Direct fragmentation of quarkonia including Fermi motion using light-cone wave function

Energy Technology Data Exchange (ETDEWEB)

Nobary, M.A. Gomshi [Razi University, Department of Physics, Faculty of Science, Kermanshah (Iran); A.E.O.I., Center for Theoretical Physics and Mathematics, Tehran (Iran); Javadi, B. [Razi University, Department of Physics, Faculty of Science, Kermanshah (Iran)

2005-07-01

We investigate the effect of Fermi motion on the direct fragmentation of the J/{psi} and {upsilon} states employing a light-cone wave function. Consistent with such a wave function we set up the kinematics of a heavy quark fragmenting into quarkonia such that the Fermi motion of the constituents splits into a longitudinal as well as a transverse direction and thus calculate the fragmentation functions for these states. In the framework of our investigation, we estimate that the fragmentation probabilities of J/{psi} and {upsilon} may increase at least up to 14 percent when including this degree of freedom. (orig.)

Plasminogen fragments K 1-3 and K 5 bind to different sites in fibrin fragment DD.

Science.gov (United States)

Grinenko, T V; Kapustianenko, L G; Yatsenko, T A; Yusova, O I; Rybachuk, V N

2016-01-01

Specific plasminogen-binding sites of fibrin molecule are located in Аα148-160 regions of C-terminal domains. Plasminogen interaction with these sites initiates the activation process of proenzyme and subsequent fibrin lysis. In this study we investigated the binding of plasminogen fragments K 1-3 and K 5 with fibrin fragment DD and their effect on Glu-plasminogen interaction with DD. It was shown that the level of Glu-plasminogen binding to fibrin fragment DD is decreased by 50-60% in the presence of K 1-3 and K 5. Fragments K 1-3 and K 5 have high affinity to fibrin fragment DD (Kd is 0.02 for K 1-3 and 0.054 μМ for K 5). K 5 interaction is independent and K 1-3 is partly dependent on C-terminal lysine residues. K 1-3 interacts with complex of fragment DD-immobilized K 5 as well as K 5 with complex of fragment DD-immobilized K 1-3. The plasminogen fragments do not displace each other from binding sites located in fibrin fragment DD, but can compete for the interaction. The results indicate that fibrin fragment DD contains different binding sites for plasminogen kringle fragments K 1-3 and K 5, which can be located close to each other. The role of amino acid residues of fibrin molecule Аα148-160 region in interaction with fragments K 1-3 and K 5 is discussed.

An investigation of fission models for high-energy radiation transport calculations

International Nuclear Information System (INIS)

Armstrong, T.W.; Cloth, P.; Filges, D.; Neef, R.D.

1983-07-01

An investigation of high-energy fission models for use in the HETC code has been made. The validation work has been directed checking the accuracy of the high-energy radiation transport computer code HETC to investigate the appropriate model for routine calculations, particularly for spallation neutron source applications. Model calculations are given in terms of neutron production, fission fragment energy release, and residual nuclei production for high-energy protons incident on thin uranium targets. The effect of the fission models on neutron production from thick uranium targets is also shown. (orig.)

Two-Step Mechanism of Membrane Disruption by Aβ through Membrane Fragmentation and Pore Formation

Science.gov (United States)

Sciacca, Michele F.M.; Kotler, Samuel A.; Brender, Jeffrey R.; Chen, Jennifer; Lee, Dong-kuk; Ramamoorthy, Ayyalusamy

2012-01-01

Disruption of cell membranes by Aβ is believed to be one of the key components of Aβ toxicity. However, the mechanism by which this occurs is not fully understood. Here, we demonstrate that membrane disruption by Aβ occurs by a two-step process, with the initial formation of ion-selective pores followed by nonspecific fragmentation of the lipid membrane during amyloid fiber formation. Immediately after the addition of freshly dissolved Aβ1–40, defects form on the membrane that share many of the properties of Aβ channels originally reported from single-channel electrical recording, such as cation selectivity and the ability to be blockaded by zinc. By contrast, subsequent amyloid fiber formation on the surface of the membrane fragments the membrane in a way that is not cation selective and cannot be stopped by zinc ions. Moreover, we observed that the presence of ganglioside enhances both the initial pore formation and the fiber-dependent membrane fragmentation process. Whereas pore formation by freshly dissolved Aβ1–40 is weakly observed in the absence of gangliosides, fiber-dependent membrane fragmentation can only be observed in their presence. These results provide insights into the toxicity of Aβ and may aid in the design of specific compounds to alleviate the neurodegeneration of Alzheimer’s disease. PMID:22947931

3′ fragment of miR173-programmed RISC-cleaved RNA is protected from degradation in a complex with RISC and SGS3

Science.gov (United States)

Yoshikawa, Manabu; Iki, Taichiro; Tsutsui, Yasuhiro; Miyashita, Kyoko; Poethig, R. Scott; Habu, Yoshiki; Ishikawa, Masayuki

2013-01-01

trans-acting small interfering RNAs (tasiRNAs) are plant-specific endogenous siRNAs produced via a unique pathway whose first step is the microRNA (miRNA)-programmed RNA-induced silencing complex (RISC)–mediated cleavage of tasiRNA gene (TAS) transcripts. One of the products is subsequently transformed into tasiRNAs by a pathway that requires several factors including SUPPRESSOR OF GENE SILENCING3 (SGS3) and RNA-DEPENDENT RNA POLYMERASE6. Here, using in vitro assembled ARGONAUTE (AGO)1–RISCs, we show that SGS3 is recruited onto RISCs only when they bind target RNA. Following cleavage by miRNA173 (miR173)-programmed RISC, SGS3 was found in complexes containing cleaved TAS2 RNA and RISC. The 3′ cleavage fragment (the source of tasiRNAs) was protected from degradation in this complex. Depletion of SGS3 did not affect TAS2 RNA cleavage by miR173-programmed RISC, but did affect the stability of the 3′ cleavage fragment. When the 3′ nucleotide of 22-nt miR173 was deleted or the corresponding nucleotide in TAS2 RNA was mutated, the complex was not observed and the 3′ cleavage fragment was degraded. Importantly, these changes in miR173 or TAS2 RNA are known to lead to a loss of tasiRNA production in vivo. These results suggest that (i) SGS3 associates with AGO1–RISC via the double-stranded RNA formed by the 3′-terminal nucleotides of 22-nt miR173 and corresponding target RNA, which probably protrudes from the AGO1–RISC molecular surface, (ii) SGS3 protects the 3′ cleavage fragment of TAS2 RNA from degradation, and (iii) the observed SGS3-dependent stabilization of the 3′ fragment of TAS2 RNA is key to tasiRNA production. PMID:23417299

Benchmark calculations with simple phantom for neutron dosimetry (2)

International Nuclear Information System (INIS)

Yukio, Sakamoto; Shuichi, Tsuda; Tatsuhiko, Sato; Nobuaki, Yoshizawa; Hideo, Hirayama

2004-01-01

Benchmark calculations for high-energy neutron dosimetry were undertaken after SATIF-5. Energy deposition in a cylindrical phantom with 100 cm radius and 30 cm depth was calculated for the irradiation of neutrons from 100 MeV to 10 GeV. Using the ICRU four-element loft tissue phantom and four single-element (hydrogen, carbon, nitrogen and oxygen) phantoms, the depth distributions of deposition energy and those total at the central region of phantoms within l cm radius and at the whole region of phantoms within 100 cm radius were calculated. The calculated results of FLUKA, MCNPX, MARS, HETC-3STEP and NMTC/JAM codes were compared. It was found that FLUKA, MARS and NMTC/JAM showed almost the same results. For the high-energy neutron incident, the MCNP-X results showed the largest ones in the total deposition energy and the HETC-3STEP results show'ed smallest ones. (author)

Gluon fragmentation into 3 PJ quarkonium

International Nuclear Information System (INIS)

Ma, J.P.

1995-01-01

The functions of the gluon fragmentation into 3 P j quarkonium are calculated to order α 2 s . With the recent progress in analysing quarkonium systems in QCD it is possible show how the so called divergence in the limit of the zero-binding energy, which is related to P-wave quarkonia, is treated correctly in the case of fragmentation functions. The obtained fragmentation functions satisfy explicitly at the order of α 2 s the Altarelli-Parisi equation and when z → 0 they behave as z -1 as expected. 19 refs., 7 figs

Simulation codes to evcaluate dose conversion coefficients for hadrons over 10 GeV

International Nuclear Information System (INIS)

Sato, T.; Tsuda, S.; Sakamoto, Y.; Yamaguchi, Y.; Niita, K.

2002-01-01

The conversion coefficients from fluence to effective dose for high energy hadrons are indispensable for various purposes such as accelerator shielding design and dose evaluation in space mission. Monte Carlo calculation code HETC-3STEP was used to evaluate dose conversion coefficients for neutrons and protons up to 10 GeV with an anthropomorphic model. The scaling model was incorporated in the code for simulation of high energy nuclear reactions. However, the secondary particle energy spectra predicted by the model were not smooth for nuclear reactions over several GeV. We attempted, therefore, to simulate transportation of such high energy particles by two newly developed Monte Carlo simulation codes: one is HETC-3STEP including the model used in EVENTQ instead of the scaling model, and the other is NMTC/JAM. By comparing calculated cross sections by these codes with experimental data for high energy nuclear reactions, it was found that NMTC/JAM had a better agreement with the data. We decided, therefore, to adopt NMTC/JAM for evaluation of dose conversion coefficients for hadrons with energies over 10 GeV. The effective dose conversion coefficients for high energy neutrons and protons evaluated by NMTC/JAM were found to be close to those by the FLUKA code

Construction of a 3D-shaped, natural product like fragment library by fragmentation and diversification of natural products.

Science.gov (United States)

Prescher, Horst; Koch, Guido; Schuhmann, Tim; Ertl, Peter; Bussenault, Alex; Glick, Meir; Dix, Ina; Petersen, Frank; Lizos, Dimitrios E

2017-02-01

A fragment library consisting of 3D-shaped, natural product-like fragments was assembled. Library construction was mainly performed by natural product degradation and natural product diversification reactions and was complemented by the identification of 3D-shaped, natural product like fragments available from commercial sources. In addition, during the course of these studies, novel rearrangements were discovered for Massarigenin C and Cytochalasin E. The obtained fragment library has an excellent 3D-shape and natural product likeness, covering a novel, unexplored and underrepresented chemical space in fragment based drug discovery (FBDD). Copyright © 2016 Elsevier Ltd. All rights reserved.

Evolution and diversity of a fungal self/nonself recognition locus.

Directory of Open Access Journals (Sweden)

Charles Hall

2010-11-01

Full Text Available Self/nonself discrimination is an essential feature for pathogen recognition and graft rejection and is a ubiquitous phenomenon in many organisms. Filamentous fungi, such as Neurospora crassa, provide a model for analyses of population genetics/evolution of self/nonself recognition loci due to their haploid nature, small genomes and excellent genetic/genomic resources. In N. crassa, nonself discrimination during vegetative growth is determined by 11 heterokaryon incompatibility (het loci. Cell fusion between strains that differ in allelic specificity at any of these het loci triggers a rapid programmed cell death response.In this study, we evaluated the evolution, population genetics and selective mechanisms operating at a nonself recognition complex consisting of two closely linked loci, het-c (NCU03493 and pin-c (NCU03494. The genomic position of pin-c next to het-c is unique to Neurospora/Sordaria species, and originated by gene duplication after divergence from other species within the Sordariaceae. The het-c pin-c alleles in N. crassa are in severe linkage disequilibrium and consist of three haplotypes, het-c1/pin-c1, het-c2/pin-c2 and het-c3/pin-c3, which are equally frequent in population samples and exhibit trans-species polymorphisms. The absence of recombinant haplotypes is correlated with divergence of the het-c/pin-c intergenic sequence. Tests for positive and balancing selection at het-c and pin-c support the conclusion that both of these loci are under non-neutral balancing selection; other regions of both genes appear to be under positive selection. Our data show that the het-c2/pin-c2 haplotype emerged by a recombination event between the het-c1/pin-c1 and het-c3/pin-c3 approximately 3-12 million years ago.These results support models by which loci that confer nonself discrimination form by the association of polymorphic genes with genes containing HET domains. Distinct allele classes can emerge by recombination and positive

Quark fragmentation into 3PJ quarkonium

International Nuclear Information System (INIS)

Ma, J.P.

1996-01-01

The functions of parton fragmentation into 3 P J quarkonium at order α 2 s are calculated, where the parton can be a heavy or a light quark. The obtained functions explicitly satisfy the Altarelli-Parisi equation and they are divergent, behaving as z -1 near z = O. However, if one choses the renormalization scale as twice of the heavy quark mass, the fragmentation functions are regular over the whole range of z. 15 refs., 2 figs

Large scale meta-analysis of fragment-based screening campaigns: privileged fragments and complementary technologies.

Science.gov (United States)

Kutchukian, Peter S; Wassermann, Anne Mai; Lindvall, Mika K; Wright, S Kirk; Ottl, Johannes; Jacob, Jaison; Scheufler, Clemens; Marzinzik, Andreas; Brooijmans, Natasja; Glick, Meir

2015-06-01

A first step in fragment-based drug discovery (FBDD) often entails a fragment-based screen (FBS) to identify fragment "hits." However, the integration of conflicting results from orthogonal screens remains a challenge. Here we present a meta-analysis of 35 fragment-based campaigns at Novartis, which employed a generic 1400-fragment library against diverse target families using various biophysical and biochemical techniques. By statistically interrogating the multidimensional FBS data, we sought to investigate three questions: (1) What makes a fragment amenable for FBS? (2) How do hits from different fragment screening technologies and target classes compare with each other? (3) What is the best way to pair FBS assay technologies? In doing so, we identified substructures that were privileged for specific target classes, as well as fragments that were privileged for authentic activity against many targets. We also revealed some of the discrepancies between technologies. Finally, we uncovered a simple rule of thumb in screening strategy: when choosing two technologies for a campaign, pairing a biochemical and biophysical screen tends to yield the greatest coverage of authentic hits. © 2014 Society for Laboratory Automation and Screening.

An improved algorithm for MFR fragment assembly

International Nuclear Information System (INIS)

Kontaxis, Georg

2012-01-01

A method for generating protein backbone models from backbone only NMR data is presented, which is based on molecular fragment replacement (MFR). In a first step, the PDB database is mined for homologous peptide fragments using experimental backbone-only data i.e. backbone chemical shifts (CS) and residual dipolar couplings (RDC). Second, this fragment library is refined against the experimental restraints. Finally, the fragments are assembled into a protein backbone fold using a rigid body docking algorithm using the RDCs as restraints. For improved performance, backbone nuclear Overhauser effects (NOEs) may be included at that stage. Compared to previous implementations of MFR-derived structure determination protocols this model-building algorithm offers improved stability and reliability. Furthermore, relative to CS-ROSETTA based methods, it provides faster performance and straightforward implementation with the option to easily include further types of restraints and additional energy terms.

Absolute fragmentation cross sections in atom-molecule collisions: Scaling laws for non-statistical fragmentation of polycyclic aromatic hydrocarbon molecules

Energy Technology Data Exchange (ETDEWEB)

Chen, T.; Gatchell, M.; Stockett, M. H.; Alexander, J. D.; Schmidt, H. T.; Cederquist, H.; Zettergren, H., E-mail: henning@fysik.su.se [Department of Physics, Stockholm University, S-106 91 Stockholm (Sweden); Zhang, Y. [Department of Mathematics, Faculty of Physics, M. V. Lomonosov Moscow State University, Leninskie Gory, 119991 Moscow (Russian Federation); Rousseau, P.; Maclot, S.; Delaunay, R.; Adoui, L. [CIMAP, UMR 6252, CEA/CNRS/ENSICAEN/Université de Caen Basse-Normandie, bd Henri Becquerel, BP 5133, F-14070 Caen Cedex 05 (France); Université de Caen Basse-Normandie, Esplanade de la Paix, F-14032 Caen (France); Domaracka, A.; Huber, B. A. [CIMAP, UMR 6252, CEA/CNRS/ENSICAEN/Université de Caen Basse-Normandie, bd Henri Becquerel, BP 5133, F-14070 Caen Cedex 05 (France); Schlathölter, T. [Zernike Institute for Advanced Materials, University of Groningen, Nijenborgh 4, 9747AG Groningen (Netherlands)

2014-06-14

We present scaling laws for absolute cross sections for non-statistical fragmentation in collisions between Polycyclic Aromatic Hydrocarbons (PAH/PAH{sup +}) and hydrogen or helium atoms with kinetic energies ranging from 50 eV to 10 keV. Further, we calculate the total fragmentation cross sections (including statistical fragmentation) for 110 eV PAH/PAH{sup +} + He collisions, and show that they compare well with experimental results. We demonstrate that non-statistical fragmentation becomes dominant for large PAHs and that it yields highly reactive fragments forming strong covalent bonds with atoms (H and N) and molecules (C{sub 6}H{sub 5}). Thus nonstatistical fragmentation may be an effective initial step in the formation of, e.g., Polycyclic Aromatic Nitrogen Heterocycles (PANHs). This relates to recent discussions on the evolution of PAHNs in space and the reactivities of defect graphene structures.

Native Frames: Disentangling Sequential from Concerted Three-Body Fragmentation

Science.gov (United States)

Rajput, Jyoti; Severt, T.; Berry, Ben; Jochim, Bethany; Feizollah, Peyman; Kaderiya, Balram; Zohrabi, M.; Ablikim, U.; Ziaee, Farzaneh; Raju P., Kanaka; Rolles, D.; Rudenko, A.; Carnes, K. D.; Esry, B. D.; Ben-Itzhak, I.

2018-03-01

A key question concerning the three-body fragmentation of polyatomic molecules is the distinction of sequential and concerted mechanisms, i.e., the stepwise or simultaneous cleavage of bonds. Using laser-driven fragmentation of OCS into O++C++S+ and employing coincidence momentum imaging, we demonstrate a novel method that enables the clear separation of sequential and concerted breakup. The separation is accomplished by analyzing the three-body fragmentation in the native frame associated with each step and taking advantage of the rotation of the intermediate molecular fragment, CO2 + or CS2 + , before its unimolecular dissociation. This native-frame method works for any projectile (electrons, ions, or photons), provides details on each step of the sequential breakup, and enables the retrieval of the relevant spectra for sequential and concerted breakup separately. Specifically, this allows the determination of the branching ratio of all these processes in OCS3 + breakup. Moreover, we find that the first step of sequential breakup is tightly aligned along the laser polarization and identify the likely electronic states of the intermediate dication that undergo unimolecular dissociation in the second step. Finally, the separated concerted breakup spectra show clearly that the central carbon atom is preferentially ejected perpendicular to the laser field.

(PCR) for direct cloning of blunt-end DNA fragments

African Journals Online (AJOL)

Administrator

2011-09-19

Sep 19, 2011 ... Key words: Blunt-end cloning, phosphorylated DNA fragment, dephosphorylated blunt-end vector. INTRODUCTION ... With this method, a lot of steps are saved, which includes restriction .... pBSK-blunt (data not shown).

Enantioselective synthesis of C{sub 9}-C{sub 1}3 fragment of erythromycin B; Sintesis enantioselectiva del fragmento C{sub 9}-C{sub 1}3 de la eritromicina B

Energy Technology Data Exchange (ETDEWEB)

Dominguez, E.; Carretero, J.C. [Departamento de Quimica Organica, Universidad Autonoma, Madrid (Spain)

1994-12-31

A stereo controlled synthesis of the enantiomerically pure C{sub 9}-C{sub 1}3 fragment of erythromycin B is described. The process takes place in 15 steps from (R)-phenylsulfonyl p-tolylsulfinyl methane and butyraldehyde (16% overall yield). The key steps, corresponding to the formation of the chiral centers, are based on the iterative synthesis of gamma-hydroxivinylsulfones and further syb-sterereoselective addition of MeLi to their protected derivatives. 8 refs.

IN SITU PLASMA MEASUREMENTS OF FRAGMENTED COMET 73P SCHWASSMANN–WACHMANN 3

International Nuclear Information System (INIS)

Gilbert, J. A.; Lepri, S. T.; Combi, M.; Zurbuchen, T. H.; Rubin, M.

2015-01-01

The interiors of comets contain some of the most pristine material in the solar system. Comet 73P/Schwassmann–Wachmann 3, discovered in 1930, is a Jupiter-family comet with a 5.34-year period. This comet split into 5 fragments in 1995 and disintegrated into nearly 70 major pieces in 2006. In 2006 May and June, recently ionized cometary particles originating from fragments including and surrounding some of these major objects were collected with the ACE/SWICS and Wind/STICS sensors. Due to a combination of the instrument characteristics and the close proximity of the fragments passing between those spacecraft and the Sun, unique measurements regarding the charge state composition and the elemental abundances of both cometary and heliospheric plasma were made during that time. The cometary material released from some of these fragments can be identified by the concentrations of water-group pickup ions having a mass-per-charge ratio of 16–18 amu e −1 , indicating that while these fragments are small, they are still actively sublimating. We present an analysis of cometary composition, spatial distribution, and heliospheric interactions, with a focus on helium, C + /O + , and water-group ions

In Situ Plasma Measurements of Fragmented Comet 73P Schwassmann-Wachmann 3

Science.gov (United States)

Gilbert, J. A.; Lepri, S. T.; Rubin, M.; Combi, M.; Zurbuchen, T. H.

2015-12-01

The interiors of comets contain some of the most pristine material in the solar system. Comet 73P/Schwassmann-Wachmann 3, discovered in 1930, is a Jupiter-family comet with a 5.34-year period. This comet split into 5 fragments in 1995 and disintegrated into nearly 70 major pieces in 2006. In 2006 May and June, recently ionized cometary particles originating from fragments including and surrounding some of these major objects were collected with the ACE/SWICS and Wind/STICS sensors. Due to a combination of the instrument characteristics and the close proximity of the fragments passing between those spacecraft and the Sun, unique measurements regarding the charge state composition and the elemental abundances of both cometary and heliospheric plasma were made during that time. The cometary material released from some of these fragments can be identified by the concentrations of water-group pickup ions having a mass-per-charge ratio of 16-18 amu e-1, indicating that while these fragments are small, they are still actively sublimating. We present an analysis of cometary composition, spatial distribution, and heliospheric interactions, with a focus on helium, C+/O+, and water-group ions.

IN SITU PLASMA MEASUREMENTS OF FRAGMENTED COMET 73P SCHWASSMANN–WACHMANN 3

Energy Technology Data Exchange (ETDEWEB)

Gilbert, J. A.; Lepri, S. T.; Combi, M.; Zurbuchen, T. H. [University of Michigan, Ann Arbor, MI 48109 (United States); Rubin, M., E-mail: jagi@umich.edu [Universität Bern, Bern (Switzerland)

2015-12-10

The interiors of comets contain some of the most pristine material in the solar system. Comet 73P/Schwassmann–Wachmann 3, discovered in 1930, is a Jupiter-family comet with a 5.34-year period. This comet split into 5 fragments in 1995 and disintegrated into nearly 70 major pieces in 2006. In 2006 May and June, recently ionized cometary particles originating from fragments including and surrounding some of these major objects were collected with the ACE/SWICS and Wind/STICS sensors. Due to a combination of the instrument characteristics and the close proximity of the fragments passing between those spacecraft and the Sun, unique measurements regarding the charge state composition and the elemental abundances of both cometary and heliospheric plasma were made during that time. The cometary material released from some of these fragments can be identified by the concentrations of water-group pickup ions having a mass-per-charge ratio of 16–18 amu e{sup −1}, indicating that while these fragments are small, they are still actively sublimating. We present an analysis of cometary composition, spatial distribution, and heliospheric interactions, with a focus on helium, C{sup +}/O{sup +}, and water-group ions.

Step 3: Manage Your Diabetes

Science.gov (United States)

... please turn JavaScript on. Feature: Type 2 Diabetes Step 3: Manage Your Diabetes Past Issues / Fall 2014 ... 2 Diabetes" Articles Diabetes Is Serious But Manageable / Step 1: Learn About Diabetes / Step 2: Know Your ...

Fragmentation in 28Si-emulsion interactions at 3.7A GeV

International Nuclear Information System (INIS)

Singh, B.K.; Tuli, S.K.

1999-01-01

The results on fragmentation of a 3.7A GeV 28 Si projectile in interactions with different target nuclei in nuclear emulsion are presented. Limiting fragmentation behaviour of the projectile fragments is achieved at this energy. It is shown that the factorization principle for fragmentation cross-sections holds for light fragments only. A bond percolation prescription is able to reproduce the experimental observations for fragments with charge 4≤Z≤10. A rise in the production of helium fragments is also predicted by bond percolation

Effect of Calcaneus Fracture Gap Without Step-Off on Stress Distribution Across the Subtalar Joint.

Science.gov (United States)

Barrick, Brett; Joyce, Donald A; Werner, Frederick W; Iannolo, Maria

2017-03-01

Subtalar arthritis is a common consequence following calcaneal fracture, and its development is related to the severity of the fracture. Previous calcaneal fracture models have demonstrated altered contact characteristics when a step-off is created in the posterior facet articular surface. Changes in posterior facet contact characteristics have not been previously characterized for calcaneal fracture gap without step-off. The contact characteristics (peak pressure, area of contact, and centroid of pressure) of the posterior facet of the subtalar joint were determined in 6 cadaveric specimens. After creating a calcaneal fracture to simulate a Sanders type II fracture, the contact characteristics were determined with the posterior facet anatomically reduced followed by an incremental increase in fracture gap displacement of 2, 3, and 5 mm without a step-off of the articular surface. Peak pressure on the medial fragment was significantly less with a 5-mm gap compared to a 2- or 3-mm gap, or reduced. On the lateral fragment, the peak pressure was significantly increased with a 5-mm gap compared to a 2- or 3-mm gap. Contact area significantly changed with increased gap. In this study, there were no significant differences in contact characteristics between a <3-mm gap and an anatomically reduced fracture, conceding the study limitations including limiting axial loading to 50% of donor body weight. A small amount of articular incongruity without a step-off can be tolerated by the subtalar joint, in contrast to articular incongruity with a step-off present.

Morphology-photovoltaic property correlation in perovskite solar cells: One-step versus two-step deposition of CH3NH3PbI3

Directory of Open Access Journals (Sweden)

Jeong-Hyeok Im

2014-08-01

Full Text Available Perovskite CH3NH3PbI3 light absorber is deposited on the mesoporous TiO2 layer via one-step and two-step coating methods and their photovoltaic performances are compared. One-step coating using a solution containing CH3NH3I and PbI2 shows average power conversion efficiency (PCE of 7.5%, while higher average PCE of 13.9% is obtained from two-step coating method, mainly due to higher voltage and fill factor. The coverage, pore-filling, and morphology of the deposited perovskite are found to be critical in photovoltaic performance of the mesoporous TiO2 based perovskite solar cells.

Computational fragment-based screening using RosettaLigand: the SAMPL3 challenge

Science.gov (United States)

Kumar, Ashutosh; Zhang, Kam Y. J.

2012-05-01

SAMPL3 fragment based virtual screening challenge provides a valuable opportunity for researchers to test their programs, methods and screening protocols in a blind testing environment. We participated in SAMPL3 challenge and evaluated our virtual fragment screening protocol, which involves RosettaLigand as the core component by screening a 500 fragments Maybridge library against bovine pancreatic trypsin. Our study reaffirmed that the real test for any virtual screening approach would be in a blind testing environment. The analyses presented in this paper also showed that virtual screening performance can be improved, if a set of known active compounds is available and parameters and methods that yield better enrichment are selected. Our study also highlighted that to achieve accurate orientation and conformation of ligands within a binding site, selecting an appropriate method to calculate partial charges is important. Another finding is that using multiple receptor ensembles in docking does not always yield better enrichment than individual receptors. On the basis of our results and retrospective analyses from SAMPL3 fragment screening challenge we anticipate that chances of success in a fragment screening process could be increased significantly with careful selection of receptor structures, protein flexibility, sufficient conformational sampling within binding pocket and accurate assignment of ligand and protein partial charges.

3D RECONSTRUCTION AND ANALYSIS OF THE FRAGMENTED GRAINS IN A COMPOSITE MATERIAL

Directory of Open Access Journals (Sweden)

Luc Gillibert

2013-06-01

Full Text Available X-ray microtomography from solid propellant allows studying the microstructure of fragmented grains in damaged samples. A new reconstruction algorithm of fragmented grains for 3D images is introduced. Based on a watershed transform of a morphological closing of the input image, the algorithm can be used  with different sets of markers. Two of them are compared. After the grain reconstruction, a multiscale segmentation  algorithm is used to extract each fragment of the damaged grains. This allows an original quantitative study of the  fragmentation of each grain in 3D. Experimental results on X-ray microtomographic images of a solid propellant fragmented under compression are presented and validated.

40 CFR 35.2109 - Step 2+3.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Step 2+3. 35.2109 Section 35.2109... ASSISTANCE Grants for Construction of Treatment Works § 35.2109 Step 2+3. The Regional Administrator may award a Step 2+3 grant which will provide the Federal share of an allowance under appendix B and the...

Cryobiology of coral fragments.

Science.gov (United States)

Hagedorn, Mary; Farrell, Ann; Carter, Virginia L

2013-02-01

Around the world, coral reefs are dying due to human influences, and saving habitat alone may not stop this destruction. This investigation focused on the biological processes that will provide the first steps in understanding the cryobiology of whole coral fragments. Coral fragments are a partnership of coral tissue and endosymbiotic algae, Symbiodinium sp., commonly called zooxanthellae. These data reflected their separate sensitivities to chilling and a cryoprotectant (dimethyl sulfoxide) for the coral Pocillopora damicornis, as measured by tissue loss and Pulse Amplitude Modulated fluorometry 3weeks post-treatment. Five cryoprotectant treatments maintained the viability of the coral tissue and zooxanthellae at control values (1M dimethyl sulfoxide at 1.0, 1.5 and 2.0h exposures, and 1.5M dimethyl sulfoxide at 1.0 and 1.5h exposures, P>0.05, ANOVA), whereas 2M concentrations did not (Pzooxanthellae. During the winter when the fragments were chilled, the coral tissue remained relatively intact (∼25% loss) post-treatment, but the zooxanthellae numbers in the tissue declined after 5min of chilling (Pzooxanthellae numbers declined in response to chilling alone (P0.05, ANOVA), but it did not protect against the loss of zooxanthellae (Pzooxanthellae are the most sensitive element in the coral fragment complex and future cryopreservation protocols must be guided by their greater sensitivity. Copyright © 2012 Elsevier Inc. All rights reserved.

Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

Science.gov (United States)

Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

2015-07-01

Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

Microsoft Windows Sharepoint Services 3.0 Step by Step

CERN Document Server

Londer, Olga; Bleeker, Todd; Coventry, Penelope

2007-01-01

Experience learning made easy-and quickly teach yourself how to use Windows SharePoint Services to enable effective team collaboration. With Step By Step, you set the pace-building and practicing the skills you need, just when you need them! Build your own SharePoint site with easy-to-use templatesCreate lists and libraries to store informationAdd discussion boards, wikis, and blogsSet up Document and Meeting Workspaces for easy collaborationShare calendars, contacts, and data from Microsoft Office programsCustomize your pages with Web Parts Your all-in-one learning experience includes: Fi

In-beam γ-ray spectroscopy of two-step fragmentation reactions at relativistic energies. The case of 36Ca

International Nuclear Information System (INIS)

Doornenbal, P.

2007-01-01

A two-step fragmentation experiment has been performed at GSI with the RISING setup. It combines the fragment separator FRS, which allows for the production of radioactive heavy ions at relativistic energies, with a high resolution γ-spectrometer. This combination offers unique possibilities for nuclear structure investigations like the test of shell model predictions far from stability. Within the present work the question if the N=14(16) shell stabilisation in Z=8 oxygen isotopes and the N=20 shell quenching in 32 Mg are symmetric with respect to the isospin projection quantum number Tz has been addressed. New γ-ray decays were found in the neutron deficient 36 Ca and 36 K by impinging a radioactive ion beam of 37 Ca on a secondary 9 Be target. The fragmentation products were selected with the calorimeter telescope CATE and the emitted γ-rays were measured with Ge Cluster, MINIBALL, and BaF 2 HECTOR detectors. For 36 Ca the 2 1 + →0 g.s. + transition energy was determined to be 3015(16) keV, which is the heaviest T=2 nucleus from which γ-spectroscopic information has been obtained so far. A comparison between the experimental 2 1 + energies of 36 Ca and its mirror nucleus 36 S yielded a mirror energy difference of ΔE M =-276(16) keV. In order to understand the large ΔE M value, the experimental single-particle energies from the A=17, T=1/2 mirror nuclei were taken and applied onto modified isospin symmetric USD interactions in shell model calculations. These calculations were in agreement with the experimental result and showed that the experimental single-particle energies may account empirically for the one body part of Thomas-Ehrman and/or Coulomb effects. A method to extract the lifetime of excited states in fragmentation reactions was investigated. Therefore, the dependence between the lifetime of an excited state and the average de-excitation velocity and trajectory of the nuclei in relativistic fragmentation experiments has been studied. Known

Diversity-Oriented Synthesis as a Strategy for Fragment Evolution against GSK3β

Science.gov (United States)

2016-01-01

Traditional fragment-based drug discovery (FBDD) relies heavily on structural analysis of the hits bound to their targets. Herein, we present a complementary approach based on diversity-oriented synthesis (DOS). A DOS-based fragment collection was able to produce initial hit compounds against the target GSK3β, allow the systematic synthesis of related fragment analogues to explore fragment-level structure–activity relationship, and finally lead to the synthesis of a more potent compound. PMID:27660690

The fragmentation of proto-globular clusters. I. Thermal instabilities

International Nuclear Information System (INIS)

Murray, S.D.; Lin, D.N.C.

1989-01-01

The metal abundances among the stars within a typical globular cluster are remarkably homogeneous. This indicates that star formation in these systems was a globally coordinated event which occurred over a time span less than or comparable to the collapse time scale of the cluster. This issue is addressed by assuming that the fragmentation of a proto-globular cluster cloud proceeded in two steps. In the first step, thermal instability led to the rapid growth of initial fluctuations. This led to a large contrast in the dynamical time scales between the perturbations and the parent cloud, and the perturbations then underwent gravitational instabilities on short time scales. This process is modeled using one-dimensional hydrodynamic simulations of clouds both with and without external heat sources and self-gravity. The models include the effects of a non-equilibrium H2 abundance. The results indicate that fragmentation can occur on time scales significantly less than the dynamical time scale of the parent cloud. 21 refs

Searching Fragment Spaces with feature trees.

Science.gov (United States)

Lessel, Uta; Wellenzohn, Bernd; Lilienthal, Markus; Claussen, Holger

2009-02-01

Virtual combinatorial chemistry easily produces billions of compounds, for which conventional virtual screening cannot be performed even with the fastest methods available. An efficient solution for such a scenario is the generation of Fragment Spaces, which encode huge numbers of virtual compounds by their fragments/reagents and rules of how to combine them. Similarity-based searches can be performed in such spaces without ever fully enumerating all virtual products. Here we describe the generation of a huge Fragment Space encoding about 5 * 10(11) compounds based on established in-house synthesis protocols for combinatorial libraries, i.e., we encode practically evaluated combinatorial chemistry protocols in a machine readable form, rendering them accessible to in silico search methods. We show how such searches in this Fragment Space can be integrated as a first step in an overall workflow. It reduces the extremely huge number of virtual products by several orders of magnitude so that the resulting list of molecules becomes more manageable for further more elaborated and time-consuming analysis steps. Results of a case study are presented and discussed, which lead to some general conclusions for an efficient expansion of the chemical space to be screened in pharmaceutical companies.

Fragment-based lead generation: identification of seed fragments by a highly efficient fragment screening technology

Science.gov (United States)

Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris

2009-08-01

For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.

Analysis of human blood plasma cell-free DNA fragment size distribution using EvaGreen chemistry based droplet digital PCR assays.

Science.gov (United States)

Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

2018-04-12

Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Fragment informatics and computational fragment-based drug design: an overview and update.

Science.gov (United States)

Sheng, Chunquan; Zhang, Wannian

2013-05-01

Fragment-based drug design (FBDD) is a promising approach for the discovery and optimization of lead compounds. Despite its successes, FBDD also faces some internal limitations and challenges. FBDD requires a high quality of target protein and good solubility of fragments. Biophysical techniques for fragment screening necessitate expensive detection equipment and the strategies for evolving fragment hits to leads remain to be improved. Regardless, FBDD is necessary for investigating larger chemical space and can be applied to challenging biological targets. In this scenario, cheminformatics and computational chemistry can be used as alternative approaches that can significantly improve the efficiency and success rate of lead discovery and optimization. Cheminformatics and computational tools assist FBDD in a very flexible manner. Computational FBDD can be used independently or in parallel with experimental FBDD for efficiently generating and optimizing leads. Computational FBDD can also be integrated into each step of experimental FBDD and help to play a synergistic role by maximizing its performance. This review will provide critical analysis of the complementarity between computational and experimental FBDD and highlight recent advances in new algorithms and successful examples of their applications. In particular, fragment-based cheminformatics tools, high-throughput fragment docking, and fragment-based de novo drug design will provide the focus of this review. We will also discuss the advantages and limitations of different methods and the trends in new developments that should inspire future research. © 2012 Wiley Periodicals, Inc.

In-beam {gamma}-ray spectroscopy of two-step fragmentation reactions at relativistic energies. The case of {sup 36}Ca

Energy Technology Data Exchange (ETDEWEB)

Doornenbal, P.

2007-10-23

A two-step fragmentation experiment has been performed at GSI with the RISING setup. It combines the fragment separator FRS, which allows for the production of radioactive heavy ions at relativistic energies, with a high resolution {gamma}-spectrometer. This combination offers unique possibilities for nuclear structure investigations like the test of shell model predictions far from stability. Within the present work the question if the N=14(16) shell stabilisation in Z=8 oxygen isotopes and the N=20 shell quenching in {sup 32}Mg are symmetric with respect to the isospin projection quantum number Tz has been addressed. New {gamma}-ray decays were found in the neutron deficient {sup 36}Ca and {sup 36}K by impinging a radioactive ion beam of {sup 37}Ca on a secondary {sup 9}Be target. The fragmentation products were selected with the calorimeter telescope CATE and the emitted {gamma}-rays were measured with Ge Cluster, MINIBALL, and BaF{sub 2} HECTOR detectors. For {sup 36}Ca the 2{sub 1}{sup +}{yields}0{sub g.s.}{sup +} transition energy was determined to be 3015(16) keV, which is the heaviest T=2 nucleus from which {gamma}-spectroscopic information has been obtained so far. A comparison between the experimental 2{sub 1}{sup +} energies of {sup 36}Ca and its mirror nucleus {sup 36}S yielded a mirror energy difference of {delta}E{sub M}=-276(16) keV. In order to understand the large {delta}E{sub M} value, the experimental single-particle energies from the A=17, T=1/2 mirror nuclei were taken and applied onto modified isospin symmetric USD interactions in shell model calculations. These calculations were in agreement with the experimental result and showed that the experimental single-particle energies may account empirically for the one body part of Thomas-Ehrman and/or Coulomb effects. A method to extract the lifetime of excited states in fragmentation reactions was investigated. Therefore, the dependence between the lifetime of an excited state and the average de

Synthesis of the thiazole-thiazoline fragment of largazole analogues

DEFF Research Database (Denmark)

Diness, Frederik; Nielsen, Daniel Skovhaur; Fairlie, David P

2011-01-01

The thiazole-thiazoline fragment of the marine natural product largazole, a potent histone deacetylase 1 inhibitor, has been synthesized in five steps. The methodology provides rapid access to thiazole-4-carbonitrile, thiazole-4-carbimidate, thiazole-oxazoline, and other thiazole-thiazoline deriv......The thiazole-thiazoline fragment of the marine natural product largazole, a potent histone deacetylase 1 inhibitor, has been synthesized in five steps. The methodology provides rapid access to thiazole-4-carbonitrile, thiazole-4-carbimidate, thiazole-oxazoline, and other thiazole...

Fragmentation of a 500 MeV/nucleon 86Kr beam, investigated at the GSI projectile fragment separator

International Nuclear Information System (INIS)

Weber, M.; Donzaud, C.; Geissel, H.; Grewe, A.; Lewitowicz, M.; Magel, A.; Mueller, A.C.; Nickel, F.; Pfuetzner, M.; Piechaczek, A.; Pravikoff, M.; Roeckl, E.; Rykaczewski, K.; Saint-Laurent, M.G.; Schall, I.; Stephan, C.; Tassan-Got, L.; Voss, B.

1993-10-01

Production cross-sections and longitudinal momentum distributions have been investigated for reactions between a 500 MeV/nucleon 86 Kr beam and beryllium, copper and tantalum targets. Fragments in a wide A/Z range were studied at the projectile-fragment separator FRS at GSI. The experimental production cross-sections have been used for testing the predictions obtained from a semi-empirical parameterization, a statistical abrasion model and an intranuclear-cascade model. The present study allows to extrapolate the production cross-sections towards very neutron-rich isotopes such as the doubly magic nucleus 78 Ni. For fragments close to the projectile the measured longitudinal momentum distributions agrees qualitatively with a semi-empirical parameterization, which is based on the two-step picture of the fragmentation process. The momentum widths of lighter fragments, however, show deviations from this simple picture. (orig.)

Combining measures of dispersal to identify conservation strategies in fragmented landscapes.

Science.gov (United States)

Leidner, Allison K; Haddad, Nick M

2011-10-01

Understanding the way in which habitat fragmentation disrupts animal dispersal is key to identifying effective and efficient conservation strategies. To differentiate the potential effectiveness of 2 frequently used strategies for increasing the connectivity of populations in fragmented landscapes-corridors and stepping stones-we combined 3 complimentary methods: behavioral studies at habitat edges, mark-recapture, and genetic analyses. Each of these methods addresses different steps in the dispersal process that a single intensive study could not address. We applied the 3 methods to the case study of Atrytonopsis new species 1, a rare butterfly endemic to a partially urbanized stretch of barrier islands in North Carolina (U.S.A.). Results of behavioral analyses showed the butterfly flew into urban and forested areas, but not over open beach; mark-recapture showed that the butterfly dispersed successfully through short stretches of urban areas (5 km) were a dispersal barrier, but shorter stretches of urban areas (≤5 km) were not. Although results from all 3 methods indicated natural features in the landscape, not urbanization, were barriers to dispersal, when we combined the results we could determine where barriers might arise: forests restricted dispersal for the butterfly only when there were long stretches with no habitat. Therefore, urban areas have the potential to become a dispersal barrier if their extent increases, a finding that may have gone unnoticed if we had used a single approach. Protection of stepping stones should be sufficient to maintain connectivity for Atrytonopsis new species 1 at current levels of urbanization. Our research highlights how the use of complementary approaches for studying animal dispersal in fragmented landscapes can help identify conservation strategies. ©2011 Society for Conservation Biology.

e-Drug3D: 3D structure collections dedicated to drug repurposing and fragment-based drug design.

Science.gov (United States)

Pihan, Emilie; Colliandre, Lionel; Guichou, Jean-François; Douguet, Dominique

2012-06-01

In the drug discovery field, new uses for old drugs, selective optimization of side activities and fragment-based drug design (FBDD) have proved to be successful alternatives to high-throughput screening. e-Drug3D is a database of 3D chemical structures of drugs that provides several collections of ready-to-screen SD files of drugs and commercial drug fragments. They are natural inputs in studies dedicated to drug repurposing and FBDD. e-Drug3D collections are freely available at http://chemoinfo.ipmc.cnrs.fr/e-drug3d.html either for download or for direct in silico web-based screenings.

SPAR-H Step-by-Step Guidance

Energy Technology Data Exchange (ETDEWEB)

W. J. Galyean; A. M. Whaley; D. L. Kelly; R. L. Boring

2011-05-01

This guide provides step-by-step guidance on the use of the SPAR-H method for quantifying Human Failure Events (HFEs). This guide is intended to be used with the worksheets provided in: 'The SPAR-H Human Reliability Analysis Method,' NUREG/CR-6883, dated August 2005. Each step in the process of producing a Human Error Probability (HEP) is discussed. These steps are: Step-1, Categorizing the HFE as Diagnosis and/or Action; Step-2, Rate the Performance Shaping Factors; Step-3, Calculate PSF-Modified HEP; Step-4, Accounting for Dependence, and; Step-5, Minimum Value Cutoff. The discussions on dependence are extensive and include an appendix that describes insights obtained from the psychology literature.

SPAR-H Step-by-Step Guidance

International Nuclear Information System (INIS)

Galyean, W.J.; Whaley, A.M.; Kelly, D.L.; Boring, R.L.

2011-01-01

This guide provides step-by-step guidance on the use of the SPAR-H method for quantifying Human Failure Events (HFEs). This guide is intended to be used with the worksheets provided in: 'The SPAR-H Human Reliability Analysis Method,' NUREG/CR-6883, dated August 2005. Each step in the process of producing a Human Error Probability (HEP) is discussed. These steps are: Step-1, Categorizing the HFE as Diagnosis and/or Action; Step-2, Rate the Performance Shaping Factors; Step-3, Calculate PSF-Modified HEP; Step-4, Accounting for Dependence, and; Step-5, Minimum Value Cutoff. The discussions on dependence are extensive and include an appendix that describes insights obtained from the psychology literature.

Towards the total synthesis of Stawamycin. Synthesis of C11-C21 fragment

Directory of Open Access Journals (Sweden)

Dias Luiz C.

2001-01-01

Full Text Available The carbocyclic (C11-C21 fragment of Stawamycin has been prepared by a sequence involving 11 steps (10% overall yield from methyl (R-(--3-hydroxy-2-methylpropionate. Key steps are Pd-catalyzed Stille coupling reaction between a vinyl iodide and a vinylstannane followed by an intramolecular Diels-Alder cycloaddition reaction to afford the desired adduct as the major isomer together with three other possible adducts in 78% overall yield.

Fracture morphology of AO/OTA 31-A trochanteric fractures: A 3D CT study with an emphasis on coronal fragments.

Science.gov (United States)

Cho, Jae-Woo; Kent, William T; Yoon, Yong-Cheol; Kim, Youngwoo; Kim, Hyungon; Jha, Ashutosh; Durai, Senthil Kumar; Oh, Jong-Keon

2017-02-01

This study was designed to assess the incidence and morphology of coronal plane fragments in AO/OTA 31-A trochanteric fractures. 156 cases of AO/OTA 31-A trochanteric fractures were retrospectively evaluated. Lateral radiographs were analyzed for the presence of coronal plane fragments followed by analysis of 3D CT reconstructions in these fractures. The incidence of coronal fragments identified on the lateral radiograph and 3D CT reconstructions were both calculated. Coronal fragment morphology was described based upon the origin and exit points of fracture lines and the number of fragments. On plain radiographs, a coronal plane fracture was identified in 59 cases, an incidence of 37.8% (59/156). In comparison, 3D CT reconstructions identified coronal plane fractures in 138 cases for an incidence of 88.4% (138/156). 3D CT reconstructions identified coronal fracture fragments in 81.9% (50/61) of AO/OTA 31-A1 cases, 94.5% (69/73) of 31-A2 cases, and 86.3% (19/22) of 31-A3 cases. Incidence of coronal fractures identified on plain radiographs of 3 AO/OTA 31-A1,A2,A3 groups was lower when compared to the incidence of coronal fractures identified on 3D CT. Of the 138 cases that had coronal plane fracture, 82 cases (59.4%) had a single coronal fragment (GT fragment 35 cases, GLT fragment 19 cases, GLPC fragment 28 cases). The remaining 56 cases (40.5%) had two coronal fragments. There is a high incidence of coronal fragments in intertrochanteric femur fractures when analyzed with 3D CT reconstructions. Our study suggests that these coronal fragments are difficult to identify on plain radiographs. Knowledge of the incidence and morphology of coronal fragments helps to avoid potential intraoperative pitfalls. Copyright © 2016 Elsevier Ltd. All rights reserved.

Synthesis and properties of 1,3-dioxo-1H-inden-2(3H)-ylidene fragment and (3-(dicyanomethylene)-5,5-dimethylcyclohex-1-enyl)vinyl fragment containing derivatives of azobenzene for holographic recording materials

Science.gov (United States)

Zarins, Elmars; Kokars, Valdis; Ozols, Andris; Augustovs, Peteris

2011-06-01

New glassy 1,3-dioxo-1H-inden-2(3H)-ylidene fragment und (3-(dicyanomethylene)-5,5-dimethylcyclohex-1-enyl)vinyl fragment containing push-pull type derivatives of azobenzene able to create thin layers have been synthesized. Thin films of synthesized glasses for holographic recording were prepared using spin coating technique from saturated chloroform solution. Holographic grating recording in films of 6a-b, 7 and 12 has been experimentally studied at 633 and 532 nm in both transmission and reflection modes with p-p recording beam polarizations. The film 12 was found to be the most efficient at both wavelengths in transmission mode exhibiting the maximum self-diffraction efficiency of 9.9% at 633 nm, and 15.3% at 532 nm. The film of 6a was the most efficient in reflection mode with the maximum selfdiffraction efficiency of about 3%.

The activity of the anti-apoptotic fragment generated by the caspase-3/p120 RasGAP stress-sensing module displays strict Akt isoform specificity.

Science.gov (United States)

Vanli, Güliz; Peltzer, Nieves; Dubuis, Gilles; Widmann, Christian

2014-12-01

The caspase-3/p120 RasGAP module acts as a stress sensor that promotes pro-survival or pro-death signaling depending on the intensity and the duration of the stressful stimuli. Partial cleavage of p120 RasGAP generates a fragment, called fragment N, which protects stressed cells by activating Akt signaling. Akt family members regulate many cellular processes including proliferation, inhibition of apoptosis and metabolism. These cellular processes are regulated by three distinct Akt isoforms: Akt1, Akt2 and Akt3. However, which of these isoforms are required for fragment N mediated protection have not been defined. In this study, we investigated the individual contribution of each isoform in fragment N-mediated cell protection against Fas ligand induced cell death. To this end, DLD1 and HCT116 isogenic cell lines lacking specific Akt isoforms were used. It was found that fragment N could activate Akt1 and Akt2 but that only the former could mediate the protective activity of the RasGAP-derived fragment. Even overexpression of Akt2 or Akt3 could not rescue the inability of fragment N to protect cells lacking Akt1. These results demonstrate a strict Akt isoform requirement for the anti-apoptotic activity of fragment N. Copyright © 2014 Elsevier Inc. All rights reserved.

[Reconstruction of long polynucleotide sequences from fragments using the Iskra-226 personal computer

Science.gov (United States)

Kostetskiĭ, P V; Dobrova, I E

1988-04-01

An algorithm for reconstructing long DNA sequences, i.e. arranging all overlapping gel readings in the contigs, and the corresponding BASIC programme for personal computer "Iskra-226" (USSR) are described. The contig construction begins with the search for all fragments overlapping the basic (longest) one follower by determination of coordinates of 5' ends of the overlapping fragments. Then the gel reading with minimal 5' end coordinate and the gel reading with maximal 3' end coordinate are selected and used as basic ones at the next assembly steps. The procedure is finished when no gel reading overlapping the basic one can be found. All gel readings entered the contig are ignored at the next steps of the assembly. Finally, one or several contigs consisted of DNA fragments are obtained. Effectiveness of the algorithm was tested on a model based on the multiple assembly of the nucleotide sequence, encoding the Na, K-ATPase alpha-subunit of pig kidney. The programme does not call for user's participation and can comprise contigs up to 10,000 nucleotides long.

When and how to operate the posterior malleolus fragment in trimalleolar fractures: a systematic literature review.

Science.gov (United States)

Verhage, Samuel Marinus; Hoogendoorn, Jochem Maarten; Krijnen, Pieta; Schipper, Inger Birgitta

2018-05-12

Whether or not and how to fixate the posterior malleolus fracture seems to depend on the fracture fragment size and its amount of dislocation, but clear guidelines for daily practice are lacking. In this review, we summarize the literature on preferred treatment of the posterior fragment in trimalleolar fractures. A systematic review of publications between January 1995 and April 30 2017 on this topic in the PubMed, Embase, and Cochrane databases was performed according to the PRISMA statement. Seventeen (2 prospective and 15 retrospective) of the 180 identified studies were included. Six studies report on indications for fixation of posterior malleolus fracture fragments. Eleven studies compare different fixation approaches and techniques for the posterior fragment. Meta-analysis was not possible due to varying fixation criteria and outcomes. There was no clear association between posterior fragment size and functional outcome or development of osteoarthritis. The non-anatomical reduction of the fragment was of more influence on outcome. Radiological and functional outcome was better after open reduction and internal fixation via the posterolateral approach than after percutaneous anterior-to-posterior screw fixation. The posterior fragment size is not a clear indication for its fixation. A step-off, however, seems an important indicator for developing posttraumatic osteoarthritis and worse functional outcome. Posterior fragments involving the intra-articular surface need to be reduced and fixated to prevent postoperative persisting step-off. Furthermore, fixation of the posterior malleolus via an open posterolateral approach seems superior to percutaneous anterior-to-posterior fixation. However, these results need to be confirmed in a prospective comparative trial. Therapeutic level II.

Product analysis illuminates the final steps of IES deletion in Tetrahymena thermophila.

Science.gov (United States)

Saveliev, S V; Cox, M M

2001-06-15

DNA sequences (IES elements) eliminated from the developing macronucleus in the ciliate Tetrahymena thermophila are released as linear fragments, which have now been detected and isolated. A PCR-mediated examination of fragment end structures reveals three types of strand scission events, reflecting three steps in the deletion process. New evidence is provided for two steps proposed previously: an initiating double-stranded cleavage, and strand transfer to create a branched deletion intermediate. The fragment ends provide evidence for a previously uncharacterized third step: the branched DNA strand is cleaved at one of several defined sites located within 15-16 nucleotides of the IES boundary, liberating the deleted DNA in a linear form.

Surface complement C3 fragments and cellular binding of microparticles in patients with SLE

DEFF Research Database (Denmark)

Winberg, Line Kjær; Nielsen, Claus Henrik; Jacobsen, Søren

2017-01-01

Objectives: To examine microparticles (MPs) from patients with SLE and healthy controls (HCs) by determining the cellular origin of the MPs, quantifying attached fragments of complement component 3 (C3) and assessing the ability of MPs to bind to circulating phagocytes and erythrocytes. These fea......Objectives: To examine microparticles (MPs) from patients with SLE and healthy controls (HCs) by determining the cellular origin of the MPs, quantifying attached fragments of complement component 3 (C3) and assessing the ability of MPs to bind to circulating phagocytes and erythrocytes...

Simulations of High Speed Fragment Trajectories

Science.gov (United States)

Yeh, Peter; Attaway, Stephen; Arunajatesan, Srinivasan; Fisher, Travis

2017-11-01

Flying shrapnel from an explosion are capable of traveling at supersonic speeds and distances much farther than expected due to aerodynamic interactions. Predicting the trajectories and stable tumbling modes of arbitrary shaped fragments is a fundamental problem applicable to range safety calculations, damage assessment, and military technology. Traditional approaches rely on characterizing fragment flight using a single drag coefficient, which may be inaccurate for fragments with large aspect ratios. In our work we develop a procedure to simulate trajectories of arbitrary shaped fragments with higher fidelity using high performance computing. We employ a two-step approach in which the force and moment coefficients are first computed as a function of orientation using compressible computational fluid dynamics. The force and moment data are then input into a six-degree-of-freedom rigid body dynamics solver to integrate trajectories in time. Results of these high fidelity simulations allow us to further understand the flight dynamics and tumbling modes of a single fragment. Furthermore, we use these results to determine the validity and uncertainty of inexpensive methods such as the single drag coefficient model.

Fine-scale movement decisions of tropical forest birds in a fragmented landscape.

Science.gov (United States)

Gillies, Cameron S; Beyer, Hawthorne L; St Clair, Colleen Cassady

2011-04-01

The persistence of forest-dependent species in fragmented landscapes is fundamentally linked to the movement of individuals among subpopulations. The paths taken by dispersing individuals can be considered a series of steps built from individual route choices. Despite the importance of these fine-scale movement decisions, it has proved difficult to collect such data that reveal how forest birds move in novel landscapes. We collected unprecedented route information about the movement of translocated forest birds from two species in the highly fragmented tropical dry forest of Costa Rica. In this pasture-dominated landscape, forest remains in patches or riparian corridors, with lesser amounts of living fencerows and individual trees or "stepping stones." We used step selection functions to quantify how route choice was influenced by these habitat elements. We found that the amount of risk these birds were willing to take by crossing open habitat was context dependent. The forest-specialist Barred Antshrike (Thamnophilus doliatus) exhibited stronger selection for forested routes when moving in novel landscapes distant from its territory relative to locations closer to its territory. It also selected forested routes when its step originated in forest habitat. It preferred steps ending in stepping stones when the available routes had little forest cover, but avoided them when routes had greater forest cover. The forest-generalist Rufous-naped Wren (Campylorhynchus rufinucha) preferred steps that contained more pasture, but only when starting from non-forest habitats. Our results showed that forested corridors (i.e., riparian corridors) best facilitated the movement of a sensitive forest specialist through this fragmented landscape. They also suggested that stepping stones can be important in highly fragmented forests with little remaining forest cover. We expect that naturally dispersing birds and species with greater forest dependence would exhibit even stronger

HIERARCHICAL FRAGMENTATION OF THE ORION MOLECULAR FILAMENTS

International Nuclear Information System (INIS)

Takahashi, Satoko; Ho, Paul T. P.; Su, Yu-Nung; Teixeira, Paula S.; Zapata, Luis A.

2013-01-01

We present a high angular resolution map of the 850 μm continuum emission of the Orion Molecular Cloud-3 (OMC 3) obtained with the Submillimeter Array (SMA); the map is a mosaic of 85 pointings covering an approximate area of 6.'5 × 2.'0 (0.88 × 0.27 pc). We detect 12 spatially resolved continuum sources, each with an H 2 mass between 0.3-5.7 M ☉ and a projected source size between 1400-8200 AU. All the detected sources are on the filamentary main ridge (n H 2 ≥10 6 cm –3 ), and analysis based on the Jeans theorem suggests that they are most likely gravitationally unstable. Comparison of multi-wavelength data sets indicates that of the continuum sources, 6/12 (50%) are associated with molecular outflows, 8/12 (67%) are associated with infrared sources, and 3/12 (25%) are associated with ionized jets. The evolutionary status of these sources ranges from prestellar cores to protostar phase, confirming that OMC-3 is an active region with ongoing embedded star formation. We detect quasi-periodical separations between the OMC-3 sources of ≈17''/0.035 pc. This spatial distribution is part of a large hierarchical structure that also includes fragmentation scales of giant molecular cloud (≈35 pc), large-scale clumps (≈1.3 pc), and small-scale clumps (≈0.3 pc), suggesting that hierarchical fragmentation operates within the Orion A molecular cloud. The fragmentation spacings are roughly consistent with the thermal fragmentation length in large-scale clumps, while for small-scale cores it is smaller than the local fragmentation length. These smaller spacings observed with the SMA can be explained by either a helical magnetic field, cloud rotation, or/and global filament collapse. Finally, possible evidence for sequential fragmentation is suggested in the northern part of the OMC-3 filament.

Restricted fragmentation of poliovirus type 1, 2, and 3 RNAs by ribonuclease III

Energy Technology Data Exchange (ETDEWEB)

Nomoto, A. (State Univ. of New York, Stony Brook); Lee, Y.F.; Babich, A.; Jacobson, A.; Dunn, J.J.; Wimmer, E.

1979-01-01

Cleavage of the genome RNAs of poliovirus type 1, 2, and 3 with the ribonuclease III of Escherichia coli has been investigated with the following results: (1) at or above physiological salt concentration, the RNAs are completely resistant to the action of the enzyme, an observation suggesting that the RNAs lack primary cleavage sites; (2) lowering the salt concentration to 0.1 M or below allows RNase III to cleave the RNAs at secondary sites. Both large and small fragments can be obtained in a reproducible manner depending on salt conditions chosen for cleavage. Fingerprints of three large fragments of poliovirus type 2 RNA show that they originate from unique segments and represent most if not all sequences of the genome. Based upon binding to poly(U) filters of poly(A)-linked fragments, a physical map of the large fragments of poliovirus type 2 RNA was constructed. The data suggest that RNase III cleavage of single-stranded RNA provides a useful method to fragment the RNA for further studies.

Continuous versus step-by-step scanning mode of a novel 3D scanner for CyberKnife measurements

International Nuclear Information System (INIS)

Al Kafi, M Abdullah; Mwidu, Umar; Moftah, Belal

2015-01-01

The purpose of the study is to investigate the continuous versus step-by-step scanning mode of a commercial circular 3D scanner for commissioning measurements of a robotic stereotactic radiosurgery system. The 3D scanner was used for profile measurements in step-by-step and continuous modes with the intent of comparing the two scanning modes for consistency. The profile measurements of in-plane, cross-plane, 15 degree, and 105 degree were performed for both fixed cones and Iris collimators at depth of maximum dose and at 10 cm depth. For CyberKnife field size, penumbra, flatness and symmetry analysis, it was observed that the measurements with continuous mode, which can be up to 6 times faster than step-by-step mode, are comparable and produce scans nearly identical to step-by-step mode. When compared with centered step-by-step mode data, a fully processed continuous mode data gives rise to maximum of 0.50% and 0.60% symmetry and flatness difference respectfully for all the fixed cones and Iris collimators studied. - Highlights: • D scanner for CyberKnife beam data measurements. • Beam data analysis for continuous and step-by-step scan modes. • Faster continuous scanning data are comparable to step-by-step mode scan data.

Step-by-step guide to building an inexpensive 3D printed motorized positioning stage for automated high-content screening microscopy.

Science.gov (United States)

Schneidereit, Dominik; Kraus, Larissa; Meier, Jochen C; Friedrich, Oliver; Gilbert, Daniel F

2017-06-15

High-content screening microscopy relies on automation infrastructure that is typically proprietary, non-customizable, costly and requires a high level of skill to use and maintain. The increasing availability of rapid prototyping technology makes it possible to quickly engineer alternatives to conventional automation infrastructure that are low-cost and user-friendly. Here, we describe a 3D printed inexpensive open source and scalable motorized positioning stage for automated high-content screening microscopy and provide detailed step-by-step instructions to re-building the device, including a comprehensive parts list, 3D design files in STEP (Standard for the Exchange of Product model data) and STL (Standard Tessellation Language) format, electronic circuits and wiring diagrams as well as software code. System assembly including 3D printing requires approx. 30h. The fully assembled device is light-weight (1.1kg), small (33×20×8cm) and extremely low-cost (approx. EUR 250). We describe positioning characteristics of the stage, including spatial resolution, accuracy and repeatability, compare imaging data generated with our device to data obtained using a commercially available microplate reader, demonstrate its suitability to high-content microscopy in 96-well high-throughput screening format and validate its applicability to automated functional Cl - - and Ca 2+ -imaging with recombinant HEK293 cells as a model system. A time-lapse video of the stage during operation and as part of a custom assembled screening robot can be found at https://vimeo.com/158813199. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Recombinant Kinase Production and Fragment Screening by NMR Spectroscopy.

Science.gov (United States)

Han, Byeonggu; Ahn, Hee-Chul

2016-01-01

During the past decade fragment-based drug discovery (FBDD) has rapidly evolved and several drugs or drug candidates developed by FBDD approach are clinically in use or in clinical trials. For example, vemurafenib, a V600E mutated BRAF inhibitor, was developed by utilizing FBDD approach and approved by FDA in 2011. In FBDD, screening of fragments is the starting step for identification of hits and lead generation. Fragment screening usually relies on biophysical techniques by which the protein-bound small molecules can be detected. NMR spectroscopy has been extensively used to study the molecular interaction between the protein and the ligand, and has many advantages in fragment screening over other biophysical techniques. This chapter describes the practical aspects of fragment screening by saturation transfer difference NMR.

NMR-Fragment Based Virtual Screening: A Brief Overview.

Science.gov (United States)

Singh, Meenakshi; Tam, Benjamin; Akabayov, Barak

2018-01-25

Fragment-based drug discovery (FBDD) using NMR has become a central approach over the last twenty years for development of small molecule inhibitors against biological macromolecules, to control a variety of cellular processes. Yet, several considerations should be taken into account for obtaining a therapeutically relevant agent. In this review, we aim to list the considerations that make NMR fragment screening a successful process for yielding potent inhibitors. Factors that may govern the competence of NMR in fragment based drug discovery are discussed, as well as later steps that involve optimization of hits obtained by NMR-FBDD.

NMR-Fragment Based Virtual Screening: A Brief Overview

Directory of Open Access Journals (Sweden)

Meenakshi Singh

2018-01-01

Full Text Available Fragment-based drug discovery (FBDD using NMR has become a central approach over the last twenty years for development of small molecule inhibitors against biological macromolecules, to control a variety of cellular processes. Yet, several considerations should be taken into account for obtaining a therapeutically relevant agent. In this review, we aim to list the considerations that make NMR fragment screening a successful process for yielding potent inhibitors. Factors that may govern the competence of NMR in fragment based drug discovery are discussed, as well as later steps that involve optimization of hits obtained by NMR-FBDD.

Structures of endothiapepsin-fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library.

Science.gov (United States)

Huschmann, Franziska U; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S; Mueller, Uwe

2016-05-01

Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein-ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin-fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity.

Structures of endothiapepsin–fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library

Science.gov (United States)

Huschmann, Franziska U.; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S.; Mueller, Uwe

2016-01-01

Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein–ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin–fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity. PMID:27139825

Efficient One-Step Fusion PCR Based on Dual-Asymmetric Primers and Two-Step Annealing

DEFF Research Database (Denmark)

Liu, Yilan; Chen, Jinjin; Thygesen, Anders

2018-01-01

Gene splicing by fusion PCR is a versatile and widely used methodology, especially in synthetic biology. We here describe a rapid method for splicing two fragments by one-round fusion PCR with a dual-asymmetric primers and two-step annealing (ODT) method. During the process, the asymmetric...... intermediate fragments were generated in the early stage. Thereafter, they were hybridized in the subsequent cycles to serve as template for the target full-length product. The process parameters such as primer ratio, elongation temperature and cycle numbers were optimized. In addition, the fusion products...

Towards the total synthesis of stawamycin. Synthesis of C11-C21 fragment.

OpenAIRE

Dias, LC; Jardim, LSA; Ferreira, AA; Soarez, HU

2001-01-01

The carbocyclic (C11-C21) fragment of Stawamycin has been prepared by a sequence involving 11 steps (10% overall yield) from methyl (R)-(-)-3-hydroxy-2-methylpropionate. Key steps are Pd-catalyzed Stille coupling reaction between a vinyl iodide and a vinylstannane followed by an intramolecular Diels-Alder cycloaddition reaction to afford the desired adduct as the major isomer together with three other possible adducts in 78% overall yield. A porção carbocíclica (C11-C21) da Estavamicina fo...

Complex fragment emission from the 3He+natAg system between 0.48 and 3.6 GeV

International Nuclear Information System (INIS)

Yennello, S.J.; Kwiatkowski, K.; Fields, D.E.; Planeta, R.; Viola, V.E.; Indiana Univ., Bloomington; Pollacco, E.C.; Volant, C.; Dayras, R.; Legrain, R.; Casssagnou, Y.; Harar, S.; Hourani, E.

1990-01-01

The emission of complex fragments (3≤Z≤12) from reactions of 3 He with nat Ag has been studied at bombarding energies of E=480, 900, 1800, 2700 and 3600 MeV. Between 900 and 1800 MeV slopes of the fragment kinetic energy spectra at backward angles undergo a change in character, becoming much flatter; in addition, the Coulomb peak is found to broaden significantly and shift to lower energies. Power-law fits to the fragment charge distributions result in decreasing values of the exponent τ up to a bombarding energy of 1800 MeV; at this value and beyond, a constant value of τ=2.1±0.1 is observed. Elemental cross sections at the highest energy are found to increase by approximately two orders of magnitude relative to data near 100 MeV. The data suggest a change in reaction mechanism between incident energies of 900 and 1800 MeV. (orig.)

Singularities of production of the light fragments with A=2 and 3 in 16Op-interactions at 3.25 A GeV/s

International Nuclear Information System (INIS)

Olimov, K.; Lutpullaev, S.L.; Olimov, Kh.K.; Petrov, V.I.; Yuldashev, A.A.; Usarov, A.A.; Yuldashev, B.S.

2006-01-01

Full text: The process of formation of the secondary nuclei is influenced by the complex superposition of several mechanisms of interactions of the proton with 16 O nucleons and the production of the quasi-free few-nucleon associations, since its details are connected to the isotope singularities of fragments, the final state interactions, and finally, the non-direct, but the cascade character of the fragment origination. The investigation of formation of the light fragments (p, d, t, 3 He 2 , and 4 He 2 ) at nucleus fragmentation allows one to obtain the more detailed information on mechanisms of production of the final products of reaction, rather than the heavier fragments (A≥5), due to the following reasons. Firstly, the cross section of formation of light fragments is comparable to that of the total inelastic interactions of the considered reaction. Secondly, these particles can be produced both in the initial stage of hadron-nucleus collisions and in the final stage of interactions. Contrary to that, the heavier fragments may 'forget' their origination, being formed at peripheral or non-peripheral interactions of colliding nuclei, and do not contain the useful information on dynamics of the initial act of the interaction. The present work contains the intermediate results on investigations of processes of the oxygen fragmentation in interactions with protons at 3.25 A GeV/s and is devoted to the study of inclusive cross sections of formation of 3 H 1 , 3 He 2 , and 4 He 2 nuclei at different topological channels of the initial nucleus decay and identification of mechanisms of production of the few-nucleon nuclei based on the experimental material consisting of 13759 measured 16 Op-events. The momentum spectra of the formed deuterons were investigated, and their multiplicities and inclusive cross sections determined. It is shown, that in formation of the deuterons flying back, the main contribution comes from the 'evaporation' process and the Fermi

Identifying Interactions that Determine Fragment Binding at Protein Hotspots.

Science.gov (United States)

Radoux, Chris J; Olsson, Tjelvar S G; Pitt, Will R; Groom, Colin R; Blundell, Tom L

2016-05-12

Locating a ligand-binding site is an important first step in structure-guided drug discovery, but current methods do little to suggest which interactions within a pocket are the most important for binding. Here we illustrate a method that samples atomic hotspots with simple molecular probes to produce fragment hotspot maps. These maps specifically highlight fragment-binding sites and their corresponding pharmacophores. For ligand-bound structures, they provide an intuitive visual guide within the binding site, directing medicinal chemists where to grow the molecule and alerting them to suboptimal interactions within the original hit. The fragment hotspot map calculation is validated using experimental binding positions of 21 fragments and subsequent lead molecules. The ligands are found in high scoring areas of the fragment hotspot maps, with fragment atoms having a median percentage rank of 97%. Protein kinase B and pantothenate synthetase are examined in detail. In each case, the fragment hotspot maps are able to rationalize a Free-Wilson analysis of SAR data from a fragment-based drug design project.

Inner-shell excitation and site specific fragmentation of poly(methylmethacrylate) thin film

Science.gov (United States)

Tinone, Marcia C. K.; Tanaka, Kenichiro; Maruyama, Junya; Ueno, Nobuo; Imamura, Motoyasu; Matsubayashi, Nobuyuki

1994-04-01

Soft x-ray excitations in the 250-600 eV photon energy range on poly(methylmethacrylate) (PMMA) result in ionic fragmentation of the original polymer with the most intense ions corresponding to CH+3, H+, CH+2, CH+, CHO+, and COOCH+3. The photon energy dependence of ion desorption from thin films of PMMA was measured to investigate the primary steps in radiation induced decomposition following carbon and oxygen 1s electron excitations using monochromatic pulsed-synchrotron radiation. It was clearly found that the decomposition depends on the nature of the electronic states created in the excited species. The fragmentation pattern changes depending on the transitions of the 1s electron to a Rydberg orbital, an unoccupied molecular orbital or the ionization continuum. Moreover, the fragmentation occurs specifically around the site of the atom where the optical excitation takes place. Excitations from carbon and oxygen 1s to σ* states seem to be specially efficient for ion production as observed in the case of CH+3, CH+2, and CH+ at 288.7 and 535.6 eV, and in the case of CHO+ at 539.3 eV.

Continuous fragment of the mu-calculus

NARCIS (Netherlands)

Fontaine, G.

2008-01-01

In this paper we investigate the Scott continuous fragment of the modal μ-calculus. We discuss its relation with constructivity, where we call a formula constructive if its least fixpoint is always reached in at most ω steps. Our main result is a syntactic characterization of this continuous

Developments in SPR Fragment Screening.

Science.gov (United States)

Chavanieu, Alain; Pugnière, Martine

2016-01-01

Fragment-based approaches have played an increasing role alongside high-throughput screening in drug discovery for 15 years. The label-free biosensor technology based on surface plasmon resonance (SPR) is now sensitive and informative enough to serve during primary screens and validation steps. In this review, the authors discuss the role of SPR in fragment screening. After a brief description of the underlying principles of the technique and main device developments, they evaluate the advantages and adaptations of SPR for fragment-based drug discovery. SPR can also be applied to challenging targets such as membrane receptors and enzymes. The high-level of immobilization of the protein target and its stability are key points for a relevant screening that can be optimized using oriented immobilized proteins and regenerable sensors. Furthermore, to decrease the rate of false negatives, a selectivity test may be performed in parallel on the main target bearing the binding site mutated or blocked with a low-off-rate ligand. Fragment-based drug design, integrated in a rational workflow led by SPR, will thus have a predominant role for the next wave of drug discovery which could be greatly enhanced by new improvements in SPR devices.

Exact Solutions of Fragmentation Equations with General Fragmentation Rates and Separable Particles Distribution Kernels

Directory of Open Access Journals (Sweden)

S. C. Oukouomi Noutchie

2014-01-01

Full Text Available We make use of Laplace transform techniques and the method of characteristics to solve fragmentation equations explicitly. Our result is a breakthrough in the analysis of pure fragmentation equations as this is the first instance where an exact solution is provided for the fragmentation evolution equation with general fragmentation rates. This paper is the key for resolving most of the open problems in fragmentation theory including “shattering” and the sudden appearance of infinitely many particles in some systems with initial finite particles number.

ACE-SWICS In Situ Plasma Composition of Fragmented Comet 73P/Schwassmann-Wachmann 3

Science.gov (United States)

Gilbert, J. A.; Lepri, S. T.; Rubin, M.; Zurbuchen, T.

2013-12-01

The interiors of comets contain some of the most pristine material in the solar system. Comet 73P/Schwassmann-Wachmann 3, discovered in 1930 with a double nucleus, is a Jupiter-family comet with a 5.34-year period. This comet split into 5 fragments in 1995 and disintegrated into nearly 70 pieces in 2006. In May and June of 2006, recently ionized cometary particles originating from some of these fragments were collected with the ACE-SWICS sensor. Due to a combination of the close proximity of the fragments passing between ACE-SWICS and the Sun, and the instrument characteristics, unique measurements regarding the charge state composition and the elemental abundances of both cometary and heliospheric plasma were made during this time. The cometary material released from some of these fragments can be identified by the concentrations of water-group pick-up ions having a mass-per-charge of 16-18 amu/e. With a focus on Helium, Carbon, and water-group ions, we present an analysis of the cometary plasma. Charge state ratios of C+/O+ fall below 0.1 during detection of comet fragment plasma, and there is a clear increase in He+ during fragment crossings. The C/O ratio and He charge states are used to provide constraints on the activity of the cometary fragments and also the spatial distribution of the extended and ionized cometary tail.

3D imaging of vesicles in hyaloclastic fragments - clues to syn-eruptive shear conditions

Science.gov (United States)

Helo, C.; Flaws, A.; Hess, K.; Franz, A.; Clague, D. A.; Dingwell, D. B.

2011-12-01

3D imaging of stretched vesicles in hyaloclastic fragments has been used to investigate the shear environment of mild pyroclastic eruptions at mid-ocean ridges. X-ray computed tomography offers an attractive non-invasive method to investigate geomaterials at a high resolution for the geometry of the different phases. In this study, we have imaged vesicles within two types of basaltic glass fragments. Stretched, ellipsoid-shaped vesicles in thin limu o Pele and tubular vesicles in a pumiceous fragment. Both types originate from pyroclastic activity on Axial Seamount, Juan de Fuca ridge. Rapid quenching of the glass has prevented extensive bubble relaxation and information about syn-eruptive shear and differential stress conditions is stored, as the dimensions of a stretched bubble directly relates to the extent and mode of shearing. The X-ray tomography data was processed using a set of codes based on edge detection and ellipsoid fitting to acquire quantitative information on the shape of the stretched vesicles. Preliminary results demonstrate, that the geometry of the stretched vesicles, e.g., the elongation of the vesicle with respect to the calculated undeformed radius, is in accordance with simple shear scenarios. Stored differential stress ranges from 5 kPa to 90 kPa with shear rates between 3.2x102 s-1 and 5.7x3 s-1 within a single limu o Pele fragment. This range may be explained by either variable time available for relaxation as the cooling front proceeds through the fragment, complex interplay in space and time between fragmentation and quenching, bubble clusters mutually inhibiting each others extend of deformation, or any combination of these. Bubble relaxation time scales are less then 0.005 s providing constraints on the timeframe for cooling to the glass transition. Qualitative analyses of the tube pumice indicates that the tubular structures grow in length by coalescence of vertically aligned ellipsoid-shaped vesicles, and in width by coalescence of

Ionic fragmentation following core-level photoionization of Sn(CH3)4 by soft X-rays

International Nuclear Information System (INIS)

Ueda, Kiyoshi; Shigemasa, Eiji; Sato, Yukinori; Yagishita, Akira; Hayaishi, Tatsuji

1990-01-01

Ionic fragmentation following the photoionization of Sn(CH 3 ) 4 (TMT) has been studied in the photon energy range of 60-600 eV using synchrotron radiation and time-of-flight mass spectrometry. Each of the Sn:4d, 4p, 3d and C:1s photoionization leads to a type of ionic fragmentation that is characteristic of each ionized core. The Sn:4d photoionization above 60 eV predominantly produces the doubly-charged TMT which dissociates into two singly-charged ions and some neutral fragments. The ions produced in this pathway are CH 3 + , C 2 H 3 + , C 2 H 5 + , SnCH m + and/or Sn + . The Sn:4p photoionization produces the triply-charged TMT and enhances the production of H + , CHsub(m' + ) (m' = 0-3) and Sn + significantly. The Sn:3d photoionization produces multiply-charged TMT whose charges are 3-5 and enhances the production of H + , CHsub(m' + ) (m' = 0-2) and Sn + significantly. The C:1s photoionization produces doubly-charged TMT via the KVV Auger transition and enhances the production of CH 3 + , C 2 H 3 + , SnCH m + and/or Sn + . (orig.)

Molecular markers. Amplified fragment length polymorphism

Directory of Open Access Journals (Sweden)

Pržulj Novo

2005-01-01

Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

Intermediate surface structure between step bunching and step flow in SrRuO3 thin film growth

Science.gov (United States)

Bertino, Giulia; Gura, Anna; Dawber, Matthew

We performed a systematic study of SrRuO3 thin films grown on TiO2 terminated SrTiO3 substrates using off-axis magnetron sputtering. We investigated the step bunching formation and the evolution of the SRO film morphology by varying the step size of the substrate, the growth temperature and the film thickness. The thin films were characterized using Atomic Force Microscopy and X-Ray Diffraction. We identified single and multiple step bunching and step flow growth regimes as a function of the growth parameters. Also, we clearly observe a stronger influence of the step size of the substrate on the evolution of the SRO film surface with respect to the other growth parameters. Remarkably, we observe the formation of a smooth, regular and uniform ``fish skin'' structure at the transition between one regime and another. We believe that the fish skin structure results from the merging of 2D flat islands predicted by previous models. The direct observation of this transition structure allows us to better understand how and when step bunching develops in the growth of SrRuO3 thin films.

Designer genes. Recombinant antibody fragments for biological imaging

Energy Technology Data Exchange (ETDEWEB)

Wu, A.M.; Yazaki, P.J. [Beckman Research Institute of the City of Hope, Duarte, CA (United States). Dept. of Molecular Biology

2000-09-01

Monoclonal antibodies (MAbs), with high specificity and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C{sub H}3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering

Designer genes. Recombinant antibody fragments for biological imaging

International Nuclear Information System (INIS)

Wu, A.M.; Yazaki, P.J.

2000-01-01

Monoclonal antibodies (MAbs), with high specificy and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C H 3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering and

Multiple H3+ fragment production in single collision of fast Hn+ clusters with He atoms

International Nuclear Information System (INIS)

Farizon, B.; Farizon, M.; Gaillard, M.J.; Gerlic, E.; Ouaskit, S.

1994-09-01

The production of H 3 + ions resulting from single collisions of mass-selected ionic hydrogen clusters, H n + (n=9,25,31), with helium at high velocity (1.55 times the Bohr velocity) has been studied. A strong double H 3 + ion production resulting from one incident cluster is observed. Moreover, evidence for a triple H 3 + fragment production is presented for n=25 and 31. Thus, in this energy range, the collision gives rise to multifragmentation processes. The formation of H 3 + ions takes place in the fragmentation of the multicharged cluster resulting from the collision. (authors)

Anatomy and classification of the posterior tibial fragment in ankle fractures.

Science.gov (United States)

Bartoníček, Jan; Rammelt, Stefan; Kostlivý, Karel; Vaněček, Václav; Klika, Daniel; Trešl, Ivo

2015-04-01

The aim of this study was to analyze the pathoanatomy of the posterior fragment on the basis of a comprehensive CT examination, including 3D reconstructions, in a large patient cohort. One hundred and forty one consecutive individuals with an ankle fracture or fracture-dislocation of types Weber B or Weber C and evidence of a posterior tibial fragment in standard radiographs were included in the study. The mean patient age was 49 years (range 19-83 years). The exclusion criteria were patients below 18 years of age, inability to provide written consent, fractures of the tibial pilon, posttraumatic arthritis and pre-existing deformities. In all patients, post-injury radiographs were obtained in anteroposterior, mortise and lateral views. All patients underwent CT scanning in transverse, sagittal and frontal planes. 3D CT reconstruction was performed in 91 patients. We were able to classify 137 cases into one of the following four types with constant pathoanatomic features: type 1: extraincisural fragment with an intact fibular notch, type 2: posterolateral fragment extending into the fibular notch, type 3: posteromedial two-part fragment involving the medial malleolus, type 4: large posterolateral triangular fragment. In the 4 cases it was not possible to classify the type of the posterior tibial fragment. These were collectively termed type 5 (irregular, osteoporotic fragments). It is impossible to assess the shape and size of the posterior malleolar fragment, involvement of the fibular notch, or the medial malleolus, on the basis of plain radiographs. The system that we propose for classification of fractures of the posterior malleolus is based on CT examination and takes into account the size, shape and location of the fragment, stability of the tibio-talar joint and the integrity of the fibular notch. It may be a useful indication for surgery and defining the most useful approach to these injuries.

Influence of fragment size and postoperative joint congruency on long-term outcome of posterior malleolar fractures.

Science.gov (United States)

Drijfhout van Hooff, Cornelis Christiaan; Verhage, Samuel Marinus; Hoogendoorn, Jochem Maarten

2015-06-01

One of the factors contributing to long-term outcome of posterior malleolar fractures is the development of osteoarthritis. Based on biomechanical, cadaveric, and small population studies, fixation of posterior malleolar fracture fragments (PMFFs) is usually performed when fragment size exceeds 25-33%. However, the influence of fragment size on long-term clinical and radiological outcome size remains unclear. A retrospective cohort study of 131 patients treated for an isolated ankle fracture with involvement of the posterior malleolus was performed. Mean follow-up was 6.9 (range, 2.5-15.9) years. Patients were divided into groups depending on size of the fragment, small (25%, n = 25), and presence of step-off after operative treatment. We have compared functional outcome measures (AOFAS, AAOS), pain (VAS), and dorsiflexion restriction compared to the contralateral ankle and the incidence of osteoarthritis on X-ray. There were no nonunions, 56% of patients had no radiographic osteoarthritis, VAS was 10 of 100, and median clinical score was 90 of 100. More osteoarthritis occurred in ankle fractures with medium and large PMFFs compared to small fragments (small 16%, medium 48%, large 54%; P = .006). Also when comparing small with medium-sized fragments (P = .02), larger fragment size did not lead to a significantly decreased function (median AOFAS 95 vs 88, P = .16). If the PMFF size was >5%, osteoarthritis occurred more frequently when there was a postoperative step-off ≥1 mm in the tibiotalar joint surface (41% vs 61%, P = .02) (whether the posterior fragment had been fixed or not). In this group, fixing the PMFF did not influence development of osteoarthritis. However, in 42% of the cases with fixation of the fragment a postoperative step-off remained (vs 45% in the group without fixation). Osteoarthritis is 1 component of long-term outcome of malleolar fractures, and the results of this study demonstrate that there was more radiographic osteoarthritis in

Protein-Templated Fragment Ligations-From Molecular Recognition to Drug Discovery.

Science.gov (United States)

Jaegle, Mike; Wong, Ee Lin; Tauber, Carolin; Nawrotzky, Eric; Arkona, Christoph; Rademann, Jörg

2017-06-19

Protein-templated fragment ligation is a novel concept to support drug discovery and can help to improve the efficacy of protein ligands. Protein-templated fragment ligations are chemical reactions between small molecules ("fragments") utilizing a protein's surface as a reaction vessel to catalyze the formation of a protein ligand with increased binding affinity. The approach exploits the molecular recognition of reactive small-molecule fragments by proteins both for ligand assembly and for the identification of bioactive fragment combinations. In this way, chemical synthesis and bioassay are integrated in one single step. This Review discusses the biophysical basis of reversible and irreversible fragment ligations and gives an overview of the available methods to detect protein-templated ligation products. The chemical scope and recent applications as well as future potential of the concept in drug discovery are reviewed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Rapid synthesis of the A-E fragment of ciguatoxin CTX3C.

Science.gov (United States)

Clark, J Stephen; Conroy, Joanne; Blake, Alexander J

2007-05-24

The A-E fragment of the marine natural product CTX3C has been prepared in an efficient manner by using a strategy in which two-directional and iterative ring-closing metathesis (RCM) reactions were employed for ring construction.

Light particles emitted with very forward quasi-projectiles and the mechanism in the fragmentation of 44 MeV/a.m.u. 40Ar

International Nuclear Information System (INIS)

Roussel, P.; Bacri, Ch.O.; Borrel, V.; Stephan, C.; Tassan-Got, L.; Beaumel, D.; Bernas, M.; Clapier, F.; Mirea, M.

1998-01-01

The mechanism of projectile fragmentation in the Fermi-energy region has been investigated for fragments emitted in the incident beam direction by detecting fast protons and neutrons evaporated by the projectile-like fragments. The proton coincidence rate is shown to increase with fragment velocity loss. This increase is also correlated to the decrease of the fragment yield, with the coincident rate doubling when the yield decreases by a factor of 10. The coincidence rate is found to be also proportional to the fragment mass loss for fragments with the beam velocity. A two-step mechanism is sketched out to interpret these results. For fragments with the beam velocity, the projectile nucleon removal is equally shared between a first fast step and the second evaporative step, while for fragments at the tenth of the maximum yield, the nucleons are removed by evaporation. Finally, the experimental observation that the most probable velocity for forward fragments is very close to that of the beam may be the result of a strong forward/backward momentum asymmetry in a Goldhaber-type analysis. (author)

On correlation between multiplicities of different fragments and deuterons in 16Op-collisions at 3.25 A GeV/C

International Nuclear Information System (INIS)

Olimov, K.; Usarov, A.; Bazarov, E.; Karshiev, D.; Fazylov, M.I.; Yuldashev, B.S.

2004-01-01

Full text: Production of light fragments is characteristical for nucleus fragmentation phenomenon. Therefore, it is impossible to understand this phenomenon without identifying a production mechanism of these particles. One can have useful information on deuterons formation dynamics by studying correlations between different fragments multiplicities. Thus, this work is dedicated to study of correlations between multiplicities of different fragments in 16 Op-events with deuteron and without. The experimental material was obtained from 1-meter hydrogen bubble chamber in HEL JINR irradiated by 16 O nuclei beam at momentum of 3,25 GeV/C. Methodological questions related to stereo graphs processing, particle and nuclei identification are described in works [1,2]. The results presented below are obtained based on an analysis of 11098 measured 16 Op events. Experimental results on correlations between multiplicities of different fragments and presence (absence) of deuterons in 16 Op-events are compared with data calculated by cascade-fragmentation evaporation model (CFEM) [3]. In frames of CFEM [3] the main mechanism of fragments production is Fermi break-up. Contribution of 'evaporative mechanism' to light fragments production can be neglected for fragmentation of such light nucleus as 16 O. Experimental values for average multiplicities of light fragments ( 1 H 1 , 3 H 1 , 3 He 2 and 4 He 2 ) in events with deuteron and without demonstrate their dependence on presence of deuteron. Appearance of 1 H 1 and 4 He 2 in events with deuterons is ∼1,75 times higher that that without deuteron; whereas for mirror nuclei 3 H 1 and 3 He 2 this difference is more than ∼2,7 times higher. Notice, average multiplicities of these mirror nuclei within statistical errors are in coincidence with each other independently of presence or absence of deuteron in this event. In CFEM, correlations between average multiplicities of fragments and presence of deuteron in the event are observed

Selective disulfide reduction for labeling and enhancement of Fab antibody fragments

International Nuclear Information System (INIS)

Kirley, Terence L.; Greis, Kenneth D.; Norman, Andrew B.

2016-01-01

Many methods have been developed for chemical labeling and enhancement of the properties of antibodies and their common fragments, including the Fab and F(ab’) 2 fragments. Somewhat selective reduction of some antibody disulfide bonds has been previously achieved, yielding antibodies and antibody fragments that can be labeled at defined sites, enhancing their utility and properties. Selective reduction of the two hinge disulfide bonds present in F(ab’) 2 fragments using mild reduction has been useful. However, such reduction is often not quantitative and results in the reduction of multiple disulfide bonds, and therefore subsequent multiple labeling or conjugation sites are neither homogenous nor stoichiometric. Here, a simple and efficient selective reduction of the single disulfide bond linking the partial heavy chain and the intact light chain which compose the Fab fragment is accomplished utilizing tris(2-carboxyethyl)phosphine (TCEP) immobilized on agarose beads. The resultant reduced cysteine residues were labeled with several cysteine-selective fluorescent reagents, as well as by cysteine-directed PEGylation. These two cysteine residues can also be re-ligated by means of a bifunctional cysteine cross-linking agent, dibromobimane, thereby both restoring a covalent linkage between the heavy and light chains at this site, far removed from the antigen binding site, and also introducing a fluorescent probe. There are many other research and clinical uses for these selectively partially reduced Fab fragments, including biotinylation, toxin and drug conjugation, and incorporation of radioisotopes, and this technique enables simple generation of very useful Fab fragment derivatives with many potential applications. - Highlights: • TCEP agarose is effective for selective reduction of a single Fab disulfide bond. • This disulfide is solvent accessible and distant from the antigen binding site. • A variety of buffers of varying pHs can be used, simplifying

Papain cleavage of the 38,000-dalton fragment inhibits the binding of 4, 4'-diisothiocyanostilbene-2, 2'-disulfonate to lys-539 on the 60,000-dalton fragment in human band 3.

Science.gov (United States)

Yamaguchi, Takeo; Kojima, Hideaki; Kawaguchi, Shiori; Shimada, Maiko; Aso, Haruka

2017-08-01

Human band 3 is a 98-kDa transmembrane (TM) protein comprising 14 TM segments. Papain cleavages band 3 into 38- and 60-kDa fragments. Under vigorous conditions, the cleavage of the loop region between the TM 7 of gate domain and the TM 8 of core domain in the 38-kDa fragment produces 7- and 31-kDa fragments. Conformational changes of the TM 5 segment containing Lys-539 by cleavage of the 38-kDa fragment remain unclear. Pressure-induced haemolysis of erythrocytes was suppressed by binding of 4, 4'-diisothiocyanostilbene-2, 2'-disulfonate (DIDS) to Lys-539. Such effect of DIDS was not observed upon cleavage of the 38-kDa fragment, because of inhibition of DIDS binding to Lys-539. Using fluorescence of DIDS labelled to Lys-539, conformational changes of band 3 were examined. Fluorescence spectra demonstrated that the molecular motion of DIDS is more restricted upon digestion of the 38-kDa fragment. Interestingly, the quenching of DIDS fluorescence showed that Hg2+ is less accessible to DIDS upon digestion of the 38-kDa fragment. Taken together, we propose that the conformational changes of the TM 5 segment characterized by the sequestration and restricted motion of Lys-539 are induced by the cleavage of the loop region between the TM 7 and the TM 8. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

Analytical Core Mass Function (CMF) from Filaments: Under Which Circumstances Can Filament Fragmentation Reproduce the CMF?

Energy Technology Data Exchange (ETDEWEB)

Lee, Yueh-Ning; Hennebelle, Patrick [IRFU, CEA, Université Paris-Saclay, F-91191 Gif-sur-Yvette (France); Chabrier, Gilles, E-mail: yueh-ning.lee@cea.fr [École normale supérieure de Lyon, CRAL, UMR CNRS 5574, Université de Lyon, F-69364 Lyon Cedex 07 (France)

2017-10-01

Observations suggest that star formation in filamentary molecular clouds occurs in a two-step process, with the formation of filaments preceding that of prestellar cores and stars. Here, we apply the gravoturbulent fragmentation theory of Hennebelle and Chabrier to a filamentary environment, taking into account magnetic support. We discuss the induced geometrical effect on the cores, with a transition from 3D geometry at small scales to 1D at large ones. The model predicts the fragmentation behavior of a filament for a given mass per unit length (MpL) and level of magnetization. This core mass function (CMF) for individual filaments is then convolved with the distribution of filaments to obtain the final system CMF. The model yields two major results. (i) The filamentary geometry naturally induces a hierarchical fragmentation process, first into groups of cores, separated by a length equal to a few filament Jeans lengths, i.e., a few times the filament width. These groups then fragment into individual cores. (ii) Non-magnetized filaments with high MpL are found to fragment excessively, at odds with observations. This is resolved by taking into account the magnetic field (treated simply as additional pressure support). The present theory suggests two complementary modes of star formation: although small (spherical or filamentary) structures will collapse directly into prestellar cores, according to the standard Hennebelle–Chabrier theory, the large (filamentary) ones, the dominant population according to observations, will follow the aforedescribed two-step process.

A Pragmatic Randomized Controlled Trial of 6-Step vs 3-Step Hand Hygiene Technique in Acute Hospital Care in the United Kingdom.

Science.gov (United States)

Reilly, Jacqui S; Price, Lesley; Lang, Sue; Robertson, Chris; Cheater, Francine; Skinner, Kirsty; Chow, Angela

2016-06-01

OBJECTIVE To evaluate the microbiologic effectiveness of the World Health Organization's 6-step and the Centers for Disease Control and Prevention's 3-step hand hygiene techniques using alcohol-based handrub. DESIGN A parallel group randomized controlled trial. SETTING An acute care inner-city teaching hospital (Glasgow). PARTICIPANTS Doctors (n=42) and nurses (n=78) undertaking direct patient care. INTERVENTION Random 1:1 allocation of the 6-step (n=60) or the 3-step (n=60) technique. RESULTS The 6-step technique was microbiologically more effective at reducing the median log10 bacterial count. The 6-step technique reduced the count from 3.28 CFU/mL (95% CI, 3.11-3.38 CFU/mL) to 2.58 CFU/mL (2.08-2.93 CFU/mL), whereas the 3-step reduced it from 3.08 CFU/mL (2.977-3.27 CFU/mL) to 2.88 CFU/mL (-2.58 to 3.15 CFU/mL) (P=.02). However, the 6-step technique did not increase the total hand coverage area (98.8% vs 99.0%, P=.15) and required 15% (95% CI, 6%-24%) more time (42.50 seconds vs 35.0 seconds, P=.002). Total hand coverage was not related to the reduction in bacterial count. CONCLUSIONS Two techniques for hand hygiene using alcohol-based handrub are promoted in international guidance, the 6-step by the World Health Organization and 3-step by the Centers for Disease Control and Prevention. The study provides the first evidence in a randomized controlled trial that the 6-step technique is superior, thus these international guidance documents should consider this evidence, as should healthcare organizations using the 3-step technique in practice. Infect Control Hosp Epidemiol 2016;37:661-666.

Studies on the Total Synthesis of Amphidinolide O (II): A Stereoselective Synthesis of C1-C11 Fragment

Energy Technology Data Exchange (ETDEWEB)

Jang, Mi Yeon; Kim, Jong Woo; Lee, Duck Hyung [Sogang University, Seoul (Korea, Republic of)

2005-10-15

Two ketones and, the C1-C11 fragment of Amphidinolide O, were prepared stereoselectively via 14 and 16 step sequences in 8.7% and 2.0% overall yield, respectively. The amphidinolides were isolated from the marine dinoflagellate Amphidinium sp., which produces a host of secondary metabolites endowed with potent cytotoxicity against various cancer cell lines. Amphidinolide O displayed potent in vitro cytotoxicity against L1210 marine leukemia cells and human epidermoid carcinoma KB cells with 1.7 and 3.6 μg/mL of IC50s, respectively. In addition to our recent reports regarding to the synthesis of C12-C17 and C3-C11 fragments of amphidinolide O, we describe herein a new route to diastereoselective synthesis of C1-C11 fragment of. The retrosynthetic analysis of led to the C1-C11 fragment and C12-C17 fragment. The hemiketal was expected from acyclic precursor 4 which, in turn, would be derived by diastereoselective aldol reaction between ketone and aldehyde.

Production and characterization of anti-human IgG F(ab')2 antibody fragment.

Science.gov (United States)

Valedkarimi, Zahra; Nasiri, Hadi; Aghebati-Maleki, Leili; Abdolalizadeh, Jalal; Esparvarinha, Mojghan; Majidi, Jafar

2018-04-10

In present study an optimized protocol for the separation of antibodies into antigen-binding fragments F(ab')2 using pepsin digestion was investigated. The production of these fragments is a consequential step in the development of medical research, treatment and diagnosis. For production of polyclonal antibody rabbit received antigen in four steps. The rabbit serum at 1/128000 dilution showed high absorbance in reaction with human IgG at the designed ELISA method. Rabbit IgG was purified by Ion-Exchange Chromatography (IEC) method. Purity was assessed by SDS-PAGE method. In non-reduced condition only one band was seen in about 150 kDa MW position and in reduced form, two bands were seen in 50 and 25 kDa MW positions. Rabbit IgG was digested by pepsin enzyme. The antibody fragments solution was applied to Gel filtration column to isolate the F(ab')2. Non-reduced SDS-PAGE for determining the purity of F(ab')2 fragment resulted in one band in 100 kDa corresponds to F(ab')2 fragment and a band in 150 kDa MW position corresponds to undigested IgG antibodies. The activities of FITC conjugated F(ab')2 fragment and commercial ones were compared using flowcytometry method. The activity results implied that the FITC conjugated- anti human F(ab')2 fragment worked as efficiently as the commercial one.

Fractal statistics of brittle fragmentation

Directory of Open Access Journals (Sweden)

M. Davydova

2013-04-01

Full Text Available The study of fragmentation statistics of brittle materials that includes four types of experiments is presented. Data processing of the fragmentation of glass plates under quasi-static loading and the fragmentation of quartz cylindrical rods under dynamic loading shows that the size distribution of fragments (spatial quantity is fractal and can be described by a power law. The original experimental technique allows us to measure, apart from the spatial quantity, the temporal quantity - the size of time interval between the impulses of the light reflected from the newly created surfaces. The analysis of distributions of spatial (fragment size and temporal (time interval quantities provides evidence of obeying scaling laws, which suggests the possibility of self-organized criticality in fragmentation.

High-voltage pulsed generator for dynamic fragmentation of rocks.

Science.gov (United States)

Kovalchuk, B M; Kharlov, A V; Vizir, V A; Kumpyak, V V; Zorin, V B; Kiselev, V N

2010-10-01

A portable high-voltage (HV) pulsed generator has been designed for rock fragmentation experiments. The generator can be used also for other technological applications. The installation consists of low voltage block, HV block, coaxial transmission line, fragmentation chamber, and control system block. Low voltage block of the generator, consisting of a primary capacitor bank (300 μF) and a thyristor switch, stores pulse energy and transfers it to the HV block. The primary capacitor bank stores energy of 600 J at the maximum charging voltage of 2 kV. HV block includes HV pulsed step up transformer, HV capacitive storage, and two electrode gas switch. The following technical parameters of the generator were achieved: output voltage up to 300 kV, voltage rise time of ∼50 ns, current amplitude of ∼6 kA with the 40 Ω active load, and ∼20 kA in a rock fragmentation regime (with discharge in a rock-water mixture). Typical operation regime is a burst of 1000 pulses with a frequency of 10 Hz. The operation process can be controlled within a wide range of parameters. The entire installation (generator, transmission line, treatment chamber, and measuring probes) is designed like a continuous Faraday's cage (complete shielding) to exclude external electromagnetic perturbations.

High-voltage pulsed generator for dynamic fragmentation of rocks

Science.gov (United States)

Kovalchuk, B. M.; Kharlov, A. V.; Vizir, V. A.; Kumpyak, V. V.; Zorin, V. B.; Kiselev, V. N.

2010-10-01

A portable high-voltage (HV) pulsed generator has been designed for rock fragmentation experiments. The generator can be used also for other technological applications. The installation consists of low voltage block, HV block, coaxial transmission line, fragmentation chamber, and control system block. Low voltage block of the generator, consisting of a primary capacitor bank (300 μF) and a thyristor switch, stores pulse energy and transfers it to the HV block. The primary capacitor bank stores energy of 600 J at the maximum charging voltage of 2 kV. HV block includes HV pulsed step up transformer, HV capacitive storage, and two electrode gas switch. The following technical parameters of the generator were achieved: output voltage up to 300 kV, voltage rise time of ˜50 ns, current amplitude of ˜6 kA with the 40 Ω active load, and ˜20 kA in a rock fragmentation regime (with discharge in a rock-water mixture). Typical operation regime is a burst of 1000 pulses with a frequency of 10 Hz. The operation process can be controlled within a wide range of parameters. The entire installation (generator, transmission line, treatment chamber, and measuring probes) is designed like a continuous Faraday's cage (complete shielding) to exclude external electromagnetic perturbations.

Uranium target fragmentation by intermediate and high energy 12C and 20Ne ions

International Nuclear Information System (INIS)

McGaughey, P.L.; Loveland, W.; Morrissey, D.J.; Aleklett, K.; Seaborg, G.T.

1985-01-01

Target fragment formation cross sections for nuclides with 24 12 C and 8.0 and 20.0 GeV 20 Ne with 238 U. Fragment isobaric yields were deduced from these data. The light fragment (A 12 C projectile energy of 1.0 GeV, the n-deficient fragments appear to originate primarily from a fission rather than a spallation process.) The excitation functions of the heavy fragments with 60 60, indicating that the general pattern of yields of these fragments is governed by the excitation energy deposited in the nucleus during the first step of the reaction and the geometry of the collision

BcL-xL Conformational Changes upon Fragment Binding Revealed by NMR

Science.gov (United States)

Aguirre, Clémentine; ten Brink, Tim; Walker, Olivier; Guillière, Florence; Davesne, Dany; Krimm, Isabelle

2013-01-01

Protein-protein interactions represent difficult but increasingly important targets for the design of therapeutic compounds able to interfere with biological processes. Recently, fragment-based strategies have been proposed as attractive approaches for the elaboration of protein-protein surface inhibitors from fragment-like molecules. One major challenge in targeting protein-protein interactions is related to the structural adaptation of the protein surface upon molecular recognition. Methods capable of identifying subtle conformational changes of proteins upon fragment binding are therefore required at the early steps of the drug design process. In this report we present a fast NMR method able to probe subtle conformational changes upon fragment binding. The approach relies on the comparison of experimental fragment-induced Chemical Shift Perturbation (CSP) of amine protons to CSP simulated for a set of docked fragment poses, considering the ring-current effect from fragment binding. We illustrate the method by the retrospective analysis of the complex between the anti-apoptotic Bcl-xL protein and the fragment 4′-fluoro-[1,1′-biphenyl]-4-carboxylic acid that was previously shown to bind one of the Bcl-xL hot spots. The CSP-based approach shows that the protein undergoes a subtle conformational rearrangement upon interaction, for residues located in helices 2, 3 and the very beginning of 5. Our observations are corroborated by residual dipolar coupling measurements performed on the free and fragment-bound forms of the Bcl-xL protein. These NMR-based results are in total agreement with previous molecular dynamic calculations that evidenced a high flexibility of Bcl-xL around the binding site. Here we show that CSP of protein amine protons are useful and reliable structural probes. Therefore, we propose to use CSP simulation to assess protein conformational changes upon ligand binding in the fragment-based drug design approach. PMID:23717610

The VERDI fission fragment spectrometer

Directory of Open Access Journals (Sweden)

Frégeau M.O.

2013-12-01

Full Text Available The VERDI time-of-flight spectrometer is dedicated to measurements of fission product yields and of prompt neutron emission data. Pre-neutron fission-fragment masses will be determined by the double time-of-flight (TOF technique. For this purpose an excellent time resolution is required. The time of flight of the fragments will be measured by electrostatic mirrors located near the target and the time signal coming from silicon detectors located at 50 cm on both sides of the target. This configuration, where the stop detector will provide us simultaneously with the kinetic energy of the fragment and timing information, significantly limits energy straggling in comparison to legacy experimental setup where a thin foil was usually used as a stop detector. In order to improve timing resolution, neutron transmutation doped silicon will be used. The high resistivity homogeneity of this material should significantly improve resolution in comparison to standard silicon detectors. Post-neutron fission fragment masses are obtained form the time-of-flight and the energy signal in the silicon detector. As an intermediary step a diamond detector will also be used as start detector located very close to the target. Previous tests have shown that poly-crystalline chemical vapour deposition (pCVD diamonds provides a coincidence time resolution of 150 ps not allowing complete separation between very low-energy fission fragments, alpha particles and noise. New results from using artificial single-crystal diamonds (sCVD show similar time resolution as from pCVD diamonds but also sufficiently good energy resolution.

String fragmentation; La fragmentation des cordes

Energy Technology Data Exchange (ETDEWEB)

Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)

1997-10-01

The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.

HETC96/MORSE calculations of activations in KEK beam stop and room by 500-MeV protons and comparisons with experiments

International Nuclear Information System (INIS)

Fu, C.Y.; Gabriel, T.A.

1997-01-01

The 1996 version of HETC has a pre-equilibrium reaction model to bridge the gap between the existing intranuclear-cascade and evaporation models. This code was used to calculate proton-induced activations, to calculate neutron fluxes for neutron energies above 19.6 MeV, and to write the neutron source for lower energies to be transported further by MORSE. For MORSE, the HILO cross section library was used for neutron transport for all detectors. Additionally for the 197 Au(n, γ) detector, the BUGLE96 library was used to study the effects of the low-lying 57 Fe inelastic levels and the resonance self-shielding in iron. Neutron fluxes were obtained from the track-length estimator for detectors inside the beam stop and from the boundary-crossing estimator for detectors attached to the surfaces of the concrete walls. Activation cross sections given in JAERI-Data/Code are combined with the calculated neutron fluxes to get the saturated activities induced by neutrons. C/E values are too low (0.5) for Fe(N, χ) 54 Mn, close to unity for Cu(n, χ) 58 Co, and too high (6.0) for 197 Au (n, γ) 198 Au. It is difficult to interpret the disagreements because most of the activation cross sections are also calculated and their uncertainties are not known. However, the calculated results are in good agreement with those calculated by others using different codes. Calculated results for four of the ten activations reported here have not been done previously, and among the four, 197 Au(n, γ) is the most bothersome because its cross section is the most well known while the calculated activations for most detector locations are in largest disagreement with experiments

Completion of autobuilt protein models using a database of protein fragments

International Nuclear Information System (INIS)

Cowtan, Kevin

2012-01-01

Two developments in the process of automated protein model building in the Buccaneer software are described: the use of a database of protein fragments in improving the model completeness and the assembly of disconnected chain fragments into complete molecules. Two developments in the process of automated protein model building in the Buccaneer software are presented. A general-purpose library for protein fragments of arbitrary size is described, with a highly optimized search method allowing the use of a larger database than in previous work. The problem of assembling an autobuilt model into complete chains is discussed. This involves the assembly of disconnected chain fragments into complete molecules and the use of the database of protein fragments in improving the model completeness. Assembly of fragments into molecules is a standard step in existing model-building software, but the methods have not received detailed discussion in the literature

Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

Directory of Open Access Journals (Sweden)

Jiabing Ji

Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

Automated building of organometallic complexes from 3D fragments.

Science.gov (United States)

Foscato, Marco; Venkatraman, Vishwesh; Occhipinti, Giovanni; Alsberg, Bjørn K; Jensen, Vidar R

2014-07-28

A method for the automated construction of three-dimensional (3D) molecular models of organometallic species in design studies is described. Molecular structure fragments derived from crystallographic structures and accurate molecular-level calculations are used as 3D building blocks in the construction of multiple molecular models of analogous compounds. The method allows for precise control of stereochemistry and geometrical features that may otherwise be very challenging, or even impossible, to achieve with commonly available generators of 3D chemical structures. The new method was tested in the construction of three sets of active or metastable organometallic species of catalytic reactions in the homogeneous phase. The performance of the method was compared with those of commonly available methods for automated generation of 3D models, demonstrating higher accuracy of the prepared 3D models in general, and, in particular, a much wider range with respect to the kind of chemical structures that can be built automatically, with capabilities far beyond standard organic and main-group chemistry.

Experimental study on the fragmentation of Adenine and Porphyrin molecules induced by low energy multicharged ion impact

International Nuclear Information System (INIS)

Li, B.

2010-01-01

Since the dissociation of small molecules might play key roles in the understanding of radiation induced damages of living tissues at the primary steps and at the molecular levels, fragmentation dynamics of small biomolecules have drawn much attention. The knowledge of the internal energy is of fundamental importance for understanding its fragmentation dynamics following external excitation. For a long time however, it was difficult to measure this parameter in coincidence with the fragmentation patterns until the development of CIDEC (Collision Induced Dissociation under Energy Control) method in 2007. In this work, the CIDEC method was extended to study the fragmentation of gas-phase biomolecules adenine (Ade: H 5 C 5 N 5 ) and porphyrin chloride FeTPPCl (C 44 H 28 N 4 FeCl). The population distribution for each dissociation channel as a function of the excitation energy of the parent molecular ions at a well-determined initial charge state has been experimentally determined, which could shed some light on the fragmentation dynamics of these molecules. In collisions between Cl + and Ade at 3 keV, the fragmentation pattern of Ade 2+ is dominated by the loss of H 2 CN + and the successive emission of HCN. The energy distribution of the parent dication confirms the successive emission dynamics. A specific decay channel is observed, i.e. the emission of a charged H 2 CN + followed by the emission of HC 2 N 2 . The measured mean excitation energies of this channel and other competitive channels are compared. In Kr 8+ - FeTPPCl collisions at 80 keV, parent ions FeTPPCL 1+,2+,3+ are observed, along with the corresponding decay patterns. It is found that, in the first step the dominant low-energy-cost decay channel is the emission of Cl 0 independent of the initial charge state of FeTPPCl r+ . For the resulted dication FeTPP 2+ , the dominant fragmentation channel is the neutral evaporation; for the tri-cation however, the dominant fragmentation channel is the

High-energy particle Monte Carlo at Los Alamos

International Nuclear Information System (INIS)

Prael, R.E.

1985-01-01

A major computational effort at Los Alamos has been the development of a code system based on the HETC code for the transport of nucleons, pions, and muons. The Los Alamos National Laboratory version of HETC utilizes MCNP geometry and interfaces with MCNP for the transport of neutrons below 20 MeV and photons at any energy. A major recent effort has been the development of the PHT code for treating the gamma cascade in excited nuclei (the residual nuclei from an HETC calculation) by the Monte Carlo method to generate a photon source for MCNP. The HETC/MCNP code system has been extensively used for design studies of accelerator targets and shielding, including the design of LAMPF-II. It is extensively used for the design and analysis of accelerator experiments. Los Alamos National Laboratory has been an active member of the International Collaboration on Advanced Neutron Sources; as such we engage in shared code development and computational efforts. In the past few years, additional effort has been devoted to the development of a Chen-model intranuclear cascade code (INCA1) featuring a cluster model for the nucleus and deuteron pickup reactions. Concurrently, the INCA2 code for the breakup of light, excited nuclei using the Fermi breakup model has been developed. Together, they have been used for the calculation of neutron and proton cross sections in the energy ranges appropriate to medical accelerators, and for the computation of tissue kerma factors

Connectivity among subpopulations of Louisiana black bears as estimated by a step selection function

Science.gov (United States)

Clark, Joseph D.; Jared S. Laufenberg,; Maria Davidson,; Jennifer L. Murrow,

2015-01-01

Habitat fragmentation is a fundamental cause of population decline and increased risk of extinction for many wildlife species; animals with large home ranges and small population sizes are particularly sensitive. The Louisiana black bear (Ursus americanus luteolus) exists only in small, isolated subpopulations as a result of land clearing for agriculture, but the relative potential for inter-subpopulation movement by Louisiana black bears has not been quantified, nor have characteristics of effective travel routes between habitat fragments been identified. We placed and monitored global positioning system (GPS) radio collars on 8 female and 23 male bears located in 4 subpopulations in Louisiana, which included a reintroduced subpopulation located between 2 of the remnant subpopulations. We compared characteristics of sequential radiolocations of bears (i.e., steps) with steps that were possible but not chosen by the bears to develop step selection function models based on conditional logistic regression. The probability of a step being selected by a bear increased as the distance to natural land cover and agriculture at the end of the step decreased and as distance from roads at the end of a step increased. To characterize connectivity among subpopulations, we used the step selection models to create 4,000 hypothetical correlated random walks for each subpopulation representing potential dispersal events to estimate the proportion that intersected adjacent subpopulations (hereafter referred to as successful dispersals). Based on the models, movement paths for males intersected all adjacent subpopulations but paths for females intersected only the most proximate subpopulations. Cross-validation and genetic and independent observation data supported our findings. Our models also revealed that successful dispersals were facilitated by a reintroduced population located between 2 distant subpopulations. Successful dispersals for males were dependent on natural land

Reversible addition-fragmentation chain transfer polymerization of 2-chloro-1,3-butadiene

OpenAIRE

Pullan, Nikki; Liu, Max; Topham, Paul D.

2013-01-01

Controlled polymerization of 2-chloro-1,3-butadiene using reversible addition–fragmentation chain transfer (RAFT) polymerization has been demonstrated for the first time. 2-Chloro-1,3-butadiene, more commonly known as chloroprene, has significant industrial relevance as a crosslinked rubber, with uses ranging from adhesives to integral automotive components. However, problems surrounding the inherent toxicity of the lifecycle of the thiourea-vulcanized rubber have led to the need for control ...

Amplification of deoxyribonucleic acid (DNA) fragment using two ...

African Journals Online (AJOL)

user

2011-04-11

Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

I. The properties of hot Ca-like fragments from the 40Ca+40Ca reaction at 35 AMeV

International Nuclear Information System (INIS)

Planeta, R.; Gawlikowicz, W.; Wieloch, A.

2001-01-01

The creation of hot Ca-like fragments was investigated in the 40 Ca + 40 Ca reaction at 35 AMeV. Using the AMPHORA 4π detector system, the primary projectile-like fragment was reconstructed and its properties were determined. Both primary and secondary distributions are compared with the predictions of a Monte Carlo code describing a heavy-ion collision as a two-step process. Some of the nucleons which are identified as participants in the first step are transferred in the second step to these final states, which correspond on the average to the maximum value of entropy (thermodynamic probability). The model allows for competition between mean-field effects and nucleon-nucleon interactions in the overlap zone of the interacting nuclei. The analysis presented here suggests a thermalized source picture of the decay of the projectile-like fragment. The validity of the reconstruction procedure for projectile-like fragments is discussed. (orig.)

Evidence of site-specific fragmentation on thioacetic acid, CH3C(O)SH, irradiated with synchrotron radiation around the S 2p and O 1s regions.

Science.gov (United States)

Erben, Mauricio F; Geronés, Mariana; Romano, Rosana M; Della Védova, Carlos O

2006-01-26

Site-specific fragmentations following S 2p and O 1s photoexcitation of thioacetic acid, CH3C(O)SH, have been studied by means of synchrotron radiation. Total ion yield (TIY) spectra were measured and multicoincidence techniques, which include photoelectron-photoion coincidence (PEPICO) and photoelectron-photoion-photoion coincidence (PEPIPICO) time-of-flight mass spectrometry, were applied. The equivalent-core approximation was employed in order to estimate ionization transition values, and the observed peaks were tentatively assigned. A site-specific fragmentation is moderately observed by comparing the mass spectra collected at resonant energies around the inner and shallow inner shell S 2p and O 1s ionization edges. Beside H+ ion, the most abundant ions observed at the S 2p edge excitation were CH3CO+, SH+, S+, and CH3+. At the O 1s region the large CH3CO+ fragment was depressed, and small CHx+ (x = 0, 1, 2, 3), S+, and SH+ fragments were dominant. The dissociation dynamic for the main ion-pair production has been discussed. Two- and three-body dissociation channels have been observed in the PEPIPICO spectra, and the dissociation mechanisms were proposed.

ACFIS: a web server for fragment-based drug discovery

Science.gov (United States)

Hao, Ge-Fei; Jiang, Wen; Ye, Yuan-Nong; Wu, Feng-Xu; Zhu, Xiao-Lei; Guo, Feng-Biao; Yang, Guang-Fu

2016-01-01

In order to foster innovation and improve the effectiveness of drug discovery, there is a considerable interest in exploring unknown ‘chemical space’ to identify new bioactive compounds with novel and diverse scaffolds. Hence, fragment-based drug discovery (FBDD) was developed rapidly due to its advanced expansive search for ‘chemical space’, which can lead to a higher hit rate and ligand efficiency (LE). However, computational screening of fragments is always hampered by the promiscuous binding model. In this study, we developed a new web server Auto Core Fragment in silico Screening (ACFIS). It includes three computational modules, PARA_GEN, CORE_GEN and CAND_GEN. ACFIS can generate core fragment structure from the active molecule using fragment deconstruction analysis and perform in silico screening by growing fragments to the junction of core fragment structure. An integrated energy calculation rapidly identifies which fragments fit the binding site of a protein. We constructed a simple interface to enable users to view top-ranking molecules in 2D and the binding mode in 3D for further experimental exploration. This makes the ACFIS a highly valuable tool for drug discovery. The ACFIS web server is free and open to all users at http://chemyang.ccnu.edu.cn/ccb/server/ACFIS/. PMID:27150808

Discovery of C5-C17 poly- and perfluoroalkyl substances in water by in-line SPE-HPLC-Orbitrap with in-source fragmentation flagging.

Science.gov (United States)

Liu, Yanna; Pereira, Alberto Dos Santos; Martin, Jonathan W

2015-04-21

The presence of unknown organofluorine compounds in environmental samples has prompted the development of nontargeted analytical methods capable of detecting new perfluoroalkyl and polyfluoroalkyl substances (PFASs). By combining high volume injection with high performance liquid chromatography (HPLC) and ultrahigh resolution Orbitrap mass spectrometry, a sensitive (0.003-0.2 ng F/mL for model mass-labeled PFASs) untargeted workflow was developed for discovery and characterization of novel PFASs in water. In the first step, up to 5 mL of water is injected to in-line solid phase extraction, chromatographed by HPLC, and detected by electrospray ionization with mass spectral acquisition in parallel modes cycling back and forth: (i) full scan with ultrahigh resolving power (RP = 120,000, mass accuracy ≤3 ppm), and (ii) in-source fragmentation flagging scans designed to yield marker fragment ions including [C2F5](-) (m/z 118.992), [C3F7](-) (m/z 168.988), [SO4H](-) (m/z 96.959), and [Cl](-) (m/z 34.9). For flagged PFASs, plausible empirical formulas were generated from accurate masses, isotopic patterns, and fragment ions. In the second step, another injection is made to collect high resolution MS/MS spectra of suspect PFAS ions, allowing further confirmation of empirical formulas while also enabling preliminary structural characterization. The method was validated by applying it to an industrial wastewater, and 36 new PFASs were discovered. Of these, 26 were confidently assigned to 3 new PFAS classes that have not previously been reported in the environment: polyfluorinated sulfates (CnFn+3Hn-2SO4(-); n = 5, 7, 9, 11, 13, and 15), chlorine substituted perfluorocarboxylates (ClCnF2nCO2(-); n = 4-11), and hydro substituted perfluorocarboxylates (HCnF2nCO2(-); n = 5-16). Application of the technique to environmental water samples is now warranted.

Inner-shell excitation and ionic fragmentation of molecules

International Nuclear Information System (INIS)

Hitchcock, A.P.; Tyliszczak, T.; Cavell, R.G.

1997-01-01

Inner-shell excitation and associated decay spectroscopies are site specific probes of electronic and geometrical structure and photoionization dynamics. X-ray absorption probes the geometric and electronic structure, while time-of-flight mass spectrometry with multi-coincidence detection provides information on the photofragmentation dynamics of the initially produced inner-shell state. Auger decay of inner-shell excited and ionised states is an efficient source of multiply charged ions. The charge separation and fragmentation of these species, studied by photoelectron-photoion-photoion coincidence (also called charge separation mass spectrometry) gives insights into bonding and electronic structure. In molecules, the dependence of the fragmentation process on the X-ray energy can reveal cases of site and/or state selective fragmentation. At the ALS the authors have examined the soft X-ray spectroscopy and ionic fragmentation of a number of molecules, including carboranes, silylenes, phosphorus halides, SF 6 and CO 2 . Their work is illustrated using results from the carborane and PF 3 studies

Inner-shell excitation and ionic fragmentation of molecules

Energy Technology Data Exchange (ETDEWEB)

Hitchcock, A.P.; Tyliszczak, T. [McMaster Univ., Hamilton, Ontario (Canada); Cavell, R.G. [Univ. of Alberta, Edmonton (Canada)] [and others

1997-04-01

Inner-shell excitation and associated decay spectroscopies are site specific probes of electronic and geometrical structure and photoionization dynamics. X-ray absorption probes the geometric and electronic structure, while time-of-flight mass spectrometry with multi-coincidence detection provides information on the photofragmentation dynamics of the initially produced inner-shell state. Auger decay of inner-shell excited and ionised states is an efficient source of multiply charged ions. The charge separation and fragmentation of these species, studied by photoelectron-photoion-photoion coincidence (also called charge separation mass spectrometry) gives insights into bonding and electronic structure. In molecules, the dependence of the fragmentation process on the X-ray energy can reveal cases of site and/or state selective fragmentation. At the ALS the authors have examined the soft X-ray spectroscopy and ionic fragmentation of a number of molecules, including carboranes, silylenes, phosphorus halides, SF{sub 6} and CO{sub 2}. Their work is illustrated using results from the carborane and PF{sub 3} studies.

Fragment Size Distribution of Blasted Rock Mass

Science.gov (United States)

Jug, Jasmin; Strelec, Stjepan; Gazdek, Mario; Kavur, Boris

2017-12-01

Rock mass is a heterogeneous material, and the heterogeneity of rock causes sizes distribution of fragmented rocks in blasting. Prediction of blasted rock mass fragmentation has a significant role in the overall economics of opencast mines. Blasting as primary fragmentation can significantly decrease the cost of loading, transport, crushing and milling operations. Blast fragmentation chiefly depends on the specific blast design (geometry of blast holes drilling, the quantity and class of explosive, the blasting form, the timing and partition, etc.) and on the properties of the rock mass (including the uniaxial compressive strength, the rock mass elastic Young modulus, the rock discontinuity characteristics and the rock density). Prediction and processing of blasting results researchers can accomplish by a variety of existing software’s and models, one of them is the Kuz-Ram model, which is possibly the most widely used approach to estimating fragmentation from blasting. This paper shows the estimation of fragmentation using the "SB" program, which was created by the authors. Mentioned program includes the Kuz-Ram model. Models of fragmentation are confirmed and calibrated by comparing the estimated fragmentation with actual post-blast fragmentation from image processing techniques. In this study, the Kuz-Ram fragmentation model has been used for an open-pit limestone quarry in Dalmatia, southern Croatia. The resulting calibrated value of the rock factor enables the quality prognosis of fragmentation in further blasting works, with changed drilling geometry and blast design parameters. It also facilitates simulation in the program to optimize blasting works and get the desired fragmentations of the blasted rock mass.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Fluctuations in the fragmentation process

International Nuclear Information System (INIS)

Botet, R.; Ploszajczak, M.

1993-01-01

Some general framework of sequential fragmentation is presented, as provided by the newly proposed Fragmentation - Inactivation - Binary model, and to study briefly its basic and universal features. This model includes as particular cases most of the previous kinetic fragmentation models. In particular it is discussed how one arrives in this framework to the critical behaviour, called the shattering transition. This model is then compared to recent data on gold multifragmentation at 600 MeV/nucl. (authors) 20 refs., 5 figs

Ternary-fragmentation-driving potential energies of 252Cf

Science.gov (United States)

Karthikraj, C.; Ren, Zhongzhou

2017-12-01

Within the framework of a simple macroscopic model, the ternary-fragmentation-driving potential energies of 252Cf are studied. In this work, all possible ternary-fragment combinations of 252Cf are generated by the use of atomic mass evaluation-2016 (AME2016) data and these combinations are minimized by using a two-dimensional minimization approach. This minimization process can be done in two ways: (i) with respect to proton numbers (Z1, Z2, Z3) and (ii) with respect to neutron numbers (N1, N2, N3) of the ternary fragments. In this paper, the driving potential energies for the ternary breakup of 252Cf are presented for both the spherical and deformed as well as the proton-minimized and neutron-minimized ternary fragments. From the proton-minimized spherical ternary fragments, we have obtained different possible ternary configurations with a minimum driving potential, in particular, the experimental expectation of Sn + Ni + Ca ternary fragmentation. However, the neutron-minimized ternary fragments exhibit a driving potential minimum in the true-ternary-fission (TTF) region as well. Further, the Q -value energy systematics of the neutron-minimized ternary fragments show larger values for the TTF fragments. From this, we have concluded that the TTF region fragments with the least driving potential and high Q values have a strong possibility in the ternary fragmentation of 252Cf. Further, the role of ground-state deformations (β2, β3, β4, and β6) in the ternary breakup of 252Cf is also studied. The deformed ternary fragmentation, which involves Z3=12 -19 fragments, possesses the driving potential minimum due to the larger oblate deformations. We also found that the ground-state deformations, particularly β2, strongly influence the driving potential energies and play a major role in determining the most probable fragment combinations in the ternary breakup of 252Cf.

Analysis of LOFT pressurizer spray and surge nozzles to include a 4500F step transient

International Nuclear Information System (INIS)

Nitzel, M.E.

1978-01-01

This report presents the analysis of the LOFT pressurizer spray and surge nozzles to include a 450 0 F step thermal transient. Previous analysis performed under subcontract by Basic Technology Incorporated was utilized where applicable. The SAASIII finite element computer program was used to determine stress distributions in the nozzles due to the step transient. Computer results were then incorporated in the necessary additional calculations to ascertain that stress limitations were not exceeded. The results of the analysis indicate that both the spray and surge nozzles will be within stress allowables prescribed by subsubarticle NB-3220 of the 1974 edition of the ASME Boiler and Pressure Vessel Code when subjected to currently known design, normal operating, upset, emergency, and faulted condition loads

Exploring rearrangements along the fragmentation pathways of diuron anion: A combined experimental and computational investigation

Science.gov (United States)

Kanawati, Basem; Harir, Mourad; Schmitt-Kopplin, Philippe

2009-12-01

Diuron (3-(3,4-dichlorophenyl)-1,1-dimethylurea), a common herbicide from phenyl urea class, was investigated by studying the formation of several negative ions [M-H]- in the gas phase and the fragmentation behaviour of the thermodynamically most probably formed isomeric anions upon linear ion acceleration/collision experiments. The collision induced dissociation experiments (CID) were carried out in a hexapole-quadrupole-hexapole hybrid system coupled to 12 T magnet with infinity ICR cell for high resolution measurements. Two distinctive main pathways were observed in the MS/MS spectrum. Sustained off-resonance irradiation (SORI) experiments inside the ICR cell reinforce the fragmentation channels obtained from linear ion acceleration experiments. The fragmentation pathways were also completely investigated by the use of B3LYP/6-311+G(2d,p)//B3LYP/6-31+G(d) level of theory. Elimination of dimethylamine takes place in a two-step process, by which two successive 1,3 proton shifts occur. The second 1,3 proton shift is concerted with the departure of dimethylamine. The driving force for the (CH3)2NH elimination is the formation of isocyanate group. The formed primary product ion can further decompose to release HCl through a new transition state. A stable new aromatic product ion is formed with 10[pi] electrons. Loss of C3H5NO neutral from another anionic isomer of the precursor ion was also observed and is characteristic for the amide terminal of the diamide functional group. A concerted mechanism is proposed, by which N-C bond breakage and cyclization of the eliminated neutral fragment C3H5NO takes place simultaneously to form 1-methyl-aziridin-2-one.

Search for relativistic projectile fragments with charges 4/3, 5/3, 7/3, and 8/3

International Nuclear Information System (INIS)

Bloomer, M.A.; Friedlander, E.M.; Heckman, H.H.; Karant, Y.J.

1984-01-01

Recent speculation on the cause of the anomalously short reaction mean free paths of projectile fragmentation products (PF's) produced from relativistic heavy-ion (RHI) collisions with emulsion nuclei has led to the suggestion that nuclei with bound third-integral charges might be present among the PF's. The authors were thus motivated to search for such fractional charges among the 1 less than or equal to Z less than or equal to 3 PF's produced by the interactions of 1.88 GeV/nucleon 56 Fe nuclei in G-5 nuclear emulsion. Results show that all charge measurements for each PF are narrowly distributed around their integer means, and, with the possible exception of the set of measurements scattered around Z = 2.33, there is no indication that PF's of third-integral charge are produced with the same relative abundance as reported for anomalons to date, i.e., 2-6% for 3 less than or equal to Z less than or equal to 26

ACFIS: a web server for fragment-based drug discovery.

Science.gov (United States)

Hao, Ge-Fei; Jiang, Wen; Ye, Yuan-Nong; Wu, Feng-Xu; Zhu, Xiao-Lei; Guo, Feng-Biao; Yang, Guang-Fu

2016-07-08

In order to foster innovation and improve the effectiveness of drug discovery, there is a considerable interest in exploring unknown 'chemical space' to identify new bioactive compounds with novel and diverse scaffolds. Hence, fragment-based drug discovery (FBDD) was developed rapidly due to its advanced expansive search for 'chemical space', which can lead to a higher hit rate and ligand efficiency (LE). However, computational screening of fragments is always hampered by the promiscuous binding model. In this study, we developed a new web server Auto Core Fragment in silico Screening (ACFIS). It includes three computational modules, PARA_GEN, CORE_GEN and CAND_GEN. ACFIS can generate core fragment structure from the active molecule using fragment deconstruction analysis and perform in silico screening by growing fragments to the junction of core fragment structure. An integrated energy calculation rapidly identifies which fragments fit the binding site of a protein. We constructed a simple interface to enable users to view top-ranking molecules in 2D and the binding mode in 3D for further experimental exploration. This makes the ACFIS a highly valuable tool for drug discovery. The ACFIS web server is free and open to all users at http://chemyang.ccnu.edu.cn/ccb/server/ACFIS/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Mass spectrometry for fragment screening.

Science.gov (United States)

Chan, Daniel Shiu-Hin; Whitehouse, Andrew J; Coyne, Anthony G; Abell, Chris

2017-11-08

Fragment-based approaches in chemical biology and drug discovery have been widely adopted worldwide in both academia and industry. Fragment hits tend to interact weakly with their targets, necessitating the use of sensitive biophysical techniques to detect their binding. Common fragment screening techniques include differential scanning fluorimetry (DSF) and ligand-observed NMR. Validation and characterization of hits is usually performed using a combination of protein-observed NMR, isothermal titration calorimetry (ITC) and X-ray crystallography. In this context, MS is a relatively underutilized technique in fragment screening for drug discovery. MS-based techniques have the advantage of high sensitivity, low sample consumption and being label-free. This review highlights recent examples of the emerging use of MS-based techniques in fragment screening. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Analyzing Internal Fragmentation of Electrosprayed Ubiquitin Ions During Beam-Type Collisional Dissociation

Science.gov (United States)

Durbin, Kenneth R.; Skinner, Owen S.; Fellers, Ryan T.; Kelleher, Neil L.

2015-05-01

Gaseous fragmentation of intact proteins is multifaceted and can be unpredictable by current theories in the field. Contributing to the complexity is the multitude of precursor ion states and fragmentation channels. Terminal fragment ions can be re-fragmented, yielding product ions containing neither terminus, termed internal fragment ions. In an effort to better understand and capitalize upon this fragmentation process, we collisionally dissociated the high (13+), middle (10+), and low (7+) charge states of electrosprayed ubiquitin ions. Both terminal and internal fragmentation processes were quantified through step-wise increases of voltage potential in the collision cell. An isotope fitting algorithm matched observed product ions to theoretical terminal and internal fragment ions. At optimal energies for internal fragmentation of the 10+, nearly 200 internal fragments were observed; on average each of the 76 residues in ubiquitin was covered by 24.1 internal fragments. A pertinent finding was that formation of internal ions occurs at similar energy thresholds as terminal b- and y-ion types in beam-type activation. This large amount of internal fragmentation is frequently overlooked during top-down mass spectrometry. As such, we present several new approaches to visualize internal fragments through modified graphical fragment maps. With the presented advances of internal fragment ion accounting and visualization, the total percentage of matched fragment ions increased from approximately 40% to over 75% in a typical beam-type MS/MS spectrum. These sequence coverage improvements offer greater characterization potential for whole proteins with no needed experimental changes and could be of large benefit for future high-throughput intact protein analysis.

File Type Identification of File Fragments using Longest Common Subsequence (LCS)

Science.gov (United States)

Rahmat, R. F.; Nicholas, F.; Purnamawati, S.; Sitompul, O. S.

2017-01-01

Computer forensic analyst is a person in charge of investigation and evidence tracking. In certain cases, the file needed to be presented as digital evidence was deleted. It is difficult to reconstruct the file, because it often lost its header and cannot be identified while being restored. Therefore, a method is required for identifying the file type of file fragments. In this research, we propose Longest Common Subsequences that consists of three steps, namely training, testing and validation, to identify the file type from file fragments. From all testing results we can conlude that our proposed method works well and achieves 92.91% of accuracy to identify the file type of file fragment for three data types.

The Wolff rearrangement of cyclic 2-diazo-1,3-diketones in electron impact - mass spectrometry - controlling the molecular fragmentation by means of low-energy electrons 18 to 70 eV

International Nuclear Information System (INIS)

Kuruc, J.; Kardosova, E.; Nikolaev, V. A.

2016-01-01

The electron-impact-induced fragmentations (the mass spectra, 17 - 70 eV) of cyclic 2-diazo-1,3-diketones were studied. As the suitable compounds were selected the following cyclic 2-diazo-1,3-diketones: 2-diazo-1,3-cyclohexanedione, Ia; 2-diazo-4,4-dimethyl-1,3-cyclohexanedione, Ib; 2-diazo-5,5-dimethyl-1,3-cyclohexanedione, Ic; 2-diazo-4,6-dioxa-5,5-dimethyl-1,3-cyclohexanedione, Id; and 2-diazo-5-phenyl-1,3-cyclohexanedione, Ie). The mass spectra were measured with Varian MAT 111 instrument with direct introduction of samples, with a source temperature of 120 grad C, energy of ionising electrons was in the range (17 - 70) eV. The elimination of the diazo group is the typical reaction of the fragmentation of the cyclic diazo-1,3-diketones after ionization of molecules by electron impact. All our studied cyclic diazo-1,3-diketones have a molecular ion with a relative intensity from 0.7 to 86.4%. Typical ions are [M]"+·, [M-N"_2]"+"·, [M-N_2-CO]"+"·, [M-N_2-CO-CH_2]"+"·, [M-N_2-CO-CH_3]"+"·. For all treatment cyclic diazo-1,3-diketones have been registered 3D mass spectra, for each cyclic diazo-1,3-diketone was proposed fragmentation scheme, including the general fragmentation scheme. The Wolff rearrangement is observed in all studied cyclic diazo-1,3-diketones after cleavage of nitrogen molecules. The energy of ionizing electrons ∼20 eV in the case of compounds Ib, Id - Ie dominating ions are fragments of the [M-N_2]"+"·, in the compound Ia at 18 and 20 eV is dominant fragment [M-N_2-CO-C_2H_2-H]"+"· and for the Ic at 30 eV becomes a dominant fragment [M-N_2-CH_3]"+"· (m/z = 123) but at (25 - 18) eV the most intensive ion is [M-N_2]"+"· (m/z = 138). (authors)

Fragmentation of CO2 into C+ + O+ + O, in collisions with protons

International Nuclear Information System (INIS)

Moretto-Capelle, P.

2000-01-01

The fragmentation of CO 2 has been investigated in 25 keV H + + CO 2 collisions using an electron-ion-ion triple coincidence technique. In this letter we focus on the three-body fragmentation into the C + + O + + O final state. A comparison between the measured correlation of C + ,O + and O momenta and simple kinematic models allows us to demonstrate that in the present case, a rather unexpected two-step process with formation of a CO 2+ ion as an intermediate state occurs. This result is at variance with the conclusions of other authors achieved in collisions of photons and electrons with the dioxide molecule. Kinetic energy release distributions in the two steps of the dissociation process are also deduced from experiment; the distributions found for the fragmentation of CO 2+ into C + + O + are found to be very similar to those measured by other authors in collisions of various particles (photons, multi-charged ions) with CO molecules at high enough collision energy. (author). Letter-to-the-editor

Congenital Symmastia: A 3-Step Approach

OpenAIRE

Sadaka, Mohamed Saad; Allam, Atef A.

2016-01-01

Summary: Congenital symmastia is a medial confluence of the breasts. It is a rare anomaly with few reports in the literature and no standard treatment. In this article, we present a case of congenital symmastia treated by 3 steps: liposuction, fixation of the skin to the chest wall in the area of the intermammary sulcus, and postoperative intermammary compression. A successful result was achieved with normal cleavage between the breasts. So, this is considered the ideal treatment for this con...

Congenital Symmastia: A 3-Step Approach

Science.gov (United States)

Allam, Atef A.

2016-01-01

Summary: Congenital symmastia is a medial confluence of the breasts. It is a rare anomaly with few reports in the literature and no standard treatment. In this article, we present a case of congenital symmastia treated by 3 steps: liposuction, fixation of the skin to the chest wall in the area of the intermammary sulcus, and postoperative intermammary compression. A successful result was achieved with normal cleavage between the breasts. So, this is considered the ideal treatment for this condition. PMID:28293510

Fragmentation of water on swift {sup 3}He{sup 2+} ion impact

Energy Technology Data Exchange (ETDEWEB)

Sabin, John R. [Quantum Theory Project, Departments of Chemistry and Physics, P.O. Box 118435, University of Florida, Gainesville, FL 32611-8435 (United States); Institut for Fysik og Kemi, Suddansk Universitet, 5230 Odense M (Denmark)], E-mail: sabin@qtp.ufl.edu; Cabrerra-Trujillo, Remigio [Instituto de Ciencias Fisicas, Universidad Nacional Autonoma de Mexico, Apartado Postal 48-3, Cuernavaca, Morelos 62251 (Mexico); Stolterfoht, Nikolaus [Hahn-Meitner Institut, Glienickerstrasse 100, D-14109 Berlin (Germany); Deumens, Erik; Ohrn, Yngve [Quantum Theory Project, Departments of Chemistry and Physics, P.O. Box 118435, University of Florida, Gainesville, FL 32611-8435 (United States)

2009-01-15

Charge exchange and fragmentation are the usual results in ion-molecule collision systems, and the specifics of the fragmentation process determine the chemical destiny of the target system. In this paper, we report recent progress on calculations of the fragmentation patterns for the model system He{sup 2+} + H{sub 2}O for projectile energies of a few keV. The calculations are obtained using the electron-nuclear dynamics (END) method for solution of the time-dependent Schroedinger equation.

3-D finite element analysis of claw-poled stepping motor

International Nuclear Information System (INIS)

Kawase, Yoshihiro; Yamaguchi, Tadashi; Mizuno; Koike, Yoshikazu

2002-01-01

Stepping motors are widely used for various electric instruments. It is necessary for the optimum design to analyze the magnetic field accurately. The 3-D finite element method with edge elements taking into account the rotation of the rotor has been applied to analyze the magnetic field of a claw-poled stepping motor. (Author)

Morphology of the posteromedial fragment in pertrochanteric fractures: A three-dimensional computed tomography analysis.

Science.gov (United States)

Sharma, Gaurav; Gn, Kiran Kumar; Khatri, Kavin; Singh, Ravijot; Gamanagatti, Shivanand; Sharma, Vijay

2017-02-01

In this study we describe the morphology of the posteromedial fragment in pertrochanteric fractures using 3D CT scans and answer two questions 1) Do differences exist between the 3D CT appearances of posteromedial fragments and the depictions made in the AO classification 2) Does the posteromedial fragment affect stability in pertrochanteric fractures, in terms of fracture collapse? Preoperative CT scans of eight 31-A1 and fifty 31-A2 fractures were analysed. The presence of PM fragment, its fragmentation, greater trochanter (GT) involvement, lesser trochanter (LT) fragment size (in terms of its posterior and medial extent as well as LT length), LT fragment displacement (in terms of medial displacement and rotation) were determined. All fractures were treated with a DHS. Fracture collapse was determined on postoperative radiographs. The relationship between fracture collapse and patient factors including age, gender, fracture type (A1 versus A2), characteristics of the posteromedial fragment, and the presence of a lateral wall fracture were determined. Three out of eight 31-A1 fractures demonstrated a separate GT fragment (three part fracture). Out of the 50 31-A2 fractures, 12 had a single PM fragment, which included the LT and GT in continuity. The more common four part fractures seem to form by further fragmentation of this basic form. In A2 fractures, the GT was almost always broken and the broken fragment comprised a mean 56% of normal GT. The LT fragment involved an average of 74% of the posterior wall, and an average of 36% of the medial wall of the proximal femur. Larger LT fragments were less displaced as compared to smaller fragments. Univariate regression analyses revealed that fracture collapse was significantly correlated with fracture type (A1 versus A2, p 0.036), GT size (p 0.002) and the presence of a lateral wall fracture (pfragmentation of the posteromedial fragment, nor the size of the lesser trochanter fragment was found to predict stability in

Virtual fragment preparation for computational fragment-based drug design.

Science.gov (United States)

Ludington, Jennifer L

2015-01-01

Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.

Regulation of nonmuscle myosin II during 3-methylcholanthrene induced dedifferentiation of C2C12 myotubes

Energy Technology Data Exchange (ETDEWEB)

Dey, Sumit K.; Saha, Shekhar; Das, Provas; Das, Mahua R.; Jana, Siddhartha S., E-mail: bcssj@iacs.res.in

2014-08-01

3-Methylcholanthrene (3MC) induces tumor formation at the site of injection in the hind leg of mice within 110 days. Recent reports reveal that the transformation of normal muscle cells to atypical cells is one of the causes for tumor formation, however the molecular mechanism behind this process is not well understood. Here, we show in an in vitro study that 3MC induces fragmentation of multinucleate myotubes into viable mononucleates. These mononucleates form colonies when they are seeded into soft agar, indicative of cellular transformation. Immunoblot analysis reveals that phosphorylation of myosin regulatory light chain (RLC{sub 20}) is 5.6±0.5 fold reduced in 3MC treated myotubes in comparison to vehicle treated myotubes during the fragmentation of myotubes. In contrast, levels of myogenic factors such as MyoD, Myogenin and cell cycle regulators such as Cyclin D, Cyclin E1 remain unchanged as assessed by real-time PCR array and reverse transcriptase PCR analysis, respectively. Interestingly, addition of the myosin light chain kinase inhibitor, ML-7, enhances the fragmentation, whereas phosphatase inhibitor perturbs the 3MC induced fragmentation of myotubes. These results suggest that decrease in RLC{sub 20} phosphorylation may be associated with the fragmentation step of dedifferentiation. - Highlights: • 3-Methylcholanthrene induces fragmentation of C2C12-myotubes. • Dedifferentiation can be divided into two steps – fragmentation and proliferation. • Fragmentation is associated with rearrangement of nonmuscle myosin II. • Genes associated with differentiation and proliferation are not altered during fragmentation. • Phosphorylation of myosin regulatory light chain is reduced during fragmentation.

Velocity distribution of fragments of catastrophic impacts

Science.gov (United States)

Takagi, Yasuhiko; Kato, Manabu; Mizutani, Hitoshi

1992-01-01

Three dimensional velocities of fragments produced by laboratory impact experiments were measured for basalts and pyrophyllites. The velocity distribution of fragments obtained shows that the velocity range of the major fragments is rather narrow, at most within a factor of 3 and that no clear dependence of velocity on the fragment mass is observed. The NonDimensional Impact Stress (NDIS) defined by Mizutani et al. (1990) is found to be an appropriate scaling parameter to describe the overall fragment velocity as well as the antipodal velocity.

Refolding Technologies for Antibody Fragments

Directory of Open Access Journals (Sweden)

Tsutomu Arakawa

2014-05-01

Full Text Available Refolding is one of the production technologies for pharmaceutical grade antibody fragments. Detergents and denaturants are primarily used to solubilize the insoluble proteins. The solubilized and denatured proteins are refolded by reducing the concentration of the denaturants or detergents. Several refolding technologies have been used for antibody fragments, comprising dilution, dialysis, solid phase solvent exchange and size exclusion chromatography, as reviewed here. Aggregation suppressor or folding-assisting agents, including arginine hydrochloride, ionic liquids and detergents or denaturants at low concentrations, are included in the refolding solvent to enhance refolding yield.

Fragmentation of dimethyl ether in femtosecond intense field

Science.gov (United States)

Zhu, Jingyi; Guo, Wei; Wang, Yanqiu; Wang, Li

2006-08-01

The fragmentation of dimethyl ether (DME) in intense femtosecond laser field has been studied at 810, 405 and 270 nm with intensities up to 2.48 × 10 15, 3.86 × 10 15 and 1.62 × 10 14 W/cm 2, respectively. At 405 nm, DME is possibly firstly ionized by multiphoton absorption, and then parent ion DME + dissociates into fragments via filed-induced dissociation. For 810 and 270 nm laser fields, DME firstly dissociates into CH 3O and CH 3 fragments and then these neutral fragments are ionized by field tunneling. Another possible way for DME to dissociate at 810 and 270 nm is that DME is ionized by intense field ejection of inner valance electron and then the excited DME + dissociates into fragment ions. Ultrafast rearrangement of DME or DME + in intense field may be responsible to the unpredictable fragment ions, CHO+/C2H5+andH2+.

Fragment-based drug design and identification of HJC0123, a novel orally bioavailable STAT3 inhibitor for cancer therapy

Science.gov (United States)

Chen, Haijun; Yang, Zhengduo; Ding, Chunyong; Chu, Lili; Zhang, Yusong; Terry, Kristin; Liu, Huiling; Shen, Qiang; Zhou, Jia

2013-01-01

Fragment-based drug design (FBDD) is a promising approach for the generation of lead molecules with enhanced activity and especially drug-like properties against therapeutic targets. Herein, we report the fragment-based drug design, systematic chemical synthesis and pharmacological evaluation of novel scaffolds as potent anticancer agents by utilizing six privileged fragments from known STAT3 inhibitors. Several new molecules such as compounds 5, 12, and 19 that may act as advanced chemical leads have been identified. The most potent compound 5 (HJC0123) has demonstrated to inhibit STAT3 promoter activity, downregulate phosphorylation of STAT3, increase the expression of cleaved caspase-3, inhibit cell cycle progression and promote apoptosis in breast and pancreatic cancer cells with low micromolar to nanomolar IC50 values. Furthermore, compound 5 significantly suppressed estrogen receptor (ER)-negative breast cancer MDA-MB-231 xenograft tumor growth in vivo (p.o.), indicating its great potential as an efficacious and orally bioavailable drug candidate for human cancer therapy. PMID:23416191

Correlations of fragments and their sequential products from the 3He-induced reaction on 58Ni at 130 MeV

International Nuclear Information System (INIS)

Stockhorst, H.

1986-01-01

The 3 He breakup on the 58 Ni nucleus was studied with a projectile energy of 130 MeV. The main topic of this studies lies thereby on the absorptive breakup in which a fragment from the 3 He breakup is absorbed by the target nucleus. Beside the single and coincidence measurements on the 3 He breakup on the one hand the reaction 58 Ni(d,pp') was studied at a projectile energy of 80 MeV and on the other hand the inclusive reactions 58 Ni(d,yX) and 58 Ni(p,yX) whereby the light particles y up to A=3 were spectroscoped in a wide angular range. The projectile energies were selected in such a way that they correspond almost to the energies of the primary fragments deuteron and proton from the 3 He breakup (E d =79 MeV and E p =39 MeV). The study of the elastic 3 He breakup resulted that the shapes of the deuteron and proton spectra can be well described by a PWBA model and reproduce the momentum distribution of the fragments before the 3 He breakup. The spectra are therefore determined by properties of the projectiles. However the proton and deuteron spectra from the absorptive breakup show distinct components which cannot be reduced to 3 He properties. Rather they are in their shape comparable with the inclusive spectra of the (d,p) respectively (p,p') reaction. Especially this is valid for spectra from the 3 He breakup in which a fragment was registrated with an energy corresponding to the projectile velocity. This suggests that in the absorptive 3 He breakup a two-stage process is present in which after the 3 He fragmentation in a second stage a (d,p) or (p,p') reaction occurs. The study of the 3 He breakup resulted that such processes yield an essential contribution to the inclusive cross section of the reactions 58 Ni( 3 He,dX) and 58 Ni( 3 He,pX). (HSI) [de

Isolation and preparation of 3H-tetrandrine

International Nuclear Information System (INIS)

Xunyang Huang; Yin Wang; Zangde Lu

1994-01-01

Tetrandrine is a bisbenzytehahydroisoquinoline alkaloid. Its structure is very complex and the preparation of labeled derivatives is difficult. We have prepared 3 H-tetrandrine using the tritium gas exposure method. This method produces many fragments which make isolation and purification of small quantities difficult. We investigated these fragments of unlabeled d-tetrandrine and found almost all contain one to several hydroxide groups. Using this information, we designed a two-step paper chromatography method for isolation and purification citric acid buffer to the paper to block the migration of hydroxide group fragments of tetrandrine. 3 H-tetrandrine was successfully prepared with a radiochemical purity of 90%. (author)

Evolution of fragment-fragment correlations in reactions of 197Au and 107,109Ag with 40Ar from 7A to 34A MeV

International Nuclear Information System (INIS)

Ethvignot, T.; Ajitanand, N.N.; Alexander, J.M.; Bauge, E.; Elmaani, A.; Kowalski, L.; Lopez, M.; Magda, M.T.; Desesquelles, P.; Elhage, H.; Giorni, A.; Heuer, D.; Kox, S.; Lleres, A.; Merchez, F.; Morand, C.; Rebreyend, D.; Stassi, P.; Viano, J.B.; Benrachi, F.; Chambon, B.; Cheynis, B.; Drain, D.; Pastor, C.

1992-01-01

In-plane and out-of-plane angular correlations have been measured between fragments of Z>3, Li fragments, 3,4 He, and 1,2,3 H. The changing patterns for 40 Ar induced reactions of 7A, 17A, 27A, and 34A MeV give an overview of the decreasing importance of mass-symmetric fissionlike reactions at the expense of a broad range of more mass-asymmetric breakups. Evidence is given that these fragments come from a central collision group of reactions that have similar violence and from which many combinations of fragments and particles are ejected. Very similar azimuthal angular correlations are observed for particles with a Li fragment and for particles with a pair of heavier fragments (Z>3). This similarity suggests comparable strengths of association with the reaction plane for single Li fragments and for fragment pairs of Z>3. Azimuthal angular correlations for Li-Li pairs exhibit distinct asymmetries; their interpretation via trajectory-model calculations indicates mean delay times of ∼5x10 -22 s

Route to three-dimensional fragments using diversity-oriented synthesis.

Science.gov (United States)

Hung, Alvin W; Ramek, Alex; Wang, Yikai; Kaya, Taner; Wilson, J Anthony; Clemons, Paul A; Young, Damian W

2011-04-26

Fragment-based drug discovery (FBDD) has proven to be an effective means of producing high-quality chemical ligands as starting points for drug-discovery pursuits. The increasing number of clinical candidate drugs developed using FBDD approaches is a testament of the efficacy of this approach. The success of fragment-based methods is highly dependent on the identity of the fragment library used for screening. The vast majority of FBDD has centered on the use of sp(2)-rich aromatic compounds. An expanded set of fragments that possess more 3D character would provide access to a larger chemical space of fragments than those currently used. Diversity-oriented synthesis (DOS) aims to efficiently generate a set of molecules diverse in skeletal and stereochemical properties. Molecules derived from DOS have also displayed significant success in the modulation of function of various "difficult" targets. Herein, we describe the application of DOS toward the construction of a unique set of fragments containing highly sp(3)-rich skeletons for fragment-based screening. Using cheminformatic analysis, we quantified the shapes and physical properties of the new 3D fragments and compared them with a database containing known fragment-like molecules.

Synthesis and photocatalytic application of α-Fe2O3/ZnO fine particles prepared by two-step chemical method

Directory of Open Access Journals (Sweden)

Patij Shah

2013-06-01

Full Text Available Composite iron oxide-Zinc oxide (α-Fe2O3/ZnO was synthesized by two-step method: in the first one step uniform α-Fe2O3 particles were prepared through a hydrolysis process of ferric chloride at 80 °C. In the second step, the ZnO particles were included in the α-Fe2O3 particles by a zinc acetate [Zn(Ac2·2H2O] assisted hydrothermal method at low temperature (90°C±C. The α-Fe2O3 and ZnO phases were identified by XRD, energy dispersive X-ray analysis (EDX. The photoreactivities of α-Fe2O3/ZnO nanoparticles under UV irradiation were quantified by the degradation of formaldehyde.

Luciferase assay to study the activity of a cloned promoter DNA fragment.

Science.gov (United States)

Solberg, Nina; Krauss, Stefan

2013-01-01

Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

Universal odd-even staggering in isotopic fragmentation and spallation cross sections of neutron-rich fragments

Science.gov (United States)

Mei, B.; Tu, X. L.; Wang, M.

2018-04-01

An evident odd-even staggering (OES) in fragment cross sections has been experimentally observed in many fragmentation and spallation reactions. However, quantitative comparisons of this OES effect in different reaction systems are still scarce for neutron-rich nuclei near the neutron drip line. By employing a third-order difference formula, the magnitudes of this OES in extensive experimental cross sections are systematically investigated for many neutron-rich nuclei with (N -Z ) from 1 to 23 over a broad range of atomic numbers (Z ≈3 -50 ). A comparison of these magnitude values extracted from fragment cross sections measured in different fragmentation and spallation reactions with a large variety of projectile-target combinations over a wide energy range reveals that the OES magnitude is almost independent of the projectile-target combinations and the projectile energy. The weighted average of these OES magnitudes derived from cross sections accurately measured in different reaction systems is adopted as the evaluation value of the OES magnitude. These evaluated OES magnitudes are recommended to be used in fragmentation and spallation models to improve their predictions for fragment cross sections.

WHAT IS CONTROLLING THE FRAGMENTATION IN THE INFRARED DARK CLOUD G14.225–0.506?: DIFFERENT LEVELS OF FRAGMENTATION IN TWIN HUBS

Energy Technology Data Exchange (ETDEWEB)

Busquet, Gemma; Girart, Josep Miquel [Institut de Ciències de l’Espai (CSIC-IEEC), Campus UAB, Carrer de Can Magrans, S/N, E-08193, Cerdanyola del Vallès, Catalunya (Spain); Estalella, Robert [Departament d’Astronomia i Meteorologia, Institut de Ciències del Cosmos (ICC), Universitat de Barcelona (IEEC-UB), Martí i Franquès, 1, E-08028 Barcelona, Catalunya (Spain); Palau, Aina [Instituto de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, P.O. Box 3-72, 58090 Morelia, Michoacán, México (Mexico); Liu, Hauyu Baobab; Ho, Paul T. P. [Academia Sinica Institute of Astronomy and Astrophysics, Taipei, Taiwan (China); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); De Gregorio-Monsalvo, Itziar [European Southern Observatory (ESO), Karl-Schwarzschild-Str. 2, D-85748 Garching (Germany); Pillai, Thushara [Max Planck Institut für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Anglada, Guillem, E-mail: busquet@ice.cat [Instituto de Astrofísica de Andalucía, CSIC, Glorieta de la Astronomía, s/n, E-18008, Granada (Spain)

2016-03-20

We present observations of the 1.3 mm continuum emission toward hub-N and hub-S of the infrared dark cloud G14.225–0.506 carried out with the Submillimeter Array, together with observations of the dust emission at 870 and 350 μm obtained with APEX and CSO telescopes. The large-scale dust emission of both hubs consists of a single peaked clump elongated in the direction of the associated filament. At small scales, the SMA images reveal that both hubs fragment into several dust condensations. The fragmentation level was assessed under the same conditions and we found that hub-N presents 4 fragments while hub-S is more fragmented, with 13 fragments identified. We studied the density structure by means of a simultaneous fit of the radial intensity profile at 870 and 350 μm and the spectral energy distribution adopting a Plummer-like function to describe the density structure. The parameters inferred from the model are remarkably similar in both hubs, suggesting that density structure could not be responsible for determining the fragmentation level. We estimated several physical parameters, such as the level of turbulence and the magnetic field strength, and we found no significant differences between these hubs. The Jeans analysis indicates that the observed fragmentation is more consistent with thermal Jeans fragmentation compared with a scenario in which turbulent support is included. The lower fragmentation level observed in hub-N could be explained in terms of stronger UV radiation effects from a nearby H ii region, evolutionary effects, and/or stronger magnetic fields at small scales, a scenario that should be further investigated.

WHAT IS CONTROLLING THE FRAGMENTATION IN THE INFRARED DARK CLOUD G14.225–0.506?: DIFFERENT LEVELS OF FRAGMENTATION IN TWIN HUBS

International Nuclear Information System (INIS)

Busquet, Gemma; Girart, Josep Miquel; Estalella, Robert; Palau, Aina; Liu, Hauyu Baobab; Ho, Paul T. P.; Zhang, Qizhou; De Gregorio-Monsalvo, Itziar; Pillai, Thushara; Anglada, Guillem

2016-01-01

We present observations of the 1.3 mm continuum emission toward hub-N and hub-S of the infrared dark cloud G14.225–0.506 carried out with the Submillimeter Array, together with observations of the dust emission at 870 and 350 μm obtained with APEX and CSO telescopes. The large-scale dust emission of both hubs consists of a single peaked clump elongated in the direction of the associated filament. At small scales, the SMA images reveal that both hubs fragment into several dust condensations. The fragmentation level was assessed under the same conditions and we found that hub-N presents 4 fragments while hub-S is more fragmented, with 13 fragments identified. We studied the density structure by means of a simultaneous fit of the radial intensity profile at 870 and 350 μm and the spectral energy distribution adopting a Plummer-like function to describe the density structure. The parameters inferred from the model are remarkably similar in both hubs, suggesting that density structure could not be responsible for determining the fragmentation level. We estimated several physical parameters, such as the level of turbulence and the magnetic field strength, and we found no significant differences between these hubs. The Jeans analysis indicates that the observed fragmentation is more consistent with thermal Jeans fragmentation compared with a scenario in which turbulent support is included. The lower fragmentation level observed in hub-N could be explained in terms of stronger UV radiation effects from a nearby H ii region, evolutionary effects, and/or stronger magnetic fields at small scales, a scenario that should be further investigated

Kaon fragmentation function from NJL-jet model

International Nuclear Information System (INIS)

Matevosyan, Hrayr H.; Thomas, Anthony W.; Bentz, Wolfgang

2010-01-01

The NJL-jet model provides a sound framework for calculating the fragmentation functions in an effective chiral quark theory, where the momentum and isospin sum rules are satisfied without the introduction of ad hoc parameters [1]. Earlier studies of the pion fragmentation functions using the Nambu-Jona-Lasinio (NJL) model within this framework showed good qualitative agreement with the empirical parameterizations. Here we extend the NJL-jet model by including the strange quark. The corrections to the pion fragmentation function and corresponding kaon fragmentation functions are calculated using the elementary quark to quark-meson fragmentation functions from NJL. The results for the kaon fragmentation function exhibit a qualitative agreement with the empirical parameterizations, while the unfavored strange quark fragmentation to pions is shown to be of the same order of magnitude as the unfavored light quark's. The results of these studies are expected to provide important guidance for the analysis of a large variety of semi-inclusive data.

Lower sperm DNA fragmentation after r-FSH administration in functional hypogonadotropic hypogonadism.

Science.gov (United States)

Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana

2013-04-01

An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .

Probing the direct step of relativistic heavy ion fragmentation: (12C, 11B+p) at 2.1 GeV/nucleon with C and CH2 targets

International Nuclear Information System (INIS)

Webb, M.L.

1987-06-01

Relativistic heavy ion collisions may be classified as central (and near central), peripheral, and grazing with each collision type producing different proton and other charged projectile fragment scattering mechanisms and characteristics. This report focuses on peripheral and grazing collisions in the fragmentation of Carbon-12 into Boron-11 and a proton, testing models of the kinetics involved in this reaction. The data were measured at the Heavy Ion Superconducting Spectrometer (HISS) at Lawrence Berkeley Laboratory and include excitation energy for the p/Boron-11 pair, and rapidity versus transverse momentum for protons and Boron-11. 58 refs., 35 figs., 8 tabs

Efficient one-step direct labelling of recombinant antibodies with technetium-99m

International Nuclear Information System (INIS)

Liberatore, M.; Neri, D.; Neri, G.; Pini, A.; Lurilli, A.P.; Ponzo, F.; Spampinato, G.; Padula, F.; Pala, A.; Colella, A.C.

1995-01-01

High-affinity bacterially expressed antibody fragments can nowadays be cloned from established hybridomas or, more conveniently, isolated directly from antibody libraries displayed on filamentous phage. Such antibodies can be tagged with C-terminal peptide tags containing one cysteine residue, which represents a convenient functionalisation site for a number of applications, including technetium-99m labelling. Here we describe a simple one-step method for 99m Tc labelling of cysteine-tagged recombinant antibodies with more than 50% radionuclide incorporation. The labelled antibodies displayed full retention of immuoreactivity and good stability. (orig.)

Efficient one-step direct labelling of recombinant antibodies with technetium-99m

Energy Technology Data Exchange (ETDEWEB)

Liberatore, M. [Dipartimento di Medicina Sperimentale, Sezione di Medicina Nucleare, Policlinico Umberto I, Universita di Roma `La Sapienza` (Italy); Neri, D. [Cambridge Centre for Protein Engineering - MRC Centre (United Kingdom); Neri, G. [Dipartimento di Biologia Molecolare, Universita di Siena (Italy); Pini, A. [Dipartimento di Biologia Molecolare, Universita di Siena (Italy); Lurilli, A.P. [Dipartimento di Medicina Sperimentale, Sezione di Medicina Nucleare, Policlinico Umberto I, Universita di Roma `La Sapienza` (Italy); Ponzo, F. [Dipartimento di Medicina Sperimentale, Sezione di Medicina Nucleare, Policlinico Umberto I, Universita di Roma `La Sapienza` (Italy); Spampinato, G. [Laboratorio di Biochimica degli Ormoni Sessuali, Il Instituto di Clinica Ostetrica e Ginecologica, Universita di Roma `La Sapienza` (Italy); Padula, F. [Laboratorio di Biochimica degli Ormoni Sessuali, Il Instituto di Clinica Ostetrica e Ginecologica, Universita di Roma `La Sapienza` (Italy); Pala, A. [Laboratorio di Biochimica degli Ormoni Sessuali, Il Instituto di Clinica Ostetrica e Ginecologica, Universita di Roma `La Sapienza` (Italy); Colella, A.C. [Dipartimento di Medicina Sperimentale, Sezione di Medicina Nucleare, Policlinico Umberto I, Universita di Roma `La Sapienza` (Italy)

1995-11-01

High-affinity bacterially expressed antibody fragments can nowadays be cloned from established hybridomas or, more conveniently, isolated directly from antibody libraries displayed on filamentous phage. Such antibodies can be tagged with C-terminal peptide tags containing one cysteine residue, which represents a convenient functionalisation site for a number of applications, including technetium-99m labelling. Here we describe a simple one-step method for {sup 99m}Tc labelling of cysteine-tagged recombinant antibodies with more than 50% radionuclide incorporation. The labelled antibodies displayed full retention of immuoreactivity and good stability. (orig.)

The Y4-RNA fragment, a potential diagnostic marker, exists in saliva

Directory of Open Access Journals (Sweden)

Tatsuya Ishikawa

2017-06-01

Full Text Available The 94-nt full-length Y4-RNA is thought to have roles in the initiation of DNA replication and RNA quality control. Although its 31/32-nt fragment also exists abundantly in plasma, little is known about its physiological role. Since the 31/32-nt Y4-RNA fragment in sera is reported to be more abundant in patients with coronary artery disease than healthy persons, the fragment may have a potential for a diagnostic and/or prognostic biomarker for some diseases regardless of its functionality. As a step toward further investigation of its potential utility, we examined if the 31/32-nt Y4-RNA fragment also exists in saliva that can be obtained noninvasively, and showed that, in addition to the 31/32-nt fragment, 14- and 11-nt Y4-RNA fragments are present in all saliva RNA samples from four healthy persons. We established a PCR method to accurately quantitate the amount of the 31/32-nt Y4-RNA fragment, and estimated its amount in saliva of healthy persons to be 0.06 ± 0.04 fmol per nanogram of saliva RNA. We also tried to develop an easier quantitation method using a DNA molecular beacon. Keywords: Y4-RNA fragment, Saliva RNA, Diagnostic/prognostic marker, Next-generation sequencing, RT-PCR, Molecular beacon

Heavy fragment radioactivity

International Nuclear Information System (INIS)

Silisteanu, I.

1991-06-01

The effect of collective mode excitation in heavy fragment radioactivity (HFR) is explored and discussed in the light of current experimental data. It is found that the coupling and resonance effects in fragment interaction and also the proper angular momentum effects may lead to an important enhancing of the emission process. New useful procedures are proposed for the study of nuclear decay properties. The relations between different decay processes are investigated in detail. We are also trying to understand and explain in a unified way the reaction mechanisms in decay phenomena. (author). 17 refs, 4 figs, 3 tabs

Gravitational fragmentation caught in the act: the filamentary Musca molecular cloud

Science.gov (United States)

Kainulainen, J.; Hacar, A.; Alves, J.; Beuther, H.; Bouy, H.; Tafalla, M.

2016-02-01

Context. Filamentary structures are common in molecular clouds. Explaining how they fragment to dense cores is a missing step in understanding their role in star formation. Aims: We perform a case study of whether low-mass filaments are close to hydrostatic prior to their fragmentation, and whether their fragmentation agrees with gravitational fragmentation models. To accomplish this, we study the ~6.5 pc long Musca molecular cloud, which is an ideal candidate for a filament at an early stage of fragmentation. Methods: We employ dust extinction mapping, in conjunction with near-infrared JHKS-band data from the CTIO/NEWFIRM instrument, and 870 μm dust continuum emission data from the APEX/LABOCA instrument to estimate column densities in Musca. We use the data to identify fragments from the cloud and to determine the radial density distribution of its filamentary part. We compare the cloud's morphology with 13CO and C18O line emission observed with the APEX/SHeFI instrument. Results: The Musca cloud is pronouncedly fragmented at its ends, but harbors a remarkably well-defined, ~1.6 pc long filament in its center region. The line mass of the filament is 21-31 M⊙ pc-1 and the full width at half maximum (FWHM) 0.07 pc. The radial profile of the filament can be fitted with a Plummer profile, which has the power-index of 2.6 ± 11% and is flatter than that of an infinite hydrostatic filament. The profile can also be fitted with a hydrostatic cylinder truncated by external pressure. These models imply a central density of ~5-10 × 104 cm-3. The fragments in the cloud have a mean separation of ~0.4 pc, in agreement with gravitational fragmentation. These properties, together with the subsonic and velocity-coherent nature of the cloud, suggest a scenario in which an initially hydrostatic cloud is currently gravitationally fragmenting. The fragmentation started a few tenths of a Myr ago from the ends of the cloud, leaving its center still relatively nonfragmented

Isolation and preparation of [sup 3]H-tetrandrine

Energy Technology Data Exchange (ETDEWEB)

Xunyang Huang; Yin Wang; Zangde Lu (Institute of the Pharmaceutic Industry, Shanghai, SH (China). Div. of Chemistry)

1994-10-01

Tetrandrine is a bisbenzytehahydroisoquinoline alkaloid. Its structure is very complex and the preparation of labeled derivatives is difficult. We have prepared [sup 3]H-tetrandrine using the tritium gas exposure method. This method produces many fragments which make isolation and purification of small quantities difficult. We investigated these fragments of unlabeled d-tetrandrine and found almost all contain one to several hydroxide groups. Using this information, we designed a two-step paper chromatography method for isolation and purification citric acid buffer to the paper to block the migration of hydroxide group fragments of tetrandrine. [sup 3]H-tetrandrine was successfully prepared with a radiochemical purity of 90%. (author).

Microsoft Office SharePoint Designer 2007 Step by Step

CERN Document Server

Coventry, Penelope

2008-01-01

The smart way to learn Office SharePoint Designer 2007-one step at a time! Work at your own pace through the easy numbered steps, practice files on CD, helpful hints, and troubleshooting tips to master the fundamentals of building customized SharePoint sites and applications. You'll learn how to work with Windows® SharePoint Services 3.0 and Office SharePoint Server 2007 to create Web pages complete with Cascading Style Sheets, Lists, Libraries, and customized Web parts. Then, make your site really work for you by adding data sources, including databases, XML data and Web services, and RSS fe

Endovascular Removal of Fractured Inferior Vena Cava Filter Fragments: 5-Year Registry Data with Prospective Outcomes on Retained Fragments.

Science.gov (United States)

Kesselman, Andrew J; Hoang, Nam Sao; Sheu, Alexander Y; Kuo, William T

2018-06-01

To evaluate the safety and efficacy of attempted percutaneous filter fragment removal during retrieval of fractured inferior vena cava (IVC) filters and to report outcomes associated with retained filter fragments. Over a 5-year period, 82 consecutive patients presenting with a fractured IVC filter were prospectively enrolled into an institutional review board-approved registry. There were 27 men and 55 women (mean, 47 y; range, 19-85 y). After main filter removal, percutaneous removal of fragments was attempted if they were deemed intravascular and accessible on preprocedural computed tomography (CT), cone-beam CT, and/or intravascular ultrasound; distal pulmonary artery (PA) fragments were left alone. A total of 185 fragments were identified (81 IVC, 33 PA, 16 cardiac, 2 hepatic vein, 1 renal vein, 1 aorta, 51 retroperitoneal). Mean filter dwell time was 2,183 days (range, 59-9,936 d). Eighty-seven of 185 fragments (47%) were deemed amenable to attempted removal: 65 IVC, 11 PA, 8 cardiac, 2 hepatic, and 1 aortic. Primary safety outcomes were major procedure-related complications. Fragment removal was successful in 78 of 87 cases (89.7%; 95% confidence interval [CI], 81.3-95.2). There were 6 minor complications with no consequence (6.9%; 95% CI, 2.6-14.4) involving intraprocedural fragment embolization and 1 major complication (1.1%; 95% CI, 0.0-6.2), a cardiac tamponade that was successfully treated. The complication rate from attempted cardiac fragment removal was 12.5% (1 of 8; 95% CI, 0.3-52.7). Among patients with retained cardiopulmonary fragments (n = 19), 81% remained asymptomatic during long-term clinical follow-up of 845 days (range, 386-2,071 d). Percutaneous removal of filter fragments from the IVC and proximal PAs is safe and effective overall, but attempted intracardiac fragment removal carries a higher risk of complication. Most residual filter fragments not amenable to percutaneous removal remain asymptomatic and may be monitored clinically

One step versus two step approach for gestational diabetes screening: systematic review and meta-analysis of the randomized trials.

Science.gov (United States)

Saccone, Gabriele; Caissutti, Claudia; Khalifeh, Adeeb; Meltzer, Sara; Scifres, Christina; Simhan, Hyagriv N; Kelekci, Sefa; Sevket, Osman; Berghella, Vincenzo

2017-12-03

To compare both the prevalence of gestational diabetes mellitus (GDM) as well as maternal and neonatal outcomes by either the one-step or the two-step approaches. Electronic databases were searched from their inception until June 2017. We included all randomized controlled trials (RCTs) comparing the one-step with the two-step approaches for the screening and diagnosis of GDM. The primary outcome was the incidence of GDM. Three RCTs (n = 2333 participants) were included in the meta-analysis. 910 were randomized to the one step approach (75 g, 2 hrs), and 1423 to the two step approach. No significant difference in the incidence of GDM was found comparing the one step versus the two step approaches (8.4 versus 4.3%; relative risk (RR) 1.64, 95%CI 0.77-3.48). Women screened with the one step approach had a significantly lower risk of preterm birth (PTB) (3.7 versus 7.6%; RR 0.49, 95%CI 0.27-0.88), cesarean delivery (16.3 versus 22.0%; RR 0.74, 95%CI 0.56-0.99), macrosomia (2.9 versus 6.9%; RR 0.43, 95%CI 0.22-0.82), neonatal hypoglycemia (1.7 versus 4.5%; RR 0.38, 95%CI 0.16-0.90), and admission to neonatal intensive care unit (NICU) (4.4 versus 9.0%; RR 0.49, 95%CI 0.29-0.84), compared to those randomized to screening with the two step approach. The one and the two step approaches were not associated with a significant difference in the incidence of GDM. However, the one step approach was associated with better maternal and perinatal outcomes.

Gallstone fragmentation by control electrohydraulic lithotripsy

International Nuclear Information System (INIS)

Tung, G.A.; Mueller, P.R.; Brink, J.A.; Saini, S.; Picus, D.; Simeone, J.F.; Ferrucci, J.T.

1989-01-01

The authors have performed in vitro contact electrohydraulic lithotripsy (EHL) of 100 gallstones > 10 mm in diameter to identify physical and technical factors that affect fragmentation success. Ninety-one of 100 stones were fragmented with a 3-F electrode (average, seven shocks; range, 1--42); only 12 stones were fragmented with a single shock. Of the nine stones refractory to 50 shocks, four were > 30 mm in diameter and five stones were densely calcified. The most important variable determining power requirements for fragmentation was gallstone size (R = .58), but radiographic calcification of gallstones was also important (R = .47). Stones < 15 mm tended to produce fragments of left-angle 2 mm; stones right-angle 20 mm tended to produce two to five large discrete fragments (P , .05). In addition, lithotripsy could be conducted equally well in 1:1 dilute diatrizoate contrast agent as in 1:6 normal saline, suggesting that contact EHL could be performed under fluoroscopy

Jet fragmentation

International Nuclear Information System (INIS)

Saxon, D.H.

1985-10-01

The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)

AUTOMATIC TEXTURE RECONSTRUCTION OF 3D CITY MODEL FROM OBLIQUE IMAGES

Directory of Open Access Journals (Sweden)

J. Kang

2016-06-01

Full Text Available In recent years, the photorealistic 3D city models are increasingly important in various geospatial applications related to virtual city tourism, 3D GIS, urban planning, real-estate management. Besides the acquisition of high-precision 3D geometric data, texture reconstruction is also a crucial step for generating high-quality and visually realistic 3D models. However, most of the texture reconstruction approaches are probably leading to texture fragmentation and memory inefficiency. In this paper, we introduce an automatic framework of texture reconstruction to generate textures from oblique images for photorealistic visualization. Our approach include three major steps as follows: mesh parameterization, texture atlas generation and texture blending. Firstly, mesh parameterization procedure referring to mesh segmentation and mesh unfolding is performed to reduce geometric distortion in the process of mapping 2D texture to 3D model. Secondly, in the texture atlas generation step, the texture of each segmented region in texture domain is reconstructed from all visible images with exterior orientation and interior orientation parameters. Thirdly, to avoid color discontinuities at boundaries between texture regions, the final texture map is generated by blending texture maps from several corresponding images. We evaluated our texture reconstruction framework on a dataset of a city. The resulting mesh model can get textured by created texture without resampling. Experiment results show that our method can effectively mitigate the occurrence of texture fragmentation. It is demonstrated that the proposed framework is effective and useful for automatic texture reconstruction of 3D city model.

Fragmentation of rotating protostellar clouds

International Nuclear Information System (INIS)

Tohline, J.E.

1980-01-01

We examine, with a three-dimensional hydrodynamic computer code, the behavior of rotating, isothermal gas clouds as they collapse from Jeans unstable configurations, in order to determine whether they are susceptible to fragmentation during the initial dynamic collapse phase of their evolution. We find that a gas cloud will not fragment unless (a) it begins collapsing from a radius much smaller than the Jeans radius (i.e., the cloud initially encloses many Jeans masses) and (b) irregularities in the cloud's initial structure (specifically, density inhomogeneities) enclose more than one Jeans mass of material. Gas pressure smooths out features that are not initially Jeans unstable while rotation plays no direct role in damping inhomogeneities. Instead of fragmenting, most of our models collapse to a ring configuration (as has been observed by other investigators in two-dimensional, axisymmetric models). The rings appear to be less susceptible to gragmentation from arbitrary perturbations in their structure than has previously been indicated in other work. Because our models, which include the effects of gas pressure, do not readily fragment during a phase of dynamic collapse, we suggest that gas clouds in the galactic disk undergo fragmentation only during quasi-equilibrium phases of their evolution

Effect of step-aging on the fracture toughness of Ti-15V-3Cr-3Sn-3Al alloy

International Nuclear Information System (INIS)

Niwa, Naotake

1993-01-01

Development and an application of a new high-low step-aging to improve the fracture toughness-strength balance of a Ti-15V-3Cr-3Sn-3Al alloy are studied. The high-low step-aging of aging at higher temperatures followed by aging at lower temperatures produces bi-modal microstructure composed of coarse and fine alpha precipitates in beta matrix. It greatly improves fracture toughness-strength balance compared with aging at a single temperature. Homogeneous distribution of coarse alpha precipitates produced by adding pre-aging at 573K before the high-low step-aging tends to reduce the superiority of the bi-modal microstructure in fracture toughness. The improvement is provided by the formation of microcracks and voids in the coarse alpha precipitates and rugged crack propagation due to the uneven microstructure. The high-low step-aging is applied to a TIG weldment of the alloy to improve the mechanical properties of the weldment. In the TIG weldment, strength of a fusion zone becomes much higher than that of a base metal after aging at a single temperature because of different aging response. In the first high temperature aging of the high low step-aging, coarse alpha particles that strengthen little and suppress strengthening by fine alpha precipitation in low temperature re-aging, precipitate more in fusion zone than in base metal because of the enhancement of aging in fusion zone. Therefore, strengthening of fusion zone in re-aging is less than in the base metal, resulting in comparable strength between the fusion zone and the base metal after re-aging. The bi-modal microstructure produced by the step-aging also improves, the, fracture toughness of the fusion zone of the weldment

Beyond the fragmentation threshold hypothesis: regime shifts in biodiversity across fragmented landscapes.

Directory of Open Access Journals (Sweden)

Renata Pardini

Full Text Available Ecological systems are vulnerable to irreversible change when key system properties are pushed over thresholds, resulting in the loss of resilience and the precipitation of a regime shift. Perhaps the most important of such properties in human-modified landscapes is the total amount of remnant native vegetation. In a seminal study Andrén proposed the existence of a fragmentation threshold in the total amount of remnant vegetation, below which landscape-scale connectivity is eroded and local species richness and abundance become dependent on patch size. Despite the fact that species patch-area effects have been a mainstay of conservation science there has yet to be a robust empirical evaluation of this hypothesis. Here we present and test a new conceptual model describing the mechanisms and consequences of biodiversity change in fragmented landscapes, identifying the fragmentation threshold as a first step in a positive feedback mechanism that has the capacity to impair ecological resilience, and drive a regime shift in biodiversity. The model considers that local extinction risk is defined by patch size, and immigration rates by landscape vegetation cover, and that the recovery from local species losses depends upon the landscape species pool. Using a unique dataset on the distribution of non-volant small mammals across replicate landscapes in the Atlantic forest of Brazil, we found strong evidence for our model predictions--that patch-area effects are evident only at intermediate levels of total forest cover, where landscape diversity is still high and opportunities for enhancing biodiversity through local management are greatest. Furthermore, high levels of forest loss can push native biota through an extinction filter, and result in the abrupt, landscape-wide loss of forest-specialist taxa, ecological resilience and management effectiveness. The proposed model links hitherto distinct theoretical approaches within a single framework

Missing Fragments: Detecting Cooperative Binding in Fragment-Based Drug Design

Science.gov (United States)

2012-01-01

The aim of fragment-based drug design (FBDD) is to identify molecular fragments that bind to alternate subsites within a given binding pocket leading to cooperative binding when linked. In this study, the binding of fragments to human phenylethanolamine N-methyltransferase is used to illustrate how (a) current protocols may fail to detect fragments that bind cooperatively, (b) theoretical approaches can be used to validate potential hits, and (c) apparent false positives obtained when screening against cocktails of fragments may in fact indicate promising leads. PMID:24900472

Fragmentation of Continental United States Forests

Science.gov (United States)

Kurt H. Riitters; James D. Wickham; Robert V. O' Neill; K. Bruce Jones; Elizabeth R. Smith; John W. Coulston; Timothy G. Wade; Jonathan H. Smith

2002-01-01

We report a multiple-scale analysis of forest fragmentation based on 30-m (0.09 ha pixel-1) land- cover maps for the conterminous United States. Each 0.09-ha unit of forest was classified according to fragmentation indexes measured within the surrounding landscape, for five landscape sizes including 2.25, 7.29, 65.61, 590.49, and 5314.41 ha....

Does string fragmentation reveal more than longitudinal phase space?

International Nuclear Information System (INIS)

Schulze, H.J.; Aichelin, J.

1989-01-01

The fragmentation of a color string into hadrons is assumed to be a sequence of binary decays governed by Fermi's golden rule. In each decay step a hadron is produced and a string with lower energy is left. Assuming that the transition matrix element depends on p/sub T/ only the decay is completely determined by the longitudinal phase space and one parameter, the 2 > of the produced hadrons. We find an almost complete agreement with the experimental momentum (longitudinal and transversal) and multiplicity distributions and the number of produced particles. The ''seagull'' shape of 2 >(x) turns out to be completely due to the sphericity analysis. This leaves little room for extracting information of QCD from single-particle-inclusive fragmentation data

The gradual development steps of the external coupled RELAP5 - DYN3D code

International Nuclear Information System (INIS)

Strmensky, C.

2001-01-01

This paper describes the on-going and finished parts of project: 'The external coupled RELAP5-DYN3D code'. The development progress was divided into four steps. In present time, second and third steps are performed and four step is started. The two parameters of coolant was selected and are exchanged between codes RELAP5 and DYN3D. (authors)

Tooth fragment reattachment techniques-A systematic review.

Science.gov (United States)

Garcia, Fernanda Cristina P; Poubel, Déborah L N; Almeida, Júlio César F; Toledo, Isabela P; Poi, Wilson R; Guerra, Eliete N S; Rezende, Liliana V M L

2018-03-07

Several strategies have been developed for tooth fragment reattachment following fracture. Although many techniques have been reported, there is no consensus on which one has the best results in terms of the bond strength between the fragment and the dentin over time. The aim of this study was to assess the currently reported tooth fragment reattachment techniques for fractured crowns of anterior teeth. The PubMed, LILACS, Web of Science, Cochrane, and Scopus databases were searched in October 2016, and the search was updated in February 2017. A search of the gray literature was performed in Google Scholar and OpenGrey. Reference lists of eligible studies were cross-checked to identify additional studies; gray literature and ongoing trials were investigated. Two authors assessed studies to determine inclusion and undertook data extraction. Case reports/series of three or more cases, cross-sectional studies, cohort studies, and in vivo clinical trials in all languages were included. Five articles remained after screening. These studies predominantly reported on fragment reattachment with composite resin and resin cement. There was little consistency among the studies in regard to the technique used for tooth fragment reattachment and length of the follow-up period. According to the evidence found in the studies included in this review, simple tooth fragment reattachment was the preferred reattachment technique. An increase in the bond strength between tooth fragment and dentin was observed when an intermediate material was used. Further investigation is needed, using standard follow-up periods and larger samples. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Compact Two-step Laser Time-of-Flight Mass Spectrometer for in Situ Analyses of Aromatic Organics on Planetary Missions

Science.gov (United States)

Getty, Stephanie; Brickerhoff, William; Cornish, Timothy; Ecelberger, Scott; Floyd, Melissa

2012-01-01

RATIONALE A miniature time-of-flight mass spectrometer has been adapted to demonstrate two-step laser desorption-ionization (LOI) in a compact instrument package for enhanced organics detection. Two-step LDI decouples the desorption and ionization processes, relative to traditional laser ionization-desorption, in order to produce low-fragmentation conditions for complex organic analytes. Tuning UV ionization laser energy allowed control ofthe degree of fragmentation, which may enable better identification of constituent species. METHODS A reflectron time-of-flight mass spectrometer prototype measuring 20 cm in length was adapted to a two-laser configuration, with IR (1064 nm) desorption followed by UV (266 nm) postionization. A relatively low ion extraction voltage of 5 kV was applied at the sample inlet. Instrument capabilities and performance were demonstrated with analysis of a model polycyclic aromatic hydrocarbon, representing a class of compounds important to the fields of Earth and planetary science. RESULTS L2MS analysis of a model PAH standard, pyrene, has been demonstrated, including parent mass identification and the onset o(tunable fragmentation as a function of ionizing laser energy. Mass resolution m/llm = 380 at full width at half-maximum was achieved which is notable for gas-phase ionization of desorbed neutrals in a highly-compact mass analyzer. CONCLUSIONS Achieving two-step laser mass spectrometry (L2MS) in a highly-miniature instrument enables a powerful approach to the detection and characterization of aromatic organics in remote terrestrial and planetary applications. Tunable detection of parent and fragment ions with high mass resolution, diagnostic of molecular structure, is possible on such a compact L2MS instrument. Selectivity of L2MS against low-mass inorganic salt interferences is a key advantage when working with unprocessed, natural samples, and a mechanism for the observed selectivity is presented.

Fragmentation of acetic acid ions with selected internal energies

Science.gov (United States)

Zha, Qingmei; Nishimura, Toshihide; Bertrand, Michel J.; Meisels, G. G.

1991-08-01

The unimolecular dissociation of acetic acid ion in the photon energy range 10.5-17.0 eV was studied using threshold photoelectron photoion coincidence mass spectrometry. The detailed breakdown graph was obtained and the fragmentation pathways were elucidated. The breakdown graph calculated using statistical theories was found to be consistent with the experimental data up to a photon energy of about 12.5 eV. The average kinetic energy release observed is higher than that calculated on the basis of quasi-equilibrium theory for the formation of COOH+ while it seems to be statistical for the formation of CH3CO+. The origin of kinetic energy release accompanying the formation of these two ions is discussed. The structure of [COH3]+ ion (m/z 31) is determined to be hydroxymethyl cation, CH2OH+, which could be formed by a two-step rearrangement prior to dissociation.

Fragmentation of low-melting metals by collapsing steam bubbles

International Nuclear Information System (INIS)

Benz, R.

1979-08-01

When a hot melt meets a vaporable liquid of lower temperature, explosive vaporisation of the cooler liquid may be the result. This is called a steam explosion if a substantial amount of thermal energy is converted into mechanical energy. One important step in understanding about steam explosions is to explain the surface increase of the hot melt. There are several competing fragmentation hypotheses, but so far there has been no model to describe fragmentation criteria as well as the time curve of surface increase on the basis of physical processes. An overall model is now given for one of the possible fragmentation mechanisms, i.e. the division of the melt by collapsing steam bubbles. The model estimates the surface increase of the melt on the basis of heavy supercooled boiling, the heat transfer connected with it, the transfer of mechanical energy during steam bubble collapse, and the solidification of the melt. The results of the calculations have shown that basic experimental observations, e.g. time and extent of fragmentation, are well presented in the model with regard to their order of magnitude. The model presents a qualitatively correct description of the effects of important influencing factors, e.g. supercooling of the coolant or initial temperature of the melt. (orig.) [de

Fission fragment yields from heavy-ion-induced reactions measured with a fragment separator

Science.gov (United States)

Tarasov, O. B.; Delaune, O.; Farget, F.; Morrissey, D. J.; Amthor, A. M.; Bastin, B.; Bazin, D.; Blank, B.; Cacéres, L.; Chbihi, A.; Fernández-Dominguez, B.; Grévy, S.; Kamalou, O.; Lukyanov, S. M.; Mittig, W.; Pereira, J.; Perrot, L.; Saint-Laurent, M.-G.; Savajols, H.; Sherrill, B. M.; Stodel, C.; Thomas, J. C.; Villari, A. C.

2018-04-01

The systematic study of fission fragment yields under different initial conditions has provided valuable experimental data for benchmarking models of fission product yields. Nuclear reactions using inverse kinematics coupled to the use of a high-resolution spectrometer with good fragment identification are shown here to be a powerful tool to measure the inclusive isotopic yields of fission fragments. In-flight fusion-fission was used in this work to produce secondary beams of neutron-rich isotopes in the collisions of a 238U beam at 24 MeV/u with 9Be and 12C targets at GANIL using the LISE3 fragment separator. Unique identification of the A, Z, and atomic charge state, q, of fission products was attained with the Δ E- TKE-B ρ- ToF measurement technique. Mass, and atomic number distributions are reported for the two reactions. The results show the importance of different reaction mechanisms in the two cases. The optimal target material for higher yields of neutron-rich high- Z isotopes produced in fusion-fission reactions as a function of projectile energy is discussed.

Predicting Post-Translational Modifications from Local Sequence Fragments Using Machine Learning Algorithms: Overview and Best Practices.

Science.gov (United States)

Tatjewski, Marcin; Kierczak, Marcin; Plewczynski, Dariusz

2017-01-01

Here, we present two perspectives on the task of predicting post translational modifications (PTMs) from local sequence fragments using machine learning algorithms. The first is the description of the fundamental steps required to construct a PTM predictor from the very beginning. These steps include data gathering, feature extraction, or machine-learning classifier selection. The second part of our work contains the detailed discussion of more advanced problems which are encountered in PTM prediction task. Probably the most challenging issues which we have covered here are: (1) how to address the training data class imbalance problem (we also present statistics describing the problem); (2) how to properly set up cross-validation folds with an approach which takes into account the homology of protein data records, to address this problem we present our folds-over-clusters algorithm; and (3) how to efficiently reach for new sources of learning features. Presented techniques and notes resulted from intense studies in the field, performed by our and other groups, and can be useful both for researchers beginning in the field of PTM prediction and for those who want to extend the repertoire of their research techniques.

Percutaneous transhepatic fragmentation of gall stones and extraction of fragments

International Nuclear Information System (INIS)

Guenther, R.; Klose, K.; Schmidt, H.D.; Staritz, M.; Mainz Univ.; Mainz Univ.

1983-01-01

Attempts at percutaneous removal have been made in 13 patients with solitary and multiple intra- and extra-hepatic biliary duct stones measuring 5 to 30 mm. The stones were fragmented with a Dormia basket and the fragments removed transhepatically. In ten patients the procedure was successful, including one patient with multiple intra-hepatic stones. The procedure can be recommended for cases of calculous obstruction of biliary anastomoses or of stones which could not be removed by endoscopy, or where there is already biliary drainage being carried out, or in patients with a high opertive risk. In two patients, dilatation of the papilla was also carried out, in four patients a stenosis was dilated and in a further two patients, electro-incision of a stenosis was performed. (orig.) [de

Integrated delivery systems: the cure for fragmentation.

Science.gov (United States)

Enthoven, Alain C

2009-12-01

Our healthcare system is fragmented, with a misalignment of incentives, or lack of coordination, that spawns inefficient allocation of resources. Fragmentation adversely impacts quality, cost, and outcomes. Eliminating waste from unnecessary, unsafe care is crucial for improving quality and reducing costs--and making the system financially sustainable. Many believe this can be achieved through greater integration of healthcare delivery, more specifically via integrated delivery systems (IDSs). An IDS is an organized, coordinated, and collaborative network that links various healthcare providers to provide a coordinated, vertical continuum of services to a particular patient population or community. It is also accountable, both clinically and fiscally, for the clinical outcomes and health status of the population or community served, and has systems in place to manage and improve them. The marketplace already contains numerous styles and degrees of integration, ranging from Kaiser Permanente-style full integration, to more loosely organized individual practice associations, to public-private partnerships. Evidence suggests that IDSs can improve healthcare quality, improve outcomes, and reduce costs--especially for patients with complex needs--if properly implemented and coordinated. No single approach or public policy will fix the fragmented healthcare system, but IDSs represent an important step in the right direction.

Fragmentation Pathways of Lithiated Hexose Monosaccharides

Science.gov (United States)

Abutokaikah, Maha T.; Frye, Joseph W.; Tschampel, John; Rabus, Jordan M.; Bythell, Benjamin J.

2018-05-01

We characterize the primary fragmentation reactions of three isomeric lithiated D-hexose sugars (glucose, galactose, and mannose) utilizing tandem mass spectrometry, regiospecific labeling, and theory. We provide evidence that these three isomers populate similar fragmentation pathways to produce the abundant cross-ring cleavage peaks (0,2A1 and 0,3A1). These pathways are highly consistent with the prior literature (Hofmeister et al. J. Am. Chem. Soc. 113, 5964-5970, 1991, Bythell et al. J. Am. Soc. Mass Spectrom. 28, 688-703, 2017, Rabus et al. Phys. Chem. Chem. Phys. 19, 25643-25652, 2017) and the present labeling data. However, the structure-specific energetics and rate-determining steps of these reactions differ as a function of precursor sugar and anomeric configuration. The lowest energy water loss pathways involve loss of the anomeric oxygen to furnish B1 ions. For glucose and galactose, the lithiated α-anomers generate ketone structures at C2 in a concerted reaction involving a 1,2-migration of the C2-H to the anomeric carbon (C1). In contrast, the β-anomers are predicted to form 1,3-anhydroglucose/galactose B1 ion structures. Initiation of the water loss reactions from each anomeric configuration requires distinct reactive conformers, resulting in different product ion structures. Inversion of the stereochemistry at C2 has marked consequences. Both lithiated mannose forms expel water to form 1,2-anhydromannose B1 ions with the newly formed epoxide group above the ring. Additionally, provided water loss is not instantaneous, the α-anomer can also isomerize to generate a ketone structure at C2 in a concerted reaction involving a 1,2-migration of the C2-H to C1. This product is indistinguishable to that from α-glucose. The energetics and interplay of these pathways are discussed. [Figure not available: see fulltext.

Computational medicinal chemistry in fragment-based drug discovery: what, how and when.

Science.gov (United States)

Rabal, Obdulia; Urbano-Cuadrado, Manuel; Oyarzabal, Julen

2011-01-01

The use of fragment-based drug discovery (FBDD) has increased in the last decade due to the encouraging results obtained to date. In this scenario, computational approaches, together with experimental information, play an important role to guide and speed up the process. By default, FBDD is generally considered as a constructive approach. However, such additive behavior is not always present, therefore, simple fragment maturation will not always deliver the expected results. In this review, computational approaches utilized in FBDD are reported together with real case studies, where applicability domains are exemplified, in order to analyze them, and then, maximize their performance and reliability. Thus, a proper use of these computational tools can minimize misleading conclusions, keeping the credit on FBDD strategy, as well as achieve higher impact in the drug-discovery process. FBDD goes one step beyond a simple constructive approach. A broad set of computational tools: docking, R group quantitative structure-activity relationship, fragmentation tools, fragments management tools, patents analysis and fragment-hopping, for example, can be utilized in FBDD, providing a clear positive impact if they are utilized in the proper scenario - what, how and when. An initial assessment of additive/non-additive behavior is a critical point to define the most convenient approach for fragments elaboration.

SPAR-H Step-by-Step Guidance

Energy Technology Data Exchange (ETDEWEB)

April M. Whaley; Dana L. Kelly; Ronald L. Boring; William J. Galyean

2012-06-01

Step-by-step guidance was developed recently at Idaho National Laboratory for the US Nuclear Regulatory Commission on the use of the Standardized Plant Analysis Risk-Human Reliability Analysis (SPAR-H) method for quantifying Human Failure Events (HFEs). This work was done to address SPAR-H user needs, specifically requests for additional guidance on the proper application of various aspects of the methodology. This paper overviews the steps of the SPAR-H analysis process and highlights some of the most important insights gained during the development of the step-by-step directions. This supplemental guidance for analysts is applicable when plant-specific information is available, and goes beyond the general guidance provided in existing SPAR-H documentation. The steps highlighted in this paper are: Step-1, Categorizing the HFE as Diagnosis and/or Action; Step-2, Rate the Performance Shaping Factors; Step-3, Calculate PSF-Modified HEP; Step-4, Accounting for Dependence, and; Step-5, Minimum Value Cutoff.

Fragger: a protein fragment picker for structural queries.

Science.gov (United States)

Berenger, Francois; Simoncini, David; Voet, Arnout; Shrestha, Rojan; Zhang, Kam Y J

2017-01-01

Protein modeling and design activities often require querying the Protein Data Bank (PDB) with a structural fragment, possibly containing gaps. For some applications, it is preferable to work on a specific subset of the PDB or with unpublished structures. These requirements, along with specific user needs, motivated the creation of a new software to manage and query 3D protein fragments. Fragger is a protein fragment picker that allows protein fragment databases to be created and queried. All fragment lengths are supported and any set of PDB files can be used to create a database. Fragger can efficiently search a fragment database with a query fragment and a distance threshold. Matching fragments are ranked by distance to the query. The query fragment can have structural gaps and the allowed amino acid sequences matching a query can be constrained via a regular expression of one-letter amino acid codes. Fragger also incorporates a tool to compute the backbone RMSD of one versus many fragments in high throughput. Fragger should be useful for protein design, loop grafting and related structural bioinformatics tasks.

Fragmentation of CO{sub 2} into C{sup +} + O{sup +} + O, in collisions with protons

Energy Technology Data Exchange (ETDEWEB)

Moretto-Capelle, P. [Laboratoire CAR-IRSAMC, UMR 5589 CNRS-Universite Paul Sabatier, 118 rue de Narbonne, 31062 Toulouse Cedex (France). E-mail: pmc at yosemite.ups-tlse.fr; Bordenave-Montesquieu, D.; Bordenave-Montesquieu, A. [Laboratoire CAR-IRSAMC, UMR 5589 CNRS-Universite Paul Sabatier, 118 rue de Narbonne, 31062 Toulouse Cedex (France)

2000-08-14

The fragmentation of CO{sub 2} has been investigated in 25 keV H{sup +} + CO{sub 2} collisions using an electron-ion-ion triple coincidence technique. In this letter we focus on the three-body fragmentation into the C{sup +} + O{sup +} + O final state. A comparison between the measured correlation of C{sup +},O{sup +} and O momenta and simple kinematic models allows us to demonstrate that in the present case, a rather unexpected two-step process with formation of a CO{sup 2+} ion as an intermediate state occurs. This result is at variance with the conclusions of other authors achieved in collisions of photons and electrons with the dioxide molecule. Kinetic energy release distributions in the two steps of the dissociation process are also deduced from experiment; the distributions found for the fragmentation of CO{sup 2+} into C{sup +} + O{sup +} are found to be very similar to those measured by other authors in collisions of various particles (photons, multi-charged ions) with CO molecules at high enough collision energy. (author). Letter-to-the-editor.

Agricultural matrices affect ground ant assemblage composition inside forest fragments.

Directory of Open Access Journals (Sweden)

Diego Santana Assis

Full Text Available The establishment of agricultural matrices generally involves deforestation, which leads to fragmentation of the remaining forest. This fragmentation can affect forest dynamics both positively and negatively. Since most animal species are affected, certain groups can be used to measure the impact of such fragmentation. This study aimed to measure the impacts of agricultural crops (matrices on ant communities of adjacent lower montane Atlantic rainforest fragments. We sampled nine forest fragments at locations surrounded by different agricultural matrices, namely: coffee (3 replicates; sugarcane (3; and pasture (3. At each site we installed pitfall traps along a 500 m transect from the interior of the matrix to the interior of the fragment (20 pitfall traps ~25 m apart. Each transect was partitioned into four categories: interior of the matrix; edge of the matrix; edge of the fragment; and interior of the fragment. For each sample site, we measured ant species richness and ant community composition within each transect category. Ant richness and composition differed between fragments and matrices. Each sample location had a specific composition of ants, probably because of the influence of the nature and management of the agricultural matrices. Species composition in the coffee matrix had the highest similarity to its corresponding fragment. The variability in species composition within forest fragments surrounded by pasture was greatest when compared with forest fragments surrounded by sugarcane or, to a lesser extent, coffee. Functional guild composition differed between locations, but the most representative guild was 'generalist' both in the agricultural matrices and forest fragments. Our results are important for understanding how agricultural matrices act on ant communities, and also, how these isolated forest fragments could act as an island of biodiversity in an 'ocean of crops'.

Agricultural matrices affect ground ant assemblage composition inside forest fragments.

Science.gov (United States)

Assis, Diego Santana; Dos Santos, Iracenir Andrade; Ramos, Flavio Nunes; Barrios-Rojas, Katty Elena; Majer, Jonathan David; Vilela, Evaldo Ferreira

2018-01-01

The establishment of agricultural matrices generally involves deforestation, which leads to fragmentation of the remaining forest. This fragmentation can affect forest dynamics both positively and negatively. Since most animal species are affected, certain groups can be used to measure the impact of such fragmentation. This study aimed to measure the impacts of agricultural crops (matrices) on ant communities of adjacent lower montane Atlantic rainforest fragments. We sampled nine forest fragments at locations surrounded by different agricultural matrices, namely: coffee (3 replicates); sugarcane (3); and pasture (3). At each site we installed pitfall traps along a 500 m transect from the interior of the matrix to the interior of the fragment (20 pitfall traps ~25 m apart). Each transect was partitioned into four categories: interior of the matrix; edge of the matrix; edge of the fragment; and interior of the fragment. For each sample site, we measured ant species richness and ant community composition within each transect category. Ant richness and composition differed between fragments and matrices. Each sample location had a specific composition of ants, probably because of the influence of the nature and management of the agricultural matrices. Species composition in the coffee matrix had the highest similarity to its corresponding fragment. The variability in species composition within forest fragments surrounded by pasture was greatest when compared with forest fragments surrounded by sugarcane or, to a lesser extent, coffee. Functional guild composition differed between locations, but the most representative guild was 'generalist' both in the agricultural matrices and forest fragments. Our results are important for understanding how agricultural matrices act on ant communities, and also, how these isolated forest fragments could act as an island of biodiversity in an 'ocean of crops'.

Intravitreal Phacoemulsification Using Torsional Handpiece for Retained Lens Fragments.

Science.gov (United States)

Kumar, Vinod; Takkar, Brijesh

2016-01-01

To evaluate the results of intravitreal phacoemulsification with torsional hand piece in eyes with posteriorly dislocated lens fragments. In this prospective, interventional case series, 15 eyes with retained lens fragments following phacoemulsification were included. All patients underwent standard three-port pars plana vitrectomy and intravitreal phacoemulsification using sleeveless, torsional hand piece (OZiL™, Alcon's Infiniti Vision System). Patients were followed up for a minimum of six months to evaluate the visual outcomes and complications. The preoperative best-corrected visual acuity (BCVA) ranged from light perception to 0.3. No complications such as thermal burns of the scleral wound, retinal damage due to flying lens fragments, or difficult lens aspiration occurred during intravitreal phacoemulsification. Mean post-operative BCVA at the final follow-up was 0.5. Two eyes developed cystoid macular edema, which was managed medically. No retinal detachment was noted. Intravitreal phacoemulsification using torsional hand piece is a safe and effective alternative to conventional longitudinal phacofragmentation.

Intravitreal Phacoemulsification Using Torsional Handpiece for Retained Lens Fragments

Science.gov (United States)

Kumar, Vinod; Takkar, Brijesh

2016-01-01

Purpose: To evaluate the results of intravitreal phacoemulsification with torsional hand piece in eyes with posteriorly dislocated lens fragments. Methods: In this prospective, interventional case series, 15 eyes with retained lens fragments following phacoemulsification were included. All patients underwent standard three-port pars plana vitrectomy and intravitreal phacoemulsification using sleeveless, torsional hand piece (OZiL™, Alcon's Infiniti Vision System). Patients were followed up for a minimum of six months to evaluate the visual outcomes and complications. Results: The preoperative best-corrected visual acuity (BCVA) ranged from light perception to 0.3. No complications such as thermal burns of the scleral wound, retinal damage due to flying lens fragments, or difficult lens aspiration occurred during intravitreal phacoemulsification. Mean post-operative BCVA at the final follow-up was 0.5. Two eyes developed cystoid macular edema, which was managed medically. No retinal detachment was noted. Conclusion: Intravitreal phacoemulsification using torsional hand piece is a safe and effective alternative to conventional longitudinal phacofragmentation. PMID:27621783

A simple and robust approach to immobilization of antibody fragments.

Science.gov (United States)

Ikonomova, Svetlana P; He, Ziming; Karlsson, Amy J

2016-08-01

Antibody fragments, such as the single-chain variable fragment (scFv), have much potential in research and diagnostics because of their antigen-binding ability similar to a full-sized antibody and their ease of production in microorganisms. Some applications of antibody fragments require immobilization on a surface, and we have established a simple immobilization method that is based on the biotin-streptavidin interaction and does not require a separate purification step. We genetically fused two biotinylation tags-the biotin carboxyl carrier protein (BCCP) or the AviTag minimal sequence-to six different scFvs (scFv13R4, scFvD10, scFv26-10, scFv3, scFv5, and scFv12) for site-specific biotinylation in vivo by endogenous biotin ligases produced by Escherichia coli. The biotinylated scFvs were immobilized onto streptavidin-coated plates directly from cell lysates, and immobilization was detected through enzyme-linked immunosorbent assays. All scFvs fusions were successfully immobilized, and scFvs biotinylated via the BCCP tag tended to immobilize better than those biotinylated via the AviTag, even when biotinylation efficiency was improved with the biotin ligase BirA. The ability of immobilized scFvs to bind antigens was confirmed using scFv13R4 and scFvD10 with their respective targets β-galactosidase and bacteriophage lambda head protein D (gpD). The immobilized scFv13R4 bound to β-galactosidase at the same level for both biotinylation tags when the surface was saturated with the scFv, and immobilized scFvs retained their functionality for at least 100days after immobilization. The simplicity and robustness of our method make it a promising approach for future applications that require antibody fragment immobilization. Copyright © 2016 Elsevier B.V. All rights reserved.

Discovery of potent, reversible MetAP2 inhibitors via fragment based drug discovery and structure based drug design-Part 2.

Science.gov (United States)

McBride, Christopher; Cheruvallath, Zacharia; Komandla, Mallareddy; Tang, Mingnam; Farrell, Pamela; Lawson, J David; Vanderpool, Darin; Wu, Yiqin; Dougan, Douglas R; Plonowski, Artur; Holub, Corine; Larson, Chris

2016-06-15

Methionine aminopeptidase-2 (MetAP2) is an enzyme that cleaves an N-terminal methionine residue from a number of newly synthesized proteins. This step is required before they will fold or function correctly. Pre-clinical and clinical studies with a MetAP2 inhibitor suggest that they could be used as a novel treatment for obesity. Herein we describe the discovery of a series of pyrazolo[4,3-b]indoles as reversible MetAP2 inhibitors. A fragment-based drug discovery (FBDD) approach was used, beginning with the screening of fragment libraries to generate hits with high ligand-efficiency (LE). An indazole core was selected for further elaboration, guided by structural information. SAR from the indazole series led to the design of a pyrazolo[4,3-b]indole core and accelerated knowledge-based fragment growth resulted in potent and efficient MetAP2 inhibitors, which have shown robust and sustainable body weight loss in DIO mice when dosed orally. Copyright © 2016 Elsevier Ltd. All rights reserved.

Synthesis of naturally occurring iminosugars from D-fructose by the use of a zinc-mediated fragmentation reaction

DEFF Research Database (Denmark)

Lauritsen, Anne; Madsen, Robert

2006-01-01

A short synthesis of 1,4-dideoxy-1,4-imino-D-arabinitol (DAB) and a formal synthesis of australine are described. In both cases, D-fructose is employed as the starting material and converted into a protected methyl 6-deoxy-6-iodo-furanoside. Zinc-mediated fragmentation produces an unsaturated...... ketone which serves as a key building block for both syntheses. Ozonolysis, reductive amination with benzylamine and deprotection affordfs 1,4-dideoxy-1,4-imino-D-arabinitol in only 7 steps and 11% overall yield from D-fructose. Alternatively, reductive amination with homoallylamine, ring......-closing metathesis and protecting group manipulations give rise to an intermediate which can be converted into australine in 3 steps. The intermediate is prepared by two different strategies both of which use a total of 9 steps. The first strategy utilizes benzyl ethers for protection of fructose while the second...

Re-entrant spin glass and stepped magnetization in mixed-valence SrFe3(PO4)3

International Nuclear Information System (INIS)

Shang Mingyu; Chen Yan; Tian Ge; Yuan Hongming; Feng Shouhua

2013-01-01

The 2 D channel mixed-valent iron (II/III) monophosphate SrFe 3 (PO 4 ) 3 was synthesized via one step mild hydrothermal method at 210 °C and characterized by X-ray diffraction techniques and magnetization measurements. Coexistence of antiferromagnetic superexchange and ferromagnetic superexchange interactions was supposed to be in the lattice according to the Goodenough-Kanamori-Anderson rules. Temperature dependent DC magnetization measurement shows that SrFe 3 (PO 4 ) 3 is ferrimagnet with three magnetic transitions between 2 and 350 K. Through AC magnetization measurement, re-entrant spin glass was observed due to the competition between ferromagnetic and antiferromagnetic interactions. Furthermore, an interesting field induced stepped magnetization was observed in SrFe 3 (PO 4 ) 3 at 2 K with the saturation magnetization Ms=2.4 μ B /f.u. at 5 T.

Binding-site assessment by virtual fragment screening.

Directory of Open Access Journals (Sweden)

Niu Huang

2010-04-01

Full Text Available The accurate prediction of protein druggability (propensity to bind high-affinity drug-like small molecules would greatly benefit the fields of chemical genomics and drug discovery. We have developed a novel approach to quantitatively assess protein druggability by computationally screening a fragment-like compound library. In analogy to NMR-based fragment screening, we dock approximately 11,000 fragments against a given binding site and compute a computational hit rate based on the fraction of molecules that exceed an empirically chosen score cutoff. We perform a large-scale evaluation of the approach on four datasets, totaling 152 binding sites. We demonstrate that computed hit rates correlate with hit rates measured experimentally in a previously published NMR-based screening method. Secondly, we show that the in silico fragment screening method can be used to distinguish known druggable and non-druggable targets, including both enzymes and protein-protein interaction sites. Finally, we explore the sensitivity of the results to different receptor conformations, including flexible protein-protein interaction sites. Besides its original aim to assess druggability of different protein targets, this method could be used to identifying druggable conformations of flexible binding site for lead discovery, and suggesting strategies for growing or joining initial fragment hits to obtain more potent inhibitors.

Fragmentation in central collisions of heavy systems

International Nuclear Information System (INIS)

Claesson, G.; Doss, K.G.R.; Ferguson, R.

1987-01-01

One of the goals of heavy ion reaction studies is to understand the fragmentation of hot nuclei. The LBL/GSI Plastic Ball detector system has been used to achieve a very high solid angle for detection of light and medium-heavy fragments emitted in 200 Mev/A Au + Au and Au + Fe reactions. The simultaneous measurement of almost all of the nucleons and nuclei resulting from each collision allows an estimation of the total charged particle multiplicity and hence the impact parameter. By choosing subsets of the data corresponding to a peripheral or central collision, the assumptions inherent in various models of nuclear fragmentation can be tested. 3 refs., 3 figs

Improved histopathological evaluation of gliomas using tissue fragments obtained by ultrasonic aspiration

DEFF Research Database (Denmark)

Neckelmann, K; Kristensen, B W; Schrøder, H D

2004-01-01

included in the biopsy removed for peroperative frozen section investigation. When the slides with Sonocut tissue fragments were analyzed, the probability of making the most malignant diagnosis increased from 81.3% - 99.1%, when slides from 1 - 5 paraffin blocks were analyzed, respectively. When subgroups...... of small, medium and big tumors were analyzed, it was found that only 2 paraffin blocks from small tumors need to be prepared to reach 98.3% probability of making the most malignant diagnosis, whereas 5 paraffin blocks from big tumors need to be prepared to reach a 96.8% probability. In conclusion......, the study shows that a limited amount of Sonocut ultrasonic tissue fragments improve the diagnostic evaluation of gliomas. These tissue fragments therefore must not be discarded. Only few paraffin blocks need to be prepared to reach close to 100% probability of making the most malignant diagnosis, reducing...

Stroma-induced Jagged1 expression drives PC3 prostate cancer cell migration; disparate effects of RIP-generated proteolytic fragments on cell behaviour and Notch signaling

Energy Technology Data Exchange (ETDEWEB)

Delury, Craig, E-mail: c.delury@lancaster.ac.uk [Division of Biomedical and Life Sciences, Faculty of Health and Medicine, Lancaster University, Lancaster, LA1 4YQ (United Kingdom); Hart, Claire, E-mail: claire.hart@manchester.ac.uk [Genito Urinary Cancer Research Group, Institute of Cancer Sciences, Paterson Building, The University of Manchester, Manchester Academic Health Science Centre, Wilmslow Road, Manchester, M20 4BX (United Kingdom); Brown, Mick, E-mail: michael.brown@ics.manchester.ac.uk [Genito Urinary Cancer Research Group, Institute of Cancer Sciences, Paterson Building, The University of Manchester, Manchester Academic Health Science Centre, Wilmslow Road, Manchester, M20 4BX (United Kingdom); Clarke, Noel, E-mail: noel.clarke@christie.nhs.uk [Genito Urinary Cancer Research Group, Institute of Cancer Sciences, Paterson Building, The University of Manchester, Manchester Academic Health Science Centre, Wilmslow Road, Manchester, M20 4BX (United Kingdom); Parkin, Edward, E-mail: e.parkin@lancaster.ac.uk [Division of Biomedical and Life Sciences, Faculty of Health and Medicine, Lancaster University, Lancaster, LA1 4YQ (United Kingdom)

2016-03-25

The Notch ligand Jagged1 is subject to regulated intramembrane proteolysis (RIP) which yields a soluble ectodomain (sJag) and a soluble Jagged1 intracellular domain (JICD). The full-length Jagged1 protein enhances prostate cancer (PCa) cell proliferation and is highly expressed in metastatic cells. However, little is known regarding the mechanisms by which Jagged1 or its RIP-generated fragments might promote PCa bone metastasis. In the current study we show that bone marrow stroma (BMS) induces Jagged1 expression in bone metastatic prostate cancer PC3 cells and that this enhanced expression is mechanistically linked to the promotion of cell migration. We also show that RIP-generated Jagged1 fragments exert disparate effects on PC3 cell behaviour and Notch signaling. In conclusion, the expression of both the full-length ligand and its RIP-generated fragments must be considered in tandem when attempting to regulate Jagged1 as a possible PCa therapy. - Highlights: • Bone marrow stroma induces Jagged1 expression in prostate cancer (PCa) PC3 cells. • This enhanced expression of full-length Jagged1 is required for PC3 cell migration. • Proteolytic fragments of Jagged1 exert disparate effects on PC3 cell behaviour. • Effects of fragments on cell behaviour do not correlate with Notch signaling. • Effects of Jagged1 and its fragments on PCa metastasis likely to be complex.

Towards a population synthesis model of self-gravitating disc fragmentation and tidal downsizing II: the effect of fragment-fragment interactions

Science.gov (United States)

Forgan, D. H.; Hall, C.; Meru, F.; Rice, W. K. M.

2018-03-01

It is likely that most protostellar systems undergo a brief phase where the protostellar disc is self-gravitating. If these discs are prone to fragmentation, then they are able to rapidly form objects that are initially of several Jupiter masses and larger. The fate of these disc fragments (and the fate of planetary bodies formed afterwards via core accretion) depends sensitively not only on the fragment's interaction with the disc, but also with its neighbouring fragments. We return to and revise our population synthesis model of self-gravitating disc fragmentation and tidal downsizing. Amongst other improvements, the model now directly incorporates fragment-fragment interactions while the disc is still present. We find that fragment-fragment scattering dominates the orbital evolution, even when we enforce rapid migration and inefficient gap formation. Compared to our previous model, we see a small increase in the number of terrestrial-type objects being formed, although their survival under tidal evolution is at best unclear. We also see evidence for disrupted fragments with evolved grain populations - this is circumstantial evidence for the formation of planetesimal belts, a phenomenon not seen in runs where fragment-fragment interactions are ignored. In spite of intense dynamical evolution, our population is dominated by massive giant planets and brown dwarfs at large semimajor axis, which direct imaging surveys should, but only rarely, detect. Finally, disc fragmentation is shown to be an efficient manufacturer of free-floating planetary mass objects, and the typical multiplicity of systems formed via gravitational instability will be low.

CF3+ fragmentation by electron impact ionization of perfluoro-propyl-vinyl-ethers, C5F10O, in gas phase

Science.gov (United States)

Kondo, Yusuke; Ishikawa, Kenji; Hayashi, Toshio; Miyawaki, Yudai; Takeda, Keigo; Kondo, Hiroki; Sekine, Makoto; Hori, Masaru

2015-04-01

The gas phase fragmentations of perfluoro-propyl-vinyl ether (PPVE, C5F10O) are studied experimentally. Dominant fragmentations of PPVE are found to be the result of a dissociative ionization reaction, i.e., CF3+ via direct bond cleavage, and C2F3O- and C3F7O- via electron attachment. Regardless of the appearance energy of around 14.5 eV for the dissociative ionization of CF3+, the observed ion efficiency for the CF3+ ion was extremely large the order of 10-20 cm-2, compared with only 10-21 cm-2 for the other channels. PPVE characteristically generated CF3+ as the largest abundant ion are advantageous for use of feedstock gases in plasma etching processes.

Application of gadolinia credit to cask transportation of BWR-STEP3 SFAs

International Nuclear Information System (INIS)

Kikuchi, Tsukasa; Mitsuhashi, Ishi; Ito, Dai-ichiro; Nakamura, Yu

2003-01-01

Instead of the fresh-fuel assumption, the application of gadolinia credit to cask transportation of BWR SFAs is studied. Its efficacy for BWR-STEP2 SFAs had already been estimated. This paper reports on the application of gadolinia credit to cask transportation of BWR-STEP3 SFAs. (author)

Effects of the fragmentation models on the determination of αsub(S) in e+e- annihilation

International Nuclear Information System (INIS)

Lavagne, Y.

1982-06-01

Jet phenomenology is presented and quantum chromodynamic notions necessary to this study comprehension are given. Device is described, together with data acquisition and different steps of hadronic event selection. Three jet topology events are selected from presented variables and methods. Two models with different fragmentation processes are used to determine αsub(S). Results for each model are gathered and display the fragmentation process influence on αsub(S) value [fr

Fission fragment excited laser system

Science.gov (United States)

McArthur, David A.; Tollefsrud, Philip B.

1976-01-01

A laser system and method for exciting lasing action in a molecular gas lasing medium which includes cooling the lasing medium to a temperature below about 150 K and injecting fission fragments through the lasing medium so as to preferentially excite low lying vibrational levels of the medium and to cause population inversions therein. The cooled gas lasing medium should have a mass areal density of about 5 .times. 10.sup.-.sup.3 grams/square centimeter, relaxation times of greater than 50 microseconds, and a broad range of excitable vibrational levels which are excitable by molecular collisions.

A stepped leader model for lightning including charge distribution in branched channels

Energy Technology Data Exchange (ETDEWEB)

Shi, Wei; Zhang, Li [School of Electrical Engineering, Shandong University, Jinan 250061 (China); Li, Qingmin, E-mail: lqmeee@ncepu.edu.cn [Beijing Key Lab of HV and EMC, North China Electric Power University, Beijing 102206 (China); State Key Lab of Alternate Electrical Power System with Renewable Energy Sources, Beijing 102206 (China)

2014-09-14

The stepped leader process in negative cloud-to-ground lightning plays a vital role in lightning protection analysis. As lightning discharge usually presents significant branched or tortuous channels, the charge distribution along the branched channels and the stochastic feature of stepped leader propagation were investigated in this paper. The charge density along the leader channel and the charge in the leader tip for each lightning branch were approximated by introducing branch correlation coefficients. In combination with geometric characteristics of natural lightning discharge, a stochastic stepped leader propagation model was presented based on the fractal theory. By comparing simulation results with the statistics of natural lightning discharges, it was found that the fractal dimension of lightning trajectory in simulation was in the range of that observed in nature and the calculation results of electric field at ground level were in good agreement with the measurements of a negative flash, which shows the validity of this proposed model. Furthermore, a new equation to estimate the lightning striking distance to flat ground was suggested based on the present model. The striking distance obtained by this new equation is smaller than the value estimated by previous equations, which indicates that the traditional equations may somewhat overestimate the attractive effect of the ground.

A stepped leader model for lightning including charge distribution in branched channels

International Nuclear Information System (INIS)

Shi, Wei; Zhang, Li; Li, Qingmin

2014-01-01

The stepped leader process in negative cloud-to-ground lightning plays a vital role in lightning protection analysis. As lightning discharge usually presents significant branched or tortuous channels, the charge distribution along the branched channels and the stochastic feature of stepped leader propagation were investigated in this paper. The charge density along the leader channel and the charge in the leader tip for each lightning branch were approximated by introducing branch correlation coefficients. In combination with geometric characteristics of natural lightning discharge, a stochastic stepped leader propagation model was presented based on the fractal theory. By comparing simulation results with the statistics of natural lightning discharges, it was found that the fractal dimension of lightning trajectory in simulation was in the range of that observed in nature and the calculation results of electric field at ground level were in good agreement with the measurements of a negative flash, which shows the validity of this proposed model. Furthermore, a new equation to estimate the lightning striking distance to flat ground was suggested based on the present model. The striking distance obtained by this new equation is smaller than the value estimated by previous equations, which indicates that the traditional equations may somewhat overestimate the attractive effect of the ground.

Fragmentation dynamics of ionized neon clusters (Ne(n), n=3-14) embedded in helium nanodroplets.

Science.gov (United States)

Bonhommeau, David; Halberstadt, Nadine; Viel, Alexandra

2006-01-14

We report a theoretical study of the nonadiabatic fragmentation dynamics of ionized neon clusters embedded in helium nanodroplets for cluster sizes up to n=14 atoms. The dynamics of the neon atoms is modeled using the molecular dynamics with quantum transitions method of Tully [J. Chem. Phys. 93, 1061 (1990)] with the nuclei treated classically and transitions between electronic states quantum mechanically. The potential-energy surfaces are derived from a diatomics-in-molecules model to which induced dipole-induced dipole interactions are added. The effect of the spin-orbit interaction is also discussed. The helium environment is modeled by a friction force acting on charged atoms whose speed exceeds the critical Landau velocity. The dependence of the fragment size distribution on the friction strength and on the initial nanodroplet size is investigated. By comparing with the available experimental data obtained for Ne3+ and Ne4+, a reasonable value for the friction coefficient, the only parameter of the model, is deduced. This value is then used to predict the effect of the helium environment on the dissociation dynamics of larger neon clusters, n=5-14. The results show stabilization of larger fragments than in the gas phase, but fragmentation is not completely caged. In addition, two types of dynamics are characterized for Ne4+: fast and explosive, therefore leaving no time for friction to cool down the process when dynamics starts on one of the highest electronic states, and slower, therefore leading to some stabilization by helium when it starts on one of the lowest electronic states.

Novel method for the production of spin-aligned RI beams in projectile fragmentation reaction with the dispersion matching technique

Energy Technology Data Exchange (ETDEWEB)

Ichikawa, Y., E-mail: yuichikawa@phys.titech.ac.jp [Tokyo Institute of Technology, Department of Physics (Japan); Ueno, H. [RIKEN Nishina Center (Japan); Ishii, Y. [Tokyo Institute of Technology, Department of Physics (Japan); Furukawa, T. [Tokyo Metropolitan University, Department of Physics (Japan); Yoshimi, A. [Okayama University, Research Core for Extreme Quantum World (Japan); Kameda, D.; Watanabe, H.; Aoi, N. [RIKEN Nishina Center (Japan); Asahi, K. [Tokyo Institute of Technology, Department of Physics (Japan); Balabanski, D. L. [Bulgarian Academy of Sciences, Institute for Nuclear Research and Nuclear Energy (Bulgaria); Chevrier, R.; Daugas, J. M. [CEA, DAM, DIF (France); Fukuda, N. [RIKEN Nishina Center (Japan); Georgiev, G. [CSNSM, IN2P3-CNRS, Universite Paris-sud (France); Hayashi, H.; Iijima, H. [Tokyo Institute of Technology, Department of Physics (Japan); Inabe, N. [RIKEN Nishina Center (Japan); Inoue, T. [Tokyo Institute of Technology, Department of Physics (Japan); Ishihara, M.; Kubo, T. [RIKEN Nishina Center (Japan); and others

2013-05-15

A novel method to produce spin-aligned rare-isotope (RI) beam has been developed, that is the two-step projectile fragmentation method with a technique of dispersion matching. The present method was verified in an experiment at the RIKEN RIBF, where an RI beam of {sup 32}Al with spin alignment of 8(1) % was successfully produced from a primary beam of {sup 48}Ca, with {sup 33}Al as an intermediate nucleus. Figure of merit of the present method was found to be improved by a factor larger than 50 compared with a conventional method employing single-step projectile fragmentation.

Structure and further fragmentation of significant [a3 + Na - H]+ ions from sodium-cationized peptides.

Science.gov (United States)

Wang, Huixin; Wang, Bing; Wei, Zhonglin; Zhang, Hao; Guo, Xinhua

2015-01-01

A good understanding of gas-phase fragmentation chemistry of peptides is important for accurate protein identification. Additional product ions obtained by sodiated peptides can provide useful sequence information supplementary to protonated peptides and improve protein identification. In this work, we first demonstrate that the sodiated a3 ions are abundant in the tandem mass spectra of sodium-cationized peptides although observations of a3 ions have rarely been reported in protonated peptides. Quantum chemical calculations combined with tandem mass spectrometry are used to investigate this phenomenon by using a model tetrapeptide GGAG. Our results reveal that the most stable [a3 + Na - H](+) ion is present as a bidentate linear structure in which the sodium cation coordinates to the two backbone carbonyl oxygen atoms. Due to structural inflexibility, further fragmentation of the [a3 + Na - H](+) ion needs to overcome several relatively high energetic barriers to form [b2 + Na - H](+) ion with a diketopiperazine structure. As a result, low abundance of [b2 + Na - H](+) ion is detected at relatively high collision energy. In addition, our computational data also indicate that the common oxazolone pathway to generate [b2 + Na - H](+) from the [a3 + Na - H](+) ion is unlikely. The present work provides a mechanistic insight into how a sodium ion affects the fragmentation behaviors of peptides. Copyright © 2015 John Wiley & Sons, Ltd.

Building a better fragment library for de novo protein structure prediction.

Directory of Open Access Journals (Sweden)

Saulo H P de Oliveira

Full Text Available Fragment-based approaches are the current standard for de novo protein structure prediction. These approaches rely on accurate and reliable fragment libraries to generate good structural models. In this work, we describe a novel method for structure fragment library generation and its application in fragment-based de novo protein structure prediction. The importance of correct testing procedures in assessing the quality of fragment libraries is demonstrated. In particular, the exclusion of homologs to the target from the libraries to correctly simulate a de novo protein structure prediction scenario, something which surprisingly is not always done. We demonstrate that fragments presenting different predominant predicted secondary structures should be treated differently during the fragment library generation step and that exhaustive and random search strategies should both be used. This information was used to develop a novel method, Flib. On a validation set of 41 structurally diverse proteins, Flib libraries presents both a higher precision and coverage than two of the state-of-the-art methods, NNMake and HHFrag. Flib also achieves better precision and coverage on the set of 275 protein domains used in the two previous experiments of the the Critical Assessment of Structure Prediction (CASP9 and CASP10. We compared Flib libraries against NNMake libraries in a structure prediction context. Of the 13 cases in which a correct answer was generated, Flib models were more accurate than NNMake models for 10. "Flib is available for download at: http://www.stats.ox.ac.uk/research/proteins/resources".

Building a Better Fragment Library for De Novo Protein Structure Prediction

Science.gov (United States)

de Oliveira, Saulo H. P.; Shi, Jiye; Deane, Charlotte M.

2015-01-01

Fragment-based approaches are the current standard for de novo protein structure prediction. These approaches rely on accurate and reliable fragment libraries to generate good structural models. In this work, we describe a novel method for structure fragment library generation and its application in fragment-based de novo protein structure prediction. The importance of correct testing procedures in assessing the quality of fragment libraries is demonstrated. In particular, the exclusion of homologs to the target from the libraries to correctly simulate a de novo protein structure prediction scenario, something which surprisingly is not always done. We demonstrate that fragments presenting different predominant predicted secondary structures should be treated differently during the fragment library generation step and that exhaustive and random search strategies should both be used. This information was used to develop a novel method, Flib. On a validation set of 41 structurally diverse proteins, Flib libraries presents both a higher precision and coverage than two of the state-of-the-art methods, NNMake and HHFrag. Flib also achieves better precision and coverage on the set of 275 protein domains used in the two previous experiments of the the Critical Assessment of Structure Prediction (CASP9 and CASP10). We compared Flib libraries against NNMake libraries in a structure prediction context. Of the 13 cases in which a correct answer was generated, Flib models were more accurate than NNMake models for 10. “Flib is available for download at: http://www.stats.ox.ac.uk/research/proteins/resources”. PMID:25901595

Universal elements of fragmentation

International Nuclear Information System (INIS)

Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

2010-01-01

A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

Distal border fragments of the equine navicular bone: association between magnetic resonance imaging characteristics and clinical lameness

Science.gov (United States)

Yorke, Elizabeth H.; Judy, Carter E.; Saveraid, Travis C.; McGowan, Conor P.; Caldwell, Fred J.

2014-01-01

Distal border fragments of the navicular bone are increasingly being detected due to the improved capabilities of magnetic resonance imaging (MRI), but their clinical significance remains unclear. The purpose of this retrospective study was to describe the location, size, and frequency of fragments in a cohort of horses presented for MRI of the foot and to compare MRI findings with severity of lameness. Archived MRI studies and medical records were searched from March 2006 to June 2008. Horses were included if a distal border fragment of the navicular bone was visible in MRI scans. Confidence interval comparisons and linear regression analyses were used to test hypotheses that fragments were associated with lameness and lameness severity was positively correlated with fragment volume and biaxial location. A total of 453 horses (874 limbs) were included. Fragments were identified in 60 horses (13.25%) and 90 limbs (10.3%). Fifty percent of the horses had unilateral fragments and 50% had bilateral fragments. Fragments were located at the lateral (62.2%), medial (8.89%), or medial and lateral (28.9%) angles of the distal border of the navicular bone. There was no increased probability of being categorized as lame if a fragment was present. There was no significant difference in fragment volume across lameness severity categorizations. Confidence intervals indicated a slightly increased probability of being classified as lame if both medial and lateral fragments were present. Findings indicated that distal border fragments of the navicular bone in equine MRI studies are unlikely to be related to existing lameness.

Sub-fragmentation of structural-reactive-material casings under explosion

Science.gov (United States)

Zhang, Fan

2015-06-01

The sub-fragmentation of structural reactive material (SRM) thick-casings is to generate fine fragments during casing fragmentation under explosive loading for their efficient energy release to enhance air blast. This has been investigated using a cylindrical casing made from either rich Al-MoO3 or Al-W-based granular composites. The former composite was to study the concept of reactive hot spots where the reaction of reactive particles, which were distributed into base SRM in a fuel-rich equivalence ratio, created heat and gas products during SRM fragmentation. The expansion of these distributed hot spots initiated local fractures of the casing, leading to fine fragments. The Al-W-based composite investigated the concept of impedance mismatch, where shock dynamics at the interfaces of different impedance ingredients resulted in non-uniform, high local temperatures and stresses and late in times the dissimilar inertia resulted in different accelerations, leading to material separation and fine fragments. The casings were manufactured through both hot iso-static pressing and cold gas dynamic spray deposition. Explosion experiments were conducted in a 3 m diameter, 23 m3 cylindrical chamber for these cased charges in a casing-to-explosive mass ratio of 1.75. The results demonstrated the presence of fine fragments and more efficient fragment combustion, compared with previous results, and indicated the effectiveness of both concepts. This work was jointly funded by Defence R&D Canada and the Advanced Energetics Program of DTRA (Dr. William H. Wilson).

Deciding Security for a Fragment of ASLan

DEFF Research Database (Denmark)

Mödersheim, Sebastian Alexander

situations in security such as the interaction between the work ow of a system with its access control policies. While even the transition relation is undecidable for ASLan in general, we show the security problem is decidable for a large and useful fragment that we call TASLan, as long as we bound...... the number of steps of honest participants. The restriction of TASLan is that all messages and predicates must be in a certain sense unambiguous in their interpretation, excluding \\type-confusions" similar to some tagging results for security protocols....

An Imaging System for Automated Characteristic Length Measurement of Debrisat Fragments

Science.gov (United States)

Moraguez, Mathew; Patankar, Kunal; Fitz-Coy, Norman; Liou, J.-C.; Sorge, Marlon; Cowardin, Heather; Opiela, John; Krisko, Paula H.

2015-01-01

The debris fragments generated by DebriSat's hypervelocity impact test are currently being processed and characterized through an effort of NASA and USAF. The debris characteristics will be used to update satellite breakup models. In particular, the physical dimensions of the debris fragments must be measured to provide characteristic lengths for use in these models. Calipers and commercial 3D scanners were considered as measurement options, but an automated imaging system was ultimately developed to measure debris fragments. By automating the entire process, the measurement results are made repeatable and the human factor associated with calipers and 3D scanning is eliminated. Unlike using calipers to measure, the imaging system obtains non-contact measurements to avoid damaging delicate fragments. Furthermore, this fully automated measurement system minimizes fragment handling, which reduces the potential for fragment damage during the characterization process. In addition, the imaging system reduces the time required to determine the characteristic length of the debris fragment. In this way, the imaging system can measure the tens of thousands of DebriSat fragments at a rate of about six minutes per fragment, compared to hours per fragment in NASA's current 3D scanning measurement approach. The imaging system utilizes a space carving algorithm to generate a 3D point cloud of the article being measured and a custom developed algorithm then extracts the characteristic length from the point cloud. This paper describes the measurement process, results, challenges, and future work of the imaging system used for automated characteristic length measurement of DebriSat fragments.

Quantitative experimental modelling of fragmentation during explosive volcanism

Science.gov (United States)

Thordén Haug, Ø.; Galland, O.; Gisler, G.

2012-04-01

exponents D. This procedure allows, for the first time, to determine the scaling laws that govern the number of fragments (N), the average size of the fragments (A) and D. We show that (1) N scales with P^(1/2), (2) A scales with P^(-2/3), (3) D scales with P^(1/5). Our experimental procedure thus appears as a unique tool to unravel the complex physics of fragmentation during phreatomagmatic explosions.

Shielding design of RIKEN RI Beam Factory

Energy Technology Data Exchange (ETDEWEB)

Uwamino, Yoshitomo; Fukunishi, Nobuhisa [Institute of Physical and Chemical Research, Wako, Saitama (Japan); Oishi, Koji [Shimizu Corp., Tokyo (Japan)

2000-03-01

Construction of the RIKEN RI Beam Factory is started, and the phase 1 will be finished by the end of March 2003. Two ring cyclotrons including one superconducting machine and two Big RIPSs will be constructed in the phase 1. Heavy ions of proton to uranium will be accelerated up to 400 MeV/u (A<40) and 150 MeV/u for uranium at an intensity of 10{sup 13} pps. Neutron production by the 400 MeV/u {sup 20}Ne beam was measured at HIMAC of NIRS and it was used for the source term of the shielding calculations. The deep penetration of high-energy neutrons was calculated by using the ANISN code with the DLC-119/HILO86R group constants and also by using the HETC code. The ANISN results were modified by using the HETC results and the shielding experiment at ISIS, and they were fitted by a simple formula for practical use. High-energy neutron penetrations of slantwise injection and the reflection probabilities of iron slab were calculated with the HETC code, and these results were used for the estimation of the thickness for the iron local shielding of Big RIPSs. Induced radioactivity in the air, accelerator components and the building, and the skyshine effect were also estimated. (author)

Charge distribution in the ternary fragmentation of {sup 252}Cf

Energy Technology Data Exchange (ETDEWEB)

Senthil Kannan, M.T.; Balasubramaniam, M. [Bharathiar University, Department of Physics, Coimbatore (India)

2017-08-15

We present here, for the first time, a study on ternary fragmentation charge distribution of {sup 252}Cf using the convolution integral method and the statistical theory. The charge distribution for all possible charge combinations of a ternary breakup are grouped as a bin containing different mass partitions. Different bins corresponding to various third fragments with mass numbers from A{sub 3} = 16 to 84 are identified with the available experimental masses. The corresponding potential energy surfaces are calculated using the three cluster model for the two arrangements A{sub 1} + A{sub 2} + A{sub 3} and A{sub 1} + A{sub 3} + A{sub 2}. The ternary fragmentation yield values are calculated for the ternary combination from each bin possessing minimum potential energy. The yields of the resulting ternary combinations as a function of the charge numbers of the three fragments are analyzed for both the arrangements. The calculations are carried out at different excitation energies of the parent nucleus. For each excitation energy the temperature of the three fragments are iteratively computed conserving the total energy. The distribution of fragment temperatures corresponding to different excitation energies for some fixed third fragments are discussed. The presence of the closed shell nucleus Sn in the favourable ternary fragmentation is highlighted. (orig.)

Fragmentation characteristics of the unstable [CH3 CO][radical sign] radicals generated by neutralization of [CH3CO]+ cations

Science.gov (United States)

Hop, C. E. C. A.; Holmes, J. L.

1991-03-01

The stability and fragmentation characteristics of [CH3 CO][radical sign] radicals, generated by vertical charge exchange between acetyl cations and permanent gases or metal vapours (He, Xe, NO, Cd, Na and K), were examined mass spectrometrically. Two dissociation reactions were observed, the losses of CH[radical sign]3 and H[radical sign]. The H[radical sign] loss reaction, the higher energy dissociation, became of greater importance as the exothermicity of the charge exchange was increased. Based on the analysis of the kinetic energy releases it was concluded that these decompositions arose from the population of two excited states of the [CH3 CO][radical sign] radical.

Light particles emitted with the fission fragments of thorium

Energy Technology Data Exchange (ETDEWEB)

San-Tsiang, T; Faraggi, H

1947-01-01

The traces produced by the fission of thorium with fast neutrons have been recorded photographically and studied. The formation of a light fragment of long range by either quadripartition or tripartition was not observed. The release of a short-range light fragment by bipartition was observed about one hundred times more frequently than was the release of such a fragment by tripartition. The ratio of the range of the two heavy fragments produced by tripartition was 1:2; this compares with a ratio of 1:3 for the heavy fragments produced by bipartition.

One step synthesis of 6-oxo-cholestan-3β,5α-diol

International Nuclear Information System (INIS)

Voisin, Maud; Silvente-Poirot, Sandrine; Poirot, Marc

2014-01-01

Highlights: • Cholesterol-5,6-epoxides are metabolized into cholestane-3β,5α,6β-triol (CT) in cancer cells. • 6-Oxo-cholestan-3β,5α-diol (OCDO) is a putative metabolite of CT. • The one step syntheses of CT and OCDO from cholesterol are reported. • The one step syntheses of labelled CT and OCDO are reported. - Abstract: Cholesterol metabolism has been recently linked to cancer, highlighting the importance of the characterization of new metabolic pathways in the sterol series. One of these pathways is centered on cholesterol-5,6-epoxides (5,6-ECs). 5,6-ECs can either generate dendrogenin A, a tumor suppressor present in healthy mammalian tissues, or the carcinogenic cholestane-3β,5α,6β-triol (CT) and its putative metabolite 6-oxo-cholestan-3β,5α-diol (OCDO) in tumor cells. We are currently investigating the identification of the enzyme involved in OCDO biosynthesis, which would be highly facilitated by the use of commercially unavailable [ 14 C]-cholestane-3β,5α,6β-triol and [ 14 C]-6-oxo-cholestan-3β,5α-diol. In the present study we report the one-step synthesis of [ 14 C]-cholestane-3β,5α,6β-triol and [ 14 C]-6-oxo-cholestan-3β,5α-diol by oxidation of [ 14 C]-cholesterol with iodide metaperiodate (HIO 4 )

Description of premixing with the MC3D code including molten jet behavior modeling. Comparison with FARO experimental results

Energy Technology Data Exchange (ETDEWEB)

Berthoud, G.; Crecy, F. de; Meignen, R.; Valette, M. [CEA-G, DRN/DTP/SMTH, 17 rue des Martyrs, 38054 Grenoble Cedex 9 (France)

1998-01-01

The premixing phase of a molten fuel-coolant interaction is studied by the way of mechanistic multidimensional calculation. Beside water and steam, corium droplet flow and continuous corium jet flow are calculated independent. The 4-field MC3D code and a detailed hot jet fragmentation model are presented. MC3D calculations are compared to the FARO L14 experiment results and are found to give satisfactory results; heat transfer and jet fragmentation models are still to be improved to predict better final debris size values. (author)

Crystallization of DNA fragments from water-salt solutions, containing 2-methylpentane-2,3-diol.

Science.gov (United States)

Osica, V D; Sukharevsky, B Y; Vasilchenko, V N; Verkin, B I; Polyvtsev, O F

1976-09-01

Fragments of calf thymus DNA have been crystallized by precipitation from water-salt solutions, containing 2-methylpentane-2,3-diol (MPD). DNA crystals usually take the form either of spherulites up to 100 mu in diameter or of needles with the length up to 50 mu. No irreversible denaturation of DNA occurs during the crystallization process. X-ray diffraction from dense slurries of DNA crystals yields crystalline powder patterns.

Preparation and photocatalytic degradation performance of Ag_3PO_4 with a two-step approach

International Nuclear Information System (INIS)

Li, Jiwen; Ji, Xiaojing; Li, Xian; Hu, Xianghua; Sun, Yanfang; Ma, Jingjun; Qiao, Gaowei

2016-01-01

Highlights: • Ag_3PO_4 photocatalysts were synthesized via one-step and two-step ion-exchange reaction. • Photocatalytic properties of Ag_3PO_4 photocatalysts was investigated, the result indicated the Ag_3PO_4 (2) was higher than that of Ag_3PO_4 (1) under the same experimental condition. • Ag_3PO_4 (2) particles were larger than Ag_3PO_4 (1) particles and many polygonal-shaped surfaces could be clearly observed in the Ag_3PO_4 (2) particles. - Abstract: Ag_3PO_4 photocatalysts were prepared via two and one-step through a facile ion-exchange route. The photocatalysts were then characterized through powder X-ray diffraction, scanning electron microscopy and UV–vis diffuse reflectance spectroscopy. The photocatalytic activity of the samples was evaluated on the basis of the photocatalytic degradation of methyl orange (MO) and methylene blue (MB) under solar irradiation. The MO degradation rate of the Photocatalyst synthesized by the two-step ion-exchange route was 89.18% in 60 min. This value was four times that of the Photocatalyst synthesized by the one-step approach.The MB degradation rate was 97% in 40 min. After six cycling runs were completed, the MO degradation rate was 73%

chi2 analyses of data on relativistic anomalous projectile fragments

International Nuclear Information System (INIS)

MacGregor, M.H.

1983-01-01

Nuclear emulsion data from four experimental groups are now available on the interactions of p relativistic anomalous projectile fragments. In the present paper we systematically combine these data together to form several different data sets, which are used to carry out a series of chi 2 parameter studies. The anomalous particle fragment component in the relativistic nuclear beam has been characterized previously in terms of the parameters f and lambda, where f is the anomalous particle fragment fraction in the secondary beam and lambda is the average anomalous particle fragment mean free path in the emulsion. We extend this result here by setting lambda = lambda 0 (2Z)/sup -beta/, where Z is the nuclear charge of the anomalous particle fragment, so that we can investigate the Z dependence of lambda. We also investigate isotopic effects in the equations used to describe ''normal'' secondary beam nuclei, and we examine the problem of optimizing the bin sizes used to represent the data. A series of (f,lambda 0 ,#betta#) parameter studies leads to the conclusion that the ''anomalous particle fragment effect'' exists for all Z values in the range Z = 3--26 included in the chi 2 analyses. These chi 2 analyses also indicate that #betta#>0, so that the anomalous particle fragment lambda's are Z dependent, but the data are not sufficient to pin down a definite value of #betta#. In order to assess the physical content of these results, we define a domain within which nuclear mean free paths can be accounted for by conventional nuclear forces (but not necessarily by conventional nuclear structure). The Z-dependent anomalous particle fragment mean free paths lie approximately on the boundary of this domain

Controlled fragmentation

International Nuclear Information System (INIS)

Arnold, Werner

2002-01-01

Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer

The effective fragment molecular orbital method for fragments connected by covalent bonds.

Directory of Open Access Journals (Sweden)

Casper Steinmann

Full Text Available We extend the effective fragment molecular orbital method (EFMO into treating fragments connected by covalent bonds. The accuracy of EFMO is compared to FMO and conventional ab initio electronic structure methods for polypeptides including proteins. Errors in energy for RHF and MP2 are within 2 kcal/mol for neutral polypeptides and 6 kcal/mol for charged polypeptides similar to FMO but obtained two to five times faster. For proteins, the errors are also within a few kcal/mol of the FMO results. We developed both the RHF and MP2 gradient for EFMO. Compared to ab initio, the EFMO optimized structures had an RMSD of 0.40 and 0.44 Å for RHF and MP2, respectively.

Molten aluminum alloy fuel fragmentation experiments

International Nuclear Information System (INIS)

Gabor, J.D.; Purviance, R.T.; Cassulo, J.C.; Spencer, B.W.

1992-01-01

Experiments were conducted in which molten aluminum alloys were injected into a 1.2 m deep pool of water. The parameters varied were (i) injectant material (8001 aluminum alloy and 12.3 wt% U-87.7 wt% Al), (ii) melt superheat (O to 50 K), (iii) water temperature (313, 343 and 373 K) and (iv) size and geometry of the pour stream (5, 10 and 20 mm diameter circular and 57 mm annular). The pour stream fragmentation was dominated by surface tension with large particles (∼30 mm) being formed from varicose wave breakup of the 10-mm circular pours and from the annular flow off a 57 mm diameter tube. The fragments produced by the 5 mm circular et were smaller (∼ mm), and the 20 mm jet which underwent sinuous wave breakup produced ∼100 mm fragments. The fragments froze to form solid particles in 313 K water, and when the water was ≥343 K, the melt fragments did not freeze during their transit through 1.2 m of water

Structure guided optimization of a fragment hit to imidazopyridine inhibitors of PI3K.

Science.gov (United States)

Pecchi, Sabina; Ni, Zhi-Jie; Han, Wooseok; Smith, Aaron; Lan, Jiong; Burger, Matthew; Merritt, Hanne; Wiesmann, Marion; Chan, John; Kaufman, Susan; Knapp, Mark S; Janssen, Johanna; Huh, Kay; Voliva, Charles F

2013-08-15

PI3 kinases are a family of lipid kinases mediating numerous cell processes such as proliferation, migration and differentiation. The PI3 Kinase pathway is often de-regulated in cancer through PI3Kα overexpression, gene amplification, mutations and PTEN phosphatase deletion. PI3K inhibitors represent therefore an attractive therapeutic modality for cancer treatment. Herein we describe how the potency of a benzothiazole fragment hit was quickly improved based on structural information and how this early chemotype was further optimized through scaffold hopping. This effort led to the identification of a series of 2-acetamido-5-heteroaryl imidazopyridines showing potent in vitro activity against all class I PI3Ks and attractive pharmacokinetic properties. Copyright © 2013 Elsevier Ltd. All rights reserved.

Two steps hydrothermal growth and characterisations of BaTiO3 films composed of nanowires

Science.gov (United States)

Zawawi, Che Zaheerah Najeehah Che Mohd; Salleh, Shahril; Oon Jew, Lee; Tufail Chaudhary, Kashif; Helmi, Mohamad; Safwan Aziz, Muhammad; Haider, Zuhaib; Ali, Jalil

2018-05-01

Barium titanate (BaTiO3) films composed of nanowires have gained considerable research interest due to their lead-free composition and strong energy conversion efficiency. BaTiO3 films can be developed with a simple two steps hydrothermal reactions, which are low cost effective. In this research, BaTiO3 films were fabricated on titanium foil through two steps hydrothermal method namely, the growth of TiO2 and followed by BaTiO3 films. The structural evolutions and the dielectric properties of the films were investigated as well. The structural evolutions of titanium dioxide (TiO2) and BaTiO3 nanowires were characterized using X-ray diffraction and scanning electron microscopy. First step of hydrothermal reaction, TiO2 nanowires were prepared in varied temperatures of 160 °C, 200 °C and 250 °C respectively. Second step of hydrothermal reaction was performed to produce a layer of BaTiO3 films.

Fragmentation cross sections outside the limiting-fragmentation regime

CERN Document Server

Sümmerer, K

2003-01-01

The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.

Universality of fragment shapes.

Science.gov (United States)

Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea

2015-03-16

The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.

Amplifier channel for a fission fragment semiconductor detector

International Nuclear Information System (INIS)

Tyurin, G.P.

1981-01-01

To compensate the decrease of the transformation coefficient of fission fragment semiconductor detector (SCD) developed is a special amplification channel with controlled transfer coefficient. The block diagram of the channel is presented, the main functional units of which are as follows: preamplifying head with charge-sensitive and timing preamplifiers, linear amplifier and the circuit of spectrum position stabilization, which includes a differential discriminator, integrator and reference signal generator. The amplification channel is made in the CAMAC standard and has the following specifications: dinamical input capacitance of charge-sensitive amplifier c=10000 n PHI, signal amplitude at output of the linear amplifier at energy of fission fragments of 120 MeV has negative polarity and is equal to 5 V. Pulse amplitude change at SCD sensitivity decrease to 50% constitutes not more than 1%. Timing preamplifier has the gain factor at voltage of K=80 at front duration of 3.5 nc. Time resolution of the amplification channel is not worse than 1 nc. Dimensions of preamplifying head are 40x40x15 mm. The amplification channel permitted to use SCD for long-term measurements of fission fragment spectra [ru

Anomalous nuclear fragments

International Nuclear Information System (INIS)

Karmanov, V.A.

1983-01-01

Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative

One step synthesis of 6-oxo-cholestan-3β,5α-diol

Energy Technology Data Exchange (ETDEWEB)

Voisin, Maud; Silvente-Poirot, Sandrine; Poirot, Marc, E-mail: marc.poirot@inserm.fr

2014-04-11

Highlights: • Cholesterol-5,6-epoxides are metabolized into cholestane-3β,5α,6β-triol (CT) in cancer cells. • 6-Oxo-cholestan-3β,5α-diol (OCDO) is a putative metabolite of CT. • The one step syntheses of CT and OCDO from cholesterol are reported. • The one step syntheses of labelled CT and OCDO are reported. - Abstract: Cholesterol metabolism has been recently linked to cancer, highlighting the importance of the characterization of new metabolic pathways in the sterol series. One of these pathways is centered on cholesterol-5,6-epoxides (5,6-ECs). 5,6-ECs can either generate dendrogenin A, a tumor suppressor present in healthy mammalian tissues, or the carcinogenic cholestane-3β,5α,6β-triol (CT) and its putative metabolite 6-oxo-cholestan-3β,5α-diol (OCDO) in tumor cells. We are currently investigating the identification of the enzyme involved in OCDO biosynthesis, which would be highly facilitated by the use of commercially unavailable [{sup 14}C]-cholestane-3β,5α,6β-triol and [{sup 14}C]-6-oxo-cholestan-3β,5α-diol. In the present study we report the one-step synthesis of [{sup 14}C]-cholestane-3β,5α,6β-triol and [{sup 14}C]-6-oxo-cholestan-3β,5α-diol by oxidation of [{sup 14}C]-cholesterol with iodide metaperiodate (HIO{sub 4})

A 3-Step Algorithm Using Region-Based Active Contours for Video Objects Detection

Directory of Open Access Journals (Sweden)

Stéphanie Jehan-Besson

2002-06-01

Full Text Available We propose a 3-step algorithm for the automatic detection of moving objects in video sequences using region-based active contours. First, we introduce a very full general framework for region-based active contours with a new Eulerian method to compute the evolution equation of the active contour from a criterion including both region-based and boundary-based terms. This framework can be easily adapted to various applications, thanks to the introduction of functions named descriptors of the different regions. With this new Eulerian method based on shape optimization principles, we can easily take into account the case of descriptors depending upon features globally attached to the regions. Second, we propose a 3-step algorithm for detection of moving objects, with a static or a mobile camera, using region-based active contours. The basic idea is to hierarchically associate temporal and spatial information. The active contour evolves with successively three sets of descriptors: a temporal one, and then two spatial ones. The third spatial descriptor takes advantage of the segmentation of the image in intensity homogeneous regions. User interaction is reduced to the choice of a few parameters at the beginning of the process. Some experimental results are supplied.

Effect of One-Step and Multi-Steps Polishing System on Enamel Roughness

Directory of Open Access Journals (Sweden)

Cynthia Sumali

2013-07-01

Full Text Available Normal 0 false false false MicrosoftInternetExplorer4 The final procedures of orthodontic treatment are bracket debonding and cleaning the remaining adhesive. Multi-step polishing system is the most common method used. The disadvantage of that system is long working time, because of the stages that should be done. Therefore, dental material manufacturer make an improvement to the system, to reduce several stages into one stage only. This new system is known as one-step polishing system. Objective: To compare the effect of one-step and multi-step polishing system on enamel roughness after orthodontic bracket debonding. Methods: Randomized control trial was conducted included twenty-eight maxillary premolar randomized into two polishing system; one-step OptraPol (Ivoclar, Vivadent and multi-step AstroPol (Ivoclar, Vivadent. After bracket debonding, the remaining adhesive on each group was cleaned by subjective polishing system for ninety seconds using low speed handpiece. The enamel roughness was subjected to profilometer, registering two roughness parameters (Ra, Rz. Independent t-test was used to analyze the mean score of enamel roughness in each group. Results: There was no significant difference of enamel roughness between one-step and multi-step polishing system (p>0.005. Conclusion: One-step polishing system can produce a similar enamel roughness to multi-step polishing system after bracket debonding and adhesive cleaning.DOI: 10.14693/jdi.v19i3.136

Comparison of spallation-model calculations with experiment on neutron production in uranium

International Nuclear Information System (INIS)

Kazaritskij, V.D.; Sibirtsev, A.A.; Stepanov, N.V.

1988-01-01

Calculated differential cross-sections for neutrons emitted from a thin uranium target due to 590 MeV protons are compared with experiment. The HETC, HAMLET, D2N2 and EVAP codes were applied. The HAMLET results are most consistent with experiment. 12 refs.; 3 figs

arXiv Generalized Fragmentation Functions for Fractal Jet Observables

CERN Document Server

Elder, Benjamin T.; Thaler, Jesse; Waalewijn, Wouter J.; Zhou, Kevin

2017-06-15

We introduce a broad class of fractal jet observables that recursively probe the collective properties of hadrons produced in jet fragmentation. To describe these collinear-unsafe observables, we generalize the formalism of fragmentation functions, which are important objects in QCD for calculating cross sections involving identified final-state hadrons. Fragmentation functions are fundamentally nonperturbative, but have a calculable renormalization group evolution. Unlike ordinary fragmentation functions, generalized fragmentation functions exhibit nonlinear evolution, since fractal observables involve correlated subsets of hadrons within a jet. Some special cases of generalized fragmentation functions are reviewed, including jet charge and track functions. We then consider fractal jet observables that are based on hierarchical clustering trees, where the nonlinear evolution equations also exhibit tree-like structure at leading order. We develop a numeric code for performing this evolution and study its phen...

Tracking and characterization of fragments in a beating heart using 3D ultrasound for interventional guidance.

Science.gov (United States)

Thienphrapa, Paul; Elhawary, Haytham; Ramachandran, Bharat; Stanton, Douglas; Popovic, Aleksandra

2011-01-01

Fragments generated by explosions and similar incidents can become trapped in a patient's heart chambers, potentially causing disruption of cardiac function. The conventional approach to removing such foreign bodies is through open heart surgery, which comes with high perioperative risk and long recovery times. We thus advocate a minimally invasive surgical approach through the use of 3D transesophageal echocardiography (TEE) and a flexible robotic end effector. In a phantom study, we use 3D TEE to track a foreign body in a beating heart, and propose a modified normalized cross-correlation method for improved accuracy and robustness of the tracking, with mean RMS errors of 2.3 mm. Motion analysis of the foreign body trajectory indicates very high speeds and accelerations, which render unfeasible a robotic retrieval method based on following the tracked trajectory. Instead, a probability map of the locus of the foreign body shows that the fragment tends to occupy only a small sub-volume of the ventricle, suggesting a retrieval strategy based on moving the robot end effector to the position with the highest spatial probability in order to maximize the possibility of capture.

Fission fragment mass distributions via prompt γ-ray spectroscopy

Indian Academy of Sciences (India)

The distribution of fragment masses formed in nuclear fission is one of the most strik- ing features .... 80. 100. 120. 140. 160. 10. 3. 10. 4. Fragment Mass. Relative yield. Sn. Cd. Te. Pd ... the secondary fragment at Z = 50 and N = 82 shells, where the yields are depleted. Both ... More systematic experimental data are required.

Numerical simulation of fragmentation of hot metal and oxide melts with the computer code IVA3

International Nuclear Information System (INIS)

Mussa, S.; Tromm, W.

1994-01-01

The phenomena of fragmentation of melts caused by water-inlet from the bottom with the computer code IVA3/11,12,13/ are investigated. With the computer code IVA3 three-component-multiphase flows can be numerically simulated. Two geometrical models are used. Both consist of a cylindrical vessel for water lying beneath a cylindrical vessel for melt. The vessels are connected to each other through a hole. Steel and UO 2 melts are. The following parameters were varied: the type of the melt (steel,UO 2 ), the water supply pressure and the geometry of the hole in the bottom plate through which the water and melt vessels are connected. As results of the numerical simulations temperature and pressure versus time curves are plotted. Additionally the volume flow rates and the volume fractions of the various phases in the vessels and the increase in surface and enthalpy of the melt during the time of simulation are depicted. With steel melts the rate of fragmentation increases with increasing water pressure and melt temperature, whereby stable channels are formed in the melt layer showing a very low flow resistance for steam. With UO 2 the formations of channels are also observed. However, these channels are not so stable that they eventually break apart and lead to the fragmentation of the UO 2 melt in drops. The fragmentation of the steel melt in water vessel is less than that of UO 2 . No essential solidification of the melt is observed in the respective duration of the simulations. However, a small drop in the melt temperature is observed. With a slight or no water pressure the melt flows from the upper vessel into the water vessel via the connecting hole. The processes take place in a very slow manner and with such a low steam production so that despite the occuring pressure peaks no sign of steam explosions could be observed. (orig./HP) [de

Fragment assignment in the cloud with eXpress-D

Science.gov (United States)

2013-01-01

Background Probabilistic assignment of ambiguously mapped fragments produced by high-throughput sequencing experiments has been demonstrated to greatly improve accuracy in the analysis of RNA-Seq and ChIP-Seq, and is an essential step in many other sequence census experiments. A maximum likelihood method using the expectation-maximization (EM) algorithm for optimization is commonly used to solve this problem. However, batch EM-based approaches do not scale well with the size of sequencing datasets, which have been increasing dramatically over the past few years. Thus, current approaches to fragment assignment rely on heuristics or approximations for tractability. Results We present an implementation of a distributed EM solution to the fragment assignment problem using Spark, a data analytics framework that can scale by leveraging compute clusters within datacenters–“the cloud”. We demonstrate that our implementation easily scales to billions of sequenced fragments, while providing the exact maximum likelihood assignment of ambiguous fragments. The accuracy of the method is shown to be an improvement over the most widely used tools available and can be run in a constant amount of time when cluster resources are scaled linearly with the amount of input data. Conclusions The cloud offers one solution for the difficulties faced in the analysis of massive high-thoughput sequencing data, which continue to grow rapidly. Researchers in bioinformatics must follow developments in distributed systems–such as new frameworks like Spark–for ways to port existing methods to the cloud and help them scale to the datasets of the future. Our software, eXpress-D, is freely available at: http://github.com/adarob/express-d. PMID:24314033

Spatial Characterization of Polycyclic Aromatic Hydrocarbons in 2008 TC3 Samples

Science.gov (United States)

Sabbah, Hassan; Morrow, A.; Zare, R. N.; Jenniskens, P.

2009-09-01

Hassan Sabbah1, Amy L. Morrow1, Richard N. Zare1 and Petrus Jenniskens2 1Stanford University, Stanford, California 94305, 2 SETI Institute, Carl Sagan Center, 515 North Whisman Road, Mountain View, California 94043, USA. In October 2006 a small asteroid (2-3 meters) was observed in outer space. On October 7, 2008, it entered the Earth's atmosphere creating a fireball over Northern Sudan. Some 280 meteorites were collected by the University of Khartoum. In order to explore the existence of organic materials, specifically polycyclic aromatic hydrocarbons (PAHs), we applied two-step laser desorption laser ionization mass spectrometry (L2MS) to some selected fragments. This technique consists of desorbing with a pulsed infrared laser beam the solid materials into a gaseous phase with no fragmentation followed by resonance enhanced multiphoton ionization to analyze the PAH content. L2MS was already applied to an array of extraterrestrial objects including interplanetary dust particles IDPs, carbonaceous chondrites and comet coma particles. Moreover, spatial resolution of PAHs in 2008 TC3 samples was achieved to explore the heterogeneity within individual fragments. The results of these studies and their contribution to understanding the formation of this asteroid will be discussed.

Non-equilibrium versus equilibrium emission of complex fragments from hot nuclei

International Nuclear Information System (INIS)

Viola, V.E.; Kwiatkowski, K.; Yennello, S.; Fields, D.E.

1989-01-01

The relative contributions of equilibrium and non-equilibrium mechanisms for intermediate-mass fragment emission have been deduced for Z=3-14 fragments formed in 3 He- and 14 N-induced reactions on Ag and Au targets. Complete inclusive excitation function measurements have been performed for 3 He projectiles from E/A=67 to 1,200 MeV and for 14 N from E/A=20 to 50 MeV. The data are consistent with a picture in which equilibrated emission is important at the lowest energies, but with increasing bombarding energy the cross sections are increasingly dominated by non-equilibrium processes. Non-equilibrium emission is also shown to be favored for light fragments relative to heavy fragments. These results are supported by coincidence studies of intermediate-mass fragments tagged by linear momentum transfer measurements

RISC-interacting clearing 3'- 5' exoribonucleases (RICEs) degrade uridylated cleavage fragments to maintain functional RISC in Arabidopsis thaliana.

Science.gov (United States)

Zhang, Zhonghui; Hu, Fuqu; Sung, Min Woo; Shu, Chang; Castillo-González, Claudia; Koiwa, Hisashi; Tang, Guiliang; Dickman, Martin; Li, Pingwei; Zhang, Xiuren

2017-05-02

RNA-induced silencing complex (RISC) is composed of miRNAs and AGO proteins. AGOs use miRNAs as guides to slice target mRNAs to produce truncated 5' and 3' RNA fragments. The 5' cleaved RNA fragments are marked with uridylation for degradation. Here, we identified novel cofactors of Arabidopsis AGOs, named RICE1 and RICE2. RICE proteins specifically degraded single-strand (ss) RNAs in vitro; but neither miRNAs nor miRNA*s in vivo. RICE1 exhibited a DnaQ-like exonuclease fold and formed a homohexamer with the active sites located at the interfaces between RICE1 subunits. Notably, ectopic expression of catalytically-inactive RICE1 not only significantly reduced miRNA levels; but also increased 5' cleavage RISC fragments with extended uridine tails. We conclude that RICEs act to degrade uridylated 5' products of AGO cleavage to maintain functional RISC. Our study also suggests a possible link between decay of cleaved target mRNAs and miRNA stability in RISC.

Nuclear fragmentation

International Nuclear Information System (INIS)

Chung, K.C.

1989-01-01

An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

Excited State Contributions to the Heavy Baryon Fragmentation Functions in a Quark-Diquark Model

CERN Document Server

Adamov, A D; Goldstein, Gary R.

2001-01-01

Spin dependent fragmentation functions for heavy flavor quarks to fragment into heavy baryons are calculated in a quark-diquark model. The production of intermediate spin 1/2 and 3/2 excited states is explicity included. The resulting $\\Lambda_b$ production rate and polarization at LEP energies are in agreement with experiment. The $\\Lambda_c$ and $\\Xi_c$ functions are also obtained. The spin independent $f_1(z)$ is compared to data. The integrated values for production rates agree with the data.

Strain-energy effects on dynamic fragmentation

International Nuclear Information System (INIS)

Glenn, L.A.; Chudnovsky, A.

1986-01-01

Grady's model of the dynamic fragmentation process, in which the average fragment size is determined by balancing the local kinetic energy and the surface energy, is modified to include the stored elastic (strain) energy. The revised model predicts that the strain energy should dominate for brittle materials, with low fracture toughness and high fracture-initiation stress. This conclusion is not borne out, however, by limited experimental data on brittle steels, even when the kinetic-energy density is small compared with the strain-energy density

Scaling and universality in binary fragmenting with inhibition

International Nuclear Information System (INIS)

Ploszajczak, M.; Botet, R.

1994-01-01

We investigate a new model of binary fragmentation with inhibition, driven by the white noise. In a broad range of fragmentation probabilities, the power-law spatio-temporal correlations ar found to arise due to self-organized criticality (SOC). We find in the SOC phase a non-trivial power spectrum of the temporal sequence of the fragmentation events. The 1/∫ behaviour is recovered in the irreversible, near-equilibrium part of this phase. (authors). 13 refs., 3 figs., 1 tab

Scaling and universality in binary fragmenting with inhibition

Energy Technology Data Exchange (ETDEWEB)

Ploszajczak, M [Grand Accelerateur National d` Ions Lourds (GANIL), 14 - Caen (France); Botet, R [Paris-11 Univ., 91 - Orsay (France). Lab. de Physique des Solides

1994-12-31

We investigate a new model of binary fragmentation with inhibition, driven by the white noise. In a broad range of fragmentation probabilities, the power-law spatio-temporal correlations ar found to arise due to self-organized criticality (SOC). We find in the SOC phase a non-trivial power spectrum of the temporal sequence of the fragmentation events. The 1/{integral} behaviour is recovered in the irreversible, near-equilibrium part of this phase. (authors). 13 refs., 3 figs., 1 tab.

Spin dependent fragmentation functions for heavy flavor baryons and single heavy hyperon polarization

CERN Document Server

Goldstein, G R

2001-01-01

Spin dependent fragmentation functions for heavy flavor quarks to fragment into heavy baryons are calculated in a quark-diquark model. The production of intermediate spin 1/2 and 3/2 excited states is explicity included. $\\Lambda_b$ , $\\Lambda_c$ and $\\Xi_c$ production rate and polarization at LEP energies are calculated and, where possible, compared with experiment. A different approach, also relying on a heavy quark-diquark model, is proposed for the small momentum transfer inclusive production of polarized heavy flavor hyperons. The predicted $\\Lambda_c$ polarization is roughly in agreement with experiment.

Role of step stiffness and kinks in the relaxation of vicinal (001) with zigzag [110] steps

Science.gov (United States)

Mahjoub, B.; Hamouda, Ajmi BH.; Einstein, TL.

2017-08-01

We present a kinetic Monte Carlo study of the relaxation dynamics and steady state configurations of 〈110〉 steps on a vicinal (001) simple cubic surface. This system is interesting because 〈110〉 (fully kinked) steps have different elementary excitation energetics and favor step diffusion more than 〈100〉 (nominally straight) steps. In this study we show how this leads to different relaxation dynamics as well as to different steady state configurations, including that 2-bond breaking processes are rate determining for 〈110〉 steps in contrast to 3-bond breaking processes for 〈100〉-steps found in previous work [Surface Sci. 602, 3569 (2008)]. The analysis of the terrace-width distribution (TWD) shows a significant role of kink-generation-annihilation processes during the relaxation of steps: the kinetic of relaxation, toward the steady state, is much faster in the case of 〈110〉-zigzag steps, with a higher standard deviation of the TWD, in agreement with a decrease of step stiffness due to orientation. We conclude that smaller step stiffness leads inexorably to faster step dynamics towards the steady state. The step-edge anisotropy slows the relaxation of steps and increases the strength of step-step effective interactions.

Synthetic Progress toward Azadirachtins. 1. Enantio- and Diastereoselective Synthesis of the Left-Wing Fragment of 11-epi-Azadirachtin I.

Science.gov (United States)

Shi, Hang; Tan, Ceheng; Zhang, Weibin; Zhang, Zichun; Long, Rong; Luo, Tuoping; Yang, Zhen

2015-05-15

A highly enantio- and diastereoselective synthesis of the left-wing fragment of 11-epi-azadirachtin I characterized with the pairwise use of palladium- and gold-catalyzed cascade reactions is presented. By enlisting a sequence of stereocontrolled transformations, our 21-step route established the stereocenters of the left-wing fragment from one chiral starting material, (-)-carvone, which would significantly facilitate the synthetic studies of the azadirachtin-type limonoids.

Influence of primary fragment excitation energy and spin distributions on fission observables

Science.gov (United States)

Litaize, Olivier; Thulliez, Loïc; Serot, Olivier; Chebboubi, Abdelaziz; Tamagno, Pierre

2018-03-01

Fission observables in the case of 252Cf(sf) are investigated by exploring several models involved in the excitation energy sharing and spin-parity assignment between primary fission fragments. In a first step the parameters used in the FIFRELIN Monte Carlo code "reference route" are presented: two parameters for the mass dependent temperature ratio law and two constant spin cut-off parameters for light and heavy fragment groups respectively. These parameters determine the initial fragment entry zone in excitation energy and spin-parity (E*, Jπ). They are chosen to reproduce the light and heavy average prompt neutron multiplicities. When these target observables are achieved all other fission observables can be predicted. We show here the influence of input parameters on the saw-tooth curve and we discuss the influence of a mass and energy-dependent spin cut-off model on gamma-rays related fission observables. The part of the model involving level densities, neutron transmission coefficients or photon strength functions remains unchanged.

Forest edge disturbance increases rattan abundance in tropical rain forest fragments.

Science.gov (United States)

Campbell, Mason J; Edwards, Will; Magrach, Ainhoa; Laurance, Susan G; Alamgir, Mohammed; Porolak, Gabriel; Laurance, William F

2017-07-20

Human-induced forest fragmentation poses one of the largest threats to global diversity yet its impact on rattans (climbing palms) has remained virtually unexplored. Rattan is arguably the world's most valuable non-timber forest product though current levels of harvesting and land-use change place wild populations at risk. To assess rattan response to fragmentation exclusive of harvesting impacts we examined rattan abundance, demography and ecology within the forests of northeastern, Australia. We assessed the community abundance of rattans, and component adult (>3 m) and juvenile (≤3 m) abundance in five intact forests and five fragments (23-58 ha) to determine their response to a range of environmental and ecological parameters. Fragmented forests supported higher abundances of rattans than intact forests. Fragment size and edge degradation significantly increased adult rattan abundance, with more in smaller fragments and near edges. Our findings suggest that rattan increase within fragments is due to canopy disturbance of forest edges resulting in preferential, high-light habitat. However, adult and juvenile rattans may respond inconsistently to fragmentation. In managed forest fragments, a rattan abundance increase may provide economic benefits through sustainable harvesting practices. However, rattan increases in protected area forest fragments could negatively impact conservation outcomes.

A linear relationship between crystal size and fragment binding time observed crystallographically: implications for fragment library screening using acoustic droplet ejection.

Directory of Open Access Journals (Sweden)

Krystal Cole

Full Text Available High throughput screening technologies such as acoustic droplet ejection (ADE greatly increase the rate at which X-ray diffraction data can be acquired from crystals. One promising high throughput screening application of ADE is to rapidly combine protein crystals with fragment libraries. In this approach, each fragment soaks into a protein crystal either directly on data collection media or on a moving conveyor belt which then delivers the crystals to the X-ray beam. By simultaneously handling multiple crystals combined with fragment specimens, these techniques relax the automounter duty-cycle bottleneck that currently prevents optimal exploitation of third generation synchrotrons. Two factors limit the speed and scope of projects that are suitable for fragment screening using techniques such as ADE. Firstly, in applications where the high throughput screening apparatus is located inside the X-ray station (such as the conveyor belt system described above, the speed of data acquisition is limited by the time required for each fragment to soak into its protein crystal. Secondly, in applications where crystals are combined with fragments directly on data acquisition media (including both of the ADE methods described above, the maximum time that fragments have to soak into crystals is limited by evaporative dehydration of the protein crystals during the fragment soak. Here we demonstrate that both of these problems can be minimized by using small crystals, because the soak time required for a fragment hit to attain high occupancy depends approximately linearly on crystal size.

Affinity of hemoglobin for the cytoplasmic fragment of human erythrocyte membrane band 3. Equilibrium measurements at physiological pH using matrix-bound proteins: the effects of ionic strength, deoxygenation and of 2,3-diphosphoglycerate.

Science.gov (United States)

Chétrite, G; Cassoly, R

1985-10-05

The cytoplasmic fragment of band 3 protein isolated from the human erythrocyte membrane was linked to a CNBr-activated Sepharose matrix in an attempt to measure, in batch experiments, its equilibrium binding constant with oxy- and deoxyhemoglobin at physiological pH and ionic strength values and in the presence or the absence of 2,3-diphosphoglycerate. All the experiments were done at pH 7.2, and equilibrium constants were computed on the basis of one hemoglobin tetramer bound per monomer of fragment. In 10 mM-phosphate buffer, a dissociation constant KD = 2 X 10(-4)M was measured for oxyhemoglobin and was shown to increase to 8 X 10(-4)M in the presence of 50 mM-NaCl. Association could not be demonstrated at higher salt concentrations. Diphosphoglycerate-stripped deoxyhemoglobin was shown to associate more strongly with the cytoplasmic fragment of band 3. In 10 mM-bis-Tris (pH 7.2) and in the presence of 120 mM-NaCl, a dissociation constant KD = 4 X 10(-4)M was measured. Upon addition of increasing amounts of 2,3-diphosphoglycerate, the complex formed between deoxyhemoglobin and the cytoplasmic fragment of band 3 was dissociated. On the reasonable assumption that the hemoglobin binding site present on band 3 fragment was not modified upon linking the protein to the Sepharose matrix, the results indicated that diphosphoglycerate-stripped deoxyhemoglobin or partially liganded hemoglobin tetramers in the T state could bind band 3 inside the intact human red blood cell.

Three-dimensional reconstructions in spine and screw trajectory simulation on 3D digital images: a step by step approach by using Mimics software.

Science.gov (United States)

Chen, Dong; Chen, Chun-Hui; Tang, Li; Wang, Kai; Li, Yu-Zhe; Phan, Kevin; Wu, Ai-Min

2017-12-01

There is a rapidly increasing amount of literature outlining the use of three-dimensional (3D) reconstruction and printing technologies in recent years. However, precise instructive articles which describe step-by-step methods of reconstructing 3D images from computed tomography (CT) or magnetic resonance imaging (MRI) remain limited. To address these issues, this article describes a detailed protocol which will allow the reader to easily perform the 3D reconstruction in their future research, to allow investigation of the appropriate surgical anatomy and allow innovative designs of novel screw fixation techniques or pre-operative surgical planning.

Binary projectile fragmentation of 12C at an incident energy of 33.3 MeV/nucleon

CERN Document Server

Förtsch, S V; Gadioli, E; Bassini, R; Buthelezi, E Z; Cerutti, F; Connell, S H; Cowley, A A; Fujita, H; Mabiala, J; Mairani, A; Mira, J; Papka, P; Neveling, R; Smit, F D

2010-01-01

Direct binary projectile fragmentation is being investigated for the case where a 400 MeV 12C projectile breaks up into an particle and a 8Be fragment in the interaction with a thin 93Nb and 197Au target. While the 8Be fragments were measured at 9 , the correlated particles were detected in an angular range between 16 and 30 on the opposite side of the beam. From the preliminary results presented here one may obtain information on the amount of quasi-elastic fragmentation (both fragments do not suffer any further interactions after they are produced). These experimental results indicate that the quasi-elastic break-up process is the dominant contribution to the measured correlation spectra. As was also observed in earlier work, the most forward quasi-elastically emitted particles have energies exceeding the beam velocity.

Controllable 3D architectures of aligned carbon nanotube arrays by multi-step processes

Science.gov (United States)

Huang, Shaoming

2003-06-01

An effective way to fabricate large area three-dimensional (3D) aligned CNTs pattern based on pyrolysis of iron(II) phthalocyanine (FePc) by two-step processes is reported. The controllable generation of different lengths and selective growth of the aligned CNT arrays on metal-patterned (e.g., Ag and Au) substrate are the bases for generating such 3D aligned CNTs architectures. By controlling experimental conditions 3D aligned CNT arrays with different lengths/densities and morphologies/structures as well as multi-layered architectures can be fabricated in large scale by multi-step pyrolysis of FePc. These 3D architectures could have interesting properties and be applied for developing novel nanotube-based devices.

Parton fragmentation in the vacuum and in the medium

CERN Document Server

Albino, S.; Arleo, F.; Besson, Dave Z.; Brooks, William K.; Buschbeck, B.; Cacciari, M.; Christova, E.; Corcella, G.; D'Enterria, David G.; Dolejsi, Jiri; Domdey, S.; Estienne, M.; Hamacher, Klaus; Heinz, M.; Hicks, K.; Kettler, D.; Kumano, S.; Moch, S.O.; Muccifora, V.; Pacetti, S.; Perez-Ramos, R.; Pirner, H.J.; Pronko, Alexandre Pavlovich; Radici, M.; Rak, J.; Roland, C.; Rudolph, Gerald; Rurikova, Z.; Salgado, C.A.; Sapeta, S.; Saxon, David H.; Seidl, Ralf-Christian; Seuster, R.; Stratmann, M.; Tannenbaum, Michael J.; Tasevsky, M.; Trainor, T.; Traynor, D.; Werlen, M.; Zhou, C.

2008-01-01

We present the mini-proceedings of the workshop on ``Parton fragmentation in the vacuum and in the medium'' held at the European Centre for Theoretical Studies in Nuclear Physics and Related Areas (ECT*, Trento) in February 2008. The workshop gathered both theorists and experimentalists to discuss the current status of investigations of quark and gluon fragmentation into hadrons at different accelerator facilities (LEP, B-factories, JLab, HERA, RHIC, and Tevatron) as well as preparations for extension of these studies at the LHC. The main physics topics covered were: (i) light-quark and gluon fragmentation in the vacuum including theoretical (global fits analyses and MLLA) and experimental (data from e+e-, p-p, e-p collisions) aspects, (ii) strange and heavy-quark fragmentation, (iii) parton fragmentation in cold QCD matter (nuclear DIS), and (iv) medium-modified fragmentation in hot and dense QCD matter (high-energy nucleus-nucleus collisions). These mini-proceedings consist of an introduction and short summ...

The Fragmentation Criteria in Local Vertically Stratified Self-gravitating Disk Simulations

Energy Technology Data Exchange (ETDEWEB)

Baehr, Hans; Klahr, Hubert [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Kratter, Kaitlin M., E-mail: baehr@mpia.de [Steward Observatory, University of Arizona, Tucson, AZ 85721 (United States)

2017-10-10

Massive circumstellar disks are prone to gravitational instabilities, which trigger the formation of spiral arms that can fragment into bound clumps under the right conditions. Two-dimensional simulations of self-gravitating disks are useful starting points for studying fragmentation because they allow high-resolution simulations of thin disks. However, convergence issues can arise in 2D from various sources. One of these sources is the 2D approximation of self-gravity, which exaggerates the effect of self-gravity on small scales when the potential is not smoothed to account for the assumed vertical extent of the disk. This effect is enhanced by increased resolution, resulting in fragmentation at longer cooling timescales β . If true, it suggests that the 3D simulations of disk fragmentation may not have the same convergence problem and could be used to examine the nature of fragmentation without smoothing self-gravity on scales similar to the disk scale height. To that end, we have carried out local 3D self-gravitating disk simulations with simple β cooling with fixed background irradiation to determine if 3D is necessary to properly describe disk fragmentation. Above a resolution of ∼40 grid cells per scale height, we find that our simulations converge with respect to the cooling timescale. This result converges in agreement with analytic expectations which place a fragmentation boundary at β {sub crit} = 3.

Evaluation of bulk shield for the JHP facilities

International Nuclear Information System (INIS)

Uwamino, Yoshitomo; Shibata, Tokushi

1991-01-01

In the Japanese Hadron Project (JHP), a 1-GeV 200-μA proton beam will be handled, and the radiation shield of the facility will be very massive concrete and iron lump. Since the constructing cost is strongly affected by the shielding design, the design must be severely performed. The neutron yield in thin targets and a copper beam dump was calculated by the HETC-KFA-2 Monte Carlo code. For the evaluation of the calculational accuracy, the calculational results were compared with the experimental data by Cierjacks and Raupp. The calculated result of heavy element agreed well with the experiment at a low energy region, E n n >100 MeV) of 90 deg close to the calculated one of about 60 deg in the absolute value. The high energy neutron transport in a 5-m-thick iron slab and in an 8-m-thick ordinary concrete slab was calculated with the HETC code and also with the discrete ordinates transport code, ANISN. In the ANISN calculation, the DLC-87/HILO and the DLC-128/LAHIMAC group cross sections were used. The ANISN calculation with the LAHIMAC cross sections gave strong underestimation compared with the HETC calculation. The difference of the shielding lengths calculated by the HETC code and by the ANISN code used with the HILO cross sections was smaller than 6% for the both iron and concrete cases. (author)

Submillimeter Monitoring of the HCN Molecule in Fragment C of the Split Comet 73P/Schwassmann-Wachmann 3

Science.gov (United States)

Drahus, Michal; Kueppers, M.; Jarchow, C.; Paganini, L.; Hartogh, P.; Villanueva, G. L.

2007-10-01

Comet 73P/Schwassmann-Wachmann 3 is a member of the Jupiter family which broke up into several fragments in 1995. After the unfavourable return in 2000/2001, the comet passed very close to the Earth in 2006, with the perigee distance below 0.1 AU. Simultaneously, it was well situated on the sky, which resulted in several observing campaigns. We observed this comet using the SMT facility at the Mt. Graham International Observatory in Arizona. In particular, on 5 nights between 10 and 22 May 2006 the HCN molecule in fragment C was spectroscopically monitored, through the J(3-2) and J(4-3) transitions. Using a simplified model, we found the expansion velocity of the HCN coma to be equal to 0.8 ± 0.1 km/s, what is a typical value for a comet at heliocentric distance r = 1 AU. We also reconstructed the production rates Q of this molecule, finding Q(r=1AU) = 2.7 ± 0.1 × 1025 molec/s. Our result is consistent with most of the other estimates, including the CN production rate. Furthermore, taking advantage of the fairly small beam sizes during our campaign (ranging from 600 km to 1200 km in radius), we detected short-term variability of the production rate, presumably stimulated by the nucleus rotation. Although our analysis did not yield a unique rotation period, we found a limited number of possible solutions. We will discuss them in detail along with a comparison with other period claims, and propose a possible scenario that links most of the periodicities reported so far for this comet. The SMT is operated by the Arizona Radio Observatory (ARO), Steward Observatory, University of Arizona.

Inclusive characteristics of the nuclear target fragmentation products induced by relativistic particles

International Nuclear Information System (INIS)

Bogatin, V.I.; Ganza, E.A.; Lozhkin, O.V.; Murin, Yu.A.; Oplavin, V.S.; Perfilov, N.A.; Yakovlev, Yu.P.

1981-01-01

An experimental investigation of inclusive characteristics of nuclei-target fragmentation is conducted for further development and test of physical value of the earlier suggested nuclear fragmentation model based on the connection of the fragmentation with fluctuations of the quasiparticle density in the two-component quantum liquid, an experimental investigation of the inclusive characteristics of the nuclei-target fragmentation is carried out. The processes of sup(3, 4, 6, 8)He and sup(6, 7, 8, 9, 11)Li fragment formation during the interaction of relativistic protons (Esub(p)=6.7 GeV) and deutrons (Esub(d)=3.1 GeV) with 112 Sn and 124 Sn isotopes are studied by the method of semiconductive ΔE-E detectors. Differential energy spectra of fragments and isotopic ratio of cross sections of their formation as well as data on the dependence of isotopic ratios of fragmentation cross sections on the energy of incident particles and on the fragment energy are obtained. Presented is a phenomenological model of fragmentation within the frames of which the obtained experimental data are analyzed [ru

Fission fragment angular momentum

International Nuclear Information System (INIS)

Frenne, D. De

1991-01-01

Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs

Revisiting the even-odd staggering in fission-fragment yields

International Nuclear Information System (INIS)

Caamano, M.; Rejmund, F.; Schmidt, K. H.

2010-01-01

The even-odd staggering observed in the experimental fission-fragment nuclear-charge yields is investigated over a wide systematics of fission fragments measured at Lohengrin in direct kinematics and at GSI in inverse kinematics. The general increase of the even-odd staggering in the fission-fragment charge yields towards asymmetric charge splits is explained by the absorption of the unpaired nucleons by the heavy fragment. As a consequence, the well established trend of even-odd staggering in the fission fragment charge yields to decrease with the fissility is attributed in part to the asymmetry evolution of the charge distribution. This interpretation is strongly supported by the data measured at GSI, which cover the complete charge distribution and include precise yields at symmetry. They reveal that the even-odd effect around symmetry remains constant over a large range of fissility. (authors)

The 0.3-kb fragment containing the R-U5-5'leader sequence of Friend murine leukemia virus influences the level of protein expression from spliced mRNA.

Science.gov (United States)

Choo, Yeng Cheng; Seki, Yohei; Machinaga, Akihito; Ogita, Nobuo; Takase-Yoden, Sayaka

2013-04-19

A neuropathogenic variant of Friend murine leukemia virus (Fr-MLV) clone A8 induces spongiform neurodegeneration when infected into neonatal rats. Studies with chimeras constructed from the A8 virus and the non-neuropathogenic Fr-MLV clone 57 identified a 0.3-kb KpnI-AatII fragment containing a R-U5-5'leader sequence as an important determinant for inducing spongiosis, in addition to the env gene of A8 as the primary determinant. This 0.3-kb fragment contains a 17-nucleotide difference between the A8 and 57 sequences. We previously showed that the 0.3-kb fragment influences expression levels of Env protein in both cultured cells and rat brain, but the corresponding molecular mechanisms are not well understood. Studies with expression vectors constructed from the full-length proviral genome of Fr-MLV that incorporated the luciferase (luc) gene instead of the env gene found that the vector containing the A8-0.3-kb fragment yielded a larger amount of spliced luc-mRNA and showed higher expression of luciferase when compared to the vector containing the 57-0.3-kb fragment. The amount of total transcripts from the vectors, the poly (A) tail length of their mRNAs, and the nuclear-cytoplasm distribution of luc-mRNA in transfected cells were also evaluated. The 0.3-kb fragment did not influence transcription efficiency, mRNA polyadenylation or nuclear export of luc-mRNA. Mutational analyses were carried out to determine the importance of nucleotides that differ between the A8 and 57 sequences within the 0.3-kb fragment. In particular, seven nucleotides upstream of the 5'splice site (5'ss) were found to be important in regulating the level of protein expression from spliced messages. Interestingly, these nucleotides reside within the stem-loop structure that has been speculated to limit the recognition of 5'ss. The 0.3-kb fragment containing the R-U5-5'leader sequence of Fr-MLV influences the level of protein expression from the spliced-mRNA by regulating the splicing

Comparison of Yamax pedometer and GT3X accelerometer steps in a free-living sample

Science.gov (United States)

Our objective was to compare steps detected by the Yamax pedometer (PEDO) versus the GT3X accelerometer (ACCEL) in free-living adults. Daily PEDO and ACCEL steps were collected from a sample of 23 overweight and obese participants (18 females; mean +/- sd: age = 52.6 +/- 8.4 yr.; body mass index = 3...

Stepped-wedge cluster randomised controlled trials: a generic framework including parallel and multiple-level designs.

Science.gov (United States)

Hemming, Karla; Lilford, Richard; Girling, Alan J

2015-01-30

Stepped-wedge cluster randomised trials (SW-CRTs) are being used with increasing frequency in health service evaluation. Conventionally, these studies are cross-sectional in design with equally spaced steps, with an equal number of clusters randomised at each step and data collected at each and every step. Here we introduce several variations on this design and consider implications for power. One modification we consider is the incomplete cross-sectional SW-CRT, where the number of clusters varies at each step or where at some steps, for example, implementation or transition periods, data are not collected. We show that the parallel CRT with staggered but balanced randomisation can be considered a special case of the incomplete SW-CRT. As too can the parallel CRT with baseline measures. And we extend these designs to allow for multiple layers of clustering, for example, wards within a hospital. Building on results for complete designs, power and detectable difference are derived using a Wald test and obtaining the variance-covariance matrix of the treatment effect assuming a generalised linear mixed model. These variations are illustrated by several real examples. We recommend that whilst the impact of transition periods on power is likely to be small, where they are a feature of the design they should be incorporated. We also show examples in which the power of a SW-CRT increases as the intra-cluster correlation (ICC) increases and demonstrate that the impact of the ICC is likely to be smaller in a SW-CRT compared with a parallel CRT, especially where there are multiple levels of clustering. Finally, through this unified framework, the efficiency of the SW-CRT and the parallel CRT can be compared. © 2014 The Authors. Statistics in Medicine Published by John Wiley & Sons Ltd.

Azimuthal Anisotropies in Nuclear Fragmentation

International Nuclear Information System (INIS)

Dabrowska, A.; Szarska, M.; Trzupek, A.; Wolter, W.; Wosiek, B.

2002-01-01

The directed and elliptic flow of fragments emitted from the excited projectile nuclei has been observed for 158 AGeV Pb collisions with the lead and plastic targets. For comparison the flow analysis has been performed for 10.6 AGeV Au collisions with the emulsion target. The strong directed flow of heaviest fragments is found. Light fragments exhibit directed flow opposite to that of heavy fragments. The elliptic flow for all multiply charged fragments is positive and increases with the charge of the fragment. The observed flow patterns in the fragmentation of the projectile nucleus are practically independent of the mass of the target nucleus and the collision energy. Emission of fragments in nuclear multifragmentation shows similar, although weaker, flow effects. (author)

Fragmentation of 12C nuclei in emulsion at 50 GeV/c

International Nuclear Information System (INIS)

El-Naghy, A.

1981-01-01

A total of 852 12 C-emulsion interactions at 4.2 GeV/nucleon was investigated. In 86% of these events, at least one projectile fragment was oberserved in each. The angular distributions of Z = 1,2, and >= 3 projectile fragments are narrow, and the dispersion of the distribution decreases with the increasing of Z. The production cross section of the reaction 12 C + Em → Li (from the projectile) + anything is about 6 x 10 -3 sigmasub(in). Only the projectile-fragmentation events, nsub(h) = O, were studied in detail; the percentage of these events is 10% of the total inelastic events. The events with the maximum probability are those in which α-fragment is the maximum-charged projectile fragment emitted. This indicates that the projectile nuclear structure plays an important role in the fragmentation process. In 1.2% of the total events, 12 C has been dissociated into 3 α-particles. (orig.)

Analysis of fission-fragment mass distribution within the quantum-mechanical fragmentation theory

Energy Technology Data Exchange (ETDEWEB)

Singh, Pardeep; Kaur, Harjeet [Guru Nanak Dev University, Department of Physics, Amritsar (India)

2016-11-15

The fission-fragment mass distribution is analysed for the {sup 208}Pb({sup 18}O, f) reaction within the quantum-mechanical fragmentation theory (QMFT). The reaction potential has been calculated by taking the binding energies, Coulomb potential and proximity potential of all possible decay channels and a stationary Schroedinger equation has been solved numerically to calculate the fission-fragment yield. The overall results for mass distribution are compared with those obtained in experiment. Fine structure dips in yield, corresponding to fragment shell closures at Z = 50 and N=82, which are observed by Bogachev et al., are reproduced successfully in the present calculations. These calculations will help to estimate the formation probabilities of fission fragments and to understand many related phenomena occurring in the fission process. (orig.)

SAPhIR: a fission-fragment detector

International Nuclear Information System (INIS)

Theisen, Ch.; Gautherin, C.; Houry, M.; Korten, W.; Le Coz, Y.; Lucas, R.; Barreau, G.; Doan, T. P.; Belier, G.; Meot, V.; Ethvignot, Th.; Cahan, B.; Le Coguie, A.; Coppolani, X.; Delaitre, B.; Le Bourlout, P.; Legou, Ph.; Maillard, O.; Durand, G.; Bouillac, A.

1998-01-01

SAPhIR is the acronym for S a clay A q uitaine P ho tovoltaic cells for I s omer R e search. It consists of solar cells, used for fission-fragment detection. It is a collaboration between 3 laboratories: CEA Saclay, CENBG Bordeaux and CEA Bruyeres le Chatel. The coupling of a highly efficient fission-fragment detector like SAPhIR with EUROBALL will provide new insights in the study of very deformed nuclear matter and in the spectroscopy of neutron-rich nuclei

Synthesis of Calystegine A(3) from Glucose by the Use of Ring-Closing Metathesis

DEFF Research Database (Denmark)

Monrad, Rune Nygaard; Pipper, Charlotte Bressen; Madsen, Robert

2009-01-01

A synthesis of the nortropane alkaloid calystegine A(3) is described from D-glucose. The key step employs a zinc-mediated tandem reaction where a benzyl-protected methyl 6-iodo glucoside is fragmented to give an unsaturated aldehyde, which is then transformed into the corresponding benzylimine...... affords calystegine A(3). The synthesis uses a total of 13 steps from glucose and confirms the absolute configuration of the natural product....

Photodissociation of CH3CHO at 248 nm by time-resolved Fourier-transform infrared emission spectroscopy: Verification of roaming and triple fragmentation

Science.gov (United States)

Hung, Kai-Chan; Tsai, Po-Yu; Li, Hou-Kuan; Lin, King-Chuen

2014-02-01

By using time-resolved Fourier-transform infrared emission spectroscopy, the HCO fragment dissociated from acetaldehyde (CH3CHO) at 248 nm is found to partially decompose to H and CO. The fragment yields are enhanced by the Ar addition that facilitates the collision-induced internal conversion. The channels to CH2CO + H2 and CH3CO + H are not detected significantly. The rotational population distribution of CO, after removing the Ar collision effect, shows a bimodal feature comprising both low- and high-rotational (J) components, sharing a fraction of 19% and 81%, respectively, for the vibrational state v = 1. The low-J component is ascribed to both roaming pathway and triple fragmentation. They are determined to have a branching ratio of 0.06, respectively, relative to the whole v = 1 population. The CO roaming is accompanied by a highly vibrational population of CH4 that yields a vibrational bimodality.

Novel approach of fragment-based lead discovery applied to renin inhibitors.

Science.gov (United States)

Tawada, Michiko; Suzuki, Shinkichi; Imaeda, Yasuhiro; Oki, Hideyuki; Snell, Gyorgy; Behnke, Craig A; Kondo, Mitsuyo; Tarui, Naoki; Tanaka, Toshimasa; Kuroita, Takanobu; Tomimoto, Masaki

2016-11-15

A novel approach was conducted for fragment-based lead discovery and applied to renin inhibitors. The biochemical screening of a fragment library against renin provided the hit fragment which showed a characteristic interaction pattern with the target protein. The hit fragment bound only to the S1, S3, and S3 SP (S3 subpocket) sites without any interactions with the catalytic aspartate residues (Asp32 and Asp215 (pepsin numbering)). Prior to making chemical modifications to the hit fragment, we first identified its essential binding sites by utilizing the hit fragment's substructures. Second, we created a new and smaller scaffold, which better occupied the identified essential S3 and S3 SP sites, by utilizing library synthesis with high-throughput chemistry. We then revisited the S1 site and efficiently explored a good building block attaching to the scaffold with library synthesis. In the library syntheses, the binding modes of each pivotal compound were determined and confirmed by X-ray crystallography and the library was strategically designed by structure-based computational approach not only to obtain a more active compound but also to obtain informative Structure Activity Relationship (SAR). As a result, we obtained a lead compound offering synthetic accessibility as well as the improved in vitro ADMET profiles. The fragments and compounds possessing a characteristic interaction pattern provided new structural insights into renin's active site and the potential to create a new generation of renin inhibitors. In addition, we demonstrated our FBDD strategy integrating highly sensitive biochemical assay, X-ray crystallography, and high-throughput synthesis and in silico library design aimed at fragment morphing at the initial stage was effective to elucidate a pocket profile and a promising lead compound. Copyright © 2016 Elsevier Ltd. All rights reserved.

Habitat fragmentation causes rapid genetic differentiation and ...

African Journals Online (AJOL)

... city buildings. These results were supported by multiple statistical analyses including Mantel's test, PCOORDA and AMOVA. Genetic enrichment and epigenetic variation studies can be included in habitat fragmentation analysis and its implications in inducing homogenization and susceptibility in natural plant populations.

Fragmentation and structure of silicon microclusters

International Nuclear Information System (INIS)

Feuston, B.P.; Kalia, R.K.; Vashishta, P.

1987-01-01

It may be possible to determine the magic numbers and fragmentation spectra from the ground-state binding energies and structure, but the relationship between the lowest-energy zero-temperature configurations and the energetics of finite-temperature microclusters is not obvious. Recall fragmentation of Si clusters occurs at temperatures the order of the melting temperature (T∼2000 K). What is needed, a first-principles finite-temperature calculation, allowing the determination of all possible structures, their corresponding binding energies, and fragmentation spectra, is not presently possible. However, a molecular dynamics calculation does allow one to study the nature of fragmentation in addition to determination of the global ground-state structure and all mechanically stable configurations underlying the finite-temperature cluster, once given an interaction potential. The authors present results for such a calculation for Si/sub 2-14/ using the Stillinger-Weber 3-body potential. Their results indicate that the existence of magic numbers is determined by the topology and energetics of high-energy bound structures rather than the structure and ground-state energies at zero temperature

Kinetic study of solid phase demineralization by weak acids in one-step enzymatic bio-refinery of shrimp cuticles

OpenAIRE

Baron, Regis; Socol, Marius; Arhaliass, A.; Bruzac, Sandrine; Le Roux, Karine; Del Pino, J. Rodriguez; Berge, Jean-pascal; Kaas, Raymond

2015-01-01

We describe a one-step bio-refinery process for shrimp composites by-products. Its originality lies in a simple rapid (6 h) biotechnological cuticle fragmentation process that recovers all major compounds (chitins, peptides and minerals in particular calcium). The process consists of a controlled exogenous enzymatic proteolysis in a food-grade acidic medium allowing chitin purification (solid phase), and recovery of peptides and minerals (liquid phase). At a pH of between 3.5 and 4, protease ...

Verification steps for the CMS event-builder software

CERN Multimedia

CERN. Geneva

2015-01-01

The CMS event-builder software is used to assemble event fragments into complete events at 100 kHz. The data originates at the detector front-end electronics, passes through several computers and is transported from the underground to the high-level trigger farm on the surface. I will present the testing and verifications steps a new software version has to pass before it is deployed in production. I will discuss the current practice and possible improvements.

Hypervelocity Impact Test Fragment Modeling: Modifications to the Fragment Rotation Analysis and Lightcurve Code

Science.gov (United States)

Gouge, Michael F.

2011-01-01

Hypervelocity impact tests on test satellites are performed by members of the orbital debris scientific community in order to understand and typify the on-orbit collision breakup process. By analysis of these test satellite fragments, the fragment size and mass distributions are derived and incorporated into various orbital debris models. These same fragments are currently being put to new use using emerging technologies. Digital models of these fragments are created using a laser scanner. A group of computer programs referred to as the Fragment Rotation Analysis and Lightcurve code uses these digital representations in a multitude of ways that describe, measure, and model on-orbit fragments and fragment behavior. The Dynamic Rotation subroutine generates all of the possible reflected intensities from a scanned fragment as if it were observed to rotate dynamically while in orbit about the Earth. This calls an additional subroutine that graphically displays the intensities and the resulting frequency of those intensities as a range of solar phase angles in a Probability Density Function plot. This document reports the additions and modifications to the subset of the Fragment Rotation Analysis and Lightcurve concerned with the Dynamic Rotation and Probability Density Function plotting subroutines.

Preparation and radiolabeling of humanized anti-HER1 monoclonal antibody nimotuzumab Fab' fragment with 68Ga and 90Y

International Nuclear Information System (INIS)

Alonso Martinez, L. M.; Xiques Castillo, A.; Leyva Montanna, R.; Perez-Malo Cruz, M.; Zamora Barrabi, M.; Manresa Sanchez, Y.

2013-01-01

Antibody-based targeted delivery of radioisotopes to malignant tissues is a promising approach in cancer diagnostics and therapy. However, intact antibody molecules are large glycoproteins (∼150 kDa) that have limited application in molecular imaging and therapy due to their relatively slow clearance from the circulation leading to a high background signal rather both cases the sensitivity can be increased with the use of enzymatically produced Fab' fragments. In this work, the ability to get labeled with 62 Ga and 90 Y of a monoclonal antibody (mAb) Fab' fragment against the transmembrane receptor tyrosine kinase HER-1 was studied for future applications in PET imaging and radioimmunotherapy of tumors. In order to obtain the Fab' fragment the mAb was cleaved with pepsin in molar excess. After separating the reaction mixture in two steps using affinity and ion-exchange chromatography, the Fab' fragment was finally obtained by reduction of the F(ab') 2 with a molar excess of 2-mercaptoethanol followed by a size exclusion purification step. The Fab' fragment was derivatized with 1,4,7,10-tetraaza cyclododecane-1,4,7,10-tetraacetic acid mono N-hydroxysuccinimide commercial ester (DOTA-NHS-ester) applying a simple procedure and the number of DOTA groups linked to Fab' were determinate. The labeling of the conjugate with 68 Ga and 90 Y from 'in-house generators yielded radiochemically pure probes that can become a suitable radioimmunoconjugated in a near future. (Author)

Study on penetration-induced initiation of energetic fragment

Science.gov (United States)

Qiao, Xiangxin; Xu, Heyang

2017-09-01

In order to investigate penetration-induced initiation of energetic fragment penetrating target, PTFE/Al (mass ratio 73.5/26.5) pressed and sintered into a Ф8mm × 8mm cylinder. To form energetic fragment, the cylinder was put into a closed container made by 35CrMnSiA. The container is 12mm long, 2mm thick. Energetic fragments were launched by a 14.5mm ballistic gun with a series of velocities and the penetrate process was simulated by AUTODYN-3D. The results show that the stress peak of energetic material exceed the initiation threshold, and energetic material will deflagrate, when energetic fragments impact velocity more than 800 m/s. The research results can provide reference for designs of energetic warhead.

Fragmentation of chromatin with 125I radioactive disintegrations

International Nuclear Information System (INIS)

Turner, G.N.; Nobis, P.; Dewey, W.C.

1976-01-01

The DNA in Chinese hamster cells was labeled first for 3 h with [ 3 H]TdR and then for 3 h with [ 125 I]UdR. Chromatin was extracted, frozen, and stored at -30 0 C until 1.0 x 10 17 and 1.25 x 10 17 disintegrations/g of labeled DNA occurred for 125 I and 3 H, respectively. Velocity sedimentation of chromatin (DNA with associated chromosomal proteins) in neutral sucrose gradients indicated that the localized energy from the 125 I disintegrations, which gave about 1 double-strand break/disintegration plus an additional 1.3 single strand breaks, selectively fragmented the [ 125 I] chromatin into pieces smaller than the [ 3 H] chromatin. In other words, 125 I disintegrations caused much more localized damage in the chromatin labeled with 125 I than in the chromatin labeled with 3 H, and fragments induced in DNA by 125 I disintegrations were not held together by the associated chromosomal proteins. Use of this 125 I technique for studying chromosomal proteins associated with different regions in the cellular DNA is discussed. For these studies, the number of disintegrations required for fragmenting DNA molecules of different sizes is illustrated

Energetics of fragmentation of CH5, H3O, and NH4 from neutralized ion-beam experiments

International Nuclear Information System (INIS)

Williams, B.W.; Porter, R.F.

1980-01-01

Fragmentation energies for radicals of the type RH 2 (RH=CH 4 , NH 3 , and H 2 O) produced by electron capture interactions of 5 keV RH 2 + ion with Na or K atoms are reported. The experimental technique involves measurement of spatial beam profiles resulting from dissociation of neutral radicals following their formation in a near resonant electron transfer process. Cross sections for RH 2 + --Na capture reactions are typically 1x10 -14 cm 2 . Fragmentation energies from measurements with Na target atoms are -2.65 +- 0.14, -0.22 +- 0.03, and -1.12 +- 0.07 eV for CH 5 , NH 4 , and H 3 O, respectively. From our results with Na and K targets and published values for proton affinities, the vertical electron affinities of CH 5 + and H 3 O + are calculated to be 5.3 +- 0.2 eV and 5.1 +- 0.3 eV, respectively. Beam profiles for ND 4 show this species to be metastable with a lifetime of about 1 μs. From this we estimate a potential barrier to dissociation in NH 4 (ND 4 ) between 0.36 and 0.48 eV, indicating this species should be stable at low temperatures. Comparison of these experimental results with theoretical calculations indicates areas of disagreement

Synaptic vesicles contain small ribonucleic acids (sRNAs) including transfer RNA fragments (trfRNA) and microRNAs (miRNA).

Science.gov (United States)

Li, Huinan; Wu, Cheng; Aramayo, Rodolfo; Sachs, Matthew S; Harlow, Mark L

2015-10-08

Synaptic vesicles (SVs) are neuronal presynaptic organelles that load and release neurotransmitter at chemical synapses. In addition to classic neurotransmitters, we have found that synaptic vesicles isolated from the electric organ of Torpedo californica, a model cholinergic synapse, contain small ribonucleic acids (sRNAs), primarily the 5' ends of transfer RNAs (tRNAs) termed tRNA fragments (trfRNAs). To test the evolutionary conservation of SV sRNAs we examined isolated SVs from the mouse central nervous system (CNS). We found abundant levels of sRNAs in mouse SVs, including trfRNAs and micro RNAs (miRNAs) known to be involved in transcriptional and translational regulation. This discovery suggests that, in addition to inducing changes in local dendritic excitability through the release of neurotransmitters, SVs may, through the release of specific trfRNAs and miRNAs, directly regulate local protein synthesis. We believe these findings have broad implications for the study of chemical synaptic transmission.

Applications of the lahet simulation code to relativistic heavy ion detectors

Energy Technology Data Exchange (ETDEWEB)

Waters, L.; Gavron, A. [Los Alamos National Lab., NM (United States)

1991-12-31

The Los Alamos High Energy Transport (LAHET) simulation code has been applied to test beam data from the lead/scintillator Participant Calorimeter of BNL AGS experiment E814. The LAHET code treats hadronic interactions with the LANL version of the Oak Ridge code HETC. LAHET has now been expanded to handle hadrons with kinetic energies greater than 5 GeV with the FLUKA code, while HETC is used exclusively below 2.0 GeV. FLUKA is phased in linearly between 2.0 and 5.0 GeV. Transport of electrons and photons is done with EGS4, and an interface to the Los Alamos HMCNP3B library based code is provided to analyze neutrons with kinetic energies less than 20 MeV. Excellent agreement is found between the test data and simulation, and results for 2.46 GeV/c protons and pions are illustrated in this article.

Applications of the LAHET simulation code to relativistic heavy ion detectors

International Nuclear Information System (INIS)

Waters, L.S.; Gavron, A.

1991-01-01

The Los Alamos High Energy Transport (LAHET) simulation code has been applied to test beam data from the lead/scintillator Participant Calorimeter of BNL AGS experiment E814. The LAHET code treats hadronic interactions with the LANL version of the Oak Ridge code HETC. LAHET has now been expanded to handle hadrons with kinetic energies greater than 5 GeV with the FLUKA code, while HETC is used exclusively below 2.0 GeV. FLUKA is phased in linearly between 2.0 and 5.0 GeV. Transport of electrons and photons is done with EGS4, and an interface to the Los Alamos HMCNP3B library based code is provided to analyze neutrons with kinetic energies less than 20 MeV. Excellent agreement is found between the test data and simulation, and results for 2.46 GeV/c protons and pions are illustrated in this article

Fragment capture device

Science.gov (United States)

Payne, Lloyd R.; Cole, David L.

2010-03-30

A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.

Neutron emission during acceleration of 252Cf fission fragments

International Nuclear Information System (INIS)

Batenkov, O.I.; Blinov, M.V.; Blinov, A.B.; Smirnov, S.N.

1991-01-01

We investigate neutron emission during acceleration of fission fragments in the process of spontaneous fission of 252 Cf. Experimental angular and energy distributions of neutrons are compared with the results of calculations of neutron evaporation during fragment acceleration. (author). 8 refs, 3 figs

DNA fragments assembly based on nicking enzyme system.

Directory of Open Access Journals (Sweden)

Rui-Yan Wang

Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.

Fixation of Trochanteric Fragments in Cementless Bipolar Hemiarthroplasty of Unstable Intertrochanteric Fracture: Cerclage Wiring.

Science.gov (United States)

Lee, Young-Kyun; Park, Chan Ho; Koo, Kyung-Hoi

2017-12-01

Bipolar hemiarthroplasty (HA) is an option for the treatment of unstable intertrochanteric fracture in elderly patients. There is a raising concern regarding cable-grip related complications for the fixation of trochanteric fragments. Therefore, the aim of this study was to evaluate outcome of cementless HA with fixation for the trochanteric fragments using monofilament wires in unstable intertrochanteric fracture. We reviewed 92 cementless bipolar HAs using a grit-blasted long stem design for unstable intertrochanteric fractures in 91 elderly patients with a mean age of 81.7 years. During the arthroplasty, trochanteric fracture fragments were fixed using 1 or 2 vertical wires and transverse wires. We evaluated the clinical outcomes such as abductor power, ambulatory ability and wire-related complications, and radiologic outcomes including the union of the trochanteric fragment and subsidence of stem. Sixty-two patients were followed for a minimum of 2 years (mean, 59 months) postoperatively. The mean abductor power and Koval category was 4.1 (range, 3 to 5) and 4.6 (range, 1 to 6). The wire was broken in 3 hips (4.8%) and the nonunion of the greater trochanter occurred in 1 hips (1.6%). Two stems subsided by 3 mm and 8 mm, respectively, during postoperative 6 weeks, after which the subsidence was not progressive. Cerclage wiring of the trochanter using monofilament wire leads to acceptable outcome in cementless HA for senile patients with unstable intertrochanteric fracture. Cerclage wiring using a monofilament wire is recommended for the fixation of trochanteric fragments.

Fragmentation of Protein Kinase N (PKN) in the Hydrocephalic Rat Brain

International Nuclear Information System (INIS)

Okii, Norifumi; Amano, Taku; Seki, Takahiro; Matsubayashi, Hiroaki; Mukai, Hideyuki; Ono, Yoshitaka; Kurisu, Kaoru; Sakai, Norio

2007-01-01

PKN (protein kinase N; also called protein kinase C-related kinase (PRK-1)), is a serine/threonine protein kinase that is ubiquitously expressed in several organs, including the brain. PKN has a molecular mass of 120 kDa and has two domains, a regulatory and a catalytic domain, in its amino-terminals and carboxyl-terminus, respectively. Although the role of PKN has not been fully elucidated, previous studies have revealed that PKN is cleaved to a constitutively active catalytic fragment of 55 kDa in response to apoptotic signals. Hydrocephalus is a pathological condition caused by insufficient cerebrospinal fluid (CSF) circulation and subsequent excess of CSF in the brain. In this study, in order to elucidate the role of PKN in the pathophysiology of hydrocephalus, we examined PKN fragmentation in hydrocephalic model rats. Hydrocephalus was induced in rats by injecting kaolin into the cisterna magna. Kaolin-induced rats (n=60) were divided into three groups according to the observation period after treatment (group 1: 3–6 weeks, group 2: 7–12 weeks, and group 3: 13–18 weeks). Sham-treated control rats, injected with sterile saline (n=20), were similarly divided into three groups. Spatial learning ability was estimated by a modified water maze test. Thereafter, brains were cut into slices and ventricular dilatation was estimated. Fragmentation of PKN was observed by Western blotting in samples collected from the parietal cortex, striatum, septal nucleus, hippocampus, and periaqueductal gray matter. All kaolin-induced rats showed ventricular dilatation. Most of them showed less spatial learning ability than those of sham-treated controls. In most regions, fragmentation of PKN had occurred in a biphasic manner more frequently than that in controls. The appearance of PKN fragmentation in periaqueductal gray matter was correlated with the extent of ventricular dilation and spatial learning disability. These results revealed that PKN fragmentation was observed in

Land fragmentation and production diversification

NARCIS (Netherlands)

Ciaian, Pavel; Guri, Fatmir; Rajcaniova, Miroslava; Drabik, Dusan; Paloma, Sergio Gomez Y.

2018-01-01

We analyze the impact of land fragmentation on production diversification in rural Albania. Albania represents a particularly interesting case for studying land fragmentation as the fragmentation is a direct outcome of land reforms. The results indicate that land fragmentation is an important driver

Hyperion polarization and transverse momentum properties in proton fragmentation

International Nuclear Information System (INIS)

Andersson, B.; Gustafson, G.; Maansson, O.

1982-11-01

A dynamical mechanism for proton interaction in hadronic collisions is presented which provides a verification of the model with an essentially one-dimensional colour force field in the proton fragmentation region, proposed earlier. We include here a discussion of the transverse momentum properties of the final state particles and polarization properties for hyperions in proton fragmentation. (Author)

Quantification of habitat fragmentation reveals extinction risk in terrestrial mammals

Science.gov (United States)

Crooks, Kevin R.; Burdett, Christopher L.; Theobald, David M.; King, Sarah R. B.; Rondinini, Carlo; Boitani, Luigi

2017-01-01

Although habitat fragmentation is often assumed to be a primary driver of extinction, global patterns of fragmentation and its relationship to extinction risk have not been consistently quantified for any major animal taxon. We developed high-resolution habitat fragmentation models and used phylogenetic comparative methods to quantify the effects of habitat fragmentation on the world’s terrestrial mammals, including 4,018 species across 26 taxonomic Orders. Results demonstrate that species with more fragmentation are at greater risk of extinction, even after accounting for the effects of key macroecological predictors, such as body size and geographic range size. Species with higher fragmentation had smaller ranges and a lower proportion of high-suitability habitat within their range, and most high-suitability habitat occurred outside of protected areas, further elevating extinction risk. Our models provide a quantitative evaluation of extinction risk assessments for species, allow for identification of emerging threats in species not classified as threatened, and provide maps of global hotspots of fragmentation for the world’s terrestrial mammals. Quantification of habitat fragmentation will help guide threat assessment and strategic priorities for global mammal conservation. PMID:28673992

Anticoagulant and calcium-binding properties of high molecular weight derivatives of human fibrinogen (plasmin fragments Y)

NARCIS (Netherlands)

Nieuwenhuizen, W.; Voskuilen, M.; Hermans, J.

1982-01-01

The present study was undertaken as a step to delineate further the localization of the calcium-binding sites in fibrinogen and to assess the anticlotting properties of fibrinogen degradation products. To this purpose, fragments Y were prepared by plasmin digestion of human fibrinogen in the

Fragmentation processes in nuclear reactions

International Nuclear Information System (INIS)

Legrain, R.

1984-08-01

Projectile and nuclear fragmentation are defined and processes referred to are recalled. The two different aspects of fragmentation are considered but the emphasis is also put on heavy ion induced reactions. The preliminary results of an experiment performed at GANIL to study peripheral heavy ions induced reactions at intermediate energy are presented. The results of this experiment will illustrate the characteristics of projectile fragmentation and this will also give the opportunity to study projectile fragmentation in the transition region. Then nuclear fragmentation is considered which is associated with more central collisions in the case of heavy ion induced reactions. This aspect of fragmentation is also ilustrated with two heavy ion experiments in which fragments emitted at large angle have been observed

Consequences of severe habitat fragmentation on density, genetics, and spatial capture-recapture analysis of a small bear population.

Directory of Open Access Journals (Sweden)

Sean M Murphy

Full Text Available Loss and fragmentation of natural habitats caused by human land uses have subdivided several formerly contiguous large carnivore populations into multiple small and often isolated subpopulations, which can reduce genetic variation and lead to precipitous population declines. Substantial habitat loss and fragmentation from urban development and agriculture expansion relegated the Highlands-Glades subpopulation (HGS of Florida, USA, black bears (Ursus americanus floridanus to prolonged isolation; increasing human land development is projected to cause ≥ 50% loss of remaining natural habitats occupied by the HGS in coming decades. We conducted a noninvasive genetic spatial capture-recapture study to quantitatively describe the degree of contemporary habitat fragmentation and investigate the consequences of habitat fragmentation on population density and genetics of the HGS. Remaining natural habitats sustaining the HGS were significantly more fragmented and patchier than those supporting Florida's largest black bear subpopulation. Genetic diversity was low (AR = 3.57; HE = 0.49 and effective population size was small (NE = 25 bears, both of which remained unchanged over a period spanning one bear generation despite evidence of some immigration. Subpopulation density (0.054 bear/km2 was among the lowest reported for black bears, was significantly female-biased, and corresponded to a subpopulation size of 98 bears in available habitat. Conserving remaining natural habitats in the area occupied by the small, genetically depauperate HGS, possibly through conservation easements and government land acquisition, is likely the most important immediate step to ensuring continued persistence of bears in this area. Our study also provides evidence that preferentially placing detectors (e.g., hair traps or cameras primarily in quality habitat across fragmented landscapes poses a challenge to estimating density-habitat covariate relationships using spatial

Supramolecular gel electrophoresis of large DNA fragments.

Science.gov (United States)

Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi

2017-10-01

Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Fragment-based drug discovery and protein–protein interactions

Directory of Open Access Journals (Sweden)

Turnbull AP

2014-09-01

Full Text Available Andrew P Turnbull,1 Susan M Boyd,2 Björn Walse31CRT Discovery Laboratories, Department of Biological Sciences, Birkbeck, University of London, London, UK; 2IOTA Pharmaceuticals Ltd, Cambridge, UK; 3SARomics Biostructures AB, Lund, SwedenAbstract: Protein–protein interactions (PPIs are involved in many biological processes, with an estimated 400,000 PPIs within the human proteome. There is significant interest in exploiting the relatively unexplored potential of these interactions in drug discovery, driven by the need to find new therapeutic targets. Compared with classical drug discovery against targets with well-defined binding sites, developing small-molecule inhibitors against PPIs where the contact surfaces are frequently more extensive and comparatively flat, with most of the binding energy localized in “hot spots”, has proven far more challenging. However, despite the difficulties associated with targeting PPIs, important progress has been made in recent years with fragment-based drug discovery playing a pivotal role in improving their tractability. Computational and empirical approaches can be used to identify hot-spot regions and assess the druggability and ligandability of new targets, whilst fragment screening campaigns can detect low-affinity fragments that either directly or indirectly perturb the PPI. Once fragment hits have been identified and confirmed using biochemical and biophysical approaches, three-dimensional structural data derived from nuclear magnetic resonance or X-ray crystallography can be used to drive medicinal chemistry efforts towards the development of more potent inhibitors. A small-scale comparison presented in this review of “standard” fragments with those targeting PPIs has revealed that the latter tend to be larger, be more lipophilic, and contain more polar (acid/base functionality, whereas three-dimensional descriptor data indicate that there is little difference in their three

Comparing the accuracy of high-dimensional neural network potentials and the systematic molecular fragmentation method: A benchmark study for all-trans alkanes

Energy Technology Data Exchange (ETDEWEB)

Gastegger, Michael; Kauffmann, Clemens; Marquetand, Philipp, E-mail: philipp.marquetand@univie.ac.at [Institute of Theoretical Chemistry, Faculty of Chemistry, University of Vienna, Währinger Straße 17, Vienna (Austria); Behler, Jörg [Lehrstuhl für Theoretische Chemie, Ruhr-Universität Bochum, Universitätsstraße 150, Bochum (Germany)

2016-05-21

Many approaches, which have been developed to express the potential energy of large systems, exploit the locality of the atomic interactions. A prominent example is the fragmentation methods in which the quantum chemical calculations are carried out for overlapping small fragments of a given molecule that are then combined in a second step to yield the system’s total energy. Here we compare the accuracy of the systematic molecular fragmentation approach with the performance of high-dimensional neural network (HDNN) potentials introduced by Behler and Parrinello. HDNN potentials are similar in spirit to the fragmentation approach in that the total energy is constructed as a sum of environment-dependent atomic energies, which are derived indirectly from electronic structure calculations. As a benchmark set, we use all-trans alkanes containing up to eleven carbon atoms at the coupled cluster level of theory. These molecules have been chosen because they allow to extrapolate reliable reference energies for very long chains, enabling an assessment of the energies obtained by both methods for alkanes including up to 10 000 carbon atoms. We find that both methods predict high-quality energies with the HDNN potentials yielding smaller errors with respect to the coupled cluster reference.

Comparing the accuracy of high-dimensional neural network potentials and the systematic molecular fragmentation method: A benchmark study for all-trans alkanes

International Nuclear Information System (INIS)

Gastegger, Michael; Kauffmann, Clemens; Marquetand, Philipp; Behler, Jörg

2016-01-01

Many approaches, which have been developed to express the potential energy of large systems, exploit the locality of the atomic interactions. A prominent example is the fragmentation methods in which the quantum chemical calculations are carried out for overlapping small fragments of a given molecule that are then combined in a second step to yield the system’s total energy. Here we compare the accuracy of the systematic molecular fragmentation approach with the performance of high-dimensional neural network (HDNN) potentials introduced by Behler and Parrinello. HDNN potentials are similar in spirit to the fragmentation approach in that the total energy is constructed as a sum of environment-dependent atomic energies, which are derived indirectly from electronic structure calculations. As a benchmark set, we use all-trans alkanes containing up to eleven carbon atoms at the coupled cluster level of theory. These molecules have been chosen because they allow to extrapolate reliable reference energies for very long chains, enabling an assessment of the energies obtained by both methods for alkanes including up to 10 000 carbon atoms. We find that both methods predict high-quality energies with the HDNN potentials yielding smaller errors with respect to the coupled cluster reference.

The physics of compensating calorimetry and the new CALOR89 code system

International Nuclear Information System (INIS)

Gabriel, T.A.; Brau, J.E.; Bishop, B.L.

1989-03-01

Much of the understanding of the physics of calorimetry has come from the use of excellent radiation transport codes. A new understanding of compensating calorimetry was introduced four years ago following detailed studies with a new CALOR system. Now, the CALOR system has again been revised to reflect a better comprehension of high energy nuclear collisions by incorporating a modified high energy fragmentation model from FLUKA87. This revision will allow for the accurate analysis of calorimeters at energies of 100's of GeV. Presented in this paper is a discussion of compensating calorimetry, the new CALOR system, the revisions to HETC, and recently generated calorimeter related data on modes of energy deposition and secondary neutron production (E < 50 MeV) in infinite iron and uranium blocks. 38 refs., 5 figs., 5 tabs

Wind energy's subtle effect - habitat fragmentation

Energy Technology Data Exchange (ETDEWEB)

Pruett, Jay

2011-07-01

Full text: New wind energy production facilities are being built to accommodate demands for more, renewable, emission-free energy. This development is most often in windy, remote parts of the United States, so new transmission infrastructure capacity is also needed for shipment of energy from prairies, hilltops and shorelines to distant population centres. Well known environmental effects from wind energy development have included direct mortality to birds and bats. However, there is a more subtle effect also at play. 'Habitat fragmentation' is an impact caused by the siting and presence of infrastructure features on wildlife species. Instead of direct mortality, there is behavioural avoidance of such features because of activity, noise and even simply the presence of vertical structures that are different from the original nature of the habitat. This fragmentation threatens to make some of the last remaining habitat for declining species, especially grassland birds, unusable by them. Prairie grouse such as prairie chickens and sage grouse appear to be particularly susceptible to habitat fragmentation due to the presence of vertical structures. Other species such as the grasshopper sparrow have also been shown to avoid such features. It is believed that these species have evolved to avoid any vertical structure because it can serve as a perch for bird-eating raptors, including eagles, hawks, falcons and owls. Certain life cycle stages, such as nesting and chick rearing, appear to be most vulnerable to these fragmentation influences. Some of the research contributing to concern over habitat fragmentation, along with the mechanism of such fragmentation, will be presented. Solutions will also be offered for the siting of wind energy facilities and transmission lines to avoid this negative environmental impact. (Author)

Heart Rate Fragmentation: A Symbolic Dynamical Approach

Directory of Open Access Journals (Sweden)

Madalena D. Costa

2017-11-01

Full Text Available Background: We recently introduced the concept of heart rate fragmentation along with a set of metrics for its quantification. The term was coined to refer to an increase in the percentage of changes in heart rate acceleration sign, a dynamical marker of a type of anomalous variability. The effort was motivated by the observation that fragmentation, which is consistent with the breakdown of the neuroautonomic-electrophysiologic control system of the sino-atrial node, could confound traditional short-term analysis of heart rate variability.Objective: The objectives of this study were to: (1 introduce a symbolic dynamical approach to the problem of quantifying heart rate fragmentation; (2 evaluate how the distribution of the different dynamical patterns (“words” varied with the participants' age in a group of healthy subjects and patients with coronary artery disease (CAD; and (3 quantify the differences in the fragmentation patterns between the two sample populations.Methods: The symbolic dynamical method employed here was based on a ternary map of the increment NN interval time series and on the analysis of the relative frequency of symbolic sequences (words with a pre-defined set of features. We analyzed annotated, open-access Holter databases of healthy subjects and patients with CAD, provided by the University of Rochester Telemetric and Holter ECG Warehouse (THEW.Results: The degree of fragmentation was significantly higher in older individuals than in their younger counterparts. However, the fragmentation patterns were different in the two sample populations. In healthy subjects, older age was significantly associated with a higher percentage of transitions from acceleration/deceleration to zero acceleration and vice versa (termed “soft” inflection points. In patients with CAD, older age was also significantly associated with higher percentages of frank reversals in heart rate acceleration (transitions from acceleration to

Dynamics and instabilities in nuclear fragmentation

International Nuclear Information System (INIS)

Colonna, M.; Guarnera, A.; Di Toro, M.; Latora, V.; Smerzi, A.; Catania Univ.

1993-01-01

A general procedure to identify instability regions which lead to multifragmentation events is presented. The method covers all possible sources of dynamical instabilities. Informations on the instability point, like the time when the nuclear system enters the critical region, the most unstable modes and the time constant of the exponential growing of the relative variances, are deduced without any numerical bias. Important memory effects in the fragmentation pattern are revealed. Some hints towards a fully dynamical picture of fragmentation processes are finally suggested. (author) 7 refs., 3 figs

3 Steps to Great Coaching: A Simple but Powerful Instructional Coaching Cycle Nets Results

Science.gov (United States)

Knight, Jim; Elford, Marti; Hock, Michael; Dunekack, Devona; Bradley, Barbara; Deshler, Donald D.; Knight, David

2015-01-01

In this article the authors describe a three-step instructional coaching cycle that can helps coaches become more effective. The article provides the steps and related components to: (1) Identify; (2) Learn; and (3) Improve. While the instructional coaching cycle is only one effective coaching program, coaches also need professional learning that…

Research on Splicing Method of Digital Relic Fragment Model

Science.gov (United States)

Yan, X.; Hu, Y.; Hou, M.

2018-04-01

In the course of archaeological excavation, a large number of pieces of cultural relics were unearthed, and the restoration of these fragments was done manually by traditional arts and crafts experts. In this process, cultural relics experts often try to splice the existing cultural relics, and then use adhesive to stick together the fragments of correct location, which will cause irreversible secondary damage to cultural relics. In order to minimize such damage, the surveyors combine 3D laser scanning with computer technology, and use the method of establishing digital cultural relics fragments model to make virtual splicing of cultural relics. The 3D software on the common market can basically achieve the model translation and rotation, using this two functions can be achieved manually splicing between models, mosaic records after the completion of the specific location of each piece of fragments, so as to effectively reduce the damage to the relics had tried splicing process.

Development of a recombinant toxin fragment vaccine for Clostridium difficile infection.

Science.gov (United States)

Karczewski, Jerzy; Zorman, Julie; Wang, Su; Miezeiewski, Matthew; Xie, Jinfu; Soring, Keri; Petrescu, Ioan; Rogers, Irene; Thiriot, David S; Cook, James C; Chamberlin, Mihaela; Xoconostle, Rachel F; Nahas, Debbie D; Joyce, Joseph G; Bodmer, Jean-Luc; Heinrichs, Jon H; Secore, Susan

2014-05-19

Clostridium difficile infection (CDI) is the major cause of antibiotic-associated diarrhea and pseudomembranous colitis, a disease associated with significant morbidity and mortality. The disease is mostly of nosocomial origin, with elderly patients undergoing anti-microbial therapy being particularly at risk. C. difficile produces two large toxins: Toxin A (TcdA) and Toxin B (TcdB). The two toxins act synergistically to damage and impair the colonic epithelium, and are primarily responsible for the pathogenesis associated with CDI. The feasibility of toxin-based vaccination against C. difficile is being vigorously investigated. A vaccine based on formaldehyde-inactivated Toxin A and Toxin B (toxoids) was reported to be safe and immunogenic in healthy volunteers and is now undergoing evaluation in clinical efficacy trials. In order to eliminate cytotoxic effects, a chemical inactivation step must be included in the manufacturing process of this toxin-based vaccine. In addition, the large-scale production of highly toxic antigens could be a challenging and costly process. Vaccines based on non-toxic fragments of genetically engineered versions of the toxins alleviate most of these limitations. We have evaluated a vaccine assembled from two recombinant fragments of TcdB and explored their potential as components of a novel experimental vaccine against CDI. Golden Syrian hamsters vaccinated with recombinant fragments of TcdB combined with full length TcdA (Toxoid A) developed high titer IgG responses and potent neutralizing antibody titers. We also show here that the recombinant vaccine protected animals against lethal challenge with C. difficile spores, with efficacy equivalent to the toxoid vaccine. The development of a two-segment recombinant vaccine could provide several advantages over toxoid TcdA/TcdB such as improvements in manufacturability. Copyright © 2014 Elsevier Ltd. All rights reserved.

Study of multifragmentation: contribution of reduced velocity correlations between particles and fragments; Etude de la multifragmentation: apport des correlations en vitesse reduite entre particules et fragments

Energy Technology Data Exchange (ETDEWEB)

Le Fevre, A. [Paris-7 Univ., 75 (France)

1997-05-14

This work is focused on the study of fragment and light particle production mechanisms in the multifragmentation process of hot nuclei, which are formed in the central collisions of Xe+Sn at 50 MeV/u. The experiment has been performed with the INDRA multidetector. The central collision events, selected via the flow angle variable, exhibit the presence of a heavy (Z=90) and highly excited (E{sup *}=12.5 MeV/u) isotropic emission source. The comparison of the data with a statistical multifragmentation model (MMMC) and a dynamical model (BNV) makes us conclude that the multifragmentation can only be explained in the frame of a relatively cold process, around 6 MeV/u of thermal excitation energy, preceded by a primary emission stage of the expanding source, during which nearly one third of the excitation energy is dissipated. In addition, it appears that the fragment energy spectra are not explained by a purely thermal process, and that one has to put forward an expansion collective motion, of 2 MeV/u of energy, following the compression of the compound system. In order to precise the existence of a two-step particle emission (primary and secondary), we have developed and applied an original method of reduced velocity correlations between particles and fragments. It has allowed us to underline two distinct origins for the particle production: one corresponding to secondary emissions, coming from the fragments, and the other one, associated with emissions which occur prior to the fragment production. At last, it has allowed us, also to bring out a hierarchy in the emission time in the decay process, with respect to the particle type. (author) 90 refs.

AutoDrug: fully automated macromolecular crystallography workflows for fragment-based drug discovery

International Nuclear Information System (INIS)

Tsai, Yingssu; McPhillips, Scott E.; González, Ana; McPhillips, Timothy M.; Zinn, Daniel; Cohen, Aina E.; Feese, Michael D.; Bushnell, David; Tiefenbrunn, Theresa; Stout, C. David; Ludaescher, Bertram; Hedman, Britt; Hodgson, Keith O.; Soltis, S. Michael

2013-01-01

New software has been developed for automating the experimental and data-processing stages of fragment-based drug discovery at a macromolecular crystallography beamline. A new workflow-automation framework orchestrates beamline-control and data-analysis software while organizing results from multiple samples. AutoDrug is software based upon the scientific workflow paradigm that integrates the Stanford Synchrotron Radiation Lightsource macromolecular crystallography beamlines and third-party processing software to automate the crystallography steps of the fragment-based drug-discovery process. AutoDrug screens a cassette of fragment-soaked crystals, selects crystals for data collection based on screening results and user-specified criteria and determines optimal data-collection strategies. It then collects and processes diffraction data, performs molecular replacement using provided models and detects electron density that is likely to arise from bound fragments. All processes are fully automated, i.e. are performed without user interaction or supervision. Samples can be screened in groups corresponding to particular proteins, crystal forms and/or soaking conditions. A single AutoDrug run is only limited by the capacity of the sample-storage dewar at the beamline: currently 288 samples. AutoDrug was developed in conjunction with RestFlow, a new scientific workflow-automation framework. RestFlow simplifies the design of AutoDrug by managing the flow of data and the organization of results and by orchestrating the execution of computational pipeline steps. It also simplifies the execution and interaction of third-party programs and the beamline-control system. Modeling AutoDrug as a scientific workflow enables multiple variants that meet the requirements of different user groups to be developed and supported. A workflow tailored to mimic the crystallography stages comprising the drug-discovery pipeline of CoCrystal Discovery Inc. has been deployed and successfully

Fragment-based screening by protein crystallography: successes and pitfalls.

Science.gov (United States)

Chilingaryan, Zorik; Yin, Zhou; Oakley, Aaron J

2012-10-08

Fragment-based drug discovery (FBDD) concerns the screening of low-molecular weight compounds against macromolecular targets of clinical relevance. These compounds act as starting points for the development of drugs. FBDD has evolved and grown in popularity over the past 15 years. In this paper, the rationale and technology behind the use of X-ray crystallography in fragment based screening (FBS) will be described, including fragment library design and use of synchrotron radiation and robotics for high-throughput X-ray data collection. Some recent uses of crystallography in FBS will be described in detail, including interrogation of the drug targets β-secretase, phenylethanolamine N-methyltransferase, phosphodiesterase 4A and Hsp90. These examples provide illustrations of projects where crystallography is straightforward or difficult, and where other screening methods can help overcome the limitations of crystallography necessitated by diffraction quality.

Fragment-Based Screening by Protein Crystallography: Successes and Pitfalls

Directory of Open Access Journals (Sweden)

Aaron J. Oakley

2012-10-01

Full Text Available Fragment-based drug discovery (FBDD concerns the screening of low-molecular weight compounds against macromolecular targets of clinical relevance. These compounds act as starting points for the development of drugs. FBDD has evolved and grown in popularity over the past 15 years. In this paper, the rationale and technology behind the use of X-ray crystallography in fragment based screening (FBS will be described, including fragment library design and use of synchrotron radiation and robotics for high-throughput X-ray data collection. Some recent uses of crystallography in FBS will be described in detail, including interrogation of the drug targets β-secretase, phenylethanolamine N-methyltransferase, phosphodiesterase 4A and Hsp90. These examples provide illustrations of projects where crystallography is straightforward or difficult, and where other screening methods can help overcome the limitations of crystallography necessitated by diffraction quality.

incaRNAfbinv: a web server for the fragment-based design of RNA sequences

Science.gov (United States)

Drory Retwitzer, Matan; Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme; Barash, Danny

2016-01-01

Abstract In recent years, new methods for computational RNA design have been developed and applied to various problems in synthetic biology and nanotechnology. Lately, there is considerable interest in incorporating essential biological information when solving the inverse RNA folding problem. Correspondingly, RNAfbinv aims at including biologically meaningful constraints and is the only program to-date that performs a fragment-based design of RNA sequences. In doing so it allows the design of sequences that do not necessarily exactly fold into the target, as long as the overall coarse-grained tree graph shape is preserved. Augmented by the weighted sampling algorithm of incaRNAtion, our web server called incaRNAfbinv implements the method devised in RNAfbinv and offers an interactive environment for the inverse folding of RNA using a fragment-based design approach. It takes as input: a target RNA secondary structure; optional sequence and motif constraints; optional target minimum free energy, neutrality and GC content. In addition to the design of synthetic regulatory sequences, it can be used as a pre-processing step for the detection of novel natural occurring RNAs. The two complementary methodologies RNAfbinv and incaRNAtion are merged together and fully implemented in our web server incaRNAfbinv, available at http://www.cs.bgu.ac.il/incaRNAfbinv. PMID:27185893

Intravitreal Phacoemulsification Using Torsional Handpiece for Retained Lens Fragments

OpenAIRE

Kumar, Vinod; Takkar, Brijesh

2016-01-01

Purpose: To evaluate the results of intravitreal phacoemulsification with torsional hand piece in eyes with posteriorly dislocated lens fragments. Methods: In this prospective, interventional case series, 15 eyes with retained lens fragments following phacoemulsification were included. All patients underwent standard three-port pars plana vitrectomy and intravitreal phacoemulsification using sleeveless, torsional hand piece (OZiL™, Alcon's Infiniti Vision System). Patients were followed up...

Fragment-based drug design.

Science.gov (United States)

Feyfant, Eric; Cross, Jason B; Paris, Kevin; Tsao, Désirée H H

2011-01-01

Fragment-based drug design (FBDD), which is comprised of both fragment screening and the use of fragment hits to design leads, began more than 15 years ago and has been steadily gaining in popularity and utility. Its origin lies on the fact that the coverage of chemical space and the binding efficiency of hits are directly related to the size of the compounds screened. Nevertheless, FBDD still faces challenges, among them developing fragment screening libraries that ensure optimal coverage of chemical space, physical properties and chemical tractability. Fragment screening also requires sensitive assays, often biophysical in nature, to detect weak binders. In this chapter we will introduce the technologies used to address these challenges and outline the experimental advantages that make FBDD one of the most popular new hit-to-lead process.

Calculating kaon fragmentation functions from the Nambu-Jona-Lasinio jet model

International Nuclear Information System (INIS)

Matevosyan, Hrayr H.; Thomas, Anthony W.; Bentz, Wolfgang

2011-01-01

The Nambu-Jona-Lasinio (NJL)-jet model provides a sound framework for calculating the fragmentation functions in an effective chiral quark theory, where the momentum and isospin sum rules are satisfied without the introduction of ad hoc parameters. Earlier studies of the pion fragmentation functions using the NJL model within this framework showed qualitative agreement with the empirical parametrizations. Here we extend the NJL-jet model by including the strange quark. The corrections to the pion fragmentation functions and corresponding kaon fragmentation functions are calculated using the elementary quark to quark-meson fragmentation functions from NJL. The results for the kaon fragmentation functions exhibit a qualitative agreement with the empirical parametrizations, while the unfavored strange quark fragmentation to pions is shown to be of the same order of magnitude as the unfavored light quark. The results of these studies are expected to provide important guidance for the analysis of a large variety of semi-inclusive data.

On the nuclear fragmentation mechanisms in nuclear collisions at intermediate and high energies

International Nuclear Information System (INIS)

Jipa, Al.; Besliu, C.; Felea, D.; Iliescu, B.; Ristea, O.; Ristea, M.; Calin, C.; Horbuniev, A.; Arsene, I.; Esanu, T.; Ochesanu, S.; Caramarcu, C.; Bordeianu, C.; Rosu, I.; Grossu, V.; Zgura, I.S.; Stan, E.; Mitu, C.; Potlog, M.; Cherciu, M.; Stefan, I.

2004-01-01

The nuclear fragmentation mechanisms can be discussed taking into account different scales. These scales are related to the fragment sizes. Taking into account the possible different fragmentation mechanisms of the nuclei at the same incident energy an analysis of the experimental results obtained in different experiments performed at the JINR Dubna (Russia), KEK Tsukuba (Japan), GSI Darmstadt (Germany) is done. Results on apparent temperatures, angular distributions, fragment momentum spectra, multiplicities of the intermediate mass fragments are used to analyse the competition between two possible nuclear fragmentation mechanisms, namely: a sudden fragmentation by explosive mechanisms, like shock waves, and a slow fragmentation by the 'fission' of the spectator regions, mainly, because of the interactions with the particles or fragments emitted from the participant region at transverse angles on the incident nucleus, in CMS.Some connections with chaos dynamics and fractal structure of the fragmentation patterns are included. (authors)

Process of Fragment-Based Lead Discovery—A Perspective from NMR

Directory of Open Access Journals (Sweden)

Rongsheng Ma

2016-07-01

Full Text Available Fragment-based lead discovery (FBLD has proven fruitful during the past two decades for a variety of targets, even challenging protein–protein interaction (PPI systems. Nuclear magnetic resonance (NMR spectroscopy plays a vital role, from initial fragment-based screening to lead generation, because of its power to probe the intrinsically weak interactions between targets and low-molecular-weight fragments. Here, we review the NMR FBLD process from initial library construction to lead generation. We describe technical aspects regarding fragment library design, ligand- and protein-observed screening, and protein–ligand structure model generation. For weak binders, the initial hit-to-lead evolution can be guided by structural information retrieved from NMR spectroscopy, including chemical shift perturbation, transferred pseudocontact shifts, and paramagnetic relaxation enhancement. This perspective examines structure-guided optimization from weak fragment screening hits to potent leads for challenging PPI targets.

Fragmentation and reactivity of energy-selected ferrocenium ions

International Nuclear Information System (INIS)

Mestdagh, H.; Dutuit, O.; Heninger, M.; Thissen, R.; Alcaraz, C.

2002-01-01

In this study, results concerning the discussion of state-selected ferrocenium ions (c-C 5 H 5 ) 2 Fe + commonly called Cp 2 Fe + , as well as their reactions with methanol and ethanol are presented. Parent ions Cp 2 Fe + were produced by vacuumultraviolett (VUV) photoionization of neutral ferrocene using synchrotron radiation, and selected in internal energy by threshold photoelectron-photoion coincidences. The apparatus is divided into three differentially pumped regions: the source, the reaction and the detection zones. In source, state-selected parent ions are formed and can be selected in mass by a first quadrupole filter. State-selected ions are then injected in the second zone which is a RF octopole ion guide where reaction product ions are mass analyzed by a second quadrupole filter and detected by microchannelplates. In addition, the long flight time in the octopoles (several hundreds of microseconds) allows studying long-lived metastable ions. Total mass spectra were recorded at different photon energies, in addition to the main CpFe + and Fe + fragments, several minor fragments were detected such as C 10 H 10 + which reflects the formation of a C-C bond between the two Cp ligands. Losses of CH 3 , C 2 H 2 and C-4H 4 also indicate that important structure rearrangements take place before cleavage. The appearance energies of each mass-selected fragment ion were measured by recording fragment ion yields as a function of photon energy. Surprisingly, all fragments were found to have the same energy onset, i.e. 13.2 eV photon energy, except for C 3 H 3 Fe + (m/z 95). For Fe + ions, a sharp increase was observed at 17 eV, above the thermochemical onset of Fe + + 2 Cp. The 13.2 eV appearance energy of Fe + is thus assigned to the formation of Fe - + C 10 H 10 . The reactivity of ferrocenium ion with methanol and ethanol was investigated as a function of photon energy. While no reaction occurs at lower photon energies, several reaction products appear at 13.0 e

Oncogenic transformation of rat lung epithelioid cells by SV40 DNA and restriction enzyme fragments

International Nuclear Information System (INIS)

Daya-Grosjean, L.; Lasne, C.; Nardeux, P.; Chouroulinkov, I.; Monier, R.

1979-01-01

Rat epithelioid lung cells were transformed with various preparations of SV40 DNA using the Ca 2+ -precipitation technique. The amount of SV40 genetic information integrated into transformed clones was evaluated by DNA-DNA renaturation kinetics. The growth properties on plastic and in soft-agar were examined, as well as the ability to induce tumors in syngeneic newborn animals or in adult nude mice. One particular transformed line, which had received the HpaII/BamHIA (59 per cent) fragment, was found to contain about 3 integrated copies of this fragment per cell and no significant amount of the HpaII/BamHIB (41 per cent fragment). This line which grew to high saturatio densities and efficiently formed clones in low serum on plastic, produced tumors in both syngeneic rats and nude mice. Thus the HpaII/BamHIA fragment, which mainly includes early viral information, was sufficient to impart these properties to rat epithelioid lung cells. (author)

Studies of complex fragment emission in heavy ion reactions

International Nuclear Information System (INIS)

Sobotka, L.G.

1989-01-01

The production of large fragments, fragments with mass between light particles and fission fragments, in intermediate and high energy nuclear reactions has fostered the proposal of a number of novel reaction mechanisms. These include liquid-vapor equilibrium and nuclear shattering. Temporarily left in the wake of these exciting proposed mechanisms was the old standard, statistical decay of compound nuclei. To be sure, the standard treatment of compound nucleus decay did not deal with large fragment production. However, this omission was not due to any fundamental deficiency of statistical models, but rather an uncertainty concerning exactly how to splice large fragment emission into statistical models. A large portion of our program deals with this problem. Specifically, by studying the yields of large fragments produced in sufficiently low energy reactions we are attempting to deduce the asymmetry and l-wave dependence of large fragment emission from compound nuclear intermediates. This, however, is only half of the problem. Since the novel mechanisms proposed for large fragment emission were spawned by intermediate and high energy reaction data, we must also realize the relevance of the compound nucleus mechanisms at high energies. It is not unreasonable to suspect that compound nucleus-like objects are formed with less than complete momentum transfer and perhaps less than complete mass transfer. Therefore the study of energy, mass, and angular momentum transfer in incomplete fusion and non-compound reactions. This thread joins the apparently divergent subjects covered in this report

Assessment of fragment projection hazard: probability distributions for the initial direction of fragments.

Science.gov (United States)

Tugnoli, Alessandro; Gubinelli, Gianfilippo; Landucci, Gabriele; Cozzani, Valerio

2014-08-30

The evaluation of the initial direction and velocity of the fragments generated in the fragmentation of a vessel due to internal pressure is an important information in the assessment of damage caused by fragments, in particular within the quantitative risk assessment (QRA) of chemical and process plants. In the present study an approach is proposed to the identification and validation of probability density functions (pdfs) for the initial direction of the fragments. A detailed review of a large number of past accidents provided the background information for the validation procedure. A specific method was developed for the validation of the proposed pdfs. Validated pdfs were obtained for both the vertical and horizontal angles of projection and for the initial velocity of the fragments. Copyright © 2014 Elsevier B.V. All rights reserved.

Insulin-like growth factor-1 (IGF-1) promotes primordial follicle growth and reduces DNA fragmentation through the phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) signalling pathway.

Science.gov (United States)

Bezerra, Maria É S; Barberino, Ricássio S; Menezes, Vanúzia G; Gouveia, Bruna B; Macedo, Taís J S; Santos, Jamile M S; Monte, Alane P O; Barros, Vanessa R P; Matos, Maria H T

2018-05-30

We investigated the effects of insulin-like growth factor 1 (IGF-1) on the morphology and follicular activation of ovine preantral follicles cultured in situ and whether the phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) pathway is involved in IGF-1 action in the sheep ovary. Ovine ovarian fragments were fixed for histological and terminal deoxynucleotidyl transferase dUTP nick-end labelling (TUNEL) analyses (fresh control) or cultured in supplemented alpha-minimum essential medium (α-MEM+; control) or α-MEM+ with IGF-1 (1, 10, 50, 100 or 200ngmL-1) for 7 days. Follicles were classified as normal or atretic, primordial or growing and the oocyte and follicle diameters were measured. DNA fragmentation was evaluated by TUNEL assay. Proliferating cell nuclear antigen (PCNA) immunohistochemistry was performed on the fresh control, α-MEM+ and 100ngmL-1 IGF-1 samples. Inhibition of PI3K activity was performed through pretreatment with the PI3K inhibitor LY294002 and phosphorylated AKT (pAKT) expression was analysed after culture in the absence or presence of LY294002. IGF-1 at 100ngmL-1 increased (PIGF-1. LY294002 significantly inhibited follicular activation stimulated by α-MEM+ and 100ngmL-1 IGF-1 and reduced pAKT expression in follicles. Overall, IGF-1 at 100ngmL-1 promoted primordial follicle activation, cell proliferation and reduced DNA fragmentation after in situ culture through the PI3K/AKT pathway.

Knowledge-based Fragment Binding Prediction

Science.gov (United States)

Tang, Grace W.; Altman, Russ B.

2014-01-01

Target-based drug discovery must assess many drug-like compounds for potential activity. Focusing on low-molecular-weight compounds (fragments) can dramatically reduce the chemical search space. However, approaches for determining protein-fragment interactions have limitations. Experimental assays are time-consuming, expensive, and not always applicable. At the same time, computational approaches using physics-based methods have limited accuracy. With increasing high-resolution structural data for protein-ligand complexes, there is now an opportunity for data-driven approaches to fragment binding prediction. We present FragFEATURE, a machine learning approach to predict small molecule fragments preferred by a target protein structure. We first create a knowledge base of protein structural environments annotated with the small molecule substructures they bind. These substructures have low-molecular weight and serve as a proxy for fragments. FragFEATURE then compares the structural environments within a target protein to those in the knowledge base to retrieve statistically preferred fragments. It merges information across diverse ligands with shared substructures to generate predictions. Our results demonstrate FragFEATURE's ability to rediscover fragments corresponding to the ligand bound with 74% precision and 82% recall on average. For many protein targets, it identifies high scoring fragments that are substructures of known inhibitors. FragFEATURE thus predicts fragments that can serve as inputs to fragment-based drug design or serve as refinement criteria for creating target-specific compound libraries for experimental or computational screening. PMID:24762971

Gold-Catalyzed Enantio- and Diastereoselective Syntheses of Left Fragments of Azadirachtin/Meliacarpin-Type Limonoids.

Science.gov (United States)

Shi, Hang; Tan, Ceheng; Zhang, Weibin; Zhang, Zichun; Long, Rong; Gong, Jianxian; Luo, Tuoping; Yang, Zhen

2016-02-05

Meliacarpin-type limonoids are an important class of organic insecticides. Their syntheses are challenging due to their chemical complexity. Here, we report the highly enantio- and diastereoselective synthesis of the left fragments of azadirachtin I and 1-cinnamoylmelianolone, being two important family members of meliacarpin-type limonoids, via pairwise palladium- and gold-catalyzed cascade reactions. Gold-catalyzed reactions of 1,7-diynes were performed as model studies, and the efficient construction of tetracyclic late-stage intermediates was achieved on the basis of this key transformation. Our unique route gave both of the left fragments in 23 steps from the commercially available chiral starting material (-)-carvone. This study significantly advances research on the synthesis of the meliacarpin-type limonoids.

Synthesis and immunological evaluation of protein conjugates of Neisseria meningitidis X capsular polysaccharide fragments

Directory of Open Access Journals (Sweden)

Laura Morelli

2014-10-01

Full Text Available A vaccine to prevent infections from the emerging Neisseria meningitidis X (MenX is becoming an urgent issue. Recently MenX capsular polysaccharide (CPS fragments conjugated to CRM197 as carrier protein have been confirmed at preclinical stage as promising candidates for vaccine development. However, more insights about the minimal epitope required for the immunological activity of MenX CPS are needed. We report herein the chemical conjugation of fully synthetic MenX CPS oligomers (monomer, dimer, and trimer to CRM197. Moreover, improvements in some crucial steps leading to the synthesis of MenX CPS fragments are described. Following immunization with the obtained neoglycoconjugates, the conjugated trimer was demonstrated as the minimal fragment possessing immunogenic activity, even though significantly lower than a pentadecamer obtained from the native polymer and conjugated to the same protein. This finding suggests that oligomers longer than three repeating units are possibly needed to mimic the activity of the native polysaccharide.

Causes of fragmented crystals in ignimbrites: a case study of the Cardones ignimbrite, Northern Chile

Science.gov (United States)

van Zalinge, M. E.; Cashman, K. V.; Sparks, R. S. J.

2018-03-01

Broken crystals have been documented in many large-volume caldera-forming ignimbrites and can help to understand the role of crystal fragmentation in both eruption and compaction processes, the latter generally overlooked in the literature. This study investigates the origin of fragmented crystals in the > 1260 km3, crystal-rich Cardones ignimbrites located in the Central Andes. Observations of fragmented crystals in non-welded pumice clasts indicate that primary fragmentation includes extensive crystal breakage and an associated ca. 5 vol% expansion of individual crystals while preserving their original shapes. These observations are consistent with the hypothesis that crystals fragment in a brittle response to rapid decompression associated with the eruption. Additionally, we observe that the extent of crystal fragmentation increases with increasing stratigraphic depth in the ignimbrite, recording secondary crystal fragmentation during welding and compaction. Secondary crystal fragmentation aids welding and compaction in two ways. First, enhanced crystal fragmentation at crystal-crystal contacts accommodates compaction along the principal axis of stress. Second, rotation and displacement of individual crystal fragments enhances lateral flow in the direction(s) of least principal stress. This process increases crystal aspect ratios and forms textures that resemble mantled porphyroclasts in shear zones, indicating lateral flow adds to processes of compaction and welding alongside bubble collapse. In the Cardones ignimbrite, secondary fragmentation commences at depths of 175-250 m (lithostatic pressures 4-6 MPa), and is modulated by both the overlying crystal load and the time spent above the glass transition temperature. Under these conditions, the existence of force-chains can produce stresses at crystal-crystal contacts of a few times the lithostatic pressure. We suggest that documenting crystal textures, in addition to conventional welding parameters, can

Fragmentation in the branching coral Acropora palmata (Lamarck): growth, survivorship, and reproduction of colonies and fragments.

Science.gov (United States)

Lirman

2000-08-23

Acropora palmata, a branching coral abundant on shallow reef environments throughout the Caribbean, is susceptible to physical disturbance caused by storms. Accordingly, the survivorship and propagation of this species are tied to its capability to recover after fragmentation. Fragments of A. palmata comprised 40% of ramets within populations that had experienced recent storms. While the survivorship of A. palmata fragments was not directly related to the size of fragments, removal of fragments from areas where they settled was influenced by size. Survivorship of fragments was also affected by type of substratum; the greatest mortality (58% loss within the first month) was observed on sand, whereas fragments placed on top of live colonies of A. palmata fused to the underlying tissue and did not experience any losses. Fragments created by Hurricane Andrew on a Florida reef in August 1992 began developing new growth (proto-branches) 7 months after the storm. The number of proto-branches on fragments was dependent on size, but growth was not affected by the size of fragments. Growth-rates of proto-branches increased exponentially with time (1.7 cm year(-1) for 1993-1994, 2.7 cm year(-1) for 1994-1995, 4.2 cm year(-1) for 1995-1996, and 6.5 cm year(-1) for 1996-1997), taking over 4 years for proto-branches to achieve rates comparable to those of adult colonies on the same reef (6.9 cm year(-1)). In addition to the initial mortality and reduced growth-rates, fragmentation resulted in a loss of reproductive potential. Neither colonies that experienced severe fragmentation nor fragments contained gametes until 4 years after the initial damage. Although A. palmata may survive periodic fragmentation, the long-term effects of this process will depend ultimately on the balance between the benefits and costs of this process.

Deformation dependent TUL multi-step direct model

International Nuclear Information System (INIS)

Wienke, H.; Capote, R.; Herman, M.; Sin, M.

2008-01-01

The Multi-Step Direct (MSD) module TRISTAN in the nuclear reaction code EMPIRE has been extended to account for nuclear deformation. The new formalism was tested in calculations of neutron emission spectra emitted from the 232 Th(n,xn) reaction. These calculations include vibration-rotational Coupled Channels (CC) for the inelastic scattering to low-lying collective levels, 'deformed' MSD with quadrupole deformation for inelastic scattering to the continuum, Multi-Step Compound (MSC) and Hauser-Feshbach with advanced treatment of the fission channel. Prompt fission neutrons were also calculated. The comparison with experimental data shows clear improvement over the 'spherical' MSD calculations and JEFF-3.1 and JENDL-3.3 evaluations. (authors)

Multiple-electron removal and molecular fragmentation of CO by fast F4+ impact

International Nuclear Information System (INIS)

Ben-Itzhak, I.; Ginther, S.G.; Carnes, K.D.

1993-01-01

Multiple-electron removal from and molecular fragmentation of carbon monoxide molecules caused by collisions with 1-MeV/amu F 4+ ions were studied using the coincidence time-of-flight technique. In these collisions, multiple-electron removal of the target molecule is a dominant process. Cross sections for the different levels of ionization of the CO molecule during the collision were determined. The relative cross sections of ionization decrease with increasing number of electrons removed in a similar way as seen in atomic targets. This behavior is in agreement with a two-step mechanism, where first the molecule is ionized by a Franck-Condon ionization and then the molecular ion dissociates. Most of the highly charged intermediate states of the molecule dissociate rapidly. Only CO + and CO 2+ molecular ions have been seen to survive long enough to be detected as molecular ions. The relative cross sections for the different breakup channels were evaluated for collisions in which the molecule broke into two charged fragments as well as for collisions where only a single charged molecular ion or fragment were produced. The average charge state of each fragment resulting from CO Q+ →C i+ +O j+ breakup increases with the number of electrons removed from the molecule approximately following the relationship bar i=bar j=Q/2 as long as K-shell electrons are not removed. This does not mean that the charge-state distribution is exactly symmetric, as, in general, removing electrons from the carbon fragment is slightly more likely than removing electrons from the oxygen due to the difference in binding energy. The cross sections for molecular breakup into a charged fragment and a neutral fragment drop rapidly with an increasing number of electrons removed

Microbial platform technology for recombinant antibody fragment production: A review.

Science.gov (United States)

Gupta, Sanjeev Kumar; Shukla, Pratyoosh

2017-02-01

Recombinant antibody fragments are being used for the last few years as an important therapeutic protein to cure various critical and life threatening human diseases. Several expression platforms now days employed for the production of these recombinant fragments, out of which bacterial system has emerged a promising host for higher expression. Since, a small antibody fragment unlike full antibody does not require human-like post-translational modification therefore it is potentially expressed in prokaryotic production system. Recently, small antibody fragments such as scFvs (single-chain variable fragments) and Fabs (antibody fragments) which does not require glycosylation are successfully produced in bacteria and have commercially launched for therapeutic use as these fragments shows better tissue penetration and less immunogenic to human body compared to full-size antibody. Recently developed Wacker's ESETEC secretion technology is an efficient technology for the expression and secretion of the antibody fragment (Fab) exceeded up to 4.0 g/L while scFv up to 3.5 g/L into the fermentation broth. The Pfenex system and pOP prokaryotic expression vector are another platform used for the considerably good amount of antibody fragment production successfully. In this review, we summarize the recent progress on various expression platforms and cloning approaches for the production of different forms of antibody fragments in E. coli.

How protein recognizes ladder-like polycyclic ethers. Interactions between ciguatoxin (CTX3C) fragments and its specific antibody 10C9.

Science.gov (United States)

Ui, Mihoko; Tanaka, Yoshikazu; Tsumuraya, Takeshi; Fujii, Ikuo; Inoue, Masayuki; Hirama, Masahiro; Tsumoto, Kouhei

2008-07-11

Ciguatoxins are a family of marine toxins composed of transfused polycyclic ethers. It has not yet been clarified at the atomic level on the pathogenic mechanism of these toxins or the interaction between a polycyclic ether compounds and a protein. Using the crystal structures of anti-ciguatoxin antibody 10C9 Fab in ligand-free form and in complexes with ABCD-ring (CTX3C-ABCD) and ABCDE-ring (CTX3C-ABCDE) fragments of the antigen CTX3C at resolutions of 2.6, 2.4, and 2.3 angstroms, respectively, we elucidated the mechanism of the interaction between the polycyclic ethers and the antibody. 10C9 Fab has an extraordinarily large and deep binding pocket at the center of the variable region, where CTX3C-ABCD or CTX3C-ABCDE binds longitudinally in the pocket via hydrogen bonds and van der Waals interactions. Upon antigen-antibody complexation, 10C9 Fab adjusts to the antigen fragments by means of rotational motion in the variable region. In addition, the antigen fragment lacking the E-ring induces a large motion in the constant region. Consequently, the thermostability of 10C9 Fab is enhanced by 10 degrees C upon complexation with CTX3C-ABCDE but not with CTX3C-ABCD. The crystal structures presented in this study also show that 10C9 Fab recoginition of CTX3C antigens requires molecular rearrangements over the entire antibody structure. These results further expand the fundamental understanding of the mechanism by which ladder-like polycyclic ethers are recognized and may be useful for the design of novel therapeutic agents by antibodies, marine toxins, or new diagnostic reagents for the detection and targeting of members of the polycyclic ether family.

Extension of moment projection method to the fragmentation process

International Nuclear Information System (INIS)

Wu, Shaohua; Yapp, Edward K.Y.; Akroyd, Jethro; Mosbach, Sebastian; Xu, Rong; Yang, Wenming; Kraft, Markus

2017-01-01

The method of moments is a simple but efficient method of solving the population balance equation which describes particle dynamics. Recently, the moment projection method (MPM) was proposed and validated for particle inception, coagulation, growth and, more importantly, shrinkage; here the method is extended to include the fragmentation process. The performance of MPM is tested for 13 different test cases for different fragmentation kernels, fragment distribution functions and initial conditions. Comparisons are made with the quadrature method of moments (QMOM), hybrid method of moments (HMOM) and a high-precision stochastic solution calculated using the established direct simulation algorithm (DSA) and advantages of MPM are drawn.

Extension of moment projection method to the fragmentation process

Energy Technology Data Exchange (ETDEWEB)

Wu, Shaohua [Department of Mechanical Engineering, National University of Singapore, Engineering Block EA, Engineering Drive 1, 117576 (Singapore); Yapp, Edward K.Y.; Akroyd, Jethro; Mosbach, Sebastian [Department of Chemical Engineering and Biotechnology, University of Cambridge, New Museums Site, Pembroke Street, Cambridge, CB2 3RA (United Kingdom); Xu, Rong [School of Chemical and Biomedical Engineering, Nanyang Technological University, 62 Nanyang Drive, 637459 (Singapore); Yang, Wenming [Department of Mechanical Engineering, National University of Singapore, Engineering Block EA, Engineering Drive 1, 117576 (Singapore); Kraft, Markus, E-mail: mk306@cam.ac.uk [Department of Chemical Engineering and Biotechnology, University of Cambridge, New Museums Site, Pembroke Street, Cambridge, CB2 3RA (United Kingdom); School of Chemical and Biomedical Engineering, Nanyang Technological University, 62 Nanyang Drive, 637459 (Singapore)

2017-04-15

The method of moments is a simple but efficient method of solving the population balance equation which describes particle dynamics. Recently, the moment projection method (MPM) was proposed and validated for particle inception, coagulation, growth and, more importantly, shrinkage; here the method is extended to include the fragmentation process. The performance of MPM is tested for 13 different test cases for different fragmentation kernels, fragment distribution functions and initial conditions. Comparisons are made with the quadrature method of moments (QMOM), hybrid method of moments (HMOM) and a high-precision stochastic solution calculated using the established direct simulation algorithm (DSA) and advantages of MPM are drawn.

Label free fragment screening using surface plasmon resonance as a tool for fragment finding - analyzing parkin, a difficult CNS target.

Directory of Open Access Journals (Sweden)

Karin Regnström

Full Text Available Surface Plasmon Resonance (SPR is rarely used as a primary High-throughput Screening (HTS tool in fragment-based approaches. With SPR instruments becoming increasingly high-throughput it is now possible to use SPR as a primary tool for fragment finding. SPR becomes, therefore, a valuable tool in the screening of difficult targets such as the ubiquitin E3 ligase Parkin. As a prerequisite for the screen, a large number of SPR tests were performed to characterize and validate the active form of Parkin. A set of compounds was designed and used to define optimal SPR assay conditions for this fragment screen. Using these conditions, more than 5000 pre-selected fragments from our in-house library were screened for binding to Parkin. Additionally, all fragments were simultaneously screened for binding to two off target proteins to exclude promiscuous binding compounds. A low hit rate was observed that is in line with hit rates usually obtained by other HTS screening assays. All hits were further tested in dose responses on the target protein by SPR for confirmation before channeling the hits into Nuclear Magnetic Resonance (NMR and other hit-confirmation assays.

Cascade Controller Including Back-stepping for Hydraulic-Mechanical Systems

DEFF Research Database (Denmark)

Choux, Martin; Hovland, Geir; Blanke, Mogens

2012-01-01

Development of a cascade controller structure including adaptive backstepping for a nonlinear hydraulic-mechanical system is considered in this paper where a dynamic friction (LuGre) model is included to obtain the necessary accuracy. The paper compares the performance of two variants of an adapt......Development of a cascade controller structure including adaptive backstepping for a nonlinear hydraulic-mechanical system is considered in this paper where a dynamic friction (LuGre) model is included to obtain the necessary accuracy. The paper compares the performance of two variants...... of an adaptive backstepping tracking controller with earlier results. The new control architecture is analysed and enhanced tracking performance is demonstrated when including the extended friction model. The complexity of the backstepping procedure is significantly reduced due to the cascade structure. Hence...

Leading Change Step-by-Step: Tactics, Tools, and Tales

Science.gov (United States)

Spiro, Jody

2010-01-01

"Leading Change Step-by-Step" offers a comprehensive and tactical guide for change leaders. Spiro's approach has been field-tested for more than a decade and proven effective in a wide variety of public sector organizations including K-12 schools, universities, international agencies and non-profits. The book is filled with proven tactics for…

Validity of the Stages of Change in Steps instrument (SoC-Step) for achieving the physical activity goal of 10,000 steps per day.

Science.gov (United States)

Rosenkranz, Richard R; Duncan, Mitch J; Caperchione, Cristina M; Kolt, Gregory S; Vandelanotte, Corneel; Maeder, Anthony J; Savage, Trevor N; Mummery, W Kerry

2015-11-30

Physical activity (PA) offers numerous benefits to health and well-being, but most adults are not sufficiently physically active to afford such benefits. The 10,000 steps campaign has been a popular and effective approach to promote PA. The Transtheoretical Model posits that individuals have varying levels of readiness for health behavior change, known as Stages of Change (Precontemplation, Contemplation, Preparation, Action, and Maintenance). Few validated assessment instruments are available for determining Stages of Change in relation to the PA goal of 10,000 steps per day. The purpose of this study was to assess the criterion-related validity of the SoC-Step, a brief 10,000 steps per day Stages of Change instrument. Participants were 504 Australian adults (176 males, 328 females, mean age = 50.8 ± 13.0 years) from the baseline sample of the Walk 2.0 randomized controlled trial. Measures included 7-day accelerometry (Actigraph GT3X), height, weight, and self-reported intention, self-efficacy, and SoC-Step: Stages of Change relative to achieving 10,000 steps per day. Kruskal-Wallis H tests with pairwise comparisons were used to determine whether participants differed by stage, according to steps per day, general health, body mass index, intention, and self-efficacy to achieve 10,000 steps per day. Binary logistic regression was used to test the hypothesis that participants in Maintenance or Action stages would have greater likelihood of meeting the 10,000 steps goal, in comparison to participants in the other three stages. Consistent with study hypotheses, participants in Precontemplation had significantly lower intention scores than those in Contemplation (p = 0.003) or Preparation (p per day (OR = 3.11; 95 % CI = 1.66,5.83) compared to those in Precontemplation, Contemplation, or Preparation. Intention (p per day. Australian New Zealand Clinical Trials Registry reference: ACTRN12611000157976 World Health Organization Universal Trial

A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

International Nuclear Information System (INIS)

Hahn, P.J.; Giddings, L.; Lane, M.J.

1989-01-01

Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

Fragmentation contributions to hadroproduction of prompt $J/\\psi$, $\\chi_{cJ}$, and $\\psi(2S)$ states

CERN Document Server

Chung, Hee Sok

2016-01-01

We compute leading-power fragmentation corrections to hadroproduction of charmonium states J/ψ, χcJ , and ψ(2S) in the nonrelativistic QCD factorization formalism. We include fragmentation functions through order α 2 s and parton production cross sections through order α 3 s . We also resum leading logarithms of the transverse momentum divided by the charm-quark mass to all orders in αs . We find that the fragmentation corrections have a significant impact on the hadroproduction cross section of charmonia. We obtain good fits to the hadroproduction cross sections measured at the Tevatron and the LHC. Using the long-distance matrix elements obtained from the fits, we make predictions for prompt J/ψ polarization that are in good agreement with the LHC data.

Complete photo-fragmentation of the deuterium molecule

International Nuclear Information System (INIS)

Weber, Thorsten; Czasch, Achim O.; Jagutzki, Ottmar; Muller, Alkis K.; Mergel, Volker; Kheifets, A.; Rotenberg, Eli; Meigs, George; Prior, Mike H.; Daveau, Sebastian; Landers, Allen; Cocke, C.L.; Osipov, Timur; Diez Muino, Ricardo; Schmidt-Bocking, Horst; Dorner, Reinhard

2004-01-01

All properties of molecules, from binding and excitation energies to their geometry, are determined by the highly correlated initial state wavefunction of the electrons and nuclei. Perhaps surprisingly, details of these correlations can be revealed by studying the break-up of these systems into their constituents. The fragmentation might be initiated by the absorption of a single photon [1, 2, 3, 4, 5, 6], collision with a charged particle [7, 8] or exposure to a strong laser pulse [9, 10]. If the exciting interaction is sufficiently understood, one can use the fragmentation process as a tool to learn about the bound initial state [11, 12]. However, often the interaction and the fragment motions pose formidable challenges to quantum theory [13, 14, 15]. Here we report the coincident measurement of the momenta of both nuclei and both electrons from the single photon induced fragmentation of the deuterium molecule. The results reveal that the correlated motion of the electrons is strongly dependent on the inter-nuclear separation in the molecular ground state at the instant of photon absorption

Element Distribution and Multiplicity of Heavy Fragments

CERN Multimedia

2002-01-01

This experiment will measure the energy and angular distribution of heavy fragments produced in the reactions of |1|2C on several targets between |2|7Al and |2|3|8U at 86~MeV/u. The systematic investigation of a highly excited interaction region (fireball) by means of a clean N and Z identification of heavy tar fragments, may result in a better understanding of temperature concept and of the degree of equilibration of the local interaction region with respect to the total system. For this investigation a large-area position sensitive ionization chamber of 50~msr solid angle in conjunction with a time-of-flight telescope consisting of parallel-plate detectors will be used. \\\\ \\\\ In order to get information on the transverse momentum transfer and the inelasticity of the collision, the energy of the PROJECTILE-FRAGMENTS will be measured at forward angles with a plastic scintillator hodoscope. In addition to this inclusive measurement correlations between heavy fragments will be investigated by means of three pos...

Chameleon fragmentation

Energy Technology Data Exchange (ETDEWEB)

Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)

2014-02-01

A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.

Chameleon fragmentation

International Nuclear Information System (INIS)

Brax, Philippe; Upadhye, Amol

2014-01-01

A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments

Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.

Science.gov (United States)

De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C

2015-03-01

Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.

A step-by-step experiment of 3C-SiC hetero-epitaxial growth on 4H-SiC by CVD

Energy Technology Data Exchange (ETDEWEB)

Xin, Bin [School of Microelectronics, Xidian University, Key Laboratory of Wide Band-Gap Semiconductor Materials and Devices, Xi’an 710071 (China); Jia, Ren-Xu, E-mail: rxjia@mail.xidian.edu.cn [School of Microelectronics, Xidian University, Key Laboratory of Wide Band-Gap Semiconductor Materials and Devices, Xi’an 710071 (China); Hu, Ji-Chao [School of Microelectronics, Xidian University, Key Laboratory of Wide Band-Gap Semiconductor Materials and Devices, Xi’an 710071 (China); Tsai, Cheng-Ying [Graduate Institute of Electronics Engineering, National Taiwan University, 10617 Taipei, Taiwan (China); Lin, Hao-Hsiung, E-mail: hhlin@ntu.edu.tw [Graduate Institute of Electronics Engineering, National Taiwan University, 10617 Taipei, Taiwan (China); Graduate Institute of Photonics and Optoelectronics, National Taiwan University, 10617 Taipei, Taiwan (China); Zhang, Yu-Ming [School of Microelectronics, Xidian University, Key Laboratory of Wide Band-Gap Semiconductor Materials and Devices, Xi’an 710071 (China)

2015-12-01

Highlights: • A step-by-step experiment to investigate the growth mechanism of SiC hetero-epitaxial is proposed. • It has shown protrusive regular “hill” morphology with much lower density of DPB defect in our experiment, which normally were in high density with shallow groove. Based on the defect morphology, an anisotropy migration rate phenomenon of adatoms has been regarded as forming the morphology of DPB defects and a new “DPB defects assist epitaxy” growth mode has been proposed based on Frank-van der Merwe growth mode. - Abstract: To investigate the growth mechanism of hetero-epitaxial SiC, a step-by-step experiment of 3C-SiC epitaxial layers grown on 4H-SiC on-axis substrates by the CVD method are reported in this paper. Four step experiments with four one-quarter 4H-SiC wafers were performed. Optical microscopy and atomic force microscopy (AFM) were used to characterize the morphology of the epitaxial layers. It was previously found that the main factor affecting the epilayer morphology was double-positioning boundary (DPB) defects, which normally were in high density with shallow grooves. However, a protrusive regular “hill” morphology with a much lower density was shown in our experiment in high-temperature growth conditions. The anisotropic migration of adatoms is regarded as forming the morphology of DPB defects, and a new “DPB defects assist epitaxy” growth mode has been proposed based on the Frank-van der Merwe growth mode. Raman spectroscopy and X-ray diffraction were used to examine the polytypes and the quality of the epitaxial layers.

An Ingested Orthodontic Wire Fragment: A Case Report.

Science.gov (United States)

Puryer, James; McNamara, Catherine; Sandy, Jonathan; Ireland, Tony

2016-08-01

Accidental ingestion or inhalation of foreign bodies has been widely documented, including incidents which occur whilst undertaking dental treatment. Most ingested objects pass through the gastrointestinal tract (GIT) spontaneously, but approximately 10%-20% need to be removed endoscopically and 1% require surgery. This case reports a complication arising from the accidental loss of an archwire fragment during maxillary archwire placement. It describes the immediate and subsequent management, including the use of radiographs to track the passage of the fragment through the gastro-intestinal tract. This case stresses the vigilance that dentists must take to prevent inhalation or ingestion of foreign bodies and the consequences of time-delays when management decisions are needed.

Validation of Geant4 fragmentation for Heavy Ion Therapy

Science.gov (United States)

Bolst, David; Cirrone, Giuseppe A. P.; Cuttone, Giacomo; Folger, Gunter; Incerti, Sebastien; Ivanchenko, Vladimir; Koi, Tatsumi; Mancusi, Davide; Pandola, Luciano; Romano, Francesco; Rosenfeld, Anatoly B.; Guatelli, Susanna

2017-10-01

12C ion therapy has had growing interest in recent years for its excellent dose conformity. However at therapeutic energies, which can be as high as 400 MeV/u, carbon ions produce secondary fragments. For an incident 400 MeV/u 12C ion beam, ∼ 70 % of the beam will undergo fragmentation before the Bragg Peak. The dosimetric and radiobiological impact of these fragments must be accurately characterised, as it can result in increasing the risk of secondary cancer for the patient as well as altering the relative biological effectiveness. This work investigates the accuracy of three different nuclear fragmentation models available in the Monte Carlo Toolkit Geant4, the Binary Intranuclear Cascade (BIC), the Quantum Molecular Dynamics (QMD) and the Liege Intranuclear Cascade (INCL++). The models were benchmarked against experimental data for a pristine 400 MeV/u 12C beam incident upon a water phantom, including fragment yield, angular and energy distribution. For fragment yields the three alternative models agreed between ∼ 5 and ∼ 35 % with experimental measurements, the QMD using the "Frag" option gave the best agreement for lighter fragments but had reduced agreement for larger fragments. For angular distributions INCL++ was seen to provide the best agreement among the models for all elements with the exception of Hydrogen, while BIC and QMD was seen to produce broader distributions compared to experiment. BIC and QMD performed similar to one another for kinetic energy distributions while INCL++ suffered from producing lower energy distributions compared to the other models and experiment.

Successful de-fragmentation of woodland by planting in an agricultural landscape? An assessment based on landscape indicators.

Science.gov (United States)

Quine, C P; Watts, K

2009-01-01

Habitat fragmentation is the focus of much conservation concern and associated research. In some countries, such as Britain, the main phase of fragmentation occurred centuries ago and the focus of conservation management is now on restoration and recovery. Scenario studies have suggested that spatial targeting is preferable if landscape scale restoration is to be achieved, and that this should bring greater benefits than site-focussed activities but this has rarely been tested in practice. In Britain, woodland expansion has been encouraged through a number of financial incentives, which have evolved from instruments that encouraged almost any addition to the potential woodland resource, to grant schemes that have set out to restore connectivity to remnant ancient woodland. This study assessed the degree of de-fragmentation achieved by woodland expansion on the Isle of Wight and in particular the success of spatial targeting of new woodland planting implemented through grant aid in the JIGSAW (Joining and Increasing Grant Scheme for Ancient Woodland) scheme. Five steps in the re-development of broad-leaved woodland were tested using eight indicators - six commonly used landscape metrics, and two ecologically scaled indicators derived from application of least-cost network evaluation. Only half of the measures indicated de-fragmentation over the whole sequence of five steps. However, the spatial targeting did appear successful, when compared to equivalent untargeted grant-aided woodland expansion, and resulted in positive change to six of the eight indicators. We discuss the utility of the indicators and ways in which future targeting could be supported by their application.

Traffic safety and step-by-step driving licence for young people

DEFF Research Database (Denmark)

Tønning, Charlotte; Agerholm, Niels

2017-01-01

presents a review of safety effects from step-by-step driving licence schemes. Most of the investigated schemes consist of a step-by-step driving licence with Step 1) various tests and education, Step 2) a period where driving is only allowed together with an experienced driver and Step 3) driving without...... companion is allowed but with various restrictions and, in some cases, additional driving education and tests. In general, a step-by-step driving licence improves traffic safety even though the young people are permitted to drive a car earlier on. The effects from driving with an experienced driver vary......Young novice car drivers are much more accident-prone than other drivers - up to 10 times that of their parents' generation. A central solution to improve the traffic safety for this group is implementation of a step-by-step driving licence. A number of countries have introduced a step...

Cumulative protons in 12C fragmentation at intermediate energy

International Nuclear Information System (INIS)

Abramov, B.M.; Alekseev, P.N.; Borodin, Y.A.; Bulychjov, S.A.; Dukhovskoi, I.A.; Khanov, A.I.; Krutenkova, A.P.; Kulikov, V.V.; Martemianov, M.A.; Matsuk, M.A.; Turdakina, E.N.

2014-01-01

In the FRAGM experiment at heavy ion accelerator complex TWAC-ITEP, the proton yields at an angle 3.5 degrees have been measured in fragmentation of carbon ions at T 0 equals 0.3, 0.6, 0.95 and 2.0 GeV/nucleon on beryllium target. The data are presented as invariant proton yields on cumulative variable x in the range 0.9 < x < 2.4. Proton spectra cover six orders of invariant cross section magnitude. They have been analyzed in the framework of quark cluster fragmentation model. Fragmentation functions of quark- gluon string model are used. The probabilities of the existence of multi-quark clusters in carbon nuclei are estimated to be 8 - 12% for six-quark clusters and 0.2 - 0.6% for nine- quark clusters. (authors)

DYNAMICS OF LARGE FRAGMENTS IN THE TAIL OF ACTIVE ASTEROID P/2010 A2

International Nuclear Information System (INIS)

Agarwal, Jessica; Jewitt, David; Weaver, Harold

2013-01-01

We examine the motions of large fragments at the head of the dust tail of the active asteroid P/2010 A2. In previous work, we showed that these fragments were ejected from the primary nucleus in early 2009, either following a hypervelocity impact or by rotationally induced breakup. Here, we follow their positions through a series of Hubble Space Telescope images taken during the first half of 2010. The orbital evolution of each fragment allows us to constrain its velocity relative to the main nucleus after leaving its sphere of gravitational influence. We find that the fragments constituting a prominent X-shaped tail feature were emitted in a direction opposite to the motion of the asteroid and toward the south of its orbital plane. Derived emission velocities of these primary fragments range between 0.02 and 0.3 m s –1 , comparable to the ∼0.08 m s –1 gravitational escape speed from the nucleus. Their sizes are on the order of decimeters or larger. We obtain the best fits to our data with ejection velocity vectors lying in a plane that includes the nucleus. This may suggest that the cause of the disruption of P/2010 A2 is rotational breakup.

Fragment library design: using cheminformatics and expert chemists to fill gaps in existing fragment libraries.

Science.gov (United States)

Kutchukian, Peter S; So, Sung-Sau; Fischer, Christian; Waller, Chris L

2015-01-01

Fragment based screening (FBS) has emerged as a mainstream lead discovery strategy in academia, biotechnology start-ups, and large pharma. As a prerequisite of FBS, a structurally diverse library of fragments is desirable in order to identify chemical matter that will interact with the range of diverse target classes that are prosecuted in contemporary screening campaigns. In addition, it is also desirable to offer synthetically amenable starting points to increase the probability of a successful fragment evolution through medicinal chemistry. Herein we describe a method to identify biologically relevant chemical substructures that are missing from an existing fragment library (chemical gaps), and organize these chemical gaps hierarchically so that medicinal chemists can efficiently navigate the prioritized chemical space and subsequently select purchasable fragments for inclusion in an enhanced fragment library.

Universality of projectile fragmentation model

International Nuclear Information System (INIS)

Chaudhuri, G.; Mallik, S.; Das Gupta, S.

2012-01-01

Presently projectile fragmentation reaction is an important area of research as it is used for the production of radioactive ion beams. In this work, the recently developed projectile fragmentation model with an universal temperature profile is used for studying the charge distributions of different projectile fragmentation reactions with different projectile target combinations at different incident energies. The model for projectile fragmentation consists of three stages: (i) abrasion, (ii) multifragmentation and (iii) evaporation

Selective disulfide reduction for labeling and enhancement of Fab antibody fragments.

Science.gov (United States)

Kirley, Terence L; Greis, Kenneth D; Norman, Andrew B

2016-11-25

Many methods have been developed for chemical labeling and enhancement of the properties of antibodies and their common fragments, including the Fab and F(ab') 2 fragments. Somewhat selective reduction of some antibody disulfide bonds has been previously achieved, yielding antibodies and antibody fragments that can be labeled at defined sites, enhancing their utility and properties. Selective reduction of the two hinge disulfide bonds present in F(ab') 2 fragments using mild reduction has been useful. However, such reduction is often not quantitative and results in the reduction of multiple disulfide bonds, and therefore subsequent multiple labeling or conjugation sites are neither homogenous nor stoichiometric. Here, a simple and efficient selective reduction of the single disulfide bond linking the partial heavy chain and the intact light chain which compose the Fab fragment is accomplished utilizing tris(2-carboxyethyl)phosphine (TCEP) immobilized on agarose beads. The resultant reduced cysteine residues were labeled with several cysteine-selective fluorescent reagents, as well as by cysteine-directed PEGylation. These two cysteine residues can also be re-ligated by means of a bifunctional cysteine cross-linking agent, dibromobimane, thereby both restoring a covalent linkage between the heavy and light chains at this site, far removed from the antigen binding site, and also introducing a fluorescent probe. There are many other research and clinical uses for these selectively partially reduced Fab fragments, including biotinylation, toxin and drug conjugation, and incorporation of radioisotopes, and this technique enables simple generation of very useful Fab fragment derivatives with many potential applications. Copyright © 2016 Elsevier Inc. All rights reserved.

Collision induced fragmentation dynamics of small metallic clusters; Dynamique de fragmentation induite par collision de petits agregats metalliques

Energy Technology Data Exchange (ETDEWEB)

Picard, Y

1999-04-15

The goal of this work is the complete analysis of the fragmentation of alkali clusters (Na{sub n}{sup +} (n < 10), NaK{sup +} and K{sub 2}{sup +}) induced by collision with light atomic (He) or molecular (H{sub 2}) targets. The main point is to study how the energy is transmitted to the cluster during the collision and how this energy is shared among the various degrees of freedom of the system and leads to its fragmentation. Two types of interactions govern the collision induced dissociation processes: on one hand, the electronic mechanisms where the target perturbs the electronic cloud and brings the molecule into a dissociative state, and on the other hand, the impulsive mechanisms where the momentum transferred to the atomic cores leads to the rotational-vibrational dissociation of the molecule. The experimental procedure is based on the measurement of the velocity vectors of the outgoing fragments detected in coincidence. This allows to reconstruct the full kinematics of the fragmentation and to separate and characterize for the first time the two types of interactions. The two basic mechanisms of collision induced dissociation are then clearly resolved for the diatomic molecule Na{sub 2}{sup +}. For the heteronuclear molecular ion NaK{sup +}, it is shown that the dissociation process is due to a combination of electronic and impulsive mechanisms in some of the dissociation pathways. The extension to the study of metallic clusters Na{sub n}{sup +} (n < 10) fragmentation shows the role and the relative importance of the electronic and impulsive mechanisms and their evolution with the cluster size. The complete analysis of Na{sub 3}{sup +} multi-fragmentation is also presented. (author)

A water-based training program that include perturbation exercises to improve stepping responses in older adults: study protocol for a randomized controlled cross-over trial

Directory of Open Access Journals (Sweden)

Tsedek Irit

2008-08-01

Full Text Available Abstract Background Gait and balance impairments may increase the risk of falls, the leading cause of accidental death in the elderly population. Fall-related injuries constitute a serious public health problem associated with high costs for society as well as human suffering. A rapid step is the most important protective postural strategy, acting to recover equilibrium and prevent a fall from initiating. It can arise from large perturbations, but also frequently as a consequence of volitional movements. We propose to use a novel water-based training program which includes specific perturbation exercises that will target the stepping responses that could potentially have a profound effect in reducing risk of falling. We describe the water-based balance training program and a study protocol to evaluate its efficacy (Trial registration number #NCT00708136. Methods/Design The proposed water-based training program involves use of unpredictable, multi-directional perturbations in a group setting to evoke compensatory and volitional stepping responses. Perturbations are made by pushing slightly the subjects and by water turbulence, in 24 training sessions conducted over 12 weeks. Concurrent cognitive tasks during movement tasks are included. Principles of physical training and exercise including awareness, continuity, motivation, overload, periodicity, progression and specificity were used in the development of this novel program. Specific goals are to increase the speed of stepping responses and improve the postural control mechanism and physical functioning. A prospective, randomized, cross-over trial with concealed allocation, assessor blinding and intention-to-treat analysis will be performed to evaluate the efficacy of the water-based training program. A total of 36 community-dwelling adults (age 65–88 with no recent history of instability or falling will be assigned to either the perturbation-based training or a control group (no training

Effective Fragment Potential Method for H-Bonding: How To Obtain Parameters for Nonrigid Fragments.

Science.gov (United States)

Dubinets, Nikita; Slipchenko, Lyudmila V

2017-07-20

Accuracy of the effective fragment potential (EFP) method was explored for describing intermolecular interaction energies in three dimers with strong H-bonded interactions, formic acid, formamide, and formamidine dimers, which are a part of HBC6 database of noncovalent interactions. Monomer geometries in these dimers change significantly as a function of intermonomer separation. Several EFP schemes were considered, in which fragment parameters were prepared for a fragment in its gas-phase geometry or recomputed for each unique fragment geometry. Additionally, a scheme in which gas-phase fragment parameters are shifted according to relaxed fragment geometries is introduced and tested. EFP data are compared against the coupled cluster with single, double, and perturbative triple excitations (CCSD(T)) method in a complete basis set (CBS) and the symmetry adapted perturbation theory (SAPT). All considered EFP schemes provide a good agreement with CCSD(T)/CBS for binding energies at equilibrium separations, with discrepancies not exceeding 2 kcal/mol. However, only the schemes that utilize relaxed fragment geometries remain qualitatively correct at shorter than equilibrium intermolecular distances. The EFP scheme with shifted parameters behaves quantitatively similar to the scheme in which parameters are recomputed for each monomer geometry and thus is recommended as a computationally efficient approach for large-scale EFP simulations of flexible systems.

DEFORMATION DEPENDENT TUL MULTI-STEP DIRECT MODEL

International Nuclear Information System (INIS)

WIENKE, H.; CAPOTE, R.; HERMAN, M.; SIN, M.

2007-01-01

The Multi-Step Direct (MSD) module TRISTAN in the nuclear reaction code EMPIRE has been extended in order to account for nuclear deformation. The new formalism was tested in calculations of neutron emission spectra emitted from the 232 Th(n,xn) reaction. These calculations include vibration-rotational Coupled Channels (CC) for the inelastic scattering to low-lying collective levels, ''deformed'' MSD with quadrupole deformation for inelastic scattering to the continuum, Multi-Step Compound (MSC) and Hauser-Feshbach with advanced treatment of the fission channel. Prompt fission neutrons were also calculated. The comparison with experimental data shows clear improvement over the ''spherical'' MSD calculations and JEFF-3.1 and JENDL-3.3 evaluations

The program LISE: a simulation of fragment separators

International Nuclear Information System (INIS)

Bazin, D.; Tarasov, O.; Lewitowicz, M.; Sorlin, O.

2001-01-01

The program LISE, which simulates the operation of fragment separators, used in the production of radioactive beams via fragmentation is described. Various aspects of the physical phenomenon involved in the production of such radioactive beams are discussed. They include fragmentation cross sections, energy losses in materials, ionic charge state distributions, as well as ion optics calculations and acceptance effects. Among the goals of this program is a highly user-friendly environment, designed not only to forecast intensities and purities for future experiments, but also as a tuning tool during experiments where its results can be quickly compared to on-line data. In addition, several general purpose tools such as a physical parameters calculator, a database of nuclei properties, and relativistic two-body kinematics calculations make it also attractive in experiments where radioactive beams are not involved. After a general description of fragment separators, the principles underlying the calculations are presented, followed by a practical description of the program and its many features. Finally, a few examples of calculations are compared to on-line data, both qualitatively and quantitatively

Robust Object Tracking Using Valid Fragments Selection.

Science.gov (United States)

Zheng, Jin; Li, Bo; Tian, Peng; Luo, Gang

Local features are widely used in visual tracking to improve robustness in cases of partial occlusion, deformation and rotation. This paper proposes a local fragment-based object tracking algorithm. Unlike many existing fragment-based algorithms that allocate the weights to each fragment, this method firstly defines discrimination and uniqueness for local fragment, and builds an automatic pre-selection of useful fragments for tracking. Then, a Harris-SIFT filter is used to choose the current valid fragments, excluding occluded or highly deformed fragments. Based on those valid fragments, fragment-based color histogram provides a structured and effective description for the object. Finally, the object is tracked using a valid fragment template combining the displacement constraint and similarity of each valid fragment. The object template is updated by fusing feature similarity and valid fragments, which is scale-adaptive and robust to partial occlusion. The experimental results show that the proposed algorithm is accurate and robust in challenging scenarios.

Fragment-based {sup 13}C nuclear magnetic resonance chemical shift predictions in molecular crystals: An alternative to planewave methods

Energy Technology Data Exchange (ETDEWEB)

Hartman, Joshua D.; Beran, Gregory J. O., E-mail: gregory.beran@ucr.edu [Department of Chemistry, University of California, Riverside, California 92521 (United States); Monaco, Stephen; Schatschneider, Bohdan [The Pennsylvania State University, The Eberly Campus, 2201 University Dr, Lemont Furnace, Pennsylvania 15456 (United States)

2015-09-14

We assess the quality of fragment-based ab initio isotropic {sup 13}C chemical shift predictions for a collection of 25 molecular crystals with eight different density functionals. We explore the relative performance of cluster, two-body fragment, combined cluster/fragment, and the planewave gauge-including projector augmented wave (GIPAW) models relative to experiment. When electrostatic embedding is employed to capture many-body polarization effects, the simple and computationally inexpensive two-body fragment model predicts both isotropic {sup 13}C chemical shifts and the chemical shielding tensors as well as both cluster models and the GIPAW approach. Unlike the GIPAW approach, hybrid density functionals can be used readily in a fragment model, and all four hybrid functionals tested here (PBE0, B3LYP, B3PW91, and B97-2) predict chemical shifts in noticeably better agreement with experiment than the four generalized gradient approximation (GGA) functionals considered (PBE, OPBE, BLYP, and BP86). A set of recommended linear regression parameters for mapping between calculated chemical shieldings and observed chemical shifts are provided based on these benchmark calculations. Statistical cross-validation procedures are used to demonstrate the robustness of these fits.

Comparison of midvelocity fragment formation with projectilelike decay

International Nuclear Information System (INIS)

Hudan, S.; Alfaro, R.; Davin, B.; Larochelle, Y.; Xu, H.; Beaulieu, L.; Lefort, T.; Yanez, R.; Souza, R.T. de; Charity, R.J.; Sobotka, L.G.; Liu, T.X.; Liu, X.D.; Lynch, W.G.; Shomin, R.; Tan, W.P.; Tsang, M.B.; Molen, A. van der; Wagner, A.; Xi, H.F.

2005-01-01

The characteristics of intermediate mass fragments (IMFs: 3≤ Z≤ 20) produced in midperipheral and central collisions are compared. We compare IMFs detected at midvelocity with those evaporated from the excited projectilelike fragment (PLF*). On average, the IMFs produced at midvelocity are larger in atomic number, exhibit broader transverse velocity distributions, and are more neutron rich as compared to IMFs evaporated from the PLF*. These characteristics of midvelocity fragments are consistent with the low-density formation of the fragments. We present in the different kinematical regions studied, the perpendicular > for isotopically identified IMFs. For a given Z, perpendicular > is either constant or decreases slightly with increasing A, in contradiction with a mass-dependent collective expansion in which all IMFs are emitted on average at the same time. Neutron-deficient isotopes of even Z elements manifest higher kinetic energies than heavier isotopes of the same element for both PLF* and midvelocity emission. This result may be because of the charged-particle decay of long-lived excited states

PHISICS/RELAP5-3D Adaptive Time-Step Method Demonstrated for the HTTR LOFC#1 Simulation

Energy Technology Data Exchange (ETDEWEB)

Baker, Robin Ivey [Idaho National Lab. (INL), Idaho Falls, ID (United States); Balestra, Paolo [Univ. of Rome (Italy); Strydom, Gerhard [Idaho National Lab. (INL), Idaho Falls, ID (United States)

2017-05-01

A collaborative effort between Japan Atomic Energy Agency (JAEA) and Idaho National Laboratory (INL) as part of the Civil Nuclear Energy Working Group is underway to model the high temperature engineering test reactor (HTTR) loss of forced cooling (LOFC) transient that was performed in December 2010. The coupled version of RELAP5-3D, a thermal fluids code, and PHISICS, a neutronics code, were used to model the transient. The focus of this report is to summarize the changes made to the PHISICS-RELAP5-3D code for implementing an adaptive time step methodology into the code for the first time, and to test it using the full HTTR PHISICS/RELAP5-3D model developed by JAEA and INL and the LOFC simulation. Various adaptive schemes are available based on flux or power convergence criteria that allow significantly larger time steps to be taken by the neutronics module. The report includes a description of the HTTR and the associated PHISICS/RELAP5-3D model test results as well as the University of Rome sub-contractor report documenting the adaptive time step theory and methodology implemented in PHISICS/RELAP5-3D. Two versions of the HTTR model were tested using 8 and 26 energy groups. It was found that most of the new adaptive methods lead to significant improvements in the LOFC simulation time required without significant accuracy penalties in the prediction of the fission power and the fuel temperature. In the best performing 8 group model scenarios, a LOFC simulation of 20 hours could be completed in real-time, or even less than real-time, compared with the previous version of the code that completed the same transient 3-8 times slower than real-time. A few of the user choice combinations between the methodologies available and the tolerance settings did however result in unacceptably high errors or insignificant gains in simulation time. The study is concluded with recommendations on which methods to use for this HTTR model. An important caveat is that these findings

Synthesis and E.I.M.S. fragmentation analysis of [1,3-{sup 15} N{sub 2}] xanthine and [1,3-{sup 15} N{sub 2}] caffeine

Energy Technology Data Exchange (ETDEWEB)

Kenani, A. [Tunis Univ. (Tunisia). Faculte de Medecine; Bernier, J.-L. [Laboratoire de Chimie Organique Physique (France); Henichart, J.-P. [UCB-Pharma (Belgium)

1995-02-01

HPLC and mass spectrometry can be used to isolate and identify all metabolites of caffeine in plasma of patients. The synthesis of [1,3-{sup 15}N{sub 2}] xanthine and [1,3-{sup 15}N{sub 2}] caffeine are of interest in the elucidation of mass spectrometry fragmentation pathways and unambiguous determination of metabolites, especially uric acid which exists as a natural constituent of human plasma. (Author).

Complejo Ojosmin: fragment of ophiolite transamazonian

International Nuclear Information System (INIS)

Bossi, J.; Pineyro, D. . Email geologia@fagro.edu.uy

2004-01-01

A preliminary geological survey of a previously unknown basic igneous complex in the Padre Alta Terrane (Pat) is presented. We report petrographic, geochemical and stratigraphic data for more than 200 outcrops. Geological evolution of the complex can be described in terms of four main events: (1) formation Pat units around 2000 Ma; (2) granodiorite thrusting onto possible ophiolite ca 1900 Ma ; (3) granophyric magmatism around 1700 Ma(4) intrusion of trachyte dykes. Data available suggest thrusting onto fragment of oceanic crust. Since the described structure presupposes the existence of pre transamazonian continental fragments in the TPA, it is very important to study the area in detail in the future [es

RISC-interacting clearing 3’- 5’ exoribonucleases (RICEs) degrade uridylated cleavage fragments to maintain functional RISC in Arabidopsis thaliana

Science.gov (United States)

Zhang, Zhonghui; Hu, Fuqu; Sung, Min Woo; Shu, Chang; Castillo-González, Claudia; Koiwa, Hisashi; Tang, Guiliang; Dickman, Martin; Li, Pingwei; Zhang, Xiuren

2017-01-01

RNA-induced silencing complex (RISC) is composed of miRNAs and AGO proteins. AGOs use miRNAs as guides to slice target mRNAs to produce truncated 5' and 3' RNA fragments. The 5' cleaved RNA fragments are marked with uridylation for degradation. Here, we identified novel cofactors of Arabidopsis AGOs, named RICE1 and RICE2. RICE proteins specifically degraded single-strand (ss) RNAs in vitro; but neither miRNAs nor miRNA*s in vivo. RICE1 exhibited a DnaQ-like exonuclease fold and formed a homohexamer with the active sites located at the interfaces between RICE1 subunits. Notably, ectopic expression of catalytically-inactive RICE1 not only significantly reduced miRNA levels; but also increased 5' cleavage RISC fragments with extended uridine tails. We conclude that RICEs act to degrade uridylated 5’ products of AGO cleavage to maintain functional RISC. Our study also suggests a possible link between decay of cleaved target mRNAs and miRNA stability in RISC. DOI: http://dx.doi.org/10.7554/eLife.24466.001 PMID:28463111

Self-organized criticality in fragmenting

DEFF Research Database (Denmark)

Oddershede, L.; Dimon, P.; Bohr, J.

1993-01-01

The measured mass distributions of fragments from 26 fractured objects of gypsum, soap, stearic paraffin, and potato show evidence of obeying scaling laws; this suggests the possibility of self-organized criticality in fragmenting. The probability of finding a fragment scales inversely to a power...

Single-Step Generation of Conditional Knockout Mouse Embryonic Stem Cells

Directory of Open Access Journals (Sweden)

Matyas Flemr

2015-07-01

Full Text Available Induction of double-strand DNA breaks (DSBs by engineered nucleases, such as CRISPR/Cas9 or transcription activator-like effector nucleases (TALENs, stimulates knockin of exogenous DNA fragments via homologous recombination (HR. However, the knockin efficiencies reported so far have not allowed more complex in vitro genome modifications such as, for instance, simultaneous integration of a DNA fragment at two distinct genomic sites. We developed a reporter system to enrich for cells with engineered nuclease-assisted HR events. Using this system in mouse embryonic stem cells (mESCs, we achieve single-step biallelic and seamless integration of two loxP sites for Cre recombinase-mediated inducible gene knockout, as well as biallelic endogenous gene tagging with high efficiency. Our approach reduces the time and resources required for conditional knockout mESC generation dramatically.

Fragment screening of cyclin G-associated kinase by weak affinity chromatography.

Science.gov (United States)

Meiby, Elinor; Knapp, Stefan; Elkins, Jonathan M; Ohlson, Sten

2012-11-01

Fragment-based drug discovery (FBDD) has become a new strategy for drug discovery where lead compounds are evolved from small molecules. These fragments form low affinity interactions (dissociation constant (K(D)) = mM - μM) with protein targets, which require fragment screening methods of sufficient sensitivity. Weak affinity chromatography (WAC) is a promising new technology for fragment screening based on selective retention of fragments by a drug target. Kinases are a major pharmaceutical target, and FBDD has been successfully applied to several of these targets. In this work, we have demonstrated the potential to use WAC in combination with mass spectrometry (MS) detection for fragment screening of a kinase target-cyclin G-associated kinase (GAK). One hundred seventy fragments were selected for WAC screening by virtual screening of a commercial fragment library against the ATP-binding site of five different proteins. GAK protein was immobilized on a capillary HPLC column, and compound binding was characterized by frontal affinity chromatography. Compounds were screened in sets of 13 or 14, in combination with MS detection for enhanced throughput. Seventy-eight fragments (46 %) with K(D) < 200 μM were detected, including a few highly efficient GAK binders (K(D) of 2 μM; ligand efficiency = 0.51). Of special interest is that chiral screening by WAC may be possible, as two stereoisomeric fragments, which both contained one chiral center, demonstrated twin peaks. This ability, in combination with the robustness, sensitivity, and simplicity of WAC makes it a new method for fragment screening of considerable potential.

Energy production using fission fragment rockets

International Nuclear Information System (INIS)

Chapline, G.; Matsuda, Y.

1991-08-01

Fission fragment rockets are nuclear reactors with a core consisting of thin fibers in a vacuum, and which use magnetic fields to extract the fission fragments from the reactor core. As an alternative to ordinary nuclear reactors, fission fragment rockets would have the following advantages: Approximately twice as efficient if one can directly convert the fission fragment energy into electricity; by reducing the buildup of a fission fragment inventory in the reactor one could avoid a Chernobyl type disaster; and collecting the fission fragments outside the reactor could simplify the waste disposal problem. 6 refs., 4 figs., 2 tabs

One-Step Solvent Evaporation-Assisted 3D Printing of Piezoelectric PVDF Nanocomposite Structures.

Science.gov (United States)

Bodkhe, Sampada; Turcot, Gabrielle; Gosselin, Frederick P; Therriault, Daniel

2017-06-21

Development of a 3D printable material system possessing inherent piezoelectric properties to fabricate integrable sensors in a single-step printing process without poling is of importance to the creation of a wide variety of smart structures. Here, we study the effect of addition of barium titanate nanoparticles in nucleating piezoelectric β-polymorph in 3D printable polyvinylidene fluoride (PVDF) and fabrication of the layer-by-layer and self-supporting piezoelectric structures on a micro- to millimeter scale by solvent evaporation-assisted 3D printing at room temperature. The nanocomposite formulation obtained after a comprehensive investigation of composition and processing techniques possesses a piezoelectric coefficient, d 31 , of 18 pC N -1 , which is comparable to that of typical poled and stretched commercial PVDF film sensors. A 3D contact sensor that generates up to 4 V upon gentle finger taps demonstrates the efficacy of the fabrication technique. Our one-step 3D printing of piezoelectric nanocomposites can form ready-to-use, complex-shaped, flexible, and lightweight piezoelectric devices. When combined with other 3D printable materials, they could serve as stand-alone or embedded sensors in aerospace, biomedicine, and robotic applications.

Fragmentation of relativistic nuclei

International Nuclear Information System (INIS)

Cork, B.

1975-06-01

Nuclei with energies of several GeV/n interact with hadrons and produce fragments that encompass the fields of nuclear physics, meson physics, and particle physics. Experimental results are now available to explore problems in nuclear physics such as the validity of the shell model to explain the momentum distribution of fragments, the contribution of giant dipole resonances to fragment production cross sections, the effective Coulomb barrier, and nuclear temperatures. A new approach to meson physics is possible by exploring the nucleon charge-exchange process. Particle physics problems are explored by measuring the energy and target dependence of isotope production cross sections, thus determining if limiting fragmentation and target factorization are valid, and measuring total cross sections to determine if the factorization relation, sigma/sub AB/ 2 = sigma/sub AA/ . sigma/sub BB/, is violated. Also, new experiments have been done to measure the angular distribution of fragments that could be explained as nuclear shock waves, and to explore for ultradense matter produced by very heavy ions incident on heavy atoms. (12 figures, 2 tables)

Detection of fission fragments by secondary emission; Detection des fragments de fission par emission secondaire

Energy Technology Data Exchange (ETDEWEB)

Audias, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

1965-07-01

This fission fragment detecting apparatus is based on the principle that fragments traversing a thin foil will cause emission of secondary electrons. These electrons are then accelerated (10 kV) and directly detected by means of a plastic scintillator and associated photomultiplier. Some of the advantages of such a detector are, its rapidity, its discriminating power between alpha particles and fission fragments, its small energy loss in detecting the fragments and the relatively great amount of fissionable material which it can contain. This paper is subdivided as follows: a) theoretical considerations b) constructional details of apparatus and some experimental details and c) a study of the secondary emission effect itself. (author) [French] Le detecteur de fragments de fission que nous avons realise est base sur le principe de l'emission secondaire produite par les fragments de fission traversant une feuille mince: les electrons secondaires emis sont acceleres a des tensions telles (de l'ordre de 10 kV), qu'ils soient directement detectables par un scintillateur plastique associe a un photomultiplicateur. L'interet d'un tel detecteur reside: dans sa rapidite, sa tres bonne discrimination alpha, fission, la possibilite de detecter les fragments de fission avec une perte d'energie pouvant rester relativement faible, et la possibilite d'introduire des quantites de matiere fissile plus importantes que dans les autres types de detecteurs. Ce travail comporte: -) un apercu bibliographique de la theorie du phenomene, -) realisation et mise au point du detecteur avec etude experimentale de quelques parametres intervenant dans l'emission secondaire, -) etude de l'emission secondaire (sur la face d'emergence des fragments de fission) en fonction de l'energie du fragment et en fonction de l'epaisseur de matiere traversee avant emission secondaire, et -) une etude comparative de l'emission secondaire sur la face d'incidence et sur la face d'emergence des fragments de

Lead facilitates foci formation in a Balb/c-3T3 two-step cell transformation model: role of Ape1 function.

Science.gov (United States)

Hernández-Franco, Pablo; Silva, Martín; Franco, Rodrigo; Valverde, Mahara; Rojas, Emilio

2018-04-01

Several possible mechanisms have been examined to gain an understanding on the carcinogenic properties of lead, which include among others, mitogenesis, alteration of gene expression, oxidative damage, and inhibition of DNA repair. The aim of the present study was to explore if low concentrations of lead, relevant for human exposure, interfere with Ape1 function, a base excision repair enzyme, and its role in cell transformation in Balb/c-3T3. Lead acetate 5 and 30 μM induced APE1 mRNA and upregulation of protein expression. This increase in mRNA expression is consistent throughout the chronic exposure. Additionally, we also found an impaired function of Ape1 through molecular beacon-based assay. To evaluate the impact of lead on foci formation, a Balb/c-3T3 two-step transformation model was used. Balb/c-3T3 cells were pretreated 1 week with low concentrations of lead before induction of transformation with n-methyl-n-nitrosoguanidine (MNNG) (0.5 μg/mL) and 12-O-tetradecanoylphorbol-13-acetate (TPA) (0.1 μg/mL) (a classical two-step protocol). Morphological cell transformation increased in response to lead pretreatment that was paralleled with an increase in Ape1 mRNA and protein overexpression and an impairment of Ape1 activity and correlating with foci number. In addition, we found that lead pretreatment and MNNG (transformation initiator) increased DNA damage, determined by comet assay. Our data suggest that low lead concentrations (5, 30 μM) could play a facilitating role in cellular transformation, probably through the impaired function of housekeeping genes such as Ape1, leading to DNA damage accumulation and chromosomal instability, one of the most important hallmarks of cancer induced by chronic exposures.

Study of multifragmentation: contribution of reduced velocity correlations between particles and fragments

International Nuclear Information System (INIS)

Le Fevre, A.

1997-01-01

This work is focused on the study of fragment and light particle production mechanisms in the multifragmentation process of hot nuclei, which are formed in the central collisions of Xe+Sn at 50 MeV/u. The experiment has been performed with the INDRA multidetector. The central collision events, selected via the flow angle variable, exhibit the presence of a heavy (Z=90) and highly excited (E * =12.5 MeV/u) isotropic emission source. The comparison of the data with a statistical multifragmentation model (MMMC) and a dynamical model (BNV) makes us conclude that the multifragmentation can only be explained in the frame of a relatively cold process, around 6 MeV/u of thermal excitation energy, preceded by a primary emission stage of the expanding source, during which nearly one third of the excitation energy is dissipated. In addition, it appears that the fragment energy spectra are not explained by a purely thermal process, and that one has to put forward an expansion collective motion, of 2 MeV/u of energy, following the compression of the compound system. In order to precise the existence of a two-step particle emission (primary and secondary), we have developed and applied an original method of reduced velocity correlations between particles and fragments. It has allowed us to underline two distinct origins for the particle production: one corresponding to secondary emissions, coming from the fragments, and the other one, associated with emissions which occur prior to the fragment production. At last, it has allowed us, also to bring out a hierarchy in the emission time in the decay process, with respect to the particle type. (author)

Thermodynamics of the fuel fragmentation gas

International Nuclear Information System (INIS)

Perez, R.B.; Alsmiller, R.G. Jr.

1977-01-01

In the context of nuclear reactor safety studies, a program is in progress at ORNL whereby fuel-fragmentation situations are mocked up by the application of high-current capacitor discharges through solid UO 2 samples. The goal of the present work is to predict such quantities as the number of gas and liquid fragments and their energy distributions. The point of view adopted is that upon fragmentation, a cloud of UO 2 vapor is formed containing ''primeval'' liquid fragments which act as condensation centers. In the evolution of time, fragment growth is controlled by nucleation, coagulation and evaporation processes. Eventually, the vapor-droplet system will reach a situation in which clusters (fragments) of various sizes and UO 2 vapor will coexist in an ''association-disassociation'' equilibrium. Thus, the physical model considered here consists of the identification of the fragmentation gas with an ''imperfect'' vapor, made up of interacting UO 2 vapor and liquid fragments. The results of the study are presented

Coulomb fission in dielectric dication clusters: experiment and theory on steps that may underpin the electrospray mechanism.

Science.gov (United States)

Chen, Xiaojing; Bichoutskaia, Elena; Stace, Anthony J

2013-05-16

A series of five molecular dication clusters, (H2O)n(2+), (NH3)n(2+), (CH3CN)n(2+), (C5H5N)n(2+), and (C6H6)n(2+), have been studied for the purpose of identifying patterns of behavior close to the Rayleigh instability limit where the clusters might be expected to exhibit Coulomb fission. Experiments show that the instability limit for each dication covers a range of sizes and that on a time scale of 10(-4) s ions close to the limit can undergo either Coulomb fission or neutral evaporation. The observed fission pathways exhibit considerable asymmetry in the sizes of the charged fragments, and are associated with kinetic (ejection) energies of ~0.9 eV. Coulomb fission has been modeled using a theory recently formulated to describe how charged particles of dielectric materials interact with one another (Bichoutskaia et al. J. Chem. Phys. 2010, 133, 024105). The calculated electrostatic interaction energy between separating fragments accounts for the observed asymmetric fragmentation and for the magnitudes of the measured ejection energies. The close match between theory and experiment suggests that a significant fraction of excess charge resides on the surfaces of the fragment ions. The experiments provided support for a fundamental step in the electrospray ionization (ESI) mechanism, namely the ejection from droplets of small solvated charge carriers. At the same time, the theory shows how water and acetonitrile may behave slightly differently as ESI solvents. However, the theory also reveals deficiencies in the point-charge image-charge model that has previously been used to quantify Coulomb fission in the electrospray process.

Somatic embryogenesis and in-vitro regeneration of rice (Oryza sativa L.) cultivars under one-step and multiple-step salinity stresses

DEFF Research Database (Denmark)

Khattak, Mohammad S. K.; Abiri, Rambod; Valdiani, Alireza

2017-01-01

The present study aimed to examine the effect of one-step and multiple-step salinity stress on the somatic embryogenesis of rice cultivars within the solid and liquid (cell suspension) culture media conditions. Five rice cultivars, including Puteh Perak, Mahsuri, Basmati-370, Nona Bokra and Khari......, and significant morphological changes were observed. In contrast, the multiple-step NaCl treatment of the calli and cell suspensions led to higher growth of the cultures in the presence of NaCl compared to the controls. The solid MS media, containing 3 μM IAA and 40 μM Kinetin performed as the best media...

Intra-operative 3D imaging system for robot-assisted fracture manipulation.

Science.gov (United States)

Dagnino, G; Georgilas, I; Tarassoli, P; Atkins, R; Dogramadzi, S

2015-01-01

Reduction is a crucial step in the treatment of broken bones. Achieving precise anatomical alignment of bone fragments is essential for a good fast healing process. Percutaneous techniques are associated with faster recovery time and lower infection risk. However, deducing intra-operatively the desired reduction position is quite challenging due to the currently available technology. The 2D nature of this technology (i.e. the image intensifier) doesn't provide enough information to the surgeon regarding the fracture alignment and rotation, which is actually a three-dimensional problem. This paper describes the design and development of a 3D imaging system for the intra-operative virtual reduction of joint fractures. The proposed imaging system is able to receive and segment CT scan data of the fracture, to generate the 3D models of the bone fragments, and display them on a GUI. A commercial optical tracker was included into the system to track the actual pose of the bone fragments in the physical space, and generate the corresponding pose relations in the virtual environment of the imaging system. The surgeon virtually reduces the fracture in the 3D virtual environment, and a robotic manipulator connected to the fracture through an orthopedic pin executes the physical reductions accordingly. The system is here evaluated through fracture reduction experiments, demonstrating a reduction accuracy of 1.04 ± 0.69 mm (translational RMSE) and 0.89 ± 0.71 ° (rotational RMSE).

Embedded Fragments from U.S. Military Personnel—Chemical Analysis and Potential Health Implications

Directory of Open Access Journals (Sweden)

José A. Centeno

2014-01-01

Full Text Available Background: The majority of modern war wounds are characterized by high-energy blast injuries containing a wide range of retained foreign materials of a metallic or composite nature. Health effects of retained fragments range from local or systemic toxicities to foreign body reactions or malignancies, and dependent on the chemical composition and corrosiveness of the fragments in vivo. Information obtained by chemical analysis of excised fragments can be used to guide clinical decisions regarding the need for fragment removal, to develop therapeutic interventions, and to better anticipate future medical problems from retained fragment related injuries. In response to this need, a new U.S Department of Defense (DoD directive has been issued requiring characterization of all removed fragments to provide a database of fragment types occurring in combat injuries. Objectives: The objective of this study is to determine the chemical composition of retained embedded fragments removed from injured military personnel, and to relate results to histological findings in tissue adjacent to fragment material. Methods: We describe an approach for the chemical analysis and characterization of retained fragments and adjacent tissues, and include case examples describing fragments containing depleted uranium (DU, tungsten (W, lead (Pb, and non-metal foreign bodies composed of natural and composite materials. Fragments obtained from four patients with penetrating blast wounds to the limbs were studied employing a wide range of chemical and microscopy techniques. Available adjacent tissues from three of the cases were histologically, microscopically, and chemically examined. The physical and compositional properties of the removed foreign material surfaces were examined with energy dispersive x-ray fluorescence spectrometry (EDXRF, scanning electron microscopy (SEM, laser ablation inductively-coupled plasma mass-spectrometry (LA-ICP-MS, and confocal laser Raman

The dual role of fragments in fragment-assembly methods for de novo protein structure prediction

Science.gov (United States)

Handl, Julia; Knowles, Joshua; Vernon, Robert; Baker, David; Lovell, Simon C.

2013-01-01

In fragment-assembly techniques for protein structure prediction, models of protein structure are assembled from fragments of known protein structures. This process is typically guided by a knowledge-based energy function and uses a heuristic optimization method. The fragments play two important roles in this process: they define the set of structural parameters available, and they also assume the role of the main variation operators that are used by the optimiser. Previous analysis has typically focused on the first of these roles. In particular, the relationship between local amino acid sequence and local protein structure has been studied by a range of authors. The correlation between the two has been shown to vary with the window length considered, and the results of these analyses have informed directly the choice of fragment length in state-of-the-art prediction techniques. Here, we focus on the second role of fragments and aim to determine the effect of fragment length from an optimization perspective. We use theoretical analyses to reveal how the size and structure of the search space changes as a function of insertion length. Furthermore, empirical analyses are used to explore additional ways in which the size of the fragment insertion influences the search both in a simulation model and for the fragment-assembly technique, Rosetta. PMID:22095594

Models of fragmentation with composite power laws

Science.gov (United States)

Tavassoli, Z.; Rodgers, G. J.

1999-06-01

Some models for binary fragmentation are introduced in which a time dependent transition size produces two regions of fragment sizes above and below the transition size. In the first model we assume a fixed rate of fragmentation for the largest fragment and two different rates of fragmentation in the two regions of sizes above and below the transition size. The model is solved exactly in the long time limit to reveal stable time-invariant solutions for the fragment size and mass distributions. These solutions exhibit composite power law behaviours; power laws with two different exponents for fragments in smaller and larger regions. A special case of the model with no fragmentation in the smaller size region is also examined. Another model is also introduced which have three regions of fragment sizes with different rates of fragmentation. The similarities between the stable distributions in our models and composite power law distributions from experimental work on shock fragmentation of long thin glass rods and thick clay plates are discussed.

Kinetics of fragmentation-annihilation processes

OpenAIRE

Filipe, JAN; Rodgers, GJ

1996-01-01

We investigate the kinetics of systems in which particles of one species undergo binary fragmentation and pair annihilation. In the latter, nonlinear process, fragments react at collision to produce an inert species, causing loss of mass. We analyze these systems in the reaction-limited regime by solving a continuous model within the mean-field approximation. The rate of fragmentation for a particle of mass x to break into fragments of masses y and x-y has the form x(lambda-1) (lambda > 0), a...

Fission fragment spins and spectroscopy

International Nuclear Information System (INIS)

Durell, J.L.

1988-01-01

Prompt γ-ray coincidence experiments have been carried out on γ-rays emitted from post-neutron emission fission fragments produced by the aup 19F + 197 Au and 18 O + 232 Th reactions. Decay schemes have been established for even-even nuclei ranging from 78 Se to 148 Nd. Many new states with spin up to ∼ 12h have been observed. Apart from providing a wealth of new information on the spectroscopy of neutron-rich nuclei, the data have been analyzed to determine the average spin of primary fission fragments as a function of fragment mass. The results suggest that the fragment spins are determined by the temperature and shape of the primary fragments at or near to scission

Topology of White Stars in Relativistic Fragmentation of Light Nuclei

CERN Document Server

Andreeva, N P; Vokal, S; Vokalova, A; Gaitinov, A Sh; Gerassimov, S G; Goncharova, L A; Dronov, V A; Zarubin, P I; Zarubina, I G; Kovalenko, A D; Kravchakova, A; Larionova, V G; Levitskaja, O V; Lepehin, F G; Malakhov, A I; Moiseenko, A A; Orlova, G I; Peresadko, N G; Polukhina, N G; Rukojatkin, P A; Rusakova, V V; Salmanova, N A; Sarkisian, V R; Simonov, B B; Stan, E; Stanoeva, R; Chernyavsky, M M; Haidue, M; Kharlamov, S P; Tsakov, I; Shchedrina, T V

2004-01-01

In the present paper, experimental observation of the multifragmentation processes of light relativistic nuclei carried out by means of emulsions are reviewed. Events of the type of "white stars" in which the dissociation of relativistic nuclei is not accompanied by the production of mesons and the target-nucleus fragments are considered. A distinctive feature of the charge topology in the dissociation of the Ne, Mg, Si and S nuclei is an almost total suppression of the binary splitting of nuclei to fragments with charges higher than 2. The growth of the nuclear fragmentation degree is revealed in an increase in the multiplicity of singly and doubly charged fragments with decreasing charge of the main non-excited part of the fragmenting nucleus. The processes of dissociation of stable Li, Be, B, C, N, and O isotopes to charged fragments were used to study special features of the formation of systems consisting of the lightest nuclei - alpha, d and t. Clustering of the 3He nucleus can be detected in "white sta...

Femtosecond laser pulses for fast 3-D surface profilometry of microelectronic step-structures.

Science.gov (United States)

Joo, Woo-Deok; Kim, Seungman; Park, Jiyong; Lee, Keunwoo; Lee, Joohyung; Kim, Seungchul; Kim, Young-Jin; Kim, Seung-Woo

2013-07-01

Fast, precise 3-D measurement of discontinuous step-structures fabricated on microelectronic products is essential for quality assurance of semiconductor chips, flat panel displays, and photovoltaic cells. Optical surface profilers of low-coherence interferometry have long been used for the purpose, but the vertical scanning range and speed are limited by the micro-actuators available today. Besides, the lateral field-of-view extendable for a single measurement is restricted by the low spatial coherence of broadband light sources. Here, we cope with the limitations of the conventional low-coherence interferometer by exploiting unique characteristics of femtosecond laser pulses, i.e., low temporal but high spatial coherence. By scanning the pulse repetition rate with direct reference to the Rb atomic clock, step heights of ~69.6 μm are determined with a repeatability of 10.3 nm. The spatial coherence of femtosecond pulses provides a large field-of-view with superior visibility, allowing for a high volume measurement rate of ~24,000 mm3/s.

Experimental determination of fragment excitation energies in multifragmentation events

Energy Technology Data Exchange (ETDEWEB)

Marie, N.; Natowitz, J.B. [Texas A and M Univ., College Station, TX (United States). Cyclotron Inst.; Chbihi, A.; Le Fevre, A.; Salou, S.; Wieleczko, J.P.; Gingras, L.; Auger, G. [Grand Accelerateur National d`Ions Lourds, 14 - Caen (France); Assenard, M. [Nantes Univ., 44 (France); Bacri, Ch.O. [Centre National de la Recherche Scientifique, CNRS, 91 - Orsay (France)] [and others

1998-03-17

For 50 MeV/nucleon {sup 129}Xe + {sup nat}Sn multifragmentation events, by means of correlation techniques, the multiplicities of the hydrogen and helium isotopes which were emitted by the hot primary excited fragments produced at the stage of the disassembly of an equilibrated hot source are determined. The relative kinetic energy distributions between the primary clusters and the light charged particles that they evaporate are also derived. From the comparison between the secondary multiplicities observed experimentally and the multiplicities predicted by the GEMINI model, it is concluded that the source breaks into primary fragments which are characterized by the same N/Z ratio as the combined system. Knowing the secondary light charged particle multiplicities and kinetic energies, the average charges of the hot fragments and are reconstructed their mean excitation energies are estimated. The fragment excitation energies are equal to 3.0 MeV/nucleon for the full range of intermediate mass fragment atomic number. This global constancy indicates that, on the average, thermodynamical equilibrium was achieved at the disassembly stage of the source. (author) 25 refs.