the northern part of Asia. Haplotype analysis of Northern Eurasian native and recently settled ethnic groups was performed on polymorphisms rs1799945, rs1800730, rs1800562, rs2071303, rs1800708, rs1572982, rs2794719, rs807209, and rs2032451 of this gene. The CCA haplotype of the rs2071303, rs1800708, and rs1572982 was found to be associated with HLA-A2 (39 %) in Asian populations. Haplotype analysis for the rs1799945, rs1800730, rs1800562, rs2071303, rs1800708, and rs1572982 was performed on Russian patients with some metabolic disorders or stomach cancer and among long-lived people. Decreased frequencies of the TTA haplotype (T in rs2071303, T in rs1800708, and A in rs1572982) were observed in the groups of patients with diseases associated with overweight (fatty liver disease, type 2 diabetes mellitus, or metabolic syndrome + arterial hypertension) as compared with the control sample. We detected significant differences in this haplotype's frequency between the patients with type 2 diabetes mellitus and Russian adolescents, elderly citizens, and long-lived people (χ(2) P value = 0.003, 0.010, and 0.015, respectively). No significant differences in frequencies of the alleles with mutations in coding regions of the HFE gene (C282Y, H63D, and S65C) were detected between the analyzed patients (with stomach cancer, metabolic syndrome, fatty liver disease, or type 2 diabetes mellitus) and the control Caucasoid sample. Monophyletic origin of H63D (rs1799945) was confirmed in Caucasoids and Northern

  20. A role for sex and a common HFE gene variant in brain iron uptake.

    Science.gov (United States)

    Duck, Kari A; Neely, Elizabeth B; Simpson, Ian A; Connor, James R

    2018-03-01

    HFE (high iron) is an essential protein for regulating iron transport into cells. Mutations of the HFE gene result in loss of this regulation causing accumulation of iron within the cell. The mutated protein has been found increasingly in numerous neurodegenerative disorders in which increased levels of iron in the brain are reported. Additionally, evidence that these mutations are associated with elevated brain iron challenges the paradigm that the brain is protected by the blood-brain barrier. While much has been studied regarding the role of HFE in cellular iron uptake, it has remained unclear what role the protein plays in the transport of iron into the brain. We investigated regulation of iron transport into the brain using a mouse model with a mutation in the HFE gene. We demonstrated that the rate of radiolabeled iron ( 59 Fe) uptake was similar between the two genotypes despite higher brain iron concentrations in the mutant. However, there were significant differences in iron uptake between males and females regardless of genotype. These data indicate that brain iron status is consistently maintained and tightly regulated at the level of the blood-brain barrier.

  1. A molecular dynamics investigation on the crizotinib resistance mechanism of C1156Y mutation in ALK

    International Nuclear Information System (INIS)

    Sun, Hui-Yong; Ji, Feng-Qin

    2012-01-01

    Highlights: ► The study revealed the detailed resistance mechanism of the non-active mutation C1156Y in ALK. ► C1156Y leads to crizotinib displacement and conformational changes in the binding cavity. ► The conformations cause a decline in the vdW and electrostatic energy between crizotinib and ALK. -- Abstract: Crizotinib is an anaplastic lymphoma kinase (ALK) inhibitor that has recently been approved in the US for the treatment of non-small cell lung carcinoma (NSCLC). Despite its outstanding safety and efficacy, several resistant mutations against crizotinib have been detected in the treatment of NSCLC. However, in contrast to the widely accepted mechanism of steric hindrance by mutations at the active site, the mechanism by which the C1156Y non-active site mutation confers resistance against crizotinib remains unclear. In the present study, the resistance mechanism of C1156Y in ALK was investigated using molecular dynamics simulations. The results suggest that despite the non-active site mutation, C1156Y causes the dislocation of crizotinib as well as the indirect conformational changes in the binding cavity, which results in a marked decrease in the van der Waals and electrostatic interactions between crizotinib and ALK. The obtained results provide a detailed explanation of the resistance caused by C1156Y and may give a vital clue for the design of drugs to combat crizotinib resistance.

  2. Tmprss6 is a genetic modifier of the Hfe-hemochromatosis phenotype in mice

    Science.gov (United States)

    Whittlesey, Rebecca L.; Andrews, Nancy C.

    2011-01-01

    The hereditary hemochromatosis protein HFE promotes the expression of hepcidin, a circulating hormone produced by the liver that inhibits dietary iron absorption and macrophage iron release. HFE mutations are associated with impaired hepatic bone morphogenetic protein (BMP)/SMAD signaling for hepcidin production. TMPRSS6, a transmembrane serine protease mutated in iron-refractory iron deficiency anemia, inhibits hepcidin expression by dampening BMP/SMAD signaling. In the present study, we used genetic approaches in mice to examine the relationship between Hfe and Tmprss6 in the regulation of systemic iron homeostasis. Heterozygous loss of Tmprss6 in Hfe−/− mice reduced systemic iron overload, whereas homozygous loss caused systemic iron deficiency and elevated hepatic expression of hepcidin and other Bmp/Smad target genes. In contrast, neither genetic loss of Hfe nor hepatic Hfe overexpression modulated the hepcidin elevation and systemic iron deficiency of Tmprss6−/− mice. These results indicate that genetic loss of Tmprss6 increases Bmp/Smad signaling in an Hfe-independent manner that can restore Bmp/Smad signaling in Hfe−/− mice. Furthermore, these results suggest that natural genetic variation in the human ortholog TMPRSS6 might modify the clinical penetrance of HFE-associated hereditary hemochromatosis, raising the possibility that pharmacologic inhibition of TMPRSS6 could attenuate iron loading in this disorder. PMID:21355094

  3. Reduced white matter MRI transverse relaxation rate in cognitively normal H63D-HFE human carriers and H67D-HFE mice.

    Science.gov (United States)

    Meadowcroft, Mark D; Wang, Jianli; Purnell, Carson J; Peters, Douglas G; Eslinger, Paul J; Neely, Elizabeth B; Gill, David J; Vasavada, Megha; Ali-Rahmani, Fatima; Yang, Qing X; Connor, James R

    2016-12-01

    Mutations within the HFE protein gene sequence have been associated with increased risk of developing a number of neurodegenerative disorders. To this effect, an animal model has been created which incorporates the mouse homologue to the human H63D-HFE mutation: the H67D-HFE knock-in mouse. These mice exhibit alterations in iron management proteins, have increased neuronal oxidative stress, and a disruption in cholesterol regulation. However, it remains undetermined how these differences translate to human H63D carriers in regards to white matter (WM) integrity. To this endeavor, MRI transverse relaxation rate (R 2 ) parametrics were employed to test the hypothesis that WM alterations are present in H63D human carriers and are recapitulated in the H67D mice. H63D carriers exhibit widespread reductions in brain R 2 compared to non-carriers within white matter association fibers in the brain. Similar R 2 decreases within white matter tracts were observed in the H67D mouse brain. Additionally, an exacerbation of age-related R 2 decrease is found in the H67D animal model in white matter regions of interest. The decrease in R 2 within white matter tracts of both species is speculated to be multifaceted. The R 2 changes are hypothesized to be due to alterations in axonal biochemical tissue composition. The R 2 changes observed in both the human-H63D and mouse-H67D data suggest that modified white matter myelination is occurring in subjects with HFE mutations, potentially increasing vulnerability to neurodegenerative disorders.

  4. Founder effect of the RET C611Y mutation in multiple endocrine neoplasia 2A in Denmark

    DEFF Research Database (Denmark)

    Mathiesen, Jes Sloth; Kroustrup, Jens Peter; Vestergaard, Peter

    2017-01-01

    BACKGROUND: Multiple endocrine neoplasia (MEN) 2A and 2B are caused by REarranged during Transfection (RET) germline mutations. In a recent nationwide study we reported of an unusually high prevalence (33%) of families with the C611Y mutation and hypothesized that this might be due to a founder...... effect. We conducted the first nationwide study of haplotypes in MEN2A families aiming to investigate the relatedness and occurrence of de novo mutations among Danish families carrying similar mutations. METHODS: The study included 21 apparently unrelated MEN2A families identified from a nationwide...... Danish RET cohort from 1994 to 2014. Twelve, two, two, three and two families carried the C611Y, C618F, C618Y, C620R and C634R mutation, respectively. Single nucleotide polymorphism chip data and identity by descent analysis were used to assess relatedness. RESULTS: A common founder mutation was found...

  5. A molecular dynamics investigation on the crizotinib resistance mechanism of C1156Y mutation in ALK

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Hui-Yong [Shandong University of Technology, Zibo 255049 (China); Ji, Feng-Qin, E-mail: fengqinji@mail.hzau.edu.cn [National Key Laboratory of Crop Genetic Improvement, College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); Center for Bioinformatics, Huazhong Agricultural University, Wuhan 430070 (China)

    2012-06-29

    Highlights: Black-Right-Pointing-Pointer The study revealed the detailed resistance mechanism of the non-active mutation C1156Y in ALK. Black-Right-Pointing-Pointer C1156Y leads to crizotinib displacement and conformational changes in the binding cavity. Black-Right-Pointing-Pointer The conformations cause a decline in the vdW and electrostatic energy between crizotinib and ALK. -- Abstract: Crizotinib is an anaplastic lymphoma kinase (ALK) inhibitor that has recently been approved in the US for the treatment of non-small cell lung carcinoma (NSCLC). Despite its outstanding safety and efficacy, several resistant mutations against crizotinib have been detected in the treatment of NSCLC. However, in contrast to the widely accepted mechanism of steric hindrance by mutations at the active site, the mechanism by which the C1156Y non-active site mutation confers resistance against crizotinib remains unclear. In the present study, the resistance mechanism of C1156Y in ALK was investigated using molecular dynamics simulations. The results suggest that despite the non-active site mutation, C1156Y causes the dislocation of crizotinib as well as the indirect conformational changes in the binding cavity, which results in a marked decrease in the van der Waals and electrostatic interactions between crizotinib and ALK. The obtained results provide a detailed explanation of the resistance caused by C1156Y and may give a vital clue for the design of drugs to combat crizotinib resistance.

  6. Alterações moleculares associadas à hemocromatose hereditária Molecular changes associated with hereditary hemochromatosis

    Directory of Open Access Journals (Sweden)

    Paulo C. J. L. Santos

    2009-01-01

    Full Text Available A hemocromatose hereditária (HH é a mais comum doença autossômica em caucasianos e caracteriza-se pelo aumento da absorção intestinal de ferro, o qual resulta em acúmulo progressivo de ferro no organismo. A classificação da HH é realizada de acordo com a alteração genética encontrada, sendo os casos divididos em tipos 1, 2A, 2B, 3 e 4, quando a sobrecarga de ferro for associada aos genes HFE, HJV, HAMP, TFR2 e SLC40A1, respectivamente. Não existem estudos brasileiros que avaliaram a presença de mutações em genes relacionados à fisiopatologia da HH (genes HJV, HAMP, TFR2 e SLC40A1, além da pesquisa das três mutações no gene HFE (C282Y, H63D e S65C. Porém, está descrito, nos estudos realizados no Brasil, que alguns pacientes com sobrecarga de ferro primária não são portadores da HH tipo 1 (associada ao gene HFE. Portanto, é de suma importância a identificação das características genéticas dessa população, uma vez que outras mutações nos genes HJV, HAMP, TFR2 e SLC40A1 podem estar associadas à fisiopatologia da doença, podendo haver interações entre os genes alterados, de forma que possa auxiliar no entendimento da fisiopatologia da HH em pacientes brasileiros.Hereditary Hemochromatosis (HH is the most common autosomal disease in Caucasians. It is characterized by an increase in intestinal absorption of iron, which results in a progressive accumulation of iron in the body. The classification of HH is carried out according to the genetic alteration found; thus cases of HH are divided into Types 1, 2A, 2B, 3 and 4, when the iron overload is associated to the HFE, HJV, HAMP, TFR2 and SLC40A1 genes, respectively. There is research on the three HFE gene mutations (C282Y, H63D and S65C in the Brazilian population however there are no Brazilian studies that evaluate the presence of mutations in other genes related to the pathophysiology of HH (HJV, HAMP, TFR2 and SLC40A1 genes. Nevertheless, studies conducted in

  7. Total and cause-specific mortality by elevated transferrin saturation and hemochromatosis genotype in individuals with diabetes - two general population studies

    DEFF Research Database (Denmark)

    Ellervik, Christina; Mandrup-Poulsen, Thomas; Tybjærg-Hansen, Anne

    2013-01-01

    ObjectiveMortality is increased in patients with hereditary hemochromatosis, in individuals from the general population with increased transferrin saturation(TS), and also in patients with diabetes type 1 and increased TS from a highly specialised diabetes clinic. Thus, we have recommended targeted...... and hemochromatosis genotype(HFE) C282Y/C282Y in individuals with diabetes(type 1,N=118;type 2,N=3228;total,N=3346).ResultsThe cumulative survival was reduced in individuals with diabetes with TS≥50% vs....

  8. Hereditary hemochromatosis (HFE) genotypes in heart failure: relation to etiology and prognosis

    DEFF Research Database (Denmark)

    Møller, Daniel Vega; Pecini, Redi; Gustafsson, Finn

    2010-01-01

    It is believed that hereditary hemochromatosis (HH) might play a role in cardiac disease (heart failure (HF) and ischemia). Mutations within several genes are HH-associated, the most common being the HFE gene. In a large cohort of HF patients, we sought to determine the etiological role...... and the prognostic significance of HFE genotypes....

  9. HFE p.H63D polymorphism does not influence ALS phenotype and survival.

    Science.gov (United States)

    Chiò, Adriano; Mora, Gabriele; Sabatelli, Mario; Caponnetto, Claudia; Lunetta, Christian; Traynor, Bryan J; Johnson, Janel O; Nalls, Mike A; Calvo, Andrea; Moglia, Cristina; Borghero, Giuseppe; Monsurrò, Maria Rosaria; La Bella, Vincenzo; Volanti, Paolo; Simone, Isabella; Salvi, Fabrizio; Logullo, Francesco O; Nilo, Riva; Giannini, Fabio; Mandrioli, Jessica; Tanel, Raffaella; Murru, Maria Rita; Mandich, Paola; Zollino, Marcella; Conforti, Francesca L; Penco, Silvana; Brunetti, Maura; Barberis, Marco; Restagno, Gabriella

    2015-10-01

    It has been recently reported that the p.His63Asp polymorphism of the HFE gene accelerates disease progression both in the SOD1 transgenic mouse and in amyotrophic lateral sclerosis (ALS) patients. We have evaluated the effect of HFE p.His63Asp polymorphism on the phenotype in 1351 Italian ALS patients (232 of Sardinian ancestry). Patients were genotyped for the HFE p.His63Asp polymorphism (CC, GC, and GG). All patients were also assessed for C9ORF72, TARDBP, SOD1, and FUS mutations. Of the 1351 ALS patients, 363 (29.2%) were heterozygous (GC) for the p.His63Asp polymorphism and 30 (2.2%) were homozygous for the minor allele (GG). Patients with CC, GC, and GG polymorphisms did not significantly differ by age at onset, site of onset of symptoms, and survival; however, in SOD1 patients with CG or GG polymorphism had a significantly longer survival than those with a CC polymorphism. Differently from what observed in the mouse model of ALS, the HFE p.His63Asp polymorphism has no effect on ALS phenotype in this large series of Italian ALS patients. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. The impact of H63D HFE gene carriage on hemoglobin and iron status in children.

    Science.gov (United States)

    Barbara, Kaczorowska-Hac; Marcin, Luszczyk; Jedrzej, Antosiewicz; Wieslaw, Ziolkowski; Elzbieta, Adamkiewicz-Drozynska; Malgorzata, Mysliwiec; Ewa, Milosz; Jacek, Kaczor Jan

    2016-12-01

    The molecular mechanism that regulates iron homeostasis is based on a network of signals, which reflect on the iron requirements of the body. Hereditary hemochromatosis is a heterogenic metabolic syndrome which is due to unchecked transfer of iron into the bloodstream and its toxic effects on parenchymatous organs. It is caused by the mutation of genes that encode proteins that help hepcidin to monitor serum iron. These proteins include the human hemochromatosis protein -HFE, transferrin-receptor 2, hemojuvelin in rare instances, and ferroportin. HFE-related hemochromatosis is the most frequent form of the disease. Interestingly, the low penetrance of polymorphic HFE genes results in rare clinical presentation of the disease, predominantly in middle-aged males. Taking into account the wide dispersion of HFE mutation in our population and also its unknown role in heterozygotes, we analyzed the impact of H63D HFE carriage in the developmental age, with respect to gender, on the iron status and hemoglobin concentration of carriers in comparison to those of wild-type HFE gene (12.7 ± 3.07 years, 42 boys and 41 girls). H63D carriers presented higher blood iron, transferrin saturation, and ferritin concentration than wild-type probands (p HFE heterozygotes.

  11. Serum ferritin concentrations and body iron stores in a multicenter, multiethnic primary-care population.

    Science.gov (United States)

    Gordeuk, Victor R; Reboussin, David M; McLaren, Christine E; Barton, James C; Acton, Ronald T; McLaren, Gordon D; Harris, Emily L; Reiss, Jacob A; Adams, Paul C; Speechley, Mark; Phatak, Pradyumna D; Sholinsky, Phyliss; Eckfeldt, John H; Chen, Wen-Pin; Passmore, Leah; Dawkins, Fitzroy W

    2008-08-01

    How often elevated serum ferritin in primary-care patients reflects increased iron stores (normally 0.8 g in men, 0.4 g in women) is not known. The Hereditary Hemochromatosis and Iron Overload Screening (HEIRS) study screened 101,168 primary-care participants (44% Caucasians, 27% African-Americans, 14% Asians/Pacific Islanders, 13% Hispanics, 2% others). Follow-up clinical evaluation was performed in 302 of 333 HFE C282Y homozygotes regardless of iron measures and 1,375 of 1,920 nonhomozygotes with serum ferritin >300 microg/L (men), >200 microg/L (women) and transferrin saturation >50% (men), >45% (women). Quantitative phlebotomy was conducted in 122 of 175 C282Y homozygotes and 122 of 1,102 nonhomozygotes with non-transfusional serum ferritin elevation at evaluation. The estimated prevalence in the Caucasian population of C282Y homozygotes with serum ferritin >900 microg/L at evaluation was 20 per 10,000 men and 4 per 10,000 women; this constellation was predictive of iron stores >4 g in men and >2 g in women. The estimated prevalence per 10,000 of non-C282Y homozygotes with serum ferritin >900 microg/L at evaluation was 7 among Caucasians, 13 among Hispanics, 20 among African Americans, and 38 among Asians and Pacific Islanders, and this constellation was predictive of iron stores >2 g but 900 microg/L after initial elevations of both serum ferritin and transferrin saturation is predictive of mildly increased iron stores in multiple ethnic populations regardless of HFE genotype. Serum ferritin >900 microg/L in male C282Y homozygotes is predictive of moderately increased iron stores. Copyright 2008 Wiley-Liss, Inc.

  12. Contribution of Hfe expression in macrophages to the regulation of hepatic hepcidin levels and iron loading

    OpenAIRE

    Makui, Hortence; Soares, Ricardo J.; Jiang, Wenlei; Constante, Marco; Santos, Manuela M.

    2005-01-01

    Hereditary hemochromatosis (HH), an iron overload disease associated with mutations in the HFE gene, is characterized by increased intestinal iron absorption and consequent deposition of excess iron, primarily in the liver. Patients with HH and Hfe-deficient (Hfe−/−) mice manifest inappropriate expression of the iron absorption regulator hepcidin, a peptide hormone produced by the liver in response to iron loading. In this study, we investigated the contribution of Hfe expression in macrophag...

  13. Hemochromatosis mutations in the general population

    DEFF Research Database (Denmark)

    Andersen, Rolf Vaern; Tybjaerg-Hansen, Anne; Appleyard, Merete

    2004-01-01

    The progression rate of iron overload in hereditary hemochromatosis in individuals in the general population is unknown. We therefore examined in the general population iron overload progression rate in C282Y homozygotes. Using a cohort study of the Danish general population, The Copenhagen City...... saturation and ferritin levels increased slightly in male and female C282Y homozygotes. None of the C282Y homozygotes developed clinically overt hemochromatosis. In conclusion, individuals in the general population with C282Y homozygosity at most demonstrate modest increases in transferrin saturation...

  14. Associations of iron metabolism genes with blood manganese levels: a population-based study with validation data from animal models

    Directory of Open Access Journals (Sweden)

    Claus Henn Birgit

    2011-11-01

    Full Text Available Abstract Background Given mounting evidence for adverse effects from excess manganese exposure, it is critical to understand host factors, such as genetics, that affect manganese metabolism. Methods Archived blood samples, collected from 332 Mexican women at delivery, were analyzed for manganese. We evaluated associations of manganese with functional variants in three candidate iron metabolism genes: HFE [hemochromatosis], TF [transferrin], and ALAD [δ-aminolevulinic acid dehydratase]. We used a knockout mouse model to parallel our significant results as a novel method of validating the observed associations between genotype and blood manganese in our epidemiologic data. Results Percentage of participants carrying at least one copy of HFE C282Y, HFE H63D, TF P570S, and ALAD K59N variant alleles was 2.4%, 17.7%, 20.1%, and 6.4%, respectively. Percentage carrying at least one copy of either C282Y or H63D allele in HFE gene was 19.6%. Geometric mean (geometric standard deviation manganese concentrations were 17.0 (1.5 μg/l. Women with any HFE variant allele had 12% lower blood manganese concentrations than women with no variant alleles (β = -0.12 [95% CI = -0.23 to -0.01]. TF and ALAD variants were not significant predictors of blood manganese. In animal models, Hfe-/- mice displayed a significant reduction in blood manganese compared with Hfe+/+ mice, replicating the altered manganese metabolism found in our human research. Conclusions Our study suggests that genetic variants in iron metabolism genes may contribute to variability in manganese exposure by affecting manganese absorption, distribution, or excretion. Genetic background may be critical to consider in studies that rely on environmental manganese measurements.

  15. Iron-related gene variants and brain iron in multiple sclerosis and healthy individuals

    Directory of Open Access Journals (Sweden)

    Jesper Hagemeier

    2018-01-01

    Full Text Available Brain iron homeostasis is known to be disturbed in multiple sclerosis (MS, yet little is known about the association of common gene variants linked to iron regulation and pathological tissue changes in the brain. In this study, we investigated the association of genetic determinants linked to iron regulation with deep gray matter (GM magnetic susceptibility in both healthy controls (HC and MS patients. Four hundred (400 patients with MS and 150 age- and sex-matched HCs were enrolled and obtained 3 T MRI examination. Three (3 single nucleotide polymorphisms (SNPs associated with iron regulation were genotyped: two SNPs in the human hereditary hemochromatosis protein gene HFE: rs1800562 (C282Y mutation and rs1799945 (H63D mutation, as well as the rs1049296 SNP in the transferrin gene (C2 mutation. The effects of disease and genetic status were studied using quantitative susceptibility mapping (QSM voxel-based analysis (VBA and region-of-interest (ROI analysis of the deep GM. The general linear model framework was used to compare groups. Analyses were corrected for age and sex, and adjusted for false discovery rate. We found moderate increases in susceptibility in the right putamen of participants with the C282Y (+6.1 ppb and H63D (+6.9 ppb gene variants vs. non-carriers, as well as a decrease in thalamic susceptibility of progressive MS patients with the C282Y mutation (left: −5.3 ppb, right: −6.7 ppb, p < 0.05. Female MS patients had lower susceptibility in the caudate (−6.0 ppb and putamen (left: −3.9 ppb, right: −4.6 ppb than men, but only when they had a wild-type allele (p < 0.05. Iron-gene linked increases in putamen susceptibility (in HC and relapsing remitting MS and decreases in thalamus susceptibility (in progressive MS, coupled with apparent sex interactions, indicate that brain iron in healthy and disease states may be influenced by genetic factors.

  16. Molecular Diagnostic and Pathogenesis of Hereditary Hemochromatosis

    Directory of Open Access Journals (Sweden)

    Paulo C. J. L. Santos

    2012-02-01

    Full Text Available Hereditary hemochromatosis (HH is an autosomal recessive disorder characterized by enhanced intestinal absorption of dietary iron. Without therapeutic intervention, iron overload leads to multiple organ damage such as liver cirrhosis, cardiomyopathy, diabetes, arthritis, hypogonadism and skin pigmentation. Most HH patients carry HFE mutant genotypes: homozygosity for p.Cys282Tyr or p.Cys282Tyr/p.His63Asp compound heterozygosity. In addition to HFE gene, mutations in the genes that encode hemojuvelin (HJV, hepcidin (HAMP, transferrin receptor 2 (TFR2 and ferroportin (SLC40A1 have been associated with regulation of iron homeostasis and development of HH. The aim of this review was to identify the main gene mutations involved in the pathogenesis of type 1, 2, 3 and 4 HH and their genetic testing indication. HFE testing for the two main mutations (p.Cys282Tyr and p.His63Asp should be performed in all patients with primary iron overload and unexplained increased transferrin saturation and/or serum ferritin values. The evaluation of the HJV p.Gly320Val mutation must be the molecular test of choice in suspected patients with juvenile hemochromatosis with less than 30 years and cardiac or endocrine manifestations. In conclusion, HH is an example that genetic testing can, in addition to performing the differential diagnostic with secondary iron overload, lead to more adequate and faster treatment.

  17. PREDICTION OF THE SPECTROSCOPIC PARAMETERS OF NEW IRON COMPOUNDS: HYDRIDE OF IRON CYANIDE/ISOCYANIDE, HFeCN/HFeNC

    Energy Technology Data Exchange (ETDEWEB)

    Redondo, Pilar; Barrientos, Carmen; Largo, Antonio, E-mail: predondo@qf.uva.es [Departamento de Química Física y Química Inorgánica Facultad de Ciencias, Universidad de Valladolid Campus Miguel Delibes Paseo de Belén 7, E-47011, Valladolid (Spain)

    2016-09-01

    Iron is the most abundant transition metal in space. Its abundance is similar to that of magnesium, and until today only, FeO and FeCN have been detected. However, magnesium-bearing compounds such as MgCN, MgNC, and HMgNC are found in IRC+10216. It seems that the hydrides of iron cyanide/isocyanide could be good candidates to be present in space. In the present work we carried out a characterization of the different minima on the quintet and triplet [C, Fe, H, N] potential energy surfaces, employing several theoretical approaches. The most stable isomers are predicted to be hydride of iron cyanide HFeCN, and isocyanide HFeNC, in their {sup 5}Δ states. Both isomers are found to be quasi-isoenergetics. The HFeNC isomer is predicted to lie about 0.5 kcal/mol below HFeCN. The barrier for the interconversion process is estimated to be around 6.0 kcal/mol, making this process unfeasible under low temperature conditions, such as those in the interstellar medium. Therefore, both HFeCN and HFeNC could be candidates for their detection. We report geometrical parameters, vibrational frequencies, and rotational constants that could help with their experimental characterization.

  18. PREDICTION OF THE SPECTROSCOPIC PARAMETERS OF NEW IRON COMPOUNDS: HYDRIDE OF IRON CYANIDE/ISOCYANIDE, HFeCN/HFeNC

    International Nuclear Information System (INIS)

    Redondo, Pilar; Barrientos, Carmen; Largo, Antonio

    2016-01-01

    Iron is the most abundant transition metal in space. Its abundance is similar to that of magnesium, and until today only, FeO and FeCN have been detected. However, magnesium-bearing compounds such as MgCN, MgNC, and HMgNC are found in IRC+10216. It seems that the hydrides of iron cyanide/isocyanide could be good candidates to be present in space. In the present work we carried out a characterization of the different minima on the quintet and triplet [C, Fe, H, N] potential energy surfaces, employing several theoretical approaches. The most stable isomers are predicted to be hydride of iron cyanide HFeCN, and isocyanide HFeNC, in their 5 Δ states. Both isomers are found to be quasi-isoenergetics. The HFeNC isomer is predicted to lie about 0.5 kcal/mol below HFeCN. The barrier for the interconversion process is estimated to be around 6.0 kcal/mol, making this process unfeasible under low temperature conditions, such as those in the interstellar medium. Therefore, both HFeCN and HFeNC could be candidates for their detection. We report geometrical parameters, vibrational frequencies, and rotational constants that could help with their experimental characterization.

  19. Genome-wide association study identifies genetic loci associated with iron deficiency.

    Directory of Open Access Journals (Sweden)

    Christine E McLaren

    2011-03-01

    Full Text Available The existence of multiple inherited disorders of iron metabolism in man, rodents and other vertebrates suggests genetic contributions to iron deficiency. To identify new genomic locations associated with iron deficiency, a genome-wide association study (GWAS was performed using DNA collected from white men aged≥25 y and women≥50 y in the Hemochromatosis and Iron Overload Screening (HEIRS Study with serum ferritin (SF≤12 µg/L (cases and iron replete controls (SF>100 µg/L in men, SF>50 µg/L in women. Regression analysis was used to examine the association between case-control status (336 cases, 343 controls and quantitative serum iron measures and 331,060 single nucleotide polymorphism (SNP genotypes, with replication analyses performed in a sample of 71 cases and 161 controls from a population of white male and female veterans screened at a US Veterans Affairs (VA medical center. Five SNPs identified in the GWAS met genome-wide statistical significance for association with at least one iron measure, rs2698530 on chr. 2p14; rs3811647 on chr. 3q22, a known SNP in the transferrin (TF gene region; rs1800562 on chr. 6p22, the C282Y mutation in the HFE gene; rs7787204 on chr. 7p21; and rs987710 on chr. 22q11 (GWAS observed P<1.51×10(-7 for all. An association between total iron binding capacity and SNP rs3811647 in the TF gene (GWAS observed P=7.0×10(-9, corrected P=0.012 was replicated within the VA samples (observed P=0.012. Associations with the C282Y mutation in the HFE gene also were replicated. The joint analysis of the HEIRS and VA samples revealed strong associations between rs2698530 on chr. 2p14 and iron status outcomes. These results confirm a previously-described TF polymorphism and implicate one potential new locus as a target for gene identification.

  20. A Mouse Model of Cardiomyopathy Induced by Mutations in the Hemochromatosis HFE Gene.

    Science.gov (United States)

    Djemai, Haidar; Thomasson, Rémi; Trzaskus, Yvan; Mougenot, Nathalie; Meziani, Amira; Toussaint, Jean-François; Noirez, Philippe; Vitiello, Damien

    2017-07-01

    The heart is 1 of the organs most affected by hereditary hemochromatosis (HH). The clinical impact of cardiomyopathy in patients with HH requires a particular diagnosis and less invasive treatments. We developed a model of cardiomyopathy in knockout (KO) mice for the high-Fe (HFE) gene and assessed left ventricular (LV) function and structure from 7-20 months. Male wild-type (WT) heterozygous and KO SV129 mice for the HFE gene were used in this study. Twenty-four mice were used to assess LV function and structure by echocardiography at 7, 14, 18, and 20 months. Evaluations of LV function and structure and myocardial fibrosis were performed at 7 and 20 months. The percent decrease of LV thickness-to-radius ratio between 7 and 20 months was higher in KO mice compared with WT mice (-30.2% ± 5.3% vs -10.5% ± 4.9%; P HFE-related hemochromatosis. Copyright © 2017 Canadian Cardiovascular Society. Published by Elsevier Inc. All rights reserved.

  1. [Molecular genetic analysis and clinical aspects of patients with hereditary hemochromatosis].

    Science.gov (United States)

    Lange, U; Teichmann, J; Dischereit, G

    2014-08-01

    The purpose of the study was to perform a molecular genetic analysis and to document clinical aspects in patients with hereditary hemochromatosis. The study included 33 outpatients (23 males average age 50.6 years and 10 females average age 60.6 years) with a disorder of iron metabolism (transferrin saturation > 75 %) as confirmation of hemochromatosis who were subjected to molecular genetic and clinical analyses. A homozygous mutation of the hemochromatosis (HFE) gene (C282YY) was detected in 63.6 %, a compound heterozygous mutation (C282Y/H63D) in 30.3% and no mutation of the HFE gene was detected in 6.1 %. The following organ manifestations could be objectified: arthralgia (78.8 %), liver disease (39.9 %), skin hyperpigmentation (30.3 %), osteoporosis (24.2 %), diabetes mellitus (24.2 %) and cardiomyopathy (12.1 %). Comparison between patients with heterozygous and homozygous hemochromatosis revealed the following differences: compound heterozygote patients presented less frequently with osteoarthritis of the metacarpophalangeal (MCP) joints and hands (85.7 %/71.4 % homozygotes vs. 60 %/60 % heterozygotes). Osteoarthritis of the shoulder joints and osteoporosis as well as hypothyroidism were more frequent in compound heterozygote patients, whereas osteoarthritis of the knee and hip joints as well as liver disease were more common in homozygote patients. No differences between both groups were seen with respect to the clinical manifestations of cardiomyopathy and diabetes mellitus. Prevalent causes of death in hereditary hemochromatosis are heart failure, liver disease (cirrhosis and hepatocellular carcinoma) and portal hypertension. Therefore, an early diagnosis, adequate therapy and genetic screening of family members are of great importance. Medicinal treatment will only effectively prevent deleterious organ involvement and subsequent complications if initiated at an early stage. Furthermore, an overview of the current data is given.

  2. Derivation of induced pluripotent stem cells from a familial Alzheimer's disease patient carrying the L282F mutation in presenilin 1

    DEFF Research Database (Denmark)

    Poon, Anna Fong-Yee; Li, Tong; Pires, Carlota

    2016-01-01

    Mutations in presenilin 1 (PSEN1) lead to the most aggressive form of familial Alzheimer's disease (AD). Human induced pluripotent stem cells (hiPSCs) derived from AD patients can be differentiated and used for disease modeling. Here, we derived hiPSC from skin fibroblasts obtained from an AD...... patient carrying a L282F mutation in PSEN1. We transfected skin fibroblasts with episomal iPSC reprogramming vectors targeting human OCT4, SOX2, L-MYC, KLF4, NANOG, LIN28, and short hairpin RNA against TP53. Our hiPSC line, L282F-hiPSC, displayed typical stem cell characteristics with consistent...... expression of pluripotency genes and the ability to differentiation into the three germ layers....

  3. A novel mutation (C1425Y) in the FBN2 gene in a father and son with congenital contractural arachnodactyly.

    Science.gov (United States)

    Chen, Ying; Lei, Yun-Ping; Zheng, Hong-Xiang; Wang, Wei; Cheng, Hong-Bo; Zhang, Jing; Wang, Hong-Yan; Jin, Li; Li, Hong

    2009-06-01

    Congenital contractural arachnodactyly (Beals syndrome) is a rare autosomal dominantly inherited connective tissue disorder characterized by flexion contractures, arachnodactyly, crumpled ears, and mild muscular hypoplasia. Here, a father and son with congenital contractural arachnodactyly features were identified. After sequencing 15 exons (22 to 36) of the FBN2 gene, a novel mutation (C1425Y) was found in exon 33. This de novo mutation presented first in the father and was transmitted to his son, but not in the other 14 unaffected family members and 365 normal people. The C1425Y mutation occurs at the 19th cbEGF domain. Cysteines in this cbEGF domain are rather conserved in species, from human down to ascidian. The cbEGF12-13 in human FBN1 was employed as the template to perform homology modeling of cbEGF18-19 of human FBN2 protein. The mutation has also been evaluated by further prediction tools, for example, SIFT, Blosum62, biochemical Yu's matrice, and UMD-Predictor tool. In all analysis, the mutation is predicted to be pathogenic. Thus, the structure destabilization by C1425Y might be the cause of the disorder.

  4. Prevalence of the N-Acetyltransferase (NAT2 gene polymorphism 282C>T in Peruvian population and health implications

    Directory of Open Access Journals (Sweden)

    Salazar-Granara Alberto

    2016-03-01

    Full Text Available Objective: To determine the frequency of the C282T polymorphism of the NAT2 gene (N acetyltransferase in Peruvian populations. Field work, focused on exploring genetic risk factor in Peruvian populations, which has influence in the response to drugs and malignancies aetiology. Material and Methods: Cross-sectional study. 166 voluntaries from Lima, Lambayeque, Apurimac, Puno, San Martin, Amazonas and Loreto were enrolled. The sampling was done by convenience and it was use the RFLP-PCR conventional technique was used. Results: The allele frequency were 54% (n=126 for C282 and 46% (n=106 for T282. For the T allele, by its orign , stand out 2 those which origins were Lima 42% (n=25, Amazonas 47% (n=16, San Martin 74% (n=28 and Apurimac 50% (n=13 (X , p>0.05. A global genotype frequency were 26.7% (n=31 for C282/C282, 56.0% (n=65 for C282/T282 and 17.2% (n=20 for T282/T282 (Hardy Weinberg Test p>0.05. By origin, Puno presented allelic imbalance (Hardy Weinberg test p0.05. Conclusion: The overall frequency of NAT2 allele T282 was 46%; San Martin had the highest prevalence (74%. The T282 allele is linked to neoplastic diseases and adverse reactions to anti-TB drugs, these results will be used for the application of pharmacogenetics in Peru

  5. Genetic disruption of NRF2 promotes the development of necroinflammation and liver fibrosis in a mouse model of HFE-hereditary hemochromatosis.

    Science.gov (United States)

    Duarte, Tiago L; Caldas, Carolina; Santos, Ana G; Silva-Gomes, Sandro; Santos-Gonçalves, Andreia; Martins, Maria João; Porto, Graça; Lopes, José Manuel

    2017-04-01

    In hereditary hemochromatosis, iron deposition in the liver parenchyma may lead to fibrosis, cirrhosis and hepatocellular carcinoma. Most cases are ascribed to a common mutation in the HFE gene, but the extent of clinical expression is greatly influenced by the combined action of yet unidentified genetic and/or environmental modifying factors. In mice, transcription factor NRF2 is a critical determinant of hepatocyte viability during exposure to acute dietary iron overload. We evaluated if the genetic disruption of Nrf2 would prompt the development of liver damage in Hfe -/- mice (an established model of human HFE-hemochromatosis). Wild-type, Nrf2 -/- , Hfe -/- and double knockout (Hfe/Nrf2 -/- ) female mice on C57BL/6 genetic background were sacrificed at the age of 6 (young), 12-18 (middle-aged) or 24 months (old) for evaluation of liver pathology. Despite the parenchymal iron accumulation, Hfe -/- mice presented no liver injury. The combination of iron overload (Hfe -/- ) and defective antioxidant defences (Nrf2 -/- ) increased the number of iron-related necroinflammatory lesions (sideronecrosis), possibly due to the accumulation of toxic oxidation products such as 4-hydroxy-2-nonenal-protein adducts. The engulfment of dead hepatocytes led to a gradual accumulation of iron within macrophages, featuring large aggregates. Myofibroblasts recruited towards the injury areas produced substantial amounts of collagen fibers involving the liver parenchyma of double-knockout animals with increased hepatic fibrosis in an age-dependent manner. The genetic disruption of Nrf2 promotes the transition from iron accumulation (siderosis) to liver injury in Hfe -/- mice, representing the first demonstration of spontaneous hepatic fibrosis in the long term in a mouse model of hereditary hemochromatosis displaying mildly elevated liver iron. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  6. Alternative Polyadenylation and Nonsense-Mediated Decay Coordinately Regulate the Human HFE mRNA Levels

    Science.gov (United States)

    Martins, Rute; Proença, Daniela; Silva, Bruno; Barbosa, Cristina; Silva, Ana Luísa; Faustino, Paula; Romão, Luísa

    2012-01-01

    Nonsense-mediated decay (NMD) is an mRNA surveillance pathway that selectively recognizes and degrades defective mRNAs carrying premature translation-termination codons. However, several studies have shown that NMD also targets physiological transcripts that encode full-length proteins, modulating their expression. Indeed, some features of physiological mRNAs can render them NMD-sensitive. Human HFE is a MHC class I protein mainly expressed in the liver that, when mutated, can cause hereditary hemochromatosis, a common genetic disorder of iron metabolism. The HFE gene structure comprises seven exons; although the sixth exon is 1056 base pairs (bp) long, only the first 41 bp encode for amino acids. Thus, the remaining downstream 1015 bp sequence corresponds to the HFE 3′ untranslated region (UTR), along with exon seven. Therefore, this 3′ UTR encompasses an exon/exon junction, a feature that can make the corresponding physiological transcript NMD-sensitive. Here, we demonstrate that in UPF1-depleted or in cycloheximide-treated HeLa and HepG2 cells the HFE transcripts are clearly upregulated, meaning that the physiological HFE mRNA is in fact an NMD-target. This role of NMD in controlling the HFE expression levels was further confirmed in HeLa cells transiently expressing the HFE human gene. Besides, we show, by 3′-RACE analysis in several human tissues that HFE mRNA expression results from alternative cleavage and polyadenylation at four different sites – two were previously described and two are novel polyadenylation sites: one located at exon six, which confers NMD-resistance to the corresponding transcripts, and another located at exon seven. In addition, we show that the amount of HFE mRNA isoforms resulting from cleavage and polyadenylation at exon seven, although present in both cell lines, is higher in HepG2 cells. These results reveal that NMD and alternative polyadenylation may act coordinately to control HFE mRNA levels, possibly varying its

  7. HFE and Spherical Cryostats MC Study

    International Nuclear Information System (INIS)

    Brodsky, Jason P.

    2016-01-01

    The copper vessel containing the nEXO TPC is surrounded by a buffer of HFE, a liquid refrigerant with very low levels of radioactive element contamination. The HFE is contained within the cryostat's inner vessel, which is in turn inside the outer vessel. While some HFE may be necessary for stable cooling of nEXO, it is possible that using substantially more than necessary for thermal reasons will help reduce backgrounds originating in the cryostats. Using a larger amount of HFE is accomplished by making the cryostat vessels larger. By itself, increasing the cryostat size somewhat increases the background rate, as the thickness of the cryostat wall must increase at larger sizes. However, the additional space inside the cryostat will be filled with HFE which can absorb gamma rays headed for the TPC. As a result, increasing the HFE reduces the number of backgrounds reaching the TPC. The aim of this study was to determine the relationship between HFE thickness and background rate. Ultimately, this work should support choosing a cryostat and HFE size that satisfies nEXO's background budget. I have attempted to account for every consequence of changing the cryostat size, although naturally this remains a work in progress until a final design is achieved. At the moment, the scope of the study includes only the spherical cryostat design. This study concludes that increasing cryostat size reduces backgrounds, reaching neglible backgrounds originating from the cryostat at the largest sizes. It also shows that backgrounds originating from the inherent radioactivity of the HFE plateau quickly, so may be considered essentially fixed at any quantity of HFE.

  8. Autoimmune Conditions in 235 Hemochromatosis Probands with HFE C282Y Homozygosity and Their First-Degree Relatives

    Directory of Open Access Journals (Sweden)

    James C. Barton

    2015-01-01

    Full Text Available We performed a retrospective study of autoimmune conditions (ACs in 235 hemochromatosis probands at diagnosis by analyzing age, sex, ACs, history of first-degree family members with ACs (FH, diabetes, heavy ethanol consumption, elevated serum ALT/AST, nonalcoholic fatty liver disease, viral hepatitis, cirrhosis, iron removed to achieve iron depletion (QFe, and positivity for human leukocyte antigen (HLA haplotypes A∗01, B∗08; A∗02, B∗44; A∗03, B∗07; A∗03, B∗14; and A∗29, B∗44. There were 138 men (58.7%. Median followup was 19.6 y. One or more of 19 ACs were diagnosed in each of 35 probands (14.9%. Prevalences of Hashimoto’s thyroiditis, rheumatoid arthritis, and ankylosing spondylitis were 8.1% (95% CI: [5.1, 12.5], 1.7% [0.6, 4.6], and 0.0085 [0.0015, 0.0337], respectively. Eighteen probands (7.7% had a FH. Eight probands with ACs had 9 family members with ACs. In a logistic regression, ACs were less likely in men (odds ratio (OR 0.3 [0.1, 0.6] and more likely in probands with a FH (OR 4.1 [1.4, 11.8]. Overall ACs risk was not significantly associated with QFe or HLA haplotypes. Estimated survival of probands with and without ACs did not differ significantly. We conclude that ACs are common in hemochromatosis probands, especially women and probands with a FH.

  9. MTHFR and HFE, but not preproghrelin and LBP, polymorphisms as risk factors for all-cause end-stage renal disease development.

    Science.gov (United States)

    Bloudíčková, S; Kuthanová, L; Hubáček, J A

    2014-01-01

    End-stage renal disease (ESRD) is a serious health problem worldwide. The high prevalence of cardiovascular diseases and chronic inflammation remains a major cause of morbidity and mortality in haemodialysed patients. Beside some external factors, genetic predisposition both to renal failure and poor prognosis has been assumed. We have collected a total of 1,014 haemodialysed patients and 2,559 unrelated healthy Caucasians. Single-nucleotide polymorphisms (SNPs) in genes for preproghrelin (GHRL), lipopolysaccharide-binding protein (LBP), HFE and MTHFR were genotyped. In the group of patients, significantly more carriers presented the MTHFR T667T (P = 0.002) and HFE Asp63Asp (P = 0.001) and Cys282Cys (P = 0.01) genotypes. The frequencies of individual SNPs within GHRL and LBP genes did not differ between the patients and controls. The trends in genotype frequencies did not differ between the subgroups of patients with different time on haemodialysis. Common variants in MTHFR and HFE could be a risk factor for all-cause ESRD development, but are not predictors for the survival on haemodialysis.

  10. Effects of strain and age on hepatic gene expression profiles in murine models of HFE-associated hereditary hemochromatosis.

    Science.gov (United States)

    Lee, Seung-Min; Loguinov, Alexandre; Fleming, Robert E; Vulpe, Christopher D

    2015-01-01

    Hereditary hemochromatosis is an iron overload disorder most commonly caused by a defect in the HFE gene. While the genetic defect is highly prevalent, the majority of individuals do not develop clinically significant iron overload, suggesting the importance of genetic modifiers. Murine hfe knockout models have demonstrated that strain background has a strong effect on the severity of iron loading. We noted that hepatic iron loading in hfe-/- mice occurs primarily over the first postnatal weeks (loading phase) followed by a timeframe of relatively static iron concentrations (plateau phase). We thus evaluated the effects of background strain and of age on hepatic gene expression in Hfe knockout mice (hfe-/-). Hepatic gene expression profiles were examined using cDNA microarrays in 4- and 8-week-old hfe-/- and wild-type mice on two different genetic backgrounds, C57BL/6J (C57) and AKR/J (AKR). Genes differentially regulated in all hfe-/- mice groups, compared with wild-type mice, including those involved in cell survival, stress and damage responses and lipid metabolism. AKR strain-specific changes in lipid metabolism genes and C57 strain-specific changes in cell adhesion and extracellular matrix protein genes were detected in hfe-/- mice. Mouse strain and age are each significantly associated with hepatic gene expression profiles in hfe-/- mice. These affects may underlie or reflect differences in iron loading in these mice.

  11. Regulation of HFE expression by poly(ADP-ribose) polymerase-1 (PARP1) through an inverted repeat DNA sequence in the distal promoter.

    Science.gov (United States)

    Pelham, Christopher; Jimenez, Tamara; Rodova, Marianna; Rudolph, Angela; Chipps, Elizabeth; Islam, M Rafiq

    2013-12-01

    Hereditary hemochromatosis (HH) is a common autosomal recessive disorder of iron overload among Caucasians of northern European descent. Over 85% of all cases with HH are due to mutations in the hemochromatosis protein (HFE) involved in iron metabolism. Although the importance in iron homeostasis is well recognized, the mechanism of sensing and regulating iron absorption by HFE, especially in the absence of iron response element in its gene, is not fully understood. In this report, we have identified an inverted repeat sequence (ATGGTcttACCTA) within 1700bp (-1675/+35) of the HFE promoter capable to form cruciform structure that binds PARP1 and strongly represses HFE promoter. Knockdown of PARP1 increases HFE mRNA and protein. Similarly, hemin or FeCl3 treatments resulted in increase in HFE expression by reducing nuclear PARP1 pool via its apoptosis induced cleavage, leading to upregulation of the iron regulatory hormone hepcidin mRNA. Thus, PARP1 binding to the inverted repeat sequence on the HFE promoter may serve as a novel iron sensing mechanism as increased iron level can trigger PARP1 cleavage and relief of HFE transcriptional repression. © 2013.

  12. HFE Genotype Restricts the Response to Paraquat in a Mouse Model of Neurotoxicity.

    Science.gov (United States)

    Nixon, Anne M; Meadowcroft, Mark D; Neely, Elizabeth B; Snyder, Amanda M; Purnell, Carson J; Wright, Justin; Lamendella, Regina; Nandar, Wint; Huang, Xuemei; Connor, James R

    2018-05-01

    Parkinson's disease is marked clinically by motor dysfunction and pathologically by dopaminergic cell loss in the substantia nigra and iron accumulation in the substantia nigra. The driver underlying iron accumulation remains unknown and could be genetic or environmental. The HFE protein is critical for the regulation of cellular iron uptake. Mutations within this protein are associated with increased iron accumulation including in the brain. We have focused on the commonly occurring H63D variant of the HFE gene as a disease modifier in a number of neurodegenerative diseases. To investigate the role of H63D HFE genotype, we generated a mouse model in which the wild-type (WT) HFE gene is replaced by the H67D gene variant (mouse homolog of the human H63D gene variant). Using paraquat toxicity as the model for Parkinson's disease, we found that WT mice responded as expected with significantly greater motor function, loss of tyrosine hydroxylase staining and increase microglial staining in the substantia nigra, and an increase in R 2 relaxation rate within the substantia nigra of the paraquat-treated mice compared to their saline-treated counterparts. In contrast, the H67D mice showed a remarkable resistance to paraquat treatment; specifically differing from the WT mice with no changes in motor function or changes in R 2 relaxation rates following paraquat exposure. At baseline, there were differences between the H67D HFE mice and WT mice in gut microbiome profile and increased L-ferritin staining in the substantia nigra that could account for the resistance to paraquat. Of particular note, the H67D HFE mice regardless of whether or not they were treated with paraquat had significantly less tyrosine hydroxylase immunostaining than WT. Our results clearly demonstrate that the HFE genotype impacts the expression of tyrosine hydroxylase in the substantia nigra, the gut microbiome and the response to paraquat providing additional support that the HFE genotype is a disease

  13. Liquid density of HFE-7200 and HFE-7500 from T = (283 to 363) K at pressures up to 100 MPa

    International Nuclear Information System (INIS)

    Fang, Dan; Li, Ying; Meng, Xianyang; Wu, Jiangtao

    2014-01-01

    Highlights: • Liquid densities are reported for HFE-7200 and HFE-7500 at temperatures from (283 to 363) K, pressures up to 100 MPa. • The expanded uncertainty (k = 2) of density measurement for HFE-7200 and HFE-7500 were 0.04% and 0.03%, respectively. • Modified Tait equations were correlated with the experimental data. • The isobaric thermal expansivity and isothermal compressibility of HFE-7200 and HFE-7500 were calculated. -- Abstract: The liquid densities of HFE-7200 (1-ethoxy-1,1,2,2,3,3,4,4,4-nonafluorobutane, CAS Registry Number: 163702-05-4) and HFE-7500 (3-ethoxyperfluoro(2-methylhexane), CAS Registry Number: 297730-93-9) have been measured over the temperature range from (283 to 363) K and pressures up to 100 MPa by using a high pressure vibrating-tube densimeter. R134a has been used as a reference fluid to validate the densimeter. The uncertainty of each obtained datum was estimated, and the maximum expanded uncertainty with a level of confidence of 0.95 (k = 2) of density measurement for HFE-7200 and HFE-7500 were 0.04% and 0.03%, respectively. The measured liquid densities were correlated with the modified Tait equation and the maximum deviation is less than 0.03%. The isothermal compressibility and isobaric thermal expansivity were also calculated

  14. Heterozygous Hfe gene deletion leads to impaired glucose homeostasis, but not liver injury in mice fed a high-calorie diet.

    Science.gov (United States)

    Britton, Laurence; Jaskowski, Lesley; Bridle, Kim; Santrampurwala, Nishreen; Reiling, Janske; Musgrave, Nick; Subramaniam, V Nathan; Crawford, Darrell

    2016-06-01

    Heterozygous mutations of the Hfe gene have been proposed as cofactors in the development and progression of nonalcoholic fatty liver disease (NAFLD). Homozygous Hfe deletion previously has been shown to lead to dysregulated hepatic lipid metabolism and accentuated liver injury in a dietary mouse model of NAFLD We sought to establish whether heterozygous deletion of Hfe is sufficient to promote liver injury when mice are exposed to a high-calorie diet (HCD). Eight-week-old wild-type and Hfe(+/-) mice received 8 weeks of a control diet or HCD Liver histology and pathways of lipid and iron metabolism were analyzed. Liver histology demonstrated that mice fed a HCD had increased NAFLD activity score (NAS), steatosis, and hepatocyte ballooning. However, liver injury was unaffected by Hfe genotype. Hepatic iron concentration (HIC) was increased in Hfe(+/-) mice of both dietary groups. HCD resulted in a hepcidin-independent reduction in HIC Hfe(+/-) mice demonstrated raised fasting serum glucose concentrations and HOMA-IR score, despite unaltered serum adiponectin concentrations. Downstream regulators of hepatic de novo lipogenesis (pAKT, SREBP-1, Fas, Scd1) and fatty acid oxidation (AdipoR2, Pparα, Cpt1) were largely unaffected by genotype. In summary, heterozygous Hfe gene deletion is associated with impaired iron and glucose metabolism. However, unlike homozygous Hfe deletion, heterozygous gene deletion did not affect lipid metabolism pathways or liver injury in this model. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  15. HNPCC: Six new pathogenic mutations

    Directory of Open Access Journals (Sweden)

    Epplen Joerg T

    2004-06-01

    Full Text Available Abstract Background Hereditary non-polyposis colorectal cancer (HNPCC is an autosomal dominant disease with a high risk for colorectal and endometrial cancer caused by germline mutations in DNA mismatch-repair genes (MMR. HNPCC accounts for approximately 2 to 5% of all colorectal cancers. Here we present 6 novel mutations in the DNA mismatch-repair genes MLH1, MSH2 and MSH6. Methods Patients with clinical diagnosis of HNPCC were counselled. Tumor specimen were analysed for microsatellite instability and immunohistochemistry for MLH1, MSH2 and MSH6 protein was performed. If one of these proteins was not detectable in the tumor mutation analysis of the corresponding gene was carried out. Results We identified 6 frameshift mutations (2 in MLH1, 3 in MSH2, 1 in MSH6 resulting in a premature stop: two mutations in MLH1 (c.2198_2199insAACA [p.N733fsX745], c.2076_2077delTG [p.G693fsX702], three mutations in MSH2 (c.810_811delGT [p.C271fsX282], c.763_766delAGTGinsTT [p.F255fsX282], c.873_876delGACT [p.L292fsX298] and one mutation in MSH6 (c.1421_1422dupTG [p.C475fsX480]. All six tumors tested for microsatellite instability showed high levels of microsatellite instability (MSI-H. Conclusions HNPCC in families with MSH6 germline mutations may show an age of onset that is comparable to this of patients with MLH1 and MSH2 mutations.

  16. Involvement of the major histocompatibility complex region in the genetic regulation of circulating CD8 T-cell numbers in humans.

    Science.gov (United States)

    Cruz, E; Vieira, J; Gonçalves, R; Alves, H; Almeida, S; Rodrigues, P; Lacerda, R; Porto, G

    2004-07-01

    Variability in T-lymphocyte numbers is partially explained by a genetic regulation. From studies in animal models, it is known that the Major Histocompatibility Complex (MHC) is involved in this regulation. In humans, this has not been shown yet. The objective of the present study was to test the hypothesis that genes in the MHC region influence the regulation of T-lymphocyte numbers. Two approaches were used. Association studies between T-cell counts (CD4(+) and CD8(+)) or total lymphocyte counts and HLA class I alleles (A and B) or mutations in the HFE (C282Y and H63D), the hemochromatosis gene, in an unrelated population (n = 264). A second approach was a sibpair correlation analysis of the same T-cell counts in relation to HLA-HFE haplotypes in subjects belonging to 48 hemochromatosis families (n = 456 sibpairs). In the normal population, results showed a strong statistically significant association of the HLA-A*01 with high numbers of CD8(+) T cells and a less powerful association with the HLA-A*24 with low numbers of CD8(+) T cells. Sibpair correlations revealed the most significant correlation for CD8(+) T-cell numbers for sibpairs with HLA-HFE-identical haplotypes. This was not observed for CD4(+) T cells. These results show that the MHC region is involved in the genetic regulation of CD8(+) T-cell numbers in humans. Identification of genes responsible for this control may have important biological and clinical implications.

  17. Diagnosis of hepatic iron overload: a family study illustrating pitfalls in diagnosing hemochromatosis.

    Science.gov (United States)

    Schranz, Melanie; Talasz, Heribert; Graziadei, Ivo; Winder, Thomas; Sergi, Consolato; Bogner, Klaus; Vogel, Wolfgang; Zoller, Heinz

    2009-03-01

    Recent identification of genetic variants in iron storage disease has changed the classification system and diagnostic algorithms for hemochromatosis. Clinical diagnosis of the disease requires phenotypic evidence of iron overload because the commonly disease-associated HFE genotypes have an incomplete penetrance. Furthermore, approximately 20% of patients with a clinical diagnosis of hemochromatosis have no disease-associated genotype, which underlines the importance of clear phenotypic criteria of hemochromatosis. A diagnosis of hemochromatosis cannot be made even in patients with liver cirrhosis simply on the basis of genetic testing that indicates that iron overload is the cause of the disease and not its consequence. Proper diagnosis requires integration of clinical presentation, family history, and the results of biochemical and histopathologic tests. Here we propose a rational diagnostic algorithm for hepatic iron overload syndromes and illustrate potential pitfalls by presenting a family study in a pedigree with rare HFE variants (H63D and E168Q), in cis on the same chromosome. Although the clinical suspicion of hemochromatosis was confirmed by histology, chemical analysis of liver tissue revealed a normal hepatic iron concentration, which is compatible with the genetic finding of 1 normal and 1 doubly mutated allele. In conclusion, clinical suspicion of hemochromatosis and elevated serum iron parameters should prompt HFE genotyping for C282Y and H63D. Should they be uninformative, further genetic tests should be recommended only if iron overload in liver tissue has been confirmed chemically.

  18. Impact of low-frequency hotspot mutation R282Q on the structure of p53 DNA-binding domain as revealed by crystallography at 1.54 Å resolution

    Energy Technology Data Exchange (ETDEWEB)

    Tu, Chao [Macromolecular Crystallography Laboratory, National Cancer Institute, Frederick, MD 21702 (United States); Tan, Yu-Hong [Department of Molecular Biology and Biochemistry, University of California at Irvine, Irvine, CA 92697 (United States); Shaw, Gary [Macromolecular Crystallography Laboratory, National Cancer Institute, Frederick, MD 21702 (United States); Zhou, Zheng; Bai, Yawen [Laboratory of Biochemistry and Molecular Biology, National Cancer Institute, Bethesda, MD 20892 (United States); Luo, Ray [Department of Molecular Biology and Biochemistry, University of California at Irvine, Irvine, CA 92697 (United States); Ji, Xinhua, E-mail: jix@ncifcrf.gov [Macromolecular Crystallography Laboratory, National Cancer Institute, Frederick, MD 21702 (United States)

    2008-05-01

    The impact of hotspot mutation R282Q on the structure of human p53 DNA-binding domain has been characterized by X-ray crystallography and molecular-dynamics simulations. Tumor suppressor p53 is a sequence-specific DNA-binding protein and its central DNA-binding domain (DBD) harbors six hotspots (Arg175, Gly245, Arg248, Arg249, Arg273 and Arg282) for human cancers. Here, the crystal structure of a low-frequency hotspot mutant, p53DBD(R282Q), is reported at 1.54 Å resolution together with the results of molecular-dynamics simulations on the basis of the structure. In addition to eliminating a salt bridge, the R282Q mutation has a significant impact on the properties of two DNA-binding loops (L1 and L3). The L1 loop is flexible in the wild type, but it is not flexible in the mutant. The L3 loop of the wild type is not flexible, whereas it assumes two conformations in the mutant. Molecular-dynamics simulations indicated that both conformations of the L3 loop are accessible under biological conditions. It is predicted that the elimination of the salt bridge and the inversion of the flexibility of L1 and L3 are directly or indirectly responsible for deactivating the tumor suppressor p53.

  19. Hemochromatosis C282Y gene mutation as a potential susceptibility ...

    African Journals Online (AJOL)

    G.M. Mokhtar

    2017-08-12

    Aug 12, 2017 ... ease (36.6%), delayed puberty (56.6%), primary (35.71%) and secondary amenorrhea (21.42%), short stature. (27.3%) .... guineous marriage (61.5%) and a high rate of positive family his- .... Safer food, better business.

  20. Structural and dynamic characterization of the C313Y mutation in Myostatin dimeric protein, responsible for the double muscle phenotype in Piedmontese cattle

    Directory of Open Access Journals (Sweden)

    Silvia eBongiorno

    2016-02-01

    Full Text Available The knowledge of the molecular effects of the C313Y mutation, responsible for the double muscle phenotype in Piedmontese cattle, can help understanding the actual mechanism of phenotype determination and paves the route for a better modulation of the positive effects of this economic important phenotype in the beef industry, while minimizing the negative side effects, now inevitably intersected.The structure and dynamic behaviour of the active dimeric form of Myostatin in cattle was analyzed by means of three state-of-the-art Molecular Dynamics simulations, 200-ns long, of wild-type and C313Y mutants. Our results highlight a role for the conserved Arg333 in establishing a network of short and long range interactions between the two monomers in the wild-type protein that is destroyed upon the C313Y mutation even in a single monomer. Furthermore, the native protein shows an asymmetry in residue fluctuation that is absent in the double monomer mutant. Time window analysis on further 200-ns of simulation demonstrates that this is a characteristic behaviour of the protein, likely depended from the long range communications between monomers. The same behaviour, in fact, has already been observed in other mutated dimers. Finally, the mutation does not produce alterations in the secondary structure elements that compose the characteristic TGF-β cystine-knot motif.

  1. Hemochromatosis and diabetes mellitus: case report and literature review

    Directory of Open Access Journals (Sweden)

    Karina Biavatti

    2008-12-01

    Full Text Available Hemochromatosis is a disorder characterized by iron storage amended. The acquired form of the disease can be caused by iron overload, alcoholism, infection by  C virus hepatitis, non-alcoholic hepatitis and chronic liver disease. The hereditary form can be caused by different mutations, being the C282Y and H63D the most frequent, 83% of cases are homozigotous for C282Y and 4% are compound heterozygous (C282Y/H63D. Hemochromatosis is a condition that can affect several organs, including: heart, joints, liver, hypothalamus, pituitary, pancreas and gonads. The aim of this study was to report a case of hemochromatosis and review the literature, with special attention to the association of hemochromatosis and diabetes mellitus. Patient 53 years, male presented to the doctor with arthralgia metacarpophalangeal, ankles, knees, coxofemoral right, and cervical and lumbar, complaints of fatigue and weight loss. Between 3 brothers, one of them had a diagnosis of hereditary hemochromatosis, with PCR demonstrating homozygous for C282Y. Labs: GOT 128 U/L, ALT 231 U/L, alkaline phosphatase 258 U/L, abdominal ultrasound with hepatomegaly and spleen at the upper limit of normal. Liver biopsy demonstrated portal fibrosis extension with hemosiderosis intense. It also made the diagnosis of diabetes mellitus. The research confirmed the same mutation of the changing family: homozygous for C282Y

  2. Differential HFE gene expression is regulated by alternative splicing in human tissues.

    Science.gov (United States)

    Martins, Rute; Silva, Bruno; Proença, Daniela; Faustino, Paula

    2011-03-03

    The pathophysiology of HFE-derived Hereditary Hemochromatosis and the function of HFE protein in iron homeostasis remain uncertain. Also, the role of alternative splicing in HFE gene expression regulation and the possible function of the corresponding protein isoforms are still unknown. The aim of this study was to gain insights into the physiological significance of these alternative HFE variants. Alternatively spliced HFE transcripts in diverse human tissues were identified by RT-PCR, cloning and sequencing. Total HFE transcripts, as well as two alternative splicing transcripts were quantified using a real-time PCR methodology. Intracellular localization, trafficking and protein association of GFP-tagged HFE protein variants were analysed in transiently transfected HepG2 cells by immunoprecipitation and immunofluorescence assays. Alternatively spliced HFE transcripts present both level- and tissue-specificity. Concerning the exon 2 skipping and intron 4 inclusion transcripts, the liver presents the lowest relative level, while duodenum presents one of the highest amounts. The protein resulting from exon 2 skipping transcript is unable to associate with β2M and TfR1 and reveals an ER retention. Conversely, the intron 4 inclusion transcript gives rise to a truncated, soluble protein (sHFE) that is mostly secreted by cells to the medium in association with β2M. HFE gene post-transcriptional regulation is clearly affected by a tissue-dependent alternative splicing mechanism. Among the corresponding proteins, a sHFE isoform stands out, which upon being secreted into the bloodstream, may act in remote tissues. It could be either an agonist or antagonist of the full length HFE, through hepcidin expression regulation in the liver or by controlling dietary iron absorption in the duodenum.

  3. Development of a HFE program for an operating NPP: Balancing between existing design practices and human factors standards

    International Nuclear Information System (INIS)

    Salo, Leena; Savioja, Paula

    2014-01-01

    This paper describes HFE program development project conducted at a Finnish power company Fortum. The aim of developing a formal HFE program was to improve integration of human factors issues in design of technical systems and to systematically document the HFE process of the company. As Fortum has a long tradition of designing control room solutions, the starting point of the HFE program development was the existing own design practices. On the other hand, the aim was to create a program which would comply with international guidelines such as NUREG-0711. The program development was conducted by tracing the HFE design practices in an on-going I and C modernization project. This empirical work was carried out by interviews of designers and other HFE key stake holders. After the explication of the current practices, the gaps, overlaps and differences in relation to the international standards and guidelines were identified. Based on an analysis of current practices and guidelines and standards a new HFE process model was created. The design process model can be followed in modifications which concern systems with human user interfaces of any kind. The model consists of five separate phases which comply with the general engineering design process model utilized at the company. The HFE program is intended to be both a practical guide on how to take human factors issues into consideration in the design of NPP systems and also a tool for the management of HFE activities

  4. ENVIRONMENTAL RESEARCH BRIEF: THERMOPHYSICAL PROPERTIES OF HFE-125

    Science.gov (United States)

    Thermophysical properties of HFE-125 (pentafluorodimethylether) suggest that it could serve as an alternative non-ozone depleting refrigerant for certain low temperature applications. This Brief presents the thermophysical properties of HFE-125 (Tables 1-4) which have been obtai...

  5. Differential HFE gene expression is regulated by alternative splicing in human tissues.

    Directory of Open Access Journals (Sweden)

    Rute Martins

    Full Text Available BACKGROUND: The pathophysiology of HFE-derived Hereditary Hemochromatosis and the function of HFE protein in iron homeostasis remain uncertain. Also, the role of alternative splicing in HFE gene expression regulation and the possible function of the corresponding protein isoforms are still unknown. The aim of this study was to gain insights into the physiological significance of these alternative HFE variants. METHODOLOGY/PRINCIPAL FINDINGS: Alternatively spliced HFE transcripts in diverse human tissues were identified by RT-PCR, cloning and sequencing. Total HFE transcripts, as well as two alternative splicing transcripts were quantified using a real-time PCR methodology. Intracellular localization, trafficking and protein association of GFP-tagged HFE protein variants were analysed in transiently transfected HepG2 cells by immunoprecipitation and immunofluorescence assays. Alternatively spliced HFE transcripts present both level- and tissue-specificity. Concerning the exon 2 skipping and intron 4 inclusion transcripts, the liver presents the lowest relative level, while duodenum presents one of the highest amounts. The protein resulting from exon 2 skipping transcript is unable to associate with β2M and TfR1 and reveals an ER retention. Conversely, the intron 4 inclusion transcript gives rise to a truncated, soluble protein (sHFE that is mostly secreted by cells to the medium in association with β2M. CONCLUSIONS/SIGNIFICANCE: HFE gene post-transcriptional regulation is clearly affected by a tissue-dependent alternative splicing mechanism. Among the corresponding proteins, a sHFE isoform stands out, which upon being secreted into the bloodstream, may act in remote tissues. It could be either an agonist or antagonist of the full length HFE, through hepcidin expression regulation in the liver or by controlling dietary iron absorption in the duodenum.

  6. [The polymorphism of catechol-O-methyltransferase (COMT) and hemochromatosis (HFE) genes in the radiocontaminated regions residents with different chromosome aberration frequency].

    Science.gov (United States)

    Ivanova, T I; Kondrashova, T V; Krikunova, L I; Smirnova, I A; Shentereva, N I; Sychenkova, N I; Rykova, E V; Zharikova, I A; Khorokhorina, V A; Riabchenko, N I; Zamulaeva, I A

    2010-01-01

    The association between polymorphisms in genes COMT, HFE that takes part in oxidative stress regulation, and chromosome aberration frequency in lymphocytes was assessed in 278 female residents of radiation polluted regions of Central Russia: Bryansk (322 kBk/m2) and Tula Districts (137Cs - 171 kBk/m2). The C187G, G845A genotyping of HFE and G1947A (H/L) of COMT was done by means of polymerase chain reaction-restriction fragment length polymorphism. Studied population was divided into 3 subgroups by level of chromosome aberrations per cell (0-2, 3-4, >5). There was shown statistically significant difference in distribution of COMTand HFE genotypes between the groups. The high frequency of chromosome aberrations (> or = 5%) was associated with homozygotes of the high activity COMT G/G and HFE CC. Heterozygotes for G1947A COMT and C187G HFE reveal negative association with the high frequency of chromosome aberrations and correspond to "resistance factors".

  7. Mek1Y130C mice recapitulate aspects of human cardio-facio-cutaneous syndrome

    Science.gov (United States)

    Aoidi, Rifdat; Houde, Nicolas; Landry-Truchon, Kim; Holter, Michael; Jacquet, Kevin; Charron, Louis; Yu, Benjamin D.; Rauen, Katherine A.; Bisson, Nicolas; Newbern, Jason

    2018-01-01

    ABSTRACT The RAS/MAPK signaling pathway is one of the most investigated pathways, owing to its established role in numerous cellular processes and implication in cancer. Germline mutations in genes encoding members of the RAS/MAPK pathway also cause severe developmental syndromes collectively known as RASopathies. These syndromes share overlapping characteristics, including craniofacial dysmorphology, cardiac malformations, cutaneous abnormalities and developmental delay. Cardio-facio-cutaneous syndrome (CFC) is a rare RASopathy associated with mutations in BRAF, KRAS, MEK1 (MAP2K1) and MEK2 (MAP2K2). MEK1 and MEK2 mutations are found in ∼25% of the CFC patients and the MEK1Y130C substitution is the most common one. However, little is known about the origins and mechanisms responsible for the development of CFC. To our knowledge, no mouse model carrying RASopathy-linked Mek1 or Mek2 gene mutations has been reported. To investigate the molecular and developmental consequences of the Mek1Y130C mutation, we generated a mouse line carrying this mutation. Analysis of mice from a Mek1 allelic series revealed that the Mek1Y130C allele expresses both wild-type and Y130C mutant forms of MEK1. However, despite reduced levels of MEK1 protein and the lower abundance of MEK1 Y130C protein than wild type, Mek1Y130C mutants showed increased ERK (MAPK) protein activation in response to growth factors, supporting a role for MEK1 Y130C in hyperactivation of the RAS/MAPK pathway, leading to CFC. Mek1Y130C mutant mice exhibited pulmonary artery stenosis, cranial dysmorphia and neurological anomalies, including increased numbers of GFAP+ astrocytes and Olig2+ oligodendrocytes in regions of the cerebral cortex. These data indicate that the Mek1Y130C mutation recapitulates major aspects of CFC, providing a new animal model to investigate the physiopathology of this RASopathy. This article has an associated First Person interview with the first author of the paper. PMID:29590634

  8. The cytochrome b p.278Y>C mutation causative of a multisystem disorder enhances superoxide production and alters supramolecular interactions of respiratory chain complexes

    DEFF Research Database (Denmark)

    Ghelli, Anna; Tropeano, Concetta V; Calvaruso, Maria Antonietta

    2013-01-01

    , the examination of respiratory supercomplexes revealed that the amounts of CIII dimer and III2IV1 were reduced, whereas those of I1III2IVn slightly increased. We therefore suggest that the deleterious effects of p.278Y>C mutation on cytochrome b are palliated when CIII is assembled into the supercomplexes I1III2......IVn, in contrast to when it is found alone. These findings underline the importance of supramolecular interactions between complexes for maintaining a basal respiratory chain activity and shed light to the molecular basis of disease manifestations associated with this mutation.......Cytochrome b is the only mtDNA-encoded subunit of the mitochondrial complex III (CIII), the functional bottleneck of the respiratory chain. Previously, the human cytochrome b missense mutation m.15579A>G, which substitutes the Tyr 278 with Cys (p.278Y>C), was identified in a patient with severe...

  9. A rare cause of osteonecrosis

    Directory of Open Access Journals (Sweden)

    Paolo Agostinis

    2012-01-01

    Full Text Available IntroductionHereditary hemochromatosis (HH is an autosomal recessive disorder caused by mutations in the HFE gene, which increase intestinal iron absorption. The prevalence of C282Y homozygosity, which causes the disorder, is 0.5% in Caucasian populations. The clinical manifestations are related to excess iron in the tissues, especially the liver, heart, pancreas, pituitary, and skin. They include fatigue, loss of libido or impotence in males, liver disease, skin pigmentation, diabetes mellitus, cardiac enlargement—with or without heart failure, and conduction defects. The classic triad of cirrhosis, diabetes mellitus, and skin pigmentation (“bronze diabetes” results from a combination of iron deposits and melanin. It occurs late in the disease, when the total body iron content is more than five times the normal value, about 20 grams. Left untreated, approximately half of all patients with HH eventually develop arthralgia or arthropathy. Chondrocalcinosis, chronic pseudo-osteoarthritis, and osteoporosis are the major rheumatic manifestations of HH. The cause of the arthropathy is still unknown. Iron deposits within joints may trigger a number of pathologic events, such as free radical generation and crystal deposition, which stimulate immune complex formation and inflammation.Materials and methodsWe describe the case of a 48-year-old male suffering from chronic bilateral ankle pain.ResultsThe work-up revealed osteonecrosis of ankle. The patient also presented high plasma ferritin levels and homozygosity for the C282Y mutation. Other than HH, which was confirmed by liver biopsy, the patient had no other risk factors for osteonecrosis.DiscussionHH represents a rare cause of osteonecrosis, and there are no prior reports of aseptic osteonecrosis of the ankle in a patient with this disease. The pathogenetic mechanism remains unknown.

  10. Isolation of temperature-sensitive mutations in murC of Staphylococcus aureus.

    Science.gov (United States)

    Ishibashi, Mihoko; Kurokawa, Kenji; Nishida, Satoshi; Ueno, Kohji; Matsuo, Miki; Sekimizu, Kazuhisa

    2007-09-01

    Enzymes in the bacterial peptidoglycan biosynthesis pathway are important targets for novel antibiotics. Of 750 temperature-sensitive (TS) mutants of Gram-positive Staphylococcus aureus, six were complemented by the murC gene, which encodes the UDP-N-acetylmuramic acid:l-alanine ligase. Each mutation resulted in a single amino acid substitution and, in all cases, the TS phenotype was suppressed by high osmotic stress. In mutant strains with the G222E substitution, a decrease in the viable cell number immediately after shift to the restrictive temperature was observed. These results suggest that S. aureus MurC protein is essential for cell growth. The MurC H343Y mutation is located in the putative alanine recognition pocket. Consistent with this, allele-specific suppression was observed of the H343Y mutation by multiple copies of the aapA gene, which encodes an alanine transporter. The results suggest an in vivo role for the H343 residue of S. aureus MurC protein in high-affinity binding to L-alanine.

  11. Effects of hemochromatosis and transferrin gene mutations on peripheral iron dyshomeostasis in Mild Cognitive Impairment and Alzheimer’s and Parkinson’s diseases

    Directory of Open Access Journals (Sweden)

    Stefania eMariani

    2013-08-01

    Full Text Available Deregulation of iron metabolism has been observed in patients with neurodegenerative diseases. We have carried out a molecular analysis investigating the interaction between iron specific gene variants [transferrin (TF, P589S, hemochromatosis (HFE C282Y and H63D], iron biochemical variables [iron, Tf, ceruloplasmin (Cp, Cp:Tf ratio and % of Tf saturation (% Tf-sat] Impairment (MCI, 78 Parkinson’s disease (PD patients and 139 healthy controls to investigate mechanisms of iron regulation or toxicity. No difference in genetic variant distributions between patients and controls was found in our Italian sample, but the stratification for the APOE e4 allele revealed that among the APOE e4 carriers was higher the frequency of those carriers of at least a mutated TF P589S allele. Decreased Tf in both AD and MCI and increased Cp:Tf ratio in AD vs. controls were detected. A multinomial logistic regression model revealed that increased iron and Cp:Tf ratio and being man instead of woman increased the risk of having PD, that increased values of Cp:Tf ratio corresponded to a 4-fold increase of the relative risk of having MCI, while higher Cp levels were protective for PD and MCI. Our study has some limitations: the small size of the sample, one ethnic group considered, the rarity of some alleles which prevent the statistical power of some genetic analysis. Even though they need confirmation in larger cohorts, our data suggest the hypothesis that deregulation of iron metabolism, in addition to other factors, has some effect on the PD disease risk.

  12. HFE genotype affects exosome phenotype in cancer.

    Science.gov (United States)

    Mrowczynski, Oliver D; Madhankumar, A B; Slagle-Webb, Becky; Lee, Sang Y; Zacharia, Brad E; Connor, James R

    2017-08-01

    Neuroblastoma is the third most common childhood cancer, and timely diagnosis and sensitive therapeutic monitoring remain major challenges. Tumor progression and recurrence is common with little understanding of mechanisms. A major recent focus in cancer biology is the impact of exosomes on metastatic behavior and the tumor microenvironment. Exosomes have been demonstrated to contribute to the oncogenic effect on the surrounding tumor environment and also mediate resistance to therapy. The effect of genotype on exosomal phenotype has not yet been explored. We interrogated exosomes from human neuroblastoma cells that express wild-type or mutant forms of the HFE gene. HFE, one of the most common autosomal recessive polymorphisms in the Caucasian population, originally associated with hemochromatosis, has also been associated with increased tumor burden, therapeutic resistance boost, and negative impact on patient survival. Herein, we demonstrate that changes in genotype cause major differences in the molecular and functional properties of exosomes; specifically, HFE mutant derived exosomes have increased expression of proteins relating to invasion, angiogenesis, and cancer therapeutic resistance. HFE mutant derived exosomes were also shown to transfer this cargo to recipient cells and cause an increased oncogenic functionality in those recipient cells. Copyright © 2017. Published by Elsevier B.V.

  13. Loss of hfe function reverses impaired recognition memory caused by olfactory manganese exposure in mice.

    Science.gov (United States)

    Ye, Qi; Kim, Jonghan

    2015-03-01

    Excessive manganese (Mn) in the brain promotes a variety of abnormal behaviors, including memory deficits, decreased motor skills and psychotic behavior resembling Parkinson's disease. Hereditary hemochromatosis (HH) is a prevalent genetic iron overload disorder worldwide. Dysfunction in HFE gene is the major cause of HH. Our previous study has demonstrated that olfactory Mn uptake is altered by HFE deficiency, suggesting that loss of HFE function could alter manganese-associated neurotoxicity. To test this hypothesis, Hfe-knockout (Hfe (-/-)) and wild-type (Hfe (+/+)) mice mice were intranasally-instilled with manganese chloride (MnCl2 5 mg/kg) or water daily for 3 weeks and examined for memory function. Olfactory Mn diminished both short-term recognition and spatial memory in Hfe (+/+) mice, as examined by novel object recognition task and Barnes maze test, respectively. Interestingly, Hfe (-/-) mice did not show impaired recognition memory caused by Mn exposure, suggesting a potential protective effect of Hfe deficiency against Mn-induced memory deficits. Since many of the neurotoxic effects of manganese are thought to result from increased oxidative stress, we quantified activities of anti-oxidant enzymes in the prefrontal cortex (PFC). Mn instillation decreased superoxide dismutase 1 (SOD1) activity in Hfe (+/+) mice, but not in Hfe (-/-) mice. In addition, Hfe deficiency up-regulated SOD1 and glutathione peroxidase activities. These results suggest a beneficial role of Hfe deficiency in attenuating Mn-induced oxidative stress in the PFC. Furthermore, Mn exposure reduced nicotinic acetylcholine receptor levels in the PFC, indicating that blunted acetylcholine signaling could contribute to impaired memory associated with intranasal manganese. Together, our model suggests that disrupted cholinergic system in the brain is involved in airborne Mn-induced memory deficits and loss of HFE function could in part prevent memory loss via a potential up-regulation of

  14. HFE gene variants and iron-induced oxygen radical generation in idiopathic pulmonary fibrosis.

    Science.gov (United States)

    Sangiuolo, Federica; Puxeddu, Ermanno; Pezzuto, Gabriella; Cavalli, Francesco; Longo, Giuliana; Comandini, Alessia; Di Pierro, Donato; Pallante, Marco; Sergiacomi, Gianluigi; Simonetti, Giovanni; Zompatori, Maurizio; Orlandi, Augusto; Magrini, Andrea; Amicosante, Massimo; Mariani, Francesca; Losi, Monica; Fraboni, Daniela; Bisetti, Alberto; Saltini, Cesare

    2015-02-01

    In idiopathic pulmonary fibrosis (IPF), lung accumulation of excessive extracellular iron and macrophage haemosiderin may suggest disordered iron homeostasis leading to recurring microscopic injury and fibrosing damage. The current study population comprised 89 consistent IPF patients and 107 controls. 54 patients and 11 controls underwent bronchoalveolar lavage (BAL). Haemosiderin was assessed by Perls' stain, BAL fluid malondialdehyde (MDA) by high-performance liquid chromatography, BAL cell iron-dependent oxygen radical generation by fluorimetry and the frequency of hereditary haemochromatosis HFE gene variants by reverse dot blot hybridisation. Macrophage haemosiderin, BAL fluid MDA and BAL cell unstimulated iron-dependent oxygen radical generation were all significantly increased above controls (pHFE allelic variants was markedly higher in IPF compared with controls (40.4% versus 22.4%, OR 2.35, p=0.008) and was associated with higher iron-dependent oxygen radical generation (HFE variant 107.4±56.0, HFE wild type (wt) 59.4±36.4 and controls 16.7±11.8 fluorescence units per 10(5) BAL cells; p=0.028 HFE variant versus HFE wt, p=0.006 HFE wt versus controls). The data suggest iron dysregulation associated with HFE allelic variants may play an important role in increasing susceptibility to environmental exposures, leading to recurring injury and fibrosis in IPF. Copyright ©ERS 2015.

  15. Different Phenotypes of the Two Chinese Probands with the Same c.889G>A (p.C162Y Mutation in COCH Gene Verify Different Mechanisms Underlying Autosomal Dominant Nonsyndromic Deafness 9.

    Directory of Open Access Journals (Sweden)

    Qi Wang

    Full Text Available By analyzing the different phenotypes of two Chinese DFNA9 families with the same mutation located in the intervening region between the LCCL and vWFA domains of cochlin and testing the functional changes in the mutant cochlin, we investigated the different pathogeneses for mutations in LCCL and vWFA domains.Targeted next-generation sequencing for deafness-related genes was used to identify the mutation in the proband in family #208. The probands of family #208 and family #32 with the same p.C162Y mutation were followed for more than 3 years to evaluate the progression of hearing loss and vestibular dysfunction using pure-tone audiometry, caloric testing, electrocochleogram, vestibular-evoked myogenic potential, and video head-impulse test. The disruption of normal cleavage to produce secreted LCCL domain fragments and the tendency to form aggregations of mutant cochlins were tested by in vitro cell experiments.The two families showed different clinical symptoms. Family #32 was identified as having early-onset, progressive sensorineural hearing loss, similar to the symptoms in DFNA9 patients with cochlin mutations in the vWFA domain. The proband of family #208 endured late-onset recurrent paroxysmal vertigo attacks and progressively deteriorating hearing, similar to symptoms in those with cochlin mutations in the LCCL domain. We therefore suggest that the disrupted cleavage of the LCCL domain fragment is likely to cause vestibular dysfunction, and aggregation of mutant cochlin caused by mutations in the vWFA domain is responsible for early-onset hearing loss. The p.C162Y mutation causes either disruption of LCCL domain fragment cleavage or aggregation of mutant cochlin, resulting in the different phenotypes in the two families.This study demonstrates that DFNA9 families with the same genotype may have significantly different phenotypes. The mutation site in cochlin is related to the pathological mechanism underlying the different phenotypes.

  16. Human Factors Engineering (HFE) insights for advanced reactors based upon operating experience

    International Nuclear Information System (INIS)

    Higgins, J.; Nasta, K.

    1997-01-01

    The NRC Human Factors Engineering Program Review Model (HFE PRM, NUREG-0711) was developed to support a design process review for advanced reactor design certification under 10CFR52. The HFE PRM defines ten fundamental elements of a human factors engineering program. An Operating Experience Review (OER) is one of these elements. The main purpose of an OER is to identify potential safety issues from operating plant experience and ensure that they are addressed in a new design. Broad-based experience reviews have typically been performed in the past by reactor designers. For the HFE PRM the intent is to have a more focussed OER that concentrates on HFE issues or experience that would be relevant to the human-system interface (HSI) design process for new advanced reactors. This document provides a detailed list of HFE-relevant operating experience pertinent to the HSI design process for advanced nuclear power plants. This document is intended to be used by NRC reviewers as part of the HFE PRM review process in determining the completeness of an OER performed by an applicant for advanced reactor design certification. 49 refs

  17. Hepcidin regulation in wild-type and Hfe knockout mice in response to alcohol consumption: evidence for an alcohol-induced hypoxic response.

    Science.gov (United States)

    Heritage, Mandy L; Murphy, Therese L; Bridle, Kim R; Anderson, Gregory J; Crawford, Darrell H G; Fletcher, Linda M

    2009-08-01

    Expression of Hamp1, the gene encoding the iron regulatory peptide hepcidin, is inappropriately low in HFE-associated hereditary hemochromatosis and Hfe knockout mice (Hfe(-/-)). Since chronic alcohol consumption is also associated with disturbances in iron metabolism, we investigated the effects of alcohol consumption on hepcidin mRNA expression in Hfe(-/-) mice. Hfe(-/-) and C57BL/6 (wild-type) mice were pair-fed either an alcohol liquid diet or control diet for up to 8 weeks. The mRNA levels of hepcidin and ferroportin were measured at the mRNA level by RT-PCR and protein expression of hypoxia inducible factor-1 alpha (HIF-1alpha) was measured by western blot. Hamp1 mRNA expression was significantly decreased and duodenal ferroportin expression was increased in alcohol-fed wild-type mice at 8 weeks. Time course experiments showed that the decrease in hepcidin mRNA was not immediate, but was significant by 4 weeks. Consistent with the genetic defect, Hamp1 mRNA was decreased and duodenal ferroportin mRNA expression was increased in Hfe(-/-) mice fed on the control diet compared with wild-type animals and alcohol further exacerbated these effects. HIF-1alpha protein levels were elevated in alcohol-fed wild-type animals compared with controls. Alcohol may decrease Hamp1 gene expression independently of the HFE pathway possibly via alcohol-induced hypoxia.

  18. Morbidity and mortality in first-degree relatives of C282Y homozygous probands with clinically detected haemochromatosis compared with the general population: the HEmochromatosis FAmily Study (HEFAS).

    NARCIS (Netherlands)

    Jacobs, E.M.G.; Hendriks, J.C.M.; Marx, J.J.M.; Deursen, C.T. van; Kreeftenberg, H.G.; Vries, R.A. de; Stalenhoef, A.F.H.; Verbeek, A.L.M.; Swinkels, D.W.

    2007-01-01

    BACKGROUND: Family screening has been suggested as a sophisticated model for the early detection of HFE-related hereditary haemochromatosis (HH). However, until now, controlled studies on the morbidity and mortality in families with HH are lacking. METHODS: Data on iron parameters, morbidity and

  19. The role of HFE genotype in macrophage phenotype.

    Science.gov (United States)

    Nixon, Anne M; Neely, Elizabeth; Simpson, Ian A; Connor, James R

    2018-02-01

    Iron regulation is essential for cellular energy production. Loss of cellular iron homeostasis has critical implications for both normal function and disease progression. The H63D variant of the HFE gene is the most common gene variant in Caucasians. The resulting mutant protein alters cellular iron homeostasis and is associated with a number of neurological diseases and cancer. In the brain, microglial and infiltrating macrophages are critical to maintaining iron homeostasis and modulating inflammation associated with the pathogenic process in multiple diseases. This study addresses whether HFE genotype affects macrophage function and the implications of these findings for disease processes. Bone marrow macrophages were isolated from wildtype and H67D HFE knock-in mice. The H67D gene variant in mice is the human equivalent of the H63D variant. Upon differentiation, the macrophages were used to analyze iron regulatory proteins, cellular iron release, migration, phagocytosis, and cytokine expression. The results of this study demonstrate that the H67D HFE genotype significantly impacts a number of critical macrophage functions. Specifically, fundamental activities such as proliferation in response to iron exposure, L-ferritin expression in response to iron loading, secretion of BMP6 and cytokines, and migration and phagocytic activity were all found to be impacted by genotype. Furthermore, we demonstrated that exposure to apo-Tf (iron-poor transferrin) can increase the release of iron from macrophages. In normal conditions, 70% of circulating transferrin is unsaturated. Therefore, the ability of apo-Tf to induce iron release could be a major regulatory mechanism for iron release from macrophages. These studies demonstrate that the HFE genotype impacts fundamental components of macrophage phenotype that could alter their role in degenerative and reparative processes in neurodegenerative disorders.

  20. [Mutation analysis of the PAH gene in children with phenylketonuria from the Qinghai area of China].

    Science.gov (United States)

    He, Jiang; Wang, Hui-Zhen; Xu, Fa-Liang; Yang, Xi; Wang, Rui; Zou, Hong-Yun; Yu, Wu-Zhong

    2015-11-01

    To study the mutation characteristics of the phenylalanine hydroxylase (PAH) gene in children with phenylketonuria (PKU) from the Qinghai area of China, in order to provide basic information for genetic counseling and prenatal diagnosis. Mutations of the PAH gene were detected in the promoter and exons 1-13 and their flanking intronic sequences of PAH gene by PCR and DNA sequencing in 49 children with PKU and their parents from the Qinghai area of China. A total of 30 different mutations were detected in 80 out of 98 mutant alleles (82%), including 19 missense (63%), 5 nonsense (17%), 3 splice-site (10%) and 3 deletions (10%). Most mutations were detected in exons 3, 6, 7, 11 and intron 4 of PAH gene. The most frequent mutations were p.R243Q (19%), IVS4-1G>A (9%), p.Y356X (7%) and p.EX6-96A>G(5%). Two novel mutations p.N93fsX5 (c.279-282delCATC) and p.G171E (c.512G>A) were found. p.H64fsX9(c.190delC) was documented for the second time in Chinese PAH gene. The mutation spectrum of the gene PAH in the Qinghai population was similar to that in other populations in North China while significantly different from that in the populations from some provinces in southern China, Japan and Europe. The mutations of PAH gene in the Qinghai area of China demonstrate a unique diversity, complexity and specificity.

  1. Effect of Hfe Deficiency on Memory Capacity and Motor Coordination after Manganese Exposure by Drinking Water in Mice.

    Science.gov (United States)

    Alsulimani, Helal Hussain; Ye, Qi; Kim, Jonghan

    2015-12-01

    Excess manganese (Mn) is neurotoxic. Increased manganese stores in the brain are associated with a number of behavioral problems, including motor dysfunction, memory loss and psychiatric disorders. We previously showed that the transport and neurotoxicity of manganese after intranasal instillation of the metal are altered in Hfe-deficient mice, a mouse model of the iron overload disorder hereditary hemochromatosis (HH). However, it is not fully understood whether loss of Hfe function modifies Mn neurotoxicity after ingestion. To investigate the role of Hfe in oral Mn toxicity, we exposed Hfe-knockout (Hfe (-/-)) and their control wild-type (Hfe (+/+)) mice to MnCl2 in drinking water (5 mg/mL) for 5 weeks. Motor coordination and spatial memory capacity were determined by the rotarod test and the Barnes maze test, respectively. Brain and liver metal levels were analyzed by inductively coupled plasma mass spectrometry. Compared with the water-drinking group, mice drinking Mn significantly increased Mn concentrations in the liver and brain of both genotypes. Mn exposure decreased iron levels in the liver, but not in the brain. Neither Mn nor Hfe deficiency altered tissue concentrations of copper or zinc. The rotarod test showed that Mn exposure decreased motor skills in Hfe (+/+) mice, but not in Hfe (-/-) mice (p = 0.023). In the Barns maze test, latency to find the target hole was not altered in Mn-exposed Hfe (+/+) compared with water-drinking Hfe (+/+) mice. However, Mn-exposed Hfe (-/-) mice spent more time to find the target hole than Mn-drinking Hfe (+/+) mice (p = 0.028). These data indicate that loss of Hfe function impairs spatial memory upon Mn exposure in drinking water. Our results suggest that individuals with hemochromatosis could be more vulnerable to memory deficits induced by Mn ingestion from our environment. The pathophysiological role of HFE in manganese neurotoxicity should be carefully examined in patients with HFE-associated hemochromatosis and

  2. Determining Y-STR mutation rates in deep-routing genealogies: Identification of haplogroup differences.

    Science.gov (United States)

    Claerhout, Sofie; Vandenbosch, Michiel; Nivelle, Kelly; Gruyters, Leen; Peeters, Anke; Larmuseau, Maarten H D; Decorte, Ronny

    2018-05-01

    Knowledge of Y-chromosomal short tandem repeat (Y-STR) mutation rates is essential to determine the most recent common ancestor (MRCA) in familial searching or genealogy research. Up to now, locus-specific mutation rates have been extensively examined especially for commercially available forensic Y-STRs, while haplogroup specific mutation rates have not yet been investigated in detail. Through 450 patrilineally related namesakes distributed over 212 deep-rooting genealogies, the individual mutation rates of 42 Y-STR loci were determined, including 27 forensic Y-STR loci from the Yfiler ® Plus kit and 15 additional Y-STR loci (DYS388, DYS426, DYS442, DYS447, DYS454, DYS455, DYS459a/b, DYS549, DYS607, DYS643, DYS724a/b and YCAIIa/b). At least 726 mutations were observed over 148,596 meiosis and individual Y-STR mutation rates varied from 2.83 × 10 -4 to 1.86 × 10 -2 . The mutation rate was significantly correlated with the average allele size, the complexity of the repeat motif sequence and the age of the father. Significant differences in average Y-STR mutations rates were observed when haplogroup 'I & J' (4.03 × 10 -3 mutations/generation) was compared to 'R1b' (5.35 × 10 -3 mutations/generation) and to the overall mutation rate (5.03 × 10 -3 mutations/generation). A difference in allele size distribution was identified as the only cause for these haplogroup specific mutation rates. The haplogroup specific mutation rates were also present within the commercially available Y-STR kits (Yfiler ® , PowerPlex ® Y23 System and Yfiler ® Plus). This observation has consequences for applications where an average Y-STR mutation rate is used, e.g. tMRCA estimations in familial searching and genealogy research. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Factors affecting the appreciation generated through applying human factors/ergonomics (HFE) principles to systems of work.

    Science.gov (United States)

    So, R H Y; Lam, S T

    2014-01-01

    This retrospective study examined the levels of appreciation (applause) given by clients to Human Factors/Ergonomic (HFE) specialists after they have modified the systems of work. Thirteen non-academic projects were chosen because the HFE interventions involved changed the way workers work at their workplaces. Companies involved range from multi-national corporations and military organizations with thousands of employees to small trading companies with less than 10 employees. In 5 cases the HFE recommendations were fully adopted and well appreciated. In 4 they were largely ignored and not appreciated, with partial adoption and some appreciation in the other 4 cases. Three factors that predict appreciation were identified: (i) alignment between the benefits HFE can provide and the project's key performance indices; (ii) awareness of HFE among the client's senior management; and (iii) a team organization appropriate for applying HFE recommendations. Having an HFE specialist on the client's side can greatly increase levels of appreciation, but lack of such a specialist will not affect levels of appreciation. A clear contractual requirement for HFE intervention does not promote appreciation significantly, but its absence can greatly reduce levels of appreciation. These relationships are discussed using the Kano's model of quality. Means to generate greater appreciation of the benefits of HFE are discussed. Copyright © 2013 Elsevier Ltd and The Ergonomics Society. All rights reserved.

  4. Trends in HFE Methods and Tools and Their Applicability to Safety Reviews

    Energy Technology Data Exchange (ETDEWEB)

    O' Hara, J.M.; Plott, C.; Milanski, J.; Ronan, A.; Scheff, S.; Laux, L.; and Bzostek, J.

    2009-09-30

    The U.S. Nuclear Regulatory Commission's (NRC) conducts human factors engineering (HFE) safety reviews of applicant submittals for new plants and for changes to existing plants. The reviews include the evaluation of the methods and tools (M&T) used by applicants as part of their HFE program. The technology used to perform HFE activities has been rapidly evolving, resulting in a whole new generation of HFE M&Ts. The objectives of this research were to identify the current trends in HFE methods and tools, determine their applicability to NRC safety reviews, and identify topics for which the NRC may need additional guidance to support the NRC's safety reviews. We conducted a survey that identified over 100 new HFE M&Ts. The M&Ts were assessed to identify general trends. Seven trends were identified: Computer Applications for Performing Traditional Analyses, Computer-Aided Design, Integration of HFE Methods and Tools, Rapid Development Engineering, Analysis of Cognitive Tasks, Use of Virtual Environments and Visualizations, and Application of Human Performance Models. We assessed each trend to determine its applicability to the NRC's review by considering (1) whether the nuclear industry is making use of M&Ts for each trend, and (2) whether M&Ts reflecting the trend can be reviewed using the current design review guidance. We concluded that M&T trends that are applicable to the commercial nuclear industry and are expected to impact safety reviews may be considered for review guidance development. Three trends fell into this category: Analysis of Cognitive Tasks, Use of Virtual Environments and Visualizations, and Application of Human Performance Models. The other trends do not need to be addressed at this time.

  5. Trends in HFE Methods and Tools and Their Applicability to Safety Reviews

    International Nuclear Information System (INIS)

    O'Hara, J.M.; Plott, C.; Milanski, J.; Ronan, A.; Scheff, S.; Laux, L.; Bzostek, J.

    2009-01-01

    The U.S. Nuclear Regulatory Commission's (NRC) conducts human factors engineering (HFE) safety reviews of applicant submittals for new plants and for changes to existing plants. The reviews include the evaluation of the methods and tools (M and T) used by applicants as part of their HFE program. The technology used to perform HFE activities has been rapidly evolving, resulting in a whole new generation of HFE M and Ts. The objectives of this research were to identify the current trends in HFE methods and tools, determine their applicability to NRC safety reviews, and identify topics for which the NRC may need additional guidance to support the NRC's safety reviews. We conducted a survey that identified over 100 new HFE M and Ts. The M and Ts were assessed to identify general trends. Seven trends were identified: Computer Applications for Performing Traditional Analyses, Computer-Aided Design, Integration of HFE Methods and Tools, Rapid Development Engineering, Analysis of Cognitive Tasks, Use of Virtual Environments and Visualizations, and Application of Human Performance Models. We assessed each trend to determine its applicability to the NRC's review by considering (1) whether the nuclear industry is making use of M and Ts for each trend, and (2) whether M and Ts reflecting the trend can be reviewed using the current design review guidance. We concluded that M and T trends that are applicable to the commercial nuclear industry and are expected to impact safety reviews may be considered for review guidance development. Three trends fell into this category: Analysis of Cognitive Tasks, Use of Virtual Environments and Visualizations, and Application of Human Performance Models. The other trends do not need to be addressed at this time.

  6. HFE mRNA expression is responsive to intracellular and extracellular iron loading: short communication.

    Science.gov (United States)

    Mehta, Kosha J; Farnaud, Sebastien; Patel, Vinood B

    2017-10-01

    In liver hepatocytes, the HFE gene regulates cellular and systemic iron homeostasis by modulating cellular iron-uptake and producing the iron-hormone hepcidin in response to systemic iron elevation. However, the mechanism of iron-sensing in hepatocytes remain enigmatic. Therefore, to study the effect of iron on HFE and hepcidin (HAMP) expressions under distinct extracellular and intracellular iron-loading, we examined the effect of holotransferrin treatment (1, 2, 5 and 8 g/L for 6 h) on intracellular iron levels, and mRNA expressions of HFE and HAMP in wild-type HepG2 and previously characterized iron-loaded recombinant-TfR1 HepG2 cells. Gene expression was analyzed by real-time PCR and intracellular iron was measured by ferrozine assay. Data showed that in the wild-type cells, where intracellular iron content remained unchanged, HFE expression remained unaltered at low holotransferrin treatments but was upregulated upon 5 g/L (p HFE and HAMP expressions were elevated only at low 1 g/L treatment (p HFE (p HFE mRNA was independently elevated by extracellular and intracellular iron-excess. Thus, it may be involved in sensing both, extracellular and intracellular iron. Repression of HAMP expression under simultaneous intracellular and extracellular iron-loading resembles non-hereditary iron-excess pathologies.

  7. Leber's hereditary optic neuropathy is associated with mitochondrial ND1 T3394C mutation

    International Nuclear Information System (INIS)

    Liang, Min; Guan, Minqiang; Zhao, Fuxing; Zhou, Xiangtian; Yuan, Meixia; Tong, Yi; Yang, Li; Wei, Qi-Ping; Sun, Yan-Hong; Lu, Fan; Qu, Jia

    2009-01-01

    We report here the clinical, genetic and molecular characterization of four Chinese families with Leber's hereditary optic neuropathy (LHON). There were variable severity and age-of-onset in visual impairment among these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of complete mitochondrial genomes in these pedigrees showed the homoplasmic T3394C (Y30H) mutation, which localized at a highly conserved tyrosine at position 30 of ND1, and distinct sets of mtDNA polymorphisms belonging to haplogroups D4b and M9a. The occurrence of T3394C mutation in these several genetically unrelated subjects affected by visual impairment strongly indicates that this mutation is involved in the pathogenesis of visual impairment. However, there was the absence of functionally significant mtDNA mutations in these four Chinese pedigrees carrying the T3394C mutation. Therefore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic expression of the LHON-associated T3394C mutation.

  8. Analysis of MYO7A in a Moroccan family with Usher syndrome type 1B: novel loss-of-function mutation and non-pathogenicity of p.Y1719C.

    Science.gov (United States)

    Boulouiz, Redouane; Li, Yun; Abidi, Omar; Bolz, Hanno; Chafik, Abdelaziz; Kubisch, Christian; Roub, Hassan; Wollnik, Bernd; Barakat, Abdelhamid

    2007-10-02

    Mutations in the MYO7A gene are responsible for Usher syndrome type 1B (USH1B), the most common USH1 subtype, which accounts for the largest proportion of USH1 cases in most populations. Molecular genetic diagnosis in Usher syndrome is well established and identification of the underlying mutations in Usher patients is important for confirmation of the clinical diagnosis and genetic counseling. We analyzed a large consanguineous USH1 family from Morocco and linked the disease in this family to the MYO7A/USH1B locus. We identified the frequently described missense change p.Y1719C. In addition, we found the homozygous c.1687G>A mutation in the last nucleotide of exon 14, which is predicted to result in aberrant splicing and may lead to loss of MYO7A transcript. We further showed that p.Y1719C is not disease-causing but does represent a frequent polymorphism in the Moroccan population, with an estimated carrier frequency of 0.07. This finding has an important impact for molecular diagnosis and genetic counseling in USH1B families.

  9. Reduction of body iron in HFE-related haemochromatosis and moderate iron overload (Mi-Iron): a multicentre, participant-blinded, randomised controlled trial.

    Science.gov (United States)

    Ong, Sim Y; Gurrin, Lyle C; Dolling, Lara; Dixon, Jeanette; Nicoll, Amanda J; Wolthuizen, Michelle; Wood, Erica M; Anderson, Gregory J; Ramm, Grant A; Allen, Katrina J; Olynyk, John K; Crawford, Darrell; Ramm, Louise E; Gow, Paul; Durrant, Simon; Powell, Lawrie W; Delatycki, Martin B

    2017-12-01

    The iron overload disorder hereditary haemochromatosis is most commonly caused by HFE p.Cys282Tyr homozygosity. In the absence of results from any randomised trials, current evidence is insufficient to determine whether individuals with hereditary haemochromatosis and moderately elevated serum ferritin, should undergo iron reduction treatment. This trial aimed to establish whether serum ferritin normalisation in this population improved symptoms and surrogate biomarkers. This study was a multicentre, participant-blinded, randomised controlled trial done at three centres in Australia. We enrolled people who were homozygous for HFE p.Cys282Tyr, aged between 18 and 70 years, with moderately elevated serum ferritin, defined as 300-1000 μg/L, and raised transferrin saturation. Participants were randomly assigned, via a computer-generated random number, to undergo either iron reduction by erythrocytapheresis (treatment group) or sham treatment by plasmapheresis (control group). Randomisation was stratified by baseline serum ferritin (cognitive subcomponent (-3·6, -5·9 to -1·3, p=0·0030), but not in the physical (-1·90 -4·5 to 0·63, p=0·14) and psychosocial (-0·54, -1·2 to 0·11, p=0·10) subcomponents. No serious adverse events occurred in either group. One participant in the control group had a vasovagal event and 17 participants (14 in the treatment group and three in the control group) had transient symptoms assessed as related to hypovolaemia. Mild citrate reactions were more common in the treatment group (32 events [25%] in 129 procedures) compared with the control group (one event [1%] in 93 procedures). To our knowledge, this study is the first to objectively assess the consequences of iron removal in individuals with hereditary haemochromatosis and moderately elevated serum ferritin. Our results suggest that serum ferritin normalisation by iron depletion could be of benefit for all individuals with hereditary haemochromatosis and elevated serum

  10. 18 CFR 284.282 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Definitions. 284.282 Section 284.282 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT... Blanket Certificates Authorizing Certain Natural Gas Sales by Interstate Pipelines § 284.282 Definitions...

  11. Autosomal dominant hypocalcemia with Bartter syndrome due to a novel activating mutation of calcium sensing receptor, Y829C.

    Science.gov (United States)

    Choi, Keun Hee; Shin, Choong Ho; Yang, Sei Won; Cheong, Hae Il

    2015-04-01

    The calcium sensing receptor (CaSR) plays an important role in calcium homeostasis. Activating mutations of CaSR cause autosomal dominant hypocalcemia by affecting parathyroid hormone secretion in parathyroid gland and calcium resorption in kidney. They can also cause a type 5 Bartter syndrome by inhibiting the apical potassium channel in the thick ascending limb of the loop of Henle in the kidney. This study presents a patient who had autosomal dominant hypocalcemia with Bartter syndrome due to an activating mutation Y829C in the transmembrane domain of the CaSR. Symptoms of hypocalcemia occurred 12 days after birth and medication was started immediately. Medullary nephrocalcinosis and basal ganglia calcification were found at 7 years old and at 17 years old. Three hypercalcemic episodes occurred, one at 14 years old and two at 17 years old. The Bartter syndrome was not severe while the serum calcium concentration was controlled, but during hypercalcemic periods, the symptoms of Bartter syndrome were aggravated.

  12. 30 CFR 282.3 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... from such activity. Contingency Plan means a plan for action to be taken in emergency situations. Data... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Definitions. 282.3 Section 282.3 Mineral... CONTINENTAL SHELF FOR MINERALS OTHER THAN OIL, GAS, AND SULPHUR General § 282.3 Definitions. When used in this...

  13. Comprehensive Genomic Profiling of 282 Pediatric Low- and High-Grade Gliomas Reveals Genomic Drivers, Tumor Mutational Burden, and Hypermutation Signatures.

    Science.gov (United States)

    Johnson, Adrienne; Severson, Eric; Gay, Laurie; Vergilio, Jo-Anne; Elvin, Julia; Suh, James; Daniel, Sugganth; Covert, Mandy; Frampton, Garrett M; Hsu, Sigmund; Lesser, Glenn J; Stogner-Underwood, Kimberly; Mott, Ryan T; Rush, Sarah Z; Stanke, Jennifer J; Dahiya, Sonika; Sun, James; Reddy, Prasanth; Chalmers, Zachary R; Erlich, Rachel; Chudnovsky, Yakov; Fabrizio, David; Schrock, Alexa B; Ali, Siraj; Miller, Vincent; Stephens, Philip J; Ross, Jeffrey; Crawford, John R; Ramkissoon, Shakti H

    2017-12-01

    Pediatric brain tumors are the leading cause of death for children with cancer in the U.S. Incorporating next-generation sequencing data for both pediatric low-grade (pLGGs) and high-grade gliomas (pHGGs) can inform diagnostic, prognostic, and therapeutic decision-making. We performed comprehensive genomic profiling on 282 pediatric gliomas (157 pHGGs, 125 pLGGs), sequencing 315 cancer-related genes and calculating the tumor mutational burden (TMB; mutations per megabase [Mb]). In pLGGs, we detected genomic alterations (GA) in 95.2% (119/125) of tumors. BRAF was most frequently altered (48%; 60/125), and FGFR1 missense (17.6%; 22/125), NF1 loss of function (8.8%; 11/125), and TP53 (5.6%; 7/125) mutations were also detected. Rearrangements were identified in 35% of pLGGs, including KIAA1549-BRAF , QKI-RAF1 , FGFR3-TACC3 , CEP85L-ROS1 , and GOPC-ROS1 fusions. Among pHGGs, GA were identified in 96.8% (152/157). The genes most frequently mutated were TP53 (49%; 77/157), H3F3A (37.6%; 59/157), ATRX (24.2%; 38/157), NF1 (22.2%; 35/157), and PDGFRA (21.7%; 34/157). Interestingly, most H3F3A mutations (81.4%; 35/43) were the variant K28M. Midline tumor analysis revealed H3F3A mutations (40%; 40/100) consisted solely of the K28M variant. Pediatric high-grade gliomas harbored oncogenic EML4-ALK , DGKB-ETV1 , ATG7-RAF1 , and EWSR1-PATZ1 fusions. Six percent (9/157) of pHGGs were hypermutated (TMB >20 mutations per Mb; range 43-581 mutations per Mb), harboring mutations deleterious for DNA repair in MSH6, MSH2, MLH1, PMS2, POLE , and POLD1 genes (78% of cases). Comprehensive genomic profiling of pediatric gliomas provides objective data that promote diagnostic accuracy and enhance clinical decision-making. Additionally, TMB could be a biomarker to identify pediatric glioblastoma (GBM) patients who may benefit from immunotherapy. By providing objective data to support diagnostic, prognostic, and therapeutic decision-making, comprehensive genomic profiling is necessary for

  14. Mutation rates at 42 Y chromosomal short tandem repeats in Chinese Han population in Eastern China.

    Science.gov (United States)

    Wu, Weiwei; Ren, Wenyan; Hao, Honglei; Nan, Hailun; He, Xin; Liu, Qiuling; Lu, Dejian

    2018-01-31

    Mutation analysis of 42 Y chromosomal short tandem repeats (Y-STRs) loci was performed using a sample of 1160 father-son pairs from the Chinese Han population in Eastern China. The results showed that the average mutation rate across the 42 Y-STR loci was 0.0041 (95% CI 0.0036-0.0047) per locus per generation. The locus-specific mutation rates varied from 0.000 to 0.0190. No mutation was found at DYS388, DYS437, DYS448, DYS531, and GATA_H4. DYS627, DYS570, DYS576, and DYS449 could be classified as rapidly mutating Y-STRs, with mutation rates higher than 1.0 × 10 -2 . DYS458, DYS630, and DYS518 were moderately mutating Y-STRs, with mutation rates ranging from 8 × 10 -3 to 1 × 10 -2 . Although the characteristics of the Y-STR mutations were consistent with those in previous studies, mutation rate differences between our data and previous published data were found at some rapidly mutating Y-STRs. The single-copy loci located on the short arm of the Y chromosome (Yp) showed relatively higher mutation rates more frequently than the multi-copy loci. These results will not only extend the data for Y-STR mutations but also be important for kinship analysis, paternal lineage identification, and family relationship reconstruction in forensic Y-STR analysis.

  15. Novel gene PUS3 c.A212G mutation in Ukrainian family with intellectual disability

    Directory of Open Access Journals (Sweden)

    Gulkovskyi R. V.

    2015-04-01

    Full Text Available Aim. To evaluate a possible role of a novel c.A212G substitution in the PUS3 gene at intellectual disability (ID. Methods. The observed group consisted of the ID Ukrainian family members (parents and two affected children and the control group – of 300 healthy individuals from general population of Ukraine. Sanger sequencing of the PUS3 gene exon 1 was performed for the family members. Polymorphic variants of c.A212G were analyzed using ARMS PCR. The homology models of wild type and p.Y71C mutant catalytic domains of human Pus3 were generated using the crystal structure of the human Pus1 catalytic domain (PDB ID: 4NZ6 as a template. Results. It was shown that the father of the affected siblings was the c.A212G substitution heterozygous carrier whereas the mother was a wild type allele homozygote, and the exom sequencing result was confirmed – the affected children are 212G homozygotes. We supposed de novo mutation in the maternal germ line. A low frequency of 212G allele (0.0017 was shown in the population of Ukraine. Homology modelling of the wild type and p.Y71C mutant catalytic domain of human Pus3 revealed that substitution p.Y71C is located in close proximity to its active site. Conclusions. The absence of hypoproteinemia in our patients, homozygous for the 212C allele allows us to assume that the mutation c.A212G PUS3 is rather neutral and cannot be the major cause of ID. However, considering a low frequency of the 212G allele in the population and close localization of p.Y71C substitution to the active site of hPus3 we cannot exclude that the c.A212G mutation in PUS3 may be a modifier for some pathologies including syndromic ID.

  16. Stability enhancement of cytochrome c through heme deprotonation and mutations.

    Science.gov (United States)

    Sonoyama, Takafumi; Hasegawa, Jun; Uchiyama, Susumu; Nakamura, Shota; Kobayashi, Yuji; Sambongi, Yoshihiro

    2009-01-01

    The chemical denaturation of Pseudomonas aeruginosa cytochrome c(551) variants was examined at pH 5.0 and 3.6. All variants were stabilized at both pHs compared with the wild-type. Remarkably, the variants carrying the F34Y and/or E43Y mutations were more stabilized than those having the F7A/V13M or V78I ones at pH 5.0 compared with at pH 3.6 by ~3.0-4.6 kJ/mol. Structural analyses predicted that the side chains of introduced Tyr-34 and Tyr-43 become hydrogen donors for the hydrogen bond formation with heme 17-propionate at pH 5.0, but less efficiently at pH 3.6, because the propionate is deprotonated at the higher pH. Our results provide an insight into a stabilization strategy for heme proteins involving variation of the heme electronic state and introduction of appropriate mutations.

  17. Brain transcriptome perturbations in the Hfe(-/-) mouse model of genetic iron loading.

    Science.gov (United States)

    Johnstone, Daniel; Graham, Ross M; Trinder, Debbie; Delima, Roheeth D; Riveros, Carlos; Olynyk, John K; Scott, Rodney J; Moscato, Pablo; Milward, Elizabeth A

    2012-04-11

    Severe disruption of brain iron homeostasis can cause fatal neurodegenerative disease, however debate surrounds the neurologic effects of milder, more common iron loading disorders such as hereditary hemochromatosis, which is usually caused by loss-of-function polymorphisms in the HFE gene. There is evidence from both human and animal studies that HFE gene variants may affect brain function and modify risks of brain disease. To investigate how disruption of HFE influences brain transcript levels, we used microarray and real-time reverse transcription polymerase chain reaction to assess the brain transcriptome in Hfe(-/-) mice relative to wildtype AKR controls (age 10 weeks, n≥4/group). The Hfe(-/-) mouse brain showed numerous significant changes in transcript levels (pgenes relating to transcriptional regulation (FBJ osteosarcoma oncogene Fos, early growth response genes), neurotransmission (glutamate NMDA receptor Grin1, GABA receptor Gabbr1) and synaptic plasticity and memory (calcium/calmodulin-dependent protein kinase IIα Camk2a). As previously reported for dietary iron-supplemented mice, there were altered levels of transcripts for genes linked to neuronal ceroid lipofuscinosis, a disease characterized by excessive lipofuscin deposition. Labile iron is known to enhance lipofuscin generation which may accelerate brain aging. The findings provide evidence that iron loading disorders can considerably perturb levels of transcripts for genes essential for normal brain function and may help explain some of the neurologic signs and symptoms reported in hemochromatosis patients. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Leber's hereditary optic neuropathy is associated with mitochondrial ND1 T3394C mutation

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Min [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Guan, Minqiang [Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Zhao, Fuxing; Zhou, Xiangtian [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Yuan, Meixia [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Tong, Yi [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); The First Affiliated Hospital, Fujian Medical University, Fuzhou, Fujian 350005 (China); Yang, Li [Division of Human Genetics, Cincinnati Children' s Hospital Medical Center, 3333 Burnet Avenue, Cincinnati, OH 45229 (United States); Wei, Qi-Ping; Sun, Yan-Hong [Department of Ophthalmology, Dongfang Hospital, Beijing University of Chinese Medicine and Pharmacology, Beijing 100078 (China); Lu, Fan [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Qu, Jia, E-mail: jqu@wzmc.net [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); and others

    2009-06-05

    We report here the clinical, genetic and molecular characterization of four Chinese families with Leber's hereditary optic neuropathy (LHON). There were variable severity and age-of-onset in visual impairment among these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of complete mitochondrial genomes in these pedigrees showed the homoplasmic T3394C (Y30H) mutation, which localized at a highly conserved tyrosine at position 30 of ND1, and distinct sets of mtDNA polymorphisms belonging to haplogroups D4b and M9a. The occurrence of T3394C mutation in these several genetically unrelated subjects affected by visual impairment strongly indicates that this mutation is involved in the pathogenesis of visual impairment. However, there was the absence of functionally significant mtDNA mutations in these four Chinese pedigrees carrying the T3394C mutation. Therefore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic expression of the LHON-associated T3394C mutation.

  19. The Hereditary Hyperferritinemia-Cataract Syndrome in 2 Italian Families

    Directory of Open Access Journals (Sweden)

    Katia Perruccio

    2013-01-01

    Full Text Available Two 8- and 9-year-old brothers were referred to the Pediatric Oncology Unit, Perugia General Hospital, because of hyperferritinemia. Both had a history of bilateral cataract and epilepsy. Genetic investigation revealed two distinct mutations in iron haemostasis genes; homozygosity for the HFE gene H63D mutation in the younger and heterozygosity in the elder. Both displayed heterozygosity for C33T mutation in the ferritin light chain iron response element. A 7-year-old boy from another family was referred to our unit because of hyperferritinemia. Genetic analyses did not reveal HFE gene mutations. Family history showed that his mother was also affected by hyperferritinemia without HFE gene mutations. Magnetic resonance imaging in the mother was positive for iron overload in the spleen. Cataract was diagnosed in mother and child. Further genetic investigation revealed the C29G mutation of the ferritin light chain iron response element. C33T and C29G mutations in the ferritin light chain iron response element underlie the Hereditary Hyperferritinemia-Cataract Syndrome (HHCS. The HFE gene H63D mutation underlies Hereditary Haemochromatosis (HH, which needs treatment to prevent organ damages by iron overload. HHCS was definitively diagnosed in all three children. HHCS is an autosomal dominant disease characterized by increased L-ferritin production. L-Ferritin aggregates accumulate preferentially in the lens, provoking bilateral cataract since childhood, as unique known organ damage. Epilepsy in one case and the spleen iron overload in another could suggest the misleading diagnosis of HH. Consequently, the differential diagnosis between alterations of iron storage system was essential, particularly in children, and required further genetic investigation.

  20. Normosmic idiopathic hypogonadotropic hypogonadism due to a novel homozygous nonsense c.C969A (p.Y323X) mutation in the KISS1R gene in three unrelated families.

    Science.gov (United States)

    Demirbilek, Huseyin; Ozbek, M Nuri; Demir, Korcan; Kotan, L Damla; Cesur, Yasar; Dogan, Murat; Temiz, Fatih; Mengen, Eda; Gurbuz, Fatih; Yuksel, Bilgin; Topaloglu, A Kemal

    2015-03-01

    The spectrum of genetic alterations in cases of hypogonadotropic hypogonadism continue to expand. However, KISS1R mutations remain rare. The aim of this study was to understand the molecular basis of normosmic idiopathic hypogonadotropic hypogonadism. Clinical characteristics, hormonal studies and genetic analyses of seven cases with idiopathic normosmic hypogonadotropic hypogonadism (nIHH) from three unrelated consanguineous families are presented. One male presented with absence of pubertal onset and required surgery for severe penoscrotal hypospadias and cryptorchidism, while other two males had absence of pubertal onset. Two of four female cases required replacement therapy for pubertal onset and maintenance, whereas the other two had spontaneous pubertal onset but incomplete maturation. In sequence analysis, we identified a novel homozygous nonsense (p.Y323X) mutation (c.C969A) in the last exon of the KISS1R gene in all clinically affected cases. We identified a homozygous nonsense mutation in the KISS1R gene in three unrelated families with nIHH, which enabled us to observe the phenotypic consequences of this rare condition. Escape from nonsense-mediated decay, and thus production of abnormal proteins, may account for the variable severity of the phenotype. Although KISS1R mutations are extremely rare and can cause a heterogeneous phenotype, analysis of the KISS1R gene should be a part of genetic analysis of patients with nIHH, to allow better understanding of phenotype-genotype relationship of KISS1R mutations and the underlying genetic basis of patients with nIHH. © 2014 John Wiley & Sons Ltd.

  1. Differing impact of the deletion of hemochromatosis-associated molecules HFE and transferrin receptor-2 on the iron phenotype of mice lacking bone morphogenetic protein 6 or hemojuvelin.

    Science.gov (United States)

    Latour, Chloé; Besson-Fournier, Céline; Meynard, Delphine; Silvestri, Laura; Gourbeyre, Ophélie; Aguilar-Martinez, Patricia; Schmidt, Paul J; Fleming, Mark D; Roth, Marie-Paule; Coppin, Hélène

    2016-01-01

    Hereditary hemochromatosis, which is characterized by inappropriately low levels of hepcidin, increased dietary iron uptake, and systemic iron accumulation, has been associated with mutations in the HFE, transferrin receptor-2 (TfR2), and hemojuvelin (HJV) genes. However, it is still not clear whether these molecules intersect in vivo with bone morphogenetic protein 6 (BMP6)/mothers against decapentaplegic (SMAD) homolog signaling, the main pathway up-regulating hepcidin expression in response to elevated hepatic iron. To answer this question, we produced double knockout mice for Bmp6 and β2-microglobulin (a surrogate for the loss of Hfe) and for Bmp6 and Tfr2, and we compared their phenotype (hepcidin expression, Bmp/Smad signaling, hepatic and extrahepatic tissue iron accumulation) with that of single Bmp6-deficient mice and that of mice deficient for Hjv, alone or in combination with Hfe or Tfr2. Whereas the phenotype of Hjv-deficient females was not affected by loss of Hfe or Tfr2, that of Bmp6-deficient females was considerably worsened, with decreased Smad5 phosphorylation, compared with single Bmp6-deficient mice, further repression of hepcidin gene expression, undetectable serum hepcidin, and massive iron accumulation not only in the liver but also in the pancreas, the heart, and the kidneys. These results show that (1) BMP6 does not require HJV to transduce signal to hepcidin in response to intracellular iron, even if the loss of HJV partly reduces this signal, (2) another BMP ligand can replace BMP6 and significantly induce hepcidin expression in response to extracellular iron, and (3) BMP6 alone is as efficient at inducing hepcidin as the other BMPs in association with the HJV/HFE/TfR2 complex; they provide an explanation for the compensatory effect of BMP6 treatment on the molecular defect underlying Hfe hemochromatosis in mice. © 2015 by the American Association for the Study of Liver Diseases.

  2. A new mutation in WFS1 gene (C.1522-1523delTA, Y508fsX421) may be responsible for early appearance of clinical features of Wolfram syndrome and suicidal behaviour.

    Science.gov (United States)

    Aluclu, Mehmet Ufuk; Bahceci, Mithat; Tuzcu, Alpaslan; Arikan, Senay; Gokalp, Deniz

    2006-12-01

    Wolfram syndrome (WS) is an autosomal recessive disorder characterized by the association of juvenile-onset diabetes mellitus and optic atrophy. It is also known by the acronym DIDMOAD (diabetes insipidus, diabetes mellitus, optic atrophy, and deafness). We diagnosed Wolfram syndrome in 2 male siblings and determined a new mutation (c. 1522-1523delTA, Y508fsX421). Both affected siblings were homozygous, other family members were heterozygous. Dilated renal outflow tracts in the third decade, and neuropsychiatric disorders including bipolar disorder and neurosensorial deafness appear in the fourth decade in ordinary WS, whereas these features appeared in second decade in our patients. This mutation may be responsible for early appearance of dilated renal outflow tracts and multiple neurological abnormalities. Psychiatric disturbances such as suicide were reported at increased frequency in Wolfram patients and in heterozygous carriers. Suicidal behaviour occurred in our patients when they were yet 11 and 13 years old. Therefore, our findings may indicate that there may be a relationship between this WFS1 mutation and mood disorder such as suicidal behaviour. We determined a new mutation (c. 1522-1523delTA, Y508fsX421) in WS1 gene in 2 siblings with Wolfram syndrome. This mutation may be responsible for early appearance of clinical features of Wolfram syndrome, and there may be a relationship between this mutation and suicidal behaviour.

  3. Stability enhancement of cytochrome c through heme deprotonation and mutations

    OpenAIRE

    Sonoyama, Takafumi; Hasegawa, Jun; Uchiyama, Susumu; Nakamura, Shota; Kobayashi, Yuji; Sambongi, Yoshihiro

    2009-01-01

    The chemical denaturation of Pseudomonas aeruginosa cytochrome c551 variants was examined at pH 5.0 and 3.6. All variants were stabilized at both pHs compared with the wild-type. Remarkably, the variants carrying the F34Y and/or E43Y mutations were more stabilized than those having the F7A/V13M or V78I ones at pH 5.0 compared with at pH 3.6 by ~3.0 – 4.6 kJ/mol. Structural analyses predicted that the side chains of introduced Tyr-34 and Tyr-43 become hydrogen donors for the hydrogen bond form...

  4. Changes in the dynamics of the cardiac troponin C molecule explain the effects of Ca2+-sensitizing mutations.

    Science.gov (United States)

    Stevens, Charles M; Rayani, Kaveh; Singh, Gurpreet; Lotfalisalmasi, Bairam; Tieleman, D Peter; Tibbits, Glen F

    2017-07-14

    Cardiac troponin C (cTnC) is the regulatory protein that initiates cardiac contraction in response to Ca 2+ TnC binding Ca 2+ initiates a cascade of protein-protein interactions that begins with the opening of the N-terminal domain of cTnC, followed by cTnC binding the troponin I switch peptide (TnI SW ). We have evaluated, through isothermal titration calorimetry and molecular-dynamics simulation, the effect of several clinically relevant mutations (A8V, L29Q, A31S, L48Q, Q50R, and C84Y) on the Ca 2+ affinity, structural dynamics, and calculated interaction strengths between cTnC and each of Ca 2+ and TnI SW Surprisingly the Ca 2+ affinity measured by isothermal titration calorimetry was only significantly affected by half of these mutations including L48Q, which had a 10-fold higher affinity than WT, and the Q50R and C84Y mutants, each of which had affinities 3-fold higher than wild type. This suggests that Ca 2+ affinity of the N-terminal domain of cTnC in isolation is insufficient to explain the pathogenicity of these mutations. Molecular-dynamics simulation was used to evaluate the effects of these mutations on Ca 2+ binding, structural dynamics, and TnI interaction independently. Many of the mutations had a pronounced effect on the balance between the open and closed conformations of the TnC molecule, which provides an indirect mechanism for their pathogenic properties. Our data demonstrate that the structural dynamics of the cTnC molecule are key in determining myofilament Ca 2+ sensitivity. Our data further suggest that modulation of the structural dynamics is the underlying molecular mechanism for many disease mutations that are far from the regulatory Ca 2+ -binding site of cTnC. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. The hemochromatosis protein HFE 20 years later: An emerging role in antigen presentation and in the immune system.

    Science.gov (United States)

    Reuben, Alexandre; Chung, Jacqueline W; Lapointe, Réjean; Santos, Manuela M

    2017-09-01

    Since its discovery, the hemochromatosis protein HFE has been primarily defined by its role in iron metabolism and homeostasis, and its involvement in the genetic disease termed hereditary hemochromatosis (HH). While HH patients are typically afflicted by dysregulated iron levels, many are also affected by several immune defects and increased incidence of autoimmune diseases that have thereby implicated HFE in the immune response. Growing evidence has supported an immunological role for HFE with recent studies describing HFE specifically as it relates to MHC I antigen presentation. Here, we present a comprehensive overview of the relationship between iron metabolism, HFE, and the immune system to better understand the origin and cause of immune defects in HH patients. We further describe the role of HFE in MHC I antigen presentation and its potential to impair autoimmune responses in homeostatic conditions, a mechanism which may be exploited by tumors to evade immune surveillance. Overall, this increased understanding of the role of HFE in the immune response sets the stage for better treatment and management of HH and other iron-related diseases, as well as of the immune defects related to this condition. © 2017 The Authors. Immunity, Inflammation and Disease Published by John Wiley & Sons Ltd.

  6. 30 CFR 282.23 - Testing Plan.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Testing Plan. 282.23 Section 282.23 Mineral... § 282.23 Testing Plan. All testing activities shall be conducted in accordance with a Testing Plan... detailed Mining Plan than is obtainable under an approved Delineation Plan, to prepare feasibility studies...

  7. 30 CFR 282.22 - Delineation Plan.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Delineation Plan. 282.22 Section 282.22 Mineral... § 282.22 Delineation Plan. All exploration activities shall be conducted in accordance with a Delineation Plan submitted by the lessee and approved by the Director. The Delineation Plan shall describe the...

  8. Global transcriptional response to Hfe deficiency and dietary iron overload in mouse liver and duodenum.

    Directory of Open Access Journals (Sweden)

    Alejandra Rodriguez

    2009-09-01

    Full Text Available Iron is an essential trace element whose absorption is usually tightly regulated in the duodenum. HFE-related hereditary hemochromatosis (HH is characterized by abnormally low expression of the iron-regulatory hormone, hepcidin, which results in increased iron absorption. The liver is crucial for iron homeostasis as it is the main production site of hepcidin. The aim of this study was to explore and compare the genome-wide transcriptome response to Hfe deficiency and dietary iron overload in murine liver and duodenum. Illumina arrays containing over 47,000 probes were used to study global transcriptional changes. Quantitative RT-PCR (Q-RT-PCR was used to validate the microarray results. In the liver, the expression of 151 genes was altered in Hfe(-/- mice while dietary iron overload changed the expression of 218 genes. There were 173 and 108 differentially expressed genes in the duodenum of Hfe(-/- mice and mice with dietary iron overload, respectively. There was 93.5% concordance between the results obtained by microarray analysis and Q-RT-PCR. Overexpression of genes for acute phase reactants in the liver and a strong induction of digestive enzyme genes in the duodenum were characteristic of the Hfe-deficient genotype. In contrast, dietary iron overload caused a more pronounced change of gene expression responsive to oxidative stress. In conclusion, Hfe deficiency caused a previously unrecognized increase in gene expression of hepatic acute phase proteins and duodenal digestive enzymes.

  9. Y-chromosome-specific microsatellite mutation rates re-examined using a minisatellite, MSY1.

    Science.gov (United States)

    Jobling, M A; Heyer, E; Dieltjes, P; de Knijff, P

    1999-10-01

    Polymorphic Y-chromosome-specific microsatellites are becoming increasingly used in evolutionary and forensic studies and, in particular, in dating the origins of Y-chromosomal lineages. Previously, haplotyping of Y chromosomes from males belonging to a set of deep-rooting pedigrees was used to estimate a conservative average Y-chromosomal microsatellite mutation rate of 2.1 x 10(-3)per locus per generation. A number of males showed multiple differences in haplotypes compared with other males within their pedigrees, and these were excluded from the calculation of this estimate, on the grounds that non-paternity was a more probable explanation than multiple mutation within a lineage. Here we reanalyse the pedigrees using an independent highly polymorphic system, the Y-specific minisatellite, MSY1. This supports the hypothesis of non-paternity where more than one microsatellite difference was observed, provides further support for the previously deduced microsatellite mutation rate and throws light on the mutation dynamics of MSY1 itself, suggesting that single-step changes are not the only mode of mutation.

  10. Arvelig hemokromatose - nytten av screening

    Directory of Open Access Journals (Sweden)

    Arne Åsberg

    2009-10-01

    Full Text Available Arvelig hemokromatose fører til jernopphopning i kroppen, men gir sjelden alvorlig helseskade. Nesten alle hemokromatosepasienter i vårt land er homozygote for C282Y-mutasjonen i HFE-genet. Omtrent 7 per 1000 innbyggere har denne genotypen. Alvorlig syke blir bare omkring 5-15% av homozygote menn og nesten ingen kvinner. Likevel er det holdepunkter for at screening for hemokromatose blant friske, yngre menn kan være kostnadseffektivt. Det er relativt lett å påvise om en person er disponert for sykdommen, i god tid før den bryter ut, og forebyggende behandling er billig og effektiv. Imidlertid kan vi ikke forutsi hvilke screeningpositive personer som ubehandlet får alvorlig sykdom. Et kontrollert forsøk med screening bør gjennomføresHereditary hemochromatosis – benefits of screening. Hereditary hemochromatosis leads to iron accumulation in the body; however, serious illness due to hemochromatosis is rare. In Norway, almost all patients with hemochromatosis are homozygous for the C282Ymutation in the HFE-gene, a genotype carried by about 7 per 1000 inhabitants. Serious complications are seen in only about 5-15% of homozygous men and in very few women. Nevertheless, screening young men for hemochromatosis may be cost-effective. Detecting predisposed men is relatively straightforward, and prophylactic treatment is cheap and effective. However, we can not predict, among screen-positive men, the few who untreated will become seriously ill. A controlled screening trial should be conducted.

  11. 30 CFR 282.24 - Mining Plan.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Mining Plan. 282.24 Section 282.24 Mineral... § 282.24 Mining Plan. All OCS mineral development and production activities shall be conducted in accordance with a Mining Plan submitted by the lessee and approved by the Director. A Mining Plan shall...

  12. Autosomal mutations affecting Y chromosome loops in Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Petrucci Romano

    2008-04-01

    Full Text Available Abstract Background The Y chromosome of Drosophila melanogaster harbors several genes required for male fertility. The genes for these fertility factors are very large in size and contain conspicuous amounts of repetitive DNA and transposons. Three of these loci (ks-1, kl-3 and kl-5 have the ability to develop giant lampbrush-like loops in primary spermatocytes, a cytological manifestation of their active state in these cells. Y-loops bind a number of non-Y encoded proteins, but the mechanisms regulating their development and their specific functions are still to be elucidated. Results Here we report the results of a screen of 726 male sterile lines to identify novel autosomal genes controlling Y-loop function. We analyzed mutant testis preparations both in vivo and by immunofluorescence using antibodies directed against Y-loop-associated proteins. This screen enabled us to isolate 17 mutations at 15 loci whose wild-type function is required for proper Y-loop morphogenesis. Six of these loci are likely to specifically control loop development, while the others display pleiotropic effects on both loops and meiotic processes such as spermiogenesis, sperm development and maturation. We also determined the map position of the mutations affecting exclusively Y-loop morphology. Conclusion Our cytological screening permitted us to identify novel genetic functions required for male spermatogenesis, some of which show pleiotropic effects. Analysis of these mutations also shows that loop development can be uncoupled from meiosis progression. These data represent a useful framework for the characterization of Y-loop development at a molecular level and for the study of the genetic control of heterochromatin.

  13. 30 CFR 282.26 - Contingency Plan.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Contingency Plan. 282.26 Section 282.26 Mineral... § 282.26 Contingency Plan. (a) When required by the Director, a lessee shall include a Contingency Plan as part of its request for approval of a Delineation, Testing, or Mining Plan. The Contingency Plan...

  14. Anti-obesity and pro-diabetic effects of hemochromatosis.

    Science.gov (United States)

    Abbas, Mousa Al; Abraham, Deveraprabu; Kushner, James P; McClain, Donald A

    2014-10-01

    Levels of tissue iron contribute to determining diabetes risk, but little is known about the effects of higher iron levels on weight, and on the interaction of weight and iron overload on diabetes risk. Therefore, the effect of iron on body mass index and diabetes in individuals with iron overload from hereditary hemochromatosis (HH), compared to non-HH siblings and historical controls was examined. Chart reviews were performed on a cohort of adults (age ≥40, N = 101) with the common C282Y/C282Y HFE genotype, compared to wild type siblings (N = 32) and comparable NHANES cohorts, with respect to body mass index and diabetes status. Males with HH have lower body mass index (BMI) than control siblings. Females had a trend toward decreased BMI that was not significant, possibly related to decreased degrees of iron overload. In both males and females, increased rates of diabetes were seen, especially in the overweight or obese. High tissue iron levels may be both pro- and anti-diabetic. The prevalence of obesity and diabetes in HH is likely dependent upon the degree of iron overload, caloric intake, and other genetic and environmental factors, contributing to the observed heterogeneity in the frequency of disease-related morbidities in HH. Copyright © 2014 The Obesity Society.

  15. A new experimental system for study on adaptive mutations

    Institute of Scientific and Technical Information of China (English)

    Lü; Zhong; (

    2001-01-01

    [1]Luria, S. E., Delbrück, M., Mutation of bacteria from virus sensitivity to virus resistance, Genetics, 1943, 28: 491.[2]Lederberg, J., Lederberg, E. M., Replica plating and indirect selection of bacteria mutants, J. Bacteriol., 1952, 63: 399.[3]Carins, J., Overbaugh, J., Miller, S., The origin of mutants, Nature, 1988, 355: 142.[4]Foster, P. L., Adaptive mutation: the uses of adversity, Annu. Rev. Microbiol., 1993, 47: 467.[5]Hall, B. G., Adaptive mutagenesis: a process that generates almost exclusively beneficient mutations, Genetica, 1998, 102/103: 109.[6]Kasak, L., Horak, R., Kivisaar, M., Promotor-creating mutations in Psuedmonas putida: A model system for the study of mutation in starving bacteria, PNAS, 1997, 94: 3134.[7]Steele, D. F., Jinks-Robertson, An examination of adaptive reversion in Saccharomyces cerevisiae, Genetics, 1992, 132: 9.[8]Davis, R. W., Botstein, Roth, J. R., Advanced Bacterial Genetics--A Manual for Genetic Engineering, New York: Cold Spring Harbor Laboratory Press, 1980, 13.[9]Miller, J. H., Experiments in Molecular Genetics, New York: Cold Spring Harbor Laboratory Press, 1972, 352.[10] Lea, D. E., Coulson, C. A., The distribution of the numbers of mutants in bacterial populations, J. Genetics, 1949, 49: 264.[11] Hughes, K. T., Roth, J. R., Transitory cis complementation: a method for provided transposition function to defective transposons, Genetics, 1988, 119: 9.[12] Sanderson, K. E., Roth J., Linkage map of Salmonella typhimurium, Microbiol. Rev., 1988, 52: 485.[13] He, B., Shiau, A., Choi, K. Y., Genes of the E. coli pur region are negatively controlled by a repressor-operator interaction, J. Bacteriol., 1990, 172: 4555.[14] Liu, B., Huang, Y., Wang, A. Q., Regulation of purine biosynthetic genes expression in Salmonella typhimurium (IV)--Oc mutation site of purG and its function analysis, Science in China, Ser. C, 1997, 40(3): 238.[15] Tang, H., Qin, J. C., Wang, A. Q

  16. Heat transfer and entropy generation analysis of HFE 7000 based nanorefrigerants

    OpenAIRE

    Helvaci, H.; Khan, Zulfiqar Ahmad

    2017-01-01

    In this study, two dimensional numerical simulations of forced convection flow of HFE 7000 based nanofluids in a horizontal circular tube subjected to a constant and uniform heat flux in laminar flow was performed by using single phase homogeneous model. Four different nanofluids considered in the present study are Al2O3, CuO, SiO2 and MgO nanoparticles dispersed in pure HFE 7000. The simulations were performed with particle volumetric concentrations of 0, 1, 4 and 6% and Reynolds number of 4...

  17. Characterization of phospholipase C gamma enzymes with gain-of-function mutations.

    Science.gov (United States)

    Everett, Katy L; Bunney, Tom D; Yoon, Youngdae; Rodrigues-Lima, Fernando; Harris, Richard; Driscoll, Paul C; Abe, Koichiro; Fuchs, Helmut; de Angelis, Martin Hrabé; Yu, Philipp; Cho, Wohnwa; Katan, Matilda

    2009-08-21

    Phospholipase C gamma isozymes (PLC gamma 1 and PLC gamma 2) have a crucial role in the regulation of a variety of cellular functions. Both enzymes have also been implicated in signaling events underlying aberrant cellular responses. Using N-ethyl-N-nitrosourea (ENU) mutagenesis, we have recently identified single point mutations in murine PLC gamma 2 that lead to spontaneous inflammation and autoimmunity. Here we describe further, mechanistic characterization of two gain-of-function mutations, D993G and Y495C, designated as ALI5 and ALI14. The residue Asp-993, mutated in ALI5, is a conserved residue in the catalytic domain of PLC enzymes. Analysis of PLC gamma 1 and PLC gamma 2 with point mutations of this residue showed that removal of the negative charge enhanced PLC activity in response to EGF stimulation or activation by Rac. Measurements of PLC activity in vitro and analysis of membrane binding have suggested that ALI5-type mutations facilitate membrane interactions without compromising substrate binding and hydrolysis. The residue mutated in ALI14 (Tyr-495) is within the spPH domain. Replacement of this residue had no effect on folding of the domain and enhanced Rac activation of PLC gamma 2 without increasing Rac binding. Importantly, the activation of the ALI14-PLC gamma 2 and corresponding PLC gamma 1 variants was enhanced in response to EGF stimulation and bypassed the requirement for phosphorylation of critical tyrosine residues. ALI5- and ALI14-type mutations affected basal activity only slightly; however, their combination resulted in a constitutively active PLC. Based on these data, we suggest that each mutation could compromise auto-inhibition in the inactive PLC, facilitating the activation process; in addition, ALI5-type mutations could enhance membrane interaction in the activated state.

  18. A combinatorial role for MutY and Fpg DNA glycosylases in mutation avoidance in Mycobacterium smegmatis

    International Nuclear Information System (INIS)

    Hassim, Farzanah; Papadopoulos, Andrea O.; Kana, Bavesh D.; Gordhan, Bhavna G.

    2015-01-01

    Highlights: • We studied the combined role of MutY and Fpg DNA glycosylases in M. smegmatis. • Loss of MutY showed increased sensitivity to oxidative damage. • Loss of MutY together with the Fpg glycosylases showed increased mutation rates. • Our data indicate interplay between these enzymes to control mutagenesis. - Abstract: Hydroxyl radical (·OH) among reactive oxygen species cause damage to nucleobases with thymine being the most susceptible, whilst in contrast, the singlet oxygen ( 1 0 2 ) targets only guanine bases. The high GC content of mycobacterial genomes predisposes these organisms to oxidative damage of guanine. The exposure of cellular DNA to ·OH and one-electron oxidants results in the formation of two main degradation products, the pro-mutagenic 8-oxo-7,8-dihydroguanine (8-oxoGua) and the cytotoxic 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyGua). These lesions are repaired through the base excision repair (BER) pathway and we previously, demonstrated a combinatorial role for the mycobacterial Endonuclease III (Nth) and the Nei family of DNA glycosylases in mutagenesis. In addition, the formamidopyrimidine (Fpg/MutM) and MutY DNA glycosylases have also been implicated in mutation avoidance and BER in mycobacteria. In this study, we further investigate the combined role of MutY and the Fpg/Nei DNA glycosylases in Mycobacterium smegmatis and demonstrate that deletion of mutY resulted in enhanced sensitivity to oxidative stress, an effect which was not exacerbated in Δfpg1 Δfpg2 or Δnei1 Δnei2 double mutant backgrounds. However, combinatorial loss of the mutY, fpg1 and fpg2 genes resulted in a significant increase in mutation rates suggesting interplay between these enzymes. Consistent with this, there was a significant increase in C → A mutations with a corresponding change in cell morphology of rifampicin resistant mutants in the Δfpg1 Δfpg2 ΔmutY deletion mutant. In contrast, deletion of mutY together with the nei homologues

  19. A combinatorial role for MutY and Fpg DNA glycosylases in mutation avoidance in Mycobacterium smegmatis

    Energy Technology Data Exchange (ETDEWEB)

    Hassim, Farzanah; Papadopoulos, Andrea O.; Kana, Bavesh D.; Gordhan, Bhavna G., E-mail: bhavna.gordhan@nhls.ac.za

    2015-09-15

    Highlights: • We studied the combined role of MutY and Fpg DNA glycosylases in M. smegmatis. • Loss of MutY showed increased sensitivity to oxidative damage. • Loss of MutY together with the Fpg glycosylases showed increased mutation rates. • Our data indicate interplay between these enzymes to control mutagenesis. - Abstract: Hydroxyl radical (·OH) among reactive oxygen species cause damage to nucleobases with thymine being the most susceptible, whilst in contrast, the singlet oxygen ({sup 1}0{sub 2}) targets only guanine bases. The high GC content of mycobacterial genomes predisposes these organisms to oxidative damage of guanine. The exposure of cellular DNA to ·OH and one-electron oxidants results in the formation of two main degradation products, the pro-mutagenic 8-oxo-7,8-dihydroguanine (8-oxoGua) and the cytotoxic 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyGua). These lesions are repaired through the base excision repair (BER) pathway and we previously, demonstrated a combinatorial role for the mycobacterial Endonuclease III (Nth) and the Nei family of DNA glycosylases in mutagenesis. In addition, the formamidopyrimidine (Fpg/MutM) and MutY DNA glycosylases have also been implicated in mutation avoidance and BER in mycobacteria. In this study, we further investigate the combined role of MutY and the Fpg/Nei DNA glycosylases in Mycobacterium smegmatis and demonstrate that deletion of mutY resulted in enhanced sensitivity to oxidative stress, an effect which was not exacerbated in Δfpg1 Δfpg2 or Δnei1 Δnei2 double mutant backgrounds. However, combinatorial loss of the mutY, fpg1 and fpg2 genes resulted in a significant increase in mutation rates suggesting interplay between these enzymes. Consistent with this, there was a significant increase in C → A mutations with a corresponding change in cell morphology of rifampicin resistant mutants in the Δfpg1 Δfpg2 ΔmutY deletion mutant. In contrast, deletion of mutY together with the nei

  20. Lack of integrase inhibitors associated resistance mutations among HIV-1C isolates.

    Science.gov (United States)

    Mulu, Andargachew; Maier, Melanie; Liebert, Uwe Gerd

    2015-12-01

    Although biochemical analysis of HIV-1 integrase enzyme suggested the use of integrase inhibitors (INIs) against HIV-1C, different viral subtypes may favor different mutational pathways potentially leading to varying levels of drug resistance. Thus, the aim of this study was to search for the occurrence and natural evolution of integrase polymorphisms and/or resistance mutations in HIV-1C Ethiopian clinical isolates prior to the introduction of INIs. Plasma samples from chronically infected drug naïve patients (N = 45), of whom the PR and RT sequence was determined previously, were used to generate population based sequences of HIV-1 integrase. HIV-1 subtype was determined using the REGA HIV-1 subtyping tool. Resistance mutations were interpreted according to the Stanford HIV drug resistance database ( http://hivdb.stanford.edu ) and the updated International Antiviral Society (IAS)-USA mutation lists. Moreover, rates of polymorphisms in the current isolates were compared with South African and global HIV-1C isolates. All subjects were infected with HIV-1C concordant to the protease (PR) and reverse transcriptase (RT) regions. Neither major resistance-associated IN mutations (T66I/A/K, E92Q/G, T97A, Y143HCR, S147G, Q148H/R/K, and N155H) nor silent mutations known to change the genetic barrier were observed. Moreover, the DDE-catalytic motif (D64G/D116G/E152 K) and signature HHCC zinc-binding motifs at codon 12, 16, 40 and 43 were found to be highly conserved. However, compared to other South African subtype C isolates, the rate of polymorphism was variable at various positions. Although the sample size is small, the findings suggest that this drug class could be effective in Ethiopia and other southern African countries where HIV-1C is predominantly circulating. The data will contribute to define the importance of integrase polymorphism and to improve resistance interpretation algorithms in HIV-1C isolates.

  1. Spent nuclear fuel project, Cold Vacuum Drying Facility human factors engineering (HFE) analysis: Results and findings

    International Nuclear Information System (INIS)

    Garvin, L.J.

    1998-01-01

    This report presents the background, methodology, and findings of a human factors engineering (HFE) analysis performed in May, 1998, of the Spent Nuclear Fuels (SNF) Project Cold Vacuum Drying Facility (CVDF), to support its Preliminary Safety Analysis Report (PSAR), in responding to the requirements of Department of Energy (DOE) Order 5480.23 (DOE 1992a) and drafted to DOE-STD-3009-94 format. This HFE analysis focused on general environment, physical and computer workstations, and handling devices involved in or directly supporting the technical operations of the facility. This report makes no attempt to interpret or evaluate the safety significance of the HFE analysis findings. The HFE findings presented in this report, along with the results of the CVDF PSAR Chapter 3, Hazards and Accident Analyses, provide the technical basis for preparing the CVDF PSAR Chapter 13, Human Factors Engineering, including interpretation and disposition of findings. The findings presented in this report allow the PSAR Chapter 13 to fully respond to HFE requirements established in DOE Order 5480.23. DOE 5480.23, Nuclear Safety Analysis Reports, Section 8b(3)(n) and Attachment 1, Section-M, require that HFE be analyzed in the PSAR for the adequacy of the current design and planned construction for internal and external communications, operational aids, instrumentation and controls, environmental factors such as heat, light, and noise and that an assessment of human performance under abnormal and emergency conditions be performed (DOE 1992a)

  2. A systematic review of human factors and ergonomics (HFE)-based healthcare system redesign for quality of care and patient safety.

    Science.gov (United States)

    Xie, Anping; Carayon, Pascale

    2015-01-01

    Healthcare systems need to be redesigned to provide care that is safe, effective and efficient, and meets the multiple needs of patients. This systematic review examines how human factors and ergonomics (HFE) is applied to redesign healthcare work systems and processes and improve quality and safety of care. We identified 12 projects representing 23 studies and addressing different physical, cognitive and organisational HFE issues in a variety of healthcare systems and care settings. Some evidence exists for the effectiveness of HFE-based healthcare system redesign in improving process and outcome measures of quality and safety of care. We assessed risk of bias in 16 studies reporting the impact of HFE-based healthcare system redesign and found varying quality across studies. Future research should further assess the impact of HFE on quality and safety of care, and clearly define the mechanisms by which HFE-based system redesign can improve quality and safety of care.

  3. A measurement of π+p backward elastic differential cross-sections from 1.282 to 2.472 GeV/c

    International Nuclear Information System (INIS)

    Candlin, D.J.; Lowe, D.C.; Peach, K.J.

    1984-02-01

    New high statistics measurements of π + p elastic scattering differential cross-sections are presented at 30 momentum points between 1.282 and 2.472 GeV/c, covering most of the angular distribution outside the forward diffractive peak. These data show significant disagreements at some momenta with previous high statistics experiments and with current partial wave analyses. (author)

  4. The expression of the soluble HFE corresponding transcript is up-regulated by intracellular iron and inhibits iron absorption in a duodenal cell model

    OpenAIRE

    Silva, Bruno; Ferreira, Joana; Santos, Vera; Baldaia, Cilénia; Serejo, Fátima; Faustino, Paula

    2014-01-01

    Background and aims: Dietary iron absorption regulation is a key-step for the maintenance of body iron homeostasis. Besides the HFE full-length protein, the HFE gene codes for alternative splicing variants responsible for the synthesis of a soluble form of HFE protein (sHFE). Here we aimed to determine whether sHFE transcript levels respond to different iron conditions in duodenal, macrophage and hepatic cell models, as well, in vivo, in the liver. Furthermore, we determined the functional ef...

  5. p53 gene mutation hotspots in skin cancer and ultraviolet induced mutation

    International Nuclear Information System (INIS)

    Ikehata, Hironobu

    1998-01-01

    Presence of certain hotspots is known in the mutation of p53 gene in skin cancer, which are codons 177, 196, 245, 248, 278 and 282 located in the exon 5-8. In these regions, mutations like C to T and CC to TT are frequent and thereby suggest that they are resulted from pyrimidine-dimers produced by ultraviolet light (UV). In cyclobutane pyrimidine dimerization (CPD), conversion of cytosine to thymine by deamination is suggested to be the primary reaction. Although studies using UVC (254 nm) suggesting that the mutation hotspots are low repair efficiency regions could not completely explain the all hotspots, those using UVB and sunlight (UVB and UVA) revealed that CPD was efficiently produced even in such regions as not explained by studies with UVC alone. Therefore, the latter studies are conceivably reasonable since the skin cancer is induced by natural sunlight. Exon 5-8 DNA is completely methylated and the absorption coefficient of 5-methylcytosine is 5-6 times as large as that of cytosine at wavelength around 290 nm. These indicate the importance of UVB in mutation of mammalian cells possessing the ability to methylate DNA. (K.H.)

  6. Y682 mutation of amyloid precursor protein promotes endo-lysosomal dysfunction by disrupting APP-SorLA interaction

    Directory of Open Access Journals (Sweden)

    Luca Rosario La Rosa

    2015-04-01

    Full Text Available The intracellular transport and localization of amyloid precursor protein (APP are critical determinants of APP processing and β-amyloid peptide production, thus crucially important for the pathophysiology of Alzheimer’s disease (AD. Notably, the C-terminal Y682ENPTY687 domain of APP binds to specific adaptors controlling APP trafficking and sorting in neurons. Mutation on the Y682 residue to glycine (Y682G leads to altered APP sorting in hippocampal neurons that favors its accumulation in intracellular compartments and the release of soluble APPα. Such alterations induce premature aging and learning and cognitive deficits in APP Y682G mutant mice (APPYG/YG. Here, we report that Y682G mutation affects formation of the APP complex with sortilin-related receptor (SorLA, resulting in endo-lysosomal dysfunctions and neuronal degeneration. Moreover, disruption of the APP/SorLA complex changes the trafficking pathway of SorLA, with its consequent increase in secretion outside neurons. Mutations in the SorLA gene are a prognostic factor in AD, and increases in SorLA levels in cerebrospinal fluid are predictive of AD in humans. These results might open new possibilities in comprehending the role played by SorLA in its interaction with APP and in the progression of neuronal degeneration. In addition, they further underline the crucial role played by Y682 residue in controlling APP trafficking in neurons.

  7. Population Screening for Hereditary Haemochromatosis in Australia: Construction and Validation of a State-Transition Cost-Effectiveness Model.

    Science.gov (United States)

    de Graaff, Barbara; Si, Lei; Neil, Amanda L; Yee, Kwang Chien; Sanderson, Kristy; Gurrin, Lyle C; Palmer, Andrew J

    2017-03-01

    HFE-associated haemochromatosis, the most common monogenic disorder amongst populations of northern European ancestry, is characterised by iron overload. Excess iron is stored in parenchymal tissues, leading to morbidity and mortality. Population screening programmes are likely to improve early diagnosis, thereby decreasing associated disease. Our aim was to develop and validate a health economics model of screening using utilities and costs from a haemochromatosis cohort. A state-transition model was developed with Markov states based on disease severity. Australian males (aged 30 years) and females (aged 45 years) of northern European ancestry were the target populations. The screening strategy was the status quo approach in Australia; the model was run over a lifetime horizon. Costs were estimated from the government perspective and reported in 2015 Australian dollars ($A); costs and quality-adjusted life-years (QALYs) were discounted at 5% annually. Model validity was assessed using goodness-of-fit analyses. Second-order Monte-Carlo simulation was used to account for uncertainty in multiple parameters. For validity, the model reproduced mortality, life expectancy (LE) and prevalence rates in line with published data. LE for C282Y homozygote males and females were 49.9 and 40.2 years, respectively, slightly lower than population rates. Mean (95% confidence interval) QALYS were 15.7 (7.7-23.7) for males and 14.4 (6.7-22.1) for females. Mean discounted lifetime costs for C282Y homozygotes were $A22,737 (3670-85,793) for males and $A13,840 (1335-67,377) for females. Sensitivity analyses revealed discount rates and prevalence had the greatest impacts on outcomes. We have developed a transparent, validated health economics model of C282Y homozygote haemochromatosis. The model will be useful to decision makers to identify cost-effective screening strategies.

  8. Polymorphisms and resistance mutations of hepatitis C virus on sequences in the European hepatitis C virus database

    Science.gov (United States)

    Kliemann, Dimas Alexandre; Tovo, Cristiane Valle; da Veiga, Ana Beatriz Gorini; de Mattos, Angelo Alves; Wood, Charles

    2016-01-01

    AIM To evaluate the occurrence of resistant mutations in treatment-naïve hepatitis C virus (HCV) sequences deposited in the European hepatitis C virus database (euHCVdb). METHODS The sequences were downloaded from the euHCVdb (https://euhcvdb.ibcp.fr/euHCVdb/). The search was performed for full-length NS3 protease, NS5A and NS5B polymerase sequences of HCV, separated by genotypes 1a, 1b, 2a, 2b and 3a, and resulted in 798 NS3, 708 NS5A and 535 NS5B sequences from HCV genotypes 1a, 1b, 2a, 2b and 3a, after the exclusion of sequences containing errors and/or gaps or incomplete sequences, and sequences from patients previously treated with direct antiviral agents (DAA). The sequence alignment was performed with MEGA 6.06 MAC and the resulting protein sequences were then analyzed using the BioEdit 7.2.5. for mutations associated with resistance. Only positions that have been described as being associated with failure in treatment in in vivo studies, and/or as conferring a more than 2-fold change in replication in comparison to the wildtype reference strain in in vitro phenotypic assays were included in the analysis. RESULTS The Q80K variant in the NS3 gene was the most prevalent mutation, being found in 44.66% of subtype 1a and 0.25% of subtype 1b. Other frequent mutations observed in more than 2% of the NS3 sequences were: I170V (3.21%) in genotype 1a, and Y56F (15.93%), V132I (23.28%) and I170V (65.20%) in genotype 1b. For the NS5A, 2.21% of the genotype 1a sequences have the P58S mutation, 5.95% of genotype 1b sequences have the R30Q mutation, 15.79% of subtypes 2a sequences have the Q30R mutation, 23.08% of subtype 2b sequences have a L31M mutation, and in subtype 3a sequences, 23.08% have the M31L resistant variants. For the NS5B, the V321L RAV was identified in 0.60% of genotype 1a and in 0.32% of genotype 1b sequences, and the N142T variant was observed in 0.32% of subtype 1b sequences. The C316Y, S556G, D559N RAV were identified in 0.33%, 7.82% and 0.32% of

  9. Polymorphisms and resistance mutations of hepatitis C virus on sequences in the European hepatitis C virus database.

    Science.gov (United States)

    Kliemann, Dimas Alexandre; Tovo, Cristiane Valle; da Veiga, Ana Beatriz Gorini; de Mattos, Angelo Alves; Wood, Charles

    2016-10-28

    To evaluate the occurrence of resistant mutations in treatment-naïve hepatitis C virus (HCV) sequences deposited in the European hepatitis C virus database (euHCVdb). The sequences were downloaded from the euHCVdb (https://euhcvdb.ibcp.fr/euHCVdb/). The search was performed for full-length NS3 protease, NS5A and NS5B polymerase sequences of HCV, separated by genotypes 1a, 1b, 2a, 2b and 3a, and resulted in 798 NS3, 708 NS5A and 535 NS5B sequences from HCV genotypes 1a, 1b, 2a, 2b and 3a, after the exclusion of sequences containing errors and/or gaps or incomplete sequences, and sequences from patients previously treated with direct antiviral agents (DAA). The sequence alignment was performed with MEGA 6.06 MAC and the resulting protein sequences were then analyzed using the BioEdit 7.2.5. for mutations associated with resistance. Only positions that have been described as being associated with failure in treatment in in vivo studies, and/or as conferring a more than 2-fold change in replication in comparison to the wildtype reference strain in in vitro phenotypic assays were included in the analysis. The Q80K variant in the NS3 gene was the most prevalent mutation, being found in 44.66% of subtype 1a and 0.25% of subtype 1b. Other frequent mutations observed in more than 2% of the NS3 sequences were: I170V (3.21%) in genotype 1a, and Y56F (15.93%), V132I (23.28%) and I170V (65.20%) in genotype 1b. For the NS5A, 2.21% of the genotype 1a sequences have the P58S mutation, 5.95% of genotype 1b sequences have the R30Q mutation, 15.79% of subtypes 2a sequences have the Q30R mutation, 23.08% of subtype 2b sequences have a L31M mutation, and in subtype 3a sequences, 23.08% have the M31L resistant variants. For the NS5B, the V321L RAV was identified in 0.60% of genotype 1a and in 0.32% of genotype 1b sequences, and the N142T variant was observed in 0.32% of subtype 1b sequences. The C316Y, S556G, D559N RAV were identified in 0.33%, 7.82% and 0.32% of genotype 1b sequences

  10. 27 CFR 28.282 - Beer.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Beer. 28.282 Section 28.282 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE... Beer. When beer has been laden on board the aircraft for use as supplies, the customs officer shall...

  11. 46 CFR 282.30 - Payment of subsidy.

    Science.gov (United States)

    2010-10-01

    ... include for payment in such voucher the amount of ODS accrued for the voyages terminated during the period. ... 46 Shipping 8 2010-10-01 2010-10-01 false Payment of subsidy. 282.30 Section 282.30 Shipping... COMMERCE OF THE UNITED STATES Subsidy Payment and Billing Procedures § 282.30 Payment of subsidy...

  12. 46 CFR 282.11 - Ranking of flags.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Ranking of flags. 282.11 Section 282.11 Shipping... COMMERCE OF THE UNITED STATES Foreign-Flag Competition § 282.11 Ranking of flags. The operators under each... priority of costs which are representative of the flag. For liner cargo vessels, the ranking of operators...

  13. Fatigue Crack Growth Behavior of Nickel-base Superalloy Haynes 282 at 550-750 °C

    Science.gov (United States)

    Rozman, K. A.; Kruzic, J. J.; Hawk, J. A.

    2015-08-01

    The fatigue crack growth rates for nickel-based superalloy Haynes 282 were measured at temperatures of 550, 650, and 750 °C using compact tension specimens with a load ratio of 0.1 and cyclic loading frequencies of 25 Hz and 0.25 Hz. Increasing the temperature from 550 to 750 °C caused the fatigue crack growth rates to increase from ~20 to 60% depending upon the applied stress intensity level. The effect of reducing the applied loading frequency increased the fatigue crack growth rates from ~20 to 70%, also depending upon the applied stress intensity range. The crack path was observed to be transgranular for the temperatures and frequencies used during fatigue crack growth rate testing. At 750 °C, there were some indications of limited intergranular cracking excursions at both loading frequencies; however, the extent of intergranular crack growth was limited and the cause is not understood at this time.

  14. Hyperhomocysteinemia and methylenetetrahydrofolate reductase 677C→T and 1298A→C mutations in patients with inflammatory bowel disease Hiperhomocisteinemia y mutaciones de la metilentetrahidrofolato reductasa 677C→T y 1298A→C en pacientes con enfermedad inflamatoria intestinal

    Directory of Open Access Journals (Sweden)

    C. Fernández-Miranda

    2005-07-01

    Full Text Available Background: hyperhomocysteinemia has been recently described in patients with inflammatory bowel disease (IBD, that could be related to the increased risk for thrombosis that exists in this disease. The aim of this study was the assessment of hyperhomocysteinemia in patients with IBD and its relation among vitamin B12 and folate levels, and methylenetetrahydrofolate reductase (MTHFR 677C→ T and 1298A→C mutations. Patients and methods: fifty two consecutive patients with IBD were studied (29 women and 23 men; age: mean (standard deviation 41.7 [11.9] years and 186 controls with no difference in age and gender. Hyperhomocysteinemia was considered as homocysteine levels higher than mean plus two standard deviations of the control group (≥ 13 μmol/l. Results: patients had an elevated prevalence of hyperhomocysteinemia (17.3 vs. 3.7%; p = 0.002 and lower folate (7.6 [4.1] vs. 8.9 [3.7] ng/ml; p = 0.01 and B12 vitamin levels (499 [287] vs. 603 [231] pg/ml; p = 0.003. Homocysteinemia was higher (14.3 [5.8] vs. 9.1 [3.9] μmol/l; p = 0.006 in 6 patients (11.5% that had suffered thromboembolism. Frequency of MTHFR 677C→T (13.5 vs. 11.3%; p = 0.66 and 1298A→C (7.8 vs. 7.0%; p = 0.76 mutations was not increased in patients. Odds ratio (OR for IBD in hyperhomocysteinemic patient was 5.51, 95% confidence interval (CI, 1.81-16.76; p = 0.002. Hyperhomocysteinemia was negatively associated with feminine gender (OR 0.08, 95% CI 0.01-0.49; p = 0.006 and folate levels (OR 0.04, 95%CI: 0.007-0.20; p Fundamento: recientemente se ha descrito la existencia de hiperhomocisteinemia en la enfermedad inflamatoria intestinal (EII, que podría estar relacionada con el mayor riesgo de trombosis en esta enfermedad. El objetivo del estudio ha sido evaluar la hiperhomocisteinemia en los pacientes con EII y su relación con las concentraciones de vitamina B12 y folato séricos y con las mutaciones de la metilentetrahidrofolato reductasa (MTHFR 677C→T y 1298A→C

  15. A combinatorial role for MutY and Fpg DNA glycosylases in mutation avoidance in Mycobacterium smegmatis.

    Science.gov (United States)

    Hassim, Farzanah; Papadopoulos, Andrea O; Kana, Bavesh D; Gordhan, Bhavna G

    2015-09-01

    Hydroxyl radical (OH) among reactive oxygen species cause damage to nucleobases with thymine being the most susceptible, whilst in contrast, the singlet oxygen ((1)02) targets only guanine bases. The high GC content of mycobacterial genomes predisposes these organisms to oxidative damage of guanine. The exposure of cellular DNA to OH and one-electron oxidants results in the formation of two main degradation products, the pro-mutagenic 8-oxo-7,8-dihydroguanine (8-oxoGua) and the cytotoxic 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyGua). These lesions are repaired through the base excision repair (BER) pathway and we previously, demonstrated a combinatorial role for the mycobacterial Endonuclease III (Nth) and the Nei family of DNA glycosylases in mutagenesis. In addition, the formamidopyrimidine (Fpg/MutM) and MutY DNA glycosylases have also been implicated in mutation avoidance and BER in mycobacteria. In this study, we further investigate the combined role of MutY and the Fpg/Nei DNA glycosylases in Mycobacterium smegmatis and demonstrate that deletion of mutY resulted in enhanced sensitivity to oxidative stress, an effect which was not exacerbated in Δfpg1 Δfpg2 or Δnei1 Δnei2 double mutant backgrounds. However, combinatorial loss of the mutY, fpg1 and fpg2 genes resulted in a significant increase in mutation rates suggesting interplay between these enzymes. Consistent with this, there was a significant increase in C → A mutations with a corresponding change in cell morphology of rifampicin resistant mutants in the Δfpg1 Δfpg2 ΔmutY deletion mutant. In contrast, deletion of mutY together with the nei homologues did not result in any growth/survival defects or changes in mutation rates. Taken together these data indicate that the mycobacterial mutY, in combination with the Fpg DNA N-glycosylases, plays an important role in controlling mutagenesis under oxidative stress. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Hypercholesterolemia Induced by a PCSK9 Gain-of-Function Mutation Augments Angiotensin II-Induced Abdominal Aortic Aneurysms in C57BL/6 Mice-Brief Report.

    Science.gov (United States)

    Lu, Hong; Howatt, Deborah A; Balakrishnan, Anju; Graham, Mark J; Mullick, Adam E; Daugherty, Alan

    2016-09-01

    Gain-of-function mutations of PCSK9 (proprotein convertase subtilisin/kexin type 9) lead to hypercholesterolemia. This study was to determine whether infection of normocholesterolemic mice with an adeno-associated viral (AAV) vector expressing a gain-of-function mutation of mouse PCSK9 increased angiotensin II (AngII)-induced abdominal aortic aneurysms. In an initial study, male C57BL/6 mice were injected intraperitoneally with either an empty vector or PCSK9 gain-of-function mutation (D377Y). AAV at 3 doses and fed a saturated fat-enriched diet for 6 weeks. Two weeks after AAV injection, mice were infused with AngII for 4 weeks. Plasma PCSK9 concentrations were increased dose dependently in mice injected with AAV containing PCSK9D377Y mutation and positively associated with elevations of plasma cholesterol concentrations. Infection with intermediate and high doses of PCSK9D377Y.AAV led to equivalent increases of maximal width of abdominal aortas in C57BL/6 mice infused with AngII. Therefore, the intermediate dose was used in subsequent experiments. We then determined effects of PCSK9D377Y.AAV infection on 5 normolipidemic mouse strains, demonstrating that C57BL/6 mice were the most susceptible to this AAV infection. PCSK9D377Y.AAV infected male C57BL/6 mice were also compared with age-matched male low-density lipoprotein receptor(-/-) mice. Although plasma cholesterol concentrations were lower in mice infected with PCSK9D377Y.AAV, these mice had equivalent abdominal aortic aneurysmal formation, compared to low-density lipoprotein receptor(-/-) mice. In a separate study, reduced plasma PCSK9 concentrations by PCSK9 antisense oligonucleotides in male low-density lipoprotein receptor(-/-) mice did not influence AngII-induced abdominal aortic aneurysms. AAV-mediated infection with a mouse PCSK9 gain-of-function mutation is a rapid, easy, and efficient approach for inducing hypercholesterolemia and promoting abdominal aortic aneurysms in C57BL/6 mice infused with Ang

  17. 27 CFR 24.282 - Multiple transfers.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Multiple transfers. 24.282 Section 24.282 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT... transfer record for all wine (including distilling material and vinegar stock) transferred by pipeline to...

  18. 46 CFR 282.23 - Hull and machinery insurance.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Hull and machinery insurance. 282.23 Section 282.23... COMMERCE OF THE UNITED STATES Calculation of Subsidy Rates § 282.23 Hull and machinery insurance. (a) Subsidy items. The fair and reasonable net premium costs (including stamp taxes) of hull and machinery...

  19. Multifocal white matter lesions associated with the D313Y mutation of the α-galactosidase A gene.

    Science.gov (United States)

    Lenders, Malte; Duning, Thomas; Schelleckes, Michael; Schmitz, Boris; Stander, Sonja; Rolfs, Arndt; Brand, Stefan-Martin; Brand, Eva

    2013-01-01

    White matter lesions (WML) are clinically relevant since they are associated with strokes, cognitive decline, depression, or epilepsy, but the underlying etiology in young adults without classical risk factors still remains elusive. Our aim was to elucidate the possible clinical diagnosis and mechanisms leading to WML in patients carrying the D313Y mutation in the α-galactosidase A (GLA) gene, a mutation that was formerly described as nonpathogenic. Pathogenic GLA mutations cause Fabry disease, a vascular endothelial glycosphingolipid storage disease typically presenting with a symptom complex of renal, cardiac, and cerebrovascular manifestations. We performed in-depths clinical, biochemical and genetic examinations as well as advanced magnetic resonance imaging analyses in a pedigree with the genetically determined GLA mutation D313Y. We detected exclusive neurologic manifestations of the central nervous system of the "pseudo"-deficient D313Y mutation leading to manifest WML in 7 affected adult family members. Furthermore, two family members that do not carry the mutation showed no WML. The D313Y mutation resulted in a normal GLA enzyme activity in leukocytes and severely decreased activities in plasma. In conclusion, our results provide evidence that GLA D313Y is potentially involved in neural damage with significant WML, demonstrating the necessity of evaluating patients carrying D313Y more thoroughly. D313Y might broaden the spectrum of hereditary small artery diseases of the brain, which preferably occur in young adults without classical risk factors. In view of the existing causal therapy regime, D313Y should be more specifically taken into account in these patients.

  20. 30 CFR 282.11 - Director's authority.

    Science.gov (United States)

    2010-07-01

    ... CONTINENTAL SHELF FOR MINERALS OTHER THAN OIL, GAS, AND SULPHUR Jurisdiction and Responsibilities of Director § 282.11 Director's authority. (a) In the exercise of jurisdiction under § 282.10, the Director is... of two or more OCS mineral leases or portions of two or more OCS mineral leases into a single mining...

  1. Hereditary hemochromatosis and risk of ischemic heart disease

    DEFF Research Database (Denmark)

    Ellervik, Christina; Tybjaerg-Hansen, Anne; Grande, Peer

    2005-01-01

    BACKGROUND: We tested the hypothesis that the hereditary hemochromatosis genotypes C282Y/C282Y, C282Y/H63D, or C282Y/wild-type are risk factors for ischemic heart disease (IHD) and myocardial infarction (MI). METHODS AND RESULTS: We performed a prospective study of 9178 individuals from the Danish...

  2. Iron regulation of hepcidin despite attenuated Smad1,5,8 signaling in mice without transferrin receptor 2 or Hfe

    Science.gov (United States)

    Corradini, Elena; Rozier, Molly; Meynard, Delphine; Odhiambo, Adam; Lin, Herbert Y.; Feng, Qi; Migas, Mary C.; Britton, Robert S.; Babitt, Jodie L.; Fleming, Robert E.

    2011-01-01

    Background & Aims HFE and transferrin receptor 2 (TFR2) are each necessary for the normal relationship between body iron status and liver hepcidin expression. In murine Hfe and Tfr2 knockout models of hereditary hemochromatosis (HH), signal transduction to hepcidin via the bone morphogenetic protein 6 (Bmp6)/Smad1,5,8 pathway is attenuated. We examined the effect of dietary iron on regulation of hepcidin expression via the Bmp6/Smad1,5,8 pathway using mice with targeted disruption of Tfr2, Hfe, or both genes. Methods Hepatic iron concentrations and mRNA expression of Bmp6 and hepcidin were compared with wild-type mice in each of the HH models on standard or iron-loading diets. Liver phospho-Smad (P-Smad)1,5,8 and Id1 mRNA levels were measured as markers of Bmp/Smad signaling. Results While Bmp6 expression was increased, liver hepcidin and Id1 expression were decreased in each of the HH models compared with wild-type mice. Each of the HH models also demonstrated attenuated P-Smad1,5,8 levels relative to liver iron status. Mice with combined Hfe/Tfr2 disruption were most affected. Dietary iron loading increased hepcidin and Id1 expression in each of the HH models. Compared with wild-type mice, HH mice demonstrated attenuated (Hfe knockout) or no increases in P-Smad1,5,8 levels in response to dietary iron loading. Conclusions These observations demonstrate that Tfr2 and Hfe are each required for normal signaling of iron status to hepcidin via Bmp6/Smad1,5,8 pathway. Mice with combined loss of Hfe and Tfr2 up-regulate hepcidin in response to dietary iron loading without increases in liver BMP6 mRNA or steady-state P-Smad1,5,8 levels. PMID:21745449

  3. An Excel Macro to Plot the HFE-Diagram to Identify Sea Water Intrusion Phases.

    Science.gov (United States)

    Giménez-Forcada, Elena; Sánchez San Román, F Javier

    2015-01-01

    A hydrochemical facies evolution diagram (HFE-D) is a multirectangular diagram, which is a useful tool in the interpretation of sea water intrusion processes. This method note describes a simple method for generating an HFE-D plot using the spreadsheet software package, Microsoft Excel. The code was applied to groundwater from the alluvial coastal plain of Grosseto (Tuscany, Italy), which is characterized by a complex salinization process in which sea water mixes with sulfate or bicarbonate recharge water. © 2014, National GroundWater Association.

  4. Multifocal white matter lesions associated with the D313Y mutation of the α-galactosidase A gene.

    Directory of Open Access Journals (Sweden)

    Malte Lenders

    Full Text Available White matter lesions (WML are clinically relevant since they are associated with strokes, cognitive decline, depression, or epilepsy, but the underlying etiology in young adults without classical risk factors still remains elusive. Our aim was to elucidate the possible clinical diagnosis and mechanisms leading to WML in patients carrying the D313Y mutation in the α-galactosidase A (GLA gene, a mutation that was formerly described as nonpathogenic. Pathogenic GLA mutations cause Fabry disease, a vascular endothelial glycosphingolipid storage disease typically presenting with a symptom complex of renal, cardiac, and cerebrovascular manifestations. We performed in-depths clinical, biochemical and genetic examinations as well as advanced magnetic resonance imaging analyses in a pedigree with the genetically determined GLA mutation D313Y. We detected exclusive neurologic manifestations of the central nervous system of the "pseudo"-deficient D313Y mutation leading to manifest WML in 7 affected adult family members. Furthermore, two family members that do not carry the mutation showed no WML. The D313Y mutation resulted in a normal GLA enzyme activity in leukocytes and severely decreased activities in plasma. In conclusion, our results provide evidence that GLA D313Y is potentially involved in neural damage with significant WML, demonstrating the necessity of evaluating patients carrying D313Y more thoroughly. D313Y might broaden the spectrum of hereditary small artery diseases of the brain, which preferably occur in young adults without classical risk factors. In view of the existing causal therapy regime, D313Y should be more specifically taken into account in these patients.

  5. Analysis of Y chromosome microdeletions and CFTR gene mutations as genetic markers of infertility in Serbian men

    Directory of Open Access Journals (Sweden)

    Dinić Jelena

    2007-01-01

    Full Text Available Background/Aim. Impaired fertility of a male partner is the main cause of infertility in up to one half of all infertile couples. At the genetic level, male infertility can be caused by chromosome aberrations or gene mutations. The presence and types of Y chromosome microdeletions and cystic fybrosis transmembrane conductance regulator (CFTR gene mutations as genetic cause of male infertility was tested in Serbian men. The aim of this study was to analyze CFTR gene mutations and Y chromosome microdelations as potential causes of male infertility in Serbian patients, as well as to test the hypothesis that CFTR mutations in infertile men are predominantly located in the several last exons of the gene. Methods. This study has encompassed 33 men with oligo- or azoospermia. The screening for Y chromosome microdeletions in the azoospermia factor (AZF region was performed by multiplex PCR analysis. The screening of the CFTR gene was performed by denaturing gradient gel electrophoresis (DGGE method. Results. Deletions on Y chromosome were detected in four patients, predominantly in AZFc region (four of total six deletions. Mutations in the CFTR gene were detected on eight out of 66 analyzed chromosomes of infertile men. The most common mutation was F508del (six of total eight mutations. Conclusion. This study confirmed that both Y chromosome microdeletions and CFTR gene mutations played important role in etiology of male infertility in Serbian infertile men. Genetic testing for Y chromosome microdeletions and CFTR gene mutations has been introduced in routine diagnostics and offered to couples undergoing assisted reproduction techniques. Considering that both the type of Y chromosome microdeletion and the type of CFTR mutation have a prognostic value, it is recommended that AZF and CFTR genotyping should not only be performed in patients with reduced sperm quality before undergoing assisted reproduction, but also for the purpose of preimplantation and

  6. 40 CFR 265.282 - Special requirements for incompatible wastes.

    Science.gov (United States)

    2010-07-01

    ..., STORAGE, AND DISPOSAL FACILITIES Land Treatment § 265.282 Special requirements for incompatible wastes... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Special requirements for incompatible wastes. 265.282 Section 265.282 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED...

  7. Comparison of ESR1 Mutations in Tumor Tissue and Matched Plasma Samples from Metastatic Breast Cancer Patients

    Directory of Open Access Journals (Sweden)

    Takashi Takeshita

    2017-10-01

    Full Text Available BACKGROUND: ESR1 mutation in circulating cell-free DNA (cfDNA is emerging as a noninvasive biomarker of acquired resistance to endocrine therapy, but there is a paucity of data comparing the status of ESR1 gene in cfDNA with that in its corresponding tumor tissue. The objective of this study is to validate the degree of concordance of ESR1 mutations between plasma and tumor tissue. METHODS: ESR1 ligand-binding domain mutations Y537S, Y537N, Y537C, and D538G were analyzed using droplet digital PCR in 35 patients with metastatic breast cancer (MBC (35 tumor tissue samples and 67 plasma samples. RESULTS: Of the 35 paired samples, 26 (74.3% were concordant: one patient had detectable ESR1 mutations both plasma (ESR1 Y537S/Y537N and tumor tissue (ESR1 Y537S/Y537C, and 25 had WT ESR1 alleles in both. Nine (25.7% had discordance between the plasma and tissue results: five had mutations detected only in their tumor tissue (two Y537S, one Y537C, one D538G, and one Y537S/Y537N/D538G, and four had mutations detected only in their plasma (one Y537S, one Y537N, and two Y537S/Y537N/D538G. Furthermore, longitudinal plasma samples from 19 patients were used to assess changes in the presence of ESR1 mutations during treatment. Eleven patients had cfDNA ESR1 mutations over the course of treatment. A total of eight of 11 patients with MBC with cfDNA ESR1 mutations (72.7% had the polyclonal mutations. CONCLUSION: We have shown the independent distribution of ESR1 mutations between plasma and tumor tissue in 35 patients with MBC.

  8. Effects of the umuC36 mutation on ultraviolet-radiation-induced base-change and frameshift mutations in Escherichia coli

    International Nuclear Information System (INIS)

    Kato, T.; Nakano, E.

    1981-01-01

    The effects of the umuC36 mutation on the induction of base-change and frameshift mutations were studied. An active umuC gene was necessary in either the uvr + or uvr - strains of Escherichia coli K12 for UV- and X-ray-induced mutations to His + , ColE and Spc, which are presumably base-change mutations, but it was not essential for ethyl methanesulphonate or N-methyl-N'-nitro-N-nitrosoguanidine-induced His + mutations. In contrast, only 1 out of 13 trp - frameshift mutations examined was UV reversible, and the process of mutagenesis was umuC + -dependent, whereas a potent frameshift mutagen, ICR191, effectively induced Trp + mutations in most of the strains regardless of the umu + or umuC genetic background. These results suggest that base substitutions are a major mutational type derived from the umuC + -dependent pathway of error-prone repair. (orig.)

  9. 40 CFR 264.282 - Special requirements for incompatible wastes.

    Science.gov (United States)

    2010-07-01

    ... DISPOSAL FACILITIES Land Treatment § 264.282 Special requirements for incompatible wastes. The owner or... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Special requirements for incompatible wastes. 264.282 Section 264.282 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED...

  10. Evidence for the Influence of the Iron Regulatory MHC Class I Molecule HFE on Tumor Progression in Experimental Models and Clinical Populations

    Science.gov (United States)

    Weston, Cody; Connor, James

    2014-01-01

    Proteins involved in iron regulation are modifiers of cancer risk and progression. Of these, the HFE protein (high iron gene and its protein product) is of particular interest because of its interaction with both iron handling and immune function and the high rate of genetic polymorphisms resulting in a mutant protein. Clinical studies suggest that HFE polymorphisms increase the risk of certain cancers, but the inconsistent outcomes suggest a more nuanced effect, possibly interacting with other genetic or environmental factors. Some basic science research has been conducted to begin to understand the implications of variant HFE genotype on cancer, but the story is far from complete. In particular, putative mechanisms exist for HFE to affect tumor progression through its role in iron handling and its major histocompatibility complex class I structural features. In this review, the current understanding of the role of HFE in cancer is described and models for future directions are identified. PMID:25520556

  11. Intrafamilial Variability of Early-Onset Diabetes due to an INS Mutation

    DEFF Research Database (Denmark)

    Fredheim, Siri; Svensson, Jannet; Pörksen, Sven

    2011-01-01

    Aim. The objective of this study was to describe the clinical characteristics of two siblings and their father carrying a C95Y mutation in the insulin (INS) gene. Methods/Results. A Danish patient, his sister, and his father were identified to carry the C95Y mutation in the preproinsulin molecule....... The father, insulin treated for over 40 years, has bilateral preproliferative retinopathy. Conclusions. These three cases further confirm the essential features of diabetes caused by INS mutations with proteotoxic effect. We conclude that patients with similar features must be investigated for mutations...

  12. 47 CFR 25.282 - Orbit raising maneuvers.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 2 2010-10-01 2010-10-01 false Orbit raising maneuvers. 25.282 Section 25.282 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES SATELLITE COMMUNICATIONS... geostationary satellite orbit under this part is also authorized to transmit in connection with short-term...

  13. Implicating the H63D polymorphism in the HFE gene in increased incidence of solid cancers: a meta-analysis.

    Science.gov (United States)

    Shen, L L; Gu, D Y; Zhao, T T; Tang, C J; Xu, Y; Chen, J F

    2015-10-29

    A number of previous studies have demonstrated that the HFE H63D polymorphism is associated with increased risk of incidence multiple types of cancer, including colorectal cancer, breast cancer, liver cancer, pancreatic cancer, and gynecological malignant tumors. However, the clinical outcomes were inconsistent. Therefore, this meta-analysis was conducted to summarize the effect of the H63D variant on the incidence of solid tumor. PubMed and EMBASE databases were searched for articles associating the HFE H63D polymorphism with cancer risk. The relationships were evaluated by calculating the pooled odds ratios (ORs) with 95% confidence intervals (CIs). A total of 28 studies, including 7728 cancer cases and 11,895 controls, were identified. Statistically significant associations were identified between the HFE H63D polymorphism and solid cancer risk (CG vs CC, OR = 1.14, 95%CI = 1.07-1.23, P HFE H63D polymorphism may play a critical role in the increased aggressiveness of hepatocellular carcinoma and pancreatic cancer.

  14. Presence of c.3956delC mutation in familial adenomatous polyposis patients from Brazil.

    Science.gov (United States)

    Moreira-Nunes, Caroline Aquino; Alcântara, Diego di Felipe Ávila; Lima-Júnior, Sérgio Figueiredo; Cavalléro, Sandro Roberto de Araújo; Rey, Juan Antonio; Pinto, Giovanny Rebouças; de Assumpção, Paulo Pimentel; Burbano, Rommel Rodriguez

    2015-08-21

    To characterize APC gene mutations and correlate them with patient phenotypes in individuals diagnosed with familial adenomatous polyposis (FAP) in northern Brazil. A total of 15 individuals diagnosed with FAP from 5 different families from the north of Brazil were analyzed in this study. In addition to patients with histopathological diagnosis of FAP, family members who had not developed the disease were also tested in order to identify mutations and for possible genetic counseling. All analyzed patients or their guardians signed a consent form approved by the Research Ethics Committee of the João de Barros Barreto University Hospital (Belem, Brazil). DNA extracted from the peripheral blood of a member of each of the affected families was subjected to direct sequencing. The proband of each family was sequenced to identify germline mutations using the Ion Torrent platform. To validate the detected mutations, Sanger sequencing was also performed. The samples from all patients were also tested for the identification of mutations by real-time quantitative polymerase chain reaction using the amplification refractory mutation system. Through interviews with relatives and a search of medical records, it was possible to construct genograms for three of the five families included in the study. All 15 patients from the five families with FAP exhibited mutations in the APC gene, and all mutations were detected in exon 15 of the APC gene. In addition to the patients with a histological diagnosis of FAP, family members without disease symptoms showed the mutation in the APC gene. In the present study, we detected two of the three most frequent germline mutations in the literature: the mutation at codon 1309 and the mutation at codon 1061. The presence of c.3956delC mutation was found in all families from this study, and suggests that this mutation was introduced in the population of the State of Pará through ancestor immigration (i.e., a de novo mutation that arose in one

  15. Composición química del huevo de tortuga lora (Lepidochelys olivacea) y evaluación de su calidad física y microbiológica durante su almacenamiento

    OpenAIRE

    Mora Castro, Randall; Chaves Quirós, Ana Cecilia

    1997-01-01

    Se determinó la composición química de los huevos de tortuga lora (Lepidochelys olivacea) y se evaluó su calidad física y microbiológica durante el almacenamiento a 5 °C y 25 °C y a una humedad relativa de 92 %. Se encontró que los huevos de tortuga lora tienen una masa promedio de 27,9 g y están constituidos por un 58,0 % de yema, un 38,0 % de clara y un 4,0 % de cáscara. La cáscara contiene un 37,0 % de humedad, un 28,2 % de proteína y un 36,0 % de materia mineral. En la clara el compone...

  16. A new 500 kb haplotype associated with high CD8+ T-lymphocyte numbers predicts a less severe expression of hereditary hemochromatosis

    Directory of Open Access Journals (Sweden)

    Mascarenhas Cláudia

    2008-11-01

    Full Text Available Abstract Background Hereditary Hemochromatosis(HH is a common genetic disorder of iron overload where the large majority of patients are homozygous for one ancestral mutation in the HFE gene. In spite of this remarkable genetic homogeneity, the condition is clinically heterogeneous, varying from a severe disease to an asymptomatic phenotype with only abnormal biochemical parameters. The recent recognition of the variable penetrance of the HH mutation in different large population studies demands the need to search for new modifiers of its phenotypic expression. The present study follows previous observations that MHC class-I linked genetic markers, associated with the setting of CD8+ T-lymphocyte numbers, could be clinically relevant modifiers of the phenotypic expression in HH, and aimed to find new markers that could be used as more reliable prognostic variables. Methods Haplotype analysis, including seven genetic markers within a 1 Mb region around the microsatellite D6S105 was performed in a group of 56 previously characterized C282Y homozygous Portuguese patients. Parameters analyzed in this study were total body iron stores, clinical manifestations related with HH and immunological parameters (total lymphocyte numbers, CD4+ and CD8+ T-lymphocyte numbers. An independent group of 10 C282Y homozygous patients from Vancouver, Canada, were also included in this study and analyzed for the same parameters. Results A highly conserved ancestral haplotype defined by the SNP markers PGBD1-A, ZNF193-A, ZNF165-T (designated as A-A-T was found associated with both abnormally low CD8+ T-lymphocyte numbers and the development of a severe clinical expression of HH. In a small proportion of patients, another conserved haplotype defined by the SNP markers PGBD1-G, ZNF193-G, ZNF165-G (designated as G-G-G was found associated with high CD8+ T-lymphocyte numbers and a milder clinical expression. Remarkably, the two conserved haplotypes defined in Portuguese

  17. [Effect of estradiol on food intake, glucose and fat metabolism in mice C57BL/6J with mutation yellow at the agouti locus].

    Science.gov (United States)

    Iakovleva, T V; Makarova, E N; Kazantseva, A Iu; Bazhan, N M

    2012-05-01

    Mutation yellow at the agouti locus in mice (A(y)/a-mice) causes the increase of food intake and development of obesity and type 2 diabetes. In A(y)/a-females the disturbances of glucose and fat metabolisms occur after puberty. We have assumed that the mutation yellow violates the regulatory effect of estradiol on glucose and fat metabolism in mice. We investigated the effects of ovariectomy and estradiol treatment on body weight, food intake, glucose tolerance, plasma levels of glucose, insulin and etherified fatty acids in A(y)/a-females. C57Bl/6J females, not carrying yellow mutation at the agouti locus (a/a-mice), were used as a control. The data suggest that the yellow mutation did not affect estradiol regulation of food intake and glucose blood levels after a night of fasting, but, apparently, prevented estradiol participation in the regulation of glucose and fat metabolisms in the muscle and fat tissues.

  18. Intrafamilial Variability of Early-Onset Diabetes due to an INS Mutation

    DEFF Research Database (Denmark)

    Fredheim, Siri; Svensson, Jannet; Pørksen, Sven

    2011-01-01

    Aim. The objective of this study was to describe the clinical characteristics of two siblings and their father carrying a C95Y mutation in the insulin (INS) gene. Methods/Results. A Danish patient, his sister, and his father were identified to carry the C95Y mutation in the preproinsulin molecule...... children. The father, insulin treated for over 40 years, has bilateral preproliferative retinopathy. Conclusions. These three cases further confirm the essential features of diabetes caused by INS mutations with proteotoxic effect. We conclude that patients with similar features must be investigated...... for mutations of INS gene....

  19. Spectrum of rhodopsin mutations in Korean patients with retinitis pigmentosa

    Science.gov (United States)

    Kim, Kwang Joong; Kim, Cinoo; Bok, Jeong; Kim, Kyung-Seon; Lee, Eun-Ju; Park, Sung Pyo; Chung, Hum; Han, Bok-Ghee; Kim, Hyung-Lae; Kimm, Kuchan; Yu, Hyeong Gon

    2011-01-01

    Purpose To determine the spectrum and frequency of rhodopsin gene (RHO) mutations in Korean patients with retinitis pigmentosa (RP) and to characterize genotype–phenotype correlations in patients with mutations. Methods The RHO mutations were screened by direct sequencing, and mutation prevalence was measured in patients and controls. The impact of missense mutations to RP was predicted by segregation analysis, peptide sequence alignment, and in silico analysis. The severity of disease in patients with the missense mutations was compared by visual acuity, electroretinography, optical coherence tomography, and kinetic visual field testing. Results Five heterozygous mutations were identified in six of 302 probands with RP, including a novel mutation (c.893C>A, p.A298D) and four known mutations (c.50C>T, p.T17M; c.533A>G, p.Y178C; c.888G>T, p.K296N; and c.1040C>T, p.P347L). The allele frequency of missense mutations was measured in 114 ethnically matched controls. p.A298D, newly identified in a sporadic patient, had never been found in controls and was predicted to be pathogenic. Among the patients with the missense mutations, we observed the most severe phenotype in patients with p.P347L, less severe phenotypes in patients with p.Y178C or p.A298D, and a relatively moderate phenotype in a patient with p.T17M. Conclusions The results reveal the spectrum of RHO mutations in Korean RP patients and clinical features that vary according to mutations. Our findings will be useful for understanding these genetic spectra and the genotype–phenotype correlations and will therefore help with predicting disease prognosis and facilitating the development of gene therapy. PMID:21677794

  20. A phase 1/2, dose-escalation trial of deferasirox for the treatment of iron overload in HFE-related hereditary hemochromatosis.

    Science.gov (United States)

    Phatak, Pradyumna; Brissot, Pierre; Wurster, Mark; Adams, Paul C; Bonkovsky, Herbert L; Gross, John; Malfertheiner, Peter; McLaren, Gordon D; Niederau, Claus; Piperno, Alberto; Powell, Lawrie W; Russo, Mark W; Stoelzel, Ulrich; Stremmel, Wolfgang; Griffel, Louis; Lynch, Nicola; Zhang, Yiyun; Pietrangelo, Antonello

    2010-11-01

    Hereditary hemochromatosis (HH) is characterized by increased intestinal iron absorption that may result in iron overload. Although phlebotomy is widely practiced, it is poorly tolerated or contraindicated in patients with anemias, severe heart disease, or poor venous access, and compliance can vary. The once-daily, oral iron chelator, deferasirox (Exjade) may provide an alternative treatment option. Patients with HH carrying the HFE gene who were homozygous for the Cys282Tyr mutation, serum ferritin levels of 300-2000 ng/mL, transferrin saturation ≥ 45%, and no known history of cirrhosis were enrolled in this dose-escalation study to characterize the safety and efficacy of deferasirox, comprising a core and an extension phase (each 24 weeks). Forty-nine patients were enrolled and received starting deferasirox doses of 5 (n = 11), 10 (n = 15), or 15 (n = 23) mg/kg/day. Adverse events were generally dose-dependent, the most common being diarrhea, headache, and nausea (n = 18, n = 10, and n = 8 in the core and n = 1, n = 1, and n = 0 in the extension, respectively). More patients in the 15 mg/kg/day than in the 5 or 10 mg/kg/day cohorts experienced increases in alanine aminotransferase and serum creatinine levels during the 48-week treatment period; six patients had alanine aminotransferase > 3 × baseline and greater than the upper limit of normal range, and eight patients had serum creatinine > 33% above baseline and greater than upper limit of normal on two consecutive occasions. After receiving deferasirox for 48 weeks, median serum ferritin levels decreased by 63.5%, 74.8%, and 74.1% in the 5, 10, and 15 mg/kg/day cohorts, respectively. In all cohorts, median serum ferritin decreased to < 250 ng/mL. Deferasirox doses of 5, 10, and 15 mg/kg/day can reduce iron burden in patients with HH. Based on the safety and efficacy results, starting deferasirox at 10 mg/kg/day appears to be most appropriate for further study in this patient population.

  1. FGFR3 mutation causes abnormal membranous ossification in achondroplasia.

    Science.gov (United States)

    Di Rocco, Federico; Biosse Duplan, Martin; Heuzé, Yann; Kaci, Nabil; Komla-Ebri, Davide; Munnich, Arnold; Mugniery, Emilie; Benoist-Lasselin, Catherine; Legeai-Mallet, Laurence

    2014-06-01

    FGFR3 gain-of-function mutations lead to both chondrodysplasias and craniosynostoses. Achondroplasia (ACH), the most frequent dwarfism, is due to an FGFR3-activating mutation which results in impaired endochondral ossification. The effects of the mutation on membranous ossification are unknown. Fgfr3(Y367C/+) mice mimicking ACH and craniofacial analysis of patients with ACH and FGFR3-related craniosynostoses provide an opportunity to address this issue. Studying the calvaria and skull base, we observed abnormal cartilage and premature fusion of the synchondroses leading to modifications of foramen magnum shape and size in Fgfr3(Y367C/+) mice, ACH and FGFR3-related craniosynostoses patients. Partial premature fusion of the coronal sutures and non-ossified gaps in frontal bones were also present in Fgfr3(Y367C/+) mice and ACH patients. Our data provide strong support that not only endochondral ossification but also membranous ossification is severely affected in ACH. Demonstration of the impact of FGFR3 mutations on craniofacial development should initiate novel pharmacological and surgical therapeutic approaches.

  2. Mutational landscape of the human Y chromosome-linked genes ...

    Indian Academy of Sciences (India)

    Mutational landscape of the human Y chromosome-linked genes and loci in patients with hypogonadism. Deepali Pathak, Sandeep Kumar Yadav, Leena Rawal and Sher Ali. J. Genet. 94, 677–687. Table 1. Details showing age, sex, karyotype, clinical features and diagnosis results of the patients with H. Hormone profile.

  3. Loss of Hfe Leads to Progression of Tumor Phenotype in Primary Retinal Pigment Epithelial Cells

    Science.gov (United States)

    Gnana-Prakasam, Jaya P.; Veeranan-Karmegam, Rajalakshmi; Coothankandaswamy, Veena; Reddy, Sushma K.; Martin, Pamela M.; Thangaraju, Muthusamy; Smith, Sylvia B.; Ganapathy, Vadivel

    2013-01-01

    Purpose. Hemochromatosis is a disorder of iron overload arising mostly from mutations in HFE. HFE is expressed in retinal pigment epithelium (RPE), and Hfe−/− mice develop age-related iron accumulation and retinal degeneration associated with RPE hyperproliferation. Here, the mechanism underlying the hyperproliferative phenotype in RPE was investigated. Methods. Cellular senescence was monitored by β-galactosidase activity. Gene expression was monitored by real-time PCR. Survivin was analyzed by Western blot and immunofluorescence. Migration and invasion were monitored using appropriate kits. Glucose transporters (GLUTs) were monitored by 3-O-methyl-D-glucose uptake. Histone deacetylases (HDACs) were studied by monitoring catalytic activity and acetylation status of histones H3/H4. Results. Hfe−/− RPE cells exhibited slower senescence rate and higher survivin expression than wild type cells. Hfe−/− cells migrated faster and showed greater glucose uptake and increased expression of GLUTs. The expression of HDACs and DNA methyltransferase (DNMTs) also was increased. Similarly, RPE cells from hemojuvelin (Hjv)-knockout mice, another model of hemochromatosis, also had increased expression of GLUTs, HDACs, and DNMTs. The expression of Slc5a8 was decreased in Hfe−/− RPE cells, but treatment with a DNA methylation inhibitor restored the transporter expression, indicating involvement of DNA methylation in the silencing of Slc5a8 in Hfe−/− cells. Conclusions. RPE cells from iron-overloaded mice exhibit several features of tumor cells: decreased senescence, enhanced migration, increased glucose uptake, and elevated levels of HDACs and DNMTs. These features are seen in Hfe−/− RPE cells as well as in Hjv−/− RPE cells, providing a molecular basis for the hyperproliferative phenotype of Hfe−/− and Hjv−/− RPE cells. PMID:23169885

  4. Genetic polymorphisms and mutation rates of 27 Y-chromosomal STRs in a Han population from Guangdong Province, Southern China.

    Science.gov (United States)

    Wang, Ying; Zhang, Yong-Ji; Zhang, Chu-chu; Li, Ran; Yang, Yang; Ou, Xue-Ling; Tong, Da-yue; Sun, Hong-Yu

    2016-03-01

    In this study, we collected blood samples from 1033 father-son pairs of a Han population from Guangdong Province, Southern China, of which 1007 fathers were unrelated male individuals. All together, 2040 male individuals were analyzed at 27 Y-chromosomal short tandem repeats (Y-STRs) with Yfiler(®) Plus system. A total of 1003 different haplotypes were observed among 1007 unrelated fathers, with the overall haplotype diversity (HD) 0.999992 and discrimination capacity (DC) 0.996. The gene diversity (GD) values for the 27 Y-STR loci ranged from 0.4400 at DYS438 to 0.9597 at DYS385a/b. 11 off-ladder alleles and 25 copy number variants were detected in 1007 males. Population relationships were analyzed by comparison with 19 other worldwide populations. With 27,920 allele transfers in 1033 father-son pairs, 124 mutation events occurred, of which 118 were one-step mutations and 6 were two-step mutations. Eleven father-son pairs were found to have mutations at two loci, while one pair at three loci. The estimated locus-specific mutation rates varied from 0 to 1.74×10(-2), with an average estimated mutation rate 4.4×10(-3) (95%CI: 3.7×10(-3) to 5.3×10(-3)). Mutations were most frequently observed at three rapidly mutating Y-STRs (RM Y-STRs), DYS576, DYS518 and DYS627. However, at DYS570, DYS449 and DYF387S1 loci, which were also described as RM Y-STRs, the mutation rates in Guangdong Han population were not as high as estimated in other populations. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  5. A systematic comparison of all mutations in hereditary sensory neuropathy type I (HSAN I) reveals that the G387A mutation is not disease associated.

    Science.gov (United States)

    Hornemann, Thorsten; Penno, Anke; Richard, Stephane; Nicholson, Garth; van Dijk, Fleur S; Rotthier, Annelies; Timmerman, Vincent; von Eckardstein, Arnold

    2009-04-01

    Hereditary sensory neuropathy type 1 (HSAN I) is an autosomal dominant inherited neurodegenerative disorder of the peripheral nervous system associated with mutations in the SPTLC1 subunit of the serine palmitoyltransferase (SPT). Four missense mutations (C133W, C133Y, V144D and G387A) in SPTLC1 were reported to cause HSAN I. SPT catalyses the condensation of Serine and Palmitoyl-CoA, which is the first and rate-limiting step in the de novo synthesis of ceramides. Earlier studies showed that C133W and C133Y mutants have a reduced activity, whereas the impact of the V144D and G387A mutations on the human enzyme was not tested yet. In this paper, we show that none of the HSAN I mutations interferes with SPT complex formation. We demonstrate that also V144D has a reduced SPT activity, however to a lower extent than C133W and C133Y. In contrast, the G387A mutation showed no influence on SPT activity. Furthermore, the growth phenotype of LY-B cells--a SPTLC1 deficient CHO cell line--could be reversed by expressing either the wild-type SPTLC1 or the G387A mutant, but not the C133W mutant. This indicates that the G387A mutation is most likely not directly associated with HSAN I. These findings were genetically confirmed by the identification of a nuclear HSAN family which showed segregation of the G387A variant as a non-synonymous SNP.

  6. Novel mutations in the USH1C gene in Usher syndrome patients.

    Science.gov (United States)

    Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Aller, Elena; Millán, José María

    2010-12-31

    Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population.

  7. New insights into thyroglobulin gene: molecular analysis of seven novel mutations associated with goiter and hypothyroidism.

    Science.gov (United States)

    Citterio, Cintia E; Machiavelli, Gloria A; Miras, Mirta B; Gruñeiro-Papendieck, Laura; Lachlan, Katherine; Sobrero, Gabriela; Chiesa, Ana; Walker, Joanna; Muñoz, Liliana; Testa, Graciela; Belforte, Fiorella S; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

    2013-01-30

    The thyroglobulin (TG) gene is organized in 48 exons, spanning over 270 kb on human chromosome 8q24. Up to now, 62 inactivating mutations in the TG gene have been identified in patients with congenital goiter and endemic or non-endemic simple goiter. The purpose of the present study was to identify and characterize new mutations in the TG gene. We report 13 patients from seven unrelated families with goiter, hypothyroidism and low levels of serum TG. All patients underwent clinical, biochemical and imaging evaluation. Single-strand conformation polymorphism (SSCP) analysis, endonuclease restriction analysis, sequencing of DNA, genotyping, population screening, and bioinformatics studies were performed. Molecular analyses revealed seven novel inactivating TG mutations: c.378C>A [p.Y107X], c.2359C>T [p.R768X], c.2736delG [p.R893fsX946], c.3842G>A [p.C1262Y], c.5466delA [p.K1803fsX1833], c.6000C>G [p.C1981W] and c.6605C>G [p.P2183R] and three previously reported mutations: c.886C>T [p.R277X], c.6701C>A [p.A2215D] and c.7006C>T [p.R2317X]. Six patients from two families were homozygous for p.R277X mutation, four were compound heterozygous mutations (p.Y107X/p.C1262Y, p.R893fsX946/p.A2215D, p.K1803fsX1832/p.R2317X), one carried three identified mutations (p.R277X/p.C1981W-p.P2183R) together with a hypothetical micro deletion and the remaining two siblings from another family with typical phenotype had a single p.R768X mutated allele. In conclusion, our results confirm the genetic heterogeneity of TG defects and the pathophysiological importance of altered TG folding as a consequency of truncated TG proteins and missense mutations located in ACHE-like domain or that replace cysteine. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  8. Hereditary Hemochromatosis

    Science.gov (United States)

    ... hemochromatosis occurs when a child inherits a mutated HFE gene from his or her parents. This mutated gene ... a special test to look for an abnormal HFE gene. This test would tell their doctor if they ...

  9. Genetics Home Reference: hereditary hemochromatosis

    Science.gov (United States)

    ... Type 1 hemochromatosis results from mutations in the HFE gene, and type 2 hemochromatosis results from mutations in ... about the genes associated with hereditary hemochromatosis HAMP HFE HJV PNPLA3 SLC40A1 TFR2 Related Information What is a gene? What is a gene mutation and how do ...

  10. MT-CYB mutations in hypertrophic cardiomyopathy

    DEFF Research Database (Denmark)

    Hagen, Christian M; Aidt, Frederik H; Havndrup, Ole

    2013-01-01

    Mitochondrial dysfunction is a characteristic of heart failure. Mutations in mitochondrial DNA, particularly in MT-CYB coding for cytochrome B in complex III (CIII), have been associated with isolated hypertrophic cardiomyopathy (HCM). We hypothesized that MT-CYB mutations might play an important...... and m.15482T>C; p.S246P were identified. Modeling showed that the p.C93Y mutation leads to disruption of the tertiary structure of Cytb by helix displacement, interfering with protein-heme interaction. The p.S246P mutation induces a diproline structure, which alters local secondary structure and induces...... of HCM patients. We propose that further patients with HCM should be examined for mutations in MT-CYB in order to clarify the role of these variants....

  11. mtDNA mutation C1494T, haplogroup A, and hearing loss in Chinese

    International Nuclear Information System (INIS)

    Wang Chengye; Kong Qingpeng; Yao Yonggang; Zhang Yaping

    2006-01-01

    Mutation C1494T in mitochondrial 12S rRNA gene was recently reported in two large Chinese families with aminoglycoside-induced and nonsyndromic hearing loss (AINHL) and was claimed to be pathogenic. This mutation, however, was first reported in a sample from central China in our previous study that was aimed to reconstruct East Asian mtDNA phylogeny. All these three mtDNAs formed a subclade defined by mutation C1494T in mtDNA haplogroup A. It thus seems that mutation C1494T is a haplogroup A-associated mutation and this matrilineal background may contribute a high risk for the penetrance of mutation C1494T in Chinese with AINHL. To test this hypothesis, we first genotyped mutation C1494T in 553 unrelated individuals from three regional Chinese populations and performed an extensive search for published complete or near-complete mtDNA data sets (>3000 mtDNAs), we then screened the C1494T mutation in 111 mtDNAs with haplogroup A status that were identified from 1823 subjects across China. The search for published mtDNA data sets revealed no other mtDNA besides the above-mentioned three carrying mutation C1494T. None of the 553 randomly selected individuals and the 111 haplogroup A mtDNAs was found to bear this mutation. Therefore, our results suggest that C1494T is a very rare event. The mtDNA haplogroup A background in general is unlikely to play an active role in the penetrance of mutation C1494T in AINHL

  12. The Y-chromosome haplogroup C3*-F3918, likely attributed to the Mongol Empire, can be traced to a 2500-year-old nomadic group.

    Science.gov (United States)

    Zhang, Ye; Wu, Xiyan; Li, Jiawei; Li, Hongjie; Zhao, Yongbin; Zhou, Hui

    2018-02-01

    The Mongol Empire had a significant role in shaping the landscape of modern populations. Many populations living in Eurasia may have been the product of population mixture between ancient Mongolians and natives following the expansion of Mongol Empire. Geneticists have found that most of these populations carried the Y-haplogroup C3* (C-M217). To trace the history of haplogroup (Hg) C3* and to further understand the origin and development of Mongolians, ancient human remains from the Jinggouzi, Chenwugou and Gangga archaeological sites, which belonged to the Donghu, Xianbei and Shiwei, respectively, were analysed. Our results show that nine of the eleven males of the Gangga site, two of the eight males of Chengwugou site and all of the twelve males of Jinggouzi site were found to have mutations at M130 (Hg C), M217 (Hg C3), L1373 (C2b, ISOGG2015), with the absence of mutations at M93 (Hg C3a), P39 (Hg C3b), M48 (Hg C3c), M407 (Hg C3d) and P62 (Hg C3f). These samples were attributed to the Y-chromosome Hg C3* (Hg C2b, ISOGG2015), and most of them were further typed as Hg C2b1a based on the mutation at F3918. Finally, we inferred that the Y-chromosome Hg C3*-F3918 can trace its origins to the Donghu ancient nomadic group.

  13. Examination of HFE associations with childhood leukemia risk and extension to other iron regulatory genes.

    Science.gov (United States)

    Kennedy, Amy E; Kamdar, Kala Y; Lupo, Philip J; Okcu, M Fatih; Scheurer, Michael E; Baum, Marianna K; Dorak, M Tevfik

    2014-09-01

    Hereditary hemochromatosis (HFE) variants correlating with body iron levels have shown associations with cancer risk, including childhood acute lymphoblastic leukemia (ALL). Using a multi-ethnic sample of cases and controls from Houston, TX, we examined two HFE variants (rs1800562 and rs1799945), one transferrin receptor gene (TFRC) variant (rs3817672) and three additional iron regulatory gene (IRG) variants (SLC11A2 rs422982; TMPRSS6 rs855791 and rs733655) for their associations with childhood ALL. Being positive for either of the HFE variants yielded a modestly elevated odds ratio (OR) for childhood ALL risk in males (1.40, 95% CI=0.83-2.35), which increased to 2.96 (95% CI=1.29-6.80) in the presence of a particular TFRC genotype for rs3817672 (P interaction=0.04). The TFRC genotype also showed an ethnicity-specific association, with increased risk observed in non-Hispanic Whites (OR=2.54, 95% CI=1.05-6.12; P interaction with ethnicity=0.02). The three additional IRG SNPs all showed individual risk associations with childhood ALL in males (OR=1.52-2.60). A polygenic model based on the number of variant alleles in five IRG SNPs revealed a linear increase in risk among males with the increasing number of variants possessed (OR=2.0 per incremental change, 95% CI=1.29-3.12; P=0.002). Our results replicated previous HFE risk associations with childhood ALL in a US population and demonstrated novel associations for IRG SNPs, thereby strengthening the hypothesis that iron excess mediated by genetic variants contributes to childhood ALL risk. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Analysis of patients with atypical hemolytic uremic syndrome treated at the Mie University Hospital: concentration of C3 p.I1157T mutation.

    Science.gov (United States)

    Matsumoto, Takeshi; Fan, Xinping; Ishikawa, Eiji; Ito, Masaaki; Amano, Keishirou; Toyoda, Hidemi; Komada, Yoshihiro; Ohishi, Kohshi; Katayama, Naoyuki; Yoshida, Yoko; Matsumoto, Masanori; Fujimura, Yoshihiro; Ikejiri, Makoto; Wada, Hideo; Miyata, Toshiyuki

    2014-11-01

    Atypical hemolytic uremic syndrome (aHUS) is caused by abnormalities of the complement system and has a significantly poor prognosis. The clinical phenotypes of 12 patients in nine families with aHUS with familial or recurrent onset and ADAMTS13 activity of ≥20 % treated at the Mie University Hospital were examined. In seven of the patients, the first episode of aHUS occurred during childhood and ten patients experienced a relapse. All patients had renal dysfunction and three had been treated with hemodialysis. Seven patients experienced probable triggering events including common cold, influenza, bacterial infection and/or vaccination for influenza. All patients had entered remission, and renal function was improved in 11 patients. DNA sequencing of six candidate genes, identified a C3 p.I1157T missense mutation in all eight patients in six families examined and this mutation was causative for aHUS. A causative mutation THBD p.D486Y was also identified in an aHUS patient. Four missense mutations, CFH p.V837I, p.Y1058H, p.V1060L and THBD p.R403K may predispose to aHUS manifestation; the remaining seven missense mutations were likely neutral. In conclusion, the clinical phenotypes of aHUS are various, and there are often trigger factors. The C3 p.I1157T mutation was identified as the causative mutation for aHUS in all patients examined, and may be geographically concentrated in or around the Mie prefecture in central Japan.

  15. Progress of Design Improvements for APR1400 Computerized Procedure System from HFE V and V results and Design Experience

    International Nuclear Information System (INIS)

    Lee, Sungjin; Seong, Nokyu

    2015-01-01

    This study shows major already improved design features from the above three processes and a design proposal for to-be-improving items. APR1400 CPS has been verified and validated by the HFE process, internal design review and site acceptance tests. APR1400 Computerized Procedure System (CPS) has been applied to Shin-Kori Nuclear Power Plant (SKN) 3 and 4 units, Shin-Hanul Nuclear Power Plant (SHN) 1 and 2 units and Baraka Nuclear Power Plant (BNPP) 1, 2, 3 and 4 units. Since APR1400 CPS is a first-of-a-kind (FOAK) human machine interface (HMI) for executing a computerized procedure in the nuclear power plant's main control room in South Korea, it has been continuously improved through a) the human factor engineering (HFE) verification and validation (V and V), b) the internal design review and c) prototype tests. Human engineering discrepancies (HEDs) can be identified by the HFE V and V activity. Some HEDs of APR1400 CPS for SKN 3 and 4 and SHN 1 and 2 have been adopted as a role of design improvement in the CPS system while others were regarded as an operator training requirement or part of task contents. Various requests for improving the CPS have been collected from those results. A HMI system should be improved continuously for removing potential defects. Some of introduced design features in this paper has been adopted for APR1400 nuclear power plants. Some of them are under the review in the CPS design team of KHNP

  16. Novel Compound Heterozygous CLCNKB Gene Mutations (c.1755A>G/ c.848_850delTCT) Cause Classic Bartter Syndrome.

    Science.gov (United States)

    Wang, Chunli; Chen, Ying; Zheng, Bixia; Zhu, Mengshu; Fan, Jia; Wang, Juejin; Jia, Zhanjun; Huang, Songming; Zhang, Aihua

    2018-02-14

    Inactivated variants in CLCNKB gene encoding the basolateral chloride channel ClC-Kb cause classic Bartter syndrome characterized by hypokalemic metabolic alkalosis and hyperreninemic hyperaldosteronism. Here we identified two cBS siblings presenting hypokalemia in a Chinese family due to novel compound heterozygous CLCNKB mutations (c.848_850delTCT/c.1755A>G). Compound heterozygosity was confirmed by amplifying and sequencing the patient's genomic DNA. The synonymous mutation c.1755A>G (Thr585Thr) was located at +2bp from the 5' splice donor site in exon 15, further transcript analysis demonstrated that this single nucleotide mutation causes exclusion of exon 15 in the cDNA from the proband and his mother. Furthermore, we investigated the expression and protein trafficking change of c.848_850delTCT (TCT) and exon 15 deletion(E15)mutation in vitro. The E15 mutation markedly decreased the expression of ClC-Kb and resulted in a low-molecular-weight band (~55kD) trapping in the endoplasmic reticulum, while the TCT mutant only decreased the total and plasma membrane ClC-Kb protein expression but did not affect the subcellular localization. Finally, we studied the physiological functions of mutations by using whole-cell patch clamp and found that E15 or TCT mutation decreased the current of ClC-Kb/barttin channel. These results suggested that the compound defective mutations of CLCNKB gene are the molecular mechanism of the two cBS siblings.

  17. Fatigue Crack Growth Mechanisms for Nickel-based Superalloy Haynes 282 at 550-750 °C

    Science.gov (United States)

    Rozman, Kyle A.; Kruzic, Jamie J.; Sears, John S.; Hawk, Jeffrey A.

    2015-10-01

    The fatigue crack growth rates for nickel-based superalloy Haynes 282 were measured at 550, 650, and 750 °C using compact tension specimens with a load ratio of 0.1 and cyclic loading frequencies of 25 and 0.25 Hz. The crack path was observed to be primarily transgranular for all temperatures, and the observed effect of increasing temperature was to increase the fatigue crack growth rates. The activation energy associated with the increasing crack growth rates over these three temperatures was calculated less than 60 kJ/mol, which is significantly lower than typical creep or oxidation mechanisms; therefore, creep and oxidation cannot explain the increase in fatigue crack growth rates. Transmission electron microscopy was done on selected samples removed from the cyclic plastic zone, and a trend of decreasing dislocation density was observed with increasing temperature. Accordingly, the trend of increasing crack growth rates with increasing temperature was attributed to softening associated with thermally assisted cross slip and dislocation annihilation.

  18. Mutation analysis of the cathepsin C gene in Indian families with Papillon-Lefèvre syndrome

    Directory of Open Access Journals (Sweden)

    Srivastava Satish

    2003-07-01

    Full Text Available Abstract Background PLS is a rare autosomal recessive disorder characterized by early onset periodontopathia and palmar plantar keratosis. PLS is caused by mutations in the cathepsin C (CTSC gene. Dipeptidyl-peptidase I encoded by the CTSC gene removes dipeptides from the amino-terminus of protein substrates and mainly plays an immune and inflammatory role. Several mutations have been reported in this gene in patients from several ethnic groups. We report here mutation analysis of the CTSC gene in three Indian families with PLS. Methods Peripheral blood samples were obtained from individuals belonging to three Indian families with PLS for genomic DNA isolation. Exon-specific intronic primers were used to amplify DNA samples from individuals. PCR products were subsequently sequenced to detect mutations. PCR-SCCP and ASOH analyses were used to determine if mutations were present in normal control individuals. Results All patients from three families had a classic PLS phenotype, which included palmoplantar keratosis and early-onset severe periodontitis. Sequence analysis of the CTSC gene showed three novel nonsense mutations (viz., p.Q49X, p.Q69X and p.Y304X in homozygous state in affected individuals from these Indian families. Conclusions This study reported three novel nonsense mutations in three Indian families. These novel nonsense mutations are predicted to produce truncated dipeptidyl-peptidase I causing PLS phenotype in these families. A review of the literature along with three novel mutations reported here showed that the total number of mutations in the CTSC gene described to date is 41 with 17 mutations being located in exon 7.

  19. Expanding the spectrum of HEXA mutations in Indian patients with Tay-Sachs disease.

    Science.gov (United States)

    Sheth, Jayesh; Mistri, Mehul; Datar, Chaitanya; Kalane, Umesh; Patil, Shekhar; Kamate, Mahesh; Shah, Harshuti; Nampoothiri, Sheela; Gupta, Sarita; Sheth, Frenny

    2014-01-01

    Tay-Sachs disease is an autosomal recessive neurodegenerative disorder occurring due to impaired activity of β-hexosaminidase-A (EC 3.2.1.52), resulting from the mutation in HEXA gene. Very little is known about the molecular pathology of TSD in Indian children except for a few mutations identified by us. The present study is aimed to determine additional mutations leading to Tay-Sachs disease in nine patients confirmed by the deficiency of β-hexosaminidase-A (C (D175A) and c.805G>C (p.G269R) in one case; and one small 1 bp deletion c.426delT (p.F142LfsX57) and one splice site mutation c.459+4A>C in the other two cases respectively. None of these mutations were detected in 100 chromosomes from healthy individuals of the same ethnic group. Three previously reported missense mutations, (i) c.532C>T (p.R178C), (ii) c.964G>T (p.D322Y), and (iii) c.1385A>T (p.E462V); two nonsense mutations (i) c.709C>T (p.Q237X) and (ii) c.1528C>T (p.R510X), one 4 bp insertion c.1277_1278insTATC (p.Y427IfsX5) and one splice site mutation c.459+5G>A were also identified in six cases. We observe from this study that novel mutations are more frequently observed in Indian patients with Tay-Sachs disease with clustering of ~ 73% of disease causing mutations in exons 5 to 12. This database can be used for a carrier rate screening in the larger population of the country.

  20. Carrier frequency of GJB2 gene mutations c.35delG, c.235delC and c.167delT among the populations of Eurasia.

    Science.gov (United States)

    Dzhemileva, Lilya U; Barashkov, Nikolay A; Posukh, Olga L; Khusainova, Rita I; Akhmetova, Vita L; Kutuev, Ildus A; Gilyazova, Irina R; Tadinova, Vera N; Fedorova, Sardana A; Khidiyatova, Irina M; Lobov, Simeon L; Khusnutdinova, Elza K

    2010-11-01

    Hearing impairment is one of the most common disorders of sensorineural function and the incidence of profound prelingual deafness is about 1 per 1000 at birth. GJB2 gene mutations make the largest contribution to hereditary hearing impairment. The spectrum and prevalence of some GJB2 mutations are known to be dependent on the ethnic origin of the population. This study presents data on the carrier frequencies of major GJB2 mutations, c.35delG, c.167delT and c.235delC, among 2308 healthy persons from 18 various populations of Eurasia: Russians, Bashkirs, Tatars, Chuvashes, Udmurts, Komi-Permyaks and Mordvins (Volga-Ural region of Russia); Belarusians and Ukrainians (East Europe); Abkhazians, Avars, Cherkessians and Ingushes (Caucasus); Kazakhs, Uighurs and Uzbeks (Central Asia); and Yakuts and Altaians (Siberia). The data on c.35delG and c.235delC mutation prevalence in the studied ethnic groups can be used to investigate the prospective founder effect in the origin and prevalence of these mutations in Eurasia and consequently in populations around the world.

  1. Cross Sections for Electron-Impact Dissociation of Alternative Etching Gas, C3HF7O

    Science.gov (United States)

    Tanaka, Hideyuki; Toyoda, Hirotaka; Sugai, Hideo

    1998-09-01

    The search for alternative for perfluorocarbon gases from the environmental point of view has resulted in a new etching gas, C3HF7O (1,2,2,2-tetrafluoroethyl-trifluoromethyl ether, abbreviated as HFE-227). In this paper, the first measurement of the absolute cross sections for the dissociation of HFE-227, is reported.The neutral dissociation is measured from the threshold to 250 eV by appearance mass spectrometry in a dual electron beam device.The threshold energies for the neutral dissociation into CF, CF2 and CF3 are 14.7, 12.5 and 11.2 eV, respectively.The cross sections for the dissociation from HFE-227 into CF3 and CF are larger than those from c-C4F8 (octafluorocyclobutane), but not for the dissociation into CF2.Besides the neutral dissociation, the cross sections for the dissociative ionization of HFE-227 are extensively measured for the formation of twelve ionic species, i.e., CO+, CHO+, CF+, CHF+, CFO+, CF2+, CHF2+, CF3+, CHF3+, C2HF2O+, C2HF4+ and C2HF4O+.

  2. NHS Gene Mutations in Ashkenazi Jewish Families with Nance-Horan Syndrome.

    Science.gov (United States)

    Shoshany, Nadav; Avni, Isaac; Morad, Yair; Weiner, Chen; Einan-Lifshitz, Adi; Pras, Eran

    2017-09-01

    To describe ocular and extraocular abnormalities in two Ashkenazi Jewish families with infantile cataract and X-linked inheritance, and to identify their underlying mutations. Seven affected members were recruited. Medical history, clinical findings, and biometric measurements were recorded. Mutation analysis of the Nance-Horan syndrome (NHS) gene was performed by direct sequencing of polymerase chain reaction-amplified exons. An unusual anterior Y-sutural cataract was documented in the affected male proband. Other clinical features among examined patients included microcorneas, long and narrow faces, and current or previous dental anomalies. A nonsense mutation was identified in each family, including a previously described 742 C>T, p.(Arg248*) mutation in Family A, and a novel mutation 2915 C>A, p.(Ser972*) in Family B. Our study expands the repertoire of NHS mutations and the related phenotype, including newly described anterior Y-sutural cataract and dental findings.

  3. Functional analysis of the novel TBX5 c.1333delC mutation resulting in an extended TBX5 protein

    Directory of Open Access Journals (Sweden)

    Ekman-Joelsson Britt-Marie

    2008-10-01

    Full Text Available Abstract Background Autosomal dominant Holt-Oram syndrome (HOS is caused by mutations in the TBX5 gene and is characterized by congenital heart and preaxial radial ray upper limb defects. Most of the TBX5 mutations found in patients with HOS cause premature truncation of the primary TBX5 transcript. TBX5 missense mutations alter the three-dimensional structure of the protein and result in failed nuclear localization or reduced binding to target DNA. In this study we present our functional analyses of the novel and unusual c.1333delC mutation found in a patient with classical HOS. Methods The functional impact of this novel mutation was assessed by investigating the intracellular localization of the resulting TBX5 protein and its ability to activate the expression of its downstream target ANF. Results The deletion of the cytosine is the first TBX5 frameshift mutation predicted to result in an elongated TBX5 protein with 74 miscoding amino acids and 62 supernumerary C-terminal amino acids. The c.1333delC mutation affects neither the nuclear localization, nor its colocalization with SALL4, but severely affects the activation of the ANF promoter. Conclusion The mutation c.1333delC does not locate within functional domains, but impairs the activation of the downstream target. This suggests that misfolding of the protein prevents its biological function.

  4. Expanding the spectrum of HEXA mutations in Indian patients with Tay–Sachs disease

    Directory of Open Access Journals (Sweden)

    Jayesh Sheth

    2014-01-01

    Full Text Available Tay–Sachs disease is an autosomal recessive neurodegenerative disorder occurring due to impaired activity of β-hexosaminidase-A (EC 3.2.1.52, resulting from the mutation in HEXA gene. Very little is known about the molecular pathology of TSD in Indian children except for a few mutations identified by us. The present study is aimed to determine additional mutations leading to Tay–Sachs disease in nine patients confirmed by the deficiency of β-hexosaminidase-A (C (D175A and c.805G>C (p.G269R in one case; and one small 1 bp deletion c.426delT (p.F142LfsX57 and one splice site mutation c.459+4A>C in the other two cases respectively. None of these mutations were detected in 100 chromosomes from healthy individuals of the same ethnic group. Three previously reported missense mutations, (i c.532C>T (p.R178C, (ii c.964G>T (p.D322Y, and (iii c.1385A>T (p.E462V; two nonsense mutations (i c.709C>T (p.Q237X and (ii c.1528C>T (p.R510X, one 4 bp insertion c.1277_1278insTATC (p.Y427IfsX5 and one splice site mutation c.459+5G>A were also identified in six cases. We observe from this study that novel mutations are more frequently observed in Indian patients with Tay–Sachs disease with clustering of ~73% of disease causing mutations in exons 5 to 12. This database can be used for a carrier rate screening in the larger population of the country.

  5. Lamin A/C mutations with lipodystrophy, cardiac abnormalities, and muscular dystrophy

    NARCIS (Netherlands)

    van der Kooi, A. J.; Bonne, G.; Eymard, B.; Duboc, D.; Talim, B.; van der Valk, M.; Reiss, P.; Richard, P.; Demay, L.; Merlini, L.; Schwartz, K.; Busch, H. F. M.; de Visser, M.

    2002-01-01

    Mutations in the lamin A/C gene are found in Emery-Dreifuss muscular dystrophy, limb girdle muscular dystrophy with cardiac conduction disturbances, dilated cardiomyopathy with conduction system disease, and familial partial lipodystrophy. Cases with lamin A/C mutations presenting with lipodystrophy

  6. cDNA sequencing improves the detection of P53 missense mutations in colorectal cancer

    International Nuclear Information System (INIS)

    Szybka, Malgorzata; Kordek, Radzislaw; Zakrzewska, Magdalena; Rieske, Piotr; Pasz-Walczak, Grazyna; Kulczycka-Wojdala, Dominika; Zawlik, Izabela; Stawski, Robert; Jesionek-Kupnicka, Dorota; Liberski, Pawel P

    2009-01-01

    Recently published data showed discrepancies beteween P53 cDNA and DNA sequencing in glioblastomas. We hypothesised that similar discrepancies may be observed in other human cancers. To this end, we analyzed 23 colorectal cancers for P53 mutations and gene expression using both DNA and cDNA sequencing, real-time PCR and immunohistochemistry. We found P53 gene mutations in 16 cases (15 missense and 1 nonsense). Two of the 15 cases with missense mutations showed alterations based only on cDNA, and not DNA sequencing. Moreover, in 6 of the 15 cases with a cDNA mutation those mutations were difficult to detect in the DNA sequencing, so the results of DNA analysis alone could be misinterpreted if the cDNA sequencing results had not also been available. In all those 15 cases, we observed a higher ratio of the mutated to the wild type template by cDNA analysis, but not by the DNA analysis. Interestingly, a similar overexpression of P53 mRNA was present in samples with and without P53 mutations. In terms of colorectal cancer, those discrepancies might be explained under three conditions: 1, overexpression of mutated P53 mRNA in cancer cells as compared with normal cells; 2, a higher content of cells without P53 mutation (normal cells and cells showing K-RAS and/or APC but not P53 mutation) in samples presenting P53 mutation; 3, heterozygous or hemizygous mutations of P53 gene. Additionally, for heterozygous mutations unknown mechanism(s) causing selective overproduction of mutated allele should also be considered. Our data offer new clues for studying discrepancy in P53 cDNA and DNA sequencing analysis

  7. Low Base-Substitution Mutation Rate in the Germline Genome of the Ciliate Tetrahymena thermophila

    Science.gov (United States)

    2016-09-15

    Tetrahymena thermophila, a model eukaryote. PLoS Biol. 4:e286. Farlow A, et al. 2015. The spontaneous mutation rate in the fission yeast Schizosaccharomyces...spontane- ous mutations in yeast . Proc Natl Acad Sci U S A. 105:9272–9277. Lynn DH, Doerder FP. 2012. The life and times of Tetrahymena. Methods Cell...Low Base-Substitution Mutation Rate in the Germline Genome of the Ciliate Tetrahymena thermophila Hongan Long1,2,y, David J. Winter3,*,y, Allan Y.-C

  8. 7 CFR 282.2 - Funding.

    Science.gov (United States)

    2010-01-01

    ... of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE FOOD STAMP AND FOOD DISTRIBUTION PROGRAM DEMONSTRATION, RESEARCH, AND EVALUATION PROJECTS § 282.2 Funding. Federal financial participation may be made available to demonstration, research, and evaluation...

  9. Non-coding keratin variants associate with liver fibrosis progression in patients with hemochromatosis.

    Directory of Open Access Journals (Sweden)

    Pavel Strnad

    Full Text Available BACKGROUND: Keratins 8 and 18 (K8/K18 are intermediate filament proteins that protect the liver from various forms of injury. Exonic K8/K18 variants associate with adverse outcome in acute liver failure and with liver fibrosis progression in patients with chronic hepatitis C infection or primary biliary cirrhosis. Given the association of K8/K18 variants with end-stage liver disease and progression in several chronic liver disorders, we studied the importance of keratin variants in patients with hemochromatosis. METHODS: The entire K8/K18 exonic regions were analyzed in 162 hemochromatosis patients carrying homozygous C282Y HFE (hemochromatosis gene mutations. 234 liver-healthy subjects were used as controls. Exonic regions were PCR-amplified and analyzed using denaturing high-performance liquid chromatography and DNA sequencing. Previously-generated transgenic mice overexpressing K8 G62C were studied for their susceptibility to iron overload. Susceptibility to iron toxicity of primary hepatocytes that express K8 wild-type and G62C was also assessed. RESULTS: We identified amino-acid-altering keratin heterozygous variants in 10 of 162 hemochromatosis patients (6.2% and non-coding heterozygous variants in 6 additional patients (3.7%. Two novel K8 variants (Q169E/R275W were found. K8 R341H was the most common amino-acid altering variant (4 patients, and exclusively associated with an intronic KRT8 IVS7+10delC deletion. Intronic, but not amino-acid-altering variants associated with the development of liver fibrosis. In mice, or ex vivo, the K8 G62C variant did not affect iron-accumulation in response to iron-rich diet or the extent of iron-induced hepatocellular injury. CONCLUSION: In patients with hemochromatosis, intronic but not exonic K8/K18 variants associate with liver fibrosis development.

  10. Moral, cultura y ley: estudios latinoamericanos sobre seguridad ciudadana

    Directory of Open Access Journals (Sweden)

    Josefina Echavarría Álvarez

    2014-03-01

    Full Text Available Antípodas de la violencia. Desafíos de cultura ciudadana para la crisis de (inseguridad en América Latina. Antanas Mockus,Henry Murraín y María Villa (coords. Corporación Visionarios por Colombia (Corpovisionarios, Banco Interamericano de Desarrollo, Washington D. C., 2012, 282 págs., il.

  11. Genomic profiling of CHEK2*1100delC-mutated breast carcinomas

    International Nuclear Information System (INIS)

    Massink, Maarten P. G.; Kooi, Irsan E.; Martens, John W. M.; Waisfisz, Quinten; Meijers-Heijboer, Hanne

    2015-01-01

    CHEK2*1100delC is a moderate-risk breast cancer susceptibility allele with a high prevalence in the Netherlands. We performed copy number and gene expression profiling to investigate whether CHEK2*1100delC breast cancers harbor characteristic genomic aberrations, as seen for BRCA1 mutated breast cancers. We performed high-resolution SNP array and gene expression profiling of 120 familial breast carcinomas selected from a larger cohort of 155 familial breast tumors, including BRCA1, BRCA2, and CHEK2 mutant tumors. Gene expression analyses based on a mRNA immune signature was used to identify samples with relative low amounts of tumor infiltrating lymphocytes (TILs), which were previously found to disturb tumor copy number and LOH (loss of heterozygosity) profiling. We specifically compared the genomic and gene expression profiles of CHEK2*1100delC breast cancers (n = 14) with BRCAX (familial non-BRCA1/BRCA2/CHEK2*1100delC mutated) breast cancers (n = 34) of the luminal intrinsic subtypes for which both SNP-array and gene expression data is available. High amounts of TILs were found in a relatively small number of luminal breast cancers as compared to breast cancers of the basal-like subtype. As expected, these samples mostly have very few copy number aberrations and no detectable regions of LOH. By unsupervised hierarchical clustering of copy number data we observed a great degree of heterogeneity amongst the CHEK2*1100delC breast cancers, comparable to the BRCAX breast cancers. Furthermore, copy number aberrations were mostly seen at low frequencies in both the CHEK2*1100delC and BRCAX group of breast cancers. However, supervised class comparison identified copy number loss of chromosomal arm 1p to be associated with CHEK2*1100delC status. In conclusion, in contrast to basal-like BRCA1 mutated breast cancers, no apparent specific somatic copy number aberration (CNA) profile for CHEK2*1100delC breast cancers was found. With the possible exception of copy number loss

  12. Functional characterization of c-Mpl ectodomain mutations that underlie congenital amegakaryocytic thrombocytopenia.

    Science.gov (United States)

    Varghese, Leila N; Zhang, Jian-Guo; Young, Samuel N; Willson, Tracy A; Alexander, Warren S; Nicola, Nicos A; Babon, Jeffrey J; Murphy, James M

    2014-02-01

    Activation of the cell surface receptor, c-Mpl, by the cytokine, thrombopoietin (TPO), underpins megakaryocyte and platelet production in mammals. In humans, mutations in c-Mpl have been identified as the molecular basis of Congenital Amegakaryocytic Thrombocytopenia (CAMT). Here, we show that CAMT-associated mutations in c-Mpl principally lead to defective receptor presentation on the cell surface. In contrast, one CAMT mutant c-Mpl, F104S, was expressed on the cell surface, but showed defective TPO binding and receptor activation. Using mutational analyses, we examined which residues adjacent to F104 within the membrane-distal cytokine receptor homology module (CRM) of c-Mpl comprise the TPO-binding epitope, revealing residues within the predicted Domain 1 E-F and A-B loops and Domain 2 F'-G' loop as key TPO-binding determinants. These studies underscore the importance of the c-Mpl membrane-distal CRM to TPO-binding and suggest that mutations within this CRM that perturb TPO binding could give rise to CAMT.

  13. Mutation of the S and 3c genes in genomes of feline coronaviruses.

    Science.gov (United States)

    Oguma, Keisuke; Ohno, Megumi; Yoshida, Mayuko; Sentsui, Hiroshi

    2018-05-17

    Feline coronavirus (FCoV) is classified into two biotypes based on its pathogenicity in cats: a feline enteric coronavirus of low pathogenicity and a highly virulent feline infectious peritonitis virus. It has been suspected that FCoV alters its biotype via mutations in the viral genome. The S and 3c genes of FCoV have been considered the candidates for viral pathogenicity conversion. In the present study, FCoVs were analyzed for the frequency and location of mutations in the S and 3c genes from faecal samples of cats in an animal shelter and the faeces, effusions, and tissues of cats that were referred to veterinary hospitals. Our results indicated that approximately 95% FCoVs in faeces did not carry mutations in the two genes. However, 80% FCoVs in effusion samples exhibited mutations in the S and 3c genes with remainder displaying a mutation in the S or 3c gene. It was also suggested that mutational analysis of the 3c gene could be useful for studying the horizontal transmission of FCoVs in multi-cat environments.

  14. Haplotype analysis suggest that the MLH1 c.2059C > T mutation is a Swedish founder mutation.

    Science.gov (United States)

    von Salomé, Jenny; Liu, Tao; Keihäs, Markku; Morak, Moni; Holinski-Feder, Elke; Berry, Ian R; Moilanen, Jukka S; Baert-Desurmont, Stéphanie; Lindblom, Annika; Lagerstedt-Robinson, Kristina

    2017-12-29

    Lynch syndrome (LS) predisposes to a spectrum of cancers and increases the lifetime risk of developing colorectal- or endometrial cancer to over 50%. Lynch syndrome is dominantly inherited and is caused by defects in DNA mismatch-repair genes MLH1, MSH2, MSH6 or PMS2, with the vast majority detected in MLH1 and MSH2. Recurrent LS-associated variants observed in apparently unrelated individuals, have either arisen de novo in different families due to mutation hotspots, or are inherited from a founder (a common ancestor) that lived several generations back. There are variants that recur in some populations while also acting as founders in other ethnic groups. Testing for founder mutations can facilitate molecular diagnosis of Lynch Syndrome more efficiently and more cost effective than screening for all possible mutations. Here we report a study of the missense mutation MLH1 c.2059C > T (p.Arg687Trp), a potential founder mutation identified in eight Swedish families and one Finnish family with Swedish ancestors. Haplotype analysis confirmed that the Finnish and Swedish families shared a haplotype of between 0.9 and 2.8 Mb. While MLH1 c.2059C > T exists worldwide, the Swedish haplotype was not found among mutation carriers from Germany or France, which indicates a common founder in the Swedish population. The geographic distribution of MLH1 c.2059C > T in Sweden suggests a single, ancient mutational event in the northern part of Sweden.

  15. Novel C16orf57 mutations in patients with Poikiloderma with Neutropenia: bioinformatic analysis of the protein and predicted effects of all reported mutations

    Directory of Open Access Journals (Sweden)

    Colombo Elisa A

    2012-01-01

    Full Text Available Abstract Background Poikiloderma with Neutropenia (PN is a rare autosomal recessive genodermatosis caused by C16orf57 mutations. To date 17 mutations have been identified in 31 PN patients. Results We characterize six PN patients expanding the clinical phenotype of the syndrome and the mutational repertoire of the gene. We detect the two novel C16orf57 mutations, c.232C>T and c.265+2T>G, as well as the already reported c.179delC, c.531delA and c.693+1G>T mutations. cDNA analysis evidences the presence of aberrant transcripts, and bioinformatic prediction of C16orf57 protein structure gauges the mutations effects on the folded protein chain. Computational analysis of the C16orf57 protein shows two conserved H-X-S/T-X tetrapeptide motifs marking the active site of a two-fold pseudosymmetric structure recalling the 2H phosphoesterase superfamily. Based on this model C16orf57 is likely a 2H-active site enzyme functioning in RNA processing, as a presumptive RNA ligase. According to bioinformatic prediction, all known C16orf57 mutations, including the novel mutations herein described, impair the protein structure by either removing one or both tetrapeptide motifs or by destroying the symmetry of the native folding. Finally, we analyse the geographical distribution of the recurrent mutations that depicts clusters featuring a founder effect. Conclusions In cohorts of patients clinically affected by genodermatoses with overlapping symptoms, the molecular screening of C16orf57 gene seems the proper way to address the correct diagnosis of PN, enabling the syndrome-specific oncosurveillance. The bioinformatic prediction of the C16orf57 protein structure denotes a very basic enzymatic function consistent with a housekeeping function. Detection of aberrant transcripts, also in cells from PN patients carrying early truncated mutations, suggests they might be translatable. Tissue-specific sensitivity to the lack of functionally correct protein accounts for the

  16. The Effects of Degraded Digital Instrumentation and Control Systems on Human-system Interfaces and Operator Performance: HFE Review Guidance and Technical Basis

    Energy Technology Data Exchange (ETDEWEB)

    O' Hara, J.M.; W. Gunther, G. Martinez-Guridi

    2010-02-26

    New and advanced reactors will use integrated digital instrumentation and control (I&C) systems to support operators in their monitoring and control functions. Even though digital systems are typically highly reliable, their potential for degradation or failure could significantly affect operator performance and, consequently, impact plant safety. The U.S. Nuclear Regulatory Commission (NRC) supported this research project to investigate the effects of degraded I&C systems on human performance and plant operations. The objective was to develop human factors engineering (HFE) review guidance addressing the detection and management of degraded digital I&C conditions by plant operators. We reviewed pertinent standards and guidelines, empirical studies, and plant operating experience. In addition, we conducted an evaluation of the potential effects of selected failure modes of the digital feedwater system on human-system interfaces (HSIs) and operator performance. The results indicated that I&C degradations are prevalent in plants employing digital systems and the overall effects on plant behavior can be significant, such as causing a reactor trip or causing equipment to operate unexpectedly. I&C degradations can impact the HSIs used by operators to monitor and control the plant. For example, sensor degradations can make displays difficult to interpret and can sometimes mislead operators by making it appear that a process disturbance has occurred. We used the information obtained as the technical basis upon which to develop HFE review guidance. The guidance addresses the treatment of degraded I&C conditions as part of the design process and the HSI features and functions that support operators to monitor I&C performance and manage I&C degradations when they occur. In addition, we identified topics for future research.

  17. N1303K (c.3909C>G) Mutation and Splicing: Implication of Its c.[744-33GATT(6); 869+11C>T] Complex Allele in CFTR Exon 7 Aberrant Splicing

    Science.gov (United States)

    Farhat, Raëd; Puissesseau, Géraldine; El-Seedy, Ayman; Pasquet, Marie-Claude; Adolphe, Catherine; Corbani, Sandra; Megarbané, André; Kitzis, Alain; Ladeveze, Véronique

    2015-01-01

    Cystic Fibrosis is the most common recessive autosomal rare disease found in Caucasians. It is caused by mutations on the Cystic Fibrosis Transmembrane Conductance Regulator gene (CFTR) that encodes a protein located on the apical membrane of epithelial cells. c.3909C>G (p.Asn1303Lys, old nomenclature: N1303K) is one of the most common worldwide mutations. This mutation has been found at high frequencies in the Mediterranean countries with the highest frequency in the Lebanese population. Therefore, on the genetic level, we conducted a complete CFTR gene screening on c.3909C>G Lebanese patients. The complex allele c.[744-33GATT(6); 869+11C>T] was always associated with the c.3909C>G mutation in cis in the Lebanese population. In cellulo splicing studies, realized by hybrid minigene constructs, revealed no impact of the c.3909C>G mutation on the splicing process, whereas the associated complex allele induces minor exon skipping. PMID:26075213

  18. HAEdb: a novel interactive, locus-specific mutation database for the C1 inhibitor gene.

    Science.gov (United States)

    Kalmár, Lajos; Hegedüs, Tamás; Farkas, Henriette; Nagy, Melinda; Tordai, Attila

    2005-01-01

    Hereditary angioneurotic edema (HAE) is an autosomal dominant disorder characterized by episodic local subcutaneous and submucosal edema and is caused by the deficiency of the activated C1 esterase inhibitor protein (C1-INH or C1INH; approved gene symbol SERPING1). Published C1-INH mutations are represented in large universal databases (e.g., OMIM, HGMD), but these databases update their data rather infrequently, they are not interactive, and they do not allow searches according to different criteria. The HAEdb, a C1-INH gene mutation database (http://hae.biomembrane.hu) was created to contribute to the following expectations: 1) help the comprehensive collection of information on genetic alterations of the C1-INH gene; 2) create a database in which data can be searched and compared according to several flexible criteria; and 3) provide additional help in new mutation identification. The website uses MySQL, an open-source, multithreaded, relational database management system. The user-friendly graphical interface was written in the PHP web programming language. The website consists of two main parts, the freely browsable search function, and the password-protected data deposition function. Mutations of the C1-INH gene are divided in two parts: gross mutations involving DNA fragments >1 kb, and micro mutations encompassing all non-gross mutations. Several attributes (e.g., affected exon, molecular consequence, family history) are collected for each mutation in a standardized form. This database may facilitate future comprehensive analyses of C1-INH mutations and also provide regular help for molecular diagnostic testing of HAE patients in different centers.

  19. The HCM-linked W792R mutation in cardiac myosin-binding protein C reduces C6 FnIII domain stability.

    Science.gov (United States)

    Smelter, Dan F; de Lange, Willem J; Cai, Wenxuan; Ge, Ying; Ralphe, J Carter

    2018-06-01

    Cardiac myosin-binding protein C (cMyBP-C) is a functional sarcomeric protein that regulates contractility in response to contractile demand, and many mutations in cMyBP-C lead to hypertrophic cardiomyopathy (HCM). To gain insight into the effects of disease-causing cMyBP-C missense mutations on contractile function, we expressed the pathogenic W792R mutation (substitution of a highly conserved tryptophan residue by an arginine residue at position 792) in mouse cardiomyocytes lacking endogenous cMyBP-C and studied the functional effects using three-dimensional engineered cardiac tissue constructs (mECTs). Based on complete conservation of tryptophan at this location in fibronectin type II (FnIII) domains, we hypothesized that the W792R mutation affects folding of the C6 FnIII domain, destabilizing the mutant protein. Adenoviral transduction of wild-type (WT) and W792R cDNA achieved equivalent mRNA transcript abundance, but not equivalent protein levels, with W792R compared with WT controls. mECTs expressing W792R demonstrated abnormal contractile kinetics compared with WT mECTs that were nearly identical to cMyBP-C-deficient mECTs. We studied whether common pathways of protein degradation were responsible for the rapid degradation of W792R cMyBP-C. Inhibition of both ubiquitin-proteasome and lysosomal degradation pathways failed to increase full-length mutant protein abundance to WT equivalence, suggesting rapid cytosolic degradation. Bacterial expression of WT and W792R protein fragments demonstrated decreased mutant stability with altered thermal denaturation and increased susceptibility to trypsin digestion. These data suggest that the W792R mutation destabilizes the C6 FnIII domain of cMyBP-C, resulting in decreased full-length protein expression. This study highlights the vulnerability of FnIII-like domains to mutations that alter domain stability and further indicates that missense mutations in cMyBP-C can cause disease through a mechanism of

  20. Cardiac myosin binding protein C phosphorylation affects cross-bridge cycle's elementary steps in a site-specific manner.

    Directory of Open Access Journals (Sweden)

    Li Wang

    Full Text Available Based on our recent finding that cardiac myosin binding protein C (cMyBP-C phosphorylation affects muscle contractility in a site-specific manner, we further studied the force per cross-bridge and the kinetic constants of the elementary steps in the six-state cross-bridge model in cMyBP-C mutated transgenic mice for better understanding of the influence of cMyBP-C phosphorylation on contractile functions. Papillary muscle fibres were dissected from cMyBP-C mutated mice of ADA (Ala273-Asp282-Ala302, DAD (Asp273-Ala282-Asp302, SAS (Ser273-Ala282-Ser302, and t/t (cMyBP-C null genotypes, and the results were compared to transgenic mice expressing wide-type (WT cMyBP-C. Sinusoidal analyses were performed with serial concentrations of ATP, phosphate (Pi, and ADP. Both t/t and DAD mutants significantly reduced active tension, force per cross-bridge, apparent rate constant (2πc, and the rate constant of cross-bridge detachment. In contrast to the weakened ATP binding and enhanced Pi and ADP release steps in t/t mice, DAD mice showed a decreased ADP release without affecting the ATP binding and the Pi release. ADA showed decreased ADP release, and slightly increased ATP binding and cross-bridge detachment steps, whereas SAS diminished the ATP binding step and accelerated the ADP release step. t/t has the broadest effects with changes in most elementary steps of the cross-bridge cycle, DAD mimics t/t to a large extent, and ADA and SAS predominantly affect the nucleotide binding steps. We conclude that the reduced tension production in DAD and t/t is the result of reduced force per cross-bridge, instead of the less number of strongly attached cross-bridges. We further conclude that cMyBP-C is an allosteric activator of myosin to increase cross-bridge force, and its phosphorylation status modulates the force, which is regulated by variety of protein kinases.

  1. Two novel mutations in surfactant protein-C, lung function and obstructive lung disease

    DEFF Research Database (Denmark)

    Baekvad-Hansen, Marie; Nordestgaard, Børge G; Tybjaerg-Hansen, Anne

    2010-01-01

    ,604) and the Copenhagen General Population Study(n=37,337) to assess the clinical relevance of these mutations. Genotyping identified 36 individuals heterozygous for A53T and 3 individuals heterozygous for Y106X. A53T heterozygotes and Y106X heterozygotes did not differ from non-carriers in FEV(1)% predicted, FVC...... or disease in the general population. We resequenced the SFTPC gene in 760 individuals and identified 18 genetic variants, of which 5 were novel. Of the five novel mutations, two were situated in highly conserved areas of the SFTPC gene: A53T and Y106X. We genotyped the Copenhagen City Heart Study(n=10......% predicted or FEV(1)/FVC. A53T heterozygotes had a two-fold increased risk for asthma in the Copenhagen City Heart Study and Copenhagen General Population Study combined (adjusted odds ratio 2.2(1.0-4.9)). A53T heterozygotes did not differ consistently from non-carriers in risk of chronic obstructive...

  2. Detection of a de novo Y278C mutation in FGFR3 in a pregnancy with severe fetal hypochondroplasia: prenatal diagnosis and literature review.

    Science.gov (United States)

    Chen, Chih-Ping; Su, Yi-Ning; Lin, Tzu-Hung; Chang, Tung-Yao; Su, Jun-Wei; Wang, Wayseen

    2013-12-01

    We describe a prenatal molecular diagnosis of hypochondroplasia (HCH) in a pregnancy not at risk of HCH and review the literature on prenatal diagnosis of HCH. A 28-year-old primigravid woman was referred for genetic counseling at 30 weeks of gestation because of short-limbed dwarfism in the fetus. The woman had a body height of 152 cm. Her husband had a body height of 180 cm. Level II ultrasound showed a normal amount of amniotic fluid and a singleton fetus with fetal biometry equivalent to 30 weeks except for short limbs. Fetal biometry measurements were as follows: biparietal diameter = 7.38 cm (30 weeks); head circumference = 28.14 cm (30 weeks); abdominal circumference (AC) = 24.64 cm (30 weeks); femur length (FL) = 3.97 cm ( 0.18); humerus = 3.64 cm (diagnosis of achondroplasia (ACH) was made. DNA testing for the FGFR3 gene and whole-genome array comparative genomic hybridization (aCGH) analysis were performed using cord blood DNA obtained by cordocentesis. FGFR3 mutation analysis revealed a de novo heterozygous c.833A > G, TAC > TGC transversion in exon 7 leading to a p.Tyr278Cys (Y278C) mutation in the FGFR3 protein. aCGH analysis revealed no genomic imbalance in cord blood. After delivery, the fetus had short limbs, a narrow thorax, brachydactyly, and relative macrocephaly. Cytogenetic analysis of cultured placental cells revealed a karyotype of 46,XX. Prenatal diagnosis of abnormal ultrasound findings suspicious of ACH should include a differential diagnosis of HCH by molecular analysis of FGFR3. Copyright © 2013. Published by Elsevier B.V.

  3. 32 CFR 282.4 - Policy.

    Science.gov (United States)

    2010-07-01

    ... certain claim settlement and advance decision functions that, by statute or delegation, are vested in the... SETTLING PERSONNEL AND GENERAL CLAIMS AND PROCESSING ADVANCE DECISION REQUESTS § 282.4 Policy. It is DoD policy that: (a) Claims shall be settled and advance decisions rendered in accordance with all pertinent...

  4. A homozygous nonsense CEP250 mutation combined with a heterozygous nonsense C2orf71 mutation is associated with atypical Usher syndrome.

    Science.gov (United States)

    Khateb, Samer; Zelinger, Lina; Mizrahi-Meissonnier, Liliana; Ayuso, Carmen; Koenekoop, Robert K; Laxer, Uri; Gross, Menachem; Banin, Eyal; Sharon, Dror

    2014-07-01

    Usher syndrome (USH) is a heterogeneous group of inherited retinitis pigmentosa (RP) and sensorineural hearing loss (SNHL) caused by mutations in at least 12 genes. Our aim is to identify additional USH-related genes. Clinical examination included visual acuity test, funduscopy and electroretinography. Genetic analysis included homozygosity mapping and whole exome sequencing (WES). A combination of homozygosity mapping and WES in a large consanguineous family of Iranian Jewish origin revealed nonsense mutations in two ciliary genes: c.3289C>T (p.Q1097*) in C2orf71 and c.3463C>T (p.R1155*) in centrosome-associated protein CEP250 (C-Nap1). The latter has not been associated with any inherited disease and the c.3463C>T mutation was absent in control chromosomes. Patients who were double homozygotes had SNHL accompanied by early-onset and severe RP, while patients who were homozygous for the CEP250 mutation and carried a single mutant C2orf71 allele had SNHL with mild retinal degeneration. No ciliary structural abnormalities in the respiratory system were evident by electron microscopy analysis. CEP250 expression analysis of the mutant allele revealed the generation of a truncated protein lacking the NEK2-phosphorylation region. A homozygous nonsense CEP250 mutation, in combination with a heterozygous C2orf71 nonsense mutation, causes an atypical form of USH, characterised by early-onset SNHL and a relatively mild RP. The severe retinal involvement in the double homozygotes indicates an additive effect caused by nonsense mutations in genes encoding ciliary proteins. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  5. Variations in CCR5, but not HFE, ELMO1, or SLC12A3, are associated with susceptibility to kidney disease in north Indian individuals with type 2 diabetes.

    Science.gov (United States)

    Yadav, Ashok K; Kumar, Vinod; Dutta, Pinaki; Bhansali, Anil; Jha, Vivekanand

    2014-11-01

    Diabetic nephropathy (DN), the leading cause of end-stage renal disease worldwide, may have a genetic component. In the present study, we investigated variations in a set of genes with susceptibility to DN in a north Indian population. Four genes (HFE, ELMO1, SLC12A3, and CCR5) were selected on the basis of reported association with type 2 diabetes and nephropathy. In all, 417 diabetic subjects (215 without kidney disease [DM] and 202 with DN) and 197 healthy controls (HC) were evaluated for variations in HFE (845 G>A and 187G>C), SLC12A3 (g.34372G>A), CCR5 (59029A>G), and ELMO1 (+9170 G>A). Polymorphism analysis was performed by polymerase chain reaction-restriction fragment length polymorphism and Taqman allele discrimination assays. Significant differences were found in genotype and allelic frequency in SLC12A3 (g.34372G>A) between diabetic subjects and HC (P A (AA+GA) genotype between diabetic subjects with and without nephropathy. However, the CCR5 59029AA genotype and A allele were significantly more frequent in diabetics compared with the HC (P = 0.01 and 0.03, respectively) and subjects with DN versus DM (P = 0.002 and 0.01, respectively). For ELMO1 (+9170 G>A), the GG genotype frequency was higher in the diabetic versus HC group. There were no differences in the frequency of HFE-845 G>A and HFE-187G>C among the groups. This study shows that the CCR5 AA genotype is over-represented in subjects with kidney disease due to type 2 diabetes. The CCR5 59029G>A and ELMO1 (+9170 G>A) loci are more frequent, and the SLC12A3 34372 AA genotype is associated with a reduced risk of diabetes. © 2014 Ruijin Hospital, Shanghai Jiaotong University School of Medicine and Wiley Publishing Asia Pty Ltd.

  6. A nonsense mutation in cGMP-dependent type II protein kinase (PRKG2) causes dwarfism in American Angus cattle.

    Science.gov (United States)

    Koltes, James E; Mishra, Bishnu P; Kumar, Dinesh; Kataria, Ranjit S; Totir, Liviu R; Fernando, Rohan L; Cobbold, Rowland; Steffen, David; Coppieters, Wouter; Georges, Michel; Reecy, James M

    2009-11-17

    Historically, dwarfism was the major genetic defect in U.S. beef cattle. Aggressive culling and sire testing were used to minimize its prevalence; however, neither of these practices can eliminate a recessive genetic defect. We assembled a 4-generation pedigree to identify the mutation underlying dwarfism in American Angus cattle. An adaptation of the Elston-Steward algorithm was used to overcome small pedigree size and missing genotypes. The dwarfism locus was fine-mapped to BTA6 between markers AFR227 and BM4311. Four candidate genes were sequenced, revealing a nonsense mutation in exon 15 of cGMP-dependant type II protein kinase (PRKG2). This C/T transition introduced a stop codon (R678X) that truncated 85 C-terminal amino acids, including a large portion of the kinase domain. Of the 75 mutations discovered in this region, only this mutation was 100% concordant with the recessive pattern of inheritance in affected and carrier individuals (log of odds score = 6.63). Previous research has shown that PRKG2 regulates SRY (sex-determining region Y) box 9 (SOX9)-mediated transcription of collagen 2 (COL2). We evaluated the ability of wild-type (WT) or R678X PRKG2 to regulate COL2 expression in cell culture. Real-time PCR results confirmed that COL2 is overexpressed in cells that overexpressed R678X PRKG2 as compared with WT PRKG2. Furthermore, COL2 and COL10 mRNA expression was increased in dwarf cattle compared with unaffected cattle. These experiments indicate that the R678X mutation is functional, resulting in a loss of PRKG2 regulation of COL2 and COL10 mRNA expression. Therefore, we present PRKG2 R678X as a causative mutation for dwarfism cattle.

  7. Population-based analysis of the frequency of HFE gene polymorphisms: Correlation with the susceptibility to develop hereditary hemochromatosis.

    Science.gov (United States)

    Katsarou, Martha-Spyridoula; Latsi, Rosana; Papasavva, Maria; Demertzis, Nikolaos; Kalogridis, Thodoris; Tsatsakis, Aristides M; Spandidos, Demetrios A; Drakoulis, Nikolaos

    2016-07-01

    Hereditary hemochromatosis (HH) is an autosomal recessive genetic disease, characterized by increased dietary iron absorption. Due to the absence of an effective excretory mechanism, the excess iron in the body may accumulate resulting in toxic effects. The HFE gene also affects the activity of hepcidin, a hormone which acts as a negative regulator of iron metabolism. In this study, we performed a population-based analysis of the distribution of three hemochromatosis-related polymorphisms in the HFE gene (rs1800562, rs1799945 and rs1800730). DNA from 1,446 non‑related individuals of Greek ethnicity was collected and analyzed, either from whole blood or buccal swabs. The frequency distribution of these HFE gene polymorphisms was then determined. The results revealed that in our Greek population cohort (gr) the frequencies of each polymorphism were as follows: rs1800562: GG (wild‑type)=97.0%, GA=1.5%, AA=1.5%; rs1799945: CC (wild‑type)=74.4%, CG=23.4%, GG=2.2%; rs1800730: AA (wild‑type)=98.1%, AT=1.5% and TT=0.4%. No association between the HFE polymorphisms rs1800562, rs1799945 and rs1800730 and gender could be established. As regards the rs1800562 polymorphism, the A allele (mutant) was ~1.8‑fold more frequent in the European population (eur) than in the Greek population [(gr)=2,3%<(eur)=4%]. As for the rs1799945 polymorphism, the G allele (mutant) was 1.2‑fold more frequent in the European population than in the Greek population [(gr)=13,9%<(eur)=17%]. As regards the rs1800730 polymorphism, the T allele (mutant) was ~1.7‑fold more frequent in the European population than in the Greek population [(gr)=1.2%<(eur)=2%]. However, these pathogenic mutations were found more frequently in the Greek population compared to the global population (gl) [rs1800562: (gl)=1%<(gr)=2,3%; rs1799945: (gl)=7%<(gr)=13,9%; rs1800730: (gl)=<1%<(gr)=1.2%]. This suggests that the Greek population may differ genetically from the northern European population

  8. An intronic mutation c.6430-3C>G in the F8 gene causes splicing efficiency and premature termination in hemophilia A.

    Science.gov (United States)

    Xia, Zunjing; Lin, Jie; Lu, Lingping; Kim, Chol; Yu, Ping; Qi, Ming

    2018-06-01

    : Hemophilia A is a bleeding disorder caused by coagulation factor VIII protein deficiency or dysfunction, which is classified into severe, moderate, and mild according to factor clotting activity. An overwhelming majority of missense and nonsense mutations occur in exons of F8 gene, whereas mutations in introns can also be pathogenic. This study aimed to investigate the effect of an intronic mutation, c.6430-3C>G (IVS22-3C>G), on pre-mRNA splicing of the F8 gene. We applied DNA and cDNA sequencing in a Chinese boy with hemophilia A to search if any pathogenic mutation in the F8 gene. Functional analysis was performed to investigate the effect of an intronic mutation at the transcriptional level. Human Splicing Finder and PyMol were also used to predict its effect. We found the mutation c.6430-3C>G (IVS22-3C>G) in the F8 gene in the affected boy, with his mother being a carrier. cDNA from the mother and pSPL3 splicing assay showed that the mutation IVS22-3C>G results in a two-nucleotide AG inclusion at the 3' end of intron 22 and leads to a truncated coagulation factor VIII protein, with partial loss of the C1 domain and complete loss of the C2 domain. The in-silico tool predicted that the mutation induces altered pre-mRNA splicing by using a cryptic acceptor site in intron 22. The IVS22-3C>G mutation was confirmed to affect pre-mRNA splicing and produce a truncated protein, which reduces the stability of binding between the F8 protein and von Willebrand factor carrier protein due to the loss of an interaction domain.

  9. Low frequency of c-MPL gene mutations in Iranian patients with Philadelphia-negative myeloproliferative disorders.

    Science.gov (United States)

    Ghotaslou, A; Nadali, F; Chahardouli, B; Alizad Ghandforosh, N; Rostami, S H; Alimoghaddam, K; Ghavamzadeh, A

    2015-01-01

    Myeloproliferative disorders are a group of diseases characterized by increased proliferation of myeloid lineage. In addition to JAK2V617F mutation, several mutations in the c-MPL gene have been reported in patients with philadelphia-negative chronic myeloproliferative disorders that could be important in the pathogenesis of diseases. The aim of the present study was to investigate the frequency of c-MPL and JAK2V617F mutations in Iranian patients with Philadelphia-negativemyeloproliferative disorders. Peripheral blood samples were collected from 60 patients with Philadelphia-negative MPD) Subgroups ET and PMF) and 25 healthy subjects as control group. The mutation status of c-MPL and Jak2V617F were investigated by using Amplification-refractory mutation system (ARMS) and Allele-Specific PCR (AS-PCR), respectively. The results were confirmed by sequencing. Among 60 patients, 34 (56.6%) and 1(1.7%) had Jak2V617F and c-MPL mutation, respectively. Patients with Jak2V617F mutation had higher WBC counts and hemoglobin concentration than those without the mutation (p= 0.005, p=0.003). In addition, for all healthy subjects in control group, mutations were negative. The present study revealed that the c-MPL mutations unlike the Jak2V617F mutations are rare in Iranian patients with Ph-negative MPNs and the low mutation rate should be considered in the design of screening strategies of MPD patients.

  10. The Effects of Degraded Digital Instrumentation and Control Systems on Human-system Interfaces and Operator Performance: HFE Review Guidance and Technical Basis

    International Nuclear Information System (INIS)

    O'Hara, J.M.; Gunther, W.; Martinez-Guridi, G.

    2010-01-01

    New and advanced reactors will use integrated digital instrumentation and control (I and C) systems to support operators in their monitoring and control functions. Even though digital systems are typically highly reliable, their potential for degradation or failure could significantly affect operator performance and, consequently, impact plant safety. The U.S. Nuclear Regulatory Commission (NRC) supported this research project to investigate the effects of degraded I and C systems on human performance and plant operations. The objective was to develop human factors engineering (HFE) review guidance addressing the detection and management of degraded digital I and C conditions by plant operators. We reviewed pertinent standards and guidelines, empirical studies, and plant operating experience. In addition, we conducted an evaluation of the potential effects of selected failure modes of the digital feedwater system on human-system interfaces (HSIs) and operator performance. The results indicated that I and C degradations are prevalent in plants employing digital systems and the overall effects on plant behavior can be significant, such as causing a reactor trip or causing equipment to operate unexpectedly. I and C degradations can impact the HSIs used by operators to monitor and control the plant. For example, sensor degradations can make displays difficult to interpret and can sometimes mislead operators by making it appear that a process disturbance has occurred. We used the information obtained as the technical basis upon which to develop HFE review guidance. The guidance addresses the treatment of degraded I and C conditions as part of the design process and the HSI features and functions that support operators to monitor I and C performance and manage I and C degradations when they occur. In addition, we identified topics for future research.

  11. BRCA Genetic Screening in Middle Eastern and North African: Mutational Spectrum and Founder BRCA1 Mutation (c.798_799delTT in North African

    Directory of Open Access Journals (Sweden)

    Abdelilah Laraqui

    2015-01-01

    Full Text Available Background. The contribution of BRCA1 mutations to both hereditary and sporadic breast and ovarian cancer (HBOC has not yet been thoroughly investigated in MENA. Methods. To establish the knowledge about BRCA1 mutations and their correlation with the clinical aspect in diagnosed cases of HBOC in MENA populations. A systematic review of studies examining BRCA1 in BC women in Cyprus, Jordan, Egypt, Lebanon, Morocco, Algeria, and Tunisia was conducted. Results. Thirteen relevant references were identified, including ten studies which performed DNA sequencing of all BRCA1 exons. For the latter, 31 mutations were detected in 57 of the 547 patients ascertained. Familial history of BC was present in 388 (71% patients, of whom 50 were mutation carriers. c.798_799delTT was identified in 11 North African families, accounting for 22% of total identified BRCA1 mutations, suggesting a founder allele. A broad spectrum of other mutations including c.68_69delAG, c.181T>G, c.5095C>T, and c.5266dupC, as well as sequence of unclassified variants and polymorphisms, was also detected. Conclusion. The knowledge of genetic structure of BRCA1 in MENA should contribute to the assessment of the necessity of preventive programs for mutation carriers and clinical management. The high prevalence of BC and the presence of frequent mutations of the BRCA1 gene emphasize the need for improving screening programs and individual testing/counseling.

  12. Identification of a c.544C>T mutation in WDR34 as a deleterious recessive allele of short rib-polydactyly syndrome

    Directory of Open Access Journals (Sweden)

    Shu-Han You

    2017-12-01

    Conclusion: This study was the first to identify c.544C > T [p.Arg182Trp] mutation in WDR34 in a patient with SRPS. According to the database, the homozygous mutation of c.544C > T in WDR34 was deleterious and the prevalence of heterozygous mutation was relatively higher in Asian population. More studies of this mutation in patients with SRPS are required.

  13. FBXO7 Y52C polymorphism as a potential protective factor in Parkinson's disease.

    Directory of Open Access Journals (Sweden)

    Chiung-Mei Chen

    Full Text Available Mutations in the F-box only protein 7 gene (FBXO7, the substrate-specifying subunit of SCF E3 ubiquitin ligase complex, cause Parkinson's disease (PD-15 (PARK15. To identify new variants, we sequenced FBXO7 cDNA in 80 Taiwanese early onset PD patients (age at onset ≤ 50 and only two known variants, Y52C (c.155A>G and M115I (c.345G>A, were found. To assess the association of Y52C and M115I with the risk of PD, we conducted a case-control study in a cohort of PD and ethnically matched controls. There was a nominal difference in the Y52C G allele frequency between PD and controls (p = 0.045. After combining data from China [1], significant difference in the Y52C G allele frequency between PD and controls (p = 0.012 and significant association of G allele with decreased PD risk (p = 0.017 can be demonstrated. Upon expressing EGFP-tagged Cys52 FBXO7 in cells, a significantly reduced rate of FBXO7 protein decay was observed when compared with cells expressing Tyr52 FBXO7. In silico modeling of Cys52 exhibited a more stable feature than Tyr52. In cells expressing Cys52 FBXO7, the level of TNF receptor-associated factor 2 (TRAF2 was significantly reduced. Moreover, Cys52 FBXO7 showed stronger interaction with TRAF2 and promoted TRAF2 ubiquitination, which may be responsible for the reduced TRAF2 expression in Cys52 cells. After induced differentiation, SH-SY5Y cells expressing Cys52 FBXO7 displayed increased neuronal outgrowth. We therefore hypothesize that Cys52 variant of FBXO7 may contribute to reduced PD susceptibility in Chinese.

  14. Hereditary thrombophilia: identification of nonsense and missense mutations in the protein C gene

    International Nuclear Information System (INIS)

    Romeo, G.; Hassan, H.J.; Staempfli, S.

    1987-01-01

    The structure of the gene for protein C, an anticoagulant serine protease, was analyzed in 29 unrelated patients with hereditary thrombophilia and protein C deficiency. Gene deletion(s) or gross rearrangement(s) was not demonstrable by Southern blot hybridization to cDNA probes. However, two unrelated patients showed a variant restriction pattern after Pvu II or BamHi digestion, due to mutations in the last exon: analysis of their pedigrees, including three or seven heterozygotes, respectively, with ∼50% reduction of both enzymatic and antigen level, showed the abnormal restriction pattern in all heterozygous individuals, but not in normal relatives. Cloning of protein C gene and sequencing of the last exon allowed the authors to identify a nonsense and a missense mutation, respectively. In the first case, codon 306 (CGA, arginine) is mutated to an inframe stop codon, thus generating a new Pvu II recognition site. In the second case, a missense mutation in the BamHI palindrome (GGATCC → GCATCC) leads to substitution of a key amino acid (a tryptophan to cysteine substitution at position 402), invariantly conserved in eukaryotic serine proteases. These point mutations may explain the protein C-deficiency phenotype of heterozygotes in the two pedigrees

  15. Coordination of I and C design with the obligatory consideration of human factors. A project management approach

    International Nuclear Information System (INIS)

    Sanz, Silvia; Ciriello, Antonio; Krause, Wolfgang; Eisinger, Asriel

    2015-01-01

    Human Factors Engineering (HFE), like other engineering disciplines involved in plant design, cannot be considered retroactively. The engineering principles and methods derived from deep knowledge of the cognitive and perceptual capabilities and limitations of the plant's 'human element' are applied instead throughout plant design. Focusing HFE efforts on the plant's I and C, the plant's HMI is designed to ensure effective and error-free performance of the monitoring, control, and administrative tasks allocated to the control room crew. Generally speaking, a project's HFE program prescribes three main steps: (1) the analyses of plant monitoring and control functions in order to identify those to be performed manually (all others are performed automatically while still manually monitored) and determine in turn the HMI inventory of information displays, controls, alarms, and operating procedures required to support their performance, (2) the guided design of the plant's HMI, ensuring its compliance with HFE principles and the completeness and correctness of the task support it provides, and (3) the subsequent evaluation of operators performance, trained to follow the operating procedures and use the HMI referred to. The I and C systems designed to monitor and control the plant processes and implement, among other functions, the plant's HMI, are likely validated, governed by I and C norms and the project's V and V guidelines. Past experience shows that the three following obligatory steps pose challenges to project execution: (1) the acquisition and analysis of the multidisciplinary functional requirements (related to plant monitoring and control); (2) the likely interdisciplinary analysis whether and how fulfillment of these requirements shall be allocated to I and C automation systems or operators (or both), and (3) the HFE-guided HMI design and validation. A timely and cost-effective application of HFE to I and C engineering can be achieved by adequate planning and

  16. GICLAS 112-29 (=NLTT 18149), A VERY WIDE COMPANION TO GJ 282 AB WITH COMMON PROPER MOTION, COMMON PARALLAX, COMMON RADIAL VELOCITY AND COMMON AGE

    OpenAIRE

    A. Poveda; A. Hernández-Alcántara; R. Costero; J. Echevarría

    2008-01-01

    En una búsqueda de compa~neras con movimiento propio común para las binarias separadas de la vecindad solar encontramos que GJ 282AB tiene una compañera distante (NLTT 18149), a una separaci on de s = 1:09°. Las paralajes trigonométricas (Hipparcos), velocidades radiales y edades son similares, y sugieren que éste es un sistema físico.

  17. Two Mutations in Surfactant Protein C Gene Associated with Neonatal Respiratory Distress

    Directory of Open Access Journals (Sweden)

    Anna Tarocco

    2015-01-01

    Full Text Available Multiple mutations of surfactant genes causing surfactant dysfunction have been described. Surfactant protein C (SP-C deficiency is associated with variable clinical manifestations ranging from neonatal respiratory distress syndrome to lethal lung disease. We present an extremely low birth weight male infant with an unusual course of respiratory distress syndrome associated with two mutations in the SFTPC gene: C43-7G>A and 12T>A. He required mechanical ventilation for 26 days and was treated with 5 subsequent doses of surfactant with temporary and short-term efficacy. He was discharged at 37 weeks of postconceptional age without any respiratory support. During the first 16 months of life he developed five respiratory infections that did not require hospitalization. Conclusion. This mild course in our patient with two mutations is peculiar because the outcome in patients with a single SFTPC mutation is usually poor.

  18. Compound Heterozygosity for Hb Alperton (HBB: c.407C>T) and IVS-I-5 (G>C) (HBB: c.92+5G>C) Mutations Presenting as a Moderate Anemia in an Indian Family.

    Science.gov (United States)

    Godbole, Koumudi G; Ramachandran, Angelina; Karkamkar, Ashwini S; Dalal, Ashwin B

    2018-04-13

    While knowledge of HBB gene mutations is necessary for offering prenatal diagnosis (PND) of β-thalassemia (β-thal), a genotype-phenotype correlation may not always be available for rare variants. We present for the first time, genotype-phenotype correlation for a compound heterozygous status with IVS-I-5 (G>C) (HBB: c.92+5G>C) and HBB: c.407C>T (Hb Alperton) mutations on the HBB gene in an Indian family. Hb Alperton is a very rare hemoglobin (Hb) variant with scant published information about its clinical presentation, especially when accompanied with another HBB gene mutation. Here we provide biochemical as well as clinical details of this variant.

  19. Phenotype of Usher syndrome type II assosiated with compound missense mutations of c.721 C>T and c.1969 C>T in MYO7A in a Chinese Usher syndrome family.

    Science.gov (United States)

    Zhai, Wei; Jin, Xin; Gong, Yan; Qu, Ling-Hui; Zhao, Chen; Li, Zhao-Hui

    2015-01-01

    To identify the pathogenic mutations in a Chinese pedigree affected with Usher syndrome type II (USH2). The ophthalmic examinations and audiometric tests were performed to ascertain the phenotype of the family. To detect the genetic defect, exons of 103 known RDs -associated genes including 12 Usher syndrome (USH) genes of the proband were captured and sequencing analysis was performed to exclude known genetic defects and find potential pathogenic mutations. Subsequently, candidate mutations were validated in his pedigree and 100 normal controls using polymerase chain reaction (PCR) and Sanger sequencing. The patient in the family occurred hearing loss (HL) and retinitis pigmentosa (RP) without vestibular dysfunction, which were consistent with standards of classification for USH2. He carried the compound heterozygous mutations, c.721 C>T and c.1969 C>T, in the MYO7A gene and the unaffected members carried only one of the two mutations. The mutations were not present in the 100 normal controls. We suggested that the compound heterozygous mutations of the MYO7A could lead to USH2, which had revealed distinguished clinical phenotypes associated with MYO7A and expanded the spectrum of clinical phenotypes of the MYO7A mutations.

  20. Identification of a novel BRCA1 nucleotide 4803delCC/c.4684delCC mutation and a nucleotide 249T>A/c.130T>A (p.Cys44Ser) mutation in two Greenlandic Inuit families

    DEFF Research Database (Denmark)

    Hansen, Thomas van Overeem; Jønson, Lars; Albrechtsen, Anders

    2010-01-01

    Germ-line mutations in the tumour suppressor proteins BRCA1 and BRCA2 predispose to breast and ovarian cancer. We have recently identified a Greenlandic Inuit BRCA1 nucleotide 234T>G/c.115T>G (p.Cys39Gly) founder mutation, which at that time was the only disease-causing BRCA1/BRCA2 mutation...... identified in this population. Here, we describe the identification of a novel disease-causing BRCA1 nucleotide 4803delCC/c.4684delCC mutation in a Greenlandic Inuit with ovarian cancer. The mutation introduces a frameshift and a premature stop at codon 1572. We have also identified a BRCA1 nucleotide 249T......>A/c.130T>A (p.Cys44Ser) mutation in another Greenlandic individual with ovarian cancer. This patient share a 1-2 Mb genomic fragment, containing the BRCA1 gene, with four Danish families harbouring the same mutation, suggesting that the 249T>A/c.130T>A (p.Cys44Ser) mutation originates from a Danish...

  1. 7 CFR 28.2 - Terms defined.

    Science.gov (United States)

    2010-01-01

    ... Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing..., TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Definitions § 28.2 Terms... to act for the Secretary. (e) Service. The Agricultural Marketing Service of the U.S. Department of...

  2. A novel mutation in the P2Y12 receptor and a function-reducing polymorphism in protease-activated receptor 1 in a patient with chronic bleeding.

    Science.gov (United States)

    Patel, Y M; Lordkipanidzé, M; Lowe, G C; Nisar, S P; Garner, K; Stockley, J; Daly, M E; Mitchell, M; Watson, S P; Austin, S K; Mundell, S J

    2014-05-01

    The study of patients with bleeding problems is a powerful approach in determining the function and regulation of important proteins in human platelets. We have identified a patient with a chronic bleeding disorder expressing a homozygous P2RY(12) mutation, predicting an arginine to cysteine (R122C) substitution in the G-protein-coupled P2Y(12) receptor. This mutation is found within the DRY motif, which is a highly conserved region in G-protein-coupled receptors (GPCRs) that is speculated to play a critical role in regulating receptor conformational states. To determine the functional consequences of the R122C substitution for P2Y(12) function. We performed a detailed phenotypic analysis of an index case and affected family members. An analysis of the variant R122C P2Y(12) stably expressed in cells was also performed. ADP-stimulated platelet aggregation was reduced as a result of a significant impairment of P2Y(12) activity in the patient and family members. Cell surface R122C P2Y(12) expression was reduced both in cell lines and in platelets; in cell lines, this was as a consequence of agonist-independent internalization followed by subsequent receptor trafficking to lysosomes. Strikingly, members of this family also showed reduced thrombin-induced platelet activation, owing to an intronic polymorphism in the F2R gene, which encodes protease-activated receptor 1 (PAR-1), that has been shown to be associated with reduced PAR-1 receptor activity. Our study is the first to demonstrate a patient with deficits in two stimulatory GPCR pathways that regulate platelet activity, further indicating that bleeding disorders constitute a complex trait. © 2014 International Society on Thrombosis and Haemostasis.

  3. Improved detection of genetic markers of antimicrobial resistance by hybridization probe-based melting curve analysis using primers to mask proximal mutations: examples include the influenza H275Y substitution.

    Science.gov (United States)

    Whiley, David M; Jacob, Kevin; Nakos, Jennifer; Bletchly, Cheryl; Nimmo, Graeme R; Nissen, Michael D; Sloots, Theo P

    2012-06-01

    Numerous real-time PCR assays have been described for detection of the influenza A H275Y alteration. However, the performance of these methods can be undermined by sequence variation in the regions flanking the codon of interest. This is a problem encountered more broadly in microbial diagnostics. In this study, we developed a modification of hybridization probe-based melting curve analysis, whereby primers are used to mask proximal mutations in the sequence targets of hybridization probes, so as to limit the potential for sequence variation to interfere with typing. The approach was applied to the H275Y alteration of the influenza A (H1N1) 2009 strain, as well as a Neisseria gonorrhoeae mutation associated with antimicrobial resistance. Assay performances were assessed using influenza A and N. gonorrhoeae strains characterized by DNA sequencing. The modified hybridization probe-based approach proved successful in limiting the effects of proximal mutations, with the results of melting curve analyses being 100% consistent with the results of DNA sequencing for all influenza A and N. gonorrhoeae strains tested. Notably, these included influenza A and N. gonorrhoeae strains exhibiting additional mutations in hybridization probe targets. Of particular interest was that the H275Y assay correctly typed influenza A strains harbouring a T822C nucleotide substitution, previously shown to interfere with H275Y typing methods. Overall our modified hybridization probe-based approach provides a simple means of circumventing problems caused by sequence variation, and offers improved detection of the influenza A H275Y alteration and potentially other resistance mechanisms.

  4. Phenotype of Usher syndrome type II assosiated with compound missense mutations of c.721 C>T and c.1969 C>T in MYO7A in a Chinese Usher syndrome family

    Directory of Open Access Journals (Sweden)

    Wei Zhai

    2015-08-01

    Full Text Available AIM:To identify the pathogenic mutations in a Chinese pedigree affected with Usher syndrome type II (USH2.METHODS:The ophthalmic examinations and audiometric tests were performed to ascertain the phenotype of the family. To detect the genetic defect, exons of 103 known RDs -associated genes including 12 Usher syndrome (USH genes of the proband were captured and sequencing analysis was performed to exclude known genetic defects and find potential pathogenic mutations. Subsequently, candidate mutations were validated in his pedigree and 100 normal controls using polymerase chain reaction (PCR and Sanger sequencing.RESULTS:The patient in the family occurred hearing loss (HL and retinitis pigmentosa (RP without vestibular dysfunction, which were consistent with standards of classification for USH2. He carried the compound heterozygous mutations, c.721 C>T and c.1969 C>T, in the MYO7A gene and the unaffected members carried only one of the two mutations. The mutations were not present in the 100 normal controls.CONCLUSION:We suggested that the compound heterozygous mutations of the MYO7A could lead to USH2, which had revealed distinguished clinical phenotypes associated with MYO7A and expanded the spectrum of clinical phenotypes of the MYO7A mutations.

  5. Kallmann syndrome: 14 novel mutations in KAL1 and FGFR1 (KAL2).

    Science.gov (United States)

    Albuisson, Juliette; Pêcheux, Chistophe; Carel, Jean-Claude; Lacombe, Didier; Leheup, Bruno; Lapuzina, Pablo; Bouchard, Philippe; Legius, Eric; Matthijs, Gert; Wasniewska, Malgorzata; Delpech, Marc; Young, Jacques; Hardelin, Jean-Pierre; Dodé, Catherine

    2005-01-01

    Kallmann syndrome (KAL) combines hypogonadotropic hypogonadism and anosmia. Hypogonadism is due to Gonadotropin Releasing Hormone (GnRH) deficiency and anosmia is related to hypoplasia of the olfactory bulbs. Occasional symptoms include renal agenesis, bimanual synkinesia, cleft lip palate, dental agenesis. KAL is genetically heterogeneous and two genes have so far been identified, namely KAL1 (Xp22.3) and FGFR1/KAL2 (8p12), which underlie the X chromosome-linked form and an autosomal dominant form of the disease, respectively. We studied a cohort of 98 unrelated Caucasian KAL patients. We identified KAL1 mutations in 14 patients, of which 7 (c.3G>A (p.M1?), g.IVS1+1G>T, c.570_571insA (p.R191fsX14), c.784G>C (p.R262P), c.958G>T (p.E320X), c.1651_1654delinsAGCT (p.P551_E552delinsSX), c.1711T>A (p.W571R)) have not been previously reported. In addition, we found FGFR1 mutations in 7 patients, namely c.303G>A (p.V102I), C.385A>C (p.D129A), c.810G>A (p.V273M), c.1093_1094delAG (p.R365fsX41), c.1561G>A (p.A520T), c.1836_1837insT (p.Y613fsX42), c.2190C>G (p.Y730X), all of which were novel mutations. In this study, unilateral renal agenesis and bimanual synkinesia were exclusively found associated with KAL1mutations, cleft palate and dental agenesia with FGFR1mutations. (c) 2004 Wiley-Liss, Inc.

  6. Mutational spectrum analysis of umuC-independent and umuC-dependent γ-radiation mutagenesis in Escherichia coli

    International Nuclear Information System (INIS)

    Sargentini, N.J.; Smith, K.C.

    1989-01-01

    γ-radiation mutagenesis Escherichia coli K-12. Mutagenesis (argE3(OC) A rg + ) was blocked in a δ(recA-srlR)306 strain at the same doses that induced mutations in umuC122::Tn5 and wild-type strains, indicating that both umuC-independent and umuC-dependent mechanisms function within recA-dependent misrepair. Analyses of various suppressor and back mutations that result in argE3 and hisG4 ochre reversion and an analysis of trpE9777 reversion were performed on umuC and wild-type cells irradiated in the presence and absence of oxygen. While the umuC strain showed the γ-radiation induction of base substitution and frameshifts when irradiated in the absence of oxygen, the umuC mutation blocked all oxygen-dependent base-substitution mutagenesis, but non all oxygen-dependent frameshift mutagenesis. For anoxically irradiated cells, the yields of GC T and AT GC transitions were essentially umuC independent, while the yields of (AT or GC) TA transversions were heavily umuC dependent. These data suggest new concepts about the nature of the DNA lesions and the mutagenic mechanisms that lead to γ-radiation mutagenesis. (author). 48 refs.; 1 tab.; 6 refs

  7. Different mutations of the human c-mpl gene indicate distinct haematopoietic diseases.

    Science.gov (United States)

    He, Xin; Chen, Zhigang; Jiang, Yangyan; Qiu, Xi; Zhao, Xiaoying

    2013-01-25

    The human c-mpl gene (MPL) plays an important role in the development of megakaryocytes and platelets as well as the self-renewal of haematopoietic stem cells. However, numerous MPL mutations have been identified in haematopoietic diseases. These mutations alter the normal regulatory mechanisms and lead to autonomous activation or signalling deficiencies. In this review, we summarise 59 different MPL mutations and classify these mutations into four different groups according to the associated diseases and mutation rates. Using this classification, we clearly distinguish four diverse types of MPL mutations and obtain a deep understand of their clinical significance. This will prove to be useful for both disease diagnosis and the design of individual therapy regimens based on the type of MPL mutations.

  8. R54C Mutation of NOTCH3 Gene in the First Rungus Family with CADASIL.

    Directory of Open Access Journals (Sweden)

    Kheng-Seang Lim

    Full Text Available Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL is a rare hereditary stroke caused by mutations in NOTCH3 gene. We report the first case of CADASIL in an indigenous Rungus (Kadazan-Dusun family in Kudat, Sabah, Malaysia confirmed by a R54C (c.160C>T, p.Arg54Cys mutation in the NOTCH3. This mutation was previously reported in a Caucasian and two Korean cases of CADASIL. We recruited two generations of the affected Rungus family (n = 9 and found a missense mutation (c.160C>T in exon 2 of NOTCH3 in three siblings. Two of the three siblings had severe white matter abnormalities in their brain MRI (Scheltens score 33 and 50 respectively, one of whom had a young stroke at the age of 38. The remaining sibling, however, did not show any clinical features of CADASIL and had only minimal changes in her brain MRI (Scheltens score 17. This further emphasized the phenotype variability among family members with the same mutation in CADASIL. This is the first reported family with CADASIL in Rungus subtribe of Kadazan-Dusun ethnicity with a known mutation at exon 2 of NOTCH3. The penetrance of this mutation was not complete during the course of this study.

  9. Mutación fundadora en una familia argentina con cáncer colorrectal hereditario Detection of a founder mutation in an Argentine family with hereditary non polyposis colorectal cancer

    Directory of Open Access Journals (Sweden)

    Laura Gómez

    2010-02-01

    Full Text Available El cáncer colorrectal hereditario no poliposo (CCHNP se relaciona con mutaciones en los genes reparadores de ADN (MLH1, MSH2 y MSH6. La mayoría de estas alteraciones son familia-específicas y su detección suele requerir la secuenciación completa de los genes relacionados. Se detectó una mutación puntual (2269-2270insT en el último codón del gen MLH1 en familias de un área del norte de Italia (Reggio Emilia y su origen se considera debido a un efecto fundador. En este trabajo presentamos una familia mendocina con CCHNP portadora de la misma mutación, cuyos ancestros eran oriundos de Reggio Emilia. Para la detección de la mutación se diseñó una estrategia basada en PCR y posterior corte enzimático. La mutación fue hallada en tres integrantes de la familia estudiada, dos de los cuales no presentaban sintomatología clínica. Estos pacientes fueron seguidos preventivamente mediante colonoscopias. La metodología utilizada en nuestro laboratorio fue específica y sensible para la detección de una mutación previamente registrada y permitió realizar el diagnóstico genético molecular en el país, evitando el envío de muestras al extranjero. Es de importancia destacar que el diagnóstico genético pre-sintomático de cáncer hereditario, enfocado desde un grupo multidisciplinario de profesionales, permite un mejor seguimiento y apoyo a las familias afectadas.Hereditary non polyposis colorectal cancer (HNPCC has been related to mutations in the DNA mismatch repair genes (MLH1, MSH2 y MSH6. Mutation detection analysis requires the complete sequencing of these genes, given the high frequency of family-specific alterations. A point mutation (2269- 2270insT in the last codon of the MLH1 gene has been detected in families from a northern region of Italy (Reggio Emilia.Given that this alteration was registered only in people from this region, it has been considered a founder mutation. In this work, we present an Argentine HNPCC family

  10. Reference: 282 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 282 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16214903i Kasahara Ryushiro...abidopsis. 11 2981-92 16214903 2005 Nov The Plant cell Drews Gary N|Kasahara Ryushiro D|Portereiko Michael F|Rabiger David S|Sandaklie-Nikolova Linda

  11. Molecular analysis of congenital goitres with hypothyroidism caused by defective thyroglobulin synthesis. Identification of a novel c.7006C>T [p.R2317X] mutation and expression of minigenes containing nonsense mutations in exon 7.

    Science.gov (United States)

    Machiavelli, Gloria A; Caputo, Mariela; Rivolta, Carina M; Olcese, María C; Gruñeiro-Papendieck, Laura; Chiesa, Ana; González-Sarmiento, Rogelio; Targovnik, Héctor M

    2010-01-01

    Thyroglobulin (TG) deficiency is an autosomal-recessive disorder that results in thyroid dyshormonogenesis. A number of distinct mutations have been identified as causing human hypothyroid goitre. The purpose of this study was to identify and characterize new mutations in the TG gene in an attempt to increase the understanding of the genetic mechanism responsible for this disorder. A total of six patients from four nonconsanguineous families with marked impairment of TG synthesis were studied. Single-strand conformation polymorphism (SSCP) analysis, sequencing of DNA, genotyping, expression of chimeric minigenes and bioinformatic analysis were performed. Four different inactivating TG mutations were identified: one novel mutation (c.7006C>T [p.R2317X]) and three previously reported (c.886C>T [p.R277X], c.6701C>A [p.A2215D] and c.6725G>A [p.R2223H]). Consequently, one patient carried a compound heterozygous for p.R2223H/p.R2317X mutations; two brothers showed a homozygous p.A2215D substitution and the remaining three patients, from two families with typical phenotype, had a single p.R277X mutated allele. We also showed functional evidences that premature stop codons inserted at different positions in exon 7, which disrupt exonic splicing enhancer (ESE) sequences, do not interfere with exon definition and processing. In this study, we have identified a novel nonsense mutation p.R2317X in the acetylcholinesterase homology domain of TG. We have also observed that nonsense mutations do not interfere with the pre-mRNA splicing of exon 7. The results are in accordance with previous observations confirming the genetic heterogeneity of TG defects.

  12. Mutation Glu82Lys in lamin A/C gene is associated with cardiomyopathy and conduction defect

    International Nuclear Information System (INIS)

    Wang Hu; Wang Jizheng; Zheng Weiyue; Wang Xiaojian; Wang Shuxia; Song Lei; Zou Yubao; Yao Yan; Hui Rutai

    2006-01-01

    Dilated cardiomyopathy is a form of heart muscle disease characterized by impaired systolic function and ventricular dilation. The mutations in lamin A/C gene have been linked to dilated cardiomyopathy. We screened genetic mutations in a large Chinese family of 50 members including members with dilated cardiomyopathy and found a Glu82Lys substitution mutation in the rod domain of the lamin A/C protein in eight family members, three of them have been diagnosed as dilated cardiomyopathy, one presented with heart dilation. The pathogenic mechanism of lamin A/C gene defect is poorly understood. Glu82Lys mutated lamin A/C and wild type protein was transfected into HEK293 cells. The mutated protein was not properly localized at the inner nuclear membrane and the emerin protein, which interacts with lamin A/C, was also aberrantly distributed. The nuclear membrane structure was disrupted and heterochromatin was aggregated aberrantly in the nucleus of the HEK293 cells stably transfected with mutated lamin A/C gene as determined by transmission electron microscopy

  13. LOS GENES BRCA1 y BRCA2. ESTUDIO MOLECULAR

    Directory of Open Access Journals (Sweden)

    N. Alonso

    2006-11-01

    Full Text Available RESUMENEn los últimos años, se realizaron numerosos estudios para establecer la predisposición hereditaria al cáncer y las alteraciones mutacionales a nivel de genes susceptibles de originar cáncer de mama y ovario. En 1994 se identificaron los genes BRCA1 (Breast Cancer Gene 1 y BRCA2 (Breast Cancer Gene 2 como susceptibles de cáncer de mama y ovario. En la actualidad se sabe que las mutaciones en BRCA1 y BRCA2 están lejos de explicar la totalidad de los casos de cáncer de mama y/o ovario, y a pesar de que se postulan alteraciones mutacionales en otros genes como CHEK2, TP53 y PTEN, el BRCA1 y BRCA2, siguen teniendo su importancia y utilidad en la valoración del riesgo de predisposición hereditaria. Aunque las cifras son variables según los distintos estudios y autores, se trata en cualquier caso de porcentajes importantes. Entre el 15 y el 85% de las mujeres portadoras de mutación BRCA 1 o BRCA 2 tienen riesgo de desarrollar un cáncer de mama y entre un 10 y 60% de desarrollar un cáncer de ovario. ABSTRACT:In the last years, numerous studies were made to establish the hereditary predisposition to the cancer and the mutationals alterations at level of genes susceptible to originate breast and ovarian cancers. In 1994 genes BRCA1 (Breast Cancer Gene 1 and BRCA2 were identified (Breast Cancer Gene 2 as susceptible of both of breast and ovarian cancers. At the present time, it is knows that the mutations in BRCA 1 and BRCA 2 are far from explaining the totality of the cases of breast cancer and/or ovary, and although mutationals alterations in other genes like CHEK2, TP53 and PTEN, the BRCA1 and BRCA2 are postulated, they continue having his importance and utility in the valuation of the risk of hereditary predisposition. Correlations between both BRCA1 and BRCA2 levels with tumour grade metastasis and prognostic accuracy. Between 15 and 85% of the carrying women of mutation BRCA 1 or BRCA 2 have risk of developing a cancer of breast

  14. Identification of a breast cancer family double heterozygote for RAD51C and BRCA2 gene mutations

    DEFF Research Database (Denmark)

    Ahlborn, Lise B; Steffensen, Ane Y; Jønson, Lars

    2015-01-01

    for mutations in the RAD51C and BRCA2 genes. The RAD51C missense mutation p.Arg258His has previously been identified in a homozygous state in a patient with Fanconi anemia. This mutation is known to affect the DNA repair function of the RAD51C protein. The BRCA2 p.Leu3216Leu synonymous mutation has not been...

  15. Relative autonomy of manifestation of welt mutation in imaginal discs of Drosophila

    International Nuclear Information System (INIS)

    Vikulova, V.K.

    1988-01-01

    Autonomy of manifestation of the temperature-sensitive lethal welt mutation was investigated during transplantation of imaginal discs of mutant larvae into normal recipients and in large clones of cells homozygous for welt induced by γ-irradiation in a dose of 1000 rd in y; fj wt/M(2)S7 T(1;2)sc s 2 heterozygotes. Three temperature regimes were used: 17 degree C, at which the welt mutation is not manifested; 29 degree C, at which it is manifested better; and 25 degree C. It was established that the welt mutation operates autonomously, but in restricted regions of imaginal discs. The possibility is discussed of nonautonomous manifestation of the mutation with direct contact of wt/wt cells with heteroxygous wt/+ tissue

  16. Delineation of C12orf65-related phenotypes: a genotype-phenotype relationship.

    Science.gov (United States)

    Spiegel, Ronen; Mandel, Hanna; Saada, Ann; Lerer, Issy; Burger, Ayala; Shaag, Avraham; Shalev, Stavit A; Jabaly-Habib, Haneen; Goldsher, Dorit; Gomori, John M; Lossos, Alex; Elpeleg, Orly; Meiner, Vardiella

    2014-08-01

    C12orf65 participates in the process of mitochondrial translation and has been shown to be associated with a spectrum of phenotypes, including early onset optic atrophy, progressive encephalomyopathy, peripheral neuropathy, and spastic paraparesis.We used whole-genome homozygosity mapping as well as exome sequencing and targeted gene sequencing to identify novel C12orf65 disease-causing mutations in seven affected individuals originating from two consanguineous families. In four family members affected with childhood-onset optic atrophy accompanied by slowly progressive peripheral neuropathy and spastic paraparesis, we identified a homozygous frame shift mutation c.413_417 delAACAA, which predicts a truncated protein lacking the C-terminal portion. In the second family, we studied three affected individuals who presented with early onset optic atrophy, peripheral neuropathy, and spastic gait in addition to moderate intellectual disability. Muscle biopsy in two of the patients revealed decreased activities of the mitochondrial respiratory chain complexes I and IV. In these patients, we identified a homozygous splice mutation, g.21043 T>A (c.282+2 T>A) which leads to skipping of exon 2. Our study broadens the phenotypic spectrum of C12orf65 defects and highlights the triad of optic atrophy, axonal neuropathy and spastic paraparesis as its key clinical features. In addition, a clear genotype-phenotype correlation is anticipated in which deleterious mutations which disrupt the GGQ-containing domain in the first coding exon are expected to result in a more severe phenotype, whereas down-stream C-terminal mutations may result in a more favorable phenotype, typically lacking cognitive impairment.

  17. A pseudoatom in a cage: trimetallofullerene Y(3)@C(80) mimics y(3)n@c(80) with nitrogen substituted by a pseudoatom.

    Science.gov (United States)

    Popov, Alexey A; Zhang, Lin; Dunsch, Lothar

    2010-02-23

    Y(3)C(80) obtained in the synthesis of nitride clusterfullerenes Y(3)N@C(2n) (2n = 80-88) by the reactive atmosphere method is found to be a genuine trimetallofullerene, Y(3)@C(80), with low ionization potential and divalent state of yttrium atoms. DFT studies of the electronic structure of Y(3)@C(80) show that this molecule mimics Y(3)N@C(80) with the pseudoatom (PA) instead of the nitrogen atom. Topology analysis of the electron density and electron localization function show that yttrium atoms form Y-PA bonds rather than direct Y-Y bonds. Molecular dynamics simulations show that the Y(3)PA cluster is as rigid as Y(3)N and rotates inside the fullerene cage as a single entity.

  18. Mitochondrial G8292A and C8794T mutations in patients with Niemann-Pick disease type C.

    Science.gov (United States)

    Masserrat, Abbas; Sharifpanah, Fatemeh; Akbari, Leila; Tonekaboni, Seyed Hasan; Karimzadeh, Parvaneh; Asharafi, Mahmood Reza; Mazouei, Safoura; Sauer, Heinrich; Houshmand, Massoud

    2018-07-01

    Niemann-Pick disease type C (NP-C) is a neurovisceral lipid storage disorder. At the cellular level, the disorder is characterized by accumulation of unesterified cholesterol and glycolipids in the lysosomal/late endosomal system. NP-C is transmitted in an autosomal recessive manner and is caused by mutations in either the NPC1 (95% of families) or NPC2 gene. The estimated disease incidence is 1 in 120,000 live births, but this likely represents an underestimate, as the disease may be under-diagnosed due to its highly heterogeneous presentation. Variants of adenosine triphosphatase (ATPase) subunit 6 and ATPase subunit 8 ( ATPase6/8 ) in mitochondrial DNA (mtDNA) have been reported in different types of genetic diseases including NP-C. In the present study, the blood samples of 22 Iranian patients with NP-C and 150 healthy subjects as a control group were analyzed. The DNA of the blood samples was extracted by the salting out method and analyzed for ATPase6/8 mutations using polymerase chain reaction sequencing. Sequence variations in mitochondrial genome samples were determined via the Mitomap database. Analysis of sequencing data confirmed the existence of 11 different single nucleotide polymorphisms (SNPs) in patients with NP-C1. One of the most prevalent polymorphisms was the A8860G variant, which was observed in both affected and non-affected groups and determined to have no significant association with NP-C incidence. Amongst the 11 polymorphisms, only one was identified in the ATPase8 gene, while 9 including A8860G were observed in the ATPase6 gene. Furthermore, two SNPs, G8292A and C8792A, located in the non-coding region of mtDNA and the ATPase6 gene, respectively, exhibited significantly higher prevalence rates in NP-C1 patients compared with the control group (PC disease. In addition, the mitochondrial SNPs identified maybe pathogenic mutations involved in the development and prevalence of NP-C. Furthermore, these results suggest a higher occurrence of

  19. c-Ha-ras BamHI RFLP in human urothelial tumors and point mutations in hot codons

    International Nuclear Information System (INIS)

    Weismanova, E; Skovraga, M.; Kaluz, S.

    1993-01-01

    High-molecular weights DNAs from 30 bladder and renal cell carcinomas (RCC) were isolated and the c-Ha-ras the c-Ha-ras gene BamHI RFLP was examined. Amplification of c-Ha-ras with normal localization with regard to the size of alleles was found only in the case. One of the normally localized c-Ha-ras allele termed RCC c-H-ras of a length of about 6.6 kbp was cloned and an oncogene-activating point mutation was identified using two restriction enzymes. After comparison of CfrI and Cfr10I cleavage maps of RCC c-Ha-ras to complete nucleotide sequences of EJ/T24 c-Ha-ras oncogene and its normal counterpart, a point mutation was identified within codon 11 or 12. The use of CfrI and Cfr10I is of value for clinical practice in identification of point mutations in c-Ha-ras PCR product in neoplasia accompanied by somatic mutation of c-Ha-ras. The correlation among c-Ha-ras allele, amplification/loss, presence of point mutation and progression of neoplasia is discussed. (author)

  20. A novel PRNP Y218N mutation in Gerstmann-Sträussler-Scheinker disease with neurofibrillary degeneration.

    Science.gov (United States)

    Alzualde, Ainhoa; Indakoetxea, Begoña; Ferrer, Isidre; Moreno, Fermin; Barandiaran, Myriam; Gorostidi, Ana; Estanga, Ainara; Ruiz, Irune; Calero, Miguel; van Leeuwen, Fred W; Atares, Begoña; Juste, Ramón; Rodriguez-Martínez, Ana Belén; López de Munain, Adolfo

    2010-08-01

    Gerstmann-Sträussler-Scheinker (GSS) disease is a prion disease associated with prion protein gene (PRNP) mutations. We report a novel PRNP mutation (Y218N) associated with GSS disease in a pathologically confirmed case and in two other affected family members. The clinical features of these cases met criteria for possible Alzheimer disease and possible frontotemporal dementia. Neuropathologic analysis revealed deposition of proteinase K-resistant prion protein (PrP(res)), widespread hyperphosphorylated tau pathology, abnormal accumulation of mitochondria in the vicinity of PrP deposits, and expression of mutant ubiquitin (UBB(+1)) in neurofibrillary tangles and dystrophic neurites. Prion protein immunoblotting using 3F4 and 1E4 antibodies disclosed multiple bands ranging from approximately 20 kd to 80 kd and lower bands of 15 kd and approximately 10 kd, the latter only seen after a long incubation. These bands were partially resistant to proteinase K pretreatment. This pattern differs from those seen in Creutzfeldt-Jakob disease andresembles those reported in other GSS cases. The approximately 10kd band was recognized with anti-PrP C-terminus antibodies but not with anti-N terminus antibodies, suggesting PrP truncation at the N terminal. This new mutation extends the list of known mutations responsible for GSS disease and reinforces its clinical heterogeneity. Genetic examination of the PRNP gene should be included in the workup of patients with poorly classifiable dementia.

  1. Efecto del tipo de lactancia durante el primer año de vida sobre el estado de hierro y el desarrollo físico y psicológico del niño

    OpenAIRE

    Bedmar Carretero, Cristina

    2012-01-01

    El objetivo de este estudio fue valorar el desarrollo del niño durante el primer año de vida en función del tipo de lactancia realizada durante el primer semestre y de la dosis de hierro administrada durante el segundo semestre. El 75,5% realizan lactancia materna exclusiva al nacer y el 16,5% la mantienen hasta los 6 meses. El 39,5%tienen alguna mutación en el gen HFE. La prevalencia de déficit de hierroy anemia ferropénicaes del 4,5% y 2,5% a los 6 meses y del 9,2% y 1,2% a los 12 meses.La ...

  2. Mutation in CPT1C Associated With Pure Autosomal Dominant Spastic Paraplegia.

    Science.gov (United States)

    Rinaldi, Carlo; Schmidt, Thomas; Situ, Alan J; Johnson, Janel O; Lee, Philip R; Chen, Ke-Lian; Bott, Laura C; Fadó, Rut; Harmison, George H; Parodi, Sara; Grunseich, Christopher; Renvoisé, Benoît; Biesecker, Leslie G; De Michele, Giuseppe; Santorelli, Filippo M; Filla, Alessandro; Stevanin, Giovanni; Dürr, Alexandra; Brice, Alexis; Casals, Núria; Traynor, Bryan J; Blackstone, Craig; Ulmer, Tobias S; Fischbeck, Kenneth H

    2015-05-01

    The family of genes implicated in hereditary spastic paraplegias (HSPs) is quickly expanding, mostly owing to the widespread availability of next-generation DNA sequencing methods. Nevertheless, a genetic diagnosis remains unavailable for many patients. To identify the genetic cause for a novel form of pure autosomal dominant HSP. We examined and followed up with a family presenting to a tertiary referral center for evaluation of HSP for a decade until August 2014. Whole-exome sequencing was performed in 4 patients from the same family and was integrated with linkage analysis. Sanger sequencing was used to confirm the presence of the candidate variant in the remaining affected and unaffected members of the family and screen the additional patients with HSP. Five affected and 6 unaffected participants from a 3-generation family with pure adult-onset autosomal dominant HSP of unknown genetic origin were included. Additionally, 163 unrelated participants with pure HSP of unknown genetic cause were screened. Mutation in the neuronal isoform of carnitine palmitoyl-transferase (CPT1C) gene. We identified the nucleotide substitution c.109C>T in exon 3 of CPT1C, which determined the base substitution of an evolutionarily conserved Cys residue for an Arg in the gene product. This variant strictly cosegregated with the disease phenotype and was absent in online single-nucleotide polymorphism databases and in 712 additional exomes of control participants. We showed that CPT1C, which localizes to the endoplasmic reticulum, is expressed in motor neurons and interacts with atlastin-1, an endoplasmic reticulum protein encoded by the ATL1 gene known to be mutated in pure HSPs. The mutation, as indicated by nuclear magnetic resonance spectroscopy studies, alters the protein conformation and reduces the mean (SD) number (213.0 [46.99] vs 81.9 [14.2]; P lipid droplets on overexpression in cells. We also observed a reduction of mean (SD) lipid droplets in primary cortical neurons

  3. Resistance analysis and characterization of NITD008 as an adenosine analog inhibitor against hepatitis C virus.

    Science.gov (United States)

    Qing, Jie; Luo, Rui; Wang, Yaxin; Nong, Junxiu; Wu, Ming; Shao, Yan; Tang, Ruoyi; Yu, Xi; Yin, Zheng; Sun, Yuna

    2016-02-01

    Hepatitis disease caused by hepatitis C virus (HCV) is a severe threat to global public health, affecting approximately 3% of the world's population. Sofosbuvir (PSI-7977), a uridine nucleotide analog inhibitor targeting the HCV NS5B polymerase, was approved by FDA at the end of 2013 and represents a key step towards a new era in the management of HCV infection. Previous study identified NITD008, an adenosine nucleoside analog, as the specific inhibitor against dengue virus and showed good antiviral effect on other flaviviruses or enteroviruses. In this report, we systematically analyzed the anti-HCV profile of NITD008, which was discovered to effectively suppress the replication of different strains of HCV in human hepatoma cells with a low nanomolar activity. On genotype 2a virus, or 2a, 1a, and 1b replicon cells, EC50 values were 8.7 nM, 93.3 nM, 60.0 nM and 67.2 nM, and selective index values were >2298.9, >214.4, >333.3, >298.5 respectively. We demonstrated that resistance to NITD008 was conferred by mutation in NS5B (S282T) in the HCV infectious virus genotype 2a (JFH-1). Then, we compared the resistant profiles of NITD008 and PSI-7977, and found that the folds change of EC50 of NITD008 to full replicon cells containing mutation S282T was much bigger than PSI-7977(folds 76.50 vs. 4.52). Analysis of NITD008 cross-resistance against previously reported NS5B drug-selected mutations showed that the resistance pattern of NITD008 was not completely similar to PSI-7977, and meanwhile, S282T resistant mutation to NITD008 emerge more easily in cell culture than PSI-7977. Interestingly, NITD008 displayed significant synergistic effects with the NS5B polymerase inhibitor PSI-7977, however, only additive effects with alpha interferon (IFNα-2b), ribavirin, and an NS3 protease inhibitor. These results verify that NITD008 is an effective analog inhibitor against hepatitis C virus and a good research tool as a supplement to other types of nucleoside analogs. Copyright

  4. CDKL5 mutations in boys with severe encephalopathy and early-onset intractable epilepsy.

    Science.gov (United States)

    Elia, M; Falco, M; Ferri, R; Spalletta, A; Bottitta, M; Calabrese, G; Carotenuto, M; Musumeci, S A; Lo Giudice, M; Fichera, M

    2008-09-23

    To search for CDKL5 gene mutations in boys presenting with severe early-onset encephalopathy and intractable epilepsy, a clinical picture very similar to that already described in girls with CDKL5 mutations. Eight boys (age range 3-16 years, mean age 8.5 years, SD 4.38) with severe or profound mental retardation and early-onset intractable seizures were selected for CDKL5 gene mutation screening by denaturing high-performance liquid chromatography analysis. We found three unrelated boys carrying three different missense mutations of the CDKL5 gene: c.872G>A (p.C291Y), c.863C>T (p.T288I), and c.533G>C (p.R178P). They presented early-onset, polymorphous, and drug-resistant seizures, mostly myoclonic and tonic or spasms. EEG showed epileptiform abnormalities which were multifocal during wakefulness, and pseudoperiodic bisynchronous during sleep. This study describes three boys carrying CDKL5 missense mutations and their detailed clinical and EEG data, and indicates that CDKL5 gene mutations may represent a cause of severe or profound mental retardation and early-onset intractable seizures, also in boys. Screening for CDKL5 mutations is strongly recommended in individuals with these clinical features.

  5. Understanding the mechanism of atovaquone drug resistance in Plasmodium falciparum cytochrome b mutation Y268S using computational methods.

    Directory of Open Access Journals (Sweden)

    Bashir A Akhoon

    Full Text Available The rapid appearance of resistant malarial parasites after introduction of atovaquone (ATQ drug has prompted the search for new drugs as even single point mutations in the active site of Cytochrome b protein can rapidly render ATQ ineffective. The presence of Y268 mutations in the Cytochrome b (Cyt b protein is previously suggested to be responsible for the ATQ resistance in Plasmodium falciparum (P. falciparum. In this study, we examined the resistance mechanism against ATQ in P. falciparum through computational methods. Here, we reported a reliable protein model of Cyt bc1 complex containing Cyt b and the Iron-Sulphur Protein (ISP of P. falciparum using composite modeling method by combining threading, ab initio modeling and atomic-level structure refinement approaches. The molecular dynamics simulations suggest that Y268S mutation causes ATQ resistance by reducing hydrophobic interactions between Cyt bc1 protein complex and ATQ. Moreover, the important histidine contact of ATQ with the ISP chain is also lost due to Y268S mutation. We noticed the induced mutation alters the arrangement of active site residues in a fashion that enforces ATQ to find its new stable binding site far away from the wild-type binding pocket. The MM-PBSA calculations also shows that the binding affinity of ATQ with Cyt bc1 complex is enough to hold it at this new site that ultimately leads to the ATQ resistance.

  6. Risk prediction of ventricular arrhythmias and myocardial function in Lamin A/C mutation positive subjects

    DEFF Research Database (Denmark)

    Hasselberg, Nina E; Edvardsen, Thor; Petri, Helle

    2014-01-01

    Mutations in the Lamin A/C gene may cause atrioventricular block, supraventricular arrhythmias, ventricular arrhythmias (VA), and dilated cardiomyopathy. We aimed to explore the predictors and the mechanisms of VA in Lamin A/C mutation-positive subjects.METHODS AND RESULTS: We included 41 Lamin A/C...

  7. Transferrin Level Before Treatment and Genetic Polymorphism in HFE Gene as Predictive Markers for Response to Adalimumab in Crohn's Disease Patients.

    Science.gov (United States)

    Repnik, Katja; Koder, Silvo; Skok, Pavel; Ferkolj, Ivan; Potočnik, Uroš

    2016-08-01

    Tumor necrosis factor α inhibitors (anti-TNF) have improved treatment of several complex diseases, including Crohn's disease (CD). However, the effect varies and approximately one-third of the patients do not respond. Since blood parameters as well as genetic factors have shown a great potential to predict response during treatment, the aim of the study was to evaluate response to anti-TNF treatment with adalimumab (ADA) between genes HFE and TF and haematological parameters in Slovenian refractory CD patients. Single nucleotide polymorphisms (SNPs) rs1799852 in gene TF and rs2071303 in gene HFE were genotyped in 68 refractory CD patients for which response has been measured using inflammatory bowel disease questionnaire (IBDQ) index. Haematological parameters and IBDQ index were determined before therapy and after 4, 12, 20 and 30 weeks. We found novel strong association between SNP rs2071303 in gene HFE and response to ADA treatment, particularly patients with G allele comparing to A allele had better response after 20 weeks (p = 0.008). Further, we found strong association between transferrin level at baseline and treatment response after 12, 20 and 30 weeks, where average transferrin level before therapy was lower in responders (2.38 g/L) compared to non-responders (2.89 g/L, p = 0.005). Association was found between transferrin level in week 30 and SNP rs1799852 (p = 0.023), and between MCHC level before treatment and SNP rs2071303 (p = 0.007). Our results suggest that SNP in gene HFE as well as haematological markers serve as promising prognostic markers of response to anti-TNF treatment in CD patients.

  8. Dynamic strain aging in Haynes 282 superalloy

    Directory of Open Access Journals (Sweden)

    Hörnqvist Magnus

    2014-01-01

    Full Text Available Haynes 282 is a newly introduced Ni-based superallony, developed to provide a combination of high-temperature mechanical properties, thermal stability and processability. The present contribution investigates the effect of dynamic strain aging (DSA on the deformation behaviour of Haynes 282 during monotonic and cyclic loading. It is shown that DSA (presumably related to carbon diffusion based on rough estimates of the activation energy completely dominates the development of the stress during cycling at intermediate temperatures, leading to extensive cyclic hardening and serrated yielding. However, no clear effects on the fatigue life or the resulting dislocation structure could be observed. The tensile properties were not severely affected, in spite of the presence of extensive serrated yielding, although a reduction in ductility was observed in the DSA temperature regime. During monotonic loading at lower strain rates indications of an additional DSA mechanism due to substitutional elements were observed.

  9. Posterior microphthalmia and nanophthalmia in Tunisia caused by a founder c.1059_1066insC mutation of the PRSS56 gene.

    Science.gov (United States)

    Said, Mariem Ben; Chouchène, Ebtissem; Salem, Salma Ben; Daoud, Kods; Largueche, Leila; Bouassida, Walid; Benzina, Zeineb; Ayadi, Hammadi; Söderkvist, Peter; Matri, Leila; Hmani-Aifa, Mounira

    2013-10-10

    Congenital microphthalmia (CMIC) is a common developmental ocular disorder characterized by a small, and sometimes malformed, eye. Posterior microphthalmia (PM) and nanophthalmia are two rare subtypes of isolated CMIC characterized by extreme hyperopia due to short axial length and elevated lens/eye volume ratio. While nanophthalmia is associated with a reduced size in both anterior and posterior segments, PM involves a normal-size anterior chamber but a small posterior segment. Several genes encoding transcription and non-transcription regulators have been identified in different forms of CMIC. MFRP gene mutations have, for instance, been associated with nanophthalmia, and mutations in the recently identified PRSS56 gene have been linked to PM. So far, these two forms of CMIC have been associated with 9 mutations in PRSS56. Of particular interest, a c.1059_1066insC mutation has recently been reported in four Tunisian families with isolated PM and one Tunisian family with nanophthalmia. Here, we performed a genome-wide scan using a high density single nucleotide polymorphism (SNP) array 50 K in a large consanguineous Tunisian family (PM7) affected with PM and identified the same causative disease mutation. A total of 24 polymorphic markers spanning the PRSS56 gene in 6 families originating from different regions of Tunisia were analyzed to investigate the origin of the c.1059_1066insC mutation and to determine whether it arose in a common ancestor. A highly significant disease-associated haplotype, spanning across the 146 kb of the 2q37.1 chromosome, was conserved in those families, suggesting that c.1059_1066insC arose from a common founder. The age of the mutation in this haplotype was estimated to be around 1,850 years. The identification of such 'founder effects' may greatly simplify diagnostic genetic screening and lead to better prognostic counseling. © 2013 Elsevier B.V. All rights reserved.

  10. Novel Mutation of LRP6 Identified in Chinese Han Population Links Canonical WNT Signaling to Neural Tube Defects.

    Science.gov (United States)

    Shi, Zhiwen; Yang, Xueyan; Li, Bin-Bin; Chen, Shuxia; Yang, Luming; Cheng, Liangping; Zhang, Ting; Wang, Hongyan; Zheng, Yufang

    2018-01-15

    Neural tube defects (NTDs), the second most frequent cause of human congenital abnormalities, are debilitating birth defects due to failure of neural tube closure. It has been shown that noncanonical WNT/planar cell polarity (PCP) signaling is required for convergent extension (CE), the initiation step of neural tube closure (NTC). But the effect of canonical WNT//β-catenin signaling during NTC is still elusive. LRP6 (low density lipoprotein receptor related proteins 6) was identified as a co-receptor for WNT/β-catenin signaling, but recent studies showed that it also can mediate WNT/PCP signaling. In this study, we screened mutations in the LRP6 gene in 343 NTDs and 215 ethnically matched normal controls of Chinese Han population. Three rare missense mutations (c.1514A>G, p.Y505C); c.2984A>G, p.D995G; and c.4280C>A, p.P1427Q) of the LRP6 gene were identified in Chinese NTD patients. The Y505C mutation is a loss-of-function mutation on both WNT/β-catenin and PCP signaling. The D995G mutation only partially lost inhibition on PCP signaling without affecting WNT/β-catenin signaling. The P1427Q mutation dramatically increased WNT/β-catenin signaling but only mildly loss of inhibition on PCP signaling. All three mutations failed to rescue CE defects caused by lrp6 morpholino oligos knockdown in zebrafish. Of interest, when overexpressed, D995G did not induce any defects, but Y505C and P1427Q caused more severe CE defects in zebrafish. Our results suggested that over-active canonical WNT signaling induced by gain-of-function mutation in LRP6 could also contribute to human NTDs, and a balanced WNT/β-catenin and PCP signaling is probably required for proper neural tube development. Birth Defects Research 110:63-71, 2018. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  11. Methylenetetrahydrofolate reductase C677T mutation and risk of retinal vein thrombosis.

    Science.gov (United States)

    Soltanpour, Mohammad Soleiman; Soheili, Zahra; Shakerizadeh, Ali; Pourfathollah, Ali Akbar; Samiei, Shahram; Meshkani, Reza; Shahjahani, Mohammad; Karimi, Abbas

    2013-06-01

    Elevated plasma homocysteine (Hcy) level has been established as a significant risk factor for venous thrombosis and cardiovascular disease. Homozygosity for the methylenetetrahydrofolate reductase (MTHFR) C677T mutation has been associated with elevated plasma Hcy concentration and may contribute to retinal vein thrombosis (RVT) development. The aim of the present study was to investigate whether the hyperhomocysteinemia and/or homozygosity for the MTHFR C677T mutation are associated with an increased risk for RVT. Our study population consisted of 73 consecutive patients (50-78 years old) with RVT and 73 control subjects (51-80 years old), matched for age and sex. Genotyping for the MTHFR C677T mutation was performed by polymerase chain reaction-restriction fragment length polymorphism technique and Hcy level was determined by an enzyme immunoassay kit. The prevalence of 677TT genotype was higher in patients than control subjects, but the difference in frequency didn't reach a significant value (P = 0.07). The frequency of the 677T allele was 26% and 21.2% in patients and controls, respectively and did not differ significantly between the two groups (odds ratio = 1.3, 95% confidence interval (0.75-2.24), P = 0.33). Fasting plasma total Hcy level was significantly higher in patients than controls (P = 0.001). Our study demonstrated that hyperhomocysteinemia, but not the MTHFR C677T mutation, is associated with RVT.

  12. Novel Founder Mutation in FANCA Gene (c.3446_3449dupCCCT) Among Romani Patients from the Balkan Region.

    Science.gov (United States)

    Dimishkovska, Marija; Kotori, Vjosa Mulliqi; Gucev, Zoran; Kocheva, Svetlana; Polenakovic, Momir; Plaseska-Karanfilska, Dijana

    2018-01-20

    Fanconi anemia is a rare autosomal recessive or X-linked disorder characterised by clinical and genetic heterogeneity. Most fanconi anemia patients harbour homozygous or double heterozygous mutations in the FANCA (60-65%), FANCC (10-15%), FANCG (~10%) or FANCD2 (3-6%) genes. We have already reported the FANCA variant c.190-256_283+1680del2040dupC as a founder mutation among Macedonian fanconi anemia patients of Gypsy-like ethnic origin. Here, we present a novel FANCA mutation in two patients from Macedonia and Kosovo. The novel FANCA mutation c.3446_3449dupCCCT was identified in two fanconi anemia patients with Romany ethnicity; a 2-year-old girl from Macedonia who is a compound heterozygote for a previously reported FANCA c.190-256_283+1680del2040dupC and the novel mutation and a 10-year-old girl from Kosovo who is a homozygote for the novel FANCA c.3446_3449dupCCCT mutation. The novel mutation is located in exon 35 in the FAAP20-binding domain which plays a crucial role in the FANCA -FAAP20 interaction and is required for integrity of the fanconi anemia pathway. The finding of the FANCA c.3446_3449dupCCCT mutation in two unrelated FA patients with Romani ethnicity from Macedonia and Kosovo suggests it is a founder mutation in the Romani population living in the Balkan region.

  13. Double-target Antisense U1snRNAs Correct Mis-splicing Due to c.639+861C>T and c.639+919G>A GLA Deep Intronic Mutations

    Directory of Open Access Journals (Sweden)

    Lorenzo Ferri

    2016-01-01

    Full Text Available Fabry disease is a rare X-linked lysosomal storage disorder caused by deficiency of the α-galactosidase A (α-Gal A enzyme, which is encoded by the GLA gene. GLA transcription in humans produces a major mRNA encoding α-Gal A and a minor mRNA of unknown function, which retains a 57-nucleotide-long cryptic exon between exons 4 and 5, bearing a premature termination codon. NM_000169.2:c.639+861C>T and NM_000169.2:c.639+919G>A GLA deep intronic mutations have been described to cause Fabry disease by inducing overexpression of the alternatively spliced mRNA, along with a dramatic decrease in the major one. Here, we built a wild-type GLA minigene and two minigenes that carry mutations c.639+861C>T and c.639+919G>A. Once transfected into cells, the minigenes recapitulate the molecular patterns observed in patients, at the mRNA, protein, and enzymatic level. We constructed a set of specific double-target U1asRNAs to correct c.639+861C>T and c.639+919G>A GLA mutations. Efficacy of U1asRNAs in inducing the skipping of the cryptic exon was evaluated upon their transient co-transfection with the minigenes in COS-1 cells, by real-time polymerase chain reaction (PCR, western blot analysis, and α-Gal A enzyme assay. We identified a set of U1asRNAs that efficiently restored α-Gal A enzyme activity and the correct splicing pathways in reporter minigenes. We also identified a unique U1asRNA correcting both mutations as efficently as the mutation-specific U1asRNAs. Our study proves that an exon skipping-based approach recovering α-Gal A activity in the c.639+861C>T and c.639+919G>A GLA mutations is active.

  14. Canine and human gastrointestinal stromal tumors display similar mutations in c-KIT exon 11

    International Nuclear Information System (INIS)

    Gregory-Bryson, Emmalena; Bartlett, Elizabeth; Kiupel, Matti; Hayes, Schantel; Yuzbasiyan-Gurkan, Vilma

    2010-01-01

    Gastrointestinal stromal tumors (GISTs) are common mesenchymal neoplasms in the gastrointestinal tract of humans and dogs. Little is known about the pathogenesis of these tumors. This study evaluated the role of c-KIT in canine GISTs; specifically, we investigated activating mutations in exons 8, 9, 11, 13, and 17 of c-KIT and exons 12, 14, and 18 of platelet-derived growth factor receptor, alpha polypeptide (PDGFRA), all of which have been implicated in human GISTs. Seventeen canine GISTs all confirmed to be positive for KIT immunostaining were studied. Exons 8, 9, 11, 13 and 17 of c-KIT and exons 12, 14, and 18 of PDGFRA, were amplified from DNA isolated from formalin-fixed paraffin-embedded samples. Of these seventeen cases, six amplicons of exon 11 of c-KIT showed aberrant bands on gel electrophoresis. Sequencing of these amplicons revealed heterozygous in-frame deletions in six cases. The mutations include two different but overlapping six base pair deletions. Exons 8, 9, 13, and 17 of c-KIT and exons 12, 14, and 18 of PDGFRA had no abnormalities detected by electrophoresis and sequencing did not reveal any mutations, other than synonymous single nucleotide polymorphisms (SNPs) found in exon 11 of c-KIT and exons 12 and 14 of PDGFRA. The deletion mutations detected in canine GISTs are similar to those previously found in the juxtamembrane domain of c-KIT in canine cutaneous mast cell tumors in our laboratory as well as to those reported in human GISTs. Interestingly, none of the other c-KIT or PDGFRA exons showed any abnormalities in our cases. This finding underlines the critical importance of c-KIT in the pathophysiology of canine GISTs. The expression of KIT and the identification of these activating mutations in c-KIT implicate KIT in the pathogenesis of these tumors. Our results indicate that mutations in c-KIT may be of prognostic significance and that targeting KIT may be a rational approach to treatment of these malignant tumors. This study further

  15. Leber's hereditary optic neuropathy is associated with mitochondrial ND6 T14502C mutation

    International Nuclear Information System (INIS)

    Zhao, Fuxin; Guan, Minqiang; Zhou, Xiangtian; Yuan, Meixia; Liang, Ming; Liu, Qi; Liu, Yan; Zhang, Yongmei; Yang, Li; Tong, Yi; Wei, Qi-Ping; Sun, Yan-Hong; Qu, Jia

    2009-01-01

    We report here the clinical, genetic, and molecular characterization of three Chinese families with Leber's hereditary optic neuropathy (LHON). There were variable severity and age of onset in visual impairment among these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of complete mitochondrial genomes in these pedigrees showed the homoplasmic T14502C (I58V) mutation, which localized at a highly conserved isoleucine at position 58 of ND6, and distinct sets of mtDNA polymorphisms belonging to haplogroups M10a, F1a1, and H2. The occurrence of T14502C mutation in these several genetically unrelated subjects affected by visual impairment strongly indicates that this mutation is involved in the pathogenesis of visual impairment. Here, mtDNA variants I187T in the ND1, A122V in CO1, S99A in the A6, and V254I in CO3 exhibited an evolutionary conservation, indicating a potential modifying role in the development of visual impairment associated with T14502C mutation in those families. Furthermore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic manifestation of the LHON-associated T14502C mutation in these Chinese families.

  16. A novel mutation in the albumin gene (c.1A>C) resulting in analbuminemia.

    Science.gov (United States)

    Caridi, Gianluca; Dagnino, Monica; Lugani, Francesca; Shalev, Stavit A; Campagnoli, Monica; Galliano, Monica; Spiegel, Ronen; Minchiotti, Lorenzo

    2013-01-01

    Analbuminemia (OMIM # 103600) is a rare autosomal recessive disorder manifested by the absence or severe reduction of circulating serum albumin in homozygous or compound heterozygous subjects. The trait is caused by a variety of mutations within the albumin gene. We report here the clinical and molecular characterisation of two new cases of congenital analbuminemia diagnosed in two members of the Druze population living in a Galilean village (Northern Israel) on the basis of their low level of circulating albumin. The albumin gene was screened by single-strand conformation polymorphism and heteroduplex analysis, and the mutated region was submitted to DNA sequencing. Both the analbuminemic subjects resulted homozygous for a previously unreported c.1 A>C transversion, for which we suggest the name Afula from the hospital where the two cases were investigated. This mutation causes the loss of the primary start codon ATG for Met1, which is replaced by a - then untranslated - triplet CTG for Leu. (p.Met1Leu). The use of an alternative downstream ATG codon would probably give rise to a completely aberrant polypeptide chain, leading to a misrouted intracellular transport and a premature degradation. The discovery of this new ALB mutation, probably inherited from a common ancestor, sheds light on the molecular mechanism underlying the analbuminemic trait and may serve in the development of a rapid genetic test for the identification of a-symptomatic heterozygous carriers in the Druze population in the Galilee. © 2012 The Authors. European Journal of Clinical Investigation © 2012 Stichting European Society for Clinical Investigation Journal Foundation.

  17. Comparison of Detection Rate and Mutational Pattern of Drug-Resistant Mutations Between a Large Cohort of Genotype B and Genotype C Hepatitis B Virus-Infected Patients in North China.

    Science.gov (United States)

    Li, Xiaodong; Liu, Yan; Xin, Shaojie; Ji, Dong; You, Shaoli; Hu, Jinhua; Zhao, Jun; Wu, Jingjing; Liao, Hao; Zhang, Xin-Xin; Xu, Dongping

    2017-06-01

    The study aimed to investigate the association of prevalent genotypes in China (HBV/C and HBV/B) with HBV drug-resistant mutations. A total of 13,847 nucleos(t)ide analogue (NA)-treated patients with chronic HBV infection from North China were enrolled. HBV genotypes and resistant mutations were determined by direct sequencing and confirmed by clonal sequencing if necessary. HBV/B, HBV/C, and HBV/D occupied 14.3%, 84.9%, and 0.8% across the study population, respectively. NA usage had no significant difference between HBV/B- and HBV/C-infected patients. Lamivudine-resistant mutations were more frequently detected in HBV/C-infected patients, compared with HBV/B-infected patients (31.67% vs. 25.26%, p M250 V/I/L substitution (0.67% vs. 1.46%, p < 0.01). Multidrug-resistant mutations (defined as coexistence of mutation to nucleoside and nucleotide analogues) were detected in 104 patients. HBV/C-infected patients had a higher detection rate of multidrug-resistant mutation than HBV/B-infected patients (0.83% vs. 0.35%, p < 0.05). The study for the first time clarified that HBV/C-infected patients had a higher risk to develop multidrug-resistant mutations, compared with HBV/B-infected patients; and HBV/C- and HBV/B-infected patients had different inclinations in the ETV-resistant mutational pattern.

  18. MERRF/MELAS overlap syndrome due to the m.3291T>C mutation.

    Science.gov (United States)

    Liu, Kaiming; Zhao, Hui; Ji, Kunqian; Yan, Chuanzhu

    2014-03-01

    We report the case of a 19-year-old Chinese female harboring the m.3291T>C mutation in the MT-TL1 gene encoding the mitochondrial transfer RNA for leucine. She presented with a complex phenotype characterized by progressive cerebellar ataxia, frequent myoclonus seizures, recurrent stroke-like episodes, migraine-like headaches with nausea and vomiting, and elevated resting lactate blood level. It is known that the myoclonus epilepsy with ragged-red fibers (MERRF) is characterized by cerebellar ataxia and myoclonus epilepsy, while that the mitochondrial encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) is characterized by recurrent stroke-like episodes, migraine-like headaches, and elevated resting lactate blood level. So the patient's clinical manifestations suggest the presence of a MERRF/MELAS overlap syndrome. Muscle biopsy of the patient showed the presence of numerous scattered ragged-red fibers, some cytochrome c oxidase-deficient fibers, and several strongly succinate dehygrogenase-reactive vessels, suggestive of a mitochondrial disorder. Direct sequencing of the complete mitochondrial genome of the proband revealed no mutations other than the T-to-C transition at nucleotide position 3291. Restriction fragment length polymorphism analysis of the proband and her family revealed maternal inheritance of the mutation in a heteroplasmic manner. The analysis of aerobic respiration and glycolysis demonstrated that the fibroblasts from the patient had mitochondrial dysfunction. Our results suggest that the m.3291T>C is pathogenic. This study is the first to describe the m.3291T>C mutation in association with the MERRF/MELAS overlap syndrome.

  19. Exploring Aquaculture. Curriculum Guide for Agriscience 282.

    Science.gov (United States)

    Texas A and M Univ., College Station. Dept. of Agricultural Education.

    This curriculum guide provides materials for teachers to use in developing a course in "Exploring Aquaculture, Agriscience 282," one of 28 semester courses in agricultural science and technology for Texas high schools. This introductory course is designed to acquaint students with the growing industry of aquaculture; it includes…

  20. Phosphorylation of connexin43 on S279/282 may contribute to laminopathy-associated conduction defects

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Steven C., E-mail: bug@uw.edu [Fred Hutchinson Cancer Research Center (FHCRC), Public Health Sciences Division, 1100 Fairview Ave. N., Seattle, WA 98109 (United States); University of Washington Department of Biochemistry, 1959 NE Pacific St., Seattle, WA 98195 (United States); Kennedy, Brian K., E-mail: bkennedy@buckinstitute.org [University of Washington Department of Biochemistry, 1959 NE Pacific St., Seattle, WA 98195 (United States); Buck Institute for Research on Aging, 8001 Redwood Boulevard, Novato, CA 94945 (United States); Lampe, Paul D., E-mail: plampe@fhcrc.org [Fred Hutchinson Cancer Research Center (FHCRC), Public Health Sciences Division, 1100 Fairview Ave. N., Seattle, WA 98109 (United States)

    2013-04-01

    An understanding of the molecular mechanism behind the arrhythmic phenotype associated with laminopathies has yet to emerge. A-type lamins have been shown to interact and sequester activated phospho-ERK1/2(pERK1/2) at the nucleus. The gap junction protein connexin43 (Cx43) can be phosphorylated by pERK1/2 on S279/282 (pS279/282), inhibiting intercellular communication. We hypothesized that without A-type lamins, pS279/282 Cx43 will increase due to inappropriate phosphorylation by pERK1/2, resulting in decreased gap junction function. We observed a 1.6-fold increase in pS279/282 Cx43 levels in Lmna{sup −/−} mouse embryonic fibroblasts (MEFs) compared to Lmna{sup +/+}, and 1.8-fold more pERK1/2 co-precipitated from Lmna{sup −/−} MEFs with Cx43 antibodies. We found a 3-fold increase in the fraction of non-nuclear pERK1/2 and a concomitant 2-fold increase in the fraction of pS279/282 Cx43 in Lmna{sup −/−} MEFs by immunofluorescence. In an assay of gap junctional function, Lmna{sup −/−} MEFs transferred dye to 60% fewer partners compared to Lmna{sup +/+} controls. These results are mirrored in 5–6 week-old Lmna{sup −/−} mice compared to their Lmna{sup +/+} littermates as we detect increased pS279/282 Cx43 in gap junctions by immunofluorescence and 1.7-fold increased levels by immunoblot. We conclude that increased pS279/282 Cx43 in the Lmna{sup −/−} background results in decreased cell communication and may contribute to the arrhythmic pathology in vivo. - Highlights: ► Connexin43 phosphorylation plays a role in laminopathy-associated conduction defects. ► Loss of A-type lamin activity results in release of pERK1/2 from the nucleus. ► Increased cytoplasmic localization of pERK1/2 acts to phosphorylate S279/282 of Cx43. ► Phosphorylation of S279/282 on Cx43 decreases gap junction activity in cell culture. ► Mice lacking A-type lamins have increased phosphorylation on S279/282 of Cx43.

  1. Inactivation of protein translocation by cold-sensitive mutations in the yajC-secDF operon

    NARCIS (Netherlands)

    Nouwen, N; Driessen, AJM

    2005-01-01

    Most mutations in the yajC-secDF operon identified via genetic screens confer a cold-sensitive growth phenotype. Here we report that two of these mutations confer this cold-sensitive phenotype by inactivating the SecDF-YajC complex in protein translocation.

  2. Novel Founder Mutation in FANCA Gene (c.3446_3449dupCCCT Among Romani Patients from the Balkan Region

    Directory of Open Access Journals (Sweden)

    Marija Dimishkovska

    2018-02-01

    Full Text Available Background: Fanconi anemia is a rare autosomal recessive or X-linked disorder characterised by clinical and genetic heterogeneity. Most fanconi anemia patients harbour homozygous or double heterozygous mutations in the FANCA (60-65%, FANCC (10-15%, FANCG (~10% or FANCD2 (3-6% genes. We have already reported the FANCA variant c.190–256_283+1680del2040dupC as a founder mutation among Macedonian fanconi anemia patients of Gypsy-like ethnic origin. Here, we present a novel FANCA mutation in two patients from Macedonia and Kosovo. Case Report: The novel FANCA mutation c.3446_3449dupCCCT was identified in two fanconi anemia patients with Romany ethnicity; a 2-year-old girl from Macedonia who is a compound heterozygote for a previously reported FANCA c.190-256_283+1680del2040dupC and the novel mutation and a 10-year-old girl from Kosovo who is a homozygote for the novel FANCA c.3446_3449dupCCCT mutation. The novel mutation is located in exon 35 in the FAAP20-binding domain which plays a crucial role in the FANCA-FAAP20 interaction and is required for integrity of the fanconi anemia pathway. Conclusion: The finding of the FANCA c.3446_3449dupCCCT mutation in two unrelated FA patients with Romani ethnicity from Macedonia and Kosovo suggests it is a founder mutation in the Romani population living in the Balkan region

  3. Clinical profile and mutation analysis of xeroderma pigmentosum in Indian patients.

    Science.gov (United States)

    Tamhankar, Parag M; Iyer, Shruti V; Ravindran, Shyla; Gupta, Neerja; Kabra, Madhulika; Nayak, Chitra; Kura, Mahendra; Sanghavi, Swapnil; Joshi, Rajesh; Chennuri, Vasundhara Sridhar; Khopkar, Uday

    2015-01-01

    Xeroderma pigmentosum (XP) is an autosomal recessive genetic disorder characterized by cutaneous and ocular photosensitivity and an increased risk of developing cutaneous neoplasms. Progressive neurological abnormalities develop in a quarter of XP patients. To study the clinical profile and perform a mutation analysis in Indian patients with xeroderma pigmentosum. Ten families with 13 patients with XP were referred to our clinic over 2 years. The genes XPA, XPB and XPC were sequentially analyzed till a pathogenic mutation was identified. Homozygous mutations in the XPA gene were seen in patients with moderate to severe mental retardation (6/10 families) but not in those without neurological features. Two unrelated families with a common family name and belonging to the same community from Maharashtra were found to have an identical mutation in the XPA gene, namely c.335_338delTTATinsCATAAGAAA (p.F112SfsX2). Testing of the XPC gene in two families with four affected children led to the identification of the novel mutations c.1243C>T or p.R415X and c.1677C>A or p.Y559X. In two families, mutations could not be identified in XPA, XPB and XPC genes. The sample size is small. Indian patients who have neurological abnormalities associated with XP should be screened for mutations in the XPA gene.

  4. Characterization of variegate porphyria mutations using a minigene approach.

    Science.gov (United States)

    Granata, Barbara Xoana; Baralle, Marco; De Conti, Laura; Parera, Victoria; Rossetti, Maria Victoria

    2015-01-01

    Porphyrias are a group of metabolic diseases that affect the skin and/or nervous system. In 2008, three unrelated patients were diagnosed with variegate porphyria at the CIPYP (Centro de Investigaciones sobre Porfirinas y Porfirias). Sequencing of the protoporphyrinogen oxidase gene, the gene altered in this type of porphyria, revealed three previously undescribed mutations: c.338+3insT, c.807G>A, and c.808-1G>C. As these mutations do not affect the protein sequence, we hypothesized that they might be splicing mutations. RT-PCRs performed on the patient's mRNAs showed normal mRNA or no amplification at all. This result indicated that the aberrant spliced transcript is possibly being degraded. In order to establish whether they were responsible or not for the patient's disease by causing aberrant splicing, we utilized a minigene approach. We found that the three mutations lead to exon skipping; therefore, the abnormal mRNAs are most likely degraded by a mechanism such as nonsense-mediated decay. In conclusion, these mutations are responsible for the disease because they alter the normal splicing pathway, thus providing a functional explanation for the appearance of disease and highlighting the use of minigene assays to complement transcript analysis.

  5. Apert Syndrome With FGFR2 758 C > G Mutation: A Chinese Case Report

    Directory of Open Access Journals (Sweden)

    Yahong Li

    2018-05-01

    Full Text Available Background: Apert syndrome is considered as one of the most common craniosynostosis syndromes with a prevalence of 1 in 65,000 individuals, and has a close relationship with point mutations in FGFR2 gene.Case report: Here, we described a Apert syndrome case, who was referred to genetic consultation in our hospital with the symptom of craniosynostosis and syndactyly of the hands and feet. Craniosynostosis, midfacial retrusion, steep wide forehead, larger head circumference, marked depression of the nasal bridge, short and wide nose and proptosis could be found obviously, apart from these, ears were mildly low compared with normal children and there was no cleft lip and palate. Mutation was identified by sanger sequencing and a mutation in the exon 7 of FGFR2 gene was detected: p.Pro253Arg (P253R 758 C > G, which was not found in his parents.Conclusion: The baby had Apert syndrome caused by 758 C > G mutation in the exon 7 of FGFR2 gene, considering no this mutation in his parents, it was spontaneous.

  6. Methylenetetrahydrofolate reductase C677T mutation and risk of retinal vein thrombosis

    Directory of Open Access Journals (Sweden)

    Mohammad Soleiman Soltanpour

    2013-01-01

    Full Text Available Background: Elevated plasma homocysteine (Hcy level has been established as a significant risk factor for venous thrombosis and cardiovascular disease. Homozygosity for the methylenetetrahydrofolate reductase (MTHFR C677T mutation has been associated with elevated plasma Hcy concentration and may contribute to retinal vein thrombosis (RVT development. The aim of the present study was to investigate whether the hyperhomocysteinemia and/or homozygosity for the MTHFR C677T mutation are associated with an increased risk for RVT. Materials and Methods: Our study population consisted of 73 consecutive patients (50-78 years old with RVT and 73 control subjects (51-80 years old, matched for age and sex. Genotyping for the MTHFR C677T mutation was performed by polymerase chain reaction-restriction fragment length polymorphism technique and Hcy level was determined by an enzyme immunoassay kit. Results: The prevalence of 677TT genotype was higher in patients than control subjects, but the difference in frequency didn′t reach a significant value (P = 0.07. The frequency of the 677T allele was 26% and 21.2% in patients and controls, respectively and did not differ significantly between the two groups (odds ratio = 1.3, 95% confidence interval (0.75-2.24, P = 0.33. Fasting plasma total Hcy level was significantly higher in patients than controls (P = 0.001. Conclusion: Our study demonstrated that hyperhomocysteinemia, but not the MTHFR C677T mutation, is associated with RVT.

  7. Efecto del tipo de lactancia durante el primer año de vida sobre el estado de hierro y el desarrollo físico y psicológico del niño

    OpenAIRE

    Bedmar Carretero, Cristina

    2012-01-01

    L’objectiu d’aquest estudi va ser valorar el desenvolupament del nen durant el primer any de vida en funció del tipus de lactància realitzada durant el primer semestre y de la dosis de ferro administrada durant el segon semestre. Hem observat que el 75,5% dels nens realitzen lactància materna exclusiva al néixer y el 16,5% la mantenen fins als 6 mesos. El 39,5% tenen alguna mutació en el gen HFE. La prevalença de dèficit de ferro y anèmia ferropènica es del 4,5% y 2,5% als 6 mesos y del 9,2% ...

  8. A patient with peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, Waardenburg syndrome, and severe hypoganglionosis associated with a novel SOX10 mutation.

    Science.gov (United States)

    Akutsu, Yuko; Shirai, Kentaro; Takei, Akira; Goto, Yudai; Aoyama, Tomohiro; Watanabe, Akimitu; Imamura, Masatoshi; Enokizono, Takashi; Ohto, Tatsuyuki; Hori, Tetsuo; Suzuki, Keiko; Hayashi, Masaharu; Masumoto, Kouji; Inoue, Ken

    2018-05-01

    In this report, we present the case of a female infant with peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, Waardenburg syndrome, and Hirschsprung disease (PCWH) associated with a novel frameshift mutation (c.842dupT) in exon 5, the last exon of SOX10. She had severe hypoganglionosis in the small intestine and entire colon, and suffered from frequent enterocolitis. The persistence of ganglion cells made both the diagnosis and treatment difficult in the neonatal period. She also showed hypopigmentation of the irises, hair and skin, bilateral sensorineural deafness with hypoplastic inner year, severe demyelinating neuropathy with hypotonia, and diffuse brain hypomyelination. The p.Ser282GlnfsTer12 mutation presumably escapes from nonsense-mediated decay and may generate a dominant-negative effect. We suggest that hypoganglionosis can be a variant intestinal manifestation associated with PCWH and that hypoganglionosis and aganglionosis may share the same pathoetiological mechanism mediated by SOX10 mutations. © 2018 Wiley Periodicals, Inc.

  9. The somatic FAH C.1061C>A change counteracts the frequent FAH c.1062+5G>A mutation and permits U1snRNA-based splicing correction.

    Science.gov (United States)

    Scalet, Daniela; Sacchetto, Claudia; Bernardi, Francesco; Pinotti, Mirko; van de Graaf, Stan F J; Balestra, Dario

    2018-05-01

    In tyrosinaemia type 1(HT1), a mosaic pattern of fumarylacetoacetase (FAH) immunopositive or immunonegative nodules in liver tissue has been reported in many patients. This aspect is generally explained by a spontaneous reversion of the mutation into a normal genotype. In one HT1 patient carrying the frequent FAH c.1062+5G>A mutation, a second somatic change (c.1061C>A) has been reported in the same allele, and found in immunopositive nodules. Here, we demonstrated that the c.1062+5G>A prevents usage of the exon 12 5' splice site (ss), even when forced by an engineered U1snRNA specifically designed on the FAH 5'ss to strengthen its recognition. Noticeably the new somatic c.1061C>A change, in linkage with the c.1062+5G>A mutation, partially rescues the defective 5'ss and is associated to trace level (~5%) of correct transcripts. Interestingly, this combined genetic condition strongly favored the rescue by the engineered U1snRNA, with correct transcripts reaching up to 60%. Altogether, these findings elucidate the molecular basis of HT1 caused by the frequent FAH c.1062+5G>A mutation, and demonstrate the compensatory effect of the c.1061C>A change in promoting exon definition, thus unraveling a rare mechanism leading to FAH immune-reactive mosaicism.

  10. Effect of T- and C-loop mutations on the Herbaspirillum seropedicae GlnB protein in nitrogen signalling.

    Science.gov (United States)

    Bonatto, Ana C; Souza, Emanuel M; Pedrosa, Fábio O; Yates, M Geoffrey; Benelli, Elaine M

    2005-01-01

    Proteins of the PII family are found in species of all kingdoms. Although these proteins usually share high identity, their functions are specific to the different organisms. Comparison of structural data from Escherichia coli GlnB and GlnK and Herbaspirillum seropedicae GlnB showed that the T-loop and C-terminus were variable regions. To evaluate the role of these regions in signal transduction by the H. seropedicae GlnB protein, four mutants were constructed: Y51F, G108A/P109a, G108W and Q3R/T5A. The activities of the native and mutated proteins were assayed in an E. coli background constitutively expressing the Klebsiella pneumoniae nifLA operon. The results suggested that the T-loop and C-terminus regions of H. seropedicae GlnB are involved in nitrogen signal transduction.

  11. The first family with Tay-Sachs disease in Cyprus: Genetic analysis reveals a nonsense (c.78G>A) and a silent (c.1305C>T) mutation and allows preimplantation genetic diagnosis.

    Science.gov (United States)

    Georgiou, Theodoros; Christopoulos, George; Anastasiadou, Violetta; Hadjiloizou, Stavros; Cregeen, David; Jackson, Marie; Mavrikiou, Gavriella; Kleanthous, Marina; Drousiotou, Anthi

    2014-12-01

    Tay-Sachs disease (TSD) is a recessively inherited neurodegenerative disorder caused by mutations in the HEXA gene resulting in β-hexosaminidase A (HEX A) deficiency and neuronal accumulation of GM2 ganglioside. We describe the first patient with Tay-Sachs disease in the Cypriot population, a juvenile case which presented with developmental regression at the age of five. The diagnosis was confirmed by measurement of HEXA activity in plasma, peripheral leucocytes and fibroblasts. Sequencing the HEXA gene resulted in the identification of two previously described mutations: the nonsense mutation c.78G>A (p.Trp26X) and the silent mutation c.1305C>T (p.=). The silent mutation was reported once before in a juvenile TSD patient of West Indian origin with an unusually mild phenotype. The presence of this mutation in another juvenile TSD patient provides further evidence that it is a disease-causing mutation. Successful preimplantation genetic diagnosis (PGD) and prenatal follow-up were provided to the couple.

  12. Mutations of 3c and spike protein genes correlate with the occurrence of feline infectious peritonitis.

    Science.gov (United States)

    Bank-Wolf, Barbara Regina; Stallkamp, Iris; Wiese, Svenja; Moritz, Andreas; Tekes, Gergely; Thiel, Heinz-Jürgen

    2014-10-10

    The genes encoding accessory proteins 3a, 3b, 3c, 7a and 7b, the S2 domain of the spike (S) protein gene and the membrane (M) protein gene of feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV) samples were amplified, cloned and sequenced. For this faeces and/or ascites samples from 19 cats suffering from feline infectious peritonitis (FIP) as well as from 20 FECV-infected healthy cats were used. Sequence comparisons revealed that 3c genes of animals with FIP were heavily affected by nucleotide deletions and point mutations compared to animals infected with FECV; these alterations resulted either in early termination or destruction of the translation initiation codon. Two ascites-derived samples of cats with FIP which displayed no alterations of ORF3c harboured mutations in the S2 domain of the S protein gene which resulted in amino acid exchanges or deletions. Moreover, changes in 3c were often accompanied by mutations in S2. In contrast, in samples obtained from faeces of healthy cats, the ORF3c was never affected by such mutations. Similarly ORF3c from faecal samples of the cats with FIP was mostly intact and showed only in a few cases the same mutations found in the respective ascites samples. The genes encoding 3a, 3b, 7a and 7b displayed no mutations linked to the feline coronavirus (FCoV) biotype. The M protein gene was found to be conserved between FECV and FIPV samples. Our findings suggest that mutations of 3c and spike protein genes correlate with the occurrence of FIP. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Multivariate Analysis of Variance: Finding significant growth in mice with craniofacial dysmorphology caused by the Crouzon mutation

    DEFF Research Database (Denmark)

    Thorup, Signe Strann; Ólafsdóttir, Hildur; Darvann, Tron Andre

    2010-01-01

    Crouzon syndrome is characterized by growth disturbances caused by premature fusion of the cranial growth zones. A mouse model with mutation Fgfr2C342Y, equivalent to the most common Crouzon syndrome mutation (henceforth called the Crouzon mouse model), has a phenotype showing many parallels to t...... used micro-CT scans of 4-week-old mice (N=5) and 6-week-old mice (N=10) with Crouzon syndrome (Fgfr2 C342Y/+) were compared to control groups of 4-week-old wild-type mice (N=5) and 6-week-old wild-type mice (N=10), respectively....

  14. Structural, Dynamical, and Energetical Consequences of Rett Syndrome Mutation R133C in MeCP2

    Directory of Open Access Journals (Sweden)

    Tugba G. Kucukkal

    2015-01-01

    Full Text Available Rett Syndrome (RTT is a progressive neurodevelopmental disease affecting females. RTT is caused by mutations in the MECP2 gene and various amino acid substitutions have been identified clinically in different domains of the multifunctional MeCP2 protein encoded by this gene. The R133C variant in the methylated-CpG-binding domain (MBD of MeCP2 is the second most common disease-causing mutation in the MBD. Comparative molecular dynamics simulations of R133C mutant and wild-type MBD have been performed to understand the impact of the mutation on structure, dynamics, and interactions of the protein and subsequently understand the disease mechanism. Two salt bridges within the protein and two critical hydrogen bonds between the protein and DNA are lost upon the R133C mutation. The mutation was found to weaken the interaction with DNA and also cause loss of helicity within the 141-144 region. The structural, dynamical, and energetical consequences of R133C mutation were investigated in detail at the atomic resolution. Several important implications of this have been shown regarding protein stability and hydration dynamics as well as its interaction with DNA. The results are in agreement with previous experimental studies and further provide atomic level understanding of the molecular origin of RTT associated with R133C variant.

  15. Prevalence of etravirine-associated mutations in clinical samples with resistance to nevirapine and efavirenz.

    Science.gov (United States)

    Llibre, J M; Santos, J R; Puig, T; Moltó, J; Ruiz, L; Paredes, R; Clotet, B

    2008-11-01

    To evaluate the expected activity of etravirine in clinical samples, according to mutational patterns associated with decreased virological response (VR). We identified 1586 routine clinical samples with resistance-associated mutations (RAMs) to nevirapine and efavirenz (K103N 60%, Y181C 37%, G190A 27%, V108I 13%). Concerning in vitro identified etravirine mutations, samples with F227C, Y181I, M230L or L100I plus K103N plus Y181C were considered highly resistant. Samples with two RAMs plus Y181C or V179D or K101E or Y188L were considered intermediate. The prevalence of 13 RAMs recently associated with decreased VR to etravirine in the DUET clinical trials was also investigated. Most samples (69%) harboured more than one IAS-USA RAM to first-generation non-nucleoside reverse transcriptase inhibitors (NNRTIs): 42% harboured two RAMs, 21% three RAMs and 6% four or more RAMs. The prevalence of 13 specific etravirine RAMs was V179F 0.12%, G190S 3.9%, Y181V 0.1%, V106I 2.6%, V179D 1.6%, K101P 2.0%, K101E 10.1%, Y181C 36.9%, A98G 5.9%, V90I 6.9%, Y181I 3.6%, G190A 27% and L100I 9.1%. The five RAMs with the most impact on VR (V179F/D, G190S, Y181V and V106I) occurred less often. Overall, 8.2% of the samples had three or more etravirine RAMs and only 1.1% had four or more. In addition, patterns of RAMs previously associated with intermediate etravirine resistance were present in 26.2% of the samples, whereas 4.85% displayed patterns of high-degree resistance. For RAMs associated with decreased VR, etravirine resistance in routine clinical samples was lower than previously reported. High-degree resistance was uncommon, even in patients with resistance to first-generation NNRTIs, whereas low-to-intermediate etravirine resistance was more common.

  16. Troponin C Mutations Partially Stabilize the Active State of Regulated Actin and Fully Stabilize the Active State When Paired with Δ14 TnT.

    Science.gov (United States)

    Baxley, Tamatha; Johnson, Dylan; Pinto, Jose R; Chalovich, Joseph M

    2017-06-13

    Striated muscle contraction is regulated by the actin-associated proteins tropomyosin and troponin. The extent of activation of myosin ATPase activity is lowest in the absence of both Ca 2+ and activating cross-bridges (i.e., S1-ADP or rigor S1). Binding of activating species of myosin to actin at a saturating Ca 2+ concentration stabilizes the most active state (M state) of the actin-tropomyosin-troponin complex (regulated actin). Ca 2+ binding alone produces partial stabilization of the active state. The extent of stabilization at a saturating Ca 2+ concentration depends on the isoform of the troponin subunits, the phosphorylation state of troponin, and, in the case of cardiac muscle, the presence of hypertrophic cardiomyopathy-producing mutants of troponin T and troponin I. Cardiac dysfunction is also associated with mutations of troponin C (TnC). Troponin C mutants A8V, C84Y, and D145E increase the Ca 2+ sensitivity of ATPase activity. We show that these mutants change the distribution of regulated actin states. The A8V and C84Y TnC mutants decreased the inactive B state distribution slightly at low Ca 2+ concentrations, but the D145E mutants had no effect on that state. All TnC mutants increased the level of the active M state compared to that of the wild type, at a saturating Ca 2+ concentration. Troponin complexes that contained two mutations that stabilize the active M state, A8V TnC and Δ14 TnT, appeared to be completely in the active state in the presence of only Ca 2+ . Because Ca 2+ gives full activation, in this situation, troponin must be capable of positioning tropomyosin in the active M state without the need for rigor myosin binding.

  17. The Frequency of c.550delA Mutation of the CANP3 Gene in the Polish LGMD2A Population.

    Science.gov (United States)

    Dorobek, Małgorzata; Ryniewicz, Barbara; Kabzińska, Dagmara; Fidziańska, Anna; Styczyńska, Maria; Hausmanowa-Petrusewicz, Irena

    2015-11-01

    Limb girdle muscular dystrophy 2A (LGMD2A) is the most frequent LGMD variant in the European population, representing about 40% of LGMD. The c.550delA mutation in the CANP3 (calcium activated neutral protease 3) gene is the most commonly reported mutation in LGMD2A. Prevalence of this mutation in the Polish population has not been previously investigated. The aim of this study was to identify and estimate the frequency of the c.550delA mutation in Polish LGMD2A patients. Polymerase chain reaction-sequencing analysis, restriction fragment length polymorphism polymerase chain reaction method. We analyzed 76 families affected with LGMD and identified 62 probands with mutations in the CANP3 gene. C.550delA was the most common mutation identified, being found in 78% of the LGMD2A families. The remaining mutations observed multiple times were as follows: c.598-612del15ntd; c.2242C>T; c.418dupC; c.1356insT, listed in terms of decreasing frequency. Two novel variants in the CANP3 gene, that is, c.700G>A Gly234Arg and c.661G>A Gly221Ser were also characterized. Overall, mutations in the LGMD2A gene were estimated to be present in 81% of patients with the LGMD phenotype who were without sarcoglycans and dysferlin deficiency on immunocytochemical analysis. The frequency of the heterozygous c.550delA mutation in the healthy Polish population was estimated at 1/124. The c.550delA is the most frequent CANP3 mutation in the Polish population, thus sequencing of exon 4 of this gene could identify the majority of LGMD2A patients in Poland.

  18. A survey of new temperature-sensitive, embryonic-lethal mutations in C. elegans: 24 alleles of thirteen genes.

    Directory of Open Access Journals (Sweden)

    Sean M O'Rourke

    2011-03-01

    Full Text Available To study essential maternal gene requirements in the early C. elegans embryo, we have screened for temperature-sensitive, embryonic lethal mutations in an effort to bypass essential zygotic requirements for such genes during larval and adult germline development. With conditional alleles, multiple essential requirements can be examined by shifting at different times from the permissive temperature of 15°C to the restrictive temperature of 26°C. Here we describe 24 conditional mutations that affect 13 different loci and report the identity of the gene mutations responsible for the conditional lethality in 22 of the mutants. All but four are mis-sense mutations, with two mutations affecting splice sites, another creating an in-frame deletion, and one creating a premature stop codon. Almost all of the mis-sense mutations affect residues conserved in orthologs, and thus may be useful for engineering conditional mutations in other organisms. We find that 62% of the mutants display additional phenotypes when shifted to the restrictive temperature as L1 larvae, in addition to causing embryonic lethality after L4 upshifts. Remarkably, we also found that 13 out of the 24 mutations appear to be fast-acting, making them particularly useful for careful dissection of multiple essential requirements. Our findings highlight the value of C. elegans for identifying useful temperature-sensitive mutations in essential genes, and provide new insights into the requirements for some of the affected loci.

  19. Novel folliculin (FLCN) mutation and familial spontaneous pneumothorax.

    Science.gov (United States)

    Zhu, J-F; Shen, X-Q; Zhu, F; Tian, L

    2017-01-01

    Familial spontaneous pneumothorax is one of the characteristics of Birt-Hogg-Dubé syndrome (BHDS), which is an autosomal dominant disease caused by the mutation of folliculin (FLCN). To investigate the mutation of FLCN gene in a familial spontaneous pneumothorax. Prospective case study. Clinical and genetic data of a Chinese family with four patients who presented spontaneous pneumothorax in the absence of skin lesions or renal tumors were collected. CT scan of patient's lung was applied for observation of pneumothorax. DNA sequencing of the coding exons (4-14 exons) of FLCN was performed for all 11 members of the family and 100 unrelated healthy controls. CT scan of patient's lung showed spontaneous pneumothorax. A mutation (c. 510C > G) that leads to a premature stop codon (p. Y170X) was found in the proband using DNA sequencing of coding exons (4-14 exons) of FLCN. This mutation was also observed in the other affected members of the family. A nonsense mutation of FLCN was found in a spontaneous pneumothorax family. Our results expand the mutational spectrum of FLCN in patients with BHDS. © The Author 2016. Published by Oxford University Press on behalf of the Association of Physicians. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Dental phenotype in Jalili syndrome due to a c.1312 dupC homozygous mutation in the CNNM4 gene.

    Directory of Open Access Journals (Sweden)

    Hans U Luder

    Full Text Available Jalili syndrome denotes a recessively inherited combination of an eye disease (cone-rod dystrophy and a dental disorder (amelogenesis imperfecta, which is caused by mutations in the CNNM4 gene. Whereas the ophthalmic consequences of these mutations have been studied comprehensively, the dental phenotype has obtained less attention. A defective transport of magnesium ions by the photoreceptors of the retina is assumed to account for the progressive visual impairment. Since magnesium is also incorporated in the mineral of dental hard tissues, we hypothesized that magnesium concentrations in defective enamel resulting from mutations in CNNM4 would be abnormal, if a similar deficiency of magnesium transport also accounted for the amelogenesis imperfecta. Thus, a detailed analysis of the dental hard tissues was performed in two boys of Kosovan origin affected by Jalili syndrome. Retinal dystrophy of the patients was diagnosed by a comprehensive eye examination and full-field electroretinography. A mutational analysis revealed a c.1312 dupC homozygous mutation in CNNM4, a genetic defect which had already been identified in other Kosovan families and putatively results in loss-of-function of the protein. The evaluation of six primary teeth using light and scanning electron microscopy as well as energy-dispersive X-ray spectroscopy showed that dental enamel was thin and deficient in mineral, suggesting a hypoplastic/hypomineralized type of amelogenesis imperfecta. The reduced mineral density of enamel was accompanied by decreased amounts of calcium, but significantly elevated levels of magnesium. In dentin, however, a similar mineral deficiency was associated with reduced magnesium and normal calcium levels. It is concluded that the c.1312 dupC mutation of CNNM4 results in mineralization defects of both enamel and dentin, which are associated with significantly abnormal magnesium concentrations. Thus, we could not disprove the hypothesis that a

  1. Is the c.3G>C mutation in the succinate dehydrogenase subunit D (SDHD) gene due to a founder effect in Chinese head and neck paraganglioma patients?

    Science.gov (United States)

    Zha, Yang; Chen, Xing-ming; Lam, Ching-wan; Lee, Soo-chin; Tong, Sui-fan; Gao, Zhi-qiang

    2011-08-01

    Three Chinese patients with head and neck paragangliomas have been reported to carry the c.3G>C mutation in the succinate dehydrogenase subunit D (SDHD) gene. In addition, in our hospital, two further patients were identified who have the same mutation. It is unclear whether the c.3G>C mutation in Chinese patients is a recurrent mutation or if it is due to a founder effect. We conducted haplotype analysis on these patients to answer this question. Individual case-control study. Germ-line mutations were confirmed in the patients and their families examined in this study using direct sequencing. We also constructed and analyzed haplotypes in four Chinese families. Genotype frequencies were compared to the control group. Three of four families shared the same haplotype, which rarely occurred in the control group. The last family shared a very short area on the physical map with the other three families. There is a founder effect in Chinese head and neck paraganglioma patients carrying the SDHD c.3G>C mutation. Copyright © 2011 The American Laryngological, Rhinological, and Otological Society, Inc.

  2. The tyrosine kinase receptor Tyro3 enhances lifespan and neuropeptide Y (Npy neuron survival in the mouse anorexia (anx mutation

    Directory of Open Access Journals (Sweden)

    Dennis Y. Kim

    2017-05-01

    Full Text Available Severe appetite and weight loss define the eating disorder anorexia nervosa, and can also accompany the progression of some neurodegenerative disorders such as amyotrophic lateral sclerosis (ALS. Although acute loss of hypothalamic neurons that produce appetite-stimulating neuropeptide Y (Npy and agouti-related peptide (Agrp in adult mice or in mice homozygous for the anorexia (anx mutation causes aphagia, our understanding of the factors that help maintain appetite regulatory circuitry is limited. Here we identify a mutation (C19T that converts an arginine to a tryptophan (R7W in the TYRO3 protein tyrosine kinase 3 (Tyro3 gene, which resides within the anx critical interval, as contributing to the severity of anx phenotypes. Our observation that, like Tyro3−/− mice, anx/anx mice exhibit abnormal secondary platelet aggregation suggested that the C19T Tyro3 variant might have functional consequences. Tyro3 is expressed in the hypothalamus and other brain regions affected by the anx mutation, and its mRNA localization appeared abnormal in anx/anx brains by postnatal day 19 (P19. The presence of wild-type Tyro3 transgenes, but not an R7W-Tyro3 transgene, doubled the weight and lifespans of anx/anx mice and near-normal numbers of hypothalamic Npy-expressing neurons were present in Tyro3-transgenic anx/anx mice at P19. Although no differences in R7W-Tyro3 signal sequence function or protein localization were discernible in vitro, distribution of R7W-Tyro3 protein differed from that of Tyro3 protein in the cerebellum of transgenic wild-type mice. Thus, R7W-Tyro3 protein localization deficits are only detectable in vivo. Further analyses revealed that the C19T Tyro3 mutation is present in a few other mouse strains, and hence is not the causative anx mutation, but rather an anx modifier. Our work shows that Tyro3 has prosurvival roles in the appetite regulatory circuitry and could also provide useful insights towards the development of interventions

  3. Hierarchical mutational events compensate for glutamate auxotrophy of a Bacillus subtilis gltC mutant.

    Science.gov (United States)

    Dormeyer, Miriam; Lübke, Anastasia L; Müller, Peter; Lentes, Sabine; Reuß, Daniel R; Thürmer, Andrea; Stülke, Jörg; Daniel, Rolf; Brantl, Sabine; Commichau, Fabian M

    2017-06-01

    Glutamate is the major donor of nitrogen for anabolic reactions. The Gram-positive soil bacterium Bacillus subtilis either utilizes exogenously provided glutamate or synthesizes it using the gltAB-encoded glutamate synthase (GOGAT). In the absence of glutamate, the transcription factor GltC activates expression of the GOGAT genes for glutamate production. Consequently, a gltC mutant strain is auxotrophic for glutamate. Using a genetic selection and screening system, we could isolate and differentiate between gltC suppressor mutants in one step. All mutants had acquired the ability to synthesize glutamate, independent of GltC. We identified (i) gain-of-function mutations in the gltR gene, encoding the transcription factor GltR, (ii) mutations in the promoter of the gltAB operon and (iii) massive amplification of the genomic locus containing the gltAB operon. The mutants belonging to the first two classes constitutively expressed the gltAB genes and produced sufficient glutamate for growth. By contrast, mutants that belong to the third class appeared most frequently and solved glutamate limitation by increasing the copy number of the poorly expressed gltAB genes. Thus, glutamate auxotrophy of a B. subtilis gltC mutant can be relieved in multiple ways. Moreover, recombination-dependent amplification of the gltAB genes is the predominant mutational event indicating a hierarchy of mutations. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  4. Genetics Ustilago violacea. XXXIII. Genetic evidence for insertional mutations in the magenta locus

    International Nuclear Information System (INIS)

    Garber, E.D.; Ruddat, M.

    1996-01-01

    Three spontaneous mutants (m-1, m-2, and m-31) with a new sporidial colony color (magenta, m) were found in the stable pink 1.A1 a-1 and 2.A2 a-2 laboratory strains. The m-1 and white (w) mutations were very closely linked (<0.1 cM); the m locus was assumed to be distal from the w locus and in the same chromosome arm. The color mutations formed a map of very closely linked (<1 cM), centromere-linked loci: orange (o)-pumpkin (p)-yellow (y)-centr-wA-wB-m. Crosses between the m-1 and m-2 mutants, between the m-2 mutant and laboratory strains with a different color, and between the m-2 mutant and strains from the herbarium/field collections gave nonsectored and sectored teliospore colonies with a nonparental color. All of the teliospores colonies from cross AV13 involving strains 1.C417* y and 2.C413 p had a nonparental color or different nonparental colors, including magenta. The UV-irradiation of m-1, m-2, and m-31 sporidia gave mostly pink (+) colonies, ranging from 9% to 48%. Occasional nonsectored w and p colonies as well as one bisectored m/+ and one w/+ colony were found. Approximately 103 m-1 sporidia were UV-irradiated, and the following colonies with a nonparental color were found: w (one), p (three), o (one), +f (one), ms (supermagenta) (one), and m/+ (one). Crosses involving the m-2 mutant and the +f, ms, p, w, and y mutants indicated that the +f and ms mutants resulted from an insertional mutation and the others from a genic mutation. Sites of element insertion were (1) most likely in the pericentric regions to give the pink phenotype, (2) less likely in the y and p loci in the same chromosome arm and in the complex w locus, and (3) least likely in the o locus in one arm and m locus in the other arm. These observations were explained by proposing the transcentric transposition of a cryptic or a transactive element in the homologous chromosome with the color mutations during meiosis and to the UV-induced transposition of an element in sporidia

  5. Cox1 mutation abrogates need for Cox23 in cytochrome c oxidase biogenesis

    Directory of Open Access Journals (Sweden)

    Richard Dela Cruz

    2016-06-01

    Full Text Available Cox23 is a known conserved assembly factor for cytochrome c oxidase, although its role in cytochrome c oxidase (CcO biogenesis remains unresolved. To gain additional insights into its role, we isolated spontaneous suppressors of the respiratory growth defect in cox23∆ yeast cells. We recovered independent colonies that propagated on glycerol/lactate medium for cox23∆ cells at 37°C. We mapped these mutations to the mitochondrial genome and specifically to COX1 yielding an I101F substitution. The I101F Cox1 allele is a gain-of-function mutation enabling yeast to respire in the absence of Cox23. CcO subunit steady-state levels were restored with the I101F Cox1 suppressor mutation and oxygen consumption and CcO activity were likewise restored. Cells harboring the mitochondrial genome encoding I101F Cox1 were used to delete genes for other CcO assembly factors to test the specificity of the Cox1 mutation as a suppressor of cox23∆ cells. The Cox1 mutant allele fails to support respiratory growth in yeast lacking Cox17, Cox19, Coa1, Coa2, Cox14 or Shy1, demonstrating its specific suppressor activity for cox23∆ cells.

  6. Aarskog-Scott syndrome: clinical update and report of nine novel mutations of the FGD1 gene.

    Science.gov (United States)

    Orrico, A; Galli, L; Faivre, L; Clayton-Smith, J; Azzarello-Burri, S M; Hertz, J M; Jacquemont, S; Taurisano, R; Arroyo Carrera, I; Tarantino, E; Devriendt, K; Melis, D; Thelle, T; Meinhardt, U; Sorrentino, V

    2010-02-01

    Mutations in the FGD1 gene have been shown to cause Aarskog-Scott syndrome (AAS), or facio-digito-genital dysplasia (OMIM#305400), an X-linked disorder characterized by distinctive genital and skeletal developmental abnormalities with a broad spectrum of clinical phenotypes. To date, 20 distinct mutations have been reported, but little phenotypic data are available on patients with molecularly confirmed AAS. In the present study, we report on our experience of screening for mutations in the FGD1 gene in a cohort of 60 European patients with a clinically suspected diagnosis of AAS. We identified nine novel mutations in 11 patients (detection rate of 18.33%), including three missense mutations (p.R402Q; p.S558W; p.K748E), four truncating mutations (p.Y530X; p.R656X; c.806delC; c.1620delC), one in-frame deletion (c.2020_2022delGAG) and the first reported splice site mutation (c.1935+3A>C). A recurrent mutation (p.R656X) was detected in three independent families. We did not find any evidence for phenotype-genotype correlations between type and position of mutations and clinical features. In addition to the well-established phenotypic features of AAS, other clinical features are also reported and discussed. Copyright 2010 Wiley-Liss, Inc.

  7. 30 CFR 282.4 - Opportunities for review and comment.

    Science.gov (United States)

    2010-07-01

    ... OPERATIONS IN THE OUTER CONTINENTAL SHELF FOR MINERALS OTHER THAN OIL, GAS, AND SULPHUR General § 282.4... potential impacts on the environment and to provide comments and recommendations for the disposition of the...

  8. CBL is frequently altered in lung cancers: its relationship to mutations in MET and EGFR tyrosine kinases.

    Directory of Open Access Journals (Sweden)

    Yi-Hung Carol Tan

    2010-01-01

    Full Text Available Non-small cell lung cancer (NSCLC is a heterogeneous group of disorders with a number of genetic and proteomic alterations. c-CBL is an E3 ubiquitin ligase and adaptor molecule important in normal homeostasis and cancer. We determined the genetic variations of c-CBL, relationship to receptor tyrosine kinases (EGFR and MET, and functionality in NSCLC.Using archival formalin-fixed paraffin embedded (FFPE extracted genomic DNA, we show that c-CBL mutations occur in somatic fashion for lung cancers. c-CBL mutations were not mutually exclusive of MET or EGFR mutations; however they were independent of p53 and KRAS mutations. In normal/tumor pairwise analysis, there was significant loss of heterozygosity (LOH for the c-CBL locus (22%, n = 8/37 and none of these samples revealed any mutation in the remaining copy of c-CBL. The c-CBL LOH also positively correlated with EGFR and MET mutations observed in the same samples. Using select c-CBL somatic mutations such as S80N/H94Y, Q249E and W802* (obtained from Caucasian, Taiwanese and African-American samples, respectively transfected in NSCLC cell lines, there was increased cell viability and cell motility.Taking the overall mutation rate of c-CBL to be a combination as somatic missense mutation and LOH, it is clear that c-CBL is highly mutated in lung cancers and may play an essential role in lung tumorigenesis and metastasis.

  9. Light fragment preformation in cold fission of {sup 282}Cn

    Energy Technology Data Exchange (ETDEWEB)

    Poenaru, D.N.; Gherghescu, R.A. [Horia Hulubei National Institute of Physics and Nuclear Engineering (IFIN-HH), P.O. Box MG-6, Bucharest-Magurele (Romania); Johann Wolfgang Goethe University, Frankfurt Institute for Advanced Studies (FIAS), Frankfurt am Main (Germany)

    2016-11-15

    In a previous article, published in Phys. Rev. C 94, 014309 (2016), we have shown for the first time that the best dynamical trajectory during the deformation toward fission of the superheavy nucleus {sup 286}Fl is a linearly increasing radius of the light fragment, R{sub 2}. This macroscopic-microscopic result reminds us about the α or cluster preformation at the nuclear surface, assumed already in 1928, and proved microscopically many times. This time we give more detailed arguments for the nucleus {sup 282}Cn. Also similar figures are presented for heavy nuclei {sup 240}Pu and {sup 252} Cf. The deep minimum of the total deformation energy near the surface is shown for the first time as a strong argument for cluster preformation. (orig.)

  10. Intermediate long X-ray bursts from the ultra-compact binary candidate SLX1737-282

    DEFF Research Database (Denmark)

    Falanga, M.; Chenevez, Jérôme; Cumming, A.

    2008-01-01

    . The observed intermediate long burst properties from SLX 1737-282 are consistent with helium ignition at the column depth of 5-8 × 109 g cm-2 and a burst energy release of 1041 erg. The apparent recurrence time of ≃86 days between the intermediate long bursts from SLX 1737-282 suggests a regime of unstable...... bursts. Methods: Up to now only four bursts, all with duration between ≃15{-}30 min, have been recorded for SLX 1737-282. The properties of three of these intermediate long X-ray bursts observed by INTEGRAL are investigated and compared to other burster sources. The broadband spectrum of the persistent...

  11. Mitochondrial C4375T mutation might be a molecular risk factor in a maternal Chinese hypertensive family under haplotype C.

    Science.gov (United States)

    Chen, Hong; Sun, Min; Fan, Zhen; Tong, Maoqing; Chen, Guodong; Li, Danhui; Ye, Jihui; Yang, Yumin; Zhu, Yongding; Zhu, Jianhua

    2017-12-04

    Here, we reported a Han Chinese essential hypertensive pedigree based on clinical hereditary and molecular data. To know the molecular basis on this family, mitochondrial genome of one proband from the family was identified through direct sequencing analysis. The age of onset year and affected degree of patients are different in this family. And matrilineal family members carrying C4375T mutation and belong to Eastern Asian halopgroup C. Phylogenetic analysis shows 4375C is highly conservative in 17 species. It is suggested that these mutations might participate in the development of hypertension in this family. And halopgroup C might play a modifying role on the phenotype in this Chinese hypertensive family.

  12. El ojo y la cámara fotográfica. Semejanzas y diferencias

    OpenAIRE

    Geijo Vegas, Noelia

    2016-01-01

    Las cámaras fotográficas poseen un sistema de formación de imagen que guarda estrecha relación con la formación de imagen del ojo humano: en una cámara la luz pasa a través de un sistema de lentes y forma una imagen invertida en el sensor; en el ojo humano la luz pasa a través de la córnea y el cristalino y forma una imagen; también invertida, en la retina. En este trabajo se describen y comparan las distintas partes de ambos elementos que intervienen en la formación de la imagen como son el ...

  13. 10 CFR 205.282 - Evaluation of petition by the Office of Hearings and Appeals.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 3 2010-01-01 2010-01-01 false Evaluation of petition by the Office of Hearings and Appeals. 205.282 Section 205.282 Energy DEPARTMENT OF ENERGY OIL ADMINISTRATIVE PROCEDURES AND SANCTIONS... and Appeals or his designee shall issue a final Decision and Order which shall govern the disposition...

  14. Xeroderma Pigmentosum-Trichothiodystrophy overlap patient with novel XPD/ERCC2 mutation

    DEFF Research Database (Denmark)

    Kralund, Henrik H; Ousager, Lilian; Jaspers, Nicolaas G

    2013-01-01

    outcome from many of these mutations. We demonstrate a patient, believed to represent an overlap between XP and TTD/CS. In addition to other organ dysfunctions, the young man presented with Photosensitivity, Ichthyosis, Brittle hair, Impaired physical and mental development, Decreased fertility and Short...... appearance also suggested XP, but fibroblast cultures only demonstrated x2 UV-sensitivity with expected NER and TFIIH-activity decrease. Genetic sequencing of the XPD/ERCC2 gene established the patient as heterozygote compound with a novel, N-terminal Y18H mutation and a known C-terminal (TTD) mutation, A725...

  15. Mutations in Plasmodium falciparum K13 propeller gene from Bangladesh (2009-2013).

    Science.gov (United States)

    Mohon, Abu Naser; Alam, Mohammad Shafiul; Bayih, Abebe Genetu; Folefoc, Asongna; Shahinas, Dea; Haque, Rashidul; Pillai, Dylan R

    2014-11-18

    Bangladesh is a malaria hypo-endemic country sharing borders with India and Myanmar. Artemisinin combination therapy (ACT) remains successful in Bangladesh. An increase of artemisinin-resistant malaria parasites on the Thai-Cambodia and Thai-Myanmar borders is worrisome. K13 propeller gene (PF3D7_1343700 or PF13_0238) mutations have been linked to both in vitro artemisinin resistance and in vivo slow parasite clearance rates. This group undertook to evaluate if mutations seen in Cambodia have emerged in Bangladesh where ACT use is now standard for a decade. Samples were obtained from Plasmodium falciparum-infected malaria patients from Upazila health complexes (UHC) between 2009 and 2013 in seven endemic districts of Bangladesh. These districts included Khagrachari (Matiranga UHC), Rangamati (Rajasthali UHC), Cox's Bazar (Ramu and Ukhia UHC), Bandarban (Lama UHC), Mymensingh (Haluaghat UHC), Netrokona (Durgapur and Kalmakanda UHC), and Moulvibazar (Sreemangal and Kamalganj UHC). Out of 296 microscopically positive P. falciparum samples, 271 (91.6%) were confirmed as mono-infections by both real-time PCR and nested PCR. The K13 propeller gene from 253 (93.4%) samples was sequenced bi-directionally. One non-synonymous mutation (A578S) was found in Bangladeshi clinical isolates. The A578S mutation was confirmed and lies adjacent to the C580Y mutation, the major mutation causing delayed parasite clearance in Cambodia. Based on computational modeling A578S should have a significant effect on tertiary structure of the protein. The data suggest that P. falciparum in Bangladesh remains free of the C580Y mutation linked to delayed parasite clearance. However, the mutation A578S is present and based on structural analysis could affect K13 gene function. Further in vivo clinical studies are required to validate the effect of this mutation.

  16. Nuclear envelope alterations in fibroblasts from LGMD1B patients carrying nonsense Y259X heterozygous or homozygous mutation in lamin A/C gene.

    NARCIS (Netherlands)

    Muchir, A.; Engelen, B.G.M. van; Lammens, M.M.Y.; Mislow, J.M.; McNally, E.; Schwartz, K.; Bonne, G.

    2003-01-01

    Mutations in the LMNA gene encoding nuclear lamins A and C are responsible for seven inherited disorders affecting specific tissues. We have analyzed skin fibroblasts from a patient with type 1B limb-girdle muscular dystrophy and from her deceased newborn grandchild carrying, respectively, a

  17. Epidermal growth factor receptor mutation in gastric cancer.

    Science.gov (United States)

    Liu, Zhimin; Liu, Lina; Li, Mei; Wang, Zhaohui; Feng, Lu; Zhang, Qiuping; Cheng, Shihua; Lu, Shen

    2011-04-01

    Epidermal growth factor receptor (EGFR) and Kirsten-RAS (KRAS) mutations have been identified as predictors of response to EGFR tyrosine kinase inhibitors (TKIs) in non-small cell lung cancer. We aimed to screen the mutations of both genes in gastric carcinoma to detect the suitability of EGFR TKIs for patients with gastric carcinoma. We screened EGFR mutation in exons 19-21 and KRAS mutation in exon 2 in 58 gastric adenocarcinomas from China using high resolution melting analysis (HRMA). Positive samples were confirmed by DNA sequencing. Three EGFR missense mutations (5.2%) and 22 single nucleotide polymorphisms (SNP, Q787Q, 37.9%) were identified. To our knowledge, we report for the first time three mutation patterns of EGFR, Y801C, L858R and G863D, in gastric carcinoma. Two samples with EGFR mutation were mucinous adenocarcinoma. These three samples were collected from male patients aged over 75 years old. The frequency of KRAS mutation was 10.3% (6/58). The exclusiveness of EGFR and KRAS mutations was proven for the first time in gastric cancer. Gastric carcinoma of the mucinous adenocarcinoma type collected from older male patients may harbour EGFR mutations. The small subset of gastric adenocarcinoma patients may respond to EGFR TKIs.

  18. A novel lamin A/C mutation in a Dutch family with premature atherosclerosis.

    Science.gov (United States)

    Weterings, A A W; van Rijsingen, I A W; Plomp, A S; Zwinderman, A H; Lekanne Deprez, R H; Mannens, M M; van den Bergh Weerman, M A; van der Wal, A C; Pinto-Sietsma, S J

    2013-07-01

    We report a novel lamin A/C (LMNA) mutation, p.Glu223Lys, in a family with extensive atherosclerosis, diabetes mellitus and steatosis hepatis. Sequence analysis of LMNA (using Alamut version 2.2), co-segregation analysis, electron microscopy, extensive phenotypic evaluation of the mutation carriers and literature comparison were used to determine the loss of function of this mutation. The father of three siblings died at the age of 45 years. The three siblings and the brother and sister of the father were referred to the cardiovascular genetics department, because of the premature atherosclerosis and dysmorphic characteristics observed in the father at autopsy. The novel LMNA mutation, p.Glu223Lys, was identified in the proband and his two sons. Clinical evaluation revealed atherosclerosis, insulin resistance and hypertension in the proband and dyslipidemia and hepatic steatosis in all the patients with the mutation. Based on the facts that in silico analysis predicts a possibly pathogenic mutation, the mutation co-segregates with the disease, only fibroblasts from mutation carriers show nuclear blebbing and a similar phenotype was reported to be due to missense mutations in LMNA we conclude that we deal with a pathogenic mutation. We conclude that the phenotype is similar to Dunnigan-type familial partial lipodystrophy. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  19. Thermal Analysis in the Technological “Step” Test of H282 Nickel Alloy

    Directory of Open Access Journals (Sweden)

    Pirowski Z.

    2015-03-01

    Full Text Available Superalloys show a good combination of mechanical strength and resistance to surface degradation under the influence of chemically active environments at high temperature. They are characterized by very high heat and creep resistance. Their main application is in gas turbines, chemical industry, and in all those cases where resistance to creep and the aggressive corrosion environment is required. Modern jet engines could never come into use if not for progress in the development of superalloys. Superalloys are based on iron, nickel and cobalt. The most common and the most interesting group includes superalloys based on nickel. They carry loads at temperatures well in excess of the eighty percent of the melting point. This group includes the H282 alloy, whose nominal chemical composition is as follows (wt%: Ni - base, Fe - max. 1.5%, Al - 1.5% Ti - 2.1%, C - 0.06% Co - 10% Cr - 20% Mo - 8.5%. This study shows the results of thermal analysis of the H282 alloy performed on a cast step block with different wall thickness. Using the results of measurements, changes in the temperature of H282 alloy during its solidification were determined, and the relationship dT / dt = f (t was derived. The results of the measurements taken at different points in the cast step block allowed identifying a number of thermal characteristics of the investigated alloy and linking the size of the dendrites formed in a metal matrix (DAS with the thermal effect of solidification. It was found that the time of solidification prolonged from less than ome minute at 10 mm wall thickness to over seven minutes at the wall thickness of 44 mm doubled the value of DAS.

  20. Leber's hereditary optic neuropathy is associated with mitochondrial ND6 T14502C mutation

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Fuxin [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Guan, Minqiang [Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Zhou, Xiangtian [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Yuan, Meixia; Liang, Ming [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Liu, Qi [Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Liu, Yan; Zhang, Yongmei [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Yang, Li [Division of Human Genetics, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH 45229 (United States); Tong, Yi [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); The First Affiliated Hospital, Fujian Medical University, Fuzhou, Fujian 350005 (China); Wei, Qi-Ping; Sun, Yan-Hong [Department of Ophthalmology, Dongfang Hospital, Beijing University of Chinese Medicine and Pharmacology, Beijing 100078 (China); Qu, Jia, E-mail: jqu@wzmc.net [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); and others

    2009-11-20

    We report here the clinical, genetic, and molecular characterization of three Chinese families with Leber's hereditary optic neuropathy (LHON). There were variable severity and age of onset in visual impairment among these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of complete mitochondrial genomes in these pedigrees showed the homoplasmic T14502C (I58V) mutation, which localized at a highly conserved isoleucine at position 58 of ND6, and distinct sets of mtDNA polymorphisms belonging to haplogroups M10a, F1a1, and H2. The occurrence of T14502C mutation in these several genetically unrelated subjects affected by visual impairment strongly indicates that this mutation is involved in the pathogenesis of visual impairment. Here, mtDNA variants I187T in the ND1, A122V in CO1, S99A in the A6, and V254I in CO3 exhibited an evolutionary conservation, indicating a potential modifying role in the development of visual impairment associated with T14502C mutation in those families. Furthermore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic manifestation of the LHON-associated T14502C mutation in these Chinese families.

  1. The m.3291T>C mt-tRNALeu(UUR) mutation is definitely pathogenic and causes multisystem mitochondrial disease

    Science.gov (United States)

    Yarham, John W.; Blakely, Emma L.; Alston, Charlotte L.; Roberts, Mark E.; Ealing, John; Pal, Piyali; Turnbull, Douglass M.; McFarland, Robert; Taylor, Robert W.

    2013-01-01

    Mitochondrial tRNA point mutations are important causes of human disease, and have been associated with a diverse range of clinical phenotypes. Definitively proving the pathogenicity of any given mt-tRNA mutation requires combined molecular, genetic and functional studies. Subsequent evaluation of the mutation using a pathogenicity scoring system is often very helpful in concluding whether or not the mutation is causing disease. Despite several independent reports linking the m.3291T>C mutation to disease in humans, albeit in association with several different phenotypes, its pathogenicity remains controversial. A lack of conclusive functional evidence and an over-emphasis on the poor evolutionary conservation of the affected nucleotide have contributed to this controversy. Here we describe an adult patient who presented with deafness and lipomas and evidence of mitochondrial abnormalities in his muscle biopsy, who harbours the m.3291T > C mutation, providing conclusive evidence of pathogenicity through analysis of mutation segregation with cytochrome c oxidase (COX) deficiency in single muscle fibres, underlining the importance of performing functional studies when assessing pathogenicity. PMID:23273904

  2. 7 CFR 282.1 - Legislative authority and notice requirements.

    Science.gov (United States)

    2010-01-01

    ... Section 282.1 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE FOOD STAMP AND FOOD DISTRIBUTION PROGRAM DEMONSTRATION, RESEARCH, AND... 17 of the Act authorizes the Secretary to conduct demonstration, research, and evaluation projects...

  3. Are c.436G>A mutations less severe forms of Lafora disease? A case report

    Directory of Open Access Journals (Sweden)

    Hélène-Marie Lanoiselée

    2014-01-01

    Full Text Available Lafora disease is a form of progressive myoclonic epilepsy with autosomal recessive transmission. Two genes have been identified so far: EPM2A and NHLRC1, and a third gene, concerning a pediatric onset subform, has been recently proposed. We report the case of a 23-year-old woman of Turkish origin with an unusual disease course. Clinical onset was at the age of 19 years with tonic–clonic seizures, followed by cognitive impairment; EEG was in favor of Lafora disease, and the mutation c.436G>A (a missense mutation substituting aspartic acid in asparagine in the NHLRC1 gene confirmed this diagnosis. After 5 years of evolution, the patient only has moderate cognitive impairment. Some NHLRC1 mutations, particularly c.436G>A, are associated with a slower clinical course, but there are conflicting data in the literature. This case strengthens the hypothesis that the c.436G>A mutation in the NHLRC1 gene leads to less severe phenotypes and late-onset disease.

  4. Clinical follow up of Mexican women with early onset of breast cancer and mutations in the BRCA1 and BRCA2 genes Estudio de seguimiento clínico de mujeres mexicanas con cáncer de mama de inicio temprano y mutaciones en los genes BRCA1 y BRCA2

    Directory of Open Access Journals (Sweden)

    Ana Laura Calderón-Garcidueñas

    2005-04-01

    Full Text Available OBJECTIVE: This study describes the presence of mutations in BRCA1 and BRCA2 genes in a group of Mexican women and the clinical evolution of early onset breast cancer (EOBC. MATERIAL AND METHODS: A prospective hospital-based study was performed in a sample of 22 women with EOBC (7 in clinical stage IIA, 8 in IIB, and 7 in IIIA. The patients attended a tertiary care hospital in northeastern Mexico in 1997 and were followed up over a 5-year period. Molecular analysis included: 1 a mutation screening by heteroduplex analysis (HA of BRCA1 and BRCA2 genes and 2 a sequence analysis. RESULTS: Of 22 patients, 14 (63.6% showed a variant band detected by heteroduplex analysis of the BRCA1 and BRCA2 genes: 8 polymorphisms, 4 mutations of uncertain significance, and 2 novel truncated protein mutations, one in BRCA1 (exon 11, 3587delT and the other in the BRCA2 gene (exon 11, 2664InsA. CONCLUSIONS: These findings support future studies to determine the significance and impact of the genetic factor in this Mexican women population.OBJETIVO: Describir la presencia de mutaciones en los genes BRCA1 y BRCA2 y la evolución clínica de un grupo de mujeres con carcinoma mamario de inicio temprano (CMIT. MATERIAL Y MÉTODOS: Se realizó un estudio hospitalario, prospectivo, en una muestra de 22 pacientes con CMIT (siete en etapa clínica IIA, ocho en la IIB y siete en etapa IIIA. Las pacientes fueron atendidas en un hospital del noreste de México en 1997 y se realizó un seguimiento clínico durante cinco años. El análisis molecular incluyó: 1 análisis heterodúplex (AH para detectar bandas variantes en la secuencia de ADN de los genes BRCA1 y BRCA2, y 2 análisis de secuenciación. RESULTADOS: De 22 pacientes, 14 (63.6% mostraron banda variante por AH en los genes BRCA1 y BRCA2: ocho polimorfismos, cuatro mutaciones de significado incierto y dos mutaciones noveles con proteína truncada, una en BRCA1 (exón 11, 3587delT y otra en BRCA2 (exón 11, 2664Ins

  5. Presenilin-1 mutations alter K+ currents in the human neuroblastoma cell line, SH-SY5Y

    DEFF Research Database (Denmark)

    Plant, Leigh D; Boyle, John P; Thomas, Natasha M

    2002-01-01

    Mutations in presenilin 1 (PS1) are the major cause of autosomal dominant Alzheimer's disease. We have measured the voltage-gated K+ current in the human neuroblastoma cell line SH-SY5Y using whole-cell patch-clamp. When cells were stably transfected to over-express PS1, no change in K+ current...

  6. Diagnosis of Xeroderma Pigmentosum Groups A and C by Detection of Two Prevalent Mutations in West Algerian Population: A Rapid Genotyping Tool for the Frequent XPC Mutation c.1643_1644delTG.

    Science.gov (United States)

    Bensenouci, Salima; Louhibi, Lotfi; De Verneuil, Hubert; Mahmoudi, Khadidja; Saidi-Mehtar, Nadhira

    2016-01-01

    Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder. Considering that XP patients have a defect of the nucleotide excision repair (NER) pathway which enables them to repair DNA damage caused by UV light, they have an increased risk of developing skin and eyes cancers. In the present study, we investigated the involvement of the prevalent XPA and XPC genes mutations-nonsense mutation (c.682C>T, p.Arg228X) and a two-base-pair (2 bp) deletion (c.1643_1644delTG or p.Val548Ala fsX25), respectively-in 19 index cases from 19 unrelated families in the West of Algeria. For the genetic diagnosis of XPA gene, we proceeded to PCR-RFLP. For the XPC gene, we validated a routine analysis which includes a specific amplification of a short region surrounding the 2 bp deletion using a fluorescent primer and fragment sizing (GeneScan size) on a sequencing gel. Among the 19 index cases, there were 17 homozygous patients for the 2 bp deletion in the XPC gene and 2 homozygous patients carrying the nonsense XPA mutation. Finally, XPC appears to be the major disease-causing gene concerning xeroderma pigmentosum in North Africa. The use of fragment sizing is the simplest method to analyze this 2 bp deletion for the DNA samples coming from countries where the mutation c.1643_1644delTG of XPC gene is prevalent.

  7. Thermo-Viscoplastic Behavior of Ni-Based Superalloy Haynes 282 and Its Application to Machining Simulation

    Directory of Open Access Journals (Sweden)

    Marcos Rodríguez-Millán

    2017-12-01

    Full Text Available Ni-based superalloys are extensively used in high-responsibility applications in components of aerospace engines and gas turbines with high temperature service lives. The wrought, γ’-strengthened superalloy Haynes 282 has been recently developed for applications similar to other common superalloys, such as Waspaloy or Inconel 718, with improved creep behavior, thermal stability, and fabrication ability. Despite the potential of Haynes 282, there are still important gaps in the knowledge of the mechanical behavior of this alloy. In fact, it was not possible to find information concerning the mechanical behavior of the alloy under impulsive loading. This paper focuses on the mechanical characterization of the Haynes 282 at strain rates ranging from 0.1 to 2800 s−1 and high temperatures ranging from 293 to 523 K using Hopkinson bar compression tests. The experimental results from the thermo-mechanical characterization allowed for calibration of the Johnson–Cook model widely used in modeling metallic alloy’s responses under dynamic loading. Moreover, the behavior of Haynes 282 was compared to that reported for Inconel 718, and the results were used to successfully model the orthogonal cutting of Haynes 282, being a typical case of dynamic loading requiring previous characterization of the alloy.

  8. Mutations in SOX17 are Associated with Congenital Anomalies of the Kidney and the Urinary Tract

    Science.gov (United States)

    Gimelli, Stefania; Caridi, Gianluca; Beri, Silvana; McCracken, Kyle; Bocciardi, Renata; Zordan, Paola; Dagnino, Monica; Fiorio, Patrizia; Murer, Luisa; Benetti, Elisa; Zuffardi, Orsetta; Giorda, Roberto; Wells, James M; Gimelli, Giorgio; Ghiggeri, Gian Marco

    2010-01-01

    Congenital anomalies of the kidney and the urinary tract (CAKUT) represent a major source of morbidity and mortality in children. Several factors (PAX, SOX,WNT, RET, GDFN, and others) play critical roles during the differentiation process that leads to the formation of nephron epithelia. We have identified mutations in SOX17, an HMG-box transcription factor and Wnt signaling antagonist, in eight patients with CAKUT (seven vesico-ureteric reflux, one pelvic obstruction). One mutation, c.775T>A (p.Y259N), recurred in six patients. Four cases derived from two small families; renal scars with urinary infection represented the main symptom at presentation in all but two patients. Transfection studies indicated a 5–10-fold increase in the levels of the mutant protein relative to wild-type SOX17 in transfected kidney cells. Moreover we observed a corresponding increase in the ability of SOX17 p.Y259N to inhibit Wnt/β-catenin transcriptional activity, which is known to regulate multiple stages of kidney and urinary tract development. In conclusion, SOX17 p.Y259N mutation is recurrent in patients with CAKUT. Our data shows that this mutation correlates with an inappropriate accumulation of SOX17-p.Y259N protein and inhibition of the β-catenin/Wnt signaling pathway. These data indicate a role of SOX17 in human kidney and urinary tract development and implicate the SOX17–p.Y259N mutation as a causative factor in CAKUT. Hum Mutat 31:1352–1359, 2010. © 2010 Wiley-Liss, Inc. PMID:20960469

  9. The effect of mutations in the AmpC promoter region on β-lactam ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-08-04

    Aug 4, 2008 ... between the -10 and -35 boxes affects the resistance of bacteria to β-lactam antibiotics. .... The chromosomal cephalosporinase gene, ampC, of E. .... mutation in the ampC promoter increasing resistance to β-lactams in.

  10. Mesotrypsin Signature Mutation in a Chymotrypsin C (CTRC) Variant Associated with Chronic Pancreatitis.

    Science.gov (United States)

    Szabó, András; Ludwig, Maren; Hegyi, Eszter; Szépeová, Renata; Witt, Heiko; Sahin-Tóth, Miklós

    2015-07-10

    Human chymotrypsin C (CTRC) protects against pancreatitis by degrading trypsinogen and thereby curtailing harmful intra-pancreatic trypsinogen activation. Loss-of-function mutations in CTRC increase the risk for chronic pancreatitis. Here we describe functional analysis of eight previously uncharacterized natural CTRC variants tested for potential defects in secretion, proteolytic stability, and catalytic activity. We found that all variants were secreted from transfected cells normally, and none suffered proteolytic degradation by trypsin. Five variants had normal enzymatic activity, whereas variant p.R29Q was catalytically inactive due to loss of activation by trypsin and variant p.S239C exhibited impaired activity possibly caused by disulfide mispairing. Surprisingly, variant p.G214R had increased activity on a small chromogenic peptide substrate but was markedly defective in cleaving bovine β-casein or the natural CTRC substrates human cationic trypsinogen and procarboxypeptidase A1. Mutation p.G214R is analogous to the evolutionary mutation in human mesotrypsin, which rendered this trypsin isoform resistant to proteinaceous inhibitors and conferred its ability to cleave these inhibitors. Similarly to the mesotrypsin phenotype, CTRC variant p.G214R was inhibited poorly by eglin C, ecotin, or a CTRC-specific variant of SGPI-2, and it readily cleaved the reactive-site peptide bonds in eglin C and ecotin. We conclude that CTRC variants p.R29Q, p.G214R, and p.S239C are risk factors for chronic pancreatitis. Furthermore, the mesotrypsin-like CTRC variant highlights how the same natural mutation in homologous pancreatic serine proteases can evolve a new physiological role or lead to pathology, determined by the biological context of protease function. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Identification of novel mutations in HEXA gene in children affected with Tay Sachs disease from India.

    Directory of Open Access Journals (Sweden)

    Mehul Mistri

    Full Text Available Tay Sachs disease (TSD is a neurodegenerative disorder due to β-hexosaminidase A deficiency caused by mutations in the HEXA gene. The mutations leading to Tay Sachs disease in India are yet unknown. We aimed to determine mutations leading to TSD in India by complete sequencing of the HEXA gene. The clinical inclusion criteria included neuroregression, seizures, exaggerated startle reflex, macrocephaly, cherry red spot on fundus examination and spasticity. Neuroimaging criteria included thalamic hyperdensities on CT scan/T1W images of MRI of the brain. Biochemical criteria included deficiency of hexosaminidase A (less than 2% of total hexosaminidase activity for infantile patients. Total leukocyte hexosaminidase activity was assayed by 4-methylumbelliferyl-N-acetyl-β-D-glucosamine lysis and hexosaminidase A activity was assayed by heat inactivation method and 4-methylumbelliferyl-N-acetyl-β-D-glucosamine-6-sulphate lysis method. The exons and exon-intron boundaries of the HEXA gene were bidirectionally sequenced using an automated sequencer. Mutations were confirmed in parents and looked up in public databases. In silico analysis for mutations was carried out using SIFT, Polyphen2, MutationT@ster and Accelrys Discovery Studio softwares. Fifteen families were included in the study. We identified six novel missense mutations, c.340 G>A (p.E114K, c.964 G>A (p.D322N, c.964 G>T (p.D322Y, c.1178C>G (p.R393P and c.1385A>T (p.E462V, c.1432 G>A (p.G478R and two previously reported mutations. c.1277_1278insTATC and c.508C>T (p.R170W. The mutation p.E462V was found in six unrelated families from Gujarat indicating a founder effect. A previously known splice site mutation c.805+1 G>C and another intronic mutation c.672+30 T>G of unknown significance were also identified. Mutations could not be identified in one family. We conclude that TSD patients from Gujarat should be screened for the common mutation p.E462V.

  12. Identification of novel mutations in HEXA gene in children affected with Tay Sachs disease from India.

    Science.gov (United States)

    Mistri, Mehul; Tamhankar, Parag M; Sheth, Frenny; Sanghavi, Daksha; Kondurkar, Pratima; Patil, Swapnil; Idicula-Thomas, Susan; Gupta, Sarita; Sheth, Jayesh

    2012-01-01

    Tay Sachs disease (TSD) is a neurodegenerative disorder due to β-hexosaminidase A deficiency caused by mutations in the HEXA gene. The mutations leading to Tay Sachs disease in India are yet unknown. We aimed to determine mutations leading to TSD in India by complete sequencing of the HEXA gene. The clinical inclusion criteria included neuroregression, seizures, exaggerated startle reflex, macrocephaly, cherry red spot on fundus examination and spasticity. Neuroimaging criteria included thalamic hyperdensities on CT scan/T1W images of MRI of the brain. Biochemical criteria included deficiency of hexosaminidase A (less than 2% of total hexosaminidase activity for infantile patients). Total leukocyte hexosaminidase activity was assayed by 4-methylumbelliferyl-N-acetyl-β-D-glucosamine lysis and hexosaminidase A activity was assayed by heat inactivation method and 4-methylumbelliferyl-N-acetyl-β-D-glucosamine-6-sulphate lysis method. The exons and exon-intron boundaries of the HEXA gene were bidirectionally sequenced using an automated sequencer. Mutations were confirmed in parents and looked up in public databases. In silico analysis for mutations was carried out using SIFT, Polyphen2, MutationT@ster and Accelrys Discovery Studio softwares. Fifteen families were included in the study. We identified six novel missense mutations, c.340 G>A (p.E114K), c.964 G>A (p.D322N), c.964 G>T (p.D322Y), c.1178C>G (p.R393P) and c.1385A>T (p.E462V), c.1432 G>A (p.G478R) and two previously reported mutations. c.1277_1278insTATC and c.508C>T (p.R170W). The mutation p.E462V was found in six unrelated families from Gujarat indicating a founder effect. A previously known splice site mutation c.805+1 G>C and another intronic mutation c.672+30 T>G of unknown significance were also identified. Mutations could not be identified in one family. We conclude that TSD patients from Gujarat should be screened for the common mutation p.E462V.

  13. Screening for BRCA1 and BRCA2 mutations in breast cancer patients from mexico: the public health perspective Tamizaje de BRCA1 y BRCA2 en pacientes con cáncerde mama en méxico: perspectiva de la salud pública

    Directory of Open Access Journals (Sweden)

    Steven A Narod

    2009-01-01

    Full Text Available Genetic testing for mutations in BRCA1 and BRCA2 has potentially important public health implications. Through judicious testing of women believed to be at high risk for early-onset breast cancer and for ovarian cancer, it is possible to identify highly-predisposed women prior to the development of cancer. Current preventive options include preventive mastectomy, preventive oophorectomy, tamoxifen and oral contraceptives. The ability to offer genetic testing in Mexico on a widespread level is enhanced if the common founder mutations in the two genes can be discovered or if the cost of genetic sequencing is reduced. It is important that a genetic testing service be a multi-disciplinary effort with co-ordinated follow-up.Los exámenes genéticos para las mutaciones en el BRCA 1 y el BRCA 2 tienen potencialmente una importante implicación en materia de salud pública. A través de exámenes juiciosos en mujeres en las que se cree que tienen un riesgo alto de padecer cáncer de mama y de ovario de inicio temprano, es posible identificar mujeres con una alta predisposición antes de que éstas desarrollen el cáncer de mama. Dentro de las medidas preventivas actuales se incluyen la mastectomía, la ooforectomía, el tamoxifen y los anticonceptivos orales. En México, la habilidad para ofrecer exámenes genéticos a nivel poblacional se vería favorecida si se pudiesen descubrir las mutaciones fundadoras en los dos genes o si el costo del secuenciamiento genético fuese reducido. Es muy importante que el servicio de los exámenes genéticos sea el resultado de un esfuerzo multidisciplinario con seguimiento coordinado de los pacientes.

  14. Empirical evaluation of cell critical volume dose vs. cell response function for pink mutations in tradescantia

    International Nuclear Information System (INIS)

    Varma, M.N.; Bond, V.P.

    1982-01-01

    Microdosimetric spectra for 0.43, 1.8, and 14.7 MeV neutrons, and for 215 kVp x rays and 1250 keV gammas were used in conjunction with relative biological effectiveness (RBE) values for pink mutations in Tradescantia to obtain an effectiveness function (i.e., a cell critical volume dose vs. cell response function). This effectiveness function (or hit size weighting function) provides the probability of inducing a biological effect of interest (in the present study, pink mutations in Tradescantia) as a function of lineal energy density y. In a preliminary analysis the critical value of y above which pink mutations are seen was 4.5 keV/μm, and the value of y at which the probability reaches unity was 115 keV/μm. Idealized but approximate event size distributions for mono-LET particles ranging from 10 to 5000 keV/μm were generated, and these distributions were weighted by the effectiveness function to determine the pink mutation frequencies. Results are compared with measured pink mutation frequencies for 11 keV/μm ( 12 C) and 31 keV/μm ( 20 Ne) ions

  15. Deep sequencing of uveal melanoma identifies a recurrent mutation in PLCB4

    DEFF Research Database (Denmark)

    Johansson, Peter; Aoude, Lauren G; Wadt, Karin

    2016-01-01

    Next generation sequencing of uveal melanoma (UM) samples has identified a number of recurrent oncogenic or loss-of-function mutations in key driver genes including: GNAQ, GNA11, EIF1AX, SF3B1 and BAP1. To search for additional driver mutations in this tumor type we carried out whole......, instead, a BRCA mutation signature predominated. In addition to mutations in the known UM driver genes, we found a recurrent mutation in PLCB4 (c.G1888T, p.D630Y, NM_000933), which was validated using Sanger sequencing. The identical mutation was also found in published UM sequence data (1 of 56 tumors......-genome or whole-exome sequencing of 28 tumors or primary cell lines. These samples have a low mutation burden, with a mean of 10.6 protein changing mutations per sample (range 0 to 53). As expected for these sun-shielded melanomas the mutation spectrum was not consistent with an ultraviolet radiation signature...

  16. Exploring the relationship between maternal iron status and offspring’s blood pressure and adiposity: a Mendelian randomization study

    Directory of Open Access Journals (Sweden)

    Alwan NA

    2012-08-01

    Full Text Available Nisreen A Alwan,1 Debbie A Lawlor,2 Harry J McArdle,3 Darren C Greenwood,4 Janet E Cade11Nutritional Epidemiology Group, School of Food Science and Nutrition, University of Leeds, Leeds, UK; 2MRC Centre for Causal Analyses in Translational Research, University of Bristol, Bristol; 3Rowett Institute of Nutrition and Health, University of Aberdeen, Aberdeen; 4Biostatistics Unit, Leeds Institute for Health, Genetics and Therapeutics, University of Leeds, Leeds, UKBackground: Iron deficiency is the most common micronutrient deficiency worldwide. Experimental animal studies suggest that mothers deficient in iron during pregnancy are more likely to have offspring who become obese with high blood pressure. C282Y mutation carriers are more likely to have higher iron stores.Methods: We undertook an instrumental variable (IV analysis, using maternal C282Y as an indicator for the mother’s iron status, to examine its association with offspring blood pressure (BP, waist circumference (WC, and body mass index (BMI, and compared the results to that of ordinary least squares (OLS regression. Offspring of a sub-cohort of mothers from the UK Women’s Cohort Study (UKWCS were recruited in 2009–2010 (n = 348, mean age = 41 years. Their blood pressure, height, and weight were measured at their local general medical practice, and they were asked to self-measure their waist circumference. About half were offspring of C282Y carriers. Maternal ferritin was used as a biomarker of maternal iron status.Results: Maternal C282Y was strongly associated with maternal ferritin (mean difference per allele = 84 g/L, 95% confidence interval: 31–137, P = 0.002. Using IV analyses, maternal ferritin was not linked to offspring’s BP, BMI, or WC. The first stage F-statistic for the strength of the instrument was 10 (Kleibergen–Paap rk LM P = 0.009. Maternal ferritin was linked to offspring diastolic BP, WC, and BMI in univariable, but not in multivariable OLS analysis. There

  17. Severe Clinical Course in a Patient with Congenital Amegakaryocytic Thrombocytopenia Due to a Missense Mutation of the c-MPL Gene.

    Science.gov (United States)

    Ok Bozkaya, İkbal; Yaralı, Neşe; Işık, Pamir; Ünsal Saç, Rukiye; Tavil, Betül; Tunç, Bahattin

    2015-06-01

    Congenital amegakaryocytic thrombocytopenia (CAMT) generally begins at birth with severe thrombocytopenia and progresses to pancytopenia. It is caused by mutations in the thrombopoietin receptor gene, the myeloproliferative leukemia virus oncogene (c-MPL). The association between CAMT and c-MPL mutation type has been reported in the literature. Patients with CAMT have been categorized according to their clinical symptoms caused by different mutations. Missense mutations of c-MPL have been classified as type II and these patients have delayed onset of bone marrow failure compared to type I patients. Here we present a girl with severe clinical course of CAMT II having a missense mutation in exon 4 of the c-MPL gene who was admitted to our hospital with intracranial hemorrhage during the newborn period.

  18. Mechanistic study on the nuclear modifier gene MSS1 mutation suppressing neomycin sensitivity of the mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

    Science.gov (United States)

    Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

    2014-01-01

    The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations.

  19. 30 CFR 282.10 - Jurisdiction and responsibilities of Director.

    Science.gov (United States)

    2010-07-01

    ... part and are under the jurisdiction of the Director: Exploration, testing, and mining operations... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Jurisdiction and responsibilities of Director... Jurisdiction and Responsibilities of Director § 282.10 Jurisdiction and responsibilities of Director. Subject...

  20. Lymphocyte gene expression signatures from patients and mouse models of hereditary hemochromatosis reveal a function of HFE as a negative regulator of CD8+ T-lymphocyte activation and differentiation in vivo.

    Science.gov (United States)

    Costa, Mónica; Cruz, Eugénia; Oliveira, Susana; Benes, Vladimir; Ivacevic, Tomi; Silva, Maria João; Vieira, Inês; Dias, Francisco; Fonseca, Sónia; Gonçalves, Marta; Lima, Margarida; Leitão, Catarina; Muckenthaler, Martina U; Pinto, Jorge; Porto, Graça

    2015-01-01

    Abnormally low CD8+ T-lymphocyte numbers is characteristic of some patients with hereditary hemochromatosis (HH), a MHC-linked disorder of iron overload. Both environmental and genetic components are known to influence CD8+ T-lymphocyte homeostasis but the role of the HH associated protein HFE is still insufficiently understood. Genome-wide expression profiling was performed in peripheral blood CD8+ T lymphocytes from HH patients selected according to CD8+ T-lymphocyte numbers and from Hfe-/- mice maintained either under normal or high iron diet conditions. In addition, T-lymphocyte apoptosis and cell cycle progression were analyzed by flow cytometry in HH patients. HH patients with low CD8+ T-lymphocyte numbers show a differential expression of genes related to lymphocyte differentiation and maturation namely CCR7, LEF1, ACTN1, NAA50, P2RY8 and FOSL2, whose expression correlates with the relative proportions of naïve, central and effector memory subsets. In addition, expression levels of LEF1 and P2RY8 in memory cells as well as the proportions of CD8+ T cells in G2/M cell cycle phase are significantly different in HH patients compared to controls. Hfe-/- mice do not show alterations in CD8+ T-lymphocyte numbers but differential gene response patterns. We found an increased expression of S100a8 and S100a9 that is most pronounced in high iron diet conditions. Similarly, CD8+ T lymphocytes from HH patients display higher S100a9 expression both at the mRNA and protein level. Altogether, our results support a role for HFE as a negative regulator of CD8+ T-lymphocyte activation. While the activation markers S100a8 and S100a9 are strongly increased in CD8+ T cells from both, Hfe-/- mice and HH patients, a differential profile of genes related to differentiation/maturation of CD8+ T memory cells is evident in HH patients only. This supports the notion that HFE contributes, at least in part, to the generation of low peripheral blood CD8+ T lymphocytes in HH.

  1. β-Thalassemia mutations in Western India: outcome of prenatal diagnosis in a hemoglobinopathies project.

    Science.gov (United States)

    Patel, Ashwin P; Patel, Rupesh B; Patel, Saumyaa A; Vaniawala, Salil N; Patel, Dipika S; Shrivastava, Naina S; Sharma, Narmadeshwar P; Zala, Jayendrasinh V; Parmar, Prakash H; Naik, Madhuben R

    2014-01-01

    Prenatal diagnosis (PND) is one of the most cost effective preventive methods, but it is available only in the large cities of India. Therefore, we initiated a program that offers PND and allows us to determine the prevalence of various mutations. Pregnant females (n = 111,426) were screened for hemoglobinopathies using complete blood count (CBC) and high performance liquid chromatography (HPLC). If the female had a hemoglobinopathy, her husband was then tested. If hemoglobinopathies were seen in both partners, a genetic mutation study was performed on the couple. Fetal samples were obtained by either chorionic villus sampling (CVS) in 70.6% or amniocentesis in 29.4%. The study included 282 couples. IVS-I-5 (G > C) was the most common mutation in all castes except in the Sindhis and Lohanas, where the 619 bp deletion was the most common. Prenatal testing was informative in 97.9% of the couples. A significant number of couples (41.0%) underwent PND during their first pregnancy. Seven patients with β-thalassemia (β-thal) trait had normal Hb A2 levels. The Hb A2 and Hb F values varied significantly (p  T or G > A), were present in 81.0% of the couples tested. β-Thalassemia mutation frequency varied among the different castes, underlining the need for evolving a testing strategy that considers the caste system. Targeting antenatal clinics could also prove to be a most cost effective way of preventing hemoglobinopathies.

  2. Reduction in hepatic drug metabolizing CYP3A4 activities caused by P450 oxidoreductase mutations identified in patients with disordered steroid metabolism

    International Nuclear Information System (INIS)

    Flueck, Christa E.; Mullis, Primus E.; Pandey, Amit V.

    2010-01-01

    Research highlights: → Cytochrome P450 3A4 (CYP3A4), metabolizes 50% of drugs in clinical use and requires NADPH-P450 reductase (POR). → Mutations in human POR cause congenital adrenal hyperplasia from diminished activities of steroid metabolizing P450s. → We are reporting that mutations in POR may reduce CYP3A4 activity. → POR mutants Y181D, A457H, Y459H, V492E and R616X lost 99%, while A287P, C569Y and V608F lost 60-85% CYP3A4 activity. → Reduction of CYP3A4 activity may cause increased risk of drug toxicities/adverse drug reactions in patients with POR mutations. -- Abstract: Cytochrome P450 3A4 (CYP3A4), the major P450 present in human liver metabolizes approximately half the drugs in clinical use and requires electrons supplied from NADPH through NADPH-P450 reductase (POR, CPR). Mutations in human POR cause a rare form of congenital adrenal hyperplasia from diminished activities of steroid metabolizing P450s. In this study we examined the effect of mutations in POR on CYP3A4 activity. We used purified preparations of wild type and mutant human POR and in vitro reconstitution with purified CYP3A4 to perform kinetic studies. We are reporting that mutations in POR identified in patients with disordered steroidogenesis/Antley-Bixler syndrome (ABS) may reduce CYP3A4 activity, potentially affecting drug metabolism in individuals carrying mutant POR alleles. POR mutants Y181D, A457H, Y459H, V492E and R616X had more than 99% loss of CYP3A4 activity, while POR mutations A287P, C569Y and V608F lost 60-85% activity. Loss of CYP3A4 activity may result in increased risk of drug toxicities and adverse drug reactions in patients with POR mutations.

  3. Infantile Alexander Disease: Spectrum of GFAP Mutations and Genotype-Phenotype Correlation

    Science.gov (United States)

    Rodriguez, Diana; Gauthier, Fernande; Bertini, Enrico; Bugiani, Marianna; Brenner, Michael; N'guyen, Sylvie; Goizet, Cyril; Gelot, Antoinette; Surtees, Robert; Pedespan, Jean-Michel; Hernandorena, Xavier; Troncoso, Monica; Uziel, Graziela; Messing, Albee; Ponsot, Gérard; Pham-Dinh, Danielle; Dautigny, André; Boespflug-Tanguy, Odile

    2001-01-01

    Heterozygous, de novo mutations in the glial fibrillary acidic protein (GFAP) gene have recently been reported in 12 patients affected by neuropathologically proved Alexander disease. We searched for GFAP mutations in a series of patients who had heterogeneous clinical symptoms but were candidates for Alexander disease on the basis of suggestive neuroimaging abnormalities. Missense, heterozygous, de novo GFAP mutations were found in exons 1 or 4 for 14 of the 15 patients analyzed, including patients without macrocephaly. Nine patients carried arginine mutations (four had R79H; four had R239C; and one had R239H) that have been described elsewhere, whereas the other five had one of four novel mutations, of which two affect arginine (2R88C and 1R88S) and two affect nonarginine residues (1L76F and 1N77Y). All mutations were located in the rod domain of GFAP, and there is a correlation between clinical severity and the affected amino acid. These results confirm that GFAP mutations are a reliable molecular marker for the diagnosis of infantile Alexander disease, and they also form a basis for the recommendation of GFAP analysis for prenatal diagnosis to detect potential cases of germinal mosaicism. PMID:11567214

  4. A novel nonsense mutation in cathepsin C gene in an Egyptian ...

    African Journals Online (AJOL)

    Hala Soliman

    2015-04-22

    Apr 22, 2015 ... as defects of phagocytic function and deregulation of localized ... Aim: The aim of this study is to detect the mutation in CTSC gene expected to be the ..... [20] Toomes C, James J, Wood AJ, McCormick D, Lench N, Hewitt.

  5. A novel mitochondrial mutation m.8989G>C associated with neuropathy, ataxia, retinitis pigmentosa - the NARP syndrome

    DEFF Research Database (Denmark)

    Duno, Morten; Wibrand, Flemming; Baggesen, Kirsten

    2013-01-01

    mitochondrial point mutation, m.8989G>C, in a patient presenting with neuropathy, ataxia and retinitis pigmentosa constituting the classical NARP phenotype. This mutation alters the amino acid right next to canonical NARP mutation. We suggest that classic NARP syndrome relates to a defined dysfunction of p...

  6. Identification of novel mutations in the α-galactosidase A gene in patients with Fabry disease: pitfalls of mutation analyses in patients with low α-galactosidase A activity.

    Science.gov (United States)

    Yoshimitsu, Makoto; Higuchi, Koji; Miyata, Masaaki; Devine, Sean; Mattman, Andre; Sirrs, Sandra; Medin, Jeffrey A; Tei, Chuwa; Takenaka, Toshihiro

    2011-05-01

    Fabry disease is an X-linked lysosomal storage disorder caused by mutations of the α-galactosidase A (GLA) gene, and the disease is a relatively prevalent cause of left ventricular hypertrophy followed by conduction abnormalities and arrhythmias. Mutation analysis of the GLA gene is a valuable tool for accurate diagnosis of affected families. In this study, we carried out molecular studies of 10 unrelated families diagnosed with Fabry disease. Genetic analysis of the GLA gene using conventional genomic sequencing was performed in 9 hemizygous males and 6 heterozygous females. In patients with no mutations in coding DNA sequence, multiplex ligation-dependent probe amplification (MLPA) and/or cDNA sequencing were performed. We identified a novel exon 2 deletion (IVS1_IVS2) in a heterozygous female by MLPA, which was undetectable by conventional sequencing methods. In addition, the g.9331G>A mutation that has previously been found only in patients with cardiac Fabry disease was found in 3 unrelated, newly-diagnosed, cardiac Fabry patients by sequencing GLA genomic DNA and cDNA. Two other novel mutations, g.8319A>G and 832delA were also found in addition to 4 previously reported mutations (R112C, C142Y, M296I, and G373D) in 6 other families. We could identify GLA gene mutations in all hemizygotes and heterozygotes from 10 families with Fabry disease. Mutations in 4 out of 10 families could not be identified by classical genomic analysis, which focuses on exons and the flanking region. Instead, these data suggest that MLPA analysis and cDNA sequence should be considered in genetic testing surveys of patients with Fabry disease. Copyright © 2011 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.

  7. Apoptotic Activity of MeCP2 Is Enhanced by C-Terminal Truncating Mutations.

    Directory of Open Access Journals (Sweden)

    Alison A Williams

    Full Text Available Methyl-CpG binding protein 2 (MeCP2 is a widely abundant, multifunctional protein most highly expressed in post-mitotic neurons. Mutations causing Rett syndrome and related neurodevelopmental disorders have been identified along the entire MECP2 locus, but symptoms vary depending on mutation type and location. C-terminal mutations are prevalent, but little is known about the function of the MeCP2 C-terminus. We employ the genetic efficiency of Drosophila to provide evidence that expression of p.Arg294* (more commonly identified as R294X, a human MECP2 E2 mutant allele causing truncation of the C-terminal domains, promotes apoptosis of identified neurons in vivo. We confirm this novel finding in HEK293T cells and then use Drosophila to map the region critical for neuronal apoptosis to a small sequence at the end of the C-terminal domain. In vitro studies in mammalian systems previously indicated a role of the MeCP2 E2 isoform in apoptosis, which is facilitated by phosphorylation at serine 80 (S80 and decreased by interactions with the forkhead protein FoxG1. We confirm the roles of S80 phosphorylation and forkhead domain transcription factors in affecting MeCP2-induced apoptosis in Drosophila in vivo, thus indicating mechanistic conservation between flies and mammalian cells. Our findings are consistent with a model in which C- and N-terminal interactions are required for healthy function of MeCP2.

  8. Prion protein with Y145STOP mutation induces mitochondria-mediated apoptosis and PrP-containing deposits in vitro

    International Nuclear Information System (INIS)

    Hachiya, Naomi S.; Watanabe, Kota; Kawabata, Makiko Y.; Jozuka, Akiko; Kozuka, Yoshimichi; Sakasegawa, Yuji; Kaneko, Kiyotoshi

    2005-01-01

    A pathogenic truncation of an amber mutation at codon 145 (Y145STOP) in Gerstmann-Straussler-Scheinker disease (GSS) was investigated through the real-time imaging in living cells, by utilizing GFP-PrP constructs. GFP-PrP(1-144) exhibited an aberrant localization to mitochondria in mouse neuroblastoma neuro2a (N2a) and HpL3-4 cells, a hippocampal cell line established from prnp gene-ablated mice, whereas full-length GFP-PrP did not. The aberrant mitochondrial localization was also confirmed by Western blot analysis. Since GFP-PrP(1-121), as previously reported, and full-length GFP-PrP do not exhibit such mitochondrial localization, the mitochondrial localization of GFP-PrP(1-144) requires not only PrP residues 121-144 (in human sequence) but also COOH-terminal truncation in the current experimental condition. Subsequently, the GFP-PrP(1-144) induced a change in the mitochondrial innermembrane potential (ΔΨ m ), release of cytochrome c from the intermembrane space into the cytosol, and DNA fragmentation in these cells. Non-fluorescent PrP(1-144) also induced the DNA fragmentation in N2a and HpL3-4 cells after the proteasomal inhibition. These data may provide clues as to the molecular mechanism of the neurotoxic property of Y145STOP mutation. Furthermore, immunoelectron microscopy revealed numerous electron-dense deposits in mitochondria clusters of GFP-PrP(1-144)-transfected N2a cells, whereas no deposit was detected in the cells transfected with full-length GFP-PrP. Co-localization of GFP/PrP-immunogold particles with porin-immunogold particles as a mitochondrial marker was observed in such electron-dense vesicular foci, resembling those found in autophagic vacuoles forming secondary lysosomes. Whether such electron-dense deposits may serve as a seed for the growth of amyloid plaques, a characteristic feature of GSS with Y145STOP, awaits further investigations

  9. Effect of the G375C and G346E achondroplasia mutations on FGFR3 activation.

    Directory of Open Access Journals (Sweden)

    Lijuan He

    Full Text Available Two mutations in FGFR3, G380R and G375C are known to cause achondroplasia, the most common form of human dwarfism. The G380R mutation accounts for 98% of the achondroplasia cases, and thus has been studied extensively. Here we study the effect of the G375C mutation on the phosphorylation and the cross-linking propensity of full-length FGFR3 in HEK 293 cells, and we compare the results to previously published results for the G380R mutant. We observe identical behavior of the two achondroplasia mutants in these experiments, a finding which supports a direct link between the severity of dwarfism phenotypes and the level and mechanism of FGFR3 over-activation. The mutations do not increase the cross-linking propensity of FGFR3, contrary to previous expectations that the achondroplasia mutations stabilize the FGFR3 dimers. Instead, the phosphorylation efficiency within un-liganded FGFR3 dimers is increased, and this increase is likely the underlying cause for pathogenesis in achondroplasia. We further investigate the G346E mutation, which has been reported to cause achondroplasia in one case. We find that this mutation does not increase FGFR3 phosphorylation and decreases FGFR3 cross-linking propensity, a finding which raises questions whether this mutation is indeed a genetic cause for human dwarfism.

  10. Effect of the G375C and G346E achondroplasia mutations on FGFR3 activation.

    Science.gov (United States)

    He, Lijuan; Serrano, Christopher; Niphadkar, Nitish; Shobnam, Nadia; Hristova, Kalina

    2012-01-01

    Two mutations in FGFR3, G380R and G375C are known to cause achondroplasia, the most common form of human dwarfism. The G380R mutation accounts for 98% of the achondroplasia cases, and thus has been studied extensively. Here we study the effect of the G375C mutation on the phosphorylation and the cross-linking propensity of full-length FGFR3 in HEK 293 cells, and we compare the results to previously published results for the G380R mutant. We observe identical behavior of the two achondroplasia mutants in these experiments, a finding which supports a direct link between the severity of dwarfism phenotypes and the level and mechanism of FGFR3 over-activation. The mutations do not increase the cross-linking propensity of FGFR3, contrary to previous expectations that the achondroplasia mutations stabilize the FGFR3 dimers. Instead, the phosphorylation efficiency within un-liganded FGFR3 dimers is increased, and this increase is likely the underlying cause for pathogenesis in achondroplasia. We further investigate the G346E mutation, which has been reported to cause achondroplasia in one case. We find that this mutation does not increase FGFR3 phosphorylation and decreases FGFR3 cross-linking propensity, a finding which raises questions whether this mutation is indeed a genetic cause for human dwarfism.

  11. Stepwise Exposure of Staphylococcus aureus to Pleuromutilins Is Associated with Stepwise Acquisition of Mutations in rplC and Minimally Affects Susceptibility to Retapamulin▿

    Science.gov (United States)

    Gentry, Daniel R.; Rittenhouse, Stephen F.; McCloskey, Lynn; Holmes, David J.

    2007-01-01

    To assess their effects on susceptibility to retapamulin in Staphylococcus aureus, first-, second-, and third-step mutants with elevated MICs to tiamulin and other investigational pleuromutilin compounds were isolated and characterized through exposure to high drug concentrations. All first- and second-step mutations were in rplC, encoding ribosomal protein L3. Most third-step mutants acquired a third mutation in rplC. While first- and second-step mutations did cause an elevation in tiamulin and retapamulin MICs, a significant decrease in activity was not seen until a third mutation was acquired. All third-step mutants exhibited severe growth defects, and faster-growing variants arose at a high frequency from most isolates. These faster-growing variants were found to be more susceptible to pleuromutilins. In the case of a mutant with three alterations in rplC, the fast-growing variants acquired an additional mutation in rplC. In the case of fast-growing variants of isolates with two mutations in rplC and at least one mutation at an unmapped locus, one of the two rplC mutations reverted to wild type. These data indicate that mutations in rplC that lead to pleuromutilin resistance have a direct, negative effect on fitness. While reduction in activity of retapamulin against S. aureus can be seen through mutations in rplC, it is likely that target-specific resistance to retapamulin will be slow to emerge due to the need for three mutations for a significant effect on activity and the fitness cost of each mutational step. PMID:17404009

  12. Kinetics of gene and chromosome mutations induced by UV-C in yeast Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Koltovaya, N.; Kokoreva, A.; Senchenko, D.; Shvaneva, N.; Zhuchkina, N.

    2017-01-01

    The systematic study of the kinetics of UV-induced gene and structural mutations in eukaryotic cells was carried out on the basis of model yeast S. cerevisiae. A variety of genetic assays (all types of base pair substitutions, frameshifts, forward mutations canl, chromosomal and plasmid rearrangements) in haploid strains were used. Yeast cells were treated by UV-C light of fluence of energy up to 200 J/m"2. The kinetics of the induced gene and structural mutations is represented by a linear-quadratic and exponential functions. The slope of curves in log-log plots was not constant, had the value 2-4 and depended on the interval of doses. It was suggested that it is the superposition and dynamics of different pathways form the mutagenic responses of eukaryotic cells to UV-C light that cause the high-order curves. [ru

  13. Sudden Sensorineural Hearing Loss and Polymorphisms in Iron Homeostasis Genes: New Insights from a Case-Control Study

    Directory of Open Access Journals (Sweden)

    Alessandro Castiglione

    2015-01-01

    Full Text Available Background. Even if various pathophysiological events have been proposed as explanations, the putative cause of sudden hearing loss remains unclear. Objectives. To investigate and to reveal associations (if any between the main iron-related gene variants and idiopathic sudden sensorineural hearing loss. Study Design. Case-control study. Materials and Methods. A total of 200 sudden sensorineural hearing loss patients (median age 63.65 years; range 10–92 were compared with 400 healthy control subjects. The following genetic variants were investigated: the polymorphism c.−8CG in the promoter of the ferroportin gene (FPN1; SLC40A1, the two isoforms C1 and C2 (p.P570S of the transferrin protein (TF, the amino acidic substitutions p.H63D and p.C282Y in the hereditary hemochromatosis protein (HFE, and the polymorphism c.–582AG in the promoter of the HEPC gene, which encodes the protein hepcidin (HAMP. Results. The homozygous genotype c.−8GG of the SLC40A1 gene revealed an OR for ISSNHL risk of 4.27 (CI 95%, 2.65–6.89; P=0.001, being overrepresented among cases. Conclusions. Our study indicates that the homozygous genotype FPN1 −8GG was significantly associated with increased risk of developing sudden hearing loss. These findings suggest new research should be conducted in the field of iron homeostasis in the inner ear.

  14. Mutations in the C-terminus of CDKL5: proceed with caution.

    Science.gov (United States)

    Diebold, Bertrand; Delépine, Chloé; Gataullina, Svetlana; Delahaye, Andrée; Nectoux, Juliette; Bienvenu, Thierry

    2014-02-01

    Mutations in the cyclin-dependent kinase-like 5 (CDKL5) gene have been described in girls with Rett-like features and early-onset epileptic encephalopathy including infantile spasms. Milder phenotypes have been associated with sequence variations in the 3'-end of the CDKL5 gene. Identification of novel CDKL5 transcripts coding isoforms characterized by an altered C-terminal region strongly questions the eventual pathogenicity of sequence variations located in the 3'-end of the gene. We investigated a group of 30 female patients with a clinically heterogeneous phenotype ranging from nonspecific intellectual disability to a severe neonatal encephalopathy and identified two heterozygous CDKL5 missense mutations, the previously reported p.Val999Met and the novel mutation p.Pro944Thr. However, these mutations have also been detected in their healthy father. Considering our results and all data from the literature, we suggest that genetic variations beyond the codon 938 in human CDKL5115 protein may have minor or no significance. It is probable that screening of exons 19-21 of the CDKL5 gene is not useful in practical molecular diagnosis of atypical Rett syndrome.

  15. Germline TP53 mutations and single nucleotide polymorphisms in children Mutaciones y polimorfismos de un único nucleótido del gen TP53 en línea germinal en niños

    Directory of Open Access Journals (Sweden)

    Pamela Valva

    2009-02-01

    Full Text Available Mutations in the gene TP53, which codifies the tumor suppressor protein p53, are found in about 50% of tumors. These mutations can occur not only at somatic level, but also in germline. Pediatric cancer patients, mostly with additional family history of malignancy, should be considered as potential TP53 germline mutation carriers. Germline TP53 mutations and polymorphisms have been widely studied to determine their relation with different tumors' pathogenesis. Our aim was to analyze the occurrence frequency of germline TP53 mutations and polymorphisms and to relate these to tumor development in a pediatric series. Peripheral blood mononuclear cell samples from 26 children with solid tumors [PST] and 21 pediatric healthy donors [HD] were analyzed for germline mutations and polymorphisms in TP53 gene spanning from exon 5 to 8 including introns 5 and 7. These PCR amplified fragments were sequenced to determine variations. A heterozygous mutation at codon 245 was found in 1/26 PST and 0/21 HD. Comparative polymorphisms distribution, at position 14181 and 14201(intron 7, between HD and PST revealed a trend of association (p= 0.07 with cancer risk. HD group disclosed a similar polymorphism distribution as published data for Caucasian and Central/South American populations. This is the first study about TP53 variant frequency and distribution in healthy individuals and cancer patients in Argentina.El gen que codifica para la proteína supresora de tumor p53 (TP53 se encuentra mutado en aproximadamente el 50% de los tumores. Estas mutaciones pueden presentarse como somáticas o en línea germinal. Los niños con tumores, sobre todo aquellos con historia familiar de enfermedad oncológica, deben considerarse potenciales portadores de mutaciones en línea germinal. Las mutaciones de TP53 y los polimorfismos son estudiados para determinar su relación con la patogénesis de diferentes tumores. El objetivo del trabajo fue analizar la frecuencia de

  16. Microstructural analysis of laser weld fusion zone in Haynes 282 superalloy

    Energy Technology Data Exchange (ETDEWEB)

    Osoba, L.O. [Department of Mechanical and Manufacturing Engineering, University of Manitoba, Winnipeg, Manitoba, R3T 5V6 (Canada); Ding, R.G. [Department of Metallurgy and Materials Engineering, University of Birmingham, Birmingham B15 2TT (United Kingdom); Ojo, O.A., E-mail: ojo@cc.umanitoba.ca [Department of Mechanical and Manufacturing Engineering, University of Manitoba, Winnipeg, Manitoba, R3T 5V6 (Canada)

    2012-03-15

    Analytical electron microscopy and spectroscopy analyses of the fusion zone (FZ) microstructure in autogenous laser beam welded Haynes 282 (HY 282) superalloy were performed. The micro-segregation patterns observed in the FZ indicate that Co, Cr and Al exhibited a nearly uniform distribution between the dendrite core and interdendritic regions while Ti and Mo were rejected into the interdendritic liquid during the weld solidification. Transmission electron diffraction analysis and energy dispersive X-ray microanalysis revealed the second phase particles formed along the FZ interdendritic region to be Ti-Mo rich MC-type carbide particles. Weld FZ solidification cracking, which is sometimes associated with the formation of {gamma}-{gamma}' eutectic in {gamma}' precipitation strengthened nickel-base superalloys, was not observed in the HY 282 superalloy. Modified primary solidification path due to carbon addition in the newly developed superalloy is used to explain preclusion of weld FZ solidification cracking in the material. - Highlights: Black-Right-Pointing-Pointer A newly developed superalloy was welded by CO{sub 2} laser beam joining technique. Black-Right-Pointing-Pointer Electron microscopy characterization of the weld microstructure was performed. Black-Right-Pointing-Pointer Identified interdendritic microconstituents consist of MC-type carbides. Black-Right-Pointing-Pointer Modification of primary solidification path is used to explain cracking resistance.

  17. Microstructural analysis of laser weld fusion zone in Haynes 282 superalloy

    International Nuclear Information System (INIS)

    Osoba, L.O.; Ding, R.G.; Ojo, O.A.

    2012-01-01

    Analytical electron microscopy and spectroscopy analyses of the fusion zone (FZ) microstructure in autogenous laser beam welded Haynes 282 (HY 282) superalloy were performed. The micro-segregation patterns observed in the FZ indicate that Co, Cr and Al exhibited a nearly uniform distribution between the dendrite core and interdendritic regions while Ti and Mo were rejected into the interdendritic liquid during the weld solidification. Transmission electron diffraction analysis and energy dispersive X-ray microanalysis revealed the second phase particles formed along the FZ interdendritic region to be Ti–Mo rich MC-type carbide particles. Weld FZ solidification cracking, which is sometimes associated with the formation of γ–γ' eutectic in γ' precipitation strengthened nickel-base superalloys, was not observed in the HY 282 superalloy. Modified primary solidification path due to carbon addition in the newly developed superalloy is used to explain preclusion of weld FZ solidification cracking in the material. - Highlights: ► A newly developed superalloy was welded by CO 2 laser beam joining technique. ► Electron microscopy characterization of the weld microstructure was performed. ► Identified interdendritic microconstituents consist of MC-type carbides. ► Modification of primary solidification path is used to explain cracking resistance.

  18. High prevalence of exon 8 G533C mutation in apparently sporadic medullary thyroid carcinoma in Greece.

    Science.gov (United States)

    Sarika, H L; Papathoma, A; Garofalaki, M; Vasileiou, V; Vlassopoulou, B; Anastasiou, E; Alevizaki, M

    2012-12-01

    Genetic screening for ret mutation has become routine practice in the evaluation of medullary thyroid carcinoma (MTC). Approximately 25% of these tumours are familial, and they occur as components of the multiple endocrine neoplasia type 2 syndromes (MEN 2A and 2B) or familial MTC. In familial cases, the majority of mutations are found in exons 10, 11, 13, 14 or 15 of the ret gene. A rare mutation involving exon 8 (G533C) has recently been reported in familial cases of MTC in Brazil and Greece; some of these cases were originally thought to be sporadic. The aim of this study was to re-evaluate a series of sporadic cases of MTC, with negative family history, and screen them for germline mutations in exon 8. Genomic DNA was extracted from peripheral lymphocytes in 129 unrelated individuals who had previously been characterized as 'sporadic' based on the negative family history and negative screening for ret gene mutations. Samples were analysed in Applied Biosystems 7500 real-time PCR and confirmed by sequencing. The G533C exon 8 mutation was identified in 10 of 129 patients with sporadic MTC. Asymptomatic gene carriers were subsequently identified in other family members. In our study, we found that 7·75% patients with apparently sporadic MTC do carry G533C mutation involving exon 8 of ret. We feel that there is now a need to include exon 8 mutation screening in all patients diagnosed as sporadic MTC, in Greece. © 2012 Blackwell Publishing Ltd.

  19. Oncogenic exon 2 mutations in Mediator subunit MED12 disrupt allosteric activation of cyclin C-CDK8/19.

    Science.gov (United States)

    Park, Min Ju; Shen, Hailian; Spaeth, Jason M; Tolvanen, Jaana H; Failor, Courtney; Knudtson, Jennifer F; McLaughlin, Jessica; Halder, Sunil K; Yang, Qiwei; Bulun, Serdar E; Al-Hendy, Ayman; Schenken, Robert S; Aaltonen, Lauri A; Boyer, Thomas G

    2018-03-30

    Somatic mutations in exon 2 of the RNA polymerase II transcriptional Mediator subunit MED12 occur at high frequency in uterine fibroids (UFs) and breast fibroepithelial tumors as well as recurrently, albeit less frequently, in malignant uterine leimyosarcomas, chronic lymphocytic leukemias, and colorectal cancers. Previously, we reported that UF-linked mutations in MED12 disrupt its ability to activate cyclin C (CycC)-dependent kinase 8 (CDK8) in Mediator, implicating impaired Mediator-associated CDK8 activity in the molecular pathogenesis of these clinically significant lesions. Notably, the CDK8 paralog CDK19 is also expressed in myometrium, and both CDK8 and CDK19 assemble into Mediator in a mutually exclusive manner, suggesting that CDK19 activity may also be germane to the pathogenesis of MED12 mutation-induced UFs. However, whether and how UF-linked mutations in MED12 affect CDK19 activation is unknown. Herein, we show that MED12 allosterically activates CDK19 and that UF-linked exon 2 mutations in MED12 disrupt its CDK19 stimulatory activity. Furthermore, we find that within the Mediator kinase module, MED13 directly binds to the MED12 C terminus, thereby suppressing an apparent UF mutation-induced conformational change in MED12 that otherwise disrupts its association with CycC-CDK8/19. Thus, in the presence of MED13, mutant MED12 can bind, but cannot activate, CycC-CDK8/19. These findings indicate that MED12 binding is necessary but not sufficient for CycC-CDK8/19 activation and reveal an additional step in the MED12-dependent activation process, one critically dependent on MED12 residues altered by UF-linked exon 2 mutations. These findings confirm that UF-linked mutations in MED12 disrupt composite Mediator-associated kinase activity and identify CDK8/19 as prospective therapeutic targets in UFs. © 2018 Park et al.

  20. Renewable Formate from C-H Bond Formation with CO2: Using Iron Carbonyl Clusters as Electrocatalysts.

    Science.gov (United States)

    Loewen, Natalia D; Neelakantan, Taruna V; Berben, Louise A

    2017-09-19

    As a society, we are heavily dependent on nonrenewable petroleum-derived fuels and chemical feedstocks. Rapid depletion of these resources and the increasingly evident negative effects of excess atmospheric CO 2 drive our efforts to discover ways of converting excess CO 2 into energy dense chemical fuels through selective C-H bond formation and using renewable energy sources to supply electrons. In this way, a carbon-neutral fuel economy might be realized. To develop a molecular or heterogeneous catalyst for C-H bond formation with CO 2 requires a fundamental understanding of how to generate metal hydrides that selectively donate H - to CO 2 , rather than recombining with H + to liberate H 2 . Our work with a unique series of water-soluble and -stable, low-valent iron electrocatalysts offers mechanistic and thermochemical insights into formate production from CO 2 . Of particular interest are the nitride- and carbide-containing clusters: [Fe 4 N(CO) 12 ] - and its derivatives and [Fe 4 C(CO) 12 ] 2- . In both aqueous and mixed solvent conditions, [Fe 4 N(CO) 12 ] - forms a reduced hydride intermediate, [H-Fe 4 N(CO) 12 ] - , through stepwise electron and proton transfers. This hydride selectively reacts with CO 2 and generates formate with >95% efficiency. The mechanism for this transformation is supported by crystallographic, cyclic voltammetry, and spectroelectrochemical (SEC) evidence. Furthermore, installation of a proton shuttle onto [Fe 4 N(CO) 12 ] - facilitates proton transfer to the active site, successfully intercepting the hydride intermediate before it reacts with CO 2 ; only H 2 is observed in this case. In contrast, isoelectronic [Fe 4 C(CO) 12 ] 2- features a concerted proton-electron transfer mechanism to form [H-Fe 4 C(CO) 12 ] 2- , which is selective for H 2 production even in the presence of CO 2 , in both aqueous and mixed solvent systems. Higher nuclearity clusters were also studied, and all are proton reduction electrocatalysts, but none