Drew Goodman, Earthbound Farm

OpenAIRE

Rabkin, Sarah

2010-01-01

Drew Goodman is CEO and co-founder, with his wife, Myra, of Earthbound Farm, based in San Juan Bautista, California. Two years after its 1984 inception on 2.5 Carmel Valley acres, Earthbound became the first successful purveyor of pre-washed salads bagged for retail sale. The company now produces more than 100 varieties of certified organic salads, fruits, and vegetables on a total of about 33,000 acres, with individual farms ranging from five to 680 acres in California, Arizona, Washington, ...

Moral Heroes Look Up and to the Right.

Science.gov (United States)

Frimer, Jeremy A; Sinclair, Lisa

2016-03-01

Portraits of moral heroes often portray the hero gazing up and to the viewer's right in part because ideologically minded followers select and propagate these images of their leaders. Study 1 found that the gaze direction of portraits of moral heroes (e.g., Martin Luther King, Jr.) tend to show the hero looking up-and-right more often than chance would predict, and more often than portraits of celebrities (e.g., Elvis Presley) do. In Studies 2 and 3, we asked participants to play the role of an ideologically motivated follower, and select an image of their leader to promote the cause. Participants preferentially selected the up-and-right version. In Study 4, we found that conceptual metaphors linking directionality to personal virtues of warmth, pride, and future-mindedness helped explain why the up-and-right posture looks most heroic. Followers play an active role in advancing social causes by portraying their leaders as moral heroes. © 2016 by the Society for Personality and Social Psychology, Inc.

Heroes as a Context for Teaching Ethics.

Science.gov (United States)

Apostolou, Barbara; Apostolou, Nicholas

1997-01-01

Heroes may be proxies for an individual's value system. An accounting course attempts to make ethics more salient by having students identify a personal hero who serves as a model for ethical behavior. Active learning and critical thinking are also engaged. (SK)

A selection of Slovenian literary heroes for the preschool period

OpenAIRE

Dolinar, Ana

2014-01-01

In preschools, Slovenian literary heroes are being displaced by foreign fantastic heroes that impress children via cartoons, magazines and video games. Slovenian heroes are an important part of our culture and can act as companions of sorts within citizenship education of youngsters. This thesis should serve as a promotion of Slovenian literary heroes for children of all ages, beginning with the preschool period. The thesis defines the selection criterion of characters; it introduces their st...

Hero Award

Centers for Disease Control (CDC) Podcasts

2009-10-07

This podcast is a lecture given by William H. Foege, MD, MPH when he was honored October 7, 2009 as the 2009 CDC Foundation Hero Award Recipient.  Created: 10/7/2009 by Centers for Disease Control and Prevention (CDC).   Date Released: 10/22/2009.

Cosmogynesis: The female hero in Tanith Lee’s The winter players

Directory of Open Access Journals (Sweden)

Eileen Donaldson

2017-11-01

Full Text Available The mass appearance of female heroes in popular culture in recent decades may encourage the opinion that the female hero has achieved the same credibility as her male counterpart. This article demonstrates, however, that she continues to generate ambivalence and that the primary reservation of most scholars is that a female hero either cannot or should not perform the masculinity of the archetype. Scholarly arguments tend towards two positions: that a female hero is an oxymoron; or that she should be limited to battles on behalf of women in which she champions feminine characteristics and challenges the belief that femininity is not heroic. Neither of these positions take archetypal heroism into account. Advocating a return to Jungian archetypal theory, I argue that the masculinity of the archetype may be as successfully performed by a female hero as by a male hero. Once this premise is accepted, the female hero should be expected to undergo the same trials and perform the same function as a male hero, in short, she should navigate the heroic monomyth outlined by Joseph Campbell. I illustrate this point through a literary analysis of Tanith Lee’s 1976 fantasy novella The winter players.

Transforming impostors into heroes. Metaphors for innovative nursing education.

Science.gov (United States)

Heinrich, K T

1997-01-01

Nurses negotiating professional transitions, whether they are entering an academic program or assuming a new role in the workplace, often feel like impostors. The metaphor of the hero can serve as an "antidote" to the impostor syndrome. The author describes an educational experience shaped around the impostor and hero metaphors that integrates feminist process with expressive methods to transform nurses' perceptions of themselves from impostors into heroes.

The Byronic Hero: Emergence, Issues and Definition of his Progenies

OpenAIRE

Pop Zarieva, Natalija; Iliev, Krste

2016-01-01

Abstract The focus of this paper is the work of Lord Gordon Byron, specifically the creation of idea of the Byronic hero. This paper aims at defining the idea of the Byronic hero that has been created from the period Byron created his heroes and continues to be shaped in history by literary critics till today. Although the majority of literary scholars agree upon the fact that the first literary Byronic hero was Byron's Childe Harold, the protagonist of Byron's epic poem Childe Harold's Pi...

78 FR 48315 - Safety Zone; North Hero Air Show; North Hero, VT

Science.gov (United States)

2013-08-08

... FR Federal Register NPRM Notice of Proposed Rulemaking A. Regulatory History and Information The... During this air show there will be low flying planes conducting aerobatic maneuvers east of North Hero...

Guitar hero: From icon of popular culture to nostalgic self-design

Directory of Open Access Journals (Sweden)

Popadić Milan

2013-01-01

Full Text Available This paper aims to interpret the transformations of the “guitar hero”, from the icon of popular culture to models of nostalgic selfdesign, meaning transformations from generally recognizable figure in the context of popular culture to mimetic patterns based in medium of contemporary technologies. The phrase “guitar hero”, in its basic meaning represents a specific phenomenon in popular culture and popular music of the second half of the twentieth century. Guitar hero is a performer with skills and appearance that transcends and transforms common patterns of guitar performances, thus creating a new and distinctive form of musical and performative statement. Seen in this way, a guitar hero is close to heroic models of antique and romanticism. On the other hand, contemporary products of cultural industries and the entertainment industry to some extent changed this basic meaning of the phrase “guitar hero”. Creation and popularization of video games like Guitar Hero or Rock Band, as well as the availability of high quality replicas of instruments of “original” guitar heroes, carried the meaning of this phrase more explicit in the field of consumerism, fetishism, and virtualization. Guitar hero in its basic meaning undoubtedly belongs to the history of the twentieth century popular culture. However, his legacy is still very much present. Specific heritage of a guitar hero in contemporary popular culture lies primarily in the dissemination of the original model through the mechanisms of consumer society, and then in the mimetic patterns based in media of contemporary technology. Thanks to these characteristics, the phenomenon of guitar hero was transformed from icon of popular culture to nostalgic self-design over the original model. Whether it is a replica of instruments of guitar hero or empathy in virtual reality of video games as Guitar Hero or Rock Band, guitar hero heritage confirms its place in modern popular culture, despite

Representasi Hero Perempuan Dalam Game Dota 2

OpenAIRE

Handoko, Sofyan; Yuwono, Elisabeth Christine; Mardiono, Bambang

2016-01-01

Dota 2 merupakan video game yang sedang berkembang di Indonesia, adalah game yang mempertarungkan pemain-pemain yang terbagi kedalam dua tim yang berbeda. Dota 2 memperlihatkan bahwa meskipun game bertema perang, terdapat karakter-karakter yang biasa disebut hero, terdapat sosok perempuan pada game Dota 2. Studi dilakukan untuk melihat apakah hero perempuan dalam game Dota 2 telah direpresentasikan sesuai dengan atribut mereka masing-masing (Strength, Agility, dan Intellegence) dan melihat ma...

Qualitative Research as a Hero's Journey: Six Archetypes to Draw on

Science.gov (United States)

Villate, Vanessa M.

2012-01-01

Is the research process similar to a hero's journey? Just as a hero draws on different archetypes during the journey, a researcher moves through phases and must draw upon different strengths. In this article, the six archetypes that Pearson (1998) links to the hero's journey are described. Then, each phase of a qualitative research study is…

Using Heroes as Role Models in Values Education: A Comparison between Social Studies Textbooks and Prospective Teachers' Choice of Hero or Heroines

Science.gov (United States)

Yazici, Sedat; Aslan, Mecnun

2011-01-01

This study explores the relationships between the frequency and identities of heroes as role models used in the social studies textbooks in teaching 20 core values and prospective teachers' preferences of heroes. The findings indicated that there are striking similarities and differences between these two variables. For gender variable, 97.4% of…

Using Stories about Heroes To Teach Values. ERIC Digest.

Science.gov (United States)

Sanchez, Tony R.

This digest discusses a method of teaching values by using the lives of heroes as examples. The trend for teaching values is to offer methods of analysis and judgment that lead to answers about right and wrong, better and worse concerning personal behavior and common good. Stories about heroes have been identified as the means of teaching and…

Who Are Our Heroes? A Critical-Thinking, Consciousness-Raising Lesson.

Science.gov (United States)

Reissman, Rose

1994-01-01

When teachers discuss different types of heroes in the classroom, they allow their students to meet powerful new role models. The article discusses how teachers can get students thinking about what makes a hero and in the process, teach them about historical figures, social issues, and current events. (SM)

‘But when I tell them about heroes, then they listen’

DEFF Research Database (Denmark)

Frisk, Kristian

2017-01-01

This paper explores the rise of the soldier hero in Denmark. From the analysis of Prime Ministers’ New Year addresses between 1940–2015, it is evident that the heroification of Danish soldiers has been linked to the elevation of professionalism, self-motivation, individual responsibility, and glo...... international interdependency. On this basis, the paper seeks to contribute to the literature on the social construction of heroes within a theoretical perspective that takes the dynamic relations between states into account, and to explain why specific notions of a hero develop....

The characteristic features which are common for heroes in works by I. malik-zade and for heroes in stories by V. Shukshin

OpenAIRE

Guseynova, L.

2010-01-01

The author tries to identify V. Shukshin and Azerbaijani writer's reference points during creation of the concept of character in article The characteristic features which are common for heroes in works by I. Malik-zade and for heroes in stories by V. Shukshin. In this way present article can be considered as an original breakthrough, the first a swallow in enlightening of works by Shukshin and the representative of the national literature.

THE HUNGER GAMES: REPRESENTING THE NEW IMAGE OF AMERICAN POPULAR HEROES

Directory of Open Access Journals (Sweden)

Aidatul Chusna

2016-02-01

Full Text Available This research is aimed at revealing the new image of American popular heroes as depicted in the novel adaptation film of The Hunger Games which is created as a trilogy, which consists of two more novels: Catching Fire and Mockingjay. This film is one of the most phenomenal films in 2013-2104, which grossed out up to $407,999,255. This research used textual approach, which focused on the text as the object, that is The Hunger Games film. The result shows that The Hunger Games essentially brings the issue of slavery back into scrutiny. However, the creation of the heroin in the film is granted as the reconstruction of popular heroes in America. She is an inspiring female hero which is exemplified as the appreciation of womens values. Yet, the heroin is broadly defined with the qualities of rouge heroes as the characteristics are the representation of the belief and values associated with freedom to wash away the oppression restore the rights of the minority. In addition to the issue of slavery , the symbols of new hope and new spirit are implicitly emerged in the story. This attempt was proficiently done by the heroin, which was eventually created as the new image of the American heroes.

Origins Space Telescope: HEterodyne Receiver for OST (HERO)

Science.gov (United States)

Bergin, Edwin; Wiedner, Martina; Laurens, Andre; Gerin, Maryvonne; HERO team, Origins Space Telescope Science and Technology Definition Team

2018-01-01

The Origins Space Telescope (OST) is a mission concept for the Far-Infrared Surveyor, one of the four science and technology definition studies selected by NASA HQ for the 2020 Astronomy and Astrophysics Decadal survey. The OST study will encompass two mission concepts (poster by A. Cooray). Concept 1 is an extremely versatile observatory with 5 science instruments, of which the HEterodyne Receivers for OST (HERO) is one.HERO’s main targets are high spectral resolution observations (Dl/l up to 107 or Dv = 0.03km/s) of water to follow its trail from cores to YSOs as well as H2O and HDO observations on comets to explore the origins of water. HERO will probe all neutral ISM phases using cooling lines ([CII], [OI]) and hydrides as probes of CO-dark H2 (CH, HF). HERO will reveal how molecular clouds and filaments form in the local ISM up to nearby galaxies. HERO will enable detailed understanding of feedback mechanisms : shocks, cosmic rays, UV induced feedback and will provide a map of the cosmic ray ionization rate in the Galaxy and nearby galaxies using molecular ions (ArH+, OH+, H3O+).In order to achieve these observational goals, HERO will cover an extremely wide frequency range from 468 to 2700 GHz (641 to 111microns) and a window around the OI line at 4563 to 4752GHz (66 to 63 microns). It will consist of very large focal plane arrays of 128 pixels between 900 - 2700 GHz and at 4.7 THz, and 32 pixels for the 468 to 900 GHz range. The instrument is exploiting Herschel/HIFI heritage, but will go well beyond HIFIs capacities. HERO’s large arrays require low dissipation and low power components. The HERO concept makes use of the latest cryogenic SiGe amplifier technology, as well as CMOS technology for the backends with 2 orders of magnitude lower power. Advances in Local Oscillator technology have also been taken into account and ambitious, but realistic assumptions have been made for future amplifier multiplier chains going up to 4.7 THz.Origins will enable

Competition between the phytophagous stink bugs Euschistus heros and Piezodorus guildinii in soybeans.

Science.gov (United States)

Tuelher, Edmar S; Silva, Éder H; Hirose, Edson; Guedes, Raul Narciso C; Oliveira, Eugênio E

2016-10-01

The abundance and contribution of the neotropical brown stink bug, Euschistus heros (F.), and the redbanded stink bug, Piezodorus guildinii (West.), to the composition of insect pests of soybean, Glycine max (L.), fields have changed both spatially and temporally in neotropical soybean production areas. Therefore, we assessed the competitiveness of each species in direct competition experiments following an additive series. We performed mixed (adult) insect infestations in soybean plants and evaluated the fitness of each species and the soybean yield. While the competitive ability of E. heros was significantly compromised by increments in conspecifics and heterospecifics (i.e. P. guildinii), the competitive ability of P. guildinii was compromised by the presence of heterospecifics (i.e. E. heros). The reproductive output of P. guildinii remained unaffected by increments in E. heros or of P. guildinii. Intriguingly, despite the fact that P. guildinii apparently lost the competition with E. heros, almost no pod production was observed in any plant colonised by the former. The higher abundance of E. heros in neotropical soybean fields seems to result from higher competitive ability than its heterospecific competitor P. guildinii, which may prevent the higher losses caused by P. guildinii. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Archive of Geosample Data and Information from the Ohio State University Byrd Polar and Climate Research Center (BPCRC) Sediment Core Repository

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — The Byrd Polar and Climate Research Center (BPCRC) Sediment Core Repository operated by the Ohio State University is a partner in the Index to Marine and Lacustrine...

NHS trust chief executives as heroes?

Science.gov (United States)

Learmonth, M

2001-01-01

This paper presents a reading of the transcripts of interviews with NHS Trust Chief Executives. Using a poststructuralist understanding of the interviews, it privileges a reading that (ironically) represents these Chief Executives as heroes. Following the classic hero story line, they leave the civilized order of home and journey into a threatening wilderness where they encounter dangerous and magical things but overcome them all because of their masculine characteristics such as rationality, strength and resourcefulness. One way in which these stories can be understood to have significance is that they (misleadingly but powerfully) portray management as obvious and necessary by evocatively drawing on a myth of ancient origin. The piece concludes with some reflections on the ontological implications of the analysis and reflexive comments on the production of truth as a problem.

Tommy Wilhelm: The Untraditional Hero of Saul Bellow’s Seize the Day

Directory of Open Access Journals (Sweden)

Md Abu Shahid Abdullah

2015-10-01

Full Text Available Many critics have judged Tommy Wilhelm in terms of his weaknesses only and have considered him a complete failure, far from being a hero. But many of them have failed to see the bright side of Tommy’s character. He possesses rare human qualities completely alien to the citizens of a morally corrupt society. The article aims to  prove that in spite of possessing various negative and unheroic qualities, Tommy, by defying social structure and network, asserts his non-conformity which, along with his humanity, love and philanthropy, aversion for power and material success and most importantly, his power of overcoming humiliation, secures him the position of a hero although an untraditional one. The narrative structure also plays a significant role behind his being a hero. Keywords: Materialism, Untraditional hero, Humanity, Non-conformity

The hero concept: self, family, and friends who are brave, honest, and hopeful.

Science.gov (United States)

Staats, Sara; Wallace, Heidi; Anderson, Tara; Gresley, Jamee; Hupp, Julie M; Weiss, Elizabeth

2009-06-01

The concept of the hero is pervasive and enduring, extending across time, culture, and age. Although an influential schema, the hero has not been empirically examined in depth. Heroic exemplars given by students and community members were examined, and the hypotheses that individuals with high Heroism scores are more hopeful and report higher Coping than individuals with low Heroism scores were also tested. Participants reported similar depictions of heroes and heroic acts; the prototypic hero being a family member, and the most common act exemplified as averting physical harm to others. Quantitative results suggest that individuals high on Heroism scores are more hopeful and cope better than individuals low on Heroism scores. Results indicate that heroism is experienced in everyday life, and a model is proposed.

Surgical video recording with a modified GoPro Hero 4 camera.

Science.gov (United States)

Lin, Lily Koo

2016-01-01

Surgical videography can provide analytical self-examination for the surgeon, teaching opportunities for trainees, and allow for surgical case presentations. This study examined if a modified GoPro Hero 4 camera with a 25 mm lens could prove to be a cost-effective method of surgical videography with enough detail for oculoplastic and strabismus surgery. The stock lens mount and lens were removed from a GoPro Hero 4 camera, and was refitted with a Peau Productions SuperMount and 25 mm lens. The modified GoPro Hero 4 camera was then fixed to an overhead surgical light. Camera settings were set to 1080p video resolution. The 25 mm lens allowed for nine times the magnification as the GoPro stock lens. There was no noticeable video distortion. The entire cost was less than 600 USD. The adapted GoPro Hero 4 with a 25 mm lens allows for high-definition, cost-effective, portable video capture of oculoplastic and strabismus surgery. The 25 mm lens allows for detailed videography that can enhance surgical teaching and self-examination.

78 FR 78998 - 60-Day Notice of Proposed Information Collection: HUD Environmental Review Online System (HEROS)

Science.gov (United States)

2013-12-27

... Information Collection: HUD Environmental Review Online System (HEROS) AGENCY: Office of Community Planning... Information Collection Title of Information Collection: HUD Environmental Review Online System (HEROS). OMB... online tool called the HUD Environmental Review Online System (HEROS), which will allow users to complete...

From Tragedy to Triumph: Counselor as Companion on the Hero's Journey.

Science.gov (United States)

Halstead, Richard W.

2000-01-01

A counselor discusses his experiences while working with a male client on a "hero's journey," or the path to self-realization. The author explains how he grappled with what his role, as counselor, should be in this process. He concludes that he should act as the "hero's travel guide," someone who makes the clients' path shorter, smoother, or less…

Evaluasi Customer Relationship Management pada Supermarket Hero di Jakarta Timur

Directory of Open Access Journals (Sweden)

S. Liawatimena

2002-09-01

Full Text Available The growing of many big retailer make Hero Supermarket must obtaining it’s existance in retail business. Therefore, Hero Supermarket must form CRM (Customer Relationship Management in order to increase a new customer, increase profit and maintaining customer, and pay attention to valuable customer. Data analysis done by searching procentage from many questions and cartesius diagram. The conclusion, the highest suitable level there are 98,27%  of quality product and the lowest is the price of merchandise, which is 45,35%. Some atribute are over the customers hope, that is good shopping place image, completeness, the comfortable and easyness in shopping, and safetyness. There are five most important atribut, that is the price, quality, completeness, the comfortable and easyness in shopping, and parking space. Those atribute will determine wether the customer of Hero Supermarket will be loyal or not.

The Cult of the Romantic Hero: Literature and Memorials

Directory of Open Access Journals (Sweden)

Jesús Ángel Sánchez-García

2015-09-01

Full Text Available : In the West the cult of the remains and relics of heroes is a tradition that can essentially be traced back to Ancient Greece. Nevertheless, when analyzing the re-emergence of the hero cult during a period as decisive in modern European history as the nineteenth century we should not restrict ourselves to the study of ancient tombs and memorials as archaeological artefacts alone. This paper will thus approach the cult of the Romantic hero from the perspective of cultural history, drawing on the literature and art inspired by historical figures that were the object of this new veneration. Taking Pierre Nora’s characterization of places of memory or lieux de mémoire as a starting point, this paper will reveal some of the links, from the literary to the artistic, that were used to encapsulate and project the glorification of Romantic heroes. An obsession with building tombs and memorials took root in the Romantic age, becoming the most visible manifestation of political strategies designed to convert memory into history. In examining the cases of Horatio Nelson, Antoine de Guillaume-Lagrange, John Moore and Napoleon, this paper underscores the value of focusing on the glorification of the figures being remembered – of their lives and actions – through literature and the first funeral rites, and on the structures and artworks that housed their remains and preserved their memories

Evaluasi Customer Relationship Management pada Supermarket Hero di Jakarta Timur

OpenAIRE

Liawatimena, S; Amanda, M. F; Handoko, Handoko; Hendry, Hendry

2002-01-01

The growing of many big retailer make Hero Supermarket must obtaining it’s existance in retail business. Therefore, Hero Supermarket must form CRM (Customer Relationship Management) in order to increase a new customer, increase profit and maintaining customer, and pay attention to valuable customer. Data analysis done by searching procentage from many questions and cartesius diagram. The conclusion, the highest suitable level there are 98,27%  of quality product and the lowest is the price of...

Oliver: The Rise and Decline of a Hero

Directory of Open Access Journals (Sweden)

Carlos Alvar

2014-12-01

Full Text Available The essential topic of this paper is the literary figure of Oliver, from his first appearances to his gradual disappearance from the texts. Thus, the starting point is the presence of the anthroponym and the discussions about its etymology, given that numerous problems (as well as some explanations affecting Western epic poetry and the relationships established between characters and texts can be related to that origin. It seems that he is a southern hero and as such, figured prominently in several lost chansons de geste, from which late or geographically distant versions survive (such as the Scandinavian versions. Since this hero belongs to the Occitan tradition, linked to the basin of the Rhone, and is alien to French epic tradition, the importance of his role in the Chanson de Roland is surprising, and from there, its preeminence in onomastics and in the lists of the Twelve Peers; however, the place he occupies is not always the same, and he is often set aside. In the Iberian Peninsula, it is not unusual to see how other heroes take the place of Oliver: Bernardo del Carpio and Reinaldos de Montalbán. Our paladin ends up being a mere shadow, a distant memory that is finally forgotten.

Surgical video recording with a modified GoPro Hero 4 camera

Directory of Open Access Journals (Sweden)

Lin LK

2016-01-01

Full Text Available Lily Koo Lin Department of Ophthalmology and Vision Science, University of California, Davis Eye Center, Sacramento, CA, USA Background: Surgical videography can provide analytical self-examination for the surgeon, teaching opportunities for trainees, and allow for surgical case presentations. This study examined if a modified GoPro Hero 4 camera with a 25 mm lens could prove to be a cost-effective method of surgical videography with enough detail for oculoplastic and strabismus surgery. Method: The stock lens mount and lens were removed from a GoPro Hero 4 camera, and was refitted with a Peau Productions SuperMount and 25 mm lens. The modified GoPro Hero 4 camera was then fixed to an overhead surgical light. Results: Camera settings were set to 1080p video resolution. The 25 mm lens allowed for nine times the magnification as the GoPro stock lens. There was no noticeable video distortion. The entire cost was less than 600 USD. Conclusion: The adapted GoPro Hero 4 with a 25 mm lens allows for high-definition, cost-effective, portable video capture of oculoplastic and strabismus surgery. The 25 mm lens allows for detailed videography that can enhance surgical teaching and self-examination. Keywords: teaching, oculoplastic, strabismus

Calibration of the High Energy Replicated Optics to Explore the Sun (HEROES) Hard X-ray Telescope

Science.gov (United States)

Wilson-Hodge, Colleen A.; Gaskin, Jessica; Christe, Steven; Shih, Albert; Tennant, Allyn; Swartz, Doug; Kilaru, Kiranmayee; Elsner, Ron; Kolodziejczak, Jeff; Ramsey, Brian

2014-01-01

On September 21-22, 2013, the High Energy Replicated Optics to Explore the Sun (HEROES) hard X-ray telescope, flew as a balloon payload from Ft. Sumner, N.M. HEROES observed the Sun, the black hole binary GRS 1915+105, and the Crab Nebula during its 27 hour flight. In this paper we describe laboratory calibration measurements of the HEROES detectors using line and continuum sources, applications of these measurements to define channel to energy (gain) corrections for observed events and to define detector response matrices. We characterize the HEROES X-ray grazing incidence optics using measurements taken in the Stray-Light (SLF) Facility in Huntsville, AL, and using ray traces.

Anthony Trollope’s Barsetshire Heroes

Science.gov (United States)

1990-01-01

tapped the rich lode of Greek mythology and the epic heroes to obtain sources for poems, essays, and stories. In The Heroea, for example, Kingsley’s 1856...and the defiant Prometheus of Greek mythology exhibit the rage and unyielding independence that attracted the later Romantic poets. In Shelley’s

Debating fabrication: 'Syrian Hero Boy' in the virtual public sphere

OpenAIRE

Storaas, Ingrid Hovda

2016-01-01

In November 2014, the film “Syrian hero boy” went viral. It depicted a young boy targeted by snipers. He dodges the bullets, and manages to save another child from the scene. After the story was published in newspapers worldwide, however, it became clear that it was a fabrication, shot and directed at a set in Malta. This thesis explores the media coverage of “Syrian hero boy” through a content analysis of 93 articles written about the film in online newspapers, asking how this coverage fit w...

The Archaeology of Heroes: Carlyle, Foucault and the Pedagogy of Interdisciplinary Narrative Discourse

Science.gov (United States)

Campbell, Louise

2017-01-01

This paper argues in favour of the beneficial currency of Thomas Carlyle's "On Heroes, Hero-worship and the Heroic in History" in three ways, each of which finds the basis of its critique in aspects of Foucault's theories of discursive practice, as explored in Foucault's theories of historical discourse; 1) that Carlyle's terminology…

Archive of information about geological samples available for research from the Ohio State University Byrd Polar and Climate Research Center (BPCRC) Polar Rock Repository

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — The Polar Rock Repository (PRR) operated by the Byrd Polar and Climate Research Center (BPCRC) at the Ohio State University is a partner in the Index to Marine and...

Landscape and Social Values in Popular Children's Literature: Nancy Drew Mysteries.

Science.gov (United States)

Brooker-Gross, Susan R.

1981-01-01

Examines the covert lessons in moral social geography found in a set of popular juvenile fiction published between 1924 and 1978--the Nancy Drew mystery stories. Topics discussed include landscape symbolism, urban environments, uses of geographical elements in the stories, rural settings, wilderness settings, social stereotypes, and landscape…

GoPro Hero Cameras for Creation of a Three-Dimensional, Educational, Neurointerventional Video.

Science.gov (United States)

Park, Min S; Brock, Andrea; Mortimer, Vance; Taussky, Philipp; Couldwell, William T; Quigley, Edward

2017-10-01

Neurointerventional education relies on an apprenticeship model, with the trainee observing and participating in procedures with the guidance of a mentor. While educational videos are becoming prevalent in surgical cases, there is a dearth of comparable educational material for trainees in neurointerventional programs. We sought to create a high-quality, three-dimensional video of a routine diagnostic cerebral angiogram for use as an educational tool. A diagnostic cerebral angiogram was recorded using two GoPro HERO 3+ cameras with the Dual HERO System to capture the proceduralist's hands during the case. This video was edited with recordings from the video monitors to create a real-time three-dimensional video of both the actions of the neurointerventionalist and the resulting wire/catheter movements. The final edited video, in either two or three dimensions, can serve as another instructional tool for the training of residents and/or fellows. Additional videos can be created in a similar fashion of more complicated neurointerventional cases. The GoPro HERO 3+ camera and Dual HERO System can be used to create educational videos of neurointerventional procedures.

Gender Differences in Adolescents' Choice of Heroes and Admired Adults in Five Countries

Science.gov (United States)

Estrada, Juan Diego; García-Ael, Cristina; Martorell, José Luis

2015-01-01

Seven hundred and sixty-eight adolescents from five countries and regions (USA, Spain, Hong Kong, Qatar, and Malaysia), aged 13-19 (M?=?15.78; SD?=?1.28) years, responded to a questionnaire designed to determine who was their most admired famous adult or hero. Male heroes clearly outnumbered admired females (73.3% vs. 26.7%). There was a pattern…

Romantic Democracy, Ronald Reagan, and Presidential Heroes.

Science.gov (United States)

Fisher, Walter R.

1982-01-01

This practical criticism is written for communication scholars who seek further understanding of significant communication events. Believing that a romantic strain exists in American history/politics, this essay suggests characteristics of presidential heroes, relates Ronald Reagan's rhetoric to the romantic tradition, and compares his rhetoric…

News Reports about Health: Between Heroes and Plagues

Directory of Open Access Journals (Sweden)

Acianela Montes de Oca

2013-12-01

Full Text Available This research characterizes news reports published in the health sections of two newspapers, El Nacional and El Universal, from 1996 to 2006 from the perspective of the myths. Mytheme analysis and rhetorical figures show that myths more frecuently used were The Hero, The Progress, The Plague and Panacea. From the analysis we concluded that the texts of the health sections of analyzed newspapers show a dangerous world (stalked by The Plague that only the Hero (the doctor can face. Science, technology, modernity, health, The Progress, Panacea, seem a gift rather than a human conquest. If we accept the premise that the myths act unify social representations and introduce a single meaning to the future, these stories express a look of helplessness and uncertainty in illness and risk.

Performance Characteristics of Hero's Turbine Using Hot Water as a Working Fluid

OpenAIRE

FUJII, Terushige; OHTA, Jun-ichi; AKAGAWA, Koji; NAKAMURA, Toshi; ASANO, Hitoshi

1992-01-01

From the viewpoint of energy conservation and the development of new energy resources,it is important to utilize geothermal resources and waste heat from factories. Among energy conversion device,there is a radial outflow reaction turbine,i.e.,Hero's turbine. Performance characteristics of Hero's turbine are analytically and experimentally clarified for flashing expansion of initially subcooled hot water. It is found that: (a)there is an optimum number of revolutions at which maximum tubine e...

Cost analysis of the Hemodialysis Reliable Outflow (HeRO) Graft compared to the tunneled dialysis catheter.

Science.gov (United States)

Al Shakarchi, Julien; Inston, Nicholas; Jones, Robert G; Maclaine, Grant; Hollinworth, David

2016-04-01

In end-stage renal disease patients with central venous obstruction, who have limited vascular access options, the Hemodialysis Reliable Outflow (HeRO) Graft is a new alternative with a lower incidence of complications and longer effective device life compared to tunneled dialysis catheters (TDCs). We undertook an economic analysis of introducing the HeRO Graft in the UK. A 1-year cost-consequence decision analytic model was developed comparing management with the HeRO Graft to TDCs from the perspective of the National Health Service in England. The model comprises four 3-month cycles during which the vascular access option either remains functional for hemodialysis or fails, patients can experience access-related infection and device thrombosis, and they can also accrue associated costs. Clinical input data were sourced from published studies and unit cost data from National Health Service 2014-15 Reference Costs. In the base case, a 100-patient cohort managed with the HeRO Graft experienced 6 fewer failed devices, 53 fewer access-related infections, and 67 fewer device thromboses compared to patients managed with TDCs. Although the initial device and placement costs for the HeRO Graft are greater than those for TDCs, savings from the lower incidence of device complications and longer effective device patency reduces these costs. Overall net annual costs are £2600 for each HeRO Graft-managed patient compared to TDC-managed patients. If the National Health Service were to reimburse hemodialysis at a uniform rate regardless of the type of vascular access, net 1-year savings of £1200 per patient are estimated for individuals managed with the HeRO Graft. The base case results showed a marginal net positive cost associated with vascular access with the HeRO Graft compared with TDCs for the incremental clinical benefit of reductions in patency failures, device-related thrombosis, and access-related infection events in a patient population with limited options for

Results of a customer-based, post-market surveillance survey of the HeRO access device.

Science.gov (United States)

Fusselman, Maureen

2010-08-01

In order to supplement post-market surveillance data on the HeRO vascular access device, a non-scientific customer survey was conducted to obtain quantitative data from dialysis providers caring for patients implanted with the device. Dialysis nurses involved in the care of HeRO patients were contacted in order to obtain post-implant device performance information for 10% of patients implanted with the device at the time of the survey. Thirty-eight dialysis units with a total of 65 HeRO patients participated in the survey. The total duration of HeRO device use was 348.4 months with an average use of 5.4 months. Thirty-eight of the 65 HeRO patients (58.5%) were reported to not have experienced any performance issues. There were 28 device performance incidents reported for the remaining 27 patients included in the survey. Occlusion was the single most commonly reported device-related performance issue with 18 patients (27.7%) experiencing 25 occlusive episodes. The majority of the patients who had an occlusion (66.7%) only experienced one occlusive event. Infections occurred in 4 patients (6.2%) with an overall infection rate of 0.38 per 1,000 patient days. Post-market clinical experience during the first 18 months of commercialization of the HeRO device were in line with expectations based on the results from initial clinical studies with the device. Device occlusion remains the most commonly reported performance issue with the reported rate in this survey less than that which was reported in earlier published studies with the device.

Tatar Nesrinde Olumlu Kahramanlar Positive Heroes In The Tatar Prose

Directory of Open Access Journals (Sweden)

Ramilya YARULLİNA YILDIRIM

2013-07-01

Full Text Available The discussions on the principles and experiences of creation ofthe hero concept, which is regarded as one of the significant subjects ofall times in the Tatar literature, still continue today. That the subjectsof the hero concept are treated in all issues of Kazan Utları (the KazanLights, a literary journal published in Kazan, is a clear evidence of it.Such ideas as “positive hero”, “exemplary hero”, “our day’s hero”,“masked hero” and “challenging hero” are often encountered in theliterary criticism texts of the recent years. The complicated hero conceptand the positive hero in the literature of recent years, which has beeninfluenced by the freedom movement, does not correspond with thedemands of the perfect hero concepts in the Soviet literature because ofthe enrichment of the former in terms of theme and style, progress ofpsychologism and of prevalence of lyrical and critical works.Nevertheless, some authors, though not in the level of the ideal of life,make efforts to create positive heroes who have a great faculty ofdecency.This paper will concentrate on the principles of the creation of thepositive hero, ideas and experiences of such men of the Tatar literaturein recent years as D. Zahidullina, A. Helim, G. Gıylmanov and F.Beyremova. From the old literature to 1980’s literature will be reviewedand examples of the positive hero are given from the literary works ofthe period. In the Tatar literature in recent years, the characteristics ofthe positive hero have been ascertained in the works of F. Safin, M.Malikova, A. Helim and F. Yarullin, by means of which the worldviewand ideals of the authors are expressed. Tatar Edebiyatının her dönem için önemli konularından sayılan kahraman konsepti yaratma prensipleri ve tecrübeleriyle ilgili tartışmalar bugün de devam etmektedir. Başkentimiz Kazan şehrinde yayımlanan Kazan Utları (Kazan ışıkları edebiyat dergisinin her sayısında kahraman konsepti konular

Performance Characteristics of Hero's Turbine Using Hot Water as a Working Fluid

OpenAIRE

藤井, 照重; 太田, 淳一; 赤川, 浩爾; 中村, 登志; 浅野, 等

1990-01-01

From the view point of energy saving and the development of new energy resources,it is important to utilize geothermal resources and waste heat from factories. As one of the energy conversion expanders,there is a radial outflow reaction turbine(that is,Hero's turbine). Performance characteristics of Hero's turbine using subcooled hot water as a working fluid are clarified analytically and experimentally. It is found that:(a)there is an optimum rotational speed at which maximum turbine efficie...

Use of Brand Heroes in Strategic Reputation Management: The Case of Bacardi, Adidas, and Daimler

NARCIS (Netherlands)

Bücker, J.J.L.E.; Ernste, K.; Erdemir, A.

2018-01-01

The last decade witnessed a renewal of historical approaches towards business management that emphasize the malleability of the past in order to serve the present. This chapter studies the use of heroes when organizations pursue strategic change, which the authors term hero-molding. The aim is to

Video Capture of Plastic Surgery Procedures Using the GoPro HERO 3+

OpenAIRE

Steven Nicholas Graves, MA; Deana Saleh Shenaq, MD; Alexander J. Langerman, MD; David H. Song, MD, MBA

2015-01-01

Background: Significant improvements can be made in recoding surgical procedures, particularly in capturing high-quality video recordings from the surgeons? point of view. This study examined the utility of the GoPro HERO 3+ Black Edition camera for high-definition, point-of-view recordings of plastic and reconstructive surgery. Methods: The GoPro HERO 3+ Black Edition camera was head-mounted on the surgeon and oriented to the surgeon?s perspective using the GoPro App. The camera was used to ...

A lyric hero in Block’s poetry

Directory of Open Access Journals (Sweden)

Hunarikova P. H.

2016-12-01

Full Text Available in the article the way of lyric hero is examined, how he changed from an in love romantic, despairing, losing a faith man, to the bitter fighter for new Russia. The author also points that Alexander Block entered the Russian literature, fiction of mankind, as a brilliant poet of the era.

Mythological hero in Boban Knežević's Black blossom

Directory of Open Access Journals (Sweden)

Jakovljević Mladen M.

2013-01-01

Full Text Available Black Blossom by Boban Knežević demonstrates that mythical structures and features, such as elements of the mythological adventure and mythical hero's traits known from ancient myths, as defined by Joseph Campbell, are still present in contemporary fiction, including Serbian literature, as well as that literary heroes and their adventures, regardless of when and where they have been created, have a lot in common. Such mythical patters and heterochrony in Black Blossom reveal the origins, essential features and mechanisms of the problems and dilemmas rooted in one nation's fictional and real past, as well as in its present.

Host plants of Carambola fruit fly, Bactrocera carambolae Drew & Hancock(Diptera:Tephritidae);and provisional list of suitable host plants of Carambola fruit fly,(Bactrocera(Bactrocera) carambolae Drew & Hancock(Diptera:Tep

Science.gov (United States)

Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae), commonly known as the carambola fruit fly, is native to Southeast Asia, but has extended its geographic range to several countries in South America. As with other tephritid fruit fly species, establishment of B.carambolae in areas where it...

Celebrities and Heroes as Models of Self-Perception

Science.gov (United States)

Szymanski, Gerald G.

1977-01-01

Who are today's models and what difference does it make? A secondary English teacher in Detroit who later became a university teacher examines the hero and the celebrity as seen by his secondary students and teachers and future teachers from 1959-1976. (Author/RK)

Nymphal and adult performance of Euschistus heros (Fabr.) (Hemiptera: Pentatomidae), as a potential alternative host for egg parasitoids multiplication

International Nuclear Information System (INIS)

Peres, Wilsimar A.A.; Correa-Ferreira, Beatriz S.

2001-01-01

This research aimed to evaluate the potential of Euschistus heros (Fabr.) (Hemiptera: Pentatomidae) as host for multiplication of egg parasitoids, by determining the nymphal and adult performance of E. heros from laboratory and the field, comparing with Nezara viridula (L.) (Hemiptera: Pentatomidae), under mass conditions. One hundred eggs of E. heros and N. viridula were placed among the leaves of soybean plants contained in cages (50x50x70 cm) and observation were made until adult emergence. The nymphs fed on soybean pods, dry soybean and peanuts seeds. The number of nymphs that reached adulthood and the development time were calculated. The survivorship and reproduction performance of laboratory and field populations of E. heros and N. viridula were evaluated during 13 weeks in February-May 1999. The number of eggs produced by 100 pairs of stink bugs per cage containing the same diet was recorded. Nymphal development time of E. heros and N. viridula was 33.0 and 34.0 days and 65.0% and 71.3% of nymphs reached adulthood, respectively. Adults of E. heros reared under laboratory conditions produced 2.5 times more eggs (5547.0 eggs/cage) than those collected in the field (2262.7 eggs/cage). The adult field population of E. heros had reduced reproduction and longevity due to parasitism by Hexacladia smithii Ash. (Hymenoptera: Encyrtidae). The N. viridula adults collected in the field produced 1.7 times more eggs (6304.9 eggs/cage) than those reared in the laboratory (3609.2 eggs/cage). E. heros laboratory reared is a promising host for egg parasitoids multiplication when compared with N. viridula collected in the field. (author)

Nymphal and adult performance of Euschistus heros (Fabr.) (Hemiptera: Pentatomidae), as a potential alternative host for egg parasitoids multiplication

Energy Technology Data Exchange (ETDEWEB)

Peres, Wilsimar A.A. [Universidade Federal do Parana, Curitiba, PR (Brazil). Dept. de Zoologia; Correa-Ferreira, Beatriz S. [EMBRAPA, Londrina, PR (Brazil). Centro Nacional de Pesquisa de Soja

2001-12-15

This research aimed to evaluate the potential of Euschistus heros (Fabr.) (Hemiptera: Pentatomidae) as host for multiplication of egg parasitoids, by determining the nymphal and adult performance of E. heros from laboratory and the field, comparing with Nezara viridula (L.) (Hemiptera: Pentatomidae), under mass conditions. One hundred eggs of E. heros and N. viridula were placed among the leaves of soybean plants contained in cages (50x50x70 cm) and observation were made until adult emergence. The nymphs fed on soybean pods, dry soybean and peanuts seeds. The number of nymphs that reached adulthood and the development time were calculated. The survivorship and reproduction performance of laboratory and field populations of E. heros and N. viridula were evaluated during 13 weeks in February-May 1999. The number of eggs produced by 100 pairs of stink bugs per cage containing the same diet was recorded. Nymphal development time of E. heros and N. viridula was 33.0 and 34.0 days and 65.0% and 71.3% of nymphs reached adulthood, respectively. Adults of E. heros reared under laboratory conditions produced 2.5 times more eggs (5547.0 eggs/cage) than those collected in the field (2262.7 eggs/cage). The adult field population of E. heros had reduced reproduction and longevity due to parasitism by Hexacladia smithii Ash. (Hymenoptera: Encyrtidae). The N. viridula adults collected in the field produced 1.7 times more eggs (6304.9 eggs/cage) than those reared in the laboratory (3609.2 eggs/cage). E. heros laboratory reared is a promising host for egg parasitoids multiplication when compared with N. viridula collected in the field. (author)

The Social Perception of Heroes and Murderers: Effects of Gender-Inclusive Language in Media Reports.

Science.gov (United States)

Hansen, Karolina; Littwitz, Cindy; Sczesny, Sabine

2016-01-01

The way media depict women and men can reinforce or diminish gender stereotyping. Which part does language play in this context? Are roles perceived as more gender-balanced when feminine role nouns are used in addition to masculine ones? Research on gender-inclusive language shows that the use of feminine-masculine word pairs tends to increase the visibility of women in various social roles. For example, when speakers of German were asked to name their favorite "heroine or hero in a novel," they listed more female characters than when asked to name their favorite "hero in a novel." The research reported in this article examines how the use of gender-inclusive language in news reports affects readers' own usage of such forms as well as their mental representation of women and men in the respective roles. In the main experiment, German participants (N = 256) read short reports about heroes or murderers which contained either masculine generics or gender-inclusive forms (feminine-masculine word pairs). Gender-inclusive forms enhanced participants' own usage of gender-inclusive language and this resulted in more gender-balanced mental representations of these roles. Reading about "heroines and heroes" made participants assume a higher percentage of women among persons performing heroic acts than reading about "heroes" only, but there was no such effect for murderers. A post-test suggested that this might be due to a higher accessibility of female exemplars in the category heroes than in the category murderers. Importantly, the influence of gender-inclusive language on the perceived percentage of women in a role was mediated by speakers' own usage of inclusive forms. This suggests that people who encounter gender-inclusive forms and are given an opportunity to use them, use them more themselves and in turn have more gender-balanced mental representations of social roles.

The social perception of heroes and murderers: Effects of gender-inclusive language in media reports

Directory of Open Access Journals (Sweden)

Karolina eHansen

2016-03-01

Full Text Available The way media depict women and men can reinforce or diminish gender stereotyping. Which part does language play in this context? Are roles perceived as more gender-balanced when feminine role nouns are used in addition to masculine ones? Research on gender-inclusive language shows that the use of feminine-masculine word pairs tends to increase the visibility of women in various social roles. For example, when speakers of German were asked to name their favorite heroine or hero in a novel, they listed more female characters than when asked to name their favorite hero in a novel. The research reported in this paper examines how the use of gender-inclusive language in news reports affects readers’ own usage of such forms as well as their mental representation of women and men in the respective roles. In the main experiment, German participants (N = 256 read short reports about heroes or murderers which contained either masculine generics or gender-inclusive forms (feminine-masculine word pairs. Gender-inclusive forms enhanced participants’ own usage of gender-inclusive language and this resulted in more gender-balanced mental representations of these roles. Reading about heroines and heroes made participants assume a higher percentage of women among persons performing heroic acts than reading about heroes only, but there was no such effect for murderers. A post-test suggested that this might be due to a higher accessibility of female exemplars in the category heroes than in the category murderers. Importantly, the influence of gender-inclusive language on the perceived percentage of women in a role was mediated by speakers’ own usage of inclusive forms. This suggests that people who encounter gender-inclusive forms and are given an opportunity to use them, use them more themselves and in turn have more gender-balanced mental representations of social roles.

The doctor(s) in house: an analysis of the evolution of the television doctor-hero.

Science.gov (United States)

Strauman, Elena C; Goodier, Bethany C

2011-03-01

The medical drama and its central character, the doctor-hero have been a mainstay of popular television. House M.D. offers a new (and problematic) iteration of the doctor-hero. House eschews the generic conventions of the "television doctor" by being neither the idealized television doctor of the past, nor the more recent competent but often fallible physicians in entertainment texts. Instead, his character is a fragmented text which privileges the biomedical over the personal or emotional with the ultimate goal of scientifically uncovering and resolving instances of disease. This article examines the implicit and explicit messages in House M.D. and critically analyzes both the show and its lead character in relation to the traditional medical drama genre that highlights the "doctor-hero" as the central character. While at first House seems to completely violate narrative and generic norms, ultimately the program provides a new form that reinforces the presence of the doctor-hero, but highlights House's character as the central figure who is personally and interpersonally problematic but biomedically effective.

An Introduction to the SMARTRISK Heroes Program: Positive Social Marketing for Adolescent Injury Prevention

Directory of Open Access Journals (Sweden)

Philip R. Groff

2006-09-01

Full Text Available This article provides background on the SMARTRISK Heroes Program, a mobile stage production that introduces young people to the prevalence of unintentional injury for their age group and presents them with a series of strategies that will reduce the likelihood that they will be unintentionally injured or killed. The program logic is consistent with theoretical work from the area of health promotion including the Protection Motivation Theory and the Transtheoretical Model of Stages of Change. The SMARTRISK Heroes Program has been the subject of a number of past evaluations that are briefly described. The program logic model was included in this article. Additional information on the program and its evaluations can be found at http://www.smartrisk.ca by selecting SMARTRISK Heroes, under the “Youth Tab.”

Rampant Lechers, Chaste Heroes

Directory of Open Access Journals (Sweden)

Heimerl, Theresia

2017-05-01

Full Text Available Violence is a central element of comic book screen adaptations in both Hollywood (Marvel, DC and Japan. Yet while sexual violence is openly shown in film versions of manga, coded sexualised violence dominates Western productions. Positively connoted protagonists exercise violence, but no sexualised or sexual violence, in both groups. Conversely, villains are characterised by violence and some form of sexually grounded violence, but In Western films, they are ultimately repressed lechers, and only in Japanese productions do they rampantly lose their inhibitory control. Moreover, the heroes of Japanese films are noticeably less chaste than the almost asceticcelibate romantics of Marvel and DC.

Hemodialysis Reliable Outflow (HeRO) device in end-stage dialysis access: a decision analysis model.

Science.gov (United States)

Dageforde, Leigh Anne; Bream, Peter R; Moore, Derek E

2012-09-01

The Hemodialysis Reliable Outflow (HeRO) dialysis access device is a permanent tunneled dialysis graft connected to a central venous catheter and is used in patients with end-stage dialysis access (ESDA) issues secondary to central venous stenosis. The safety and effectiveness of the HeRO device has previously been proven, but no study thus far has compared the cost of its use with tunneled dialysis catheters (TDCs) and thigh grafts in patients with ESDA. A decision analytic model was developed to simulate outcomes for patients with ESDA undergoing placement of a HeRO dialysis access device, TDC, or thigh graft. Outcomes of interest were infection, thrombosis, and ischemic events. Baseline values, ranges, and costs were determined from a systematic review of the literature. Total costs were based on 1 year of post-procedure outcomes. Sensitivity analyses were conducted to test model strength. The HeRO dialysis access device is the least costly dialysis access with an average 1-year cost of $6521. The 1-year cost for a TDC was $8477. A thigh graft accounted for $9567 in a 1-year time period. The HeRO dialysis access device is the least costly method of ESDA. The primary determinants of cost in this model are infection in TDCs and leg ischemia necessitating amputation in thigh grafts. Further study is necessary to incorporate patient preference and quality of life into the model. Copyright © 2012 Elsevier Inc. All rights reserved.

Folk Hero Modeling Therapy for Puerto Rican Adolescents.

Science.gov (United States)

Costantino, Guiseppe; And Others

1988-01-01

Describes development of a new modality for Puerto Rican adolescents which presents Puerto Rican folk heros and heroines in modeling therapy targeted towards enhancing adolescents' pride in their ethnic heritage. Evaluation of therapy using 21 adolescents indicated subjects increased in self-disclosure and self-confidence, gained pride, learned…

Heroes and Cowards: Genealogy, Subjectivity and War in the Twenty-First Century

Directory of Open Access Journals (Sweden)

Peter Lee

2018-04-01

Full Text Available From the wars of Ancient Greece to the collapsing Islamic State in the present, the same, apparently timeless protagonists appear and their stories told and re-told: the heroes, cowards and other combatants. This article proposes a framework which combines a Foucauldian genealogical approach with his conception of the subject as both constituted in relation to code-oriented moralities, and creatively self-formed in relation to ethics-oriented moralities (Foucault 1992, pp. 5, 25, to understand how it is possible to speak meaningfully of heroes and cowards in the age of the drone and the jihadist. Section one will explore the applicability of Foucauldian genealogy as the methodological basis for understanding present combatants in the context of war. The second section will assess Foucault’s ‘modes of subjectivation’ and ‘practices of the self’ (Foucault 1992, p. 28, as a means of analyzing the emergence of the subject of war over millennia, with emphasis on the ethical dimension of subjectivity that can be applied to heroes and cowards. Then the third section will use insights from Homer and Augustine to begin to illustrate how Foucault’s genealogical approach and his conception of ethical subjectivity combine to enable heroes and cowards to be meaningfully spoken of and better understood in the domain of war today. The purpose of such a study is to set out the basis on which political genealogy after Foucault can provide a nuanced conceptualization of subjectivity in modern war, as those subjects are formed, claimed, valorized and criticized by competing entities in contemporary political discourse.

Health Economics in Radiation Oncology: Introducing the ESTRO HERO project

International Nuclear Information System (INIS)

Lievens, Yolande; Grau, Cai

2012-01-01

New evidence based regimens and novel high precision technology have reinforced the important role of radiotherapy in the management of cancer. Current data estimate that more than 50% of all cancer patients would benefit from radiotherapy during the course of their disease. Within recent years, the radiotherapy community has become more than conscious of the ever-increasing necessity to come up with objective data to endorse the crucial role and position of radiation therapy within the rapidly changing global oncology landscape. In an era of ever expanding health care costs, proven safety and effectiveness is not sufficient anymore to obtain funding, objective data about cost and cost-effectiveness are nowadays additionally requested. It is in this context that ESTRO is launching the HERO-project (Health Economics in Radiation Oncology), with the overall aim to develop a knowledge base and a model for health economic evaluation of radiation treatments at the European level. To accomplish these objectives, the HERO project will address needs, accessibility, cost and cost-effectiveness of radiotherapy. The results will raise the profile of radiotherapy in the European cancer management context and help countries prioritizing radiotherapy as a highly cost-effective treatment strategy. This article describes the different steps and aims within the HERO-project, starting from evidence on the role of radiotherapy within the global oncology landscape and highlighting weaknesses that may undermine this position.

Considerations on the Media and "Sports Heroes" of Mixed Martial Arts

Directory of Open Access Journals (Sweden)

Igor Sampaio Pinho Dos Santos

2015-05-01

Full Text Available The text presents some considerations about mechanisms used by the media industry in the construction of "sports heroes" of Mixed Martial Arts (MMA. For that, there was a theoretical study and highlighted a few examples of situations experienced by Brazilian MMA athletes to discuss such mechanisms. Thus, it is understood that the sporting spectacle, the use of specialized marketing and sensationalism in the dissemination of information about the lives of these athletes are some of the mechanisms used by the media in the construction of MMA heroes. We conclude that this is one of the most effective strategies to transform the MMA a popular phenomenon, encouraging their consumption sold in Brazilian society.

Book Talk. Books About All Kinds of Heroes.

Science.gov (United States)

Freeman, Judy

1998-01-01

Presents an annotated listing of books about all kinds of heroes for elementary school students. Stories include the young King Arthur; an assertive, baseball-playing heroine who becomes a princess; an older brother dealing with his younger brother; a Christmas story; civil rights icon Rosa Parks; and the cow who jumped over the moon. (SM)

Stories, Heroes and Commercials. Spreading the Message across with a New Type of Responsibility

Directory of Open Access Journals (Sweden)

Ana ADI

2015-12-01

Full Text Available Stories have always been a form of communication, the first form of narrative we have encountered in early childhood. And although we have grown up they continue to fascinate us. They maintain and recreate bonds with old traditions, legends, archetypes, myths and symbols. In analyzing stories, Joseph Campbell (2008 proposed the monomyth or the Hero's Journey, a basic pattern, which comprises fundamental stages and structures identifiable in all narratives from different cultures and ages. Although the pattern was further refined and enriched according to the specifics of the narrative (myth, fairy tale, dream, movie etc. the common structural elements of the Hero's Journey from the ordinary world to a challenging and unfamiliar world include: the departure, the initiation and the return. Picking up on Campbell’s model, Sachs (2012 proposes a circular representation of the hero and his/her journey. In this model, a new character, the mentor, plays a pivotal role in the shaping of the hero and his/her transformation. It is the mentor that supports the hero in her/his taking the call to adventure as well as in providing the needed support for crossing the thresholds to the supernatural world and back. Based on what Sachs (2012 suggests that brands could use storytelling as a means to engage with consumers. In doing so he argues that brands should reflect and adopt the role of mentors in their consumers’ journeys, guiding them through the challenges on their own world and contributing to their personal fulfillment. This paper aims to evaluate four stories, all focused on women and empowerment and as a result our discussion focuses mainly on the position of the brand within the story and its role. This, we believe, may contribute to a new trend focused on the adoption and applications of empowerment storytelling.

For Parents Particularly: Lessons in Moral Behavior. A Few Heroes.

Science.gov (United States)

Cohen, Stewart

1993-01-01

Discusses ways for parents (and educators) to use the life stories of heroes, such as individuals who rescued Jews from the Holocaust, to foster children's moral courage, sense of right and wrong, and commitment to others. (MDM)

Development of a dry artificial diet for Nezara viridula (L.) and Euschistus heros (Fabricius) (Heteroptera: Pentatomidae)

International Nuclear Information System (INIS)

Fortes, Priscila; Parra, Jose R.P.; Panizzi, Antonio R.

2006-01-01

Artificial diets prepared with wheat germ, soybean protein, dextrosol, potato starch, sucrose, cellulose, soybean or sunflower oil, and vitamin solution for rearing Nezara viridula (L.) and Euschistus heros (Fabricius) were tested under controlled temperature (25 ± 1 deg C), RH (60 ± 10%), and photophase (14h). Three diets were tested and compared with the natural diet privet [soybean and peanut seeds and privet Ligustrum lucidum Ait. fruit (Oleaceae)]. All three artificial diets allowed full development. The diet containing sunflower oil was the most suitable for N. viridula while E. heros developed better on a diet composed of soybean oil. Data indicated that the artificial diets were inferior to the natural diet. The artificial diets were more adequate for E. heros. (author)

Development of a dry artificial diet for Nezara viridula (L.) and Euschistus heros (Fabricius) (Heteroptera: Pentatomidae)

Energy Technology Data Exchange (ETDEWEB)

Fortes, Priscila; Parra, Jose R.P. [Universidade de Sao Paulo (USP), Piracicaba, SP (Brazil). Escola Superior de Agricultura Luiz de Queiroz (ESALQ). Dept. Entomologia, Fitopatologia e Zoologia Agricola; Magro, Sandra R. [Faculdade Integrada de Campo Mourao, PR (Brazil); Panizzi, Antonio R. [EMBRAPA, Londrina, PR (Brazil). Centro Nacional de Pesquisa de Soja

2006-09-15

Artificial diets prepared with wheat germ, soybean protein, dextrosol, potato starch, sucrose, cellulose, soybean or sunflower oil, and vitamin solution for rearing Nezara viridula (L.) and Euschistus heros (Fabricius) were tested under controlled temperature (25 {+-} 1 deg C), RH (60 {+-} 10%), and photophase (14h). Three diets were tested and compared with the natural diet privet [soybean and peanut seeds and privet Ligustrum lucidum Ait. fruit (Oleaceae)]. All three artificial diets allowed full development. The diet containing sunflower oil was the most suitable for N. viridula while E. heros developed better on a diet composed of soybean oil. Data indicated that the artificial diets were inferior to the natural diet. The artificial diets were more adequate for E. heros. (author)

Health economics in radiation oncology: introducing the ESTRO HERO project.

Science.gov (United States)

Lievens, Yolande; Grau, Cai

2012-04-01

New evidence based regimens and novel high precision technology have reinforced the important role of radiotherapy in the management of cancer. Current data estimate that more than 50% of all cancer patients would benefit from radiotherapy during the course of their disease. Within recent years, the radiotherapy community has become more than conscious of the ever-increasing necessity to come up with objective data to endorse the crucial role and position of radiation therapy within the rapidly changing global oncology landscape. In an era of ever expanding health care costs, proven safety and effectiveness is not sufficient anymore to obtain funding, objective data about cost and cost-effectiveness are nowadays additionally requested. It is in this context that ESTRO is launching the HERO-project (Health Economics in Radiation Oncology), with the overall aim to develop a knowledge base and a model for health economic evaluation of radiation treatments at the European level. To accomplish these objectives, the HERO project will address needs, accessibility, cost and cost-effectiveness of radiotherapy. The results will raise the profile of radiotherapy in the European cancer management context and help countries prioritizing radiotherapy as a highly cost-effective treatment strategy. This article describes the different steps and aims within the HERO-project, starting from evidence on the role of radiotherapy within the global oncology landscape and highlighting weaknesses that may undermine this position. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Human or superhuman: The concept of hero in ancient Greek religion and/in politics

Directory of Open Access Journals (Sweden)

Stevanović Lada

2008-01-01

Full Text Available The word hero appears in Greek language with a twofold meaning. On one hand it is used for denoting a divine being, who lived a mortal life, but after doing some great deed deserved to become god. On the other hand, the hero stands for great and brave warrior who is ready to give his life in order to gain immortal glory, and continue to live in the social sphere, in the memory of his descendants. Exactly this epic narrative survived and was exploited many times, as a very convenient and useful pattern in con strutting the ideal of brave warrior, ready to die for his country when necessary. I am going to requisition the relation between two meanings of the word hero, in order to get deeper insight in the meaning of this twofold term in the social and cultural context in which it appears, as a religious concept or as a narrative in war propaganda.

Signos Vitales de los CDC-Epidemia de heroína (Heroin Epidemic)

Centers for Disease Control (CDC) Podcasts

2015-07-07

Este podcast se basa en la edición de julio del informe Signos Vitales de los CDC. El consumo de heroína y las muertes por sobredosis relacionadas con esta droga están aumentando. La mayoría de las personas están consumiendo heroína con otras drogas, especialmente analgésicos opioides recetados. Sepa qué se puede hacer para prevenir y tratar el problema.  Created: 7/7/2015 by National Center for Injury Prevention and Control (NCIPC).   Date Released: 7/7/2015.

Magnetic anomaly patterns over crustal blocks of the King Edward VII Peninsula, Marie Byrd Land, West Antarctica

Directory of Open Access Journals (Sweden)

M. Spano

2000-06-01

Full Text Available Within the framework of the GITARA II project an aeromagnetic survey was performed during the GANOVEXVII expedition (1992/1993 over the King Edward VII Peninsula in northwestern Marie Byrd Land (West Antarctica. This region which may represent the eastern flank of the Ross Sea rift system had previously been explored only at reconnaissance level. New total field and upward continued (10 km magnetic anomaly maps are produced and interpreted here to map and discuss the crustal structure of the Edward VII Peninsula. Tworound-shaped, high-amplitude magnetic anomalies are recognised over the Alexandra Mountains block. The anomalies are difficult to interpret since susceptibility data indicate the prevalence of non-magnetic rocks at the surface. A possible interpretation is that the anomalies are due to Cretaceous mafic intrusives distinct from weakly magnetic Byrd Coast Granite of the adjacent Rockefeller Mountains block. Alternatively the anomalies could be related to buried pluton-sized Devonian Ford Granodiorite intruded by dikes. If Cretaceous in age, the former intrusives revealed from the magnetics could also be responsible for contact metamorphism of the adjacent Alexandra Mountains migmatites. Lower amplitude circular anomalies over the Central Plateau and Prestrud Inlet are likely to be caused by unexposed Devonian Ford Granodiorite which crops out in the Ford Ranges. Elongated high-frequency anomalies of the Sulzberger Bay are similar to those recognised over seismically constrained Cenozoic rift-related volcanics of the Ross Sea. A broad magnetic low over the Sulzberger Ice Shelf may be indicative of a fault bounded graben-like basin with sedimentary infill. Overall recognition of magnetic anomaly patterns and trends reveals segmentation of the Edward VII Peninsula and of the adjacent marine areas in distinct crustal blocks. Faults may separate these blocks and they are interpreted to reflect multiple Cretaceous and maybe Cenozoic crustal

On the formation of the novel “A Hero of Our Time”

Directory of Open Access Journals (Sweden)

Nikishov Yuri Mikhailovich

2015-10-01

Full Text Available This is a new version of a story of Lermontov’s “A Hero of Our Time” creation. The story begins in the end of 1837 with creation of an independent tale (novella “Taman”. Creative success stimulated Lermontov to continue work in the genre of notes as it is reflected in the subtitle of journal publication of “Bela”: “From the notes of a military officer on the Caucasus”. But the new story has changed the original plan. Now the figure of the hero became the basis for the cycle. The book has integrity, which is not provided by the initial strict plan. It is based on dialog links of the cycle novels.

Effects of the cyberbullying prevention program media heroes (Medienhelden) on traditional bullying.

Science.gov (United States)

Chaux, Enrique; Velásquez, Ana María; Schultze-Krumbholz, Anja; Scheithauer, Herbert

2016-01-01

There is considerable debate over whether cyberbullying is just another form of bullying, or whether it is a problem distinct enough to require specific intervention. One way to explore this issue is to analyze whether programs designed to prevent traditional bullying help prevent cyberbullying, and whether programs designed to prevent cyberbullying prevent traditional bullying. The main goal of the current study was to analyze the spillover effects of the cyberbullying prevention program Media Heroes (Medienhelden) on traditional bullying. Media Heroes promotes empathy, knowledge of risks and consequences, and strategies that allow bystanders to defend victims from cyberbullying. Mixed ANOVAs were conducted comparing pretest and post-test (6 months after intervention) measures of 722 students (ages 11-17) assigned to a long (15 sessions) intervention, a short (1 day) intervention, and a control group. In addition to confirming the previously reported effects on cyberbullying, Media Heroes was found to reduce traditional bullying. Effects were larger for the long-version of the program than for the short 1-day version. No effects were found on victimization by either cyberbullying or traditional bullying. Strategies to complement traditional and cyberbullying prevention efforts are discussed. Aggr. Behav. 42:157-165, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

The war hero

Directory of Open Access Journals (Sweden)

Raffaele Menarini

2014-06-01

Full Text Available The article explains the phenomenon of war through the transpersonal perspective as an existential way which is independent from subject's intentionality. Therefore war not as a pondered product but as a reproduction of an unthinkable aggressiveness. Within the transpersonal dynamic, those that Bion defined 'basic assumptions' prevail: dependency, attack-escape and pairing. Bion finds in the myth of Palinuro the typical pattern of destructiveness that prevents the birth of the thinkable. Menarini continues Bion's speculation working on the myth of hero Achilles as an archetypal which founds imagery of war and on the figure of Elena as a motor for the destructive act. In fact Elena is considered as a simulacrum, an object that, through the appearance, gives meaning to what would not make sense in absence of it, that is the transpersonal destructiveness. Like Elena every war has its simulacrum, such as the Washington Mall, and history is full of them.

The predictive validity of the HERO Scorecard in determining future health care cost and risk trends.

Science.gov (United States)

Goetzel, Ron Z; Henke, Rachel Mosher; Benevent, Richele; Tabrizi, Maryam J; Kent, Karen B; Smith, Kristyn J; Roemer, Enid Chung; Grossmeier, Jessica; Mason, Shawn T; Gold, Daniel B; Noeldner, Steven P; Anderson, David R

2014-02-01

To determine the ability of the Health Enhancement Research Organization (HERO) Scorecard to predict changes in health care expenditures. Individual employee health care insurance claims data for 33 organizations completing the HERO Scorecard from 2009 to 2011 were linked to employer responses to the Scorecard. Organizations were dichotomized into "high" versus "low" scoring groups and health care cost trends were compared. A secondary analysis examined the tool's ability to predict health risk trends. "High" scorers experienced significant reductions in inflation-adjusted health care costs (averaging an annual trend of -1.6% over 3 years) compared with "low" scorers whose cost trend remained stable. The risk analysis was inconclusive because of the small number of employers scoring "low." The HERO Scorecard predicts health care cost trends among employers. More research is needed to determine how well it predicts health risk trends for employees.

KrygsheldelWar Heroes LT A.W. BEAUCHAMP-PROCTOR - DIE ...

African Journals Online (AJOL)

Many millions of words have been written abour heroes and many more will be written in the future, but this article about the late Captain Andrew Weatherby Beauchamp-Proctor, VC., 050.,. MC.(Bar), OFC., is special because he was the only South African among nineteen pilots to win the Victoria Cross during the First ...

GoPro HERO 4 Black recording of scleral buckle placement during retinal detachment repair.

Science.gov (United States)

Ho, Vincent Y; Shah, Vaishali G; Yates, David M; Shah, Gaurav K

2017-08-01

GoPro and Google Glass technology have previously been used to record procedures in ophthalmology and other medical fields. In this manuscript, GoPro's latest HERO 4 Black edition camera (GoPro Inc, San Mateo, Calif.) will be used to record the placement of a scleral buckle during retinal detachment surgery. GoPro HERO 4 Black edition camera, which records 4K-quality video with a resolution of 3840 (pixels) x 2160 (lines), was mounted on a head strap to record placement of a scleral buckle for a retinal detachment. Excellent video quality was achieved with the 4K SuperView setting. Bluetooth connection with an Apple iPad (Apple Inc, Cupertino, Calif.) provided live streaming and use of the GoPro App. Zoom, horizontal/vertical alignment, exposure, and contrast adjustments were made with postproduction editing on GoPro Studio software. Video recording with the GoPro HERO 4 Black edition camera is an excellent way to document extraocular procedures to improve medical education, self-training, or medicolegal documentation. Copyright © 2017 Canadian Ophthalmological Society. Published by Elsevier Inc. All rights reserved.

Methodological proposal for the jotted issue of the first epoch of the Hero magazine.

Directory of Open Access Journals (Sweden)

Maité García Díaz

2013-07-01

Full Text Available During the neocolonial republic emerges in Sancti Spiritus a very significative magazine of artistic, literary and scientific sketch: Hero, founded by Jacinto Gomer Fernández-Morera and Anastacio Fernández-Morera del Castillo, it first appeared on December 20th 1907. This issue constitutes a vivid reflect of the commercial, literary, cultural, scientific and historic panorama and above all, of the life of the middle and high class in Sancti Spiritus at the beginning of the XX century. The need to divulge the advantage the texts of Hero constitute for the high school and university students, also to humanistic profile graduates and others, such as investigators, evidenced the need to carry out an investigation that pursued such purposes. That’s why the methodological proposal for the jotted issue of the first epoch of the Hero magazine (1907-1908 takes place, composed by 38 publications, departing from the fundamental theorizations about the jotted issue of the presentation of the methodological proposal on behalf of updating these publication texts for its potential readers.

Heroes and Villains: Ijaw Nationalist Narratives of the Nigerian Civil ...

African Journals Online (AJOL)

the Ijaw. The fiscal centralization of oil resources that followed the war and the persistence of minority exclusion within the Nigerian polity have encouraged Ijaw elites, and other southern minorities, to review their commitment to Nigerian federalism. Conflicting tales of the Ijaw nationalist hero Isaac Boro testify to a growing ...

Narratives and shared memories of heroes in the Aphrodisian cityscape

DEFF Research Database (Denmark)

Mortensen, Eva

2017-01-01

The article revolves around narratives that were shaped, adapted and maintained by past and present heroes in the city of Aphrodisias. The focus is on two different years, AD 14 and AD 100, and the intention is to see when, how and why certain narratives developed in a limited time period...

Tradução e adaptação transcultural do "Harris Hip Score modificado por Byrd" Translation and transcultural adaptation of the modified Harris Hip Score

Directory of Open Access Journals (Sweden)

Rodrigo Pereira Guimarães

2010-01-01

Full Text Available OBJETIVO: As artroscopias do quadril têm sido utilizadas tanto para fins diagnósticos, como para fins terapêuticos, fazendo parte do arsenal rotineiro dos cirurgiões do quadril. Devido a necessidade de avaliação dos resultados artroscópicos, Byrd propôs a modificação do "Harris Hip Score", realizando a avaliação da dor e função. O objetivo deste estudo foi traduzir e adaptar transculturalmente o protocolo de avaliação do "Harris Hip Score" modificado por Byrd, utilizado nas artroscopias do quadril. MÉTODO: O método utilizado constituiu em: 1 tradução inicial, 2 retrotradução, 3 pré - teste e 4 teste definitivo. RESULTADOS: A versão em português foi aplicada em 30 pacientes com afecções do quadril para verificar o nível de compreensão do protocolo. Foram realizadas mudanças e substituições de termos e expressões que não foram entendidas pelos pacientes durante o pré-teste e realizada a versão final em consenso. Novamente a versão final do questionário foi aplicada com 100% de entendimento pelos pacientes. CONCLUSÃO: disponibiliza-se assim a versão final em português do questionário "Harris Hip Score" modificado por Byrd. A validação desta versão já está em desenvolvimento.OBJECTIVE: Hip arthroscopy has been used for diagnostic as well as therapeutic purposes, and it is part of the daily arsenal of hip surgeons. Due to the need for arthroscopic evaluation of the results, Byrd proposed a modification of the Harris Hip Score by assessing pain and function. This study aimed to translate and cross-culturally adapt the evaluation protocol of the modified Harris Hip Score used in hip arthroscopies. METHOD: The method used consisted of: 1 an initial translation, 2 a back translation, 3 a pre-test and 4 a final test. RESULTS: The Portuguese version was used with 30 patients with hip disorders to determine the level of comprehension of the protocol. Expressions which were not understood by patients during the

The mythic structure in the black dome of the Haftpeikar: Study of Hero's journey in the first dome

Directory of Open Access Journals (Sweden)

Seyed Kazem Mousavi

2016-12-01

Full Text Available Abstract In this paper the Vogler Hero's journey is used for analyzing the mythic structures and hero's journey of the first dome of the Haftpeikar. Vogler Released his founds in the Writer's Journey book. This book that is really dependent on Campbell's Single Myth Theory is a practical guidance for script writing and review of that. The levels of the hero's journey in his book are include: The normal world, invitation to the story, reject the invitation, visit the mentor, passing the first gate, the exams, the allies, the enemies, qualifying to the deepest cave, trial, the reward, the road back, resurrection, return with the elixir.  In this paper, at first the properties of each level of the hero's journey theory are matching with the journey's levels in the black dome story. After that seven useful archetypes including hero, mentor, threshold guardian, herald, shape shifter, the shadow and trickster, are determined in the text.  Black dome has several journeys' cycles. Journey's that are seen in this dome are: (Bahram's journey: A part of the internal journey of Bahram in black dome. (The king's maid journey: Internal journey of the king's maid that wears black clothes after hearing the story. (King of black clothes' journey: The king's journey to the Madhooshan city for exploring the mystery of the black alien. (The reader's journey: This internal journey belongs to the readers of the first dome that learn their lessons through traveling to the character's world. (Nezami's journey: The Nezami's internal journey with composing the text. Checking the reader's journey and black dome's composer is out of this text. While the first and second journey just saying some parts, the black king has completer levels and for affecting on the other journeys is the most important story of the first dome. Therefore at first we check the black king story and we explain the other journeys.  The goal of this paper in addition to the usage of the vogler

The American Hero in Children's Literature: A Standards-Based Approach

Science.gov (United States)

Butzow, Carol; Butzow, John

2005-01-01

By means of 30 children's picture books--with stories set in times ranging from the early settlement of American until today--this book explores the characteristics of American heroes and the ways in which they have influenced our history, our way of life, and the principles upon which our culture has developed.

Evaluation and optimization of the man-machine interface in nuclear power plants using the HEROS procedure in PSA

International Nuclear Information System (INIS)

Richei, A.; Koch, M.K.; Unger, H.; Hauptmanns, U.

1998-01-01

For the probabilistic evaluation and optimization of the man-machine-system a new procedure is developed. This and the resulting expert system, which is based on the fuzzy set theory, is called HEROS, an acronym for Human Error Rate Assessment and Optimizing System. There are several existing procedures for the probabilistic evaluation of human errors, which have several disadvantages. However, in all of these procedures fuzzy verbal expressions are often used for the evaluation of human factors, also in the best known procedures. This use of verbal expressions for describing performance-shaping factors, enabling the evaluation of human factors is the basic approach for HEROS. A model of a modem man-machine-system is the basis of the procedure. Results from ergonomic studies are used to establish a rule-based expert system. HEROS simplifies the importance analysis for the evaluation of human factors, which is necessary for the optimization of the man-machine-system. It can be used in all areas of probabilistic safety assessment. The application of HEROS in the scope of accident management procedures and the comparison with the results of other procedures as an example for the usefulness and substantially more extensive applicability of this new procedure will be shown. (author)

Molecular and biometric assessment of Myzodium mimulicola (Drew & Sampson) (Hemiptera, Aphididae), new synonymy, host, and distributional data

Science.gov (United States)

Molecular and biometric assessment and subsequent redescription of Myzodium mimulicola (Drew & Sampson) is provided. New host and distributional data for North America are presented, including the first record from Alaska. The current study determined that Myzodium knowltoni (Smith & Robinson) is a ...

Economic Injury Level of the Neotropical Brown Stink Bug Euschistus heros (F.) on Cotton Plants.

Science.gov (United States)

Soria, M F; Degrande, P E; Panizzi, A R; Toews, M D

2017-06-01

In Brazil, the Neotropical brown stink bug, Euschistus heros (F.) (Hemiptera: Pentatomidae), commonly disperses from soybeans to cotton fields. The establishment of an economic treatment threshold for this pest on cotton crops is required. Infestation levels of adults of E. heros were evaluated on cotton plants at preflowering, early flowering, boll filling, and full maturity by assessing external and internal symptoms of injury on bolls, seed cotton/lint production, and fiber quality parameters. A completely randomized experiment was designed to infest cotton plants in a greenhouse with 0, 2, 4, 6, and 8 bugs/plant, except at the full-maturity stage in which only infestation with 8 bugs/plant and uninfested plants were evaluated. Results indicated that the preflowering, early-flowering, and full-maturity stages were not affected by E. heros. A linear regression model showed a significant increase in the number of internal punctures and warts in the boll-filling stage as the population of bugs increased. The average number of loci with mottled immature fibers was significantly higher at 4, 6, and 8 bugs compared with uninfested plants with data following a quadratic regression model. The seed and lint cotton was reduced by 18 and 25% at the maximum level of infestation (ca. 8 bugs/plant) in the boll-filling stage. The micronaire and yellowing indexes were, respectively, reduced and increased with the increase of the infestation levels. The economic injury level of E. heros on cotton plants at the boll-filling stage was determined as 0.5 adult/plant. Based on that, a treatment threshold of 0.1 adult/plant can be recommended to avoid economic losses.

Ernest Borgnine Lays it on the Line Hollywood Hero Focuses on Macular Degeneration

Science.gov (United States)

... Feature: Vision Ernest Borgnine Lays it on the Line Hollywood Hero Focuses on Macular Degeneration Past Issues / ... otherwise? Your work. Television. Newspapers. Your wife's wonderful smile. That's what I would miss. We are happily ...

The LGBT-Heroes in Modern Foreign Fairy Tales (How to Read With Children

Directory of Open Access Journals (Sweden)

Olga Derkachova

2017-06-01

Full Text Available The article is devoted to the LGBT-protagonists as a new type of heroes in modern foreign fairy tales. Such tales are becoming popular in the modern world. So, there is a problem to read or not to read them and if to read how to do it. The best thing is to analyze them not through the LGBT-base, but through the human being. The writers use traditional tale’s plots and heroes and just change sexual nature. LGBT-relationships are typically avoided in children’s books. Such tales put children towards understanding these relationships. They also show that protagonists’ features and acts are more important for readers than their homosexuality. A human with his feelings and acts is the main thing in LGBT-tales.

Video Capture of Plastic Surgery Procedures Using the GoPro HERO 3+.

Science.gov (United States)

Graves, Steven Nicholas; Shenaq, Deana Saleh; Langerman, Alexander J; Song, David H

2015-02-01

Significant improvements can be made in recoding surgical procedures, particularly in capturing high-quality video recordings from the surgeons' point of view. This study examined the utility of the GoPro HERO 3+ Black Edition camera for high-definition, point-of-view recordings of plastic and reconstructive surgery. The GoPro HERO 3+ Black Edition camera was head-mounted on the surgeon and oriented to the surgeon's perspective using the GoPro App. The camera was used to record 4 cases: 2 fat graft procedures and 2 breast reconstructions. During cases 1-3, an assistant remotely controlled the GoPro via the GoPro App. For case 4 the GoPro was linked to a WiFi remote, and controlled by the surgeon. Camera settings for case 1 were as follows: 1080p video resolution; 48 fps; Protune mode on; wide field of view; 16:9 aspect ratio. The lighting contrast due to the overhead lights resulted in limited washout of the video image. Camera settings were adjusted for cases 2-4 to a narrow field of view, which enabled the camera's automatic white balance to better compensate for bright lights focused on the surgical field. Cases 2-4 captured video sufficient for teaching or presentation purposes. The GoPro HERO 3+ Black Edition camera enables high-quality, cost-effective video recording of plastic and reconstructive surgery procedures. When set to a narrow field of view and automatic white balance, the camera is able to sufficiently compensate for the contrasting light environment of the operating room and capture high-resolution, detailed video.

Judging Jack: Rethinking Historical Agency and the Sport Hero

OpenAIRE

Kohe, Geoff

2014-01-01

One aspect of the dizzying (aesthetic, cultural, linguistic, visual, and post-modern) ‘turns’ Sport history has taken in recent times has been the revision/deconstruction of sporting heroes and demystification of historical narratives. This, in turn, has attended to larger historical concerns about the centrality of agents and agency in narrative making. Encouraged by these directions, this paper reconsiders the primacy afforded agents and their agency within national Olympic history creation...

Usulan Pengembangan Komunikasi Pemasaran Melalui Strategi Customer Bonding (Studi Kasus : Supermarket Hero di Jakarta

Directory of Open Access Journals (Sweden)

Ronald Sukwadi

2012-03-01

Full Text Available The consequence of competition is the decrease of the number of customers which causes Hero Supermarket closed down several of its outlets. This decrease is also caused by the existence of internal issue of marketing communication (promotion which lacked a strong concept. The ineffective selection of communication channel which in turn fails to conform the activity to the public. For that, the identification in marketing communication activity through Customer Bonding strategy is needed. Through marketing communication program assessment with Customer Bonding (Awareness Bonding, Relationship Bonding, and Advocacy Bonding, intensity of marketing communication problem can be identified, through survey assessment (management and costumer, analyzed with statistical testing like validity and reliability test, Spearman Correlation test and Cross tab test. The questionnaires will be given to 13 respondents from Hero Management by using quota sampling and 100 customers using stratified sampling.               Through marketing communication program assessment using Customer Bonding, marketing communication intensity and correlation analysis between marketing communication program and consumer loyalty are obtained. From this analysis, it is shown that there is noise in marketing communication that influences information sending to customer. Hero must maintain marketing communication program which focuses in marketing program that have competitive advantages. Beside that, evaluation has always to be done in order to improve customer loyalty. Keywords: communication, customer bonding, loyalty

Hero/Heroine Modeling for Puerto Rican Adolescents: A Preventive Mental Health Intervention.

Science.gov (United States)

Malgady, Robert G.; And Others

1990-01-01

Developed hero/heroine intervention based on adult Puerto Rican role models to foster ethnic identity, self-concept, and adaptive coping behavior. Screened 90 Puerto Rican eighth and ninth graders for presenting behavior problems in school and randomly assigned them to intervention or control groups. After 19 sessions, intervention significantly…

Losers Don’t Play Videogames. . . Heroes Do: The Remediation of Videogames in 1980s Science Fiction Films

Directory of Open Access Journals (Sweden)

Dawn Stobbart

2015-07-01

Full Text Available A decade before the first adaptation of a videogame to film (Super Mario Brothers, 1993, computer and arcade videogames were incorporated as subject matter in mainstream Hollywood films such as War Games (1983, The Terminator (1984, and The Last Starfighter (1984, presenting the new medium through a science fictional lens. While these films aired widespread anxieties about the ability of computers and videogames to start global wars and override human social structures and agency, at the same time, they offered a counterpoint to the traditional masculine hero, which this article will explore, situating the adolescent within the historical context of the 1980s, film, and videogames. The article will also consider the rhetorical questions raised by these films: the protagonist of War Games both inadvertently sets off and stops a chain of events that would lead to World War III. He does more than save the world from his own error, however: he teaches the government’s military computer to think and humanises the machine, rendering it less dangerous. When the protagonist of The Last Starfighter beats the arcade game for which the film is named, he is visited by aliens, who inform him that they planted the game in hope of finding a hero with shooting skills that can save the galaxy from its enemies. They transport him to fight that war, and he emerges a victorious hero. All of these films reinvent the adolescent as a hero, and at the same time, question the role of technology as a growing part of 1980s culture.

Montana Proficiency Events Handbook. FHA HERO: Future Homemakers of America toward New Horizons.

Science.gov (United States)

McGregor, Linda, Ed.; Quickenden, Sandy, Ed.

This handbook contains directions for FHA/HERO (Future Homemakers of America/Home Economics Related Occupations) participation activities in Montana. Participation activities are local, state, and national level competitions involving students in vocational home economics programs. The handbook provides a general overview of participation…

The Effect of Autoclave Sterilization on Resistance to Cyclic Fatigue of Hero Endodontic File #642 (6%) at Two Artificial Curvature.

Science.gov (United States)

Khabiri, Masoud; Ebrahimi, Maziar; Saei, Mohammad Reza

2017-12-01

File fracture can interfere with cleaning and shaping of the canal and compromise periradicular healing. Autoclave sterilization may prone the files to fracture. The purpose of the present study was to determine the effect of autoclave sterilization on the cyclic fatigue resistance of Hero642 rotary instrument in two curvatures of 45 and 60 degrees. For this experimental in-vitro study, 90 Nickel-Titanium HERO 642 rotary files #30 with 0.06 taper were selected. They were divided into two groups (curvature of 45 and 60 degree) of 45 files. Each group was then subdivided into 3 subgroups; group I: no sterilization, group II: 5 cycles of sterilization and group III: 10 cycles of sterilization. Files were used in artificial canals until fracture. The cyclic fatigue was measured as the number of cycles before fracture. The data was statically analyzed by Student's t-test and two-way analysis of variance. There was a significant difference in cyclic fatigue of two curvature of 45 and 60 degrees ( p = 0.001). However, sterilization process has no significant effect on cyclic fatigue of HERO files ( p = 0.557). Sterilization had no effect on the cyclic fatigue of HERO 642 files when used in curvature of 45 or 60 degrees.

The contaminated Western Hero and other madness during the Atomic Age

International Nuclear Information System (INIS)

Herzog, Rudolph

2012-01-01

The book on mad activities during the Atomic Age includes the following topics: The second most hazardous invention in all time; the red bomb; the story on the tactic nuclear war; the contaminated Western hero or how the bomb came to Alaska; swords into plowshares; the apocalypse machine; flying reactors; how safe is safe?; atomic Australia; nuclear medicine on wrong ways; broken arrows.

Storage of Euschistus heros Eggs (Fabricius) (Hemiptera: Pentatomidae) in Liquid Nitrogen for Parasitization by Telenomus podisi Ashmead (Hymenoptera: Platygastridae).

Science.gov (United States)

Favetti, B M; Butnariu, A R; Doetzer, A K

2014-06-01

Records in the literature with regard to the influence of freezing of pentatomid eggs on parasitism by microhymenopterans are scarce. In this research, we compared the storage of Euschistus heros (Fabricius) (Hemiptera: Pentatomidae) eggs in liquid nitrogen for different periods with the objective of optimizing the multiplication of Telenomus podisi Ashmead (Hymenoptera: Platygastridae) in the laboratory. Fresh eggs of E. heros were exposed (S3, S6) or not (NS3, NS6) to UV light for 30 min and stored in 1.5-mL plastic vials in liquid nitrogen either for 3 (S3, NS3) or 6 months (S6, NS6), and egg suitability to parasitoid development was compared to control eggs exposed (SC) or not (NSC) to UV treatment. Global data analysis showed that E. heros eggs stored in liquid nitrogen with or without UV treatment, for 3 or 6 months, were suitable for T. podisi parasitization.

Teaching Global Change in Local Places: The HERO Research Experiences for Undergraduates Program

Science.gov (United States)

Yarnal, Brent; Neff, Rob

2007-01-01

The Human-Environment Research Observatory (HERO) Research Experience for Undergraduates (REU) program aimed to develop the next generation of researchers working on place-based human-environment problems. The program followed a cooperative learning model to foster an integrated approach to geographic research and to build collaborative research…

Eco-Heroes and Eco-Villains: An Archetypal Analysis of Environmental Film, 1950-2010

Science.gov (United States)

Roberts, Candice D.; Stein, Susan

2015-01-01

Archetypes are characters recognizable by media consumers that operate at a subconscious level and often elicit strong emotional responses. Popular Hollywood films addressing issues of the environment offer hero and villain figures that demonstrate strong archetypal characteristics. Surrounding the intricate characters, many of these films also…

Victims, Heroes, and Just Plain Folks (Teaching and Learning about Cultural Diversity).

Science.gov (United States)

Miller, Howard M., Ed.

1998-01-01

Argues that multicultural education, if it is to be effective and meaningful, needs to be woven throughout the curriculum. Discusses 11 children's books that take into account the age and maturity level of students as they tell forthright stories of the victims, heroes, and just plain folks of the Holocaust, slavery, and the involuntary of…

URBAN COMMUNITY RESPONSES TO VISUAL APPROPRIATE THEMATIC DESIGN, SUPER HERO PARK BANDUNG

Directory of Open Access Journals (Sweden)

Dian Duhita

2017-06-01

Full Text Available Parks is one of city public area that serves as a communal place for city community. On another perspective, parks is an architectural design that is designed with an aesthetic element to attract. Bandung, since a few years was to make improvements in various sectors, especially in the public space. Through the slogan Creative City, Bandung City Government revived communities part of the citizens by providing place for a activities, creation and production. Thematic Parks became one of the alternative approaches responsive design as part of creative cities development. Object of research study object is Super Hero park. The purpose of research is to analyzing the response of communities to design a thematic park. The study was conducted with a qualitative approach through participation observation method. The scope of the research includes visual appropriate and city community response. The conclussion obtain that visual appropriate are in accordance with the theme. Urban Community was able to respond well the identity of Super Hero park with visual appropriate design.

Representações da Guerra Fria no discurso jornalístico norte-americano de Drew Pearson (1950-1960 = Representations of the Cold War in the north american journalistic discourse of Drew Pearson (1950-1960

Directory of Open Access Journals (Sweden)

Portela, Leonice

2014-01-01

Full Text Available O presente artigo pretende realizar uma análise nas páginas da revista O Cruzeiro no período de 1950 a 1960, na coluna Carrossel do Mundo escrita pelo jornalista norte-americano Drew Person. Nesta pesquisa evidenciaremos o cruzamento da história com a imprensa e as representações que esta fazia do contexto dos anos de 1950 a 1960. Além de utilizarmos a revistas O Cruzeiro como fonte de pesquisa, está também será nosso objeto de estudo na medida em que se pretende analisar a revista nos seus intrincados bastidores e relações com o poder. A revista é fonte de sua própria história e das mais diversas situações, encontramos dados sobre a sociedade, costumes, informando sobre questões políticas e econômicas inseridas em suas representações através de suas palavras e imagens. Realizaremos um panorama dos artigos de Drew Pearson no período de 1950 a 1960, sendo classificadas em três Eixos Temáticos que se destacam como: a Articulações Políticas dos Estados Unidos nas relações internas e externas; b As ameaças do Comunismo; c Guerra Fria na sua perspectiva de “guerra de nervos”

Video Capture of Plastic Surgery Procedures Using the GoPro HERO 3+

Directory of Open Access Journals (Sweden)

Steven Nicholas Graves, MA

2015-02-01

Conclusions: The GoPro HERO 3+ Black Edition camera enables high-quality, cost-effective video recording of plastic and reconstructive surgery procedures. When set to a narrow field of view and automatic white balance, the camera is able to sufficiently compensate for the contrasting light environment of the operating room and capture high-resolution, detailed video.

Maxwell Fry and Jane Drew Partners : The Contributions of British Architects to Built Environment in Colonial Nigeria, 1946-1959

Directory of Open Access Journals (Sweden)

Abiodun Akeem Oladiti

2016-06-01

Full Text Available This paper examines the contributions of two British architects, Maxwell Fry and Jane Drew in the development of built environment in Nigeria after World War II. It analyses the historical development of the built environment in Nigeria’s public space with respect to modernize infrastructures such as banks, schools, teachers training colleges and the university needed in support of the colonial administration in Nigeria. The agitation of the nationalists and postwar reconstruction facilitated and encouraged the British Empire to develop the edifice or structures that would be suitable for the environment. This, to a large extent, influenced the Nigerian architecture and built environment. Their design principles yielded functional institutional spaces and a hybrid aesthetics that signifies modernist construction and colonial influence. The paper concludes that the designs of both Fry and Drew represent a milestone and significant contribution to the development of built environment in colonial Nigeria.

Parasitismo e sítios de diapausa de adultos do percevejo marrom, Euschistus heros na região da Grande Dourados, MS Parasitism and diapause sites of brown stink bug adults, Euschistus heros in the Great Dourados Region, MS, Brazil

Directory of Open Access Journals (Sweden)

Karlla Barbosa Godoy

2010-05-01

Full Text Available Entre os insetos que atacam a soja, o percevejo marrom Euschistus heros (Fabricius é considerado uma das principais pragas. Os objetivos deste trabalho foram avaliar a ocorrência de parasitismo em adultos do percevejo marrom E. hero, no período de cultivo da soja e de entressafra, e identificar seus sítios de diapausa no período de entressafra, na região da Grande Dourados, Mato Grosso do Sul (MS. Foram coletados adultos do percevejo em lavouras de soja, durante as safras 2004/05 e 2005/06, sendo as coletas realizadas semanalmente. No período de entressafra da soja de 2005 e 2006, foram realizadas inspeções em diferentes ambientes vegetais visando a constatar possíveis sítios de diapausa do percevejo, bem como avaliar a ocorrência de parasitismo nesses ambientes. Em cada coleta, foram individualizados 40 adultos em caixas gerbox contendo Ligustrum lucidum Ait. (Oleraceae, sendo os insetos observados durante um período de 40 dias. Os parasitoides foram armazenados em álcool 70% e encaminhados para identificação. O índice natural de parasitismo de adultos de E. heros amostrados no período de safra e de entressafra de soja variou de 0,0 a 5,0%, considerando-se as diferentes coletas realizadas, sendo Hexacladia smithii Ashmead (Hymenoptera: Encyrtidae a única espécie de parasitoide ocorrente. No período de entressafra, foi verificada maior incidência do percevejo E. heros em folhas secas de mangueira (Mangifera indica L. caídas no chão, evidenciando que esse ambiente é um importante sítio de diapausa para essa praga na região.Among the insects that attack soybeans, brown stink bug Euschistus heros (Fabricius is considered a major pest. The aim of this research was to evaluate the occurrence of parasitism in adults of brown stink bugs E. heros during soybean crop season and to identify diapause sites during the period of soybean absence in the great region of Dourados, MS. Adults of brown stick bugs were collected weekly in

Antonio Ricaurte: the creation of a portray as a child-hero 1830- 1881

Directory of Open Access Journals (Sweden)

Abel Fernando Martínez Martín

2012-01-01

(Ricaurte’s birth and death. Hence, it helps in the process of nation construction by appealing to the children heroes. Same example is Los Niños Héroes de Chapultepec in the oficial Mexican history. This paper collects a mixture of written sources with the National Independence iconographic sources.

THE PROBLEM OF BRAZILIAN HERO: 'O GUARANI' IN LITERATURE AND COMICS

Directory of Open Access Journals (Sweden)

Pascoal Farinaccio

2015-08-01

Full Text Available This article aims to analyze the aesthetic and ideological contradictions involved in the literary representation of the genuine Brazilian hero in the novel O Guarani, wrote by José de Alencar, and also in its graphical representation in the adaptation of this book to the language of comics. The context considered is that of a culture deeply marked by inferiority complex arising from its colonial history.

No Bursts Detected from FRB121102 in Two 5 hr Observing Campaigns with the Robert C. Byrd Green Bank Telescope

Science.gov (United States)

Price, Danny C.; Gajjar, Vishal; Rosenthal, Lee; Hallinan, Gregg; Croft, Steve; DeBoer, David; Hellbourg, Greg; Isaacson, Howard; Lebofsky, Matt; Lynch, Ryan; MacMahon, David H. E.; Men, Yunpeng; Xu, Yonghua; Liu, Zhiyong; Lee, Kejia; Siemion, Andrew

2018-02-01

Here, we report non-detection of radio bursts from Fast Radio Burst FRB 121102 during two 5-hour observation sessions on the Robert C. Byrd 100-m Green Bank Telescope in West Virginia, USA, on December 11, 2017, and January 12, 2018. In addition, we report non-detection during an abutting 10-hour observation with the Kunming 40-m telescope in China, which commenced UTC 10:00 January 12, 2018. These are among the longest published contiguous observations of FRB 121102, and support the notion that FRB 121102 bursts are episodic. These observations were part of a simultaneous optical and radio monitoring campaign with the the Caltech HIgh- speed Multi-color CamERA (CHIMERA) instrument on the Hale 5.1-m telescope.

Use of artificial substrates of different colors for oviposition by the brown stink bug Euschistus heros (Hemiptera, Pentatomidae

Directory of Open Access Journals (Sweden)

Diones Krinski

2013-09-01

Full Text Available Aiming to contribute to a rearing methodology for the brown stink bug, Euschistus heros, in the laboratory, we evaluated oviposition on artificial substrates of different colors. During six days, oviposition was evaluated daily, by counting the total number of eggs, number of clutches, and eggs/clutch. Females laid 12,463 eggs, in 1,677 clutches, resulting in an average of 7.28 ± 0.44 eggs/clutch. Black, brown, and green felt had the most eggs and clutches. The results demonstrated that many colors are suitable as oviposition substrate for E. heros, providing information for the mass rearing of this insect.

Surgical video recording with a modified GoPro Hero 4 camera

OpenAIRE

Lin LK

2016-01-01

Lily Koo Lin Department of Ophthalmology and Vision Science, University of California, Davis Eye Center, Sacramento, CA, USA Background: Surgical videography can provide analytical self-examination for the surgeon, teaching opportunities for trainees, and allow for surgical case presentations. This study examined if a modified GoPro Hero 4 camera with a 25 mm lens could prove to be a cost-effective method of surgical videography with enough detail for oculoplastic and strabismus surgery. Me...

The ritual person as a hero in J. P. Clark's Ozidi | Eghagha | Lagos ...

African Journals Online (AJOL)

Within the microcosmos of J.P. Clark's epic-drama Ozidi, a man can become a hero by fulfilling the demands of ritual. Ozidi is a posthumous avenger, bom to set right the wrong committed by conspirators who had murdered his father in cold blood. By avenging his father's death, he gives the man honour and prestige among ...

Guitar hero: From icon of popular culture to nostalgic self-design

OpenAIRE

Popadić Milan

2013-01-01

This paper aims to interpret the transformations of the “guitar hero”, from the icon of popular culture to models of nostalgic selfdesign, meaning transformations from generally recognizable figure in the context of popular culture to mimetic patterns based in medium of contemporary technologies. The phrase “guitar hero”, in its basic meaning represents a specific phenomenon in popular culture and popular music of the second half of the twentieth century. Guitar hero is a performer with...

Let’s sing our heroes: A comparison of biographical series for children in Kenya and South Africa

Directory of Open Access Journals (Sweden)

C.K. Muriungi

2004-07-01

Full Text Available In this article two series of biographies written for children, and dealing with prominent personalities in Kenya and South Africa, are compared. In the line of argumentation developed the aim is to examine the main features in these biographies, and to indicate the importance of biographies in the general field of children’s literature. By examining a sample text from each series the specific ways in which the authors mould these personalities into heroes of their countries are scrutinised. Furthermore the way in which gender is represented in the two series is also examined and it is argued that both men and women form part of any country’s gallery of heroes. Underlying the main argument of the article is the contention that biographies are important in perpetuating the stories of the two countries’ heroes: also in teaching the history of each country to the young. A general motif of hard work resonates in these works, and therefore it is asserted that individuals’ biographies can be used as anecdotes to communicate with and to inspire and encourage young readers. The authors of the biographies actually intervene by presenting children with role models. Furthermore these role models are not abstract fictional characters but real human beings who made great sacrifices for their countries – people with whom children are thus able to identify.

The Teacher's Role in Quality Classroom Interactions: Q&A with Dr. Drew Gitomer. REL Mid-Atlantic Teacher Effectiveness Webinar Series

Science.gov (United States)

Regional Educational Laboratory Mid-Atlantic, 2013

2013-01-01

In this webinar, Dr. Drew Gitomer, professor at Rutgers University, shared results from recent studies of classroom observations that helped participants understand both general findings about the qualities of classroom interactions and also the challenges to carrying out valid and reliable observations. This Q&A addressed the questions…

Pre-test analysis of protected loss of primary pump transients in CIRCE-HERO facility

Science.gov (United States)

Narcisi, V.; Giannetti, F.; Del Nevo, A.; Tarantino, M.; Caruso, G.

2017-11-01

In the frame of LEADER project (Lead-cooled European Advanced Demonstration Reactor), a new configuration of the steam generator for ALFRED (Advanced Lead Fast Reactor European Demonstrator) was proposed. The new concept is a super-heated steam generator, double wall bayonet tube type with leakage monitoring [1]. In order to support the new steam generator concept, in the framework of Horizon 2020 SESAME project (thermal hydraulics Simulations and Experiments for the Safety Assessment of MEtal cooled reactors), the ENEA CIRCE pool facility will be refurbished to host the HERO (Heavy liquid mEtal pRessurized water cOoled tubes) test section to investigate a bundle of seven full scale bayonet tubes in ALFRED-like thermal hydraulics conditions. The aim of this work is to verify thermo-fluid dynamic performance of HERO during the transition from nominal to natural circulation condition. The simulations have been performed with RELAP5-3D© by using the validated geometrical model of the previous CIRCE-ICE test section [2], in which the preceding heat exchanger has been replaced by the new bayonet bundle model. Several calculations have been carried out to identify thermal hydraulics performance in different steady state conditions. The previous calculations represent the starting points of transient tests aimed at investigating the operation in natural circulation. The transient tests consist of the protected loss of primary pump, obtained by reducing feed-water mass flow to simulate the activation of DHR (Decay Heat Removal) system, and of the loss of DHR function in hot conditions, where feed-water mass flow rate is absent. According to simulations, in nominal conditions, HERO bayonet bundle offers excellent thermal hydraulic behavior and, moreover, it allows the operation in natural circulation.

Sensory response of the egg parasitoid Telenomus podisi to stimuli from the bug Euschistus heros Resposta sensorial do parasitóide de ovos Telenomus podisi a estímulos provenientes do percevejo Euschistus heros

Directory of Open Access Journals (Sweden)

Cleonor Cavalcante Silva

2006-07-01

Full Text Available The objective of this work was to study the foraging behavior of Telenomus podisi Ashmead (Hymenoptera: Scelionidae in the presence of stimuli from its host, Euschistus heros (Heteroptera: Pentatomidae. The stimuli selected were: egg mass; virgin males and females; volatile extracts of sexually mature males and females; components of male sex pheromone; a component of the alarm pheromone, hexane and an empty cage as control. In a closed arena, the parasitoids were given the choice between single and combined stimuli presented to them simultaneously. To find the host egg, T. podisi primarily uses the sensory cues released from the male insects. The orientation toward odors of male chemical extract indicates that a source of kairomone was detected. Gas chromatographic analyses of this substance showed peak of methyl 2,6,10-trimethyltridecanoate, the main component of male sexual pheromone. The sensory response to methyl 2,6,10-trimethyltridecanoate confirms that this compound may act as a kairomone to find host eggs. Females and egg mass stimuli were weakly attractive to the parasitoid.O objetivo deste trabalho foi estudar o comportamento de busca de Telenomus podisi Ashmead (Hymenoptera: Scelionidae, em presença de estímulos provenientes do hospedeiro Euschitus heros (Heteroptera: Pentatomidae. As fontes de estímulos utilizadas foram: massas de ovos, machos e fêmeas virgens, extratos químicos de machos e fêmeas sexualmente maduros, componentes sintéticos do feromônio sexual do macho de E. heros, um composto sintético do feromônio de alarme, hexano e uma gaiola vazia como controle. Os testes foram conduzidos em arenas, onde foi dada a oportunidade para os parasitóides escolherem entre estímulos isolados e estímulos combinados. Para encontrar o hospedeiro, T. podisi utiliza principalmente estímulos olfativos emitidos pelos machos. As respostas sensoriais aos odores liberados pelos extratos químicos do macho indicam que uma fonte de

Social media and nutrition education: the food hero experience.

Science.gov (United States)

Tobey, Lauren N; Manore, Melinda M

2014-01-01

Social media can be a quick, low-cost, direct way for nutrition educators to broaden the scope of their targeted programs. The authors' viewpoint is that for social media to be effective, strategies for its use should follow "best practices" guidelines. This viewpoint suggests social media best practices based on experience gained from the Food Hero social marketing campaign. Understanding of how nutrition educators can take advantage of social media as a new mechanism for reaching their target audience is needed, including best practices for implementation, management, and evaluation. Copyright © 2014 Society for Nutrition Education and Behavior. Published by Elsevier Inc. All rights reserved.

From Heroes and Heroines to Hermaphrodites: Emasculation or Emancipation of School Leaders and Leadership?

Science.gov (United States)

Sugrue, Ciaran

2009-01-01

In the fast paced, fluid contemporary world, and in a headlong rush to invent the future, there is a tendency to jettison aspects of the past as flotsam and jetsam, unworthy of a place in steerage into the future. This paper argues that is some respects the ordinary heroes and heroines who enact school leaderships, and from their practice…

Six Small Boys and Marshall Dillon: Contribution of Hero Identification to Improved In School Behavior

Science.gov (United States)

Whiting, Anita

1970-01-01

Summarized are several theoretical positions on identification, together with one application in a case study. An autographed picture of their hero was presented to each of six uncerachieving and disruptive boys in an effort to provide an interested" adult role model for them. The school staff reinforced this identification with projects in which…

Warrior Heroes and Little Green Men: Soldiers, Military Training, and the Construction of Rural Masculinities.

Science.gov (United States)

Woodward, Rachel

2000-01-01

Examines military training in the United Kingdom; the construction of military masculinities, particularly the ideal type of the warrior hero; and the role of the countryside (as the training location) and rurality (as a social construction) in that process. Argues that becoming an infantry soldier means being molded to this hegemonic model of…

Introducing Statistical Research to Undergraduate Mathematical Statistics Students Using the Guitar Hero Video Game Series

Science.gov (United States)

Ramler, Ivan P.; Chapman, Jessica L.

2011-01-01

In this article we describe a semester-long project, based on the popular video game series Guitar Hero, designed to introduce upper-level undergraduate statistics students to statistical research. Some of the goals of this project are to help students develop statistical thinking that allows them to approach and answer open-ended research…

75 FR 56858 - Improvements to the Supplemental Security Income Program-Heroes Earnings Assistance and Relief...

Science.gov (United States)

2010-09-17

... number, 1-800-772-1213, or TTY 1-800-325-0778, or visit our Internet site, Social Security Online, at... SOCIAL SECURITY ADMINISTRATION 20 CFR Part 416 [Docket No. SSA-2009-0017] RIN 0960-AH00 Improvements to the Supplemental Security Income Program--Heroes Earnings Assistance and Relief Tax Act of 2008...

"Tugboat Annie:" nursing's hero of Pearl Harbor--Grace Lally (1897-1983).

Science.gov (United States)

Hawkins, J W; Matthews, I

1991-01-01

In 1991 we will mark the 50th anniversary of the Japanese attack on Pearl Harbor. Few nurses know that the Chief Nurse aboard the USS Solace, the only hospital ship in port on that fateful day, played a critical role in caring for the survivors. Grace Lally's calm, professional manner, along with her sensitivity to the needs of her patients, her 12 nurses, and the crew of the Solace made her a hero. This study is an investigation of her role on December 7, 1941, and her contributions as a career military nurse.

Wellbeing in the Secondary Music Classroom: Ideas from Hero's Journeys and Online Gaming

Science.gov (United States)

Countryman, June; Stewart Rose, Leslie

2017-01-01

This paper explores the idea that wellbeing and healthy development should be the central goal of school music programs. After establishing a framework of student wellbeing, the metaphor of rites of passage experiences is employed--through Joseph Campbell's hero's journey and Jane McGonigal's analysis of the benefits of online gaming--as one way…

How many new cancer patients in Europe will require radiotherapy by 2025? An ESTRO-HERO analysis

DEFF Research Database (Denmark)

Borras, Josep M; Lievens, Yolande; Barton, Michael

2016-01-01

BACKGROUND: The objective of this HERO study was to assess the number of new cancer patients that will require at least one course of radiotherapy by 2025. METHODS: European cancer incidence data by tumor site and country for 2012 and 2025 was extracted from the GLOBOCAN database. The projection ...

The Gay Artist as Tragic Hero in The Picture of Dorian Gray

OpenAIRE

Alley, Henry

2009-01-01

In his article "The Gay Artist as Tragic Hero in The Picture of Dorian Gray" Henry M. Alley discusses the central artistic figure in Oscar Wilde's novel, Basil Hallward. As the novel's tragic protagonist, he commands the most pity and fear and serves as the most dynamic member of the dramatis personae. Alley contextualizes his discussion within Aristotle's Poetics, contemporary criticism, as well as Wilde's own comments. In addition, Alley looks at Hallward's attempt to hide or censor his gay...

Zmarli mówią - dialogi elizejskie, najwybitniejsi twórcy i ich utwory

OpenAIRE

Urbańska, Monika

2005-01-01

The study deals with the history of development of the genre dialogues of the dead. Most authors of the dialogues drew inspiration from creation of a poet Lukian from Samosat. The genre especially flourished in XVIIIth century France. The greatest French authors of dialogues were: Boileau, Fontenelle and Fénelon. Boileau was the author of the first significiant dialogues U's Heros de roman, dialogue á la maniere de iMcien which was published in 1773. Fontenclle made his débu...

Fecundity and longevity of Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae

Directory of Open Access Journals (Sweden)

Cristiane Ramos Jesus-Barros

2017-12-01

Full Text Available Bactrocera carambolae Drew & Hancock is an exotic species considered a quarantine pest in Brazil, with distribution limited to the states of Amapá and Roraima. Knowledge of its biology under Brazilian conditions is still limited. The objective of this work was to determine the fecundity and longevity of B. carambolae females, reared on artificial diet, under laboratory conditions. The experiment was carried out at Embrapa Amapá, where 20 newly emerged B. carambolae couples were selected (F3 generation. Each couple was placed in a plastic cage containing feed, distilled water and an artificial oviposition device and stored in an air-conditioned room (26 ± 1°C, 60 ± 10% R. H. and 12-hour photoperiod. The eggs deposited on each device were counted daily. Mean survival was 90.70 ± 9.97 days and the maximum longevity was 150 days. The mean duration of the pre-oviposition period was 25.15 ± 3.54 days and the oviposition period was 62.73 ± 7.84 days. Fecundity was variable over time, with an oviposition peak on the 28th day. The mean number of eggs per female was 1,088.26 ± 167.82. These results suggest that B. carambolae uses high fecundity and longevity as a reproductive strategy.

PLATO’S INVISIBLE HERO OF DEMOCRACY: SOCRATES IN THE REPUBLIC AND CRITO

Directory of Open Access Journals (Sweden)

RICHARD J. KLONOSKI

2014-11-01

Full Text Available The author argues that a careful reading of Republic VIII 557a-558a, coupled with an analysis of the mythic backdrop to the conversation between Socrates and Crito in the Crito, reveals that Plato intends the reader to see Socrates as an invisible moral and political hero of the democratic polis even though Socrates was, for much of his life, a critic of the Athenian democracy, and even given the fact that Socrates doesn’t give democracy the highest standing among the political regimes in the Republic. The author discusses the myth of Theseus and the Minotaur and Hesiod’s races of man, in order to show that in the Republic and the Crito Socrates is portrayed as a hero, specifically one who supports democracy as the only regime in which philosophy and the philosopher can exist. Finally, the author argues that Socrates’ final act of heroism in the Crito is the act of remaining in prison, in large measure out of respect for the laws of Athens and its democratic legal procedures, a respect evident in the very structure of the conversation among Socrates, Crito, and the Athenian laws. It is suggested that the conversation in the Crito is indeed an imitation of a democratic legal procedure that would likely have been used to convict Socrates of a crime against the democracy were he to have followed Crito’s advice and escaped from prison.

Characterization of susceptibility and resistance responses to potato cyst nematode (Globodera spp.) infection of tomato lines in the absence and presence of the broad-spectrum nematode resistance Hero gene.

Science.gov (United States)

Sobczak, Miroslaw; Avrova, Anna; Jupowicz, Justyna; Phillips, Mark S; Ernst, Karin; Kumar, Amar

2005-02-01

The tomato Hero A gene is the only member of a multigene family that confers a high level (>80%) of resistance to all the economically important pathotypes of potato cyst nematode (PCN) species Globodera rostochiensis and G. pallida. Although the resistance levels of transgenic tomato lines were similar to those of the tomato line LA1792 containing the introgressed Hero multigene family, transgenic potato plants expressing the tomato Hero A gene are not resistant to PCNs. Comparative microscopy studies of in vitro infected roots of PCN-susceptible tomato cv. Money Maker, the resistant breeding line LA1792, and transgenic line L10 with Ro1 pathotype have revealed no statistically significant difference in the number of juveniles invading roots. However, syncytia (specialized feeding cells) induced in LA1792 and L10 roots mostly were found to have degenerated a few days after their induction, and a few surviving syncytia were able to support only the development of males rather than females. Thus, the ratio between males and females was biased towards males on LA1792 and L10 roots. A series of changes occur in resistant plants leading to formation of a layer of necrotic cells separating the syncytium from stellar conductive tissues and this is followed by degradation of the syncytium. Although the Hero A gene is expressed in all tissues, including roots, stems, leaves, and flower buds, its expression is upregulated in roots in response to PCN infection. Moreover, the expression profiles of the Hero A correlates with the timing of death of the syncytium.

Blood hero: An application for encouraging the blood donation by applying gamification.

Science.gov (United States)

Domingos, Daniela C L; Lima, Luis F S G; Messias, Thiago F; Feijo, Jose V L; Diniz, Anthony A R; Soares, Heliana B

2016-08-01

There is a strong need for actions to supply the blood demand in the World. Based on this fact, it was designed an application, named `Blood Hero', by applying the `gamification' concept, which allows users to be rewarded by social acts related to the blood donation. It takes advantage of the application of mobile devices, implementing a specific social network, to attract and retain blood donators. This application makes possible an interaction between users and blood centers, and is being tested aiming at evaluating its acceptance and impact in bloodstocks.

Conception, complicated pregnancy, and labour of gods and heroes in Greek mythology.

Science.gov (United States)

Iavazzo, Christos; Trompoukis, Constantinos; Sardi, Thalia; Falagas, Matthew E

2008-01-01

Pregnancy and labour are holy moments in a woman's life. Even in Greek mythology we can find descriptions of them. We searched in the Greek myths to find descriptions of labours of ancient heroes and gods. We identified descriptions of extracorporeal fertilization, superfecundation, ectopic pregnancy, preterm labour, prolonged pregnancy and Caesarean section. The use of imagination could help the reader to find similarities in present or future developments in the field of obstetrics. It could be concluded that various aspects of modern obstetrical practice are described in Greek mythology.

A community responds to collective trauma: an ecological analysis of the James Byrd murder in Jasper, Texas.

Science.gov (United States)

Wicke, Thomas; Silver, Roxane Cohen

2009-12-01

The brutal murder of James Byrd Jr. in June 1998 unleashed a storm of media, interest groups, high profile individuals and criticism on the Southeast Texas community of Jasper. The crime and subsequent response-from within the community as well as across the world-engulfed the entire town in a collective trauma. Using natural disaster literature/theory and employing an ecological approach, Jasper, Texas was investigated via an interrupted time series analysis to identify how the community changed as compared to a control community (Center, Texas) on crime, economic, health, educational, and social capital measures collected at multiple pre- and post-crime time points between 1995 and 2003. Differences-in-differences (DD) analysis revealed significant post-event changes in Jasper, as well as a surprising degree of resilience and lack of negative consequences. Interviews with residents conducted between March 2005 and 2007 identified how the community responded to the crisis and augmented quantitative findings with qualitative, field-informed interpretation. Interviews suggest the intervention of external organizations exacerbated the severity of the events. However, using strengths of specific local social institutions-including faith based, law enforcement, media, business sector and civic government organizations-the community effectively responded to the initial threat and to the potential negative ramifications of external entities.

Biographies of Heroes. Grade 2 Model Lesson for Standard 5. California History-Social Science Course Models.

Science.gov (United States)

Porter, Priscilla

Students focus on people who make a difference. The unit features men and women whose achievements have had a direct or indirect influence in the students' lives. These individuals include heroes from long ago and the recent past along with people who are currently active in the local community. The unit is crafted around biographies. It aims to…

Batman - A hero of the American monomyth : An exploration of comic book superheroes

OpenAIRE

Paalanen, Pekka Johan Karoly

2012-01-01

Heroes play an integral part in fiction in our society, especially within the realm of comic books and their film adaptations. Joseph Campbell introduced the concept of the “classic monomyth”; an underlying narrative structure and a heroic archetype whose characteris-tics are apparent in every mythical story from Prometheus to Luke Skywalker. The clas-sical monomyth is an underlying narrative of how a heroic figure travels out into a world of wonder on an adventure, returns and finds his/her ...

Ten Simple Rules for the Care and Feeding of Scientific Data

OpenAIRE

Goodman, A.; Pepe, A.; Blocker, A.W.; Borgman, C.L.; Cranmer, K.; Crosas, M.; Di Stefano, R.; Gil, Y; Groth, P.T.; Hedstrom, M.; Hogg, D.W.; Kashyap, V.; Mahabal, A.; Siemiginowska, A.; Slavkovic, A.

2014-01-01

In the early 1600s, Galileo Galilei turned a telescope toward Jupiter. In his log book each night, he drew to-scale schematic diagrams of Jupiter and some oddly moving points of light near it. Galileo labeled each drawing with the date. Eventually he used his observations to conclude that the Earth orbits the Sun, just as the four Galilean moons orbit Jupiter. History shows Galileo to be much more than an astronomical hero, though. His clear and careful record keeping and publication style no...

Entre Venus y Marte: el viaje del héroe en Desertor (Between Venus and Mars: The Journey of the Hero in Desertor

Directory of Open Access Journals (Sweden)

Grethel Ramírez Villalobos

2015-11-01

Full Text Available En este artículo se estudia la figura del héroe en la novela Desertor, del costarricense Juan Ramón Rojas. Este relato tiene su ambiente en El Salvador y analiza algunos de los principales hechos históricos de la década de 1980. El protagonista del relato se ve impulsado a revisar sus propias convicciones políticas y emprende un viaje, que resulta análogo a los periplos de los héroes mitológicos. A partir del examen de la conformación del héroe, se discuten los simbolismos literarios y los principales asuntos tratados en la novela. This article addresses the figure of the hero in the novel Desertor, by the Costa Rican Juan Ramón Rojas. It takes place in El Salvador and analyzes some of the main historical events of the 1980s. The protagonist is forced to review his own political convictions and sets out on a journey analogous to those of mythological heroes. Considering the analysis of the conformation of the hero, literary symbolism and the main topics of the novel are examined.

A Formative Evaluation of Healthy Heroes: A Photo Comic Book-Social Cognitive Theory Based Obesity Prevention Program

Science.gov (United States)

Branscum, Paul; Housley, Alexandra; Bhochhibhoya, Amir; Hayes, Logan

2016-01-01

Purpose: Low consumption of fruits and vegetables is often associated with poor diet quality, and childhood obesity. The purpose of this study was to assess the feasibility, and conduct a formative evaluation, of Healthy Heroes, an innovative, social cognitive theory-based program that uses child created photo-comic books to promote fruit and…

The human error rate assessment and optimizing system HEROS - a new procedure for evaluating and optimizing the man-machine interface in PSA

International Nuclear Information System (INIS)

Richei, A.; Hauptmanns, U.; Unger, H.

2001-01-01

A new procedure allowing the probabilistic evaluation and optimization of the man-machine system is presented. This procedure and the resulting expert system HEROS, which is an acronym for Human Error Rate Assessment and Optimizing System, is based on the fuzzy set theory. Most of the well-known procedures employed for the probabilistic evaluation of human factors involve the use of vague linguistic statements on performance shaping factors to select and to modify basic human error probabilities from the associated databases. This implies a large portion of subjectivity. Vague statements are expressed here in terms of fuzzy numbers or intervals which allow mathematical operations to be performed on them. A model of the man-machine system is the basis of the procedure. A fuzzy rule-based expert system was derived from ergonomic and psychological studies. Hence, it does not rely on a database, whose transferability to situations different from its origin is questionable. In this way, subjective elements are eliminated to a large extent. HEROS facilitates the importance analysis for the evaluation of human factors, which is necessary for optimizing the man-machine system. HEROS is applied to the analysis of a simple diagnosis of task of the operating personnel in a nuclear power plant

Crustal structure of the Transantarctic Mountains, Ellsworth Mountains and Marie Byrd Land, Antarctica: constraints on shear wave velocities, Poisson's ratios and Moho depths

Science.gov (United States)

Ramirez, C.; Nyblade, A.; Emry, E. L.; Julià, J.; Sun, X.; Anandakrishnan, S.; Wiens, D. A.; Aster, R. C.; Huerta, A. D.; Winberry, P.; Wilson, T.

2017-12-01

A uniform set of crustal parameters for seismic stations deployed on rock in West Antarctica and the Transantarctic Mountains (TAM) has been obtained to help elucidate similarities and differences in crustal structure within and between several tectonic blocks that make up these regions. P-wave receiver functions have been analysed using the H-κ stacking method to develop estimates of thickness and bulk Poisson's ratio for the crust, and jointly inverted with surface wave dispersion measurements to obtain depth-dependent shear wave velocity models for the crust and uppermost mantle. The results from 33 stations are reported, including three stations for which no previous results were available. The average crustal thickness is 30 ± 5 km along the TAM front, and 38 ± 2 km in the interior of the mountain range. The average Poisson's ratios for these two regions are 0.25 ± 0.03 and 0.26 ± 0.02, respectively, and they have similar average crustal Vs of 3.7 ± 0.1 km s-1. At multiple stations within the TAM, we observe evidence for mafic layering within or at the base of the crust, which may have resulted from the Ferrar magmatic event. The Ellsworth Mountains have an average crustal thickness of 37 ± 2 km, a Poisson's ratio of 0.27, and average crustal Vs of 3.7 ± 0.1 km s-1, similar to the TAM. This similarity is consistent with interpretations of the Ellsworth Mountains as a tectonically rotated TAM block. The Ross Island region has an average Moho depth of 25 ± 1 km, an average crustal Vs of 3.6 ± 0.1 km s-1 and Poisson's ratio of 0.30, consistent with the mafic Cenozoic volcanism found there and its proximity to the Terror Rift. Marie Byrd Land has an average crustal thickness of 30 ± 2 km, Poisson's ratio of 0.25 ± 0.04 and crustal Vs of 3.7 ± 0.1 km s-1. One station (SILY) in Marie Byrd Land is near an area of recent volcanism and deep (25-40 km) seismicity, and has a high Poisson's ratio, consistent with the presence of partial melt in the crust.

Social influence of a religious hero: the late Cardinal Stephen Kim Sou-hwan's effect on cornea donation and volunteerism.

Science.gov (United States)

Bae, Hyuhn-Suhck; Brown, William J; Kang, Seok

2011-01-01

This study examined the mediated influence of a celebrated religious hero in South Korea, Cardinal Stephen Kim, through two forms of involvement--parasocial interaction and identification--on intention toward cornea donation and volunteerism, and it investigated how the news media diffused of his death. A structural equation modeling analysis with a Web-based voluntary survey of more than 1,200 people in South Korea revealed a multistep social influence process, beginning with parasocial interaction with Cardinal Kim, leading to identification with him, which predicted intention toward cornea donation and volunteerism. Additional investigations found that news of Cardinal Kim's death diffused rapidly through media and interpersonal communication. Results of this study demonstrate that religious leaders who achieve a celebrity hero status can prompt public discussion of important issues rather quickly through extensive media coverage, enabling them to promote prosocial behavior and positively affect public health.

Heroes or Health Victims?: Exploring How the Elite Media Frames Veterans on Veterans Day.

Science.gov (United States)

Rhidenour, Kayla B; Barrett, Ashley K; Blackburn, Kate G

2017-11-27

We examine the frames the elite news media uses to portray veterans on and surrounding Veterans Day 2012, 2013, 2014, and 2015. We use mental health illness and media framing literature to explore how, why, and to what extent Veterans Day news coverage uses different media frames across the four consecutive years. We compiled a Media Coverage Corpora for each year, which contains the quotes and paraphrased remarks used in all veterans news stories for that year. In our primary study, we applied the meaning extraction method (MEM) to extract emergent media frames for Veterans Day 2014 and compiled a word frequency list, which captures the words most commonly used within the corpora. In post hoc analyses, we collected news stories and compiled word frequency lists for Veterans Day 2012, 2013, and 2015. Our findings reveal dissenting frames across 2012, 2013, and 2014 Veterans Day media coverage. Word frequency results suggest the 2012 and 2013 media frames largely celebrate Veterans as heroes, but the 2014 coverage depicts veterans as victimized by their wartime experiences. Furthermore, our results demonstrate how the prevailing 2015 media frames could be a reaction to 2014 frames that portrayed veterans as health victims. We consider the ramifications of this binary portrayal of veterans as either health victims or heroes and discuss the implications of these dueling frames for veterans' access to healthcare resources.

El mito de hero y leandro: Algunas Fuentes grecolatinas y su pervivencia en el siglo de oro Español

Directory of Open Access Journals (Sweden)

María Jesús Franco Durán

1994-12-01

Full Text Available El mito de Hero y Leandro no se relaciona con ningún ciclo heroico concreto sino que, como tantas otras historias, vive independiente del resto. Es posible localizar la leyenda en un entomo geográfico bien delimitado, el Helesponto, entre las ciudades de Sesto, en Ia ribera europea, y Abido, en Ia asiatica, y cuya distancia ya había sido fijada por los antiguos, casi con total unanimidad, en 1295 metros. Museo es el autor que nos relata la fábula con más profundidad y detalle, dedicándole al asunto un poema completo que consta de trescientos cuarenta y tres versos. Leandro es un joven residente en Abido. Hero es una mujer muy bella de Sesto, sacerdotisa de Afrodita que se mantiene virgen, ignorando el matrimonio y viviendo en una torre con Ia única compañía de una sirvienta.

The Breakthrough Listen Search for Intelligent Life: A Wideband Data Recorder System for the Robert C. Byrd Green Bank Telescope

Science.gov (United States)

MacMahon, David H. E.; Price, Danny C.; Lebofsky, Matthew; Siemion, Andrew P. V.; Croft, Steve; DeBoer, David; Enriquez, J. Emilio; Gajjar, Vishal; Hellbourg, Gregory; Isaacson, Howard; Werthimer, Dan; Abdurashidova, Zuhra; Bloss, Marty; Brandt, Joe; Creager, Ramon; Ford, John; Lynch, Ryan S.; Maddalena, Ronald J.; McCullough, Randy; Ray, Jason; Whitehead, Mark; Woody, Dave

2018-04-01

The Breakthrough Listen Initiative is undertaking a comprehensive search for radio and optical signatures from extraterrestrial civilizations. An integral component of the project is the design and implementation of wide-bandwidth data recorder and signal processing systems. The capabilities of these systems, particularly at radio frequencies, directly determine survey speed; further, given a fixed observing time and spectral coverage, they determine sensitivity as well. Here, we detail the Breakthrough Listen wide-bandwidth data recording system deployed at the 100 m aperture Robert C. Byrd Green Bank Telescope. The system digitizes up to 6 GHz of bandwidth at 8 bits for both polarizations, storing the resultant 24 GB s‑1 of data to disk. This system is among the highest data rate baseband recording systems in use in radio astronomy. A future system expansion will double recording capacity, to achieve a total Nyquist bandwidth of 12 GHz in two polarizations. In this paper, we present details of the system architecture, along with salient configuration and disk-write optimizations used to achieve high-throughput data capture on commodity compute servers and consumer-class hard disk drives.

In Search for H.E.R.O among Filipino Teachers: The Relationship of Positive Psychological Capital and Work-Related Outcomes

Science.gov (United States)

Ganotice, Fraide A., Jr.; Yeung, Susanna S.; Beguina, Leonora A.; Villarosa, Jonalyn B.

2016-01-01

Recent positive psychology literature has consistently demonstrated the link between PsyCap (composite score of hope, efficacy, resilience, and optimism--HERO) and employee productivity. However, most of these studies were conducted in industrial or organizational settings and have mostly examined the independent effect of hope, efficacy,…

Gênero, heroísmo e patriotismo em obras de literatura para crianças

Directory of Open Access Journals (Sweden)

Rosa Maria Hessel Silveira

2012-10-01

Full Text Available No presente artigo analisamos representações de mulher presentes em obrasliterárias destinadas a crianças escolarizadas das primeiras décadas do século XX: CultoCívico, escrita por João Roque Moreira Gomes, que circulou entre professores sul-riograndenses, e Heroínas e Mártires Brasileiras, de autoria de Renato Sêneca Fleury,dedicada principalmente a meninas leitoras. Estas coletâneas de poesia e prosa sãomarcadas por um ideário patriótico e forte inspiração cívica, valores característicos doperíodo. Através de uma análise discursiva, buscamos delinear certo perfil feminino,observando que nos textos examinados figuram mulheres devotadas ao lar e à família, queassumem a maternidade como condição natural e que educam os filhos para o patriotismo,a honradez e o respeito às instituições legais. Figuram ainda mulheres heroínas que, emcontextos de guerra, assumem frentes de combate, lutando ao lado de seus maridos, ouainda, como mulheres consagradas à caridade, atuam em hospitais de campanha, cuidandodos soldados com zelo maternal. Tais obras apresentam e enaltecem acontecimentosprotagonizados por mulheres e homens e, através de exemplos edificantes, colaboram paranaturalizar determinados atributos femininos, ensinando sobre patriotismo e sobre práticasdesejáveis naquele contexto histórico.

A Positive Psychology Intervention in a Hindu Community: The Pilot Study of the Hero Lab Curriculum.

Science.gov (United States)

Sundar, Siddhi; Qureshi, Adil; Galiatsatos, Panagis

2016-12-01

India has high rates of mental health issues among its youth and low-income communities experience a disproportionate amount of depression and suicide. Positive psychology, the act of promoting well-being, could be used as a tool to promote wellness and help improve the mental health of youth living in slum areas of India. A pilot positively psychology program, "The Hero Lab", was conducted in a migratory slum in Worli, Mumbai, with trained Hindu community leaders implementing the interventions toward at-risk Hindu youth. The curriculum's impact showed statistical improvement (p < 0.001) in happiness (General Happiness Scale from 11.24 ± 1.56 to 19.08 ± 3.32), grit (Grit Survey from 2.23 ± 0.34 to 3.24 ± 0.67), empathy (Toronto Empathy Questionnaire from 24.92 ± 3.27 to 41.96 ± 8.41), and gratitude (Gratitude Survey from 16.88 ± 3.47 to 27.98 ± 6.59). While a pilot study, the Hero Lab curriculum demonstrates that positive psychology interventions may be an important tool in improving mental health in at-risk children.

Renaissance Epyllions: A Comparative Reading of Christopher Marlowe's "Hero and Leander," Thomas Lodge's "Scylla's Metamorphosis" and Francis Beaumont's "Salmacis and Hermaphroditus"

Science.gov (United States)

Mahmoudi, Yazdan

2016-01-01

The present paper is supposed to compare and contrast three of these masterpieces written the Renaissance period. The epyllions under study are Christopher Marlowe's "Hero and Leander," Thomas Lodge's "Scylla's Metamorphosis" and Francis Beaumont's "Salmacis and Hermaphroditus." Bush believes that "the influence…

The Traces of “New Character” in Uzbek Short Story Heroes Based on Two Examples of Uzbek Short Stories of the Present Day

Directory of Open Access Journals (Sweden)

Veli Savaş Yelok

2014-12-01

Full Text Available The era following the Uzbek independence resulted in a renaissance in Uzbek life. This process in which a renaissance was experienced, also affected the material and moral elements that shape their view of life. When this situation affected the way people understand life, this reform of the Uzbek people naturally formed “the new era”. This new era demanded new ways of thinking from those who lived in that era. The effect of this development and change on people’s minds and their way of understanding and thinkingand its description found itself in literary life. In the short stories published following the independence, the spirit of the time and the different fates of those people who lived in that era were reflected. As a result, writers created the heroes of today through the change experienced by people in their inner world who lived in the same era as the writers. As a general principle, creating a hero is seen as the first issue in the literature of every era. This is so because the hero in the work of literature is the tool that reflects the inner and outer world of the people of a specific era. All the nice and ugly things in a person’s life -starting from the person’s lifestyle and continuing to the end of his life- are passed onto the hero’s thoughts and actions. Describing the changes constantly observed in a hero’s character, reflecting these by forming a direct relationship with the era is comparatively easier in a short story when compared to other genres. In this article, information on the development of short story in present day Uzbek Literature is presented. In addition, the reflection of “the person of the new era” observed in the heroes in the stories “The Author” and “The Trick of Gumshoe Jacob” written by Erkin A‘zam and Xurshid Dostmuhammad who have gained the admiration of readers in their works following the independence is studied.

HERO: a space based low frequency interferometric observatory for heliophysicsenabled by novel vector sensor technology

Science.gov (United States)

2017-04-07

baseline of HeRO-S or HeRO-G will detect type II and III solar bursts over several decades of intensity and frequency. Shown for comparison are an...and disturbances in a key region of the helio-11 sphere, from two to tens of solar radii, using interferometric observations of solar12 radio bursts at...fronts14 will be traced via type II burst emissions, and heliospheric magnetic field geometries15 will be probed by measuring precise trajectories of type

Infarto agudo de miocardio inducido por heroína

Directory of Open Access Journals (Sweden)

Beatriz Wills

2014-09-01

Full Text Available El uso mundial de drogas recreativas ha alcanzado proporciones preocupantes, al punto de amenazar la estabilidad socioeconómica de los países. Se estima que en los países desarrollados una de cada 4 personas ha utilizado drogas recreativas en algún momento de su vida. Por tanto, es frecuente que los médicos se enfrenten a cuadros de intoxicación secundaria al abuso de estas drogas. Además de sus efectos en el sistema nervioso central, también producen cambios significativos a nivel cardiovascular, responsables de una cantidad no despreciable de morbimortalidad relacionada con estas. En este artículo se expone un caso de infarto agudo de miocardio secundario al consumo de heroína, se revisan los efectos sistémicos de esta droga y se examinan el manejo y los mecanismos estudiados que explican esta relación.

Toxicity of Piper aduncum (Piperaceae) Essential Oil Against Euschistus heros (F.) (Hemiptera: Pentatomidae) and Non-Effect on Egg Parasitoids.

Science.gov (United States)

Turchen, L M; Piton, L P; Dall'Oglio, E L; Butnariu, A R; Pereira, M J B

2016-10-01

Plant essential oils have been recognized as significant natural resources for insecticides. Herein, we have assessed the toxicity of the essential oil of Piper aduncum (Piperaceae) against Euschistus heros (F.) (Hemiptera: Pentatomidae), a key soybean pest in Neotropical America. In addition, we have assessed its effect on the performance of egg parasitoids. The essential oil was obtained from the leaves of P. aduncum via hydrodistillation. Subsequently, bioassays of the concentration response to eggs (contact and immersion methods), nymphs, and adults (topical application) were conducted, to assess the lethal effects on the stink bug. We also evaluated the performance of parasitism and adult emergence of egg parasitoids, when the host eggs were treated with essential oil. In the egg bioassay, both exposure methods were efficient for unviable eggs (immersion LC 50  = 15.64 mg mL -1 ; contact LC 50  = 21.29 mg mL -1 ), with the highlight on the immersion method. The bioassay with nymphs indicated a higher toxicity of essential oil, with lower concentrations (LC 50  = 11.37 mg mL -1 ) being required to cause the death of insects. For adults, a reduction in survival of insects was observed, and consequently, there was a reduction in the number of individuals in the next generation. Although the essential oil was toxic to E. heros, it exhibited lower toxicity for egg parasitoids, as there was no effect on parasitism and the emergence of wasps. We discuss likely explanations for such selectivity. In summary, we found that the essential oil was promising for the control of E. heros, because it caused deleterious effects at all development stages of the stink bug and had no effect on parasitism and emergence of the egg parasitoids, which suggested compatibility with biological control.

Guitar Hero: novas práticas de consumo e cultura auditiva na música através dos videogames

Directory of Open Access Journals (Sweden)

NOGUEIRA, Bruno Pedrosa

2009-12-01

Full Text Available This paper introduces the context of musical videogames, based on the experience presented in the Guitar Hero series. From its relations with mass popular music and music industry is created a reflection based on two research hypothesis: how those games will influence the way we consume and listen to music today?

No impact of Bt soybean that express Cry1Ac protein on biological traits of Euschistus heros (Hemiptera, Pentatomidae and its egg parasitoid Telenomus podisi (Hymenoptera, Platygastridae

Directory of Open Access Journals (Sweden)

Gabriela Vieira Silva

2014-09-01

Full Text Available No impact of Bt soybean that express Cry1Ac protein on biological traits of Euschistus heros (Hemiptera, Pentatomidae and its egg parasitoid Telenomus podisi (Hymenoptera, Platygastridae. Biological traits of the stink bug Euschistus heros and its main biological control agent Telenomus podisi were evaluated under controlled environmental conditions (25 ± 2ºC; 60 ± 10% RH; and 14/10 h photoperiod by placing first instar nymphs into Petri dishes with pods originating from two soybean isolines (Bt-soybean MON 87701 × MON 89788, which expresses the Cry1Ac protein, and its near non-Bt isoline A5547 where they remained until the adult stage. Due to gregarious behavior exhibited by first instar nymphs, they were individualized only when at the second instar. Adults were separated by sex and weighed, and pronotum width of each individual was subsequently measured. They were placed into plastic boxes containing soybean grains of the same soybean isoline as food source. Egg viability and female fecundity were assessed in adult individuals. Adult females of T. podisi (up to 24h old were placed with eggs of E. heros from mothers reared on both soybean isolines. Nymphal development time, insect weight, pronotum width, sex ratio, female fecundity, and egg viability (% emergence of Euschistus heros did not differ between treatments. Eggto-adult development time, female longevity, sex ratio, and percentage of parasitized eggs were not impacted by the Bt-soybean (expressing Cry1Ac protein. Results indicate that the Bt-soybean, MON 87701 × MON 89788, has no direct significant impact on the two studied species.

Process-based coastal erosion modeling for Drew Point (North Slope, Alaska)

Science.gov (United States)

Ravens, Thomas M.; Jones, Benjamin M.; Zhang, Jinlin; Arp, Christopher D.; Schmutz, Joel A.

2012-01-01

A predictive, coastal erosion/shoreline change model has been developed for a small coastal segment near Drew Point, Beaufort Sea, Alaska. This coastal setting has experienced a dramatic increase in erosion since the early 2000’s. The bluffs at this site are 3-4 m tall and consist of ice-wedge bounded blocks of fine-grained sediments cemented by ice-rich permafrost and capped with a thin organic layer. The bluffs are typically fronted by a narrow (∼ 5  m wide) beach or none at all. During a storm surge, the sea contacts the base of the bluff and a niche is formed through thermal and mechanical erosion. The niche grows both vertically and laterally and eventually undermines the bluff, leading to block failure or collapse. The fallen block is then eroded both thermally and mechanically by waves and currents, which must occur before a new niche forming episode may begin. The erosion model explicitly accounts for and integrates a number of these processes including: (1) storm surge generation resulting from wind and atmospheric forcing, (2) erosional niche growth resulting from wave-induced turbulent heat transfer and sediment transport (using the Kobayashi niche erosion model), and (3) thermal and mechanical erosion of the fallen block. The model was calibrated with historic shoreline change data for one time period (1979-2002), and validated with a later time period (2002-2007).

Christopher R. Fee & David A. Leeming. Gods, Heroes, and Kings. The Battle for Mythic Britain

Directory of Open Access Journals (Sweden)

Sophie ALATORRE

2006-06-01

Full Text Available A reassessment of British mythology has long been overdue, and Gods, Heroes and Kings is to be regarded as a stimulating contribution which helps to situate Anglo-Saxon tales in the mainstream of Medieval literature. Myths, pagan and Judeo-Christian beliefs, classical narratives: such vast material forms the backcloth Christopher F. Fee and David A. Leeming have undertaken to explore, thanks to an erudite comparative approach. Obviously, their book first aims at giving readers a new image of ...

The Social Perception of Heroes and Murderers: Effects of Gender-Inclusive Language in Media Reports

OpenAIRE

Hansen, Karolina; Littwitz, Cindy; Sczesny, Sabine

2016-01-01

The way media depict women and men can reinforce or diminish gender stereotyping. Which part does language play in this context? Are roles perceived as more gender-balanced when feminine role nouns are used in addition to masculine ones? Research on gender-inclusive language shows that the use of feminine-masculine word pairs tends to increase the visibility of women in various social roles. For example, when speakers of German were asked to name their favorite “heroine or hero in a novel,” t...

Diapause and different seasonal morphs of Euschistus heros (Fabr.) (Hemiptera: Pentatomidae) in Northern Parana State; Diapausa e diferentes formas sazonais em Euschistus heros (Fabr.) (Hemiptera: Pentatomidae) no Norte do Parana, Brazil

Energy Technology Data Exchange (ETDEWEB)

Mourao, Ana P. M. [Universidade Estadual de Londrina, PR (Brazil). Dept. de Agronomia; Panizzi, Antonio R. [EMBRAPA, Londrina, PR (Brazil). Centro Nacional de Pesquisa de Soja

2000-06-15

The Neotropical brown stink bug, Euschistus heros (Fabr.), was collected on sunflower [Helianthus annuus (L.)], soybean [Glycine max (L.) Merrill], star bristle [Acanthospermum hispidum (DC.)], and under fallen leaves of mango tree [Mangifera indica (L.)] and privet (Ligustrum lucidum Ait.), during one year, to evaluate the diapause incidence and the occurrence of different seasonal morphs. The majority of the insects (ca. 90%) with mature reproductive organs was observed during the summer (December-March), when E. heros was found on soybean or on sunflower; in the beginning of autumn, most insects (87%) showed immature reproductive organs, and they were found on star bristle and under fallen leaves. Bugs with mature reproductive organs had more developed shoulders (3.23 and 3.27 mm, for males and females, respectively) than bugs with immature organs (2.91 and 2.89 mm, for males and females, respectively). Two distinct body colors, dark brown and reddish brown, were observed. Nevertheless, the reddish brown was the predominant color of both mature and immature adults during all year. Adults were parasitized by Hexacladia smithii (Ashmead) (Hymenoptera: Encyrtidae) and Tachinidae mainly Trichopoda giacomellii (Blanchard) (Diptera: Tachinidae) (80% and 40% of parasitism in male and female, respectively) during summer (December), when the bugs colonized sunflower. In soybean, 12% of males and 10% of females were parasitized, whereas in fallen leaves, the parasitism rate was 5% in both sexes.These results showed that in autumn/winter (shorter photoperiod) the majority of the insects were inactive under fallen leaves, showing immature reproductive organs and less developed shoulders, indicating that, at this time, these bugs were in diapause. (author)

Healing Gods, Heroes and Rituals in the Graeco-Roman World

Directory of Open Access Journals (Sweden)

Panayotis Pachis

2016-05-01

Full Text Available This editorial introduces the articles published within the OLH Special Collection, ‘Healing Gods, Heroes and Rituals in the Graeco-Roman World’. The first two articles in this collection interrogate the figures of specific healing gods. Olympia Panagiotidou’s article ‘Asclepius’ Myths and Healing Narratives: Counter-Intuitive Concepts and Cultural Expectations’ focuses on the curative features that defined the image of Asclepius, the most famous of the healing gods. The next article in the collection, ‘The Fate of a Healing Goddess: Ocular Pathologies, the Antonine Plague, and the Ancient Roman Cult of Bona Dea’ by Leonardo Ambasciano, interrogates the religious figure of another healing agent: the Italian goddess Bona Dea who was particularly venerated in Rome and in the region of Latium and whose cult reveals the way in which ancient Roman androcentric control over women was institutionalised through religious figures.  The third article in the collection, Audrey Ferlut’s ‘Goddesses as Consorts of the Healing Gods in 'Gallia Belgica' and the 'Germaniae': Forms of Cult and Ritual Practices’ considers the impact that cults dedicated to gods and goddesses had on populations in the wider area of the Roman Empire, focusing on the Northern provinces of the Western Roman Empire ('Gallia Belgica' and the 'Germaniae'. The collection’s final article, ‘From Textual Reception to Textual Codification: Thessalos and the Quest for Authenticity’ by Spyros Piperakis, moves the discussion from the question of cult practices to ‘alternative’ healing therapies in antiquity. Piperakis deals with astrological medicine, one of many alternative therapeutic methods that became popular during the Hellenistic and Roman period.  Taken together, the articles in ‘Healing Gods, Heroes and Rituals in the Graeco-Roman World’ demonstrate that we need to approach the study of ancient myths and cults within their socio-cultural context

Comparison of effects of ProTaper, HeroShaper, and Gates Glidden Burs on cervical dentin thickness and root canal volume by using multislice computed tomography.

Science.gov (United States)

Mahran, Abeer H; AboEl-Fotouh, Mona M

2008-10-01

The purpose of this study was to compare the effects of 3 different instruments used to prepare curved root canals on the remaining cervical dentin thickness and total amount of dentin removed from root canals during instrumentation by using multislice computed tomography. Mesiobuccal canals of 45 mandibular first molars with curvature between 30-40 degrees were divided into 3 equal groups: ProTaper, Hero Shaper, and Gates Glidden Bur with Flex-R hand file. Cervical dentin thickness and canal volume were measured before and after instrumentation by using multislice computed tomography and image analysis software. The results indicated that ProTaper removed significantly less cervical dentin from distal wall of the root (dangerous zone) than HeroShaper and Gates Glidden Bur (P ProTaper system (P < .05).

Prevalence of comorbidities and baseline characteristics of LAP-BAND AP® subjects in the Helping Evaluate Reduction in Obesity (HERO study.

Directory of Open Access Journals (Sweden)

Nancy Dreyer

Full Text Available OBJECTIVE: To describe the baseline characteristics in patients who chose placement of a LAP-BAND AP® System (LBAP and participated in the Helping Evaluate Reduction in Obesity (HERO Study across regions. PATIENTS AND METHODS: HERO is a five-year, prospective, multicenter, international study of patients with LBAP placement between July 22, 2009 and January 31, 2011. In addition to baseline and peri-surgery clinical data, seven follow up visits are scheduled at 3, 6 and 12 months, and annually through year five. Data collection included family and medical history, clinical outcomes, laboratory data, health-related quality of life (HRQoL, productivity, healthcare resource utilization, and adverse events. RESULTS: LBAP were placed in 1106 enrolled patients; 56.6% from the US, 26.3% from Europe, 7.1% from Canada, and 10.0% from Australia. The majority were female (n = 877 (79.3% with a mean age of 43 years (s.d. = 11.4 and mean body mass index of 45.1 kg/m(2 (s.d. = 6.9. The most common comorbidities were hypertension (HTN (overall  = 42.9% and diabetes (overall 22.2%, with 27% from the US and 14% from Europe. Overall, less than 5% had a history of cardiovascular disease. The prevalence rates of HTN, diabetes and cardiovascular disease were significantly (p<0.001 higher in men than in women across all regions. Overall HRQoL also worsened with increasing BMI. CONCLUSIONS: The HERO study is the first large, multinational and long-term registry with the LBAP. This study will provide real-world outcomes data on LAGB that will help inform patient choice, clinician treatment strategies, and payer reimbursement decisions.

The Hero With a Thousand Faces In Yaşar Kemal's Çukurova Trilogy : The Other Face Of The Mountain = Yaşar Kemal'in Çukurova Üçlemesi : Dağın Öbür Yüzü'ndeki Bin Yüzlü Kahraman

Directory of Open Access Journals (Sweden)

A. Clare BRANDABUR

2003-01-01

Full Text Available Joseph Campbell's classic work, The Hero With A Thousand Faces, traces the archetypal pattern of the hero from obscure origins, the call to adventure, the crossing of the threshold, encounter with dark forces, the winning of a boon, the re-crossing of the threshold, the re-entry of the ordinary world and the hero's re-integration with his community. The present paper traces this pattern in the Triliogy of Yaşar Kemal entitled The Other Face of the Mountain, following the hero Tashbash through the various phases of this archetypal-heroic journey. The presence in Yaşar Kemal's work of these universal patterns embodied in highly original and brilliant prose makes it clear that this Turkish novelist belongs among the great authors of world literature.

A professora-heroína no filme Verônica: endereçamento, identificação e conformismo social

Directory of Open Access Journals (Sweden)

Dostoiewski Mariatt de Oliveira Champangnatte

2016-12-01

Full Text Available Este artigo realiza uma análise do filme Verônica, de 2009, que apresenta uma professora da rede pública do Rio de Janeiro como heroína. A partir da análise crítica do discurso, proposta por Fairclough (2001, e aplicada a filmes neste trabalho, abordam-se as caracterizações da professora e do enredo do filme, com o objetivo de discutir questões relacionadas a estratégias de endereçamento e identificação voltadas a professores-espectadores. Como também de relacionar tais estratégias às práticas sociais do produtor e dos patrocinadores da obra. A partir da análise realizada, observou-se que o conformismo social foi um dos principais valores a ser endereçado/identificado aos/pelos professores-espectadores, tal como a reiteração de práticas negativas relativas à docência. Concluindo-se, ao final, que o heroísmo da professora nada tem a ver com a escola ou a educação.

Achilles: A Homeric hero enamoured with the absolute.

Science.gov (United States)

Evzonas, Nicolas

2017-07-21

This article explores through a psychoanalytical lens the character of Achilles in Homer's Iliad, the matrix behind the Western conception of heroism. The contribution reveals the psychological link binding the words and acts of the most valiant of warriors in Antiquity, which is situated in myth and termed "the Eros of the absolute." The paroxystic ideality underlying the aforementioned myth, which is rooted in the anthropological need to believe, is at the origin of Achilles' legendary μῆνις, that is, the flood of rage triggered by contests for supremacy, aggravated by the loss of his war comrade, aroused by the drama of aging and death, and then transfigured through song and memory. The main claim of the author is that Iliad, despite its seeming lack of attention to interiority, is launched by the archetypal emotion of wrath and owes its appeal to its hero's embrace of heroic idealism in an excessive, radical and absolute way that results in a captivating narcissism and sadomasochistic antithesis of ideality. This argument leads to the conclusion that Homer is the Father of the "primitive horde" of affects. Copyright © 2017 Institute of Psychoanalysis.

Early Cretaceous paleomagnetic results from Marie Byrd Land, West Antarctica: Implications for the Weddellia collage of crustal blocks

Science.gov (United States)

Divenere, Vic; Kent, Dennis V.; Dalziel, Ian W. D.

1995-05-01

A new approximately 117 Ma paleomagnetic pole has been defined from the study of volcanic and plutonic rocks from the eastern portion Marie Byrd Land (MBL). The new pole (185.6 deg E/56.8 deg S, A(sub 95) = 8.7 deg) implies that the eastern portion of MBL was an integral part of Weddellia, which included the ancestral Antarctic Peninsula, Thurston Island, and Ellsworth-Whitmore Mountains blocks of West Antarctica. This pole is generally similar to a approximately 125 Ma pole from Thurston Island. Both poles call for major clockwise rotation and poleward motion of eastern MBL and Thurston Island between the Early Cretaceous (125-117 Ma) and the mid-Cretaceous (110-100 Ma). We propose that in the Early Cretaceous, eastern MBL and the Eastern Province of New Zealand were part of a continuous active Pacific margin of Gondwana, connecting with the Antarctic Peninsula, and distinct from western MBL, the Western Province of New Zealand, and North Victoria Land. These western terranes are thought to have accreted to Gondwana in the Devonian. Eastern MBL and the Eastern Province of New Zealand amalgamated with western MBL and the Western Province of New Zealand by the mid-Cretaceous. Major Early Cretaceous motions of the Weddellia blocks postdate the estimated initiation of seafloor spreading in the Weddell Sea and therefore may be the result of plate reorganization during the Cretaceous Quiet Zone.

A Study of the Significant Factors That Affect the Job Placement Rates of Students Who Have Completed a HERO Program.

Science.gov (United States)

Instructional Development and Evaluation Associates, Inc., Berkeley, MI.

A three-year study examined the significant factors that affect the job placement rates of students completing a Home Economics Related Occupations (HERO) program. Other purposes of the study were to develop and pilot test a model that could be used to determine factors related to student placement in a variety of vocational education programs and…

The contaminated Western Hero and other madness during the Atomic Age; Der verstrahlte Westernheld und anderer Irrsinn aus dem Atomzeitalter

Energy Technology Data Exchange (ETDEWEB)

Herzog, Rudolph

2012-11-01

The book on mad activities during the Atomic Age includes the following topics: The second most hazardous invention in all time; the red bomb; the story on the tactic nuclear war; the contaminated Western hero or how the bomb came to Alaska; swords into plowshares; the apocalypse machine; flying reactors; how safe is safe?; atomic Australia; nuclear medicine on wrong ways; broken arrows.

Architecture of Stalingrad: the image of the hero city by the language of "Stalinist Empire style"

Science.gov (United States)

Ptichnikova, Galina; Antyufeev, Alexey

2018-03-01

The article is dedicated to the peculiarities of the architecture of "Stalinist Empire style" by the example of Stalingrad architecture. This city was restored again after Stalingrad battle which took place in the period of 1942-1943, in accordance with the principals of socialist urban construction. Reconstruction of Stalingrad is considered by the authors of the article as the creation of a new type of a Soviet city - a Hero City. The authors reveal the artistic features of architectural ensembles and buildings designed according to the principles of "Stalinist Empire style".

SuperQueeroes – Our LGBTI* Comic Book Heroes and Heroines Schwules Museum*, January 22-June 26, 2016

Directory of Open Access Journals (Sweden)

Carlos Kong

2016-11-01

Full Text Available SuperQueeroes – Our LGBTI* Comic Book Heroes and Heroines at the Schwules Museum* in Berlin presents the first exhibition of queer comics in Europe. The exhibition provides a comprehensive survey of comics with LGBTI characters and narratives, primarily from Europe and America. As a foundational endeavor, SuperQueeroes raises important questions regarding the curation of both comics and the history of sexuality, whose critical examination remains relevant for the future work on queer comics that the exhibition will likely inspire.

We don't need another hero.

Science.gov (United States)

Badaracco, J L

2001-09-01

Everybody loves the stories of heroes like Martin Luther King, Jr., Mother Teresa, and Gandhi. But the heroic model of moral leadership usually doesn't work in the corporate world. Modesty and restraint are largely responsible for the achievements of the most effective moral leaders in business. The author, a specialist in business ethics, says the quiet leaders he has studied follow four basic rules in meeting ethical challenges and making decisions. The rules constitute an important resource for executives who want to encourage the development of such leaders among their middle managers. The first rule is "Put things off till tomorrow." The passage of time allows turbulent waters to calm and lets leaders' moral instincts emerge. "Pick your battles" means that quiet leaders don't waste political capital on fights they can't win; they save it for occasions when they really want to fight. "Bend the rules, don't break them" sounds easier than it is--bending the rules in order to resolve a complicated situation requires imagination, discipline, restraint, flexibility, and entrepreneurship. The fourth rule, "Find a compromise," reflects the author's finding that quiet leaders try not to see situations as polarized tests of ethical principles. These individuals work hard to craft compromises that are "good enough"--responsible and workable enough--to satisfy themselves, their companies, and their customers. The vast majority of difficult problems are solved through the consistent striving of people working far from the limelight. Their quiet approach to leadership doesn't inspire, thrill, or provide story lines for uplifting TV shows. But the unglamorous efforts of quiet leaders make a tremendous difference every day in the corporate world.

Diapause and different seasonal morphs of Euschistus heros (Fabr.) (Hemiptera: Pentatomidae) in Northern Parana State

International Nuclear Information System (INIS)

Mourao, Ana P. M.; Panizzi, Antonio R.

2000-01-01

The Neotropical brown stink bug, Euschistus heros (Fabr.), was collected on sunflower [Helianthus annuus (L.)], soybean [Glycine max (L.) Merrill], star bristle [Acanthospermum hispidum (DC.)], and under fallen leaves of mango tree [Mangifera indica (L.)] and privet (Ligustrum lucidum Ait.), during one year, to evaluate the diapause incidence and the occurrence of different seasonal morphs. The majority of the insects (ca. 90%) with mature reproductive organs was observed during the summer (December-March), when E. heros was found on soybean or on sunflower; in the beginning of autumn, most insects (87%) showed immature reproductive organs, and they were found on star bristle and under fallen leaves. Bugs with mature reproductive organs had more developed shoulders (3.23 and 3.27 mm, for males and females, respectively) than bugs with immature organs (2.91 and 2.89 mm, for males and females, respectively). Two distinct body colors, dark brown and reddish brown, were observed. Nevertheless, the reddish brown was the predominant color of both mature and immature adults during all year. Adults were parasitized by Hexacladia smithii (Ashmead) (Hymenoptera: Encyrtidae) and Tachinidae mainly Trichopoda giacomellii (Blanchard) (Diptera: Tachinidae) (80% and 40% of parasitism in male and female, respectively) during summer (December), when the bugs colonized sunflower. In soybean, 12% of males and 10% of females were parasitized, whereas in fallen leaves, the parasitism rate was 5% in both sexes.These results showed that in autumn/winter (shorter photoperiod) the majority of the insects were inactive under fallen leaves, showing immature reproductive organs and less developed shoulders, indicating that, at this time, these bugs were in diapause. (author)

New Age Fairy Tales: The Abject Female Hero in El laberinto del fauno and La rebelión de los conejos mágicos

Directory of Open Access Journals (Sweden)

Patricia Lapolla Swier

2011-11-01

Full Text Available In totalitarian regimes, the Other is marginalized, prosecuted, and often eliminated from the national spectrum. While Spain is just beginning to confront the violations of the post-Civil War era, the nations of the Latin American Southern Cone have continued to struggle with the trauma and memory related to the violence perpetrated by the dictatorship. Through a psychoanalytic reading based on Julia Kristeva's theories of the abject and Joseph Campbell's investigations of myth within the hero's journey, I show how the young female heroes of El laberinto del fauno (Pan's Labyrinth and La rebelión de los conejos mágicos (The Rabbits' Rebellion embark upon a journey of personal self-discovery and self-transcendence in the marginal space of the abject, and how, by doing so, they release the repressed stories of the victims of these dictatorships. Through their journeys in these fairy-tale settings emerges a transformation of consciousness that provides more comprehensive readings of history at the universal level.

Desempenho alimentar e sobrevivência de Euschistus heros parasitado por Hexacladia smithii em sementes de soja

Directory of Open Access Journals (Sweden)

Nunes Maria Clarice

2002-01-01

Full Text Available Avaliou-se, em laboratório, a influência do parasitóide Hexacladia smithii Ashmead (Hymenoptera: Encyrtidae na atividade alimentar e sobrevivência de Euschistus heros (Fabricius (Hemiptera: Pentatomidae, aos 10, 20, 30 e 40 dias após o início do parasitismo. A atividade alimentar foi avaliada pelo número de bainhas constatadas nas sementes de soja, Glycine max (L. Merrill (Fabaceae, em 48 horas de alimentação. O teste foi mantido sob condições controladas de temperatura (25±2°C, umidade (65±10% e fotoperíodo (14L:10E. No início do desenvolvimento de H. smithii a atividade alimentar dos percevejos não-parasitados e parasitados foi semelhante, obtendo-se, entretanto, duas vezes mais bainhas alimentares depositadas/grão pelos machos e fêmeas, após 30 dias de parasitismo. A sobrevivência dos percevejos parasitados foi menor que a dos percevejos não-parasitados, alcançando 100% de mortalidade 40 a 50 dias após o início do parasitismo. A redução na sobrevivência dos percevejos parasitados por H. smithii e a atividade alimentar, semelhante a dos percevejos não-parasitados durante quase todo o período de desenvolvimento do parasitóide, destacam a contribuição desse parasitismo na redução da população do percevejo-marrom E. heros.

Vision Algorithm for the Solar Aspect System of the HEROES Mission

Science.gov (United States)

Cramer, Alexander; Christe, Steven; Shih, Albert

2014-01-01

This work covers the design and test of a machine vision algorithm for generating high-accuracy pitch and yaw pointing solutions relative to the sun for the High Energy Replicated Optics to Explore the Sun (HEROES) mission. It describes how images were constructed by focusing an image of the sun onto a plate printed with a pattern of small fiducial markers. Images of this plate were processed in real time to determine relative position of the balloon payload to the sun. The algorithm is broken into four problems: circle detection, fiducial detection, fiducial identification, and image registration. Circle detection is handled by an Average Intersection method, fiducial detection by a matched filter approach, identification with an ad-hoc method based on the spacing between fiducials, and image registration with a simple least squares fit. Performance is verified on a combination of artificially generated images, test data recorded on the ground, and images from the 2013 flight.

Comportamentos de risco ao HIV em utilizadores de heroína em um distrito português: estudo qualitativo HIV risk behaviors in heroin users in a Portuguese district: a qualitative study

Directory of Open Access Journals (Sweden)

Vanessa Fabiane Machado Gomes Marsden

2009-12-01

Full Text Available OBJETIVO: Explorar relatos de utilizadores de heroína sobre seus comportamentos de risco para transmissão do vírus da imunodeficiência humana (HIV no distrito de Vila Real, Portugal, já que a heroína é a droga predominante no que se refere ao uso problemático de drogas em Portugal, e 48% de todas as notificações de infecção por HIV no país são associadas à dependência de drogas. MÉTODO: Utilizadores de heroína recebendo tratamento ambulatorial para dependência em clínica pública foram selecionados aleatoriamente e convidados a participar do estudo. A coleta de dados foi realizada através de entrevista qualitativa semiestruturada, desenvolvida para explorar os relatos dos participantes sobre seu comportamento de risco associado ao uso de heroína. RESULTADOS: Vinte e cinco entrevistas foram realizadas. A idade média foi de 32 anos, e 92% eram homens. Os participantes relataram um tempo médio de uso de heroína de 14,7 anos, e 64% deles mencionaram uso diário da droga. Dois terços relataram uso de heroína e 16% referiram uso intravenoso da droga nos 30 dias anteriores à entrevista. 75% referiram compartilhamento de seringas ou parafernália de injeção. Front-loading ou back-loading foram técnicas comuns e não reconhecidas como comportamento de risco. 84% referiram ter sido testados anteriormente para o HIV. CONCLUSÕES: O desenvolvimento de melhores programas de prevenção ao HIV para este grupo de risco é essencial através do uso de informações sobre movimentos demográficos e padrões de comportamento de utilizadores de heroína, abordando seus comportamentos de risco nas práticas sexuais e no compartilhamento de parafernália de injeção.OBJECTIVE: To explore heroin users' accounts of risk behavior in relation to the transmission of human immunodeficiency virus (HIV in the district of Vila Real, northern Portugal, since heroin is the predominant drug in problematic drug use in Portugal and 48% of the total

A Study of the Significant Factors That Affect the Job Placement Rates of Students Who Have Completed a HERO Program. Year 2 Report.

Science.gov (United States)

Instructional Development and Evaluation Associates, Inc., Berkeley, MI.

A three-year study examined the significant factors that affect the job placement rates of students completing a Home Economics Related Occupations (HERO) program. Other purposes of the study were to develop and pilot test a model that could be used to determine factors related to student placement in a variety of vocational education programs and…

A Study of the Significant Factors That Affect the Job Placement Rates of Students Who Have Completed a HERO Program. Year Summary Report.

Science.gov (United States)

Instructional Development and Evaluation Associates, Inc., Berkeley, MI.

A three-year study examined the significant factors that affect the job placement rates of students completing a Home Economics Related Occupations (HERO) program. Other purposes of the study were to develop and pilot test a model that could be used to determine factors related to student placement in a variety of vocational education programs and…

Monitoramento do percevejo marrom Euschistus heros (Hemiptera: Pentatomidae por feromônio sexual em lavoura de soja

Directory of Open Access Journals (Sweden)

Valvenarg Pereira da Silva

2014-11-01

Full Text Available O objetivo deste trabalho foi avaliar a eficiência das formulações septo de borracha e lure do feromônio sexual do percevejo marrom Euschistus heros e compará-la ao método do pano de batida, para o monitoramento dessa praga em lavoura de soja. Os tratamentos foram: feromônio em septo de borracha, feromônio em lure e amostragem com pano de batida. As amostragens foram realizadas semanalmente durante a fase reprodutiva da soja (dez semanas. Para estimar a densidade populacional de percevejos e compará-la à captura nas armadilhas de feromônio, foram efetuados quatro panos de batida por semana em todas as parcelas; além disso, foi determinado o número de percevejos capturados nas armadilhas por semana. Os danos provocados pelos percevejos nas sementes foram analisados pelo teste de tetrazólio. As formulações do feromônio foram eficientes na captura de E. heros, e a formulação em lure capturou mais percevejos. O controle precoce da população, indicado pelo nível de controle nas armadilhas com feromônio, resultou em sementes com maior qualidade do que as provenientes das parcelas monitoradas pelo pano de batida. Assim, as armadilhas com feromônio são mais eficientes que o pano de batida para o monitoramento das populações de percevejos durante a fase crítica do ataque deste inseto nas lavouras de soja.

Atilius Regulus: A Tragic Hero in the Culture of the Eighteenth Century

Directory of Open Access Journals (Sweden)

Stefano Ferrari

2017-11-01

Full Text Available Atilius Regulus is one of the many tragic heroes that the classical tradition has handed down to Western culture. His fortune in the eighteenth century, however, is marked by an almost unique peculiarity that specifically measures the transition from ancient to modern age. Unlike other figures, that of the Roman consul is submitted between the second half of the seventeenth century and the end of the eighteenth century to a careful philological examination that has the result not only to reject as historically groundless the famous episode of torture suffered in Carthage, but also that of the embassy held in front of the Rome senate to deal with peace between the two rival cities. Despite the authenticity of this last episode of the life of the Roman consul has been questioned, it has also met in the course of the eighteenth century a huge favor by poets, philosophers, art writers and painters.

Patrones de consumo de heroína en una muestra de consumidores de Medellín - Colombia Patterns of heroin use in a sample of consumers in Medellín - Colombia

Directory of Open Access Journals (Sweden)

Guillermo Alonso Castaño Pérez

2012-09-01

Full Text Available INTRODUCCIÓN: En Colombia no existen estudios específicos de prevalencia de consumo de heroína. Este artículo evalúa los patrones de consumo de esta sustancia en un grupo de consumidores de la ciudad de Medellín y su área metropolitana, evidenciándose que el consumo empieza a ser una amenaza para la salud pública por las particulares formas de consumo, entre las que se incluyen prácticas de riesgo. OBJETIVO: Evaluar el consumo de heroína en la ciudad de Medellín y su área metropolitana. MÉTODOS: La investigación tuvo un enfoque mixto mediante el estudio de casos múltiples hasta saturar cada una de las variables y categorías propuestas. Se accedió a 42 consumidores de heroína de centros de tratamiento de la ciudad de Medellín y área metropolitana mediante la técnica de "bola de nieve", proceso que se realizó entre los meses de julio y septiembre de 2008. La información se recolectó mediante una entrevista estructurada, cara a cara, que consultó el tipo de heroína consumida, vías de administración, frecuencias de consumo, utensilios utilizados, prácticas de consumo y rituales que acompañan estas prácticas. Los datos cuantitativos se analizaron con el paquete estadístico EPI-Info 2.000 y los cualitativos con Atlas ti, versión 5.5, para Windows. RESULTADOS: Los consumidores eran predominantemente hombres, solteros, con edades comprendidas entre los 18 y los 23 años, sin hijos y muchos con estudios universitarios no terminados. Mayoritariamente se ubicaban en un estrato socioeconómico medio, tenían antecedentes familiares de consumo de sustancias psicoactivas y se iniciaron en el consumo de heroína entre los 15 y los 17 años. Tienen formas particulares de nombrar la heroína, los consumidores, y poseen rituales propios para consumir esta sustancia. En el artículo se presentan detalles de la heroína que consumen, la parafernalia y las prácticas asociadas a dicho consumo. CONCLUSIONES: El consumo de heroína es

Heroes, Mates and Family: How Tragedy Teaches Us About Being Australian

Directory of Open Access Journals (Sweden)

Sarah Gillman

2010-03-01

Full Text Available In his 2006 Australia Day address to the National Press Club in Canberra, the then prime minister, John Howard, told journalists that ‘people come to this country because they want to be Australians’. However, as Howard himself admitted, ‘The irony is that no institution or code lays down a test of Australianness’. So how can we know what it is to be Australian? One way is to look at the public statements the Howard made in the wake of tragedy and disaster during his decade as prime minister. These statements reinforce the key values of the Howard government: the role of family, the place of heroes and the importance of mateship. This article analyses the public reaction of the Howard during media coverage of events such as the Port Arthur shootings, the Bali bombings, the 2004 tsunami and the Beaconsfield mine rescue. It argues that Howard’s public responses to these tragedies reflect a move on hi part to recapture the cultural debate and define what it is to be an ‘Australian’.

Heroes, mates and family : how tragedy teaches us about being Australian

Directory of Open Access Journals (Sweden)

Gillman, Sarah

2010-01-01

Full Text Available In his 2006 Australia Day address to the National Press Club in Canberra, the then prime minister, John Howard, told journalists that ‘people come to this country because they want to be Australians’. However, as Howard himself admitted, ‘The irony is that no institution or code lays down a test of Australianness’. So how can we know what it is to be Australian? One way is to look at the public statements the Howard made in the wake of tragedy and disaster during his decade as prime minister. These statements reinforce the key values of the Howard government: the role of family, the place of heroes and the importance of mateship. This article analyses the public reaction of the Howard during media coverage of events such as the Port Arthur shootings, the Bali bombings, the 2004 tsunami and the Beaconsfield mine rescue. It argues that Howard’s public responses to these tragedies reflect a move on hi part to recapture the cultural debate and define what it is to be an ‘Australian’.

Heroes, Mates and Family: How Tragedy Teaches Us About Being Australian

Directory of Open Access Journals (Sweden)

Sarah Gillman

2010-02-01

Full Text Available In his 2006 Australia Day address to the National Press Club in Canberra, the then prime minister, John Howard, told journalists that ‘people come to this country because they want to be Australians’. However, as Howard himself admitted, ‘The irony is that no institution or code lays down a test of Australianness’. So how can we know what it is to be Australian? One way is to look at the public statements the Howard made in the wake of tragedy and disaster during his decade as prime minister. These statements reinforce the key values of the Howard government: the role of family, the place of heroes and the importance of mateship. This article analyses the public reaction of the Howard during media coverage of events such as the Port Arthur shootings, the Bali bombings, the 2004 tsunami and the Beaconsfield mine rescue. It argues that Howard’s public responses to these tragedies reflect a move on hi part to recapture the cultural debate and define what it is to be an ‘Australian’.

A personagem dostoievskiana e a relação autor/herói em Grande sertão: veredas / The Dostoevskian character and the relationship author/hero in Grande sertão: veredas

Directory of Open Access Journals (Sweden)

Sandra Mara Moraes Lima

2011-11-01

Full Text Available RESUMO: O trabalho tece considerações sobre o enfoque da personagem pelo autor no romance de Dostoiévski a partir da obra Problemas da poética de Dostoiévski de Bakhtin, estabelecendo uma analogia entre a relação autor/herói na obra de Dostoiévski e a relação autor/herói no romance Grande sertão: veredas, de Guimarães Rosa. Segundo Bakhtin, Dostoiévski inaugura o romance polifônico, dialógico, apresentando um herói cuja voz está equiparada à voz do autor. É nesse mesmo contexto que se analisa, no romance rosiano, o narrador Riobaldo. ABSTRACT: This work makes considerations about the focus of the character by the author on Dostoevsky romance from the work Problems of Dostoevsky’s Poetics of Bakhtin, establishing an analogy between author/hero in Dostoevsky work and the relationship author/hero in the romance Grande sertão: veredas from Guimarães Rosa. According toBakhtin Dostoevsky inaugurates the polyphonic, dialogical, presenting a hero whose voice is equalized to the author voice. In this context we presented the narrator Riobaldo.

Informed consent during the clinical emergency of acute myocardial infarction (HERO-2 consent substudy): a prospective observational study.

Science.gov (United States)

Williams, Barbara F; French, John K; White, Harvey D

2003-03-15

Anxiety, fear, pain, and treatment with morphine might compromise the ability of patients to comprehend information about, and give informed consent for, participation in clinical trials. We aimed to assess whether patients with acute myocardial infarction could understand written and verbal information and whether they were competent to give autonomous informed consent to participate in a clinical trial. We prospectively studied 399 patients with acute myocardial infarction in 16 hospitals in New Zealand and Australia who were eligible for participation in the Hirulog and Early Reperfusion or Occlusion (HERO)-2 trial. We assessed readability of patient information sheets, patients' educational status, their views of the consent process, comprehension of verbal and written information, and competence to give consent. The patient information sheet needed a year 13 (age 18) educational level for comprehension, although only 75 of 345 patients (22%) had been educated beyond secondary school. Only 63 of 346 (18%) read the patient information sheet before giving or refusing consent to participate. Patients who gave consent were more likely to report good or partial comprehension of the information provided than were those who refused consent (272 [89%] vs 14 [70%], respectively; p=0.009). In an assessment of competence to make an autonomous decision, 75 of 145 (52%) were ranked at the lowest grade and 26 (18%) were not competent to consent. Although the consent process for HERO-2 met regulatory requirements for clinical trials, it was inappropriate for the needs of most patients. The patients' comprehension of the information provided and their competence to autonomously give consent was less than optimum.

Patrones de consumo de heroína en una cárcel de la frontera norte de México: barreras de acceso a tratamiento

Directory of Open Access Journals (Sweden)

Cravioto Patricia

2003-01-01

Full Text Available OBJETIVO: Describir la prevalencia del consumo de heroína, los patrones de inicio, el alto consumo y la dependencia a esta sustancia e identificar barreras que impidan a los adictos acudir a tratamiento. MATERIAL Y MÉTODOS: El estudio se realizó en la cárcel de Ciudad Juárez, Chihuahua, México, entre abril y junio de 2000; los participantes se obtuvieron a través de un muestreo aleatorio simple, partiendo del censo del penal. Se identificaron las barreras al tratamiento, estimadas mediante un modelo de regresión logística. RESULTADOS: La prevalencia de consumo de heroína en los últimos seis meses fue de 26.4%; de 25.3% para usuarios fuertes; 95% fueron dependientes. El promedio de la edad de inicio del consumo fue a los 21 años. El modelo multivariado mostró que baja escolaridad, abstinencia, sobredosis, enfermedades crónicas y tiempo de exposición son barreras que impiden solicitar tratamiento. CONCLUSIONES: Las implicaciones de los resultados se discuten en función de aplicarlos para implantar programas de tratamiento en las cárceles.

Methyl eugenol aromatherapy enhances the mating competitiveness of male Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae).

Science.gov (United States)

Haq, Ihsan; Vreysen, Marc J B; Cacéres, Carlos; Shelly, Todd E; Hendrichs, Jorge

2014-09-01

Males of Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae) are strongly attracted to methyl eugenol (ME) (1,2-dimethoxy-4-(2-propenyl)benzene), a natural compound occurring in variety of plant species. ME-feeding is known to enhance male B. carambolae mating competitiveness 3 days after feeding. Enhanced male mating competitiveness due to ME-feeding can increase the effectiveness of sterile insect technique (SIT) manifolds. However, the common methods for emergence and holding fruit flies prior to field releases do not allow the inclusion of any ME feeding treatment after fly emergence. Therefore this study was planned to assess the effects of ME-aromatherapy in comparison with ME feeding on male B. carambolae mating competitiveness as aromatherapy is pragmatic for fruit flies emergence and holding facilities. Effects of ME application by feeding or by aromatherapy for enhanced mating competitiveness were evaluated 3d after treatments in field cages. ME feeding and ME aromatherapy enhanced male mating competitiveness as compared to untreated males. Males treated with ME either by feeding or by aromatherapy showed similar mating success but mating success was significantly higher than that of untreated males. The results are discussed in the context of application of ME by aromatherapy as a pragmatic approach in a mass-rearing facility and its implications for effectiveness of SIT. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

A reinvenção do heroísmo na contemporaneidade: a busca de uma estética relacional ativista

OpenAIRE

Tania Alice Caplain Feix

2013-01-01

O artigo aborda as performances realizadas pelo Coletivo de performance carioca Heróis do Cotidiano, que investiga a possibilidade e as condições de surgimento e expansão do hero¬ísmo na Contemporaneidade. Pela criação de micro-utopias temporárias e locais, o Coletivo realiza uma apropriação do espaço público, dialogando com o conceito de Estética Relacional de Nicolas Bourriaud, estabelecendo novas formas de sociabilidade e estabelecendo proces¬sos de subjetivação diferentes daqueles propost...

True Grit: In Tracking down the Real Story of a Legendary Hero of the Old West, Vaunda Micheaux Nelson also Nabbed the Coretta Scott King Award

Science.gov (United States)

Fleishhacker, Joy

2010-01-01

When Vaunda Micheaux Nelson donned a black Stetson to become the biographer of Deputy U.S. Marshal Bass Reeves, she had no idea that her square-shooting book about an unsung African-American hero of the Old West would win over a posse of fans and earn her the prestigious 2010 Coretta Scott King (CSK) Author Award. "Bad News for Outlaws"…

Using a Hero as a Model in Video Instruction to Improve the Daily Living Skills of an Elementary-Aged Student with Autism Spectrum Disorder: A Pilot Study

Science.gov (United States)

Ohtake, Yoshihisa

2015-01-01

The present pilot study investigated the impact of video hero modelling (VHM) on the daily living skills of an elementary-aged student with autism spectrum disorder. The VHM, in which a character much admired by the student exhibited a correct response, was shown to the participant immediately before the situation where he needed to exhibit the…

Hydroxychloroquine effectiveness in reducing symptoms of hand osteoarthritis (HERO): study protocol for a randomized controlled trial

Science.gov (United States)

2013-01-01

Background Osteoarthritis (OA) is the most common type of arthritis, causing significant joint pain and disability. It is already a major cause of healthcare expenditure and its incidence will further increase with the ageing population. Current treatments for OA have major limitations and new analgesic treatments are needed. Synovitis is prevalent in OA and is associated with pain. Hydroxychloroquine is used in routine practice for treating synovitis in inflammatory arthritides, such as rheumatoid arthritis. We propose that treating patients with symptomatic hand OA with hydroxychloroquine will be a practical and safe treatment to reduce synovitis and pain. Methods/design HERO is an investigator-initiated, multicentre, randomized, double-blind, placebo-controlled trial. A total of 252 subjects with symptomatic hand OA will be recruited across primary and secondary care sites in the UK and randomized on a 1:1 basis to active treatment or placebo for 12 months. Daily medication dose will range from 200 to 400 mg according to ideal body weight. The primary endpoint is change in average hand pain during the previous two weeks (measured on a numerical rating scale (NRS)) between baseline and six months. Secondary endpoints include other self-reported pain, function and quality-of-life measures and radiographic structural change at 12 months. A health economics analysis will also be performed. An ultrasound substudy will be conducted to examine baseline levels of synovitis. Linear and logistic regression will be used to compare changes between groups using univariable and multivariable modelling analyses. All analyses will be conducted on an intention-to-treat basis. Discussion The HERO trial is designed to examine whether hydroxychloroquine is an effective analgesic treatment for OA and whether it provides any long-term structural benefit. The ultrasound substudy will address whether baseline synovitis is a predictor of therapeutic response. This will potentially

The Tragedy of Work: Working Class Heroes in the Italian 21st-century Literature

Directory of Open Access Journals (Sweden)

Claudio Panella

2017-11-01

Full Text Available The paper aims at exploring how the literary representation of the worker has changed between the end of 20th-century and the beginning of the 21st-century. With the fall of the 20th-century ideologies and raising the fragmentation of labour, texts have emerged in Italian literature which illustrated the tragic social and existential condition of the working class. Among these texts we can find some récits de filiation written by sons and daughters of workers whose health and ideals have been undermined even down to death. These typology of texts let emerged two equally tragic characters: fathers, ill and defeated but still working class heroes and sons, tragically conscious of their roles witnesses-superstites of those ‘denied heroes’. Among the texts being tackled in the paper Il nemico (2009 by Emanuele Tonon, Amianto (2012 by Alberto Prunetti, Il fuoco a mare (2015 by Andrea Bottalico, Ilva Football Club (2016 by Fulvio Colucci and Lorenzo d’Alò

From hero to Newcomen: the critical scientific and technological developments that led to the invention of the steam engine.

Science.gov (United States)

Kitsikopoulos, Harry

2013-09-01

This essay provides an analytical account of the history of various steam devices by tracing the key technological and scientific developments culminating in the Savery and Newcomen models. It begins in antiquity with the writings of Hero of Alexandria, which were rediscovered and translated in Italy fourteen centuries later, followed by the construction of simple steam devices. The most decisive development comes in the middle of the seventeenth century with the overturning, through the experimental work of Torricelli, Pascal, and Guericke, of the Aristotelian dogma that no vacuum exists. The final stretch of this discovery process amounted to an Anglo-French race, with English inventors being more successful in the end.

A Hero in the Friendly Arctic: Deconstructing Vilhjalmur Stefansson's Rhetorical Maneuver

Directory of Open Access Journals (Sweden)

Silje Gaupseth

2012-05-01

Full Text Available The article deals with Arctic explorer and anthropologist Vilhjalmur Stefansson's self-presentation in the expedition account The Friendly Arctic: The Story of Five Years in Polar Regions (1921, which tells the story of his travels and trials in the Canadian High Arctic in the years between 1913-1918. The account has been considered a key text to Stefansson's Arctic career, and provides a textbook example of his characteristic theory of living off the country in the so-called Eskimo way. Against the background of Stefansson's debated position as Arctic expert and visionary, I ask if it is possible to read the kind of criticism with which Stefansson frequently was met as rooted in some of the narrative aspects of his account. The narrative persona or implied author is a central element in the literature of exploration, as several literary scholars have pointed out. My reading is centred around the implied author of The Friendly Arctic, which I argue must be read in light of the sometimes conflicting roles given to Stefansson as protagonist and narrator in his own story. Close-readings of passages from the account raise the dilemma of how it is possible to present oneself as a hero in an essentially friendly Arctic.

A letter from the United States: the romance of medicine--voyages and heroes.

Science.gov (United States)

Richard V, Lee

2009-03-01

Becoming a physician is a lifelong journey, not merely the completion of medical school and postgraduate training. For those pedagogues that wish to train doctors as technicians the notion that there is something heroic and romantic in a physician's life is quaint, old fashioned, and out of date! In today's teaching hospitals virtual patients come via digital technology in computed x-ray and magnetic resonance images, automated laboratory test panels, electrophysiologic studies, and algorhythmic histories. Doctors have no need to leave their computer and increasingly doctors do not leave their computers for the bedside, the home, the neighborhood, or the country of their "patients". Contemporary doctors are in danger of losing their bedside clinical skills and with them go the role of physician as a wise, widely traveled human being knowledgeable about the rigors of inhospitable environs, the hardiness of the species, the despair of poverty, and the seductive dangers of wealth. There is similarity of this kind of physician to mythic heroes, and they still have stories to tell.

Radiotherapy staffing in the European countries: Final results from the ESTRO-HERO survey

International Nuclear Information System (INIS)

Lievens, Yolande; Defourny, Noémie; Coffey, Mary; Borras, Josep M.; Dunscombe, Peter; Slotman, Ben; Malicki, Julian; Bogusz, Marta; Gasparotto, Chiara; Grau, Cai; Kokobobo, Arianit; Sedlmayer, Felix; Slobina, Elena; Coucke, Philippe; Gabrovski, Roumen; Vosmik, Milan; Eriksen, Jesper Grau; Jaal, Jana; Dejean, Catherine; Polgar, Csaba

2014-01-01

Background: The ESTRO Health Economics in Radiation Oncology (HERO) project has the overall aim to develop a knowledge base of the provision of radiotherapy in Europe and build a model for health economic evaluation of radiation treatments at the European level. The first milestone was to assess the availability of radiotherapy resources within Europe. This paper presents the personnel data collected in the ESTRO HERO database. Materials and methods: An 84-item questionnaire was sent out to European countries, through their national scientific and professional radiotherapy societies. The current report includes a detailed analysis of radiotherapy staffing (questionnaire items 47–60), analysed in relation to the annual number of treatment courses and the socio-economic status of the countries. The analysis was conducted between February and July 2014, and is based on validated responses from 24 of the 40 European countries defined by the European Cancer Observatory (ECO). Results: A large variation between countries was found for most parameters studied. Averages and ranges for personnel numbers per million inhabitants are 12.8 (2.5–30.9) for radiation oncologists, 7.6 (0–19.7) for medical physicists, 3.5 (0–12.6) for dosimetrists, 26.6 (1.9–78) for RTTs and 14.8 (0.4–61.0) for radiotherapy nurses. The combined average for physicists and dosimetrists is 9.8 per million inhabitants and 36.9 for RTT and nurses. Radiation oncologists on average treat 208.9 courses per year (range: 99.9–348.8), physicists and dosimetrists conjointly treat 303.3 courses (range: 85–757.7) and RTT and nurses 76.8 (range: 25.7–156.8). In countries with higher GNI per capita, all personnel categories treat fewer courses per annum than in less affluent countries. This relationship is most evident for RTTs and nurses. Different clusters of countries can be distinguished on the basis of available personnel resources and socio-economic status. Conclusions: The average personnel

Radiotherapy staffing in the European countries: final results from the ESTRO-HERO survey.

Science.gov (United States)

Lievens, Yolande; Defourny, Noémie; Coffey, Mary; Borras, Josep M; Dunscombe, Peter; Slotman, Ben; Malicki, Julian; Bogusz, Marta; Gasparotto, Chiara; Grau, Cai; Kokobobo, Arianit; Sedlmayer, Felix; Slobina, Elena; Coucke, Philippe; Gabrovski, Roumen; Vosmik, Milan; Eriksen, Jesper Grau; Jaal, Jana; Dejean, Catherine; Polgar, Csaba; Johannsson, Jakob; Cunningham, Moya; Atkocius, Vydmantas; Back, Carlo; Pirotta, Martin; Karadjinovic, Vanja; Levernes, Sverre; Maciejewski, Boguslaw; Trigo, Maria Lurdes; Šegedin, Barbara; Palacios, Amalia; Pastoors, Bert; Beardmore, Charlotte; Erridge, Sara; Smyth, Gaile; Cleries Soler, Ramon

2014-08-01

The ESTRO Health Economics in Radiation Oncology (HERO) project has the overall aim to develop a knowledge base of the provision of radiotherapy in Europe and build a model for health economic evaluation of radiation treatments at the European level. The first milestone was to assess the availability of radiotherapy resources within Europe. This paper presents the personnel data collected in the ESTRO HERO database. An 84-item questionnaire was sent out to European countries, through their national scientific and professional radiotherapy societies. The current report includes a detailed analysis of radiotherapy staffing (questionnaire items 47-60), analysed in relation to the annual number of treatment courses and the socio-economic status of the countries. The analysis was conducted between February and July 2014, and is based on validated responses from 24 of the 40 European countries defined by the European Cancer Observatory (ECO). A large variation between countries was found for most parameters studied. Averages and ranges for personnel numbers per million inhabitants are 12.8 (2.5-30.9) for radiation oncologists, 7.6 (0-19.7) for medical physicists, 3.5 (0-12.6) for dosimetrists, 26.6 (1.9-78) for RTTs and 14.8 (0.4-61.0) for radiotherapy nurses. The combined average for physicists and dosimetrists is 9.8 per million inhabitants and 36.9 for RTT and nurses. Radiation oncologists on average treat 208.9 courses per year (range: 99.9-348.8), physicists and dosimetrists conjointly treat 303.3 courses (range: 85-757.7) and RTT and nurses 76.8 (range: 25.7-156.8). In countries with higher GNI per capita, all personnel categories treat fewer courses per annum than in less affluent countries. This relationship is most evident for RTTs and nurses. Different clusters of countries can be distinguished on the basis of available personnel resources and socio-economic status. The average personnel figures in Europe are now consistent with, or even more favourable than

‘An augury of the world’s ruin’ and the making of the tragic hero in Chinua Achebe’s Arrow of God

Directory of Open Access Journals (Sweden)

Ignatius Chukwumah

2016-06-01

Full Text Available Chinua Achebe’s Arrow of God has been adjudged by critics as a tragic work with Ezeulu as its tragic hero. However, none of these studies has paid detailed attention to the framing of Ezeulu in the historical context of his age. How he appears when compared to a classical Greek tragic hero has also been ignored. A major context giving rise to Ezeulu becoming a tragic hero is the period leading to the synthesis of two contrary histories, juxtaposed discourses and the collision of opposites and contraries in the sociocultural and political sphere of the villages of Umuaro and Okperi. This circumstance is captured by the narrator as ‘an augury of the world’s ruin’, by Nwaka as ‘the white man turned us upside down’ and by Ezeulu as ‘the world is spoilt and there is no longer head or tail in anything that is done’. Allen, an earlier District Commissioner in Things Fall Apart, but textually implicated in Arrow of God, terms it ‘great situations’. The above historical context requires more than mastery and acknowledgement by the tragic figure, in the absence of which he, a self-professed knowledgeable person, becomes a victim of what he failed to take into account. Consequently, he is set aside as a specimen for history and other men. This article will use Hegel’s and Aristotle’s theories of history and of tragedy, respectively, to explicate the above. It concludes that the tragic hero of Chinua Achebe’s Arrow of God is substantially the victim of the clash between Umuaro’s history and Hegel’s History. ’n Teken van die wêreld se ondergang en die skepping van die tragiese held in Chinua Achebe se Arrow of God. Chinua Achebe se boek, Arrow of God, word deur kritici beskryf as ’n tragedie met die karakter Ezeulu as held. Niemand het egter noukeurige aandag geskenk aan hoe Ezeulu inpas in die gapings van botsende geskiedenisse soos vergestalt in die mens ten opsigte van hulle optredes, houdings, vrese en begeertes nie

A família Drew de Walworth: um século após a avaliação inicial finalmente o diagnóstico doença de Machado-Joseph The Drew family of Walworth: one century from the first evaluation until the final diagnosis, Machado-Joseph disease

Directory of Open Access Journals (Sweden)

Hélio A. Ghizoni Teive

2004-03-01

Full Text Available As enfermidades heredo-degenerativas, entre elas as ataxias cerebelares autossômicas dominantes, agora conhecidas como ataxias espinocerebelares (AEC, correspondem a extenso grupo de s com grande heterogeneidade genética. Algumas formas de AEC, em especial a de Machado-Joseph (DMJ, caracteriza-se por acentuada variabilidade de expressão fenotípica intra e inter-familial. Em 1895, na Grã-Bretanha, foi descrita uma família com uma forma autossômica dominante de AEC que viria a ser conhecida como a família Drew de Walworth. Desde sua descrição inicial até 1995, quando do diagnóstico genético final de DMJ, vários membros e gerações desta família foram examinados e seus achados descritos na literatura por famosos neurologistas como Gowers, Stewart, Collier, Kinnier-Wilson, Turner, Worster-Drought, Ferguson, Critchley e Anita Harding. Neste artigo, os autores descrevem a trajetória histórica tortuosa e as discussões sobre os diagnósticos nosológicos propostos no decorrer de um século, com o propósito de mostrar a impressionante e atraente complexidade que envolve este grupo de s neurodegenerativas.Autosomal dominant spinocerebellar ataxia (SCA is an heterogeneous group of neurodegenerative diseases involving cerebellum and its connections. Several forms have already been described, and it seems the most common form of SCA observed among the many series of families described worldwide is SCA3 (Machado-Joseph disease. SCA3 is characterized by a marked phenotypic expression with a wide spectrum of clinical findings including cerebellar ataxia, pyramidal and extrapyramidal (e.g. dystonia, parkinsonism, lower motor neuron syndrome and peripheral neuropathy. The Drew family of Walworth, England, has several affected members seen and described by famous neurologists including Gowers, Stewart, Collier, Kinnier-Wilson, Turner, Worster-Drought, Ferguson, Critchley, and Anita Harding from 1895 to our days. In fact, the final genetic

HOBYS and W43-HERO: Two more steps toward a Galaxy-wide understanding of high-mass star formation

Science.gov (United States)

Motte, Frédérique; Bontemps, Sylvain; Tigé, Jérémy

The Herschel/HOBYS key program allows to statistically study the formation of 10-20 M ⊙ stars. The IRAM/W43-HERO large program is itself dedicated to the much more extreme W43 molecular complex, which forms stars up to 50 M ⊙. Both reveal high-density cloud filaments of several pc3, which are forming clusters of OB-type stars. Given their activity, these so-called mini-starburst cloud ridges could be seen as ``miniature and instant models'' of starburst galaxies. Both surveys also strongly suggest that high-mass prestellar cores do not exist, in agreement with the dynamical formation of cloud ridges. The HOBYS and W43 surveys are necessary steps towards Galaxy-wide studies of high-mass star formation.

The impact of cancer incidence and stage on optimal utilization of radiotherapy. Methodology of a population based analysis by the ESTRO-HERO project

DEFF Research Database (Denmark)

Borras, Josep M; Barton, Michael; Grau, Cai

2015-01-01

-HERO project. MATERIALS AND METHODS: Data from Australian Collaboration for Cancer Outcomes Research and Evaluation (CCORE) were used. Population based stages at diagnosis from the cancer registries of Belgium, Slovenia, the Greater Poland region of Poland, and The Netherlands were used to assess the OUP...... in stage at diagnosis across countries. The most important impact on the OUP by country was due to changes in relative frequency of tumours rather than stage at diagnosis. CONCLUSIONS: This methodology can be adapted using European data, thus facilitating the planning of resources required to cope...

The family roles of siblings of people diagnosed with a mental disorder: heroes and lost children.

Science.gov (United States)

Sanders, Avihay; Szymanski, Kate; Fiori, Kate

2014-08-01

In order to cope with the diagnosis of mental illness in a family member, siblings may be forced to adjust their roles in the family. Taking into account the crucial role that some siblings play in caregiving for the mentally ill especially when the parents are no longer available, it is imperative to develop awareness of their unique needs and address them. Thirty-three adult siblings of people diagnosed with a mental disorder completed the Role Behaviour Inventory (RBI) and a general questionnaire including open-ended questions regarding the roles they played in their families of origin. Findings from the inventory and general questionnaire suggest that the well siblings score higher on two roles, the Hero and Lost Child, and lower on the Mascot and Scapegoat roles relative to a comparison group (N = 33). Being a sibling caregiver emerged as a risk factor to assume certain dysfunctional roles in the family. Implications for future research and therapy are discussed. © 2013 International Union of Psychological Science.

Exhibition of Masayuki Miyata＇s Works of Art

Institute of Scientific and Technical Information of China (English)

无

2004-01-01

To commemorate the 25th anniversary of the signing of the Sino-Japanese Peace and Friendship Treaty, the CPAFFC held the exhibition of Masayuki Miyata's works of art in the Painting Exhibition Hall of the Palace Museum from October 23 to 27, 2003. Miyata's 124 best works were selected for the exhibition, among which works on the subjects about China and those about Japan were half and half. They drew their materials mainly from Chinese classic literary works such as Records of the Historian, Water Margin, Legend of Heroes in the Tang Dynasty, Romance of the Three Kingdoms and Japanese classic The Story of Genji, etc. Also on display were works of the Japa-nese scenery such as Japan's Four Seasons, Snow, Moon and Flowers, etc. and The Red Fujiyama, a work acknowledged by the United Nations.

Heroes of Civilization. The Amazon Region as Agricultural Export Cosmopolis in the Work of General Rafael Reyes

Directory of Open Access Journals (Sweden)

Felipe Martínez Pinzón

2013-07-01

the isthmus led the Colombian elites to rethink other border spaces. The article analyzes the discourse of appropriation of the Amazon territory set forth by President, General, and entrepreneur Rafael Reyes (1849-1921 in speeches lectures, travel diaries, and autobiographical memoirs. On the basis of those materials, the article argues that instead of nationalizing the Amazonian territory, Reyes suggesting incorporating it into the dynamics of global capitalism through the contradictory proposal of an “agricultural export cosmopolis” aimed at exploiting the region’s wealth. The contradictions of a segregationist cosmopolis, as a narrative of globalization in the early 20th century, also led General Reyes to represent the entrepreneurs of the agricultural frontier as “heroes of civilization”, a phrase that betrays the anachronism and irrationalism inherent in the allegedly indestructible rational discourse of civilization in the tropics.

Reconciling the shadow of a subduction signature with rift geochemistry and tectonic environment in Eastern Marie Byrd Land, Antarctica

Science.gov (United States)

LeMasurier, Wesley E.; Choi, Sung Hi; Hart, Stanley R.; Mukasa, Sam; Rogers, Nick

2016-09-01

Basalt-trachyte volcanoes in the Marie Byrd Land (MBL) Cenozoic province lie along the Amundsen Sea coast on the north flank of the West Antarctic rift. Basalts here are characterized by OIB-like geochemistry, restricted ranges of 87Sr/86Sr (0.702535-0.703284) and 143Nd/144Nd (0.512839-0.513008) and a wide range of 206Pb/204Pb (19.357-20.934). Basalts at three MBL volcanoes display two anomalies compared with the above and with all other basalts in West Antarctica. They include 143Nd/144Nd (0.512778-0.512789) values at Mt. Takahe and Mt. Siple that are 2σ lower than other West Antarctic basalts, and Ba/Nb, Ba/La, and Ba/Th values at Mt. Murphy and Mt. Takahe that are 3-8 times higher than normal OIB. Isotope and trace element data do not support crustal and lithospheric mantle contamination, or the presence of residual mantle amphibole or phlogopite as explanations of these anomalies. The apparent coincidence of these anomalies with the site of a pre-Cenozoic convergence zone along the Gondwanaland margin suggests a subduction influence. Major episodes of subduction and granitic plutonism took place in MBL during the Devonian, Permian, and Late Cretaceous. Relicts in the source region, of components from these subducted slabs, provide a credible explanation for the uncoupling of Ba from other large ion lithophile elements (LILE), for its erratic distribution, and for the anomalously low 143Nd/144Nd at Mt. Takahe. The last episode of subduction ended 85 Ma, and was followed by continental break-up, rifting and lithospheric attenuation that produced the West Antarctic rift as we know it today. Thus, the enigmatic geochemical signatures in these three volcanoes seem to have been preserved roughly 61-85 m.y. after subduction ended. New calculations of source melting depth and a new determination of lithospheric thickness suggest that the source of the anomalies resides in a fossil mélange diapir that rose from the Cretaceous subducting slab, became attached to the

An integrated systems approach to risk management within a technology driven industry using the design structure matrix and fuzzy logic

OpenAIRE

2012-01-01

D.Ing. “Innovation is the act of introducing something new” (Byrd & Brown, 2003). When companies are competing on the technology “playground” they need to be innovative. By analysis according to Byrd & Brown (Byrd & Brown, 2003) the “act of introducing”, relates to risk taking, and the “new” relates to creativity, and therefore these concepts, creativity and risk taking, in combination, are what innovation is all about. Risk management has become one of the greatest challenges of the 21st ...

War as social regeneration: Sombart from The Quintessence of Capitalism to Merchants and Heroes

Directory of Open Access Journals (Sweden)

Fabio Degli Esposti

2015-03-01

Full Text Available The essay examines a particular stage of the life and scientific production of Werner Sombart: the years of the First World War. Most biographers of Sombart showed that the German scholar, during these years, remained essentially on the fringe of the debate that took place in Germany, as well in other countries taking part in the war, on the economic and social transformations induced by the conflict, and in particular, on the new role assumed by the State in directing the life of the economy and society. Published in 1915, Händler und Helden (Merchants and Heroes should be primarily considered as a work of propaganda. It is a vicious attack on Britain, seen as the country that had produced a petty and materialistic conception of existence. The topics chosen by Sombart for his polemic, however, summarize many aspects of his previous works on the origins and development of modern economics, and even anticipate some of his reflections – later developed in the second edition of Modern Capitalism or in works such as German socialism – on the future and the fate of capitalism.

Kahramanın Yolculuğu: Beyazperdede Çocukların Kahraman Olma Macerası The Hero’s Journey: Children’s Adventure Of Being Heroes In Cinema

Directory of Open Access Journals (Sweden)

Filiz ERDEMİR GÖZE

2013-09-01

Full Text Available Both in mythological stories -fairy tales and films the heroesalways follows the same first models in their journey. This model isdefined as the core unit of monomyth and it consists of three steps:“Dissociation”, “Initiation” and “Return”. First of all a hero leaves hisdaily and regular life and goes to the region that he is going toexperience his adventure and prove himself. Here he experiences thethings that will make him a hero and thanks to his enemies andbuddies he wins a certain victory by passing some trials. At last thehero comes back to his home from this mysterious adventure with apower which excels the others.In general the hero is described as the man or the woman whoheads to the unknown, shows the courage of going strange placesleaving his/her belongings, home, family and prosperity. Indeed thejourney he makes is his inner journey. Starting from this point, it ispossible to say that in general the concept of hero is attributed to adultman and few women. When it is handled in terms of the children,except the films made for children, in cinema the stages of being a herofor the adults don’t work for the children.The image of the child that changed in the recent movies andanalyzing the process of children’s being hero in adults’ world,composes the subject of this research. In this respect, it is aimed in thisstudy to show that the children experience same processes of being ahero and trials of adults, in the movies that children star but adults’being in the centre concerning the topic.Within the context of this research, two films that children hadthe leading role are analyzed. The first one is the film called “TheReturn” in which the boys star and filmed in Russia in 2003 by AndreiZvyagintsev. The other one is called “Rabbit –Proof Fence” in which girlsstar and this movie was filmed in Australia in 2002 by Philip Noyce.Films were analyzed in the light of the three steps mentioned above

Impact of mild to severe hemophilia on education and work by US men, women, and caregivers of children with hemophilia B: The Bridging Hemophilia B Experiences, Results and Opportunities into Solutions (B-HERO-S) study.

Science.gov (United States)

Cutter, Susan; Molter, Don; Dunn, Spencer; Hunter, Susan; Peltier, Skye; Haugstad, Kimberly; Frick, Neil; Holot, Natalia; Cooper, David L

2017-04-01

The psychosocial impact of hemophilia on work was recently investigated in the Hemophilia Experiences, Results and Opportunities (HERO) study. The findings revealed that hemophilia had an impact for adults with moderate/severe hemophilia and caregivers of children with hemophilia. HERO did not specifically evaluate impact on education in adults/children with mild/moderate hemophilia or the impact on employment of spouses/partners of caregivers of affected children. The Bridging Hemophilia B Experiences, Results and Opportunities into Solutions (B-HERO-S) study evaluated the impact of hemophilia on the lives of adult men/women with mild-severe hemophilia B and caregivers of boys/girls with hemophilia B and their spouses/partners. Many adults with hemophilia B (94%) reported that hemophilia had a negative effect on their ability to complete a formal education, often attributed to the inability to attend or concentrate in school as a result of hemophilia-related bleeding or pain. Most adults with hemophilia B (95%) and caregivers/partners (89%/84%) indicated that hemophilia had a negative impact on employment. Most adults with hemophilia were employed (81%), with construction/manufacturing (35%) as the most frequently reported industry; many worked in jobs requiring manual labor (39%). Of those unemployed, 62% never worked, and those who stopped working reported that they left the workforce due to financial issues (59%), including insurance coverage/co-pays, or hemophilia-related issues (55%). Nearly one-third of caregivers voluntarily left the workforce to care for children with hemophilia. These results suggest a need to focus more effort on career counseling for adults with hemophilia B and caregivers of affected children, especially around mild/moderate hemophilia, as this population may not be as well informed regarding potential impact in school and the workplace. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Ferocious Enemies and Noble Heroes: Images of “Us” and “Them” in Polish American Textbooks (until the 1930s

Directory of Open Access Journals (Sweden)

Adam Walaszek

2003-12-01

Full Text Available Ethnic schools had an important role to play in propagating profiles of “ideal” heroes and members of society among immigrant communities. Consequently, it was often the role of school coursebooks to inform pupils of the messages adults wanted to transmit to the younger generation. In this paper the author attempts to describe contents of various textbooks used in Polish-American parochial schools. Invention of national mythology and simplification of facts was necessary to facilitate the memorizing process as required. But to form group solidarity one also had to identify common enemies. Various textbooks published in the U.S.A. before World War I did not help immigrants’ children to acculturate to their American realities. Being very didactic, they focused mainly on Polish realities and Polish history. Only after World War I did an American presence become more visible in books used in the first grade. In thirties Felicians predominantly used textbooks written in the U.S.A., mainly by S. M. Cyryla (Magdalena Tobaka. The heroes they presented were characterized schematically, and the ideals found therein were alien to Polish-American children. Polska by S. Mary Cyryla, was the book on which this analysis was based. The image of Poles and “other” nations is surprisingly defined in black and white. Foreign nations are depicted as cruel, monstrous, villain, pagan, barbaric, etc. “Us”, the Poles, are seen as brave, just, good, wise, honest, faithful, etc., they “have loved faith, country, and language” etc. Cyryla’s textbook tried to engender feelings of community by dividing the world into “us” and “them”, thereby provoking antagonism towards “them.” Polish personality traits were very much in keeping with the images and self-stereotypes which Polish society had about itself. In constructing a positive and ideal self-image, it was useful for “others” and “strangers” to be depicted as “enemies”. �

Haemophilia Experiences, Results and Opportunities (HERO) Study: influence of haemophilia on interpersonal relationships as reported by adults with haemophilia and parents of children with haemophilia.

Science.gov (United States)

Cassis, F R M Y; Buzzi, A; Forsyth, A; Gregory, M; Nugent, D; Garrido, C; Pilgaard, T; Cooper, D L; Iorio, A

2014-07-01

Evidence delineating the effects of haemophilia on interpersonal relationships is sparse and largely outdated, failing to reflect the impact of current treatment strategies. HERO (Haemophilia Experiences, Results and Opportunities) was commenced to garner a more comprehensive understanding of psychosocial issues facing persons with haemophilia (PWH). This article describes the findings of the quantitative HERO survey relating to the influence of haemophilia on interpersonal relationships of adult PWH, and parents/caregivers of children with haemophilia. Separate questionnaires were completed by adult PWH and parents of minor children from 10 countries, including satisfaction with support from partners, family, friends and other social contacts; disclosure of haemophilia and carrier status and family dynamics. A total of 675 PWH and 561 parents completed the survey. Over half of PWH (57%) and parents (84%) were married. Most PWH were satisfied with support from partners (94%), family (90%) and friends (85%), with lower percentages reported among those with inhibitors. Most parents were likewise satisfied with support from partners (88%) and family (83%). Whereas PWH were reticent to disclose their diagnosis beyond family and friends, parents were more likely to share their son's diagnosis, and most were satisfied with the support from their son's peers (74%), teachers (83%) and other adults in supervisory roles (85%). PWH and parents surveyed were satisfied overall with the support they received from partners, family, friends and social contacts. Relationships are affected by haemophilia in various ways, and particularly affected in terms of disease burden, age and social life. © 2014 John Wiley & Sons Ltd.

La propagande cachée sur les ondes de la BBC pendant la Seconde Guerre Mondiale : vers une héroïsation nationale Hidden propaganda and national hero-making on the BBC Home Service during the Second World War

Directory of Open Access Journals (Sweden)

Cécile Vallée

2009-10-01

Full Text Available With the aim of maintaining morale on the Home Front, as well as getting the British population to trust in final victory, the British government put in place a hidden control of the BBC, which was regularly instructed as to what broadcast form propaganda should take on the Home Service. These secret, regular and precise guidelines were to result in the projection of an ultra-positive image of Great Britain and of the British at war. The systematic hero-making propaganda was to become gradually better organised, more subtle, and therefore more efficient as the years went by thanks to the expertise of BBC staff. Countless programmes were broadcast, which stressed the heroic virtues of British soldiers, of the Navy and of the R.A.F, or reminded the listeners of past heroes, the glorious history of Great Britain being systematically commemorated, thus exalting national pride daily. To the constant cult of the heroes of the Home Front (particularly of women corresponded an equally constant denigration of the Nazi enemy. Although there was no recourse to lies, the way both the military and the Home Front were presented was undoubtedly of a propaganda nature. Indeed, the aim was to win the hearts and minds of the British population by playing on two chords: on the one hand, turning the enemy into an evil beast, minimising defeats and difficulties, and, on the other hand, systematically extolling the power and glory of Great Britain and the innate qualities of the British.

AMERICAN SPORT AND THE SPORTS HEROES OF THE ROARING TWENTIES

Directory of Open Access Journals (Sweden)

Michał Mazurkiewicz

2014-04-01

Full Text Available The aim of the article is to show the role of sport in American society against the background of a very important—for many reasons—period of great social transformation in the United States, one which visibly gathered pace in the 1920s. The author presents different aspects of popular culture, which was in full bloom on account of the following factors: the joy after World War I, a sense of optimism, the development of the economy and industry, the growth of big cities, and the greater affluence of the citizens. The analysis of that unusual decade corroborates the role of sport and its great power of influence on society. In an age when technology and mass production had robbed experiences and objects of their uniqueness, sports provided some of the unpredictability and drama that people craved when looking for romance and adventure. The reasons for the popularity of sport in the USA are presented, as well as the major sports diciplines and heroes of American sport who, in a time when mass production seemed to be making individuals less significant, met with a favorable response—people clung to the heroic personalities of sports figures. The analysis of the beginnings of professionalism in sport, the beginnings of organized support, and sports broadcasting, leaves no doubt as to the significance of the period. As the article demonstrates, it was a time of rapid and profound transformation in the realm of sport. Every serious examination of phenomena in contemporary American sport—and this is also true in the case of other countries—without a knowledge of the specificity of sport in the 1920s, would be far from perfect.

Experimental reslts from the HERO project: In situ measurements of ionospheric modifications using sounding rockets

International Nuclear Information System (INIS)

Rose, G.; Grandal, B.; Neske, E.; Ott, W.; Spenner, K.; Maseide, K.; Troim, J.

1985-01-01

The Heating Rocket project HERO comprised the first in situ experiments to measure artifical ionospheric modifications at F layer heights set up by radio waves transmitted from the Heating facility at Ramfjord near Tromso in Northern Norway. Four instrumented payloads were launched on sounding rockets from Andoya Rocket Range during the autumn of 1982 into a sunlit ionosphere with the sun close to the horizon. The payloads recorded modifications, in particular, the presence of electron plasma waves near the reflection level of the heating wave. The amplitude and phase of the three components of the electric and magnetic fields of the heating wave were measured simultaneously as a function of altitude. Coherent spectra of the three electric field components of the locally generated electron plasma waves were obtained in a 50-kHz-wide band. At the same time quasi-continuous measurements were made on several fixed frequencies from 4 kHz to 16 kHz below the heating frequency and in the VLF-range using linear dipole antennas. Moreover, measurements were made of electron temperature, suprathermal electrons and local electron density along the rocket trajectory. The experimental results will be presented and discussed

New Spirit and New Hero: How Hungarian Startups Redefine the Ideas of Local Capitalism

Directory of Open Access Journals (Sweden)

Szabó Natasa

2016-12-01

Full Text Available The present paper investigates how the Bridge Budapest, a CSR organization founded by leading Hungarian IT startups, attempts to shape the values of Hungarian society towards capitalism in general, and towards entrepreneurship in particular. In my paper I argue that the central aim of the organization is to facilitate Hungary’s catching up with the core capitalist countries through the transformation of the attitudes and the ideologies surrounding capitalism in the Hungarian context, i.e. the local spirit of capitalism. This consists, on the one hand, of restoring the legitimation of some of the core institutions of capitalism, such as the enterprise and the entrepreneur, and of confronting the risk-taking, innovative and ethical figure of the entrepreneur hero with the provincial figure of the ‘postcommunist cheater’. On the other hand, it also consists of propagating a new management of work that aims to produce self-controlling and self-motivating employees. In the narrative of Bridge Budapest IT companies appear as the perfect moral and economic subjects – the bearers of the new spirit of capitalism – that have the expertise to offer solutions to the problems of Hungarian society, and around which the local capitalism should be built.

78 FR 22554 - Nationwide Differential Global Positioning System (NDGPS)

Science.gov (United States)

2013-04-16

... accuracy and integrity of the Global Positioning System (GPS) derived positions for surface transportation..., contact LT Luke Byrd, Coast Guard, NDGPS Program Manager, telephone 202-372-1547 or email Robert.l.byrd... The NDGPS augments GPS with an additional differential correction signal. Differential GPS (DGPS...

Radiotherapy equipment and departments in the European countries: final results from the ESTRO-HERO survey.

Science.gov (United States)

Grau, Cai; Defourny, Noémie; Malicki, Julian; Dunscombe, Peter; Borras, Josep M; Coffey, Mary; Slotman, Ben; Bogusz, Marta; Gasparotto, Chiara; Lievens, Yolande; Kokobobo, Arianit; Sedlmayer, Felix; Slobina, Elena; Feyen, Karen; Hadjieva, Tatiana; Odrazka, Karel; Grau Eriksen, Jesper; Jaal, Jana; Bly, Ritva; Chauvet, Bruno; Willich, Normann; Polgar, Csaba; Johannsson, Jakob; Cunningham, Moya; Magrini, Stefano; Atkocius, Vydmantas; Untereiner, Michel; Pirotta, Martin; Karadjinovic, Vanja; Levernes, Sverre; Sladowski, Krystol; Lurdes Trigo, Maria; Šegedin, Barbara; Rodriguez, Aurora; Lagerlund, Magnus; Pastoors, Bert; Hoskin, Peter; Vaarkamp, Jaap; Cleries Soler, Ramon

2014-08-01

Documenting the distribution of radiotherapy departments and the availability of radiotherapy equipment in the European countries is an important part of HERO - the ESTRO Health Economics in Radiation Oncology project. HERO has the overall aim to develop a knowledge base of the provision of radiotherapy in Europe and build a model for health economic evaluation of radiation treatments at the European level. The aim of the current report is to describe the distribution of radiotherapy equipment in European countries. An 84-item questionnaire was sent out to European countries, principally through their national societies. The current report includes a detailed analysis of radiotherapy departments and equipment (questionnaire items 26-29), analyzed in relation to the annual number of treatment courses and the socio-economic status of the countries. The analysis is based on validated responses from 28 of the 40 European countries defined by the European Cancer Observatory (ECO). A large variation between countries was found for most parameters studied. There were 2192 linear accelerators, 96 dedicated stereotactic machines, and 77 cobalt machines reported in the 27 countries where this information was available. A total of 12 countries had at least one cobalt machine in use. There was a median of 0.5 simulator per MV unit (range 0.3-1.5) and 1.4 (range 0.4-4.4) simulators per department. Of the 874 simulators, a total of 654 (75%) were capable of 3D imaging (CT-scanner or CBCT-option). The number of MV machines (cobalt, linear accelerators, and dedicated stereotactic machines) per million inhabitants ranged from 1.4 to 9.5 (median 5.3) and the average number of MV machines per department from 0.9 to 8.2 (median 2.6). The average number of treatment courses per year per MV machine varied from 262 to 1061 (median 419). While 69% of MV units were capable of IMRT only 49% were equipped for image guidance (IGRT). There was a clear relation between socio-economic status, as

Radiotherapy equipment and departments in the European countries: Final results from the ESTRO-HERO survey

International Nuclear Information System (INIS)

Grau, Cai; Defourny, Noémie; Malicki, Julian; Dunscombe, Peter; Borras, Josep M.; Coffey, Mary; Slotman, Ben; Bogusz, Marta; Gasparotto, Chiara; Lievens, Yolande; Kokobobo, Arianit; Sedlmayer, Felix; Slobina, Elena; Feyen, Karen; Hadjieva, Tatiana; Odrazka, Karel; Eriksen, Jesper Grau; Jaal, Jana; Bly, Ritva; Chauvet, Bruno

2014-01-01

Background: Documenting the distribution of radiotherapy departments and the availability of radiotherapy equipment in the European countries is an important part of HERO – the ESTRO Health Economics in Radiation Oncology project. HERO has the overall aim to develop a knowledge base of the provision of radiotherapy in Europe and build a model for health economic evaluation of radiation treatments at the European level. The aim of the current report is to describe the distribution of radiotherapy equipment in European countries. Methods: An 84-item questionnaire was sent out to European countries, principally through their national societies. The current report includes a detailed analysis of radiotherapy departments and equipment (questionnaire items 26–29), analyzed in relation to the annual number of treatment courses and the socio-economic status of the countries. The analysis is based on validated responses from 28 of the 40 European countries defined by the European Cancer Observatory (ECO). Results: A large variation between countries was found for most parameters studied. There were 2192 linear accelerators, 96 dedicated stereotactic machines, and 77 cobalt machines reported in the 27 countries where this information was available. A total of 12 countries had at least one cobalt machine in use. There was a median of 0.5 simulator per MV unit (range 0.3–1.5) and 1.4 (range 0.4–4.4) simulators per department. Of the 874 simulators, a total of 654 (75%) were capable of 3D imaging (CT-scanner or CBCT-option). The number of MV machines (cobalt, linear accelerators, and dedicated stereotactic machines) per million inhabitants ranged from 1.4 to 9.5 (median 5.3) and the average number of MV machines per department from 0.9 to 8.2 (median 2.6). The average number of treatment courses per year per MV machine varied from 262 to 1061 (median 419). While 69% of MV units were capable of IMRT only 49% were equipped for image guidance (IGRT). There was a clear

Irradiation as a quarantine treatment against the invader fruit fly (Bactrocera Invadens, Drew) in mangoes (Mangifera Indica L,)

International Nuclear Information System (INIS)

Odai, B.T.

2010-06-01

The detection of the African invader fly, Bactrocera invadens Drew, Tsuruta and White, in Ghana has led to limitations in the export of mango fruits from Ghana to other countries. The limitations ranging from increased control costs to outright rejection of exports has necessitated a study in the area of quarantine treatment. A study was conducted to ascertain the effectiveness of gamma radiation for control of Bactrocera invadens in fruit destined for export. Pupae were obtained from the incubation of mango fruits collected from various locations. Adults were reared and infestation levels were determined after fruits were exposed to 5, 10, 20 females in different cages. Late instar larvae in fruits were irradiated at 15, 25, 35, 45, 50, 60 and 75 Gy to determine an effective dose for B. invadens. The mortality of the fly was determined at the various doses to obtain a probit 9 figure of 68.06 Gy (rounded to 70 Gy). The confirmatory test for 3050 larvae endorsed the effective dose as the probit 9 dose. Non-infested mature green export grade mango fruits were irradiated with 0, 70 and 150 Gy to determine its effect on ascorbic acid and total acidity content, sweetness, colour, juiciness, sourness, aroma and firmness of the mango fruits. Ascorbic acid and total acidity were not irradiation dependent. Varietal differences (p 0.05) by irradiation. Varietal differences did not affect the acceptability of the sweetness, sourness and colour of the fruits (p>0.05). Storage days significantly affected (p<0.05) the acceptability of all the sensory attributes. (au)

Sense of Time in A. Akhmatova’s and T.S. Eliot’s Latter Poetry (Comparative Analysis of Poem Without a Hero and Four Quartets

Directory of Open Access Journals (Sweden)

Anna Kurasova

2018-01-01

Full Text Available Anna Akhmatova and Thomas Stearns Eliot are considered among the most influential representatives of Modernism, Eliot - in Anglo-American Literature, and Akhmatova – in Russian. Modernism emerged at the beginning of the 20th century, seeking to point out people's failure to maintain a culture based on spiritual values,  an idea that was central to the works of Eliot and Akhmatova. By analysing and contrasting their last major poems, Four Quartets and Poem Without a Hero, this paper aims to present Eliot’s and Akhmatova’s perception of time and modernity. Faced with the tragedy of World War II, Eliot and Akhmatova turned to reflecting on notions of time and history. Despite the differences in the poets’ experiences, mentality, and background, Four Quartets and Poem Without a Hero bear a resemblance to each other in many respects and express the common for Akhmatova and Eliot perception of time. The poets saw time as a complex continuum, in which every element has its place and persistently interacts with all the other elements; thus, the past is present in our lives today and shapes our destiny. Therefore, history is not simply a sequence of past events unrelated to the present, but rather an active creator of every moment of our present lives. Establishing the immutable connection between the past, the present, and the future, the poets remind their readers of the notions of sin, guilt and responsibility. The poets also shared an attitude towards modernity, which they saw as a time of lost people who deny their past and for that reason will have no future unless they change. Therefore, in the face of eternity, which is wiser than we are capable of seeing, all that remains for humanity is acceptance and humility.

Morphological and histological damage on reproduction organ of radio-sterilized male fruit flies bactrocera carambolae (drew & hancock) (diptera; tephritidae)

International Nuclear Information System (INIS)

Achmad Nasroh Kuswadi

2011-01-01

It is known that gamma irradiation of 90 Gy on pupae of Bactrocera carambolae (Drew & Hancock) fruit fly induced sterility on the adults, however limited data on the cause of sterility is available. To obtain such information, morphological and histological damages on the reproduction organ of male adult flies emerged from irradiated pupae were observed. Pupae of 9 day-old were irradiated with 90 Gy gamma, and the male adults of 7 and 14 day-old emerged from the pupae were dissected to obtained the testis. Morphology and size of the testis of irradiated and unirradiated flies were observed under the microscopes, each in 10 replicates. Preparate of the testis were also made and observed under the microscopes of 400 magnification. The results showed that significant damages were found on testis of the irradiated B. carambolae flies due to irradiation, so that the growth of the organ disturbed as shown by the smallers size of the irradiated testis as compare to the normal one. On the irradiated 7 day-old flies, the length and width of testis were 25.9 and 30.2 % smaller, while on those of 14 day-old the testis were 39.20 and 44.42 % smaller, than the normal. Besides smaller in size, dead germinal cells on the testis preparate were also observed. It is concluded that sterility on the male flies was due to the damage on the germinal cells so that abnormal spermatogenesis process happened. The smaller in size of the testis, is also differentiate between of the irradiated from the normal flies of B. carambolae. (author)

Medical history for the masses: how American comic books celebrated heroes of medicine in the 1940s.

Science.gov (United States)

Hansen, Bert

2004-01-01

When comic books rose to mass popularity in the early 1940s, one segment of the industry specialized in "true adventures," with stories about real people from the past and the present--in contrast to competing books that offered fantasy, science fiction, superheroes, detectives and crime, funny people, or funny animals. This study examines the figures from both medical history and twentieth-century medicine who were portrayed as heroes and role models in these comic books: first, to call attention to this very popular, if unknown, genre of medical history, and second, to illustrate how medical history was used at that time to popularize scientific and medical ideas, to celebrate the achievements of medical research, to encourage medical science as a career choice, and to show medicine as a humane and noble enterprise. The study explains how these medical history stories were situated in American popular culture more generally, and how the graphic power of comic books successfully conveyed both values and information while also telling a good story. Attention to this colorful genre of popular medical history enriches our picture of the mid-twentieth-century public's enthusiasm for medical progress.

How many new cancer patients in Europe will require radiotherapy by 2025? An ESTRO-HERO analysis.

Science.gov (United States)

Borras, Josep M; Lievens, Yolande; Barton, Michael; Corral, Julieta; Ferlay, Jacques; Bray, Freddie; Grau, Cai

2016-04-01

The objective of this HERO study was to assess the number of new cancer patients that will require at least one course of radiotherapy by 2025. European cancer incidence data by tumor site and country for 2012 and 2025 was extracted from the GLOBOCAN database. The projection of the number of new cases took into account demographic factors (age and size of the population). Population based stages at diagnosis were taken from four European countries. Incidence and stage data were introduced in the Australian Collaboration for Cancer Outcomes Research and Evaluation (CCORE) model. Among the different tumor sites, the highest expected relative increase by 2025 in treatment courses was prostate cancer (24%) while lymphoma (13%), head and neck (12%) and breast cancer (10%) were below the average. Based on the projected cancer distributions in 2025, a 16% expected increase in the number of radiotherapy treatment courses was estimated. This increase varied across European countries from less than 5% to more than 30%. With the already existing disparity in radiotherapy resources in mind, the data provided here should act as a leverage point to raise awareness among European health policy makers of the need for investment in radiotherapy. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Canons and Heroes: The Reception of the Complete Works Translation Project in Finland, 2002-13

Directory of Open Access Journals (Sweden)

Keinänen Nely

2017-12-01

Full Text Available This essay examines the reception of the ten-year Complete Works translation project undertaken by the Finnish publishing company Werner Söderström Oy (WSOY in 2004-13. Focusing on reviews published in the first and last years of the project, the essay details ongoing processes of Shakespeare (re-canonization in Finland, as each new generation explains to itself what Shakespeare means to them, and why it continues to read, translate and perform Shakespeare. These processes are visible in comments from the series editors and translators extolling the importance of Shakespeare’s work and the necessity of creating new, modern translations so Finns can read Shakespeare in their mother tongue; in discussions of the literary qualities of a good Shakespeare translation, e.g. whether it is advisable to use iambic pentameter in Finnish, a trochaic language; and in the creation of publisher and translator “heroes,” who at significant cost to themselves, whether in money in terms of the publisher, or time and effort in terms of the translators, labour to provide the public with their Shakespeare in modern Finnish. While on the whole reviewers celebrated the new translations, there was some resistance to changes in familiar lines from older translations, such as Macbeth’s “tomorrow” speech, suggesting that there are nevertheless some limits on modernizing “classic” translations.

Linking Workplace Health Promotion Best Practices and Organizational Financial Performance: Tracking Market Performance of Companies With Highest Scores on the HERO Scorecard.

Science.gov (United States)

Grossmeier, Jessica; Fabius, Ray; Flynn, Jennifer P; Noeldner, Steven P; Fabius, Dan; Goetzel, Ron Z; Anderson, David R

2016-01-01

The aim of the study was to evaluate the stock performance of publicly traded companies that received high scores on the HERO Employee Health Management Best Practices Scorecard in Collaboration with Mercer© based on their implementation of evidence-based workplace health promotion practices. A portfolio of companies that received high scores in a corporate health and wellness self-assessment was simulated based on past market performance and compared with past performance of companies represented on the Standard and Poor's (S&P) 500 Index. Stock values for a portfolio of companies that received high scores in a corporate health and wellness self-assessment appreciated by 235% compared with the S&P 500 Index appreciation of 159% over a 6-year simulation period. Robust investment in workforce health and well-being appears to be one of multiple practices pursued by high-performing, well-managed companies.

A Discourse Analysis of Portrayals of Community College Leadership in the "Chronicle"

Science.gov (United States)

Wilson, Kristin B.; Cox, Elizabeth

2012-01-01

The hero motif is well-nourished in Western culture through music, movies, and novels. Westerners understand the notion of a hero, and want to both have and be a hero. This extends to our organizational life. However, the masculine hero motif is self-focused, and, from our perspective, therefore, a failed hero. Joseph Campbell's hero motif of an…

Functionality of resistance gene Hero, which controls plant root-infecting potato cyst nematodes, in leaves of tomato.

Science.gov (United States)

Poch, H L Cabrera; López, R H Manzanilla; Kanyuka, K

2006-07-01

The expression of host genomes is modified locally by root endoparasitic nematode secretions to induce the development of complex cellular structures referred as feeding sites. In compatible interactions, the feeding sites provide the environment and nutrients for the completion of the nematode's life cycle, whereas in an incompatible (resistant) interaction, the host immune system triggers a plant cell death programme, often in the form of a hypersensitive reaction, which restricts nematode reproduction. These processes have been studied in great detail in organ tissues normally infected by these nematodes: the roots. Here we show that host leaves can support a similar set of programmed developmental events in the potato cyst nematode Globodera rostochiensis life cycle that are typical of the root-invading nematodes. We also show that a gene-for-gene type specific disease resistance that is effective against potato cyst nematodes (PCN) in roots also operates in leaves: the expression of the resistance (R) gene Hero and members of its gene family in leaves correlates with the elicitation of a hypersensitive response only during the incompatible interaction. These findings, and the ability to isolate RNA from relevant parasitic stages of the nematode, may have significant implications for the identification of nematode factors involved in incompatible interactions.

Energy drew up 2008

International Nuclear Information System (INIS)

2008-01-01

This article is about the following topics: energy analysis, production and use, supply and demand, consumption, energy sources, petroleum products for energy production, energy demand by economic sector and final consumption.

Following Hegel’s Sovereign Beast: An Excursus on the Right of Heroes

Directory of Open Access Journals (Sweden)

Joshua Ben David Nichols

2013-01-01

Full Text Available In The Beast and the Sovereign, Derrida addresses an association that is as paradoxical as it is common. On the one hand, it seems as if the sovereign is, or at least should be, the furthest from the beast. And yet, as soon as we consult the various archives of political mythology––myth, theology, philosophy, art, etc.––we find them together, inseparable despite their distance. The seminar itself is a continuation of his previous explorations of the host concepts and figures that populate the political and philosophical history of sovereignty. The course takes him through a series of texts that stretches from Plato, Machiavelli, Hobbes and Rousseau, to Freud, Heidegger, Lacan and Schmitt, among others, but his engagement with Hegel is limited. The few times that Hegel’s name does appear, it is almost exclusively a reference or aside within other more substantial engagements (Lacan and Heidegger, in particular. This absence is at least somewhat curious given the extent of Derrida’s previous engagements with Hegel’s corpus. I am not suggesting that this absence constitutes some essential oversight; rather, it is an opportunity to set out on an excursion from the course of The Beast and the Sovereign without leaving its territory. After all, Hegel also has an account of the origins of law. He, too, has a character that is set apart by his (almost animal quality. This figure arrives on stage before history begins. His role––and indeed his “right”––is to found the most basic elements of the state. We are told that his “right” is absolute. He is no Lord. He is not driven by a desire for the recognition of the other. However, who confers this “absolute” right? If his actions are not bound by any measure or proportion, how do we distinguish between the hero and the criminal?

ACCURACY ASSESSMENT OF GO PRO HERO 3 (BLACK CAMERA IN UNDERWATER ENVIRONMENT

Directory of Open Access Journals (Sweden)

P. Helmholz,

2016-06-01

Full Text Available Modern digital cameras are increasing in quality whilst decreasing in size. In the last decade, a number of waterproof consumer digital cameras (action cameras have become available, which often cost less than $500. A possible application of such action cameras is in the field of Underwater Photogrammetry. Especially with respect to the fact that with the change of the medium to below water can in turn counteract the distortions present. The goal of this paper is to investigate the suitability of such action cameras for underwater photogrammetric applications focusing on the stability of the camera and the accuracy of the derived coordinates for possible photogrammetric applications. For this paper a series of image sequences was capture in a water tank. A calibration frame was placed in the water tank allowing the calibration of the camera and the validation of the measurements using check points. The accuracy assessment covered three test sets operating three GoPro sports cameras of the same model (Hero 3 black. The test set included the handling of the camera in a controlled manner where the camera was only dunked into the water tank using 7MP and 12MP resolution and a rough handling where the camera was shaken as well as being removed from the waterproof case using 12MP resolution. The tests showed that the camera stability was given with a maximum standard deviation of the camera constant σc of 0.0031mm for 7MB (for an average c of 2.720mm and 0.0072 mm for 12MB (for an average c of 3.642mm. The residual test of the check points gave for the 7MB test series the largest rms value with only 0.450mm and the largest maximal residual of only 2.5 mm. For the 12MB test series the maximum rms value is 0. 653mm.

Accuracy Assessment of GO Pro Hero 3 (black) Camera in Underwater Environment

Science.gov (United States)

Helmholz, , P.; Long, J.; Munsie, T.; Belton, D.

2016-06-01

Modern digital cameras are increasing in quality whilst decreasing in size. In the last decade, a number of waterproof consumer digital cameras (action cameras) have become available, which often cost less than 500. A possible application of such action cameras is in the field of Underwater Photogrammetry. Especially with respect to the fact that with the change of the medium to below water can in turn counteract the distortions present. The goal of this paper is to investigate the suitability of such action cameras for underwater photogrammetric applications focusing on the stability of the camera and the accuracy of the derived coordinates for possible photogrammetric applications. For this paper a series of image sequences was capture in a water tank. A calibration frame was placed in the water tank allowing the calibration of the camera and the validation of the measurements using check points. The accuracy assessment covered three test sets operating three GoPro sports cameras of the same model (Hero 3 black). The test set included the handling of the camera in a controlled manner where the camera was only dunked into the water tank using 7MP and 12MP resolution and a rough handling where the camera was shaken as well as being removed from the waterproof case using 12MP resolution. The tests showed that the camera stability was given with a maximum standard deviation of the camera constant σc of 0.0031mm for 7MB (for an average c of 2.720mm) and 0.0072 mm for 12MB (for an average c of 3.642mm). The residual test of the check points gave for the 7MB test series the largest rms value with only 0.450mm and the largest maximal residual of only 2.5 mm. For the 12MB test series the maximum rms value is 0. 653mm.

Heroínas pós-feministas: as contradições da produção audiovisual feminina no YouTube

Directory of Open Access Journals (Sweden)

Lígia Campos de Cerqueira Lana

2017-10-01

Full Text Available Este artigo investiga contradições e ambiguidades de papéis sociais femininos difundidos em vlogs produzidos por mulheres no YouTube. O trabalho analisa as origens de vídeos amadores na internet e a relação entre TV e web, discutindo as características da televisão da intimidade. Mais especificamente, a investigação examina o canal de Flavia Calina, que possui, na atualidade, mais de três milhões de assinantes e cerca de 800 milhões de visualizações. Vídeos, comentários de espectadores e um encontro da vlogueira com seu público são analisados tendo em vista a crítica pós-feminista. As conclusões sugerem que Flavia Calina, famosa em virtude do seu reality show digital, sintetiza um tipo de heroísmo neoliberal de classe média, em que o empoderamento feminino é associado à exibição da intimidade e à celebração das escolhas individuais.

Osobnosť gréckych hrdinov z pohľadu modernej psychológie (Personality of Greek Heroes from the Viewpoint of Modern Psychology

Directory of Open Access Journals (Sweden)

Matúš Porubjak

2012-03-01

Full Text Available Drawing from Homer’s Iliad, the article focuses on characters of ancient Greek heroes and relates them to personality psychology. First, it discusses what major personality characteristics have been identified by modern psychological research and how they can be measured. In the next part, the authors summarize how they attempted to verify the historical and intercultural validity of outlined personality models using theIliad and present the results of their analysis. Concluding that ancient Greek accounts testify to the universality of human nature throughout ages and cultures, the article also provides the expected personality profiles of major heroes—Achilles and Agamemnon. Even more interestingly, the authors discuss how and why their motives and behavioral tendencies might cause clashes in their interaction, and also what occupational options they would probably face nowadays. Interdisciplinary in its nature, the paper concludes with implications of the results for philosophy.

Sexual Success after Stress? Imidacloprid-Induced Hormesis in Males of the Neotropical Stink Bug Euschistus heros

Science.gov (United States)

Haddi, Khalid; Mendes, Marcos V.; Lino-Neto, José; Freitas, Hemerson L.; Guedes, Raul Narciso C.; Oliveira, Eugênio E.

2016-01-01

Environmental stress in newly-emerged adult insects can have dramatic consequences on their life traits (e.g., dispersion, survival and reproduction) as adults. For instance, insects sublethally exposed to environmental stressors (e.g., insecticides) can gain fitness benefits as a result of hormesis (i.e., benefits of low doses of compounds that would be toxic at higher doses). Here, we experimentally tested whether sublethal exposure to the insecticide imidacloprid would hormetically affect the sexual fitness of newly-emerged adults of the Neotropical brown stink bug Euschistus heros (Hemiptera: Heteroptera: Pentatomidae), which is the most abundant and prevalent insect pest in Neotropical soybean fields. We evaluated the sexual fitness of four couple combinations: unexposed couples, exposed females, exposed males, and exposed couples. Sublethal exposure to dry residues (i.e., contact) of imidacloprid (at 1% of recommended field rate) did not affect insect survival, but led to higher mating frequencies when at least one member of the couple was exposed. However, the average mating duration was shortened when only females were exposed to imidacloprid. Moreover, exposed males showed higher locomotory (walking) activity, lower respiration rates and induced higher fecundity rates when mated to unexposed females. Although the reproductive tracts of exposed males did not differ morphometrically from unexposed males, their accessory glands exhibited positive reactions for acidic and basic contents. Our findings suggest that males of the Neotropical brown stink bug hormetically increase their sexual fitness when cued by impending insecticidal stress in early adulthood. PMID:27284906

Sexual Success after Stress? Imidacloprid-Induced Hormesis in Males of the Neotropical Stink Bug Euschistus heros.

Directory of Open Access Journals (Sweden)

Khalid Haddi

Full Text Available Environmental stress in newly-emerged adult insects can have dramatic consequences on their life traits (e.g., dispersion, survival and reproduction as adults. For instance, insects sublethally exposed to environmental stressors (e.g., insecticides can gain fitness benefits as a result of hormesis (i.e., benefits of low doses of compounds that would be toxic at higher doses. Here, we experimentally tested whether sublethal exposure to the insecticide imidacloprid would hormetically affect the sexual fitness of newly-emerged adults of the Neotropical brown stink bug Euschistus heros (Hemiptera: Heteroptera: Pentatomidae, which is the most abundant and prevalent insect pest in Neotropical soybean fields. We evaluated the sexual fitness of four couple combinations: unexposed couples, exposed females, exposed males, and exposed couples. Sublethal exposure to dry residues (i.e., contact of imidacloprid (at 1% of recommended field rate did not affect insect survival, but led to higher mating frequencies when at least one member of the couple was exposed. However, the average mating duration was shortened when only females were exposed to imidacloprid. Moreover, exposed males showed higher locomotory (walking activity, lower respiration rates and induced higher fecundity rates when mated to unexposed females. Although the reproductive tracts of exposed males did not differ morphometrically from unexposed males, their accessory glands exhibited positive reactions for acidic and basic contents. Our findings suggest that males of the Neotropical brown stink bug hormetically increase their sexual fitness when cued by impending insecticidal stress in early adulthood.

Irradiation of Eggs and Larvae of Bactrocera Carambolae (Drew and Hancock) Fruit Fly to Produce Irradiation Host for Its Parasitoids

International Nuclear Information System (INIS)

Achmad Nasroh Kuswadi; Murni lndarwatmi; Nasution, Indah Arastuti

2004-01-01

Bactrocera carambolae (Drew and Hancock) fruit fly, a major pests of commercial fruits in Indonesia, is attacked by several species of parasitoids in the field, such as by Biosteres sp. that attacks on early instar larvae and Opius sp. on late instar larvae. In order to produce irradiated host in mass rearing of both species, several dosage of gamma were tested on both eggs and larvae. Egg masses of 0.5 ml were irradiated with 0, 10, 20, 30, 40 and 50 Gy and then inoculated into artificial diet. Viability of the eggs, the larval period and the number of pupae produced were observed. About 200 third instar larvae irradiated with 0, 10, 30, 50,70 dan 90 Gy and the number and quality of the pupae developed were then observed. The results showed that the eggs irradiated with tested dosage did not reduce its viability however it reduced the survival of larvae emerged. Number of pupae produced from 0.5 ml irradiated eggs were reduced from 2740 pupae to 407, 167, 113, 53 and 44 pupae, besides the pupation delayed up to three days. Irradiation on third instars larvae did not reduce its pupation, since pupae were developed from > 85 % of irradiated larvae. However, irradiation did reduced the fly emergence from the pupae. Irradiated hosts for Biosteres sp and Opius sp can be produced by irradiating eggs however it should be evaluated since the survival rate of the larvae reduced. Irradiation of third instar larvae may produce irradiated host for Opius sp So, the use of irradiated eggs or irradiated larvae as host in the colonization of the parasitoids will insure no hosts emerged as adult. However it remain to be proved whether irradiated hosts are prefered and able to support the life of parasitoid. (author)

Fri os fra ejerskabets byrde

DEFF Research Database (Denmark)

Damsgaard, Jan

2017-01-01

Engang var musik et statussymbol og en luksus. Man måtte nemlig købe den musik, som man gerne ville lytte til på en lp eller en cd, der var ganske dyr – en enkelt lp eller cd kostede det samme som to måneders Spotify-abonnement. Og lp’en og cd’en gav kun adgang til at lytte til de udvalgte numre...

Pæren er faldet langt fra stammen

DEFF Research Database (Denmark)

Haarder, Jon Helt

2013-01-01

Roman: Hassan Preislers vellykkede debutroman udleverer ikke bare multikulti-industrien. Den er også en rablende diagnosticering af det moderne menneskes livsvilkår HASSAN PREISLER BRUN MANDS BYRDE 224 sider, 249,95 Lindhardt og Ringhof Er udkommet 4......Roman: Hassan Preislers vellykkede debutroman udleverer ikke bare multikulti-industrien. Den er også en rablende diagnosticering af det moderne menneskes livsvilkår HASSAN PREISLER BRUN MANDS BYRDE 224 sider, 249,95 Lindhardt og Ringhof Er udkommet 4...

Heroic Models.

Science.gov (United States)

Levine, Toni L.

1986-01-01

Describes a class project for which students discussed their conception of a hero, defined a hero in an essay, researched a specific person they felt was a hero, and finally, gave an oral presentation to the class acting out the character of their hero. (SRT)

Solid Phase Synthesis of Polymacromer and Copolymacromer Brushes

Science.gov (United States)

2012-04-25

between immiscible polymers, which dictates the volume in which the interfacial reaction can occur, depends on the nature of thermodynamic interactions...Y.; Beers , K. L.; Byrd, H. C. M.; VanderHart, D. L.; Washburn, N. R. J. Am. Chem. Soc. 2004, 126, 3472−3476. (4) Merrifield, R. B. J. Am. Chem. Soc...Hartmann, L.; Krause, E.; Antonietti, M.; Boerner, H. G. Biomacromolecules 2006, 7, 1239−1244. (16) Mei, Y.; Beers , K. L.; Byrd, H. C. M.; VanderHart, D. L

Heroe, Egregio, para contrabaixo e cravo: aspectos didáticos e interpretativos em uma transcrição de uma cantata do repertório colonial brasileiro Heroe, Egregio for double and harpsichord: interpretive and pedagogical aspects in a transcription of a cantata from the Brazilian colonial repertory

Directory of Open Access Journals (Sweden)

Fausto Borém

2008-12-01

Full Text Available O ainda restrito acesso a partituras e concertos do vasto repertório musical brasileiro dos séculos XVIII e XIX e sua instrumentação estereotipada (quase sempre obras vocais religiosas com acompanhamento orquestral são obstáculos para sua inclusão nos currículos dos cursos de música no país e sua apreciação por um público mais amplo. Uma alternativa para mudar este quadro é a transcrição de obras desse repertório e adaptação de sua instrumentação para grupos de câmara menores, com exclusão até mesmo da voz na sua instrumentação. Essas transcrições podem proporcionar, de maneira mais eficaz, o contato e a experimentação com as assim-chamadas práticas de performance historicamente informadas (Historically Informed Performance ou HIP, seja a partir da adaptação de referências (auditivas e textuais já consolidadas na interpretação do repertório europeu, seja a partir da análise de elementos históricos, formais e possíveis figuras de retórica. No presente trabalho, estas questões são abordadas no Recitativo e Aria da cantata acadêmica Heroe, egregio, douto, peregrino (anônimo, Salvador, 1759 para soprano, dois violinos e baixo contínuo, transcrita para um instrumento de cordas orquestral solista (violino, viola, violoncelo ou contrabaixo e cravo.The still limited access to scores and concerts of the vast Brazilian music repertoire from the eighteenth and nineteenth centuries and its stereotyped instrumentation (almost always sacred vocal music with orchestral accompaniment are obstacles for the inclusion of this repertory in the country's instrumental music curricula and its appreciation by a wider audience. An alternative for this situation is the transcription of works and change of their instrumentation to fit smaller chamber formations, including those without singing. Moreover, these transcriptions could also allow the contact and experimentation with the so-called Historically Informed Performance

The Making of an Environmental Hero: A History of Ecomodern Masculinity, Fuel Cells and Arnold Schwarzenegger

Directory of Open Access Journals (Sweden)

Martin Hultman

2013-05-01

Full Text Available In 2007, Arnold Schwarzenegger received the European Campaigner of the Year award. Chosen by the readers of European Voice for his work on solving global environmental problems, he was hailed as a visionary environmental hero, at the pinnacle of his popularity as a politician. In Sweden the public was told to follow his lead and politicians were advised to learn from his example. How could this happen? How could Schwarzenegger be portrayed as an environmental role model, even in countries such as Sweden, a country known around the world for progressive policies in gender equality and the environment? This paper introduces and investigates the notion of ‘ecomodern masculinity,’ through the assemblage of Schwarzenegger’s gender identity, environmental politics, and image in Sweden. While there has been research on gender inequity in relation to environmental and developmental goals, there has been little concern with constructions of how shifting hegemonic masculinity is embedded in environmental policy. As former California governor, actor, and Mr. Universe, Schwarzenegger’s connection to the ecomodern politics that he prescribed is researched within a framework combining insights from the fields of gender and environmental studies. Ecomodern environmental politics and Kindergarten Commando masculinity are understood as attempts to incorporate and deflect criticism in order to perpetuate hegemony, to ensure that practices remain in effect, ‘business as usual.’ By looking at the historical changes in Schwarzenegger’s identity intertwined with the rise of ecomodern discourse, this article illustrates those changes and broadens our understanding of global politics in the fields of energy and the environment.

Apocalyptic souls: the existential (anti hero metaphor in the Metal Gear Solid: Snake Eater, Peace Walker and Ground Zeroes games

Directory of Open Access Journals (Sweden)

Daniel de Vasconcelos Guimarães

2015-06-01

Full Text Available In the present study, I drew a correlation between Søren Kierkegaard’s (1813-1855 existentialist theory and apocalyptic representations in the Metal Gear Solid: Snake Eater, Peace Walker and Ground Zeroes video games (Konami Computer Entertainment Japan, Kojima Productions, 2004, 2010 and 2014. In this successful franchise, the game’s main character, ‘Snake’ personifies ‘the knight of infinite resignation,’ the ‘tragic hero’ in ‘the infinite movement’ towards the achievement of ‘higher causes’. Also, Snake’s mentor ‘The Boss’, who sacrifices herself in order to reconcile the world from its 1960’s Cold War antagonism would represent another Kierkegaard notion called ‘the knight of faith’, who believes in his/her faith (the cause above all things. Such character traits enrich both gameplay and game narrative and the overall experience by introducing philosophical inquiries to the player. The methodology utilized was a free-form semiotic framework with emphasis on the symbolic representations along with Kierkegaard’s existentialism and other philosophical constructs as well.

Videoendoscopia digestiva superior en el Centro Médico de Diagnóstico de Alta Tecnología "Las Heroínas de Mérida" del estado venezolano de Mérida Upper gastrointestinal video endoscopy at the Diagnostic Medical Center of High Technology "Las heroínas de Mérida" of Mérida state in Venezuela

Directory of Open Access Journals (Sweden)

Odalis García Paneque

2013-02-01

Full Text Available Se efectuó un estudio descriptivo y transversal de los 1 742 pacientes mayores de 18 años en los que se realizó de forma satisfactoria la videoendoscopia del tracto digestivo superior en el Centro Médico de Diagnóstico de Alta Tecnología "Las Heroínas de Mérida" del Estado Mérida (Venezuela, desde el 2008 hasta el 2011, con vistas a describir los hallazgos a través de dicho procedimiento. En la casuística predominaron el sexo femenino (63,3 % y el grupo etario de 46-61 años, con una edad promedio de 55,8 años; además, 30,6 % de las pruebas resultaron normales. El dolor epigástrico (48,6 %, la dispepsia (43,5 % y el reflujo gastroesofágico (8,6 % fueron las principales causas de remisión, en tanto la gastritis (32,4 % constituyó el diagnóstico endoscópico más frecuente, específicamente sus variedades eritematosa y eritemato-erosiva, con 66,0 y 13,0 %, respectivamente. Del total, 10 pacientes presentaron cáncer gástrico y 9, cáncer esofágico. Se pudo concluir que el procedimiento permitió el diagnóstico preciso de las enfermedades del tracto digestivo superior, así como una atención terapéutica adecuada.A descriptive and cross-sectional study was conducted in 1 742 patients over 15 years, in whom the video endoscopy of upper gastrointestinal tract was successfully performed at the Diagnostic Medical Center of High Technology "Las Heroínas de Mérida" of Mérida state (Venezuela, from 2008 to 2011, with the purpose of describing the findings through this procedure. Female sex (63.3% and age group of 46-61 years with a mean age of 55.8 years predominated in the case material, and 30.6% of the tests were normal. Epigastric pain (48.6%, dyspepsia (43.5% and gastroesophageal reflux (8.6% were the main reasons for referrals, while gastritis (32.4% constituted the most frequent endoscopic diagnosis, specifically its erythematous and erythematous-erosive varieties, with 66.0 and 13.0%, respectively. Of the total, 10

Guidelines for equipment and staffing of radiotherapy facilities in the European countries: Final results of the ESTRO-HERO survey

International Nuclear Information System (INIS)

Dunscombe, Peter; Grau, Cai; Defourny, Noémie; Malicki, Julian; Borras, Josep M.; Coffey, Mary; Bogusz, Marta; Gasparotto, Chiara; Slotman, Ben; Lievens, Yolande; Kokobobo, Arianit; Sedlmayer, Felix; Slobina, Elena; De Hertogh, Olivier; Hadjieva, Tatiana; Petera, Jiri; Eriksen, Jesper Grau; Jaal, Jana; Bly, Ritva; Azria, David

2014-01-01

Background and purpose: In planning to meet evidence based needs for radiotherapy, guidelines for the provision of capital and human resources are central if access, quality and safety are not to be compromised. A component of the ESTRO-HERO (Health Economics in Radiation Oncology) project is to document the current availability and content of guidelines for radiotherapy in Europe. Materials and methods: An 84 part questionnaire was distributed to the European countries through their national scientific and professional radiotherapy societies with 30 items relating to the availability of guidelines for equipment and staffing and selected operational issues. Twenty-nine countries provided full or partial evaluable responses. Results: The availability of guidelines across Europe is far from uniform. The metrics used for capital and human resources are variable. There seem to have been no major changes in the availability or specifics of guidelines over the ten-year period since the QUARTS study with the exception of the recent expansion of RTT staffing models. Where comparison is possible it appears that staffing for radiation oncologists, medical physicists and particularly RTTs tend to exceed guidelines suggesting developments in clinical radiotherapy are moving faster than guideline updating. Conclusion: The efficient provision of safe, high quality radiotherapy services would benefit from the availability of well-structured guidelines for capital and human resources, based on agreed upon metrics, which could be linked to detailed estimates of need

Historical Painting and Portraits of Independence Heroes in Colombia during the Nineteenth Century: Lack of Public Support and Importance of Private Initiatives

Directory of Open Access Journals (Sweden)

Santiago Robledo Páez

2018-01-01

Full Text Available In this article we study historical painting and portraits of founding fathers and independence heroes produced in Colombia during the 19th century. These paintings have usually been analyzed from iconographic and iconological perspectives; however, they are presented here as cultural objects that undergo specific production, diffusion, reception and appropriation processes. To shine some light on these topics, we examined different document collections from the General Archive of the Nation (Colombia and the Historical Archive of the National Museum (Colombia, as well as the press and legislation of the time. It was found that the minimal state support of pictorial production would have discouraged the elaboration of historical paintings in Colombia. We discovered that although portrait painting was occasionally encouraged by the Government throughout the 19th century, most of the portraits were the result of private initiatives. This situation, however, didn’t prevent their exhibition in public spaces and an increase in their circulation. In conclusion, the absence of wide ranging projects for an official production of that type of paintings leads us to relativize the role of representation in the creation of Colombia’s national narrative, particularly in the National Museum.

[Shaping ability of two nickel-titanium rotary systems in simulated S-shaped canals].

Science.gov (United States)

Luo, Hong-xia; Huang, Ding-ming; Zhang, Fu-hua; Tan, Hong; Zhou, Xue-dong

2008-01-01

To evaluate the shaping ability of two nickel-titanium rotary systems (ProTaper and Hero642) in simulated S-shaped canals. Thirty simulated S-shaped canals were randomly divided into three groups and prepared by ProTaper, Hero642, ProTaper combined with Hero642 respectively. All the canals were scanned before and after instrumentation, and the amount of material removed in the inner and outer wall and the canal width after instrumentation were measured with a computer image analysis program. There was significant difference in the amount of material removed at the inner side of apical curvature and outer side of apex between ProTaper combined with Hero642 and ProTaper files (P Hero642, and the taper of canals were better than those prepared by Hero642. ProTaper combined with Hero 642 had better shaping ability to maintain the original shape and could create good taper canals in the simulated S-shaped canal model.

Mollie Lentaigne, the nurse who drew McIndoe's Guinea pigs: Exploring the role of a medical artist at the Queen Victoria Hospital, 1940-1945.

Science.gov (United States)

Baldwin, Alexander J

2018-04-16

Mollie Lentaigne was a medical artist who worked at the Queen Victoria Hospital in East Grinstead during the Second World War alongside Archibald McIndoe and his dedicated team. She drew hundreds of medical illustrations for McIndoe and his fellow surgeons during the years between 1940 and 1945. Her illustrations depict the plastic surgery that was carried out in that hospital on the badly burnt RAF servicemen injured during the war that took place in the skies over Europe, which included many aircrew injured during the Battle of Britain. This project looks at the career of Lentaigne and her role within the surgical team in East Grinstead during that era and explores a number of Lentaigne's illustrations whilst providing context as to the procedures and patients depicted. An examination of Lentaigne's story, using an interview conducted by the author with the artist offers an alternative perspective with which to observe the events that unfolded in East Grinstead during that conflict. An analysis of these images shows the ability of this artist to portray relatively complex operations with a series of simple pencil or ink diagrams whilst also skilfully engaging the observer's sense of touch. The ability of a medical artist to be selective with her illustrations allowed them to provide clearer, less cluttered images that were preferred by McIndoe when recording the specific surgical procedures for use in the patient's medical records. Copyright © 2018 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.

A Comparative Study on the Stages of Myths Where Nature Appears Sympathetic in Greek & Persian Myths

Directory of Open Access Journals (Sweden)

Hiam Gerdabi

2015-04-01

Full Text Available During a mythical quest, a typical hero undergoes certain ordeals to achieve the heroic goal which sets him/her on the path of adventure in the first place. Facing the difficulties, the narrator offers help not only through the internal powers of the hero’s soul but also through a variety of external forces (natural/supernatural. In Greek and Persian mythology, heroes sometimes receive help from nature as a source of independent power which can bring about changes. The current study aims to hold out a few cases of natural changes in legendary quests that take ordinary natural phenomena out of their path affecting the quest results. Joseph Campbell’s list of stages of a myth is to be used for juxtaposing the natural phenomena in the myths in order to decide about the part of the legend where nature leaves a mark. The result of the study is expected to categorize different types of heroes that appear in Greek and Persian myths. Furthermore, the relationship between heroes and nature will be examined; as the Persian hero receives the natural interference during the ongoing stages of their quest as help, while the Greek hero receives the effect of nature after their death. All these are supposed to reveal the reward mechanism and how it reflects on the type of measures taken by nature. Keywords: Archetypes, Mythical Hero, Structure of Myths, Reward, Persian Hero, Greek Hero

The King of Norway: negative individuation, the hero myth and psychopathic narcissism in extreme violence and the life of Anders Behring Breivik.

Science.gov (United States)

Virtanen, Harri

2013-11-01

The paper discusses negative individuation and the hero myth as developmental concepts. It is suggested that in negative individuation healthy psychological development is hindered and goes astray. Aggression then becomes the central psychic system. Repressed anger is the core element in psychopathic narcissism (Diamond) and malignant narcissism (Kernberg). Both Diamond and Kernberg extend narcissistic personality structure to antisocial, psychopathic personality in an effort to better understand extreme violence. According to Freud, love (libido) and hate (the death drive) are the major motivational systems in the human psyche. In contrast to Freud, Jung sees libido as a life force in general, not simply as a sexual drive. Jung writes about evil and the shadow but does not present a comprehensive theory of the negative development of an individual's life. The concept of negative individuation connects the shadow and the death drive with psychopathology, psychiatry and psychotherapy. In this paper, I explore these concepts in the light of contemporary affect theory according to Kernberg. I also ask how ideology is tied to extreme violence and how it is possible that narcissistic personality structures can lead to such radically different outcomes as were manifested in the lives of Anders Behring Breivik and Steve Jobs. © 2013, The Society of Analytical Psychology.

I mutevoli volti dell’eroe

Directory of Open Access Journals (Sweden)

Giuseppe Serpillo

2013-03-01

Full Text Available Yeats needed heroes and looked forward to finding one who might embody his ideas and hopes of the beginning of a new era. However, his standard of perfection changed over the years: from a character in whom the best and highest qualities of an individual might come into being, to a model of the hero able to stand as a symbol and guide for his fellow men, in particular those people Yeats felt mainly responsible for, the Irish. There is something Carlylean in this (Yeats knew and appreciated Carlyle, even though he did not like his style, but his view of the hero includes other models, like the tragic hero and the hero of myth. This paper takes into consideration two heroes who frequently recur in his work, Oisin and Cuchulainn, pointing to similarities and difference both in their qualities and functions. However, above and beyond them, it is the poet himself that emerges as a key figure of a hero in Yeats’s poetry, as the only one who can fulfil the double task of developing his self and playing an essential social and moral role.

Archetypy v řecké mytologii

OpenAIRE

Domanjová, Nikola

2011-01-01

This work deals with characteristics of Greek mythology and tries to define a myth and to describe the differences between myths and fairy tales. It focuses on an origin and a history of myths, on gods and on heroes. My work also examines a concept of collective unconscious and archetypes, that appears in antique mythology (especially the archetype of a hero). Based on these findings, this work forms characteristic features of heroes, that are applied on the Greek heroes Odysseus and Achilles...

Reaching Low-Income Mothers to Improve Family Fruit and Vegetable Intake: Food Hero Social Marketing Campaign—Research Steps, Development and Testing

Science.gov (United States)

Tobey, Lauren N.; Koenig, Harold F.; Brown, Nicole A.; Manore, Melinda M.

2016-01-01

The objective of this study was to create/test a social marketing campaign to increase fruit/vegetable (FV) intake within Oregon Supplemental Nutrition Assistance Program (SNAP) eligible families. Focus groups (n = 2) and pre/post campaign phone surveys (n = 2082) were conducted in intervention counties (IC) and one control county. Participants were female (86%–100%) with 1–2 children at home. Mean FV intake/without juice was 3.1 servings/day; >50% preferred the Internet for delivery of healthy eating information. Participants reported time/financial burdens, low household FV variety and desirability of frozen/canned FV, and acceptance of positive messages. A Food Hero (FH) campaign was created/delivered daily August–October 2009 to mothers through multiple channels (e.g., grocery stores, online, educators). Results showed that the IC had better FH name recall (12%) and interpretation of intended messages (60%) vs. control (3%, 23%, respectively). Compared to controls, the IC were less likely to report healthy food preparation as time consuming or a FV rich diet expensive, and it was easier to get their family to eat fruit. Results did not vary based on county/household characteristics. The FH campaign increased FH awareness and positive FV beliefs. A longer campaign with FV assessments will increase understanding of the target audience, and allow for campaign refinement. PMID:27649233

Reaching Low-Income Mothers to Improve Family Fruit and Vegetable Intake: Food Hero Social Marketing Campaign—Research Steps, Development and Testing

Directory of Open Access Journals (Sweden)

Lauren N. Tobey

2016-09-01

Full Text Available The objective of this study was to create/test a social marketing campaign to increase fruit/vegetable (FV intake within Oregon Supplemental Nutrition Assistance Program (SNAP eligible families. Focus groups (n = 2 and pre/post campaign phone surveys (n = 2082 were conducted in intervention counties (IC and one control county. Participants were female (86%–100% with 1–2 children at home. Mean FV intake/without juice was 3.1 servings/day; >50% preferred the Internet for delivery of healthy eating information. Participants reported time/financial burdens, low household FV variety and desirability of frozen/canned FV, and acceptance of positive messages. A Food Hero (FH campaign was created/delivered daily August–October 2009 to mothers through multiple channels (e.g., grocery stores, online, educators. Results showed that the IC had better FH name recall (12% and interpretation of intended messages (60% vs. control (3%, 23%, respectively. Compared to controls, the IC were less likely to report healthy food preparation as time consuming or a FV rich diet expensive, and it was easier to get their family to eat fruit. Results did not vary based on county/household characteristics. The FH campaign increased FH awareness and positive FV beliefs. A longer campaign with FV assessments will increase understanding of the target audience, and allow for campaign refinement.

Reaching Low-Income Mothers to Improve Family Fruit and Vegetable Intake: Food Hero Social Marketing Campaign-Research Steps, Development and Testing.

Science.gov (United States)

Tobey, Lauren N; Koenig, Harold F; Brown, Nicole A; Manore, Melinda M

2016-09-13

The objective of this study was to create/test a social marketing campaign to increase fruit/vegetable (FV) intake within Oregon Supplemental Nutrition Assistance Program (SNAP) eligible families. Focus groups (n = 2) and pre/post campaign phone surveys (n = 2082) were conducted in intervention counties (IC) and one control county. Participants were female (86%-100%) with 1-2 children at home. Mean FV intake/without juice was 3.1 servings/day; >50% preferred the Internet for delivery of healthy eating information. Participants reported time/financial burdens, low household FV variety and desirability of frozen/canned FV, and acceptance of positive messages. A Food Hero (FH) campaign was created/delivered daily August-October 2009 to mothers through multiple channels (e.g., grocery stores, online, educators). Results showed that the IC had better FH name recall (12%) and interpretation of intended messages (60%) vs. control (3%, 23%, respectively). Compared to controls, the IC were less likely to report healthy food preparation as time consuming or a FV rich diet expensive, and it was easier to get their family to eat fruit. Results did not vary based on county/household characteristics. The FH campaign increased FH awareness and positive FV beliefs. A longer campaign with FV assessments will increase understanding of the target audience, and allow for campaign refinement.

Entre as heroínas e o silêncio: a condição feminina na Atenas clássica = Between the heroines and silence: the status of women in Athens classic

Directory of Open Access Journals (Sweden)

Berquó, Thirzá Amaral

2014-01-01

Full Text Available O presente artigo tem como objetivo abordar as relações de gênero em Atenas no período clássico (sécs. V-IV a. C. , a fim de examinar a condição feminina nesta sociedade, sendo a primeira etapa de uma pesquisa mais ampla, sobre o erro trágico (hamartia feminino e o protagonismo/heroísmo feminino na tragédia grega. Para tanto, foram analisadas fontes primárias textuais, contrastando as representações da mulher no trabalho de poetas, historiadores, filósofos e oradores e a realidade social feminina na Atenas clássica. Desse modo, são examinados os diversos estatutos para as mulheres nessa sociedade, quais sejam, cidadãs (mélissai, concubinas (pallakai, metecas, cortesãs (hetairai, prostitutas (pornai e escravas

"And first he drew a line"

DEFF Research Database (Denmark)

Graham, Brian Russell

At the end of “Night the Seventh” of Blake’s The Four Zoas, Blake’s Los, against a background of “furious war”, takes a stance and then performs an act which might seem powerless and quaint against such a backdrop: he draws a line, beginning work consisting of lines which Enitharmon, his companion......, tinctures, as it emerges. Placing this moment in the context of the poem’s epic struggle, this paper explores the reasons for Blake’s choice of image at this juncture in the “history”, thereby making a contribution to our understanding of the opposition between form and formlessness in the narrative....

DCS Terrain Submission for Drew AR

Data.gov (United States)

Federal Emergency Management Agency, Department of Homeland Security — Terrain data, as defined in FEMA Guidelines and Specifications, Appendix N: Data Capture Standards, describes the digital topographic data that was used to create...

Postmodern messiahs: the changing saviours of contemporary popular culture

Directory of Open Access Journals (Sweden)

Sofia Sjö

2009-01-01

Full Text Available The messiah myth is alive and well in the modern world. Contemporary science fiction film has taken the myth to heart and given us an endless stream of larger than life heroes. The heroes of the present are, however, not exactly the same as the heroes of the past. A changing world demands new things of its saviours. Using a textual and narrative analysis based on insights gained from feminist film theory and cultural studies, this article looks closely at the messiah theme in science fiction films and TV series from the last three decades. The study explores the changes that have occurred in relation to images of the body, the attitudes and personalities of modern heroes, gender, questions of power and ideas of the transcendent. The article then discusses what these changes both between newer and older heroes and between contemporary heroes and the traditional messiah story might say about religion and spirituality in the modern world. Finally the article explores the question of why the messiah myth still finds an audience today.

References to Gauguin paintings in Somerset Maugham’s The moon and sixpence

Directory of Open Access Journals (Sweden)

Laurence Wright

2014-12-01

Full Text Available It has not before been noticed that in describing works of art painted by his fictional anti-hero,Charles Strickland, in the novel The moon and sixpence, which is loosely based on the life of Paul Gauguin, Somerset Maugham drew on actual works by Gauguin in his verbal descriptions. Sometimes the references are to specific paintings, at others to phases in his work. For readers familiar with Gauguin’s artistic output, his writings on art and his biography, the effect of this insistent visual ‘quotation’ is to create a disturbing sense of aesthetic dissonance, in that it becomes difficult to accept the inarticulate, surly, impassioned but utterly grim and joyless figure of the fictional Charles Strickland as the source of these vivifying paintings, which possess their own real history and provenance. There is nothing in Strickland of Gauguin’s child-like zest for life, his exuberance, his fantasies, his extrovert willingness to explain his art to friends and the public through fascinating if deeply unreliable writings. The reader must either attempt to blot all knowledge of Gauguin and his art from consciousness, there by denying that Maugham is ‘quoting’ Gauguin’s oeuvre, or else submit to an intolerable level of fictional incredulity and disbelief.

Conceptual Study of A Hetrodyne Receiver for the Origins Space Telescope

Science.gov (United States)

Wiedner, Martina

2018-01-01

The Origins Space Telescope (OST) is a mission concept of an extremely versatile observatory with 5 science instruments, of which the HEterodyne Receivers for OST (HERO) is one. HERO's main targets are high spectral resolution observations (Δλ/λ up to 107 or Δv = 0.03km/s) of water to follow its trail from cores to YSOs as well as H2O and HDO observations on comets. HERO will probe all neutral ISM phases using cooling lines ([CII], [OI]) and hydrides as probes of CO-dark H2 (CH, HF). HERO will reveal how molecular clouds and filaments form in the local ISM up to nearby galaxies. In order to achieve these observational goals, HERO will cover an extremely wide frequency range from 468 to 2700 GHz and a window around the OI line at 4563 to 4752GHz. It will consist of very large focal plane arrays of 128 pixels between 900 - 2700 GHz and at 4.7 THz, and 32 pixels for the 468 to 900 GHz range. The instrument is exploiting Herschel/HIFI heritage. HERO's large arrays require low dissipation and low power components. The HERO concept makes use of the latest cryogenic SiGe amplifier technology, as well as CMOS technology for the backends with 2 orders of magnitude lower power.

Osteometric sorting of skeletal elements from a sample of modern Colombians: a pilot study.

Science.gov (United States)

Rodríguez, Juan Manuel Guerrero; Hackman, Lucina; Martínez, Wendy; Medina, César Sanabria

2016-03-01

The Colombian armed conflict has been catalogued not only as the longest civil war in the western hemisphere, but also as having one of the highest indexes of missing persons. Among the several challenges faced by forensic practitioners in Colombia, the commingling of human remains has been recognised as one of the most difficult to approach. The method of osteometric sorting described by Byrd and Adams and Byrd (2008) has proven relevant as a powerful tool to aid in the reassociation process of skeletal structures. The aim of this research was to evaluate the three osteometric sorting models developed by Byrd (2008) (paired elements, articulating bone portions and other bone portions) in a sample of modern Colombian individuals. A set of 39 linear measurements was recorded from a sample of 100 individuals (47 females and 53 males aged between 20 and 74 and 18 and 77 years, respectively), which was used to create a reference sample database. A different subset of eight individuals (five females aged between 23 and 48 years, and three males aged between 27 and 43 years) was employed to randomly create six small-scale commingled assemblages for the purposes of testing the osteometric sorting models. Results demonstrate that this method has significant potential for use in the Colombian forensic context.

Victimización y heroísmo. Disputas de las memorias emblemáticas de la izquierda chilena en dos fechas conmemorativas: aniversario del golpe de Estado y día del joven combatiente

Directory of Open Access Journals (Sweden)

Tamara vidaurrazaga aránguiz

2015-01-01

Full Text Available En el presente trabajo proponemos reflexionar en torno a dos memorias emblemáticas y dicotómicas que tienen lugar dentro de la izquierda chilena a la hora de recordar a quienes resistieron a la dictadura de Pinochet, reelaboraciones que hemos denominado memoria de la victimización y memoria del heroísmo, y que ejemplificaremos en dos fechas icónicas para la izquierda chilena: la conmemoración del Golpe de Estado cada 11 de septiembre, y el Día del Joven Combatiente rememorado cada 29 de marzo. Lo que nos interesa es reflexionar en torno a la marmolización que implican estas dos reconstrucciones, y la dificultad para imaginar un futuro para el proyecto político heredado por la izquierda chilena al sumirnos en esta dicotomía estanca.

Synonymization of key pest species within the Bactrocera dorsalis species complex (Diptera: Tephritidae): taxonomic changes based on a review of 20 years of integrative morphological, molecular, cytogenetic, behavioral, and c

Science.gov (United States)

Bactrocera papayae Drew & Hancock, Bactrocera philippinensis Drew & Hancock, Bactrocera carambolae Drew & Hancock, and Bactrocera invadens Drew, Tsuruta & White are four horticultural pest tephritid fruit fly species that are highly morphologically and genetically similar to the destructive pest, th...

A comparison of patency and interventions in thigh versus Hemodialysis Reliable Outflow grafts for chronic hemodialysis vascular access.

Science.gov (United States)

Brownie, Evan R; Kensinger, Clark D; Feurer, Irene D; Moore, Derek E; Shaffer, David

2016-11-01

With improvements in medical management and survival of patients with end-stage renal disease, maintaining durable vascular access is increasingly challenging. This study compared primary, assisted primary, and secondary patency, and procedure-specific complications, and evaluated whether the number of interventions to maintain or restore patency differed between prosthetic femoral-femoral looped inguinal access (thigh) grafts and Hemodialysis Reliable Outflow (HeRO; Hemosphere Inc, Minneapolis, Minn) grafts. A single-center, retrospective, intention-to-treat analysis was conducted of consecutive thigh and HeRO grafts placed between May 2004 and June 2015. Medical history, interventions to maintain or restore patency, and complications were abstracted from the electronic medical record. Data were analyzed using parametric and nonparametric statistical tests, Kaplan-Meier survival methods, and multivariable proportional hazards regression and logistic regression. Seventy-six (43 thigh, 33 HeRO) grafts were placed in 61 patients (54% male; age 53 [standard deviation, 13] years). Median follow-up time in the intention-to-treat analysis was 21.2 months (min, 0.0; max, 85.3 months) for thigh grafts and 6.7 months (min, 0.0; max, 56.3 months) for HeRO grafts (P = .02). The groups were comparable for sex, age, coronary artery disease, diabetes mellitus, peripheral vascular disease, and smoking history (all P ≥ .12). One thigh graft (2%) and five HeRO (15%) grafts failed primarily. In the intention-to-treat analysis, patency durations were significantly longer in the thigh grafts (all log-rank P ≤ .01). Point estimates of primary patency at 6 months, 1 year, and 3 years were 61%, 46%, and 4% for the thigh grafts and 25%, 15%, and 6% for the HeRO grafts. Point estimates of assisted primary patency at 6 months, 1 year, and 3 years were 75%, 66%, and 54% for the thigh grafts and 41%, 30%, and 10% for the HeRO grafts. Point estimates of secondary patency at 6�

Patrones de consumo de heroína en una cárcel de la frontera norte de México: barreras de acceso a tratamiento Heroin consumption patterns in a northern Mexican border prison: obstacles to treatment access

Directory of Open Access Journals (Sweden)

Patricia Cravioto

2003-06-01

Full Text Available OBJETIVO: Describir la prevalencia del consumo de heroína, los patrones de inicio, el alto consumo y la dependencia a esta sustancia e identificar barreras que impidan a los adictos acudir a tratamiento. MATERIAL Y MÉTODOS: El estudio se realizó en la cárcel de Ciudad Juárez, Chihuahua, México, entre abril y junio de 2000; los participantes se obtuvieron a través de un muestreo aleatorio simple, partiendo del censo del penal. Se identificaron las barreras al tratamiento, estimadas mediante un modelo de regresión logística. RESULTADOS: La prevalencia de consumo de heroína en los últimos seis meses fue de 26.4%; de 25.3% para usuarios fuertes; 95% fueron dependientes. El promedio de la edad de inicio del consumo fue a los 21 años. El modelo multivariado mostró que baja escolaridad, abstinencia, sobredosis, enfermedades crónicas y tiempo de exposición son barreras que impiden solicitar tratamiento. CONCLUSIONES: Las implicaciones de los resultados se discuten en función de aplicarlos para implantar programas de tratamiento en las cárceles.OBJECTIVE: To assess the prevalence of heroin use, patterns of initiation, intense use, and drug-dependency; also, to assess barriers to drug treatment access. MATERIAL AND METHODS: The study was conducted in the Ciudad Juarez, Chihuahua prison. Subjects were selected using simple random sampling from census of prison inmates. Barriers to drug treatment were identified and analyzed using a logistic regression model. RESULTS: The prevalence of heroin use for the last six months was 26.4%; 25.3% were intense heroin users; and 95% showed dependence. The mean age of initiation was 21 years. A multivariate model showed that the significant barriers to drug treatment access were: low education, withdrawal, overdosing, presence of chronic diseases, and duration of heroin use. CONCLUSIONS: Study findings should serve to devise potential applications to establish treatment programs in prisons.

HEROs: Design of a Mixed-Methods Formative Research Phase for an Ecocultural Intervention to Promote Healthy Eating and Activity Behaviors in Rural Families With Preschoolers.

Science.gov (United States)

Bellows, Laura L; McCloskey, Morgan; Clark, Lauren; Thompson, Darcy A; Bekelman, Traci A; Chamberlin, Barbara; Johnson, Susan L

2018-04-10

To describe the mixed-methods formative research phase in the development of the Healthy Environments Study (HEROs), a technology-based, interactive family intervention to promote healthy eating and activity behaviors for young children in the home environment. A mixed-method iterative approach, using ecocultural theory as a framework, will guide the development of both quantitative and qualitative formative research assessments. Rural eastern Colorado. Low-income families (n = 200) with preschool-aged children enrolled at 6 Head Start/preschool centers. Quantitative and qualitative methodologies will garner insights into 4 key topic areas: (1) food behaviors and environments (Remote Food Photography Method, parent focus group, and survey), (2) physical activity behaviors and environments (parent interview and survey), (3) mobile device use (parent survey and interview), and (4) daily life (ecocultural family interview and teacher/staff group discussions). Results will be interpreted in combination to allow for a holistic understanding of participant behaviors, beliefs, attitudes and values related to each of the 4 topic areas. Collectively, outcomes will provide a comprehensive picture of preschoolers' daily life and inform intervention design and strategies to enhance preschoolers' eating and activity behaviors in the home environment. Copyright © 2018 Society for Nutrition Education and Behavior. Published by Elsevier Inc. All rights reserved.

Green Bank Observatory (GBO)

Data.gov (United States)

Federal Laboratory Consortium — The largest fully steerable telescope in the world - the Robert C. Byrd Green Bank Telescope (GBT), began observations in Green Bank, West Virginia in 2000and is a...

Zimnij put’ u Puškina. (Nacional’naja priroda kuchnja istorii kak kul’tury)

OpenAIRE

Ivanickij, Aleksandr

1998-01-01

In The Snowstorm, Captain's daughter and Eugene Onegin (chapter V, The dream of Tatyana) Pushkin's heroes of adventurous or sentimental novels are becoming partly fairy tales heroes and their roads in lives are receiving national and historical meaning. First, the adventurous way for the hero is laid by the fairy nature. Acting like a storm reforming the world, nature is continued in history (the 1812 war), or tallies with history (Pugachev's rebellion). The storm joins a...

Health Extension and Clinical and Translational Science: An Innovative Strategy for Community Engagement.

Science.gov (United States)

Kaufman, Arthur; Rhyne, Robert L; Anastasoff, Juliana; Ronquillo, Francisco; Nixon, Marnie; Mishra, Shiraz; Poola, Charlene; Page-Reeves, Janet; Nkouaga, Carolina; Cordova, Carla; Larson, Richard S

Health Extension Regional Officers (HEROs) through the University of New Mexico Health Sciences Center (UNMHSC) help to facilitate university-community engagement throughout New Mexico. HEROs, based in communities across the state, link priority community health needs with university resources in education, service, and research. Researchers' studies are usually aligned with federal funding priorities rather than with health priorities expressed by communities. To help overcome this misalignment, the UNM Clinical and Translational Science Center (CTSC) provides partial funding for HEROs to bridge the divide between research priorities of UNMHSC and health priorities of the state's communities. A bidirectional partnership between HEROs and CTSC researchers was established, which led to: 1) increased community engaged studies through the CTSC, 2) the HERO model itself as a subject of research, 3) a HERO-driven increase in local capacity in scholarship and grant writing, and 4) development of training modules for investigators and community stakeholders on community-engaged research. As a result, 5 grants were submitted, 4 of which were funded, totaling $7,409,002.00, and 3 research articles were published. Health extension can serve as a university-funded, community-based bridge between community health needs and Clinical and Translational Science Award (CTSA) research capacity, opening avenues for translational research. © Copyright 2017 by the American Board of Family Medicine.

De héroes, naciones milenarias y guerras fratricidas. Tres mitos fundacionales en tres relatos historiográficos de la nación mexicana About heroes, ancient nations and fratricidal wars: Three foundational myths in three Mexican nation's historiographic stories

Directory of Open Access Journals (Sweden)

Óscar Javier Linares Londoño

2010-07-01

Full Text Available La interpretación canónica de la independencia de México explica los hechos que van de 1810 a 1821 como la emancipación de la nación mexicana, pueblo milenario que remonta su identidad nacional a los mexicas, habitantes del Valle de México, antes de la llegada de los españoles. Por trescientos años el pueblo fue oprimido bajo el yugo español, y logra su independencia gracias al movimiento nacionalista de sus héroes. Esta interpretación construida por los relatos historiográficos del siglo XIX, está basada en lo que llamaré los mitos fundacionales de la nación: el mito de la nación milenaria, el mito de los héroes y el mito de la pugna irreconciliable entre criollos y españoles. La historiografía decimonónica difundirá estos mitos con la firme intención de legitimar el movimiento independentista y de dotar de un relato homogéneo a la naciente nación.The canonical interpretation of the independence of Mexico explains the facts that go from 1810 to 1821 as the emancipation of the Mexican nation, ancient nation that traced back its national identity to the Mexican people, inhabitants of the Valley of Mexico before the Spanish arrived. Oppressed for three hundred years under Spanish rule, the Mexican nation achieves its independence through nationalist movement of its heroes. This interpretation, built by the nineteenth-century historiographical tales, is based on what we call the nation founding myths: the myth of the ancient nation, the myth of the heroes, and the myth of irreconcilable conflict between Creoles and Spanish people. Nineteenth-century historiography will spread these myths with the firm intention of legitimizing the independence movement and give a consistent story to the emerging nation.

75 FR 56503 - Membership of the Departmental Performance Review Board

Science.gov (United States)

2010-09-16

.... Washington, Deputy General Counsel Chief Financial Officer and Assistant Secretary for Administration... Walters, Chief Financial Officer and Director of Administration International Trade Administration... National Oceanic and Atmospheric Administration: Robert J. Byrd, Chief Financial Officer/Chief...

New exact solutions to the generalized KdV equation with ...

Indian Academy of Sciences (India)

is reduced to an ordinary differential equation with constant coefficients ... Application to generalized KdV equation with generalized evolution ..... [12] P F Byrd and M D Friedman, Handbook of elliptic integrals for engineers and physicists.

The Force Awakens: The Individualistic and Contemporary Heroine

Directory of Open Access Journals (Sweden)

Payal Doctor

2017-12-01

Full Text Available Star Wars Episode VII: The Force Awakens is not the hero’s journey as George Lucas previously conceptualized it. Instead, the story line of The Force Awakens leads me to believe that it creates a new iteration of the hero myth. It follows the contemporary heroine’s journey while conforming to the essential construct of the hero monomyth. First, the contemporary heroine’s journey focuses primarily on the greater good and secondarily on her own personal journey, which is the converse of the traditional hero’s journey. Second, the contemporary heroine’s self is awakened and called to adventure in a different way than the traditional hero. Third, the traditional hero receives guidance on his journey, while the contemporary heroine pushes ahead alone, striving to save her society from despair.

Microstructural Location and Composition of Impurities in Polar Ice Cores, Version 1

Data.gov (United States)

National Aeronautics and Space Administration — This data set contains measurements of impurities and ions in three polar ice cores: the Vostok 5G ice core and the Byrd ice core from Antarctica, and the Greenland...

Effect of different doses of aerobic exercise on total white blood cell (WBC and WBC subfraction number in postmenopausal women: results from DREW.

Directory of Open Access Journals (Sweden)

Neil M Johannsen

Full Text Available BACKGROUND: Elevated total white blood cell (WBC count is associated with an increased risk of coronary heart disease and death. Aerobic exercise is associated with lower total WBC, neutrophil, and monocyte counts. However, no studies have evaluated the effect of the amount of aerobic exercise (dose on total WBC and WBC subfraction counts. PURPOSE: To examine the effects of 3 different doses of aerobic exercise on changes in total WBC and WBC subfraction counts and independent effects of changes in fitness, adiposity, markers of inflammation (IL-6, TNF-α, C-reactive protein, fasting glucose metabolism, and adiponectin. METHODS: Data from 390 sedentary, overweight/obese postmenopausal women from the DREW study were used in these analyses. Women were randomized to a non-exercise control group or one of 3 exercise groups: energy expenditure of 4, 8, or 12 kcal kg(-1⋅week(-1 (KKW for 6 months at an intensity of 50% VO2peak. RESULTS: A dose-dependent decrease in total WBC counts (trend P = 0.002 was observed with a significant decrease in the 12KKW group (-163.1±140.0 cells/µL; mean±95%CI compared with the control (138.6±144.7 cells/µL. A similar response was seen in the neutrophil subfraction (trend P = 0.001 with a significant decrease in the 12KKW group (-152.6±115.1 cells/µL compared with both the control and 4KKW groups (96.4±119.0 and 21.9±95.3 cells/µL, respectively and in the 8KKW group (-102.4±125.0 cells/µL compared with the control. When divided into high/low baseline WBC categories (median split, a dose-dependent decrease in both total WBCs (P = 0.003 and neutrophils (P<0.001 was observed in women with high baseline WBC counts. The effects of exercise dose on total WBC and neutrophil counts persisted after accounting for significant independent effects of change in waist circumference and IL-6. CONCLUSION: Aerobic exercise training reduces total WBC and neutrophil counts, in a dose-dependent manner, in

‘We the Avant-Garde’. A History from Below of Dutch Heroin Use in the 1970s

Directory of Open Access Journals (Sweden)

Gemma Blok

2017-03-01

Full Text Available In the 1970s the Netherlands (like many other western countries was shocked by a sudden wave of heroin use. The heroin ‘epidemic’ is  currently framed as a public health problem that has been solved in a commendably humane fashion. In the mean time heroin users have gained a ‘loser image’. Using memoirs written by and interviews with former heroin users, this article argues that heroin use was initially linked to cultural rebellion, self-development and social criticism. We need to take this forgotten aspect of the history of the Dutch heroin ‘epidemic’ into account when we try to explain this historical phenomenon. ‘Wij de avant-garde’. Een history from below van heroïnegebruik in Nederland in de jaren zeventigIn de jaren zeventig van de vorige eeuw werd Nederland (net als veel andere westerse landen opgeschrikt door een plotselinge golf van heroïnegebruik. Deze ‘heroïne-epidemie’ wordt momenteel beschouwd als volksgezondheidsprobleem dat succesvol is bedwongen, op een bewonderenswaardig humane wijze. Ondertussen hebben heroïnegebruikers een ‘loser’ imago gekregen. Op basis van memoires geschreven door en interviews met voormalige heroïnegebruikers, betoogt dit artikel dat het gebruik van heroïne oorspronkelijk verbonden was met culturele rebellie, zelfontplooiing en cultuurkritiek. Dit vergeten aspect van de ‘epidemie’ is onderdeel van de verklaring voor de populariteit van opiaten destijds.

El problema del héroe cómico en Avispas

Directory of Open Access Journals (Sweden)

María Jimena Schere

2014-09-01

Full Text Available In spite of the fact that the critics has argued that Philocleon is the comic hero of Wasps, in this work we propose to demonstrate that this function is exercised by his son Bdelicleon. Bdelicleon have several features in common with other heroes of the early comedy: its role as a spokesperson of the positive discourse endorsed in the play, its moral and intellectual superiority, its beneficial action for the city, its successive victories in the agônes, among other reasons. The hypothesis that Bdelycleon is in fact the comic hero permit recognize a common model in the early comedy and argue that the hero has an argumentative function in the play. Its features of superiority make it a legitimized spokesman of the ideology support in the play and favor the persuasive effects of the comedy

CONTRIBUTIONS FROM POSITIVE ORGANIZATIONAL PSYCHOLOGY TO DEVELOP HEALTHY AND RESILIENT ORGANIZATIONS

Directory of Open Access Journals (Sweden)

Marisa Salanova

2016-09-01

Full Text Available The aim of the current paper is to show the main results obtained by the WANT Research team on the HERO Model (HEalthy & Resilient Organizations to conceptualize, evaluate and intervene in the development of healthy and positive people, groups and organizations. First, we present the theoretical model, methodology and tools to evaluate HEROs. These tools are collectively administered and applied to different stakeholders in the organization: interviews with CEOs, and questionnaires aimed at employees distributed in natural groups, supervisors and clients. Secondly, we present the main results obtained from the application of the HERO methodology in different socio-economic contexts. The last part of the paper is dedicated to highlighting the different options of positive interventions, as well as recent experiences in the HERO intervention carried out by WANT based on Positive Organizational Psychology.

Combined ice core and climate-model evidence for the collapse of the West Antarctic Ice Sheet during Marine Isotope Stage 5e.

Science.gov (United States)

Steig, Eric J.; Huybers, Kathleen; Singh, Hansi A.; Steiger, Nathan J.; Frierson, Dargan M. W.; Popp, Trevor; White, James W. C.

2015-04-01

It has been speculated that collapse of the West Antarctic Ice Sheet explains the very high eustatic sea level rise during the last interglacial period, marine isotope stage (MIS) 5e, but the evidence remains equivocal. Changes in atmospheric circulation resulting from a collapse of the West Antarctic Ice Sheet (WAIS) would have significant regional impacts that should be detectable in ice core records. We conducted simulations using general circulation models (GCMs) at varying levels of complexity: a gray-radiation aquaplanet moist GCM (GRaM), the slab ocean version of GFDL-AM2 (also as an aquaplanet), and the fully-coupled version of NCAR's CESM with realistic topography. In all the experiments, decreased elevation from the removal of the WAIS leads to greater cyclonic circulation over the West Antarctic region. This creates increased advection of relatively warm marine air from the Amundsen-Bellingshausen Seas towards the South Pole, and increased cold-air advection from the East Antarctic plateau towards the Ross Sea and coastal Marie Byrd Land. The result is anomalous warming in some areas of the East Antarctic interior, and significant cooling in Marie Byrd Land. Comparison of ice core records shows good agreement with the model predictions. In particular, isotope-paleotemperature records from ice cores in East Antarctica warmed more between the previous glacial period (MIS 6) and MIS 5e than coastal Marie Byrd Land. These results add substantial support to other evidence for WAIS collapse during the last interglacial period.

Entre héroes y traidores: Sentidos militares y militantes acerca del rol de los conscriptos en los años 70 Entre heróis e traidores: Sentidos militares e militantes sobre o papel dos recrutas nos anos 70 Between heroes and traitors: Military and militant meanings regarding conscripts' role in the 70s

Directory of Open Access Journals (Sweden)

Santiago Garaño

2011-07-01

Full Text Available En este trabajo analizaremos cómo las autoridades militares argentinas concibieron el rol que los conscriptos debían jugar en la autodenominada "lucha contra la subversión", en el contexto de violencia política previo al golpe de estado del 24 de marzo de 1976. En primer lugar, mostraremos que los soldados que cumplían el servicio militar obligatorio fueron interpelados no sólo por el Ejército sino también por el PRT-ERP, apelando en ambos casos a los valores morales del 'heroísmo' y del 'sacrificio' de la propia vida. En segundo lugar, argumentaremos que el personal militar fundó una lógica binaria "héroe"-"traidor" como parámetro para juzgar moralmente las conductas de los conscriptos. Por último, postularemos que se apuntaló ese código moral utilizando ideas de pureza, contaminación y peligro.Neste trabalho analisaremos como, nos anos setenta, as autoridades militares argentinas conceberam o papel que os soldados deviam desempenhar na autodenominada "luta contra a subversão", no contexto da violência política prévio ao golpe de estado acontecido no dia 24 de março de 1976. Em primeiro lugar, mostraremos que os recrutas foram interpelados não só por parte do exército, mas também pelo PRT-ERP, apelando em ambos os casos ao valor moral do 'heroísmo' e do 'sacrifício' da própria vida. Em segundo lugar, argumentaremos que os militares se apoiaram em uma lógica binária de "herói" - "traidor" como parâmetro para julgar moralmente as condutas dos recrutas, e afirmaremos que esse código moral foi sustentado através de ideias de pureza, contaminação e perigo.In this article we analyze the different ways in which, during the 70s, the Argentinean military authorities conceived the role that soldiers should play in the "struggle against subversion" in a context of political violence before the military coup on March 24 th 1976. To begin with, we expose that the conscripts serving the Compulsory Military Service were

Feasibility Study of Utilization of Action Camera, GoPro Hero 4, Google Glass, and Panasonic HX-A100 in Spine Surgery.

Science.gov (United States)

Lee, Chang Kyu; Kim, Youngjun; Lee, Nam; Kim, Byeongwoo; Kim, Doyoung; Yi, Seong

2017-02-15

Study for feasibility of commercially available action cameras in recording video of spine. Recent innovation of the wearable action camera with high-definition video recording enables surgeons to use camera in the operation at ease without high costs. The purpose of this study is to compare the feasibility, safety, and efficacy of commercially available action cameras in recording video of spine surgery. There are early reports of medical professionals using Google Glass throughout the hospital, Panasonic HX-A100 action camera, and GoPro. This study is the first report for spine surgery. Three commercially available cameras were tested: GoPro Hero 4 Silver, Google Glass, and Panasonic HX-A100 action camera. Typical spine surgery was selected for video recording; posterior lumbar laminectomy and fusion. Three cameras were used by one surgeon and video was recorded throughout the operation. The comparison was made on the perspective of human factor, specification, and video quality. The most convenient and lightweight device for wearing and holding throughout the long operation time was Google Glass. The image quality; all devices except Google Glass supported HD format and GoPro has unique 2.7K or 4K resolution. Quality of video resolution was best in GoPro. Field of view, GoPro can adjust point of interest, field of view according to the surgery. Narrow FOV option was the best for recording in GoPro to share the video clip. Google Glass has potentials by using application programs. Connectivity such as Wi-Fi and Bluetooth enables video streaming for audience, but only Google Glass has two-way communication feature in device. Action cameras have the potential to improve patient safety, operator comfort, and procedure efficiency in the field of spinal surgery and broadcasting a surgery with development of the device and applied program in the future. N/A.

76 FR 54196 - Membership of the Departmental Performance Review Board

Science.gov (United States)

2011-08-31

.... Chief Financial Officer and Assistant Secretary for Administration, William J. Fleming, Director for... Assistant Secretary for Regional Affairs, Sandra Walters, Chief Financial Officer and Director of..., Robert J. Byrd, Chief Financial Officer/Chief Administrative Officer, NWS, Joseph, F. Klimavicz, Chief...

Kant’s Doctrine of Right. A Commentary

Directory of Open Access Journals (Sweden)

Thomas Mertens

2013-12-01

Full Text Available http://dx.doi.org/10.5007/1677-2954.2013v12n2p355 Review of: B. Sharon Byrd and Joachim Hruschka, Kant’s Doctrine of Right. A Commentary (Cambridge University Press, Cambridge 2010 336 p.

Everyday Heroes.

Science.gov (United States)

Johnson, Beth

Designed for low-level adult learners, this book contains true stories of 20 men and women who have faced and overcome serious challenges in their lives. The book is intended to inspire and motivate developmental students in basic reading and writing classes. The book can be adapted to different instructional approaches--some teachers may wish to…

Acerca del rol de Pedro Bermúdez en el Cantar de Mio Cid: Un acercamiento a su figura épica

Directory of Open Access Journals (Sweden)

Érica Janín

2007-11-01

Full Text Available This work makes an attempt on getting close to the literary figure of Pedro Bermúdez in the Cantar de Mio Cid that allows it to characterize him as a peculiar hero; and proposes that Pedro represents a type of hero which is different to the model the Cantar means to coin, perhaps more primitive and alternative to the cidian paradigm, thus the virtues and values of the tradition of the most arcaic epic songs are not eliminated but displaced to a hero that seconds the protagonist, complementing him at the same time.

Introduction - The impacts of the 2008 eruption of Kasatochi Volcano on terrestrial and marine ecosystems in the Aleutian Islands, Alaska

Science.gov (United States)

DeGange, Anthony R.; Byrd, G. Vernon; Walker, Lawrence R.; Waythomas, C.F.

2010-01-01

The Aleutian Islands are situated on the northern edge of the so-called “Pacific Ring of Fire,” a 40,000-km-long horseshoe-shaped assemblage of continental landmasses and islands bordering the Pacific Ocean basin that contains many of the world's active and dormant volcanoes. Schaefer et al. (2009) listed 27 historically active volcanoes in the Aleutian Islands, of which nine have had at least one major eruptive event since 1990. Volcanic eruptions are often significant natural disturbances, and ecosystem responses to volcanic eruptions may vary markedly with eruption style (effusive versus explosive), frequency, and magnitude of the eruption as well as isolation of the disturbed sites from potential colonizing organisms (del Moral and Grishin, 1999). Despite the relatively high frequency of volcanic activity in the Aleutians, the response of island ecosystems to volcanic disturbances is largely unstudied because of the region's isolation. The only ecological studies in the region that address the effects of volcanic activity were done on Bogoslof Island, a remote, highly active volcanic island in the eastern Aleutians, which grew from a submarine eruption in 1796 (Merriam, 1910; Byrd et al., 1980; Byrd and Williams, 1994). Nevertheless, in the 214 years of Bogoslof's existence, the island has been visited only intermittently.Kasatochi Island is a small (2.9 km by 2.6 km, 314 m high) volcano in the central Aleutian Islands of Alaska (52.17°N latitude, 175.51°W longitude; Fig. 1) that erupted violently on 7-8 August 2008 after a brief, but intense period of precursory seismic activity (Scott et al., 2010 [this issue]; Waythomas et al., in review). The island is part of the Aleutian arc volcanic front, and is an isolated singular island. Although the immediate offshore areas are relatively shallow (20–50 m water depth), the island is about 10 km south of the 2000 m isobath, north of which, ocean depths increase markedly. Kasatochi is located between the

Anticipatory conditioned responses to subjective and physiological effects of heroin in addicted persons

Directory of Open Access Journals (Sweden)

Humberto M. Trujillo

2005-01-01

Full Text Available Estudio 1: El objetivo de este experimento fue analizar en personas desintoxicadas a la heroína respuestas condicionadas (RCs opuestas a ciertos efectos fisiológicos y subjetivos de esta droga. El procedimiento consistió en presentar diapositivas con imágenes de estímulos neutros (ENs y estímulos condicionados (ECs de la heroína a personas no adictas y a personas adictas desintoxicadas. Las respuestas evaluadas fueron conductancia (C y autopercepción de síntomas de abstinencia (ASA. Los resultados se consideraron como indicadores de respuestas condicionadas compensatorias de los efectos de la heroína (abstinencia condicionada. Estudio 2: El objetivo de este experimento fue facilitar en personas adictas desintoxicadas a la heroína la emisión de respuestas condicionadas miméticas (RCMs de los efectos subjetivos incondicionados de la heroína. Para ello se utilizaron tres series estimulares: SA, serie control; SB, el investigador administra un leve pinchazo; SC, el participante realiza el ritual de “bombeo” sin droga. La respuesta medida fue ASA. Los datos obtenidos se consideraron como indicadores de RCMs. Los resultados de ambos estudios se discutieron desde el modelo de la especificidad ambiental de las respuestas anticipatorias de los efectos de las drogas.

Innovation Engine for Blog Spaces

Science.gov (United States)

2011-09-01

Humanoid robots ( Cyborg ) that can change into vehicles (Tram), and they are also Heroes that appear in comic books (Flash (comics)) and animated series...comics) Count Mushroom Cyborg Farm Hero Table 2.2: Some good interpretation vectors of novel words. Each column in the table contains an

Pengembangan Permainan Edukatif Pahlawan Nasional Berbasis Android

Directory of Open Access Journals (Sweden)

Andhi Setiawan

2015-08-01

Full Text Available With over time the smartphone is increasingly recognized by the public, it is contrary to the interest in learning about the history of Indonesia, especially the National Hero. Because of it, the idea to combine these two, which combines the sophistication of a smartphone with a history of national hero. Lack of instructional media on a national hero also be one of the factors that led to the creation of this application, not only can be an alternative medium of learning from the lessons of history, this application can also be one of the games that can entertain users. This application intended to provide additional knowledge about the national hero aside from the lessons taught in schools or other educational institutions, the media smartphone is well known by the public is expected that these applications can easily be accepted and may be useful for users who play this application.

75 FR 19183 - National Former Prisoner of War Recognition Day, 2010

Science.gov (United States)

2010-04-14

... heroes. Through multiple wars, thousands of American service members have faced unimaginable cruelty and... history books. Yet, their stories are etched in our national conscience, and their courage is enshrined in... received nor burdens borne by these heroes and their families, but neither shall we forget their selfless...

High Energy Replicated Optics to Explore the Sun: Hard X-ray balloon-borne telescope

Science.gov (United States)

Gaskin, J.; Apple, J.; Chavis, K. S.; Dietz, K.; Holt, M.; Koehler, H.; Lis, T.; O'Connor, B.; Otero, M. R.; Pryor, J.; Ramsey, B.; Rinehart-Dawson, M.; Smith, L.; Sobey, A.; Wilson-Hodge, C.; Christe, S.; Cramer, A.; Edgerton, M.; Rodriguez, M.; Shih, A.; Gregory, D.; Jasper, J.; Bohon, S.

Set to fly in the Fall of 2013 from Ft. Sumner, NM, the High Energy Replicated Optics to Explore the Sun (HEROES) mission is a collaborative effort between the NASA Marshall Space Flight Center and the Goddard Space Flight Center to upgrade an existing payload, the High Energy Replicated Optics (HERO) balloon-borne telescope, to make unique scientific measurements of the Sun and astrophysical targets during the same flight. The HEROES science payload consists of 8 mirror modules, housing a total of 109 grazing-incidence optics. These modules are mounted on a carbon-fiber - and Aluminum optical bench 6 m from a matching array of high pressure xenon gas scintillation proportional counters, which serve as the focal-plane detectors. The HERO gondola utilizes a differential GPS system (backed by a magnetometer) for coarse pointing in the azimuth and a shaft angle encoder plus inclinometer provides the coarse elevation. The HEROES payload will incorporate a new solar aspect system to supplement the existing star camera, for fine pointing during both the day and night. A mechanical shutter will be added to the star camera to protect it during solar observations. HEROES will also implement two novel alignment monitoring system that will measure the alignment between the optical bench and the star camera and between the optics and detectors for improved pointing and post-flight data reconstruction. The overall payload will also be discussed. This mission is funded by the NASA HOPE (Hands On Project Experience) Training Opportunity awarded by the NASA Academy of Program/Project and Engineering Leadership, in partnership with NASA's Science Mission Directorate, Office of the Chief Engineer and Office of the Chief Technologist.

78 FR 19267 - Change in Bank Control Notices; Acquisitions of Shares of a Bank or Bank Holding Company

Science.gov (United States)

2013-03-29

... indirectly retain voting shares of First-Citizens Bank & Trust Company, both in Raleigh, North Carolina. B... Byrd Street, Richmond, Virginia 23261-4528: 1. Olivia Britton Holding, Raleigh, North Carolina; to... First-Citizens Bank & Trust Company, both in Raleigh, North Carolina. 2. Frank Brown Holding, Jr...

Sedução, rivalidade e danação em noite na taverna

Directory of Open Access Journals (Sweden)

Alessandra Accorsi Trindade

2012-10-01

Full Text Available The text is an analysis of the novel Night in the Tavern by Álvares de Azevedo, approaching the characters´ torn experiences, which are the same lived by the hero Don Juan in El Burlador de Sevilla by Tirso de Molina. Beginning with the issue of the duplicity in the romanticism, we find in Tirso de Molina and Álvares de Azevedo the representation of rivalry present in the donjuanesque theme, the search for the hero identity with the rival and the seduction of the wife of the rival as something valuable. However, the damnation traces the destiny of the romantic hero.

Charting Relationships in American Popular Film. Part I.

Science.gov (United States)

Burke, Ken

1997-01-01

Explains several diagrams showing the evolution of significant film genres in context of each other and relevant historical trends. Figures present: (1) relationships of decades of U.S. history to popular film genres; (2) hero types by genre and decade; and (3) hero types as exemplified by various genres. (AEF)

Gauvain Soleil Noyé

Directory of Open Access Journals (Sweden)

Jacques K. Noble-Kooijman

2017-11-01

Full Text Available The stature of the character of Gauvain in the novels of Chrétien de Troyes aroused number of studies which conclude in a degradation of the image of the hero the status of which seemed inviolable. It is not that with the Cart that a collection parallel to that of Lancelot, hero of the novel, is committed by Gauvain who fails straightaway in the Bridge under the water where he is close to the drowning and makes sorry figure. The appeal to a functional analysis of the structure of the novel leads to identify Gauvain as the false hero of the wonderful tales which had analyzed Propp. This analysis heuristics clarifies the intuitions of the previous critics which saw in Gauvain an anti-hero. The "sun of the chivalry" flooded in the water of the Bridge "Évage" made so by the tale of the Cart the origin wanted by Christian of this Gauvain's downgrading among the heroes as he makes act. The Cart is the novel-key of the evolution of the sense to be given to the chivalrous exploit as well as to worldly courtesy in the continuity of the work of the novelist champenois. Sense of Lancelot's adventures in the Cart is the proDrôme of the spiritual orientations of Perceval which relegate in the background the "ground" chivalries which illustrated Gauvain.

Long-timescale dynamics of the Drew-Dickerson dodecamer

Czech Academy of Sciences Publication Activity Database

Dans, P. D.; Danilane, L.; Ivani, I.; Dršata, Tomáš; Lankaš, Filip; Hospital, A.; Walther, J.; Pujagut, R. I.; Battistini, F.; Gelpí, J. L.; Lavery, R.; Orozco, M.

2016-01-01

Roč. 44, č. 9 (2016), s. 4052-4066 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GA14-21893S Institutional support: RVO:61388963 Keywords : microsecond molecular dynamics * B-DNA dodecamer * analyzing ion distributions Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016 http://nar.oxfordjournals.org/content/44/9/4052.full

Cyclopia: from Greek antiquity to medical genetics.

Science.gov (United States)

Kalantzis, George C; Tsiamis, Costas B; Poulakou-Rebelakou, Effie L

2013-01-01

Cyclops are among the best-known monsters of Greek mythology, also mentioned in art and literature. According to the most recent scientific knowledge, the malformations caused by defective development of the anterior brain and midline mesodermal structures include cyclopia (synophthalmos), ethmocephaly, cebocephaly and arrhinencephaly. These severe forebrain lesions often are accompanied by severe systemic malformations, and affected infants rarely survive. Neither true cyclopia nor synophthalmos are compatible with life because an anomalous development of the brain is involved. Thus, it is difficult to assume that ancient Greeks drew their inspiration from an adult patient suffering from cyclopia. Cyclops appear for the first time in literature in Homer's Odyssey (8th-7th century BC) and one of them, Polyphemus, is blinded by the hero of the epic poem. The description of the creature is identical with patients suffering from cyclopia; eyes are fused and above the median eye there is a proboscis, which is the result of an abnormal development of the surface ectodermal structures covering the brain. The next literature appearance of Cyclops is at the end of 7th century BC in "Theogonia", written by Hesiodus. Another interesting description is made by Euripides in his satyr play entitled 'Cyclops' (5th century BC). In conclusion, though it is not certain whether Homer's description of Cyclops was based on his personal experience or the narration of his ancestors, there is no doubt that the ophthalmological disease, cyclopia, was named after this mythical creature.

Phylogeny and biogeography of 91 species of heroine cichlids (Teleostei: Cichlidae) based on sequences of the cytochrome b gene.

Science.gov (United States)

Pérez, Gustavo A Concheiro; Rícan, Oldrich; Ortí, Guillermo; Bermingham, Eldredge; Doadrio, Ignacio; Zardoya, Rafael

2007-04-01

Heroini constitute the second largest tribe of Neotropical cichlids and show their greatest diversity in Mesoamerica. Although heroine species are morphologically and ecologically very diverse, they were all historically assigned to one single genus, Cichlasoma that was never formally revised from a phylogenetic point of view. Here, we present the most comprehensive molecular phylogeny of the tribe Heroini to date, based on the complete DNA sequence of the mitochondrial gene cytochrome b, and the analysis of 204 individuals representing 91 species. Phylogenetic analyses did not support the monophyly of heroines because the genus Pterophyllum was placed as the sister group of all remaining heroines plus cichlasomatines. However, the recovered relative position of Pterophyllum was without strong statistical support. Within the remaining heroines, Hyspelecara and Hoplarchus are recovered with low support in a basal position with respect to a clade that includes Heros, Uaru, Mesonauta, and Symphysodon, and the circumamazonian (CAM) heroines. The first clade is restricted to South America. The largest clade of heroines, the CAM heroines, include more than 85% of the species within the tribe. This clade is mostly Mesoamerican, but also contains four species found in the Greater Antilles (Nandopsis), and three genera found in South America (the 'Heros' festae group, Australoheros, and Caquetaia). Up to eight major lineages can be recovered within the CAM heroines, but the phylogenetic relationships among them remain unresolved. Two large suprageneric groups can be distinguished, the amphilophines and the herichthyines. The amphilophines include Amphilophus, Archocentrus, Hypsophrys, Neetroplus, Parachromis, Petenia, and five additional unnamed genera (the 'Heros' istlanus group, the 'Amphilophus' calobrensis group, the 'Heros' urophthalmus group, the 'Heros' wesseli group, and the 'Heros' sieboldii group). The herichthyines include the crown-group herichthyines

High energy resolution off-resonant X-ray spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Wojciech, Blachucki [Univ. of Fribourg (Switzerland). Dept. of Physics

2015-10-16

This work treats of the high energy resolution off-resonant X-ray spectroscopy (HEROS) method of determining the density of unoccupied electronic states in the vicinity of the absorption edge. HEROS is an alternative to the existing X-ray absorption spectroscopy (XAS) methods and opens the way for new studies not achievable before.

Lone Wolf or Leader of the Pack?: Rethinking the Grand Narrative of Fred Newton Scott

Science.gov (United States)

Mastrangelo, Lisa

2010-01-01

Americans are obsessed with heroes, and they seemingly create them from anyone and everyone, anywhere and everywhere. This predilection is also clear in American histories. Their belief in heroes shows their connection to their society and culture, their willingness to follow someone in their social settings, and their belief that good people who…

Tall Tales of North America.

Science.gov (United States)

Fresno City Unified School District, CA.

Designed for use in junior high school language arts classes, this learning activity packet introduces students to North American folklore. Selected readings cover Indian tales, real folk heroes (Davy Crockett and John Henry), imaginary folk heroes (Paul Bunyan and Pecos Bill), Black folk stories (Brer Rabbit), and tales of Washington Irving. Each…

77 FR 26759 - Change in Bank Control Notices; Acquisitions of Shares of a Bank or Bank Holding Company

Science.gov (United States)

2012-05-07

... May 29, 2012. A. Federal Reserve Bank of Richmond (Adam M. Drimer, Assistant Vice President) 701 East Byrd Street, Richmond, Virginia 23261-4528: 1. Gerald F. Smith, Jr. Revocable Trust, (trustee, Gerald F. Smith, Jr.) Winchester, Virginia, to individually acquire voting shares of First National Corporation...

Working against the Grain: White Privilege in Human Resource Development

Science.gov (United States)

Monaghan, Catherine H.

2010-01-01

Research demonstrates that white privilege and racism have a direct impact on the success of businesses and the economy (Updegrave, Byrd, and Leuchter, 1989). Furthermore, organizations that are effective in integrating diversity experience increased organizational viability and profitability. Employees' intentions and actions of engaging in the…

My IGY in Antarctica

Science.gov (United States)

Bentley, Charles

2012-01-01

Dr Charles Bentley is the A.P. Crary Professor Emeritus of Geophysics, Department of Geology and Geophysics, University of Wisconsin-Madison. Dr. Bentley joined the Arctic Institute of North America in 1956 to participate in International Geophysical Year (IGY)-related activities in the Antarctic. He wintered over consecutively in 1957 and 1958 at Byrd Station, a station in the interior of West Antarctica that housed 24 men each winter - 12 Navy support people and 12 civilian scientists/technicians. During the austral summers, he also participated in over-snow traverses, first as co-leader, then leader (the other coleader went home after the first year). These traverses consisted of six men and three vehicles, and lasted several months. These traverses covered more than 1609 kilometers (1000 miles) of largely unmapped and unphotographed terrain. During these traverses, connections to Byrd Station were by radio (daily, when the transmission conditions were good enough) and roughly every 2 weeks by resupply flight.

From repression to Displacement: A Psychoanalytic Reexamination ...

African Journals Online (AJOL)

The protagonist of Chinua Achebe's Things Fall Apart has been variously described by critics as a hero or an anti-hero owing to his conformity or otherwise to the concept of heroism depending on the perspective from which each critic appraises his actions and behavioural traits. From the classical to the modern, there have ...

Book review - Borderline justice: the fight for refugee and migrant rights by Frances Webber, London, Pluto Press, 2012

NARCIS (Netherlands)

Liempt, I.C. van

2013-01-01

Our leaders encourage and treat as heroes those people who are fighting for democracy and human rights, in Burma, in Libya, in Egypt and Syria…But as soon as these heroes seek sanctuary here in the ‘free world’, they are transformed into a hostile alien threat to our culture and our values, to be

The Tragedy in the Story of Rostam and Sohrab in Ferdowsi’s Shahnameh

Directory of Open Access Journals (Sweden)

Mokhtar Ebrahimi

2017-02-01

Full Text Available Tragedy is a stunning example of confrontation between man and nature along with sadness and consequently fate and life. In tragedy, usually one person (hero is in the center of the story and all of the stories come together to make the inevitable fate happen for that hero. This inevitable fate is usually along with death or a tragic end which occurs for the hero. The purpose of poet in tragedy is illustration of an advice for readers after death of the hero. In this article, we have tried to review various aspects of tragic story of Rostam and Sohrab and the way the Master of Tous makes his audience and fans aware of passage of time and the eternal destiny using analytical descriptive method. Undoubtedly, what the ancient Greeks, especially Aristotle have proposed as a definition for tragedy as, is in some cases different from Ferdowsi's view but there is a close consistency between the nature of tragedy and the base of tragedy of Rostam and Sohrab and definition of tragedy.

Lakon Baratayuda Versi Klaten: Kajian Struktur Naratif

Directory of Open Access Journals (Sweden)

Endah Budiarti

2013-11-01

Lakon Baratayuda versi Klaten: Study of Narative Structure. This paper is intended to find the flow of the action hero in the Lakon Baratayuda Klaten version. The theory of the structure of folk tales Vladimir Propp adapted and modified in this paper. Propp’s theory says that a folk tale has a structure formed of functions that move sequentially. With regard to the theory, the method of analysis used is the method of Propp’s structural models. To be able to find the flow of the  action hero first revealed what functions (action dramatic personae are present, then determine the sequence of functions (action dramatic personae, and further reveals the narrative structure of the Lakon Baratayuda Klaten version. There are several things that can be raised from the analysis of Lakon Baratayuda Klaten version. The first, discovered fourteen function (action hero is tracked from the stream acts as a hero in the Lakon Baratayuda Klaten version. Second, the Lakon Baratayuda Klaten version contains more than one main story movement. Keywords: Baratayuda, structural, Propp

Pengaruh Iklan dan Kualitas Pelayanan terhadap Kepuasan Pelanggan di Giant Cabang Kalibata

Directory of Open Access Journals (Sweden)

Hadita Hadita

2017-01-01

Full Text Available Tujuan dari penelitian ini adalah untuk mengetahui pengaruh iklan dan kualitas layanan pada kepuasan pelanggan di Giant PT. Hero Supermarket, Tbk cabang Kalibata. Penelitian dilakukan dengan metode survei dengan mencari korelasi antara variabel independen dan variabel dependen, koefisien determinasi berganda dan analisis beberapa persamaan regresi. Hasil penelitian menunjukkan bahwa ada pengaruh iklan yang signifikan dan kualitas layanan yang signifikan terhadap kepuasan pelanggan di Giant PT. Hero Supermarket, Tbk cabang Kalibata. Analisis regresi linier berganda ditemukan bahwa variabel iklan dan layanan berkualitas memiliki dampak yang signifikan terhadap kepuasan pelanggan di Giant PT. Hero Supermarket, Tbk cabang Kalibata. Dengan menggunakan tingkat kepercayaan (confidence level dari 95% (α = 0,05, menunjukkan bahwa variabel iklan dan variabel kualitas layanan yang sama-sama mempengaruhi peningkatan kepuasan pelanggan. Koefisien regresi menunjukkan bahwa b2 memiliki nilai lebih besar dari b1 sehingga kedua variabel memiliki pengaruh yang sama. Dengan demikian dapat diketahui bahwa variabel iklan dan layanan berkualitas memiliki pengaruh yang signifikan terhadap kepuasan pelanggan di Giant PT. Hero Supermarket, Tbk cabang Kalibata.

[Torque resistance of three different types of nickel-titanium rotary instruments].

Science.gov (United States)

Sun, Wei; Hou, Ben-xiang

2010-10-01

To compare torsional fracture of three different types of nickel-titanium rotary instruments ProTaper, Hero642 and Mtwo by making a stimulate models in vitro. Through the establishment of model in vitro, compared the different time with 3 kinds of nickel titanium file in cutting-edge bound occurs, and to observe the section of fractured instruments by scanning electron microscope. The resistence to torque was different from three types of nickel titanium instruments. The time to fracture of Mtwo was significantly longer than ProTaper's and Hero642's, but ProTaper's and Hero642's had no significant difference. Three kinds cross-sectional design were different, a lot of toughness nests were seen in broken surface. Most of them were ductile fracture. Time to fracture was influenced by the quality disfigurement. The resistance to torque of Mtwo was better than ProTaper and Hero642. The lifespan was influenced by the design of cross-section. The quality disfigurement of the files reduced the resistance to flexual fatigue.

APORTACIONES DESDE LA PSICOLOGÍA ORGANIZACIONAL POSITIVA PARA DESARROLLAR ORGANIZACIONES SALUDABLES Y RESILIENTES

Directory of Open Access Journals (Sweden)

Marisa Salanova,

2016-09-01

Full Text Available El objetivo de este trabajo es presentar los principales resultados obtenidos por el equipo de investigación WANT Prevención Psicosocial y Organizaciones Saludables sobre el Modelo HERO (HEalthy & Resilient Organizations para conceptualizar, evaluar e intervenir en el desarrollo de personas, grupos y organizaciones positivas. En primer lugar, se presenta el modelo teórico, metodología y herramientas para la evaluación de HEROs. Estas herramientas se administran a nivel colectivo y se aplican a diferentes stakeholders o agentes clave en la organización: entrevistas a dirección, y cuestionarios dirigidos a empleados distribuidos en grupos naturales, supervisores, y clientes. En segundo lugar, se presentan los principales resultados obtenidos de la aplicación de la metodología HERO en diferentes contextos socioeconómicos. En la última parte del trabajo se muestran distintas opciones de intervenciones positivas, así como recientes experiencias de intervención HERO que se han llevado a cabo desde nuestro equipo bajo el paradigma de la Psicología Organizacional Positiva.

Thermal-Polarimetric and Visible Data Collection for Face Recognition

Science.gov (United States)

2016-09-01

matching a thermal face image with visible spectrum face images for interoperability with existing biometric face databases and watch lists. One of the...Byrd KA Preview of the newly acquired NVESD-ARL multimodal face database. Proc SPIE DSS. 2013;8734. 10. Yuffa AJ, Gurton KP, Videen G. Appl Optics

Sample-Starved Large Scale Network Analysis

Science.gov (United States)

2016-05-05

As reported in our journal publication (G. Marjanovic and A. O. Hero, ”l0 Sparse Inverse Covariance Estimation,” IEEE Trans on Signal Processing, vol... Marjanovic and A. O. Hero, ”l0 Sparse Inverse Covariance Estimation,” in IEEE Trans on Signal Processing, vol. 63, no. 12, pp. 3218-3231, May 2015. 6. G

Musik og film - på tværs

DEFF Research Database (Denmark)

Christensen, Erik; Fock, Eva

2011-01-01

An introduction to Chinese and Japanese Music and the Movies "Crouching Tiger, Hidden Dragon" and "Hero" (music by Tan Dun), "Ran" and "Rising Sun" (Music By Toru Takemitsu)......An introduction to Chinese and Japanese Music and the Movies "Crouching Tiger, Hidden Dragon" and "Hero" (music by Tan Dun), "Ran" and "Rising Sun" (Music By Toru Takemitsu)...

Art, Boys, and the Boy Scout Movement: Lord Baden-Powell

Science.gov (United States)

Chalmers, F. Graeme; Dancer, Andrea A.

2007-01-01

Robert Stephenson Smyth Baden-Powell (1857-1941), founder of the Boy Scout Movement in 1907, was a British military hero during the Boer War. Within an ethos and era of empire-building, athleticism, soldier-heroes and the pursuit of "manliness," Baden-Powell valued the arts and adapted his artistic skill to his wartime and Scouting activities. His…

Overcoming the Biological Trap: A Study of Ernest Hemingway's "A Farewell to Arms" and "The Old Man and the Sea"

Science.gov (United States)

Tsavmbu, Aondover Alexis; Amase, Emmanuel Lanior; Kaan, Aondover Theophilus

2014-01-01

Ernest Hemingway is one of the greatest writers that America has produced. His works have indeed, contributed immensely in shaping the literary path in his country. All his novels are tragedies and his heroes tragic heroes because he is always conscious of man's mortality. In this paper, we have undertaken a critical study of Hemingway's…

Putting the Teaching of American History and Civics Back in the Classroom. Hearing of the Committee on Health, Education, Labor, and Pensions, United States Senate. One Hundred Eighth Congress, First Session on Examining S. 504, To Establish Academies for Teachers and Students of American History and Civics and a National Alliance of Teachers of American History and Civics (April 10, 2003).

Science.gov (United States)

Congress of the U.S., Washington, DC. Senate Committee on Health, Education, Labor, and Pensions.

Statements by the following individuals were given at this hearing and are presented in this document: Hon. Lamar Alexander; David McCullough; Hon. Robert Byrd; Bruce Cole; Eugene W. Hickok; James H. Billington; Diane Ravitch; Hon. Christopher J. Dodd; and Russell Berg accompanied by Peter Sullivan and Blanche Deaderick. Additional material…

Pre- and Post-Processing Tools to Create and Characterize Particle-Based Composite Model Structures

Science.gov (United States)

2017-11-01

white. The domain boundaries for processor 0 are shown as black lines. Approved for public release; distribution is unlimited. 6 Fig. 1 (Left...WML N J TRIVEDI RDRL WML B D TAYLOR J P LARENTZOS J K BRENNAN B RICE E F C BYRD B BARNES N DANG J GOTTFRIED S

76 FR 47589 - Change in Bank Control Notices; Acquisitions of Shares of a Bank or Bank Holding Company

Science.gov (United States)

2011-08-05

... Byrd Street, Richmond, Virginia 23261-4528: 1. James S. MacLeod, Hilton Head Island, South Carolina; to acquire up to 31.36 percent of the voting shares of CoastalSouth Bancshares, Inc., Hilton Head Island, South Carolina, and thereby acquire shares of CoastalStates Bank, Hilton Head, South Carolina. Board of...

The Attitudes of Blacks Toward Stories in Selected Basal Readers Which Contain Negro Characters: Teaching Black Experience Through Literature.

Science.gov (United States)

Dantzler, Dolores J.

The purposes of the study were to determine the extent to which basal readers contain stories pertaining to blacks; to find out if the racial implications stated in basal texts are those that blacks want; to locate the black heroes in basal readers and evaluate whether or not these are the preferred heroes of the population of blacks sampled in…

Pederasty, heroism, and the family in classical Greece.

Science.gov (United States)

Ungaretti, J R

1978-01-01

Male homosexuality in Classical Greece found its expression in relationships that conformed to a pederastic model. This socially endorsed hierarchical relationship between older lover and younger beloved can be understood as an integral part of the culture by examining the concept of heroism and of the ideal warrior/hero presented in the poems of Homer and discussed in classical literature. Pederasty functioned to support the family and the continued primacy of masculine values and ethics. There is evidence that by the Classical period, traditional views, formed on the model of the warrior/hero, were undergoing a weakening and confusion. Social critics of the time rediculed these weaknesses and urged a return to values that stressed the dominance and strength of the hero.

Religious Ideology and Motivation of Action: A Study of Nature of Action in T. S. Eliot’s “Murder in the Cathedral”

Directory of Open Access Journals (Sweden)

Golbarg Khorsand

2014-01-01

Full Text Available The aim of the present study is to re-establish the status of Archbishop Becket as a standard tragic hero of a religious play written by T. S. Eliot. Various critics have denounced the characterization of Archbishop Becket as a proper tragic hero, claiming that the entire process of the plot is devoid of ‘dramatic action', which is considered the backbone of any drama. In this paper the author has tried to illuminate on a renewed definition of ‘dramatic action' and consequently prove that the performance and actions of Archbishop Becket are, in fact, a process of mental action which nevertheless arrive the character to the definitive destination of all other dramatic heroes, i.e. a tragic death.

Study of stability of the ceramic Ba{sub 2}NiWO{sub 6} in crude petroleum drew back from state - Brazil oil wells; Microestrutura e propriedades mecanicas da ceramica Ba{sub 2}NiWO{sub 6} apos imersao em petroleo cru retirado de pocos de prtroleo do estado de Sergipe - Brasil

Energy Technology Data Exchange (ETDEWEB)

Yadava, Y.P.; Bezerra, L.P.; Diniz, M.J.L.; Ferreira, R.A.S. [Universidade Federal de Pernambuco (DEM/UFPE), Recife, PE (Brazil). Dept. de Engenharia Mecanica], e-mail: yadava@ufpe.br

2008-07-01

The necessity of developing technologies which make practical the oil-well exploration is notorious. Knowing that those are hostile places is necessary to find materials which are capable to resist to the inclemency caused by those environments. Pondering that the ceramics show the required characteristics to this purpose the present assignment views the elaboration of complex perovskite ceramic Ba{sub 2}NiWO{sub 6} to produce ceramics components parts of temperature sensors to oil-well. To this purpose we studied the ceramic stability when they are vulnerable to the attack of the crude petroleum drew back from ocean and earth's oil-wells of Sergipe state-Brazil. The ceramics were submersed in the mentioned petroleum during thirty days and then they were analyzed by X-ray diffraction, optics microscopy and microhardness Vickers to verify if changes happened in the structure, microstructure and mechanics proprieties characteristics. These results are showed and discussed in this assignment. (author)

75 FR 12544 - Change in Bank Control Notices; Acquisition of Shares of Bank or Bank Holding Companies

Science.gov (United States)

2010-03-16

... East Byrd Street, Richmond, Virginia 23261-4528:> 1. Peden B. McLeod, Mary H. McLeod, John R. McLeod, all of Walterboro, South Carolina; Peden B. McLeod, Jr., Mt. Pleasant, South Carolina; Mary C. Benson... of Walterboro, South Carolina. B. Federal Reserve Bank of St. Louis (Glenda Wilson, Community Affairs...

Lakon Baratayuda Versi Klaten: Kajian Struktur Naratif

OpenAIRE

Endah Budiarti

2013-01-01

Tulisan ini dimaksudkan untuk menemukan aliran tindakan hero dalam Lakon Baratayuda versi Klaten. Teori struktur cerita rakyat Vladimir Propp diadaptasi dan dimodifikasi dalam tulisan ini. Teori Propp mengatakan bahwa sebuah cerita rakyat memiliki struktur yang dibentuk dari fungsi-fungsi yang bergerak berurutan. Berdasarkan teori tersebut, metode analisis yang digunakan dalam tulisan ini adalah metode struktural model Propp. Upaya untuk dapat menemukan aliran tindakan sang hero p...

Thailand's unsung heroes.

Science.gov (United States)

Treerutkuarkul, Apiradee

2008-01-01

The success of primary health care programmes in Thailand over the past three decades can be attributed not only to medical advances but to the role of community health volunteers. Buddhist monks and their temples have been strongly involved in health promotion and education, particularly in remote, rural communities.

Victims and Heroes

DEFF Research Database (Denmark)

Højbjerg, Christian K.

2010-01-01

Victimization, autochthony and citizenship, power and nation-building constitute recurrent, interrelated themes in post-war Manding historical memory in the border area between Liberia and Guinea. While the perceived history of the Manding diverges from academic, historical knowledge as well...

A Hero's Welcome.

Science.gov (United States)

Moores, Samantha

1999-01-01

Tony Hopson founded and directs Self Enhancement, Inc., a nonprofit program that helps inner-city youth in Portland (Oregon) improve academically and develop talents, skills, values, and attitudes needed to become positive, contributing members of society. The program's success is based on the relationship model, continuity of services,…

Local Heroes Live!

Science.gov (United States)

1999-09-01

Physics teacher Andrew Morrison from High Pavement College in Nottingham has recently been appointed as Schools' officer for particle physics by the Particle Physics and Astronomy Research Council, as part of the Council's Public Understanding of Science programme. As well as his role as an experienced physics teacher, Andrew has acted as marketing manager for his college and chair of the Nottinghamshire section of the Association for Science Education. He will now be working two days each week in his new role with PPARC, acting as a link between the science education and research communities, helping researchers develop ideas for promoting particle physics and leading some specific new projects for the production of schools materials. Andrew can be contacted at High Pavement Sixth Form College, Gainsford Crescent, Nottingham NG5 5HT (tel: 0115 916 6165 or e-mail: morrison@innotts.co.uk). On the other side of the Atlantic, an 18 year-old student at Atlee High School in Mechanicsville, Virginia, USA was the recipient of the `1999 Young Scientist of the Year' award. Jakob Harmon submitted a project on magnetic levitation (maglev) in this extracurricular competition organized by PhysLINK.com, a leading Internet authority on physics and engineering education. The prize was a summer placement at Virginia Polytechnic Institute, Blacksburg, where Jakob continued his education in one of the most active maglev research and development groups in the USA. He also received science books and software as part of the award. The PhysLINK.com award was established to recognize, encourage and foster talented high school students in physics and engineering, with the prize being designed to fit the specific needs and aspirations of each individual winner. Details of next year's competition, along with Jakob's project and more about magnetic levitation can be viewed at www.physlink.com or by contacting Anton Skorucak of PhysLINK.com at 11271 Ventura Blvd #299, Studio City, CA 91606, USA (fax: (1) 818 985 2466, e-mail: info@physlink.com).

Development of a procedure for qualitative and quantitative evaluation of human factors as a part of probabilistic safety assessments of nuclear power plants. Part A

International Nuclear Information System (INIS)

Richei, A.

1998-01-01

The objective of this project is the development of a procedure for the qualitative and quantitative evaluation of human factors in the probabilistic safety assessment for nuclear power plants. The Human Error Rate Assessment and Optimizing System (HEROS) is introduced. The evaluation of a task with HEROS is realized in the three evaluation levels, i.e. 'Management Structure', 'Working Environment' and 'Man-Machine-Interface'. The developed expert system uses the fuzzy set theory for an assessment. For the evaluation of cognitive tasks evaluation criteria are derived also. The validation of the procedure is based on three examples, reflecting the common practice of probabilistic safety assessments and including problems, which cannot, respectively - only insufficiently - be evaluated with the established human risk analysis procedures. HERO applications give plausible and comprehensible results. (orig.) [de

First a hero of science and now a martyr to science: the James Watson Affair - political correctness crushes free scientific communication.

Science.gov (United States)

Charlton, Bruce G

2008-01-01

James Watson will not just be exonerated but vindicated as an exemplar of the true morality of science: that scientific communication needs to be allowed to be clear, direct - even crass - in the pursuit of truth. James Watson has been a hero of science for the achievements of his career, and also a martyr for science at the end of his career.

“You may have heard of me”:an archetypal analysis of the protagonist of Patrick Rothfuss’ The Name of the Wind

OpenAIRE

Tikkanen, T. (Tapio)

2016-01-01

Abstract This research examines the protagonist of the fantasy novel The Name of the Wind written by Patrick Rothfuss. The goal is to establish that the given protagonist is not an archetypal hero or villain character, but rather he transcends the simplistic binary definitions of hero and villain by acting on humane drives and understandable reasons, both of which can contribute towards good or evil. The paper draws upon mu...

Structure, Stiffness and Substates of the Dickerson-Drew Dodecamer

Czech Academy of Sciences Publication Activity Database

Dršata, Tomáš; Pérez, A.; Orozco, M.; Morozov, A. V.; Šponer, Jiří; Lankaš, Filip

2013-01-01

Roč. 9, č. 1 (2013), s. 707-721 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822 Grant - others:CEITEC(XE) CZ.1.05/1.1.00/02.0068 Institutional support: RVO:61388963 ; RVO:68081707 Keywords : DNA * mechanical properties * molecular dynamics Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 5.310, year: 2013

Comparative analysis of torsional and bending behavior through finite-element models of 5 Ni-Ti endodontic instruments.

Science.gov (United States)

Arbab-Chirani, Reza; Chevalier, Valérie; Arbab-Chirani, Shabnam; Calloch, Sylvain

2011-01-01

The objectives of this study were to compare numerically the bending and torsional mechanical behavior of 5 endodontic rotary Ni-Ti instruments with equivalent size and various designs for tapers, pitch, and cutting blades.First, the geometries of Hero (20/0.06), HeroShaper (20/0.06), ProFile (20/0.06), Mtwo (20/0.06), and ProTaper F1 were generated by finite element code. Then, the 2 most representative clinical loadings, i.e., bending and torsion, were studied with an ad hoc model for the superelasticity of Ni-Ti. Bending was generated by tip deflection and torsion by a constant twist-angle of the tip. Mechanical behavior of these 5 endodontic rotary Ni-Ti instruments could be evaluated and compared. Protaper F1 presented the greatest level of bending stress and torque. Hero and HeroShaper were more rigid than ProFile and Mtwo. This numerical comparison evaluated the effects of the geometrical parameters on the instrumental mechanical behavior. The 5 endodontic instruments, investigated in the present study, do not have the same bending and torsional mechanical behavior. Each clinician must be aware of these behavior differences so as to use the adequate file according to the clinical situation and to the manufacturer's recommendations. Copyright © 2011 Mosby, Inc. All rights reserved.

La construcción de la imagen heroica a través del discurso periodístico. El caso de la activista peruana María Elena Moyano.

Directory of Open Access Journals (Sweden)

Gabriela McEvoy.

2008-01-01

Full Text Available This work tries to demonstrate that the social construction of the national hero/heroine as a symbol of courage and resistance generally arises within a period of social, political, and economic crisis. The national hero is a construction that is created in a moment characterized by the loss of public trust and the failure of government leaders to act. The creation of the heroic image functions as a sociopolitical tool. The article suggests that there is a close relationship between the history and the construction of heroic fgures. Using the death of Peruvian activist María Elena Moyano as a concrete example, it demonstrates that journalistic discourse has the ability to create an heroic image around a person who has been given the traditional role that the hero has played in society since Antiquity.

My Oar Keeps Breaking: How to Move Your Part of the Program Forward

Science.gov (United States)

2016-02-01

ship analogy. I had a whiteboard in my office. One day, I drew a large sailing ship with two masts and labeled the ship the S.S. Program. I drew...the journey over the edge. Finally, another drew a little boat popping up out of the water and labeled it the alternative to our program that the...that I needed to focus my energies on the part of the program I could control. 55 Defense AT&L: January–February 2016 moron! Of course you can’t

Super Bitches and Action Babes

DEFF Research Database (Denmark)

Schubart, Rikke

An analysis of the female hero in popular film genres such as actionfilms, war films, wip-films, rape-revenge dramas, science fiction from 1970-2006. Mostly American films but with chapters on Michelle Yeoh and Meiko Kaji.......An analysis of the female hero in popular film genres such as actionfilms, war films, wip-films, rape-revenge dramas, science fiction from 1970-2006. Mostly American films but with chapters on Michelle Yeoh and Meiko Kaji....

A Further Study of the“Code Hero”in Ernest Hemingway’s Works

Institute of Scientific and Technical Information of China (English)

万艳; 姜立

2014-01-01

Hemingway is one of the greatest writers in American literary history,has always been known as"code hero".For this reason,he is also defined as the spiritual leader of the United States of America.It is not an exaggeration to say,in fact,he does make a contribution to the history of American literature,and he deserves the recognition and praise.This article positively starts from the perspective of"code hero"image,and the spirit of his works.

Examining the Structure in Rostam’s Seven Trials: Analyzing the Archetype of the Hero’s Journey

OpenAIRE

محمود رضا قربان صباغ

2013-01-01

In 1949, Joseph Campbell (1904-1987), American mythologist, in his book entitled The Hero with a Thousand Faces discusses his view on "monomyth" in detail: the hero turns his back on the mundane daily life; accepts the perils of a harrowing and hazardous journey; grapples with evil and restraining forces; overcomes all impediments and, upon his return, generously offers his people the hard-earned boon and blessing: the "souvenirs" of his journey. Campbell, in his suggested model, presents a ...

Sparse Representation of Multimodality Sensing Databases for Data Mining and Retrieval

Science.gov (United States)

2015-04-09

Information ," IEEE Transactions on Multimedia, vol 14, no 1, pp. 3-16, Feb 2012. Preprint posted electronically on IEEE Xplore on Sept 5, 2011...08/30/2012 08/30/2012 Received Paper 6.00 7.00 8.00 K.-J. Hsiao, J. Kulezsa, A.O. Hero. Social Collaborative Retrieval, IEEE JOURNAL OF SELECTED...III. Ensemble estimators for multivariate entropy estimation, IEEE Trans on Information Theory, (07 2013): 4374. doi: A.O. Hero, K. Todros. On

ディケンズの『デイヴィッド・コパーフィールド』における時間

OpenAIRE

福島, 光義

1995-01-01

David Copperfield (1849-50) is an autobiographical novel which is narrated by the hero David Tune m this novel will be discussed in connection with Dickens' traumatic experiences, identity, writing, and memory. As the narrator says, "this narrative is my [his] written memory." David narrates his birth (by hearsay), child-hood, school days and matrimony, with his "good memory" and "close observation." The hero's feelings of love and hate, happiness and misery, pride and shame are frank-ly reco...

THE RING IN THE FOLK STORIES-HALK ANLATILARINDA YÜZÜK

Directory of Open Access Journals (Sweden)

Yaprak Pelin Uluışık

2017-04-01

Full Text Available A ring is not just a piece of jewelry that indicates commitment, endless unity and loyalty; it is a symbol that has a chain of common meanings intertwined with similar features in different geographies. It is seen that rings in myths, epics, legends, fairy tales and folk stories provide features such as power, control, wisdom, youth, earthly and spiritual prosperity, good fortune, invisibility, shape changing, talking with plants and animals. Heroes wearing these rings that protect the human soul from the evil will not suffer in any way. In the stories of the west, it is often mentioned about cursed rings that effects its owner in a bad manner and brings only bad luck. These rings, located in places that can be associated with the underground such as the ground, the hole, the cave and the water bed, are given to the heroes by supernatural beings or wise men. Supernatural beings, such as demons or giants, are trapped in these rings, many of which are magical, as slaves of the rings at an unknown time. When the hero rubs his ring, reverses it, puts it in his mouth; when he hits the ring or whistles to it, the slave of the ring comes out and asks the hero for his wish. This wish is carried out by the slave right after the hero tells the slave what he wishes. In this article, many examples from the Chinese myths to the Arabic tales, from the Babylonian Talmud to the descriptions of Scandinavian, Celtic, Welsh, French and Spanish culture have been examined in order to determine the characteristics of the rings mentioned in folkloric tales. In addition, many examples of Turkish folk literature from Dede Korkut to Anatolian tales were also discussed.

Frederick National Lab Encourages Healthy Living at the Annual In The Street Festival | Poster

Science.gov (United States)

While it was the pleasant weather, live music, and scores of vendors that drew thousands to Frederick’s 2017 In The Street festival, it was the eye-catching activities and prizes that drew attendees to the Frederick National Laboratory for Cancer Research tent.

Variations in the use of emergency PCI for the treatment of re-infarction following intravenous fibrinolytic therapy: impact on outcomes in HERO-2.

Science.gov (United States)

Edmond, J J; French, J K; Aylward, P E G; Wong, C K; Stewart, R A H; Williams, B F; De Pasquale, C G; O'connell, R L; Van den Berg, K; Van de Werf, F J; Simes, R J; White, H D

2007-06-01

Patients who suffer re-infarction during initial hospitalization for ST-elevation myocardial infarction (STEMI) have decreased survival compared to patients without re-infarction, so treatment of re-infarction may influence survival. To determine whether the utilization of reperfusion therapies varied within 12 h of re-infarction and was associated with 30-day mortality, we studied 552 patients with re-infarction of 17,073 patients with STEMI enrolled in HERO-2 in five regions (Russia, Eastern Europe, Western Countries, Asia, and Latin America). Patients presenting within 6 h of symptom-onset were randomized to receive either bivalirudin or unfractionated heparin intravenously just prior to streptokinase. Re-infarction occurred in 2.8 and 3.6% of bivalirudin and heparin treated patients, respectively (P = 0.004), but treatment assignment did not influence mortality after re-infarction. Patients with re-infarction had a higher 30-day mortality than those without re-infarction (24 vs. 10%; P model). Within 12 h of re-infarction, fibrinolytic therapy was administered to 12.0 and 8.2% underwent percutaneous coronary intervention (PCI); these two treatments were more frequently utilized in patients from Western countries (n = 112), compared to patients from other countries (n = 440) (34.8 and 16.1% compared to 6.1 and 6.1%, respectively, P < 0.001). Mortality was 15% in patients receiving reperfusion therapy for re-infarction and 27% for those with conservative management, hazard ratio (HR) 0.53 (95% CI 0.32-0.88), P = 0.01. In multiple Cox regression analysis which included adjustment for clinical variables and randomized treatment assignment, 30-day mortality after re-infarction varied by region (highest Latin America 29%, lowest Western countries 15%; P = 0.01). Other independent prognostic factors included age, time from randomization to re-infarction, and Killip class at randomization. The HR for PCI treatment of re-infarction was 0.18 [(95% CI 0.04-0.76), P = 0

A Case Study in Byzantine Dragon-Slaying: Digenes and the Serpent

Directory of Open Access Journals (Sweden)

Christopher Livanos

2011-03-01

Full Text Available The Byzantine epic Digenes Akrites has similarities with ancient and medieval Iranian traditions that, in consideration of the epic’s Eastern settings, suggest Iranian influences. Digenes resembles dragon-slaying heroes of other Indo-European traditions. He also resembles the Irish hero Cú Chulainn in that he is not psychologically fit to live in the midst of the community that depends on his protection. Freudian readings of Digenes’ encounters with the dragon and the Amazon Maximou are proposed.

The Alternate Ending: A Warrior’s Death In Fact, Fiction, And Film

Science.gov (United States)

2016-05-01

of their lives. Some might call them heroes and others call their deaths a tragedy. If these were the deaths of older men , a funeral may be a...a long life to a full life, which is not always the case. So the question remains, are the men in these stories heroes, despite the un-heroic...embodiment of the stereotypical pilot to a more mature, honest version of himself. When the reader meets Carpenter, he is a womanizer who drinks too much

The antihero in comics

OpenAIRE

Antauer, Gašper

2015-01-01

In this thesis I researched the general appearance of the antihero in popular comics. Firstly I answered the questions who or what is the archetypal hero, what is his traditional role through history of storytelling, his visual and characteristic attributes and what types of heroes do we know of in the mythological sense. From there I analysed the role of the antihero in mythological and literal history, where and when the term appeared and summarised the transition that turned the antiher...

La construcción de la imagen heroica a través del discurso periodístico. El caso de la activista peruana María Elena Moyano.

OpenAIRE

Gabriela McEvoy.

2008-01-01

This work tries to demonstrate that the social construction of the national hero/heroine as a symbol of courage and resistance generally arises within a period of social, political, and economic crisis. The national hero is a construction that is created in a moment characterized by the loss of public trust and the failure of government leaders to act. The creation of the heroic image functions as a sociopolitical tool. The article suggests that there is a close relationship between the histo...

Romantismus, osvícenství a fantastický hrdina

Directory of Open Access Journals (Sweden)

Nikola Balaš

2010-12-01

Full Text Available This article attempts to discover the roots of fantastic literature. In comparison with popular opinion of fantasy being a succesor of romanticism, this article shows that the popular opinion constitutes only half of the truth. Admittedly works of C. S. Lewis, J. R. R. Tolkien or R. E. Howard share distinctive romantic elements – enmity toward modernity, longing for traditional society or love for the nature. Nevertheless there is a tangible evidence that fantasy as a literary, movie or video game genre has much in common with enlightenment world-view. Prime example of this influence is the archetype of fantastic hero. Usually individualistic in essence fantastic heroes confront their nefarious adversaries in order emerge victoriously in the end. With emphasis on autonomy and individual authenticity behaviour of those literary heroes therefore serves as a pattern for modern people to follow. Is fantasy genre either to be understood as a sort of escapist literature or as an user manual for living in modern world?

“Yo soy el profesor”: Héroe mítico y nueva masculinidad en el manga Great Teacher Onizuka

Directory of Open Access Journals (Sweden)

Azul Kikey Castelli-Olvera

2016-02-01

Full Text Available The objective of this work is the analysis of Japanese comics Great Teacher Onizuka, created by the artist Tōru Fujisawa and published in Mexico in 2006 by Editorial Vid. Through the analysis of image and text, we analyze the way in which the main character, Onizuka, is building like a hero according to the theory of heroic adventure, the mythological cycle and characteristics assigned Joseph Campbell to the mythical hero. On the other hand, we want to examine the way in which the protagonist transgress stereotypes of masculinity based on figures powerful physical appearance, which embody a set of moral values and, through different attributes and actions contribute to shaping the male identity linked to violence in the patriarchal system. We intend to visualize how the character of Onizuka although it plays a mythical hero, represents a break in the schemes of masculinity by showing an alternate model of “being a man”.

TINJAUAN ASPEK KELAYAKAN ELEMEN PEMBENTUK RUANG KOMUNAL DI TAMAN MONUMEN 45 KOTA PEKALONGAN

Directory of Open Access Journals (Sweden)

Moch Fathoni Setiawan

2016-01-01

Full Text Available Taman Monumen 45 is one of the city park in Pekalongan City, in which there are statues of the heroes as monument to commemorate the services of the heroes. In this park there are also garden element in shape of hard elements and soft elements. Some hard elements are sitting group, pedestrian area, sports area, and the statue of the heroes (sculpture. The hard elements are referred to support the communal activity for the citizens of Pekalongan. They are functioned as for gathering and chatting, lounging, skateboarding and BMX styling. This study aims to assess the feasibility aspects in Taman Monumen 45 in Pekalongan City. From the research, it was revealed that there are some elements of the park that do not meet the eligibility aspect as constituting elements of communal space. It can be seen from the condition of these elements, either hard material or soft material that is still less maintained and is not in accordance with its function.

Exotic primitivism of death in classical Hollywood living dead films

Directory of Open Access Journals (Sweden)

Outi Hakola

2012-11-01

Full Text Available http://dx.doi.org/10.5007/2175-8026.2012n62p219 The classical Hollywood horror exhibited the undead monsters, such as mummies, zombies and vampires, at the time when cultural practices of death and dying were changing in the United States. Consequently, the way death is handled in these films is connected to the ongoing marginalization of death. In the classical films, heroes represent modern, medicalized, scientific and marginalized death. In contrast, the undead represent traditional, or irrational and magical, death. When the heroes hunt down and kill the monsters, they also claim the superiority of modern death. Furthermore, the exclusion of traditional death is highlighted by using (postcolonial tensions. The non-western monsters and realm of the world stand for traditional death and the past whereas western heroes represent modern death and the future. This article concentrates on how the classical living dead films narrate the cultural tension between the waning (traditional and emerging (modern practices of death.

Speed-Accuracy Tradeoffs in Speech Production

Science.gov (United States)

2017-06-01

capacity of discrete motor responses under different cognitive sets. Journal of Experimental Psychology , 71 (4), 475. SPEED-ACCURACY TRADEOFFS IN HUMAN...space defined by vocal tract constriction degree and location, as in Articulatory Phonology Browman & Goldstein (1992). These high-level spaces are...relationship between speech gestures varies as a function of their positions within the syllable Browman & Goldstein (1995); Krakow (1999); Byrd et al

Antarctica: intellectual Armistice Since 1961

Science.gov (United States)

2015-05-21

www.uscg.mil/hq/cg5/cg552/images/20140626%20Major%20Icebreaker%20Chart.pdf. 99 Ibid. 100 K. Zacny et al ., “Lunar Vader,” Journal of Aerospace...Data Center (NSIDC) have documented the impacts of climate change since 1988 and 1982 respectively...the 1961 Antarctic Treaty ratification hearings. Dr. Laurence Gould , a leading US geologist who accompanied Admiral Byrd on his 1957 Antarctic

The crustal structure and tectonic development of the continental margin of the Amundsen Sea Embayment, West Antarctica: implications from geophysical data

Science.gov (United States)

Kalberg, Thomas; Gohl, Karsten

2014-07-01

The Amundsen Sea Embayment of West Antarctica represents a key component in the tectonic history of Antarctic-New Zealand continental breakup. The region played a major role in the plate-kinematic development of the southern Pacific from the inferred collision of the Hikurangi Plateau with the Gondwana subduction margin at approximately 110-100 Ma to the evolution of the West Antarctic Rift System. However, little is known about the crustal architecture and the tectonic processes creating the embayment. During two `RV Polarstern' expeditions in 2006 and 2010 a large geophysical data set was collected consisting of seismic-refraction and reflection data, ship-borne gravity and helicopter-borne magnetic measurements. Two P-wave velocity-depth models based on forward traveltime modelling of nine ocean bottom hydrophone recordings provide an insight into the lithospheric structure beneath the Amundsen Sea Embayment. Seismic-reflection data image the sedimentary architecture and the top-of-basement. The seismic data provide constraints for 2-D gravity modelling, which supports and complements P-wave modelling. Our final model shows 10-14-km-thick stretched continental crust at the continental rise that thickens to as much as 28 km beneath the inner shelf. The homogenous crustal architecture of the continental rise, including horst and graben structures are interpreted as indicating that wide-mode rifting affected the entire region. We observe a high-velocity layer of variable thickness beneath the margin and related it, contrary to other `normal volcanic type margins', to a proposed magma flow along the base of the crust from beneath eastern Marie Byrd Land-West Antarctica to the Marie Byrd Seamount province. Furthermore, we discuss the possibility of upper mantle serpentinization by seawater penetration at the Marie Byrd Seamount province. Hints of seaward-dipping reflectors indicate some degree of volcanism in the area after break-up. A set of gravity anomaly data

West Europe Report, No. 2174.

Science.gov (United States)

1983-07-15

and inks , 4 billion for acrylics, adhesives, glues, etc.). Finally, the contract places emphasis on the foreign trade balance. This means that CDF...cafe he took a white napkin and drew a large circle and a smaller circle. They represented social democracy and communism. Then Hermansson drew a

Prezentace novináře v normalizační filmové tvorbě

OpenAIRE

Novotná, Petra

2014-01-01

The roles of journalists in motion pictures are diverse and they are to be found amongst leading or supporting characters as well as amongst heroes or villains. Journalists also appear in different film genres from sci-fi movies to musicals. In my diploma thesis I analyse how the makers of the films in normalisation presented journalists. Whether they used them as leading or supporting characters or whether they showed them as heroes or villains. In my thesis I am aiming to describe the type ...

An Analysis in Harry Potter Series from the Perspective of Education

Institute of Scientific and Technical Information of China (English)

董旻鑫

2015-01-01

In the story,Harry Potter becomes a hero in the end.What makes him a hero? This paper discusses it from the perspective of education in the following 2 aspects.First,it discusses the educational system of Hogwarts.It is totally different from the educational system in China.And the two educational systems are compared and contrasted in 3 aspects,the transition in middle school and high school,the establishment of the houses,and the exams.Secondly,the educational thoughts in Hogwarts are very special.

Telemedicine in the 'Hood.

Science.gov (United States)

Elgrably, Jordan

1998-01-01

Telemedicine, the ability to examine patients while physically removed from them by using high-tech virtual treatment, is used increasingly to diagnose and prescribe treatment for patients in nontraditional settings. In Los Angeles (California), Charles R. Drew University of Medicine and King-Drew Medical Center communicate in real time with…

A scanning electron microscopic study of smear layer remaining following use of Greater Taper rotary instruments

Directory of Open Access Journals (Sweden)

S Soumya

2011-01-01

Full Text Available The aim of this in vitro study was to evaluate the smear layer in the root canal following the use of Ni-Ti hand ProTaper, HERO shaper and Twisted rotary instruments. Fifteen freshly extracted single rooted human mandibular premolar teeth were selected. Crowns of all teeth were cut off at the cemento-enamel junction with a carborundum disc. The roots were then randomly divided into three groups of 5 samples each. The working length of all teeth was established by the insertion of an endodontic instrument into the canal until its tip is visible at the apical foramen and then subtracted by 0.5 mm. A sequential crown down technique was carried out in all the three groups as follows: Group-I- Specimens in this group were instrumented with ProTaper Ni-Ti hand instruments. Group-II- Specimens were instrumented with HERO shapers. Group-III - The specimens in this group were instrumented with Twisted rotary instruments. Irrigation was done with 3% NaOCl and 15% EDTA in all the three groups. Teeth were carefully split with hammer and chisel and stored in small labeled bottles containing normal saline until SEM evaluation. Results showed that when comparing ProTaper files, Twisted rotary instruments and HERO shaper instruments, HERO shaper series of rotary instruments showed maximum amount of smear layer followed by the Twisted rotary instruments. Hand instruments produced least amount of smear layer.

THE PROBLEM OF THE PLOT AND THE GENRE IN N. A. RADISHCHEV’S “CHURILA PLENKOVICH, BOGATYR SONGWRITING”

Directory of Open Access Journals (Sweden)

Olga V. Zakharova

2017-03-01

Full Text Available In the 18th–19th centuries, attempts to appropriate folklore heroes and genres in literature were made. One of such literary works was N. A. Radishchev’s poem (1801 where the epic hero Churila Plenkovich became a character. Imitating the folkloric and literary tradition (Homer, Virgil, Ariosto, Voltaire, Wieland, V. A. Levshin, I. P. Bogdanovich, the author combined the images and motives of such genres as bylina (Russian epic song, fairy and literary tale, heroic and comic poem in his work. Using the storyline and retaining the main motives of Levshin’s tale, the poet added mythological and fairy images (Zmey Gorynych (dragon, Yaga, Lel’ (Lel’o, Lada to his writing, supplemented the narrative with new motives, and gave justifications for the heroes’ actions. Radishchev created literary heroes using fairytale types; he showed their sufferings, emotions and feelings. Radishchev’s Churila lost all features of the bogatyr. He is a literary hero — a handsome, good-looking, ardent and sensitive young man. Prelepa and Yaga have fallen in love with him. His feats represent a plot of romance and adventure novel; his heroic deeds are inspired by Lel’o, a god of love who gives the bogatyr strength. As a result of these transformations, an original fabulous plot and genre of the literary work appeared. The writer is precise in his defining: his Churila is a character of the epic story in verse based on folkloric and literary tale.

Greek Gods and Heroes

NARCIS (Netherlands)

Peter Schoon,; Sander Paarlberg,

2001-01-01

Many famous en less famous myths and historic events from Greek antiquity painted by Dutch and Flemish artists from the 16th and 17th century. For the first time a broad selection of paintings and prints with subjects from Greek mythology and history are exposed. Famous painters like Rembrandt,

Heroes for Our Students.

Science.gov (United States)

Brandriss, Tobie

1999-01-01

Describes six books appropriate for use with high school advanced or honors biology classes. The stories describe scientists who persevered against existing preconceptions in science or society at three levels: (1) prevailing mainstream scientific ideas; (2) gender; and (3) nationality or race. Presents ideas for using biographies as part of a…

Revealing Television's Analogue Heroes

NARCIS (Netherlands)

Jackson, Vanessa

2013-01-01

abstractIn this article I will argue that we need to create new archival models in order to preserve and share knowledge of historical, ‘hidden’ television professions and production cultures. Oral history traditions of recording life stories give us a useful starting point. Engineering ‘encounters’

The Heroes of CRISPR.

Science.gov (United States)

Lander, Eric S

2016-01-14

Three years ago, scientists reported that CRISPR technology can enable precise and efficient genome editing in living eukaryotic cells. Since then, the method has taken the scientific community by storm, with thousands of labs using it for applications from biomedicine to agriculture. Yet, the preceding 20-year journey--the discovery of a strange microbial repeat sequence; its recognition as an adaptive immune system; its biological characterization; and its repurposing for genome engineering--remains little known. This Perspective aims to fill in this backstory--the history of ideas and the stories of pioneers--and draw lessons about the remarkable ecosystem underlying scientific discovery. Copyright © 2016 Elsevier Inc. All rights reserved.

Revealing Television's Analogue Heroes

Directory of Open Access Journals (Sweden)

Vanessa Jackson

2013-12-01

Full Text Available In this article I will argue that we need to create new archival models in order to preserve and share knowledge of historical, ‘hidden’ television professions and production cultures. Oral history traditions of recording life stories give us a useful starting point. Engineering ‘encounters’ between skilled television technicians, and the now obsolete equipment they operated in the 1970s and 80s, is challenging for a myriad of reasons, but videoing the interaction of man and machine provides us with a rich insight into how analogue television was produced and broadcast. Social media enables us to disseminate these histories in new and innovative ways..

I mutevoli volti dell’eroe

OpenAIRE

Giuseppe Serpillo

2013-01-01

Yeats needed heroes and looked forward to finding one who might embody his ideas and hopes of the beginning of a new era. However, his standard of perfection changed over the years: from a character in whom the best and highest qualities of an individual might come into being, to a model of the hero able to stand as a symbol and guide for his fellow men, in particular those people Yeats felt mainly responsible for, the Irish. There is something Carlylean in this (Yeats knew and appreciated Ca...

The Hypermasculine and Ubersexual Men in the Harlequin Novels of the 1980s and 2000s

OpenAIRE

Soedibio, Sari M.R.D; Djundjung, Jenny M

2013-01-01

Harlequin novels are so popular that Harlequin romance emerges as a genre. Unlike on the heroines, there are scarcely any studies or works on the heroes, thus, I want to focus my study on the heroes of Harlequin Romance. By analyzing using the Male Sex Role in the 1980s and themes of masculinity in the 2000s, I will prove that there are four types of ideal men in the 1980s Harlequin novels whose characteristics originated from the ideal men in the society at that time, the Hypermasculine men ...

Shannon's Wayにおける恋と結婚の障害

OpenAIRE

中村, 豪; Takeshi, Nakamura; 昭和女子大学英語コミュニケーション学科

2016-01-01

The theme of this study is Shannon's Way as love story: the hero and the heroine's love and the obstacles to their marriage. The novel was written by a Scottish writer and physician, A.J.Cronin(in full Archibald Joseph Cronin, 1896-1981)and published in 1948. The setting of the story is chiefly Winton, a fictitious city based on Glasgow. The hero is Robert Shannon, a twenty-four-year-old poor but excellent researcher and doctor whose ambition is to be successful in medical science by a great ...

The Influence of Drawing on Third Graders' Writing Performance.

Science.gov (United States)

Norris, Edith A.; Reichard, Carla; Mokhtari, Kouider

1997-01-01

Compares writing products of 60 third-grade students who drew before writing a story to writing products of 59 students who wrote without drawing. Finds that students who drew produced more words and overall wrote better than nondrawers. Notes that results were consistent for boys and girls regardless of group membership. (PA)

Cultural Resources Survey of Palmetto and Coochie Revetments, Mississippi River M-326 to 315

Science.gov (United States)

1993-11-11

1840 - SION G. ROWAN ’WILKINSON S PAUL PANDELLY!COKTESWORTH P. SMm .- - ’WILLIAM STAMPS SCHOOL MOSES UD .P E WILLIAM STAMPS1 SECTION WIL.IA\\ -1830 /AND... Tourism , Baton Rouge. Smith, Steven D., Philip G. Rivet, Kathleen M. Byrd, and Nancy W. Hawkins 1983 Louisiana’s Comprehensive Archaeological Plan. State...of Louisiana, Department of Culture, Recreation and Tourism , Officer of Cultural Development, Division of Archaeology, Baton Rouge. Society of

Synonymization of key pest species within the Bactrocera dorsalis species complex (Diptera: Tephritidae): taxonomic changes based on a review of 20 years of integrative morphological, molecular, cytogenetic, behavioural and chemoecological data

International Nuclear Information System (INIS)

Schutze, Mark K.

2015-01-01

Bactrocera papayae Drew & Hancock, Bactrocera philippinensis Drew & Hancock, Bactrocera carambolae Drew & Hancock, and Bactrocera invadens Drew, Tsuruta & White are four horticultural pest tephritid fruit fly species that are highly similar, morphologically and genetically, to the destructive pest, the Oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae). This similarity has rendered the discovery of reliable diagnostic characters problematic, which, in view of the economic importance of these taxa and the international trade implications, has resulted in ongoing difficulties for many areas of plant protection and food security. Consequently, a major international collaborative and integrated multidisciplinary research effort was initiated in 2009 to build upon existing literature with the specific aim of resolving biological species limits among B. papayae, B. philippinensis, B. carambolae, B. invadens and B. dorsalis to overcome constraints to pest management and international trade. Bactrocera philippinensis has recently been synonymized with B. papayae as a result of this initiative and this review corroborates that finding; however, the other names remain in use. While consistent characters have been found to reliably distinguish B. carambolae from B. dorsalis, B. invadens and B. papayae, no such characters have been found to differentiate the latter three putative species. We conclude that B. carambolae is a valid species and that the remaining taxa, B. dorsalis, B. invadens and B. papayae, represent the same species. Thus, we consider B. dorsalis (Hendel) as the senior synonym of B. papayae Drew and Hancock syn.n. and B. invadens Drew, Tsuruta & White syn.n. A redescription of B. dorsalis is provided. Given the agricultural importance of B. dorsalis, this taxonomic decision will have significant global plant biosecurity implications, affecting pest management, quarantine, international trade, postharvest treatment and basic research

Romanticising Shinsengumi in Contemporary Japan

Directory of Open Access Journals (Sweden)

Rosa Lee

2011-01-01

Full Text Available Shinsengumi, a group of young men recruited by the Bakufu to protect Kyoto from radical Imperial House loyalists in the tumultuous Bakumatsu period, is romanticised and idolised in Japan despite its limited place in history. This article attempts to comprehend this phenomenon by locating the closest crystallisation of popularly imagined Shinsengumi in Moeyo ken, a popular historical fiction by Shiba Ryōtarō. Antonio Gramsci explains readers are attracted to popular literature because it reflects their ‘philosophies of the age’, which may be discovered by examining popular heroes with their subsequent replications. This article will identify why Shinsengumi is appealing by comparing Shiba’s hero in Moeyo ken with its twenty-first century reincarnation in Gintama, a popular manga series, and by discerning reader response to Moeyo ken from customer reviews on Amazon.co.jp. It will be demonstrated from these studies that a likely reason for the Japanese public’s romanticisation of Shinsengumi in recent years could be their attraction to autonomous, self-determining heroes who also appreciate the value of community.

76 FR 16741 - Applications for New Awards; Erma Byrd Scholarship Program

Science.gov (United States)

2011-03-25

... (APA) (5 U.S.C. 553) and section 437 of the General Education Provisions Act (GEPA), 20 U.S.C. 1232(d..., 2010, Public Law 111-117 provides, however, that the provisions of section 553 of the APA and section... with disabilities can obtain a copy of the application package in an accessible format (e.g. braille...

Tracking the El Nino events from Antarctic ice core records

International Nuclear Information System (INIS)

Keskin, S.S.; Oelmez, I.

2004-01-01

Sodium and chlorine measurements were made by instrumental neutron activation analysis (INAA) on stratigraphically dated ice core samples from Byrd Station, Antarctica, for the last three centuries. The time period between 1969 and 1989 showed an enhanced impact on the Antarctic ice sheets from oceans in the form of marine aerosols. A disturbed ocean-atmosphere interface due to El Ni Southern Oscillation (ENSO) events seems to be a candidate for this observation in Antarctica. (author)

Defense AT&L (Volume 35, Number 3, May-June 2006)

Science.gov (United States)

2006-06-01

purchasing, and will also result in better stew - ardship of taxpayer dollars. 29 Defense AT&L: May-June 2006 The authors welcome comments and questions. They...Quality Individual or Team Award • Naval Air Depot Cherry Point Environmental Manage- ment System Team (Edward Childs, Wesley Lamb , James Byrd, Billy...program, congratulated the winners in a naval message saying, “I am proud that you are working hard to achieve superior environmental stew - ardship while

Study of Bird Ingestions into Small Inlet Area, Aircraft Turbine Engines

Science.gov (United States)

1989-12-01

TFE731 3 -0- -0- NONE NONE NONE12/16/1987 -0- -0- -0- RICHMOND, VA-BYRD FIELD YES TFE731 3R A,O 2 NONE NONE NONE12/17/1987 8. -0- FOH FRIEDRICHSHAFEN ...GERMANY NO TPE331 5 A,X 1 -0- NONE RETARE12/17/1987 8. -0- FDH FRIEDRICHSHAFEN , GERMANY NO TPE331 5 A,K I 0 NONE RETARD12/30/1987 -0- -0- -0- CRICIUNA

Production, Manipulation, and Applications of Ultracold Polar Molecules

Science.gov (United States)

2015-04-30

were added to the MURI, and in some cases , the experiments were carried out on different molecules than originally stated (e.g., laser cooling and...interactions between like homonuclear alkali metal diatoms. J. Chem. Phys., 135:244307, 2011. [21] Jason N. Byrd, H. Harvey Michels, Jr. John A. Montgomery...111:1, 2013. [35] M. I. Fabrikant, Tian Li, N. J. Fitch, N. Farrow, Jonathan D. Weinstein , and H. J. Lewandowski. Method for traveling-wave

Query 3; A Data Base Inquiry System Description and User’s Tutorials.

Science.gov (United States)

1980-03-01

since Query 3 exists on the ARPANET. These references include: Defense Communications Agency Report NIC 45601, ARPANET Resource Handbook, October 1978...34 T"abular ok:m dIR " biddle dale england fox gridley halsey harry e. yarnell horne josephus daniels jouett leahy reeves richmond k. turner sterett...the terminal, "dwight d. eise... nimitz ainsworth fox reeves valdez dale biddle miller pharris richard e. byrd texas conygham semmes goldsborouqh query

Timing of millennial-scale climate change in Antarctica and Greenland during the last glacial period

DEFF Research Database (Denmark)

Blunier, T; Brook, E J

2001-01-01

A precise relative chronology for Greenland and West Antarctic paleotemperature is extended to 90,000 years ago, based on correlation of atmospheric methane records from the Greenland Ice Sheet Project 2 and Byrd ice cores. Over this period, the onset of seven major millennial-scale warmings in A....... This pattern provides further evidence for the operation of a "bipolar see-saw" in air temperatures and an oceanic teleconnection between the hemispheres on millennial time scales....

La villanía heroica de El Señor de los Cielos en la lucha contra un Estado anómico

OpenAIRE

Vásquez Mejías, Ainhoa; Universidad Católica de Chile

2014-01-01

Amado Carillo Fuentes, a Mexican drug trafficker of the 90’s, has been shown as a dual individual: Transformed into a hero by his own town of origin and sentenced as villain by the Mexican State. His life has been narrated in several productions as “narcororridos,” films, soap operas, and more recently in telenovela “El Señor de los Cielos.” Although in the novel with the same title, published in 2013 by Andrés López, Carillo is described as a hero, the Telemundo telenovela shows him as a vil...

Gifted and Talented Students’ Images of Scientists

Directory of Open Access Journals (Sweden)

Sezen Camcı-Erdoğan

2013-06-01

Full Text Available The purpose of this study was to investigate gifted students’ images of scientists. The study involved 25 students in grades 7 and 8. The Draw-a-Scientist Test (DAST (Chamber, 183 was used to collect data. Drawings were eval-uated using certain criterion such as a scien-tist’s appearance and investigation, knowledge and technology symbols and gender and working style, place work, expressions, titles-captions-symbols and alternative images and age. The results showed that gifted students’ perceptions about scientists were stereotypical, generally with glasses and laboratory coats and working with experiment tubes, beakers indoors and using books, technological tools and dominantly lonely males. Most gifted stu-dents drew male scientists. Although females drew male scientists, none of the boys drew female scientist.

Power in Jeopardy: A Poststructuralist Reading of the Arthurian Legend from Malory’s Le Morte d’Arthur and Tennyson’s Idylls of the King to Tolkien’s The Lord of the Rings

Directory of Open Access Journals (Sweden)

Timuçin Buğra Edman

2015-12-01

Full Text Available Power in Jeopardy: A Poststructuralist Reading of the Arthurian Legend from Malory’s Le Morte d’Arthur and Tennyson’s Idylls of the King to Tolkien’s The Lord of the Rings Abstract The days of the classical heroes are over, as the days of Romance or Chivalric Romance and Epic that depict the hero in quest of the ideal are. A typical Romance situates the hero in a succession of challenges, each of which is overcome by him, who finally defeats the dark, evil force and brings peace and order to his community, thus offering to it the opportunity of living in a system defined by the norms of universal morality and enlightenment. The hero becomes a model of universal justice and stability, and he towers above all of his fellow men as a symbol of perfection and endurance of will against the powers of darkness. This plot of one-man challenge and task has been much fruitful in the creation of the stories of the pre-Christian times, the times of the foundation and expansion of Christianity, and the Medieval Age. During these eras such legendary figures as Osiris, Prometheus, Moses, Jesus Christ, and King Arthur of England have emerged as representative perfect super heroes and as universal and absolute role models. Known as monomyths, such stories have shown parallelism regarding the character and plot structure, all yielding similarities as dictated by Romance; this is mostly obvious through the continuous clash of good and evil. The clash creates a sustained tension in the reader whose moral understanding and conscience are kept busy in wondering whether the hero will lose the battle of righteousness or win it, announcing that human dignity has once again been victorious over evil forces. As suggested above, the days of such heroes are over, together with their references to super human qualities which have long been referred to as universal symbols that stand for ideal models for humanity. Such symbols, signifiers, refer to a sign both in

Clinical gait evaluation of patients with knee osteoarthritis.

Science.gov (United States)

Sun, Jun; Liu, Yancheng; Yan, Songhua; Cao, Guanglei; Wang, Shasha; Lester, D Kevin; Zhang, Kuan

2017-10-01

Knee osteoarthritis (KOA) is the most common osteoarthritis in lower limbs, and gait measurement is important to evaluate walking function of KOA patients before and after treatment. The third generation Intelligent Device for Energy Expenditure and Activity (IDEEA3) is a portable gait analysis system to evaluate gaits. This study is to evaluate the accuracy and reliability of IDEEA3 for gait measurement of KOA patients. Meanwhile, gait differences between KOA patients and healthy subjects are examined. Twelve healthy volunteers were recruited for measurement comparison of gait cycle (GC), cadence, step length, velocity and step counts between a motion analysis system and a high-speed camera (GoPro Hero3). Twenty-three KOA patients were recruited for measurement comparison of former five parameters between GoPro Hero3 and IDEEA3. Paired t-test, Concordance Correlation Coefficient (CCC) and Intraclass Correlation Coefficient (ICC) were used for data analysis. All p-values of paired t-tests for GC, cadence, step length and velocity were greater than 0.05 while all CCC and ICC results were above 0.95. The measurements of GC, cadence, step length, velocity and step counts by motion analysis system are highly consistent with the measurements by GoPro Hero3. The measurements of former parameters by GoPro Hero3 are not statistically different from the measurements by IDEEA3. IDEEA3 can be effectively used for the measurement of GC, cadence, step length, velocity and step counts in KOA patients. The KOA patients walk with longer GC, lower cadence, shorter step length and slower speed compared with healthy subjects in natural speed with flat shoes. Copyright © 2017 Elsevier B.V. All rights reserved.

Resident assistant training program for increasing alcohol, other drug, and mental health first-aid efforts.

Science.gov (United States)

Thombs, Dennis L; Gonzalez, Jennifer M Reingle; Osborn, Cynthia J; Rossheim, Matthew E; Suzuki, Sumihiro

2015-05-01

In college and university residence halls, resident assistants (RAs) are expected to serve as first-aid providers to students who may have alcohol, other drug, mental health, and academic problems. Despite this responsibility, evidence-based, first-aid programs have not been developed and tested for the RA workforce. The current study examined effects of an investigational first-aid program designed specifically for RAs. The online Peer Hero Training program is a novel approach to RA training in its use of interactive video dramatizations of incidents involving substance-using or distressed residents. A 9-month randomized trial conducted on eight US campuses compared RAs who participated in the Peer Hero Training program to RAs who received training-as-usual. Participation in the Peer Hero Training program significantly increased RA first-aid efforts for residential students who may have had alcohol, other drug, mental health, or academic problems 6 months after baseline. Compared with those in the training-as-usual condition, RAs in the Peer Hero Training program made more than 10 times as many first-aid efforts for possible alcohol problems, almost 14 times the number of first-aid efforts for possible drug use, almost 3 times the number of first-aid efforts for possible mental health problems, and 3 times the number of first-aid efforts for academic problems. There was no evidence that measured RA attitudes mediated the effects of the intervention. Results of this preliminary evaluation trial suggest that online training using interactive video dramatizations is a viable approach to strengthening RAs' ability to provide alcohol, other drugs, and mental health first-aid to undergraduates.

Genome-Wide Association Study of a Validated Case Definition of Gulf War Illness in a Population-Representative Sample

Science.gov (United States)

2013-09-01

neuropsychological [10, 11] , neurophysiological [10, 12] , auto- nomic [13] , brain imaging [7, 14–16] and functional status [17] measures, with...Craig Hill and Robert E. Mason. E. William Byrd Jr., Michael E. Murray, Helen Koo and a team of RTI staff contributed to the design of reproductive and...152: 992–1002. 19 Poblete PP, Araneta MRG, Sato PA, Hilio- poulos KM, Kamens DR, Morn CB, Zau AC, Gray GC: National study on reproductive outcomes

Artists in and out of the Caribbean

OpenAIRE

Sally Price; Sally Price

1999-01-01

[First paragraph] Caribbean Art. VEERLE POUPEYE. London: Thames and Hudson, 1998. 224 pp. (Paper US$ 14.95) Transforming the Crown: African, Asian and Caribbean Artists in Britain, 1966-1996. MORA J. BEAUCHAMP-BYRD & M. FRANKLIN SIRMANS (eds.). New York: Caribbean Cultural Center, 1998. 177 pp. (Paper US$ 39.95, £31.95) "Caribbean" (like "Black British") culture is (as a Dutch colleague once said of postmodernism) a bit of a slippery fish. One of the books under ...

The Quest. Haywood Hansell and American Strategic Bombing in World War II

Science.gov (United States)

1999-09-01

Tigers . The Chinese government made it profit- abu for Americans to |cin their struggle against the Japanese. Luke Williamson and Billy McDonald...Calif.: Redwood Press, 1981], DE-14, 15, F-15, 16, 0-4, 5, 6. 31. Martha Byrd, Chennault: Giving Wings to the Tiger (Tuscaloosa, Ala.: University...college. She was able to rent the home of a professor on sabbatical leave and take care of her brother, who suffered from asthma . She remained in

Auto-avaliação de escolas e produção de conhecimento científico com o projecto QUALIS

OpenAIRE

Arroz, Ana Margarida Moura

2010-01-01

2º Colóquio Avaliação de Escolas. Angra do Heroísmo Universidade dos Açores, Campus do Pico da Urze, Angra do Heroísmo, Açores, Portugal, 2 de Outubro de 2010. Dado que a estrutura do modelo permite uma considerável margem de manobra das equipas de auto-avaliação na selecção e ênfase atribuída aos diferentes aspectos do funcionamento da escola no relatório que elaboram… "interessa-nos estudar até que ponto a informação que as equipas de auto-avaliação mobilizam no processo avaliativo e os ...

Aynı Coğrafyada İki Savaş: Troia ve Çanakkale Savaşlarının Karşılaştırılması

Directory of Open Access Journals (Sweden)

Reyhan Körpe

2015-04-01

Full Text Available The Trojan War and the Gallipoli Campaigns are two pivotal battles that took place on the shores of the Dardanelles. They are similar in several respects: Both battles involve several groups coming from different places. Some of the tactics employed during the Gallipoli campaigns are reminiscent of those used during the Trojan War. Many allied soldiers, as their memoirs and letters reveal, knew well the Trojan War and the deeds of its heroes. Their writings also reveal that they compared themselves to the ancient Greek heroes that fought at Troy. They also thought the Gallipoli Campaign as a sort of New Trojan War

A US Air Force Strategy for Africa (Drew Paper, Number 7)

Science.gov (United States)

2009-08-01

of the French empire. In 1935 the French war minister “insisted that sparse French military resources— mechanized weaponry, field artillery...elsewhere might receive them.”3 The common argument against such broad-ranging consideration of consequences is that it engen - ders “analysis

Epicuticular chemistry reinforces the new taxonomic classification of the Bactrocera dorsalis species complex (Diptera: Tephritidae, Dacinae)

Science.gov (United States)

Vaníčková, Lucie; Nagy, Radka; Pompeiano, Antonio

2017-01-01

Bactrocera invadens Drew, Tsuruta & White, Bactrocera papayae Drew & Hancock, and Bactrocera philippinensis Drew & Hancock, key pest species within the Bactrocera dorsalis species complex, have been recently synonymized under the name Bactrocera dorsalis (Hendel). The closely related Bactrocera carambolae Drew & Hancock remains as a discrete taxonomic entity. Although the synonymizations have been accepted by most researchers, debate about the species limits remains. Because of the economic importance of this group of taxa, any new information available to support or deny the synonymizations is valuable. We investigated the chemical epicuticle composition of males and females of B. dorsalis, B. invadens, B. papayae, B. philippinensis, and B. carambolae by means of one- and two-dimensional gas chromatography–mass spectrometry, followed by multiple factor analyses and principal component analysis. Clear segregation of complex cuticule profiles of both B. carambolae sexes from B. dorsalis (Hendel) was observed. In addition to cuticular hydrocarbons, abundant complex mixtures of sex-specific oxygenated lipids (three fatty acids and 22 fatty acid esters) with so far unknown function were identified in epicuticle extracts from females of all species. The data obtained supports both taxonomic synonymization of B. invadens, B. papayae, and B. philippinensis with B. dorsalis, as well as the exclusion of B. carambolae from B. dorsalis. PMID:28873446

Saints, Heroes and Moral Necessity

NARCIS (Netherlands)

Archer, Alfred

2015-01-01

Many people who perform paradigmatic examples of acts of supererogation claim that they could not have done otherwise. In this paper I will argue that these self-reports from moral exemplars present a challenge to the traditional view of supererogation as involving agential sacrifice. I will argue

The Hero and His Shadow

Directory of Open Access Journals (Sweden)

Simona Micali

2010-08-01

Full Text Available

Abstract (E: This essay traces the literary theme of the ‘disobedient shadow’ from the Romantic archetype to its adaptation nineteenth- and twentieth-century fantastic fiction. Focusing on texts in which the shadow takes up its own identity, becoming an uncanny double of its master, it is argued that the development of this theme is closely linked with the evolution of the human subject through the epistemological and cultural revolutions of the last two centuries.

Unsung heroes in the South.

Science.gov (United States)

1991-11-01

While recognizing the important role played by lesbian women in HIV/AIDS prevention in many countries, and as members of some gay organizations in the South, this article focuses only on gay men. Even though formidable societal proscriptions against homosexuality exist in many developing countries and Eastern European countries, gay men served duty on the front lines as AIDS educators and care givers. The threat of the AIDS crisis impelled some to openly acknowledge their sexuality in an effort to reach gay men at risk. In the West, gay organizations had already laid a 10 year foundation of organization and community trust, when the AIDS epidemic appeared in the public spot light. This fact allowed them to act as effective educators of their own gay communities. They were so effective that the number of new HIV cases has leveled off in the gay community. In Central and South America, gay movement cohered in 1976 and responded quickly to AIDS in 1983. In Africa, homosexuality is often considered a contamination of the West and national gay organizations (NGOs) have only recently been formed in Ghana, Tanzania, and Nigeria. The only AIDS services organizations (ASOs) for black men exist in Zimbabwe and South Africa. In Asia NGOs are a new phenomenon that exist only in Hong Kong, Indonesia, India, Malaysia, Singapore, Taiwan and Thailand. All NGOs have several things in common. Governments are rarely interested in working with NGOs so they are forced to find their own funding and develop their own education campaigns. Even in countries that recognize the implications and magnitude of the AIDS crisis, their education programs and policies are often homophobic or anti-gay. In the countries where the government is sympathetic to the gay community they rely upon NGOs to help them develop national education programs for both gays and the rest of the population.

RUSSIA'S HEROES 1941–45

African Journals Online (AJOL)

ismith

demonstrates that war is deeply destructive and brings about more than just ... Axell contextualises his narrative on the partisans –of whom roughly 6 000 .... time, when confronted by Messerschmitts they lost four aircraft on one day and.

RUSSIA'S HEROES 1941–45

African Journals Online (AJOL)

ismith

It is seldom that one comes across a work where history-writing and qualitative research meet succinctly. Add to this an author who communicates crisply and relates real-life narratives that capture and hold the reader's attention. This is such a work. The author read history but did more than that. Since 1960,. Axell has ...

Heroes between materiality and myth

DEFF Research Database (Denmark)

Kjærboe, Rasmus

2017-01-01

The most significant Danish warrior burial is arguably the Memorial Grove in Ryvangen for members of the Danish resistance movement during World War II. This article places the memorial within Danish history and the reception of WWII and argues for its particular qualities as a modernist re-worki...... aspects of identity and collective memory for both individuals and Danish society. Future uses of the site can either go in the direction of recreation or toward immersive education....

Bulgarian Heroes (Patsov & Mechkov, 2014

Directory of Open Access Journals (Sweden)

B.V. Toshev

2015-09-01

Full Text Available This is a book for the participation of Bulgaria in the First World War (1915-1916. The compilers have collected a large number of stories for martial feats of Bulgarian officers and soldiers at the fronts of the war. These stories were published in different sources during or after the war.

Mathematical Heroes--No Longer Unsung

Science.gov (United States)

Chin, Cynthia E.

2007-01-01

The history of Fermat's Last Theorem, recounted in the theatrical piece "Fermat's Last Tango," is a useful vehicle for introducing students to the variety of personalities, processes, and products involved in advanced mathematical investigation. The musical's accessible, informative, and positive portrayal of mathematicians and their work is…

Heroes of the knowledge economy

DEFF Research Database (Denmark)

Ørberg, Jakob Williams

they themselves envisage their futures. The thesis looks behind the mirror cabinet of policy making and aims to better grasp the work and personal investments of Indian youth in creating the imaginaries we rely on globally, when we envision the global knowledge economy. The thesis is as such an account......The Indian engineering student has both nationally and globally come to symbolize the advent of a global knowledge economy. Indian engineering students are depicted in policy documents and popular media as important protagonists that will take India into the this promising future. This thesis...... is a study of these Indian ‘heroes’. It is based on ethnographic fieldwork in an iconic site for their production, the top Indian engineering university, the Indian Institute of Technology Delhi, and it aims to understand how students engage in the creation of both their own and national – even global...

VizieR Online Data Catalog: Absolute polarimetry observations of 33 pulsars (Force+, 2015)

Science.gov (United States)

Force, M. M.; Demorest, P.; Rankin, J. M.

2017-11-01

The observations were carried out in the summer of 2011 using the 100-m Robert C. Byrd GBT and the Green Bank Ultimate Pulsar Processing Instrument (GUPPI) in coherent filterbank mode. Full-Stokes spectra were acquired in an 800 MHz bandwidth centred at 1500 MHz radio frequency; the ~1200-1300 MHz airport radar analogue filter was used, resulting in a ~700 MHz effective bandwidth. The filterbank frequency resolution was 1.5 MHz, or 512 channels across the full band. (2 data files).

Radiation Dose Assessments for Fleet-Based Individuals in Operation Tomodachi, Revision 1

Science.gov (United States)

2014-04-01

94 B-18. USS Tortuga (LSD 46...A LCAC 9, 29 USS Tortuga ‡ LSD 46 N/A N/A USS Harpers Ferry LSD 49 N/A LCAC 10, 81 Military Sealift Command (MSC) USNS Richard E. Byrd T-AKE 4 N/A...10 Apr 11–May 11 At Sea Sasebo NB USS Tortuga (LSD 46) Mar 12 Mar 13–Apr 10 Apr 11 Apr 12–14 Apr 15–27 Apr 28–May 11 Sasebo NB At Sea

Whole Exome Analysis of Early Onset Alzheimer’s Disease

Science.gov (United States)

2017-04-01

Alzheimer’s Disease 5a. CONTRACT NUMBER W81XWH-12-1-0013 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR( S ) Margaret A. Pericak-Vance, Ph.D...Gerald D. Schellenberg, Goldie S . Byrd, Jonathan L. Haines, Margaret A. Pericak-Vance, and the Alzheimer Disease Genetics Consortium. ABCA7 Frameshift...Alzheimer’s & Parkinson’s Diseases (AD/PD), Vienna, Austria, Mar 29-Apr 2, 2017: Cukier HN, Gross SP, Kunkle BW, Rolati S , Hamilton-Nelson KL, Whitehead PL

Quantitative evaluation of apical extrusion of debris and irrigants using four rotary instrumentation systems: an in vitro study.

Science.gov (United States)

Nagaveni, S Aspalli; Balakoti, K Reddy; Smita, Karan; Ratnakar, P; Satish, S V; Aravind, T

2013-11-01

The apical extrusion of infected debris may have the potential to disrupt the balance between microbial aggression and host defense, resulting in incidents of acute inflammation. During preparation, irrigants and debris, such as bacteria, dentin filings and necrotic tissue may be extruded into the periradicular region leading to periapical inflammation and postoperative flare ups. Using an instrumentation technique that minimizes apical extrusion would be beneficial to both the practitioner and patient. The purpose of the study was to evaluate the weight of debris and volume of irrigant extruded apically from extracted teeth in vitro after endodontic instrumentation using four different rotary root canal instrumentation systems. Four groups of each 20 extracted mandibular premolars were instrumented using one of the four systems: ProTaper Universal (Dentsply Maillefer, Ballaigues, Switzerland)), Hero-shaper (MicroMega, Besancon, France), RaCe (FKG Dentaire, La-Chaux-de-Fonds, Switzerland) and K3 (SybronEndo, West Collins, CA). Debris and irrigant extruded from the apical foramen during instrumentation were collected in preweighed test tubes. Volume of irrigant extruded was noted. The containers were stored in incubator at 70° for two days to evaporate the moisture. Weight of dry debris was noted. Data was analyzed using Kruskall-Wallis and Mann-Whitney U test at a significance of 0.001. The results indicated that all of the instrumentation systems tested caused measurable apical extrusion of debris and irrigants. Higher extrusion was observed with Protaper system which was statistically significant with Hero-Shaper, RaCe and K3 systems. There were no statistical differences between Hero-shaper, K3 and RaCe systems (p < 0.05). All instrumentation techniques apically extruded debris and irrigant. However, Hero-shaper, K3 and RaCe systems produced less extruded debris and irrigant than the Protaper system.

Appealing to the Republic of Letters: An Autopsy of Anti-venereal Trials in Eighteenth-century Mexico.

Science.gov (United States)

Clark, Fiona

2014-02-01

This study analyses the narrative elements of a little-known report into anti-venereal trials written by an Irish military physician-surgeon, Daniel O'Sullivan (1760- c .1797). It explores the way in which O'Sullivan as the narrator of the Historico-critical report creates medical heroes and anti-heroes as a means to criticise procedures initiated by staff in the Hospital General de San Andrés, Mexico City. The resulting work depicts a much less positive picture of medical trials and hospital authorities in this period than has been recorded to date, and provides a critical and complicated assessment of one of Spain's leading physicians of the nineteenth century, Francisco Javier Balmis (1753-1819).

Difficulty Swallowing After Stroke (Dysphagia)

Science.gov (United States)

... Stroke Heroes Among Us Difficulty Swallowing After Stroke (Dysphagia) Updated:Nov 15,2016 Excerpted and adapted from "Swallowing Disorders After a Stroke," Stroke Connection Magazine July/August ...

EVALUATION OF THE QUALITY OF ACTION CAMERAS WITH WIDE-ANGLE LENSES IN UAV PHOTOGRAMMETRY

Directory of Open Access Journals (Sweden)

H. Hastedt

2016-06-01

Full Text Available The application of light-weight cameras in UAV photogrammetry is required due to restrictions in payload. In general, consumer cameras with normal lens type are applied to a UAV system. The availability of action cameras, like the GoPro Hero4 Black, including a wide-angle lens (fish-eye lens offers new perspectives in UAV projects. With these investigations, different calibration procedures for fish-eye lenses are evaluated in order to quantify their accuracy potential in UAV photogrammetry. Herewith the GoPro Hero4 is evaluated using different acquisition modes. It is investigated to which extent the standard calibration approaches in OpenCV or Agisoft PhotoScan/Lens can be applied to the evaluation processes in UAV photogrammetry. Therefore different calibration setups and processing procedures are assessed and discussed. Additionally a pre-correction of the initial distortion by GoPro Studio and its application to the photogrammetric purposes will be evaluated. An experimental setup with a set of control points and a prospective flight scenario is chosen to evaluate the processing results using Agisoft PhotoScan. Herewith it is analysed to which extent a pre-calibration and pre-correction of a GoPro Hero4 will reinforce the reliability and accuracy of a flight scenario.

Evaluation of the Quality of Action Cameras with Wide-Angle Lenses in Uav Photogrammetry

Science.gov (United States)

Hastedt, H.; Ekkel, T.; Luhmann, T.

2016-06-01

The application of light-weight cameras in UAV photogrammetry is required due to restrictions in payload. In general, consumer cameras with normal lens type are applied to a UAV system. The availability of action cameras, like the GoPro Hero4 Black, including a wide-angle lens (fish-eye lens) offers new perspectives in UAV projects. With these investigations, different calibration procedures for fish-eye lenses are evaluated in order to quantify their accuracy potential in UAV photogrammetry. Herewith the GoPro Hero4 is evaluated using different acquisition modes. It is investigated to which extent the standard calibration approaches in OpenCV or Agisoft PhotoScan/Lens can be applied to the evaluation processes in UAV photogrammetry. Therefore different calibration setups and processing procedures are assessed and discussed. Additionally a pre-correction of the initial distortion by GoPro Studio and its application to the photogrammetric purposes will be evaluated. An experimental setup with a set of control points and a prospective flight scenario is chosen to evaluate the processing results using Agisoft PhotoScan. Herewith it is analysed to which extent a pre-calibration and pre-correction of a GoPro Hero4 will reinforce the reliability and accuracy of a flight scenario.

The Structural Analysis of the Lyrical Tales of Faraj ba’d az Shedat’s Translation based on Propp’s Model

Directory of Open Access Journals (Sweden)

nahid nasrazaddani

2016-03-01

Full Text Available The pivotal role of ethics in structural analyses of the book Faraj ba’d az Shedat has led to neglecting its lyrical tales. This paper aims to analyze such tales based on Propp’s model. In accordance to Propp’s theory, the beginning phase of tales starts with stability situation. Then, the first function in the story is the appearance of the hero or villain or defection. The villain in the form of poorness is common in one fourth of the tales and it is the second factor of movement in them. In almost half of the tales the anti-hero is the minister or caliphate of the court who easily becomes the helper or donor via his moral virtues and this in turn decreases the excitement and dynamicity in lyrical tales of this work. The lack of animal, supernatural characters as well as fairies and marvelous elements has contributed to the verisimilitude of tales. The moralistic orientation of this work has confused the function of various elements such as anti-hero, helper and donor. The dilemma of some tales is solved without much effort which is the result of the simple mind of the author and his contemporaries.

Cryptotermes brevis (Isoptera: Kalotermitidae) in the Azores: lessons after 2 yr of monitoring in the Archipelago.

Science.gov (United States)

Borges, Paulo A V; Guerreiro, Orlando; Ferreira, Maria T; Borges, Annabella; Ferreira, Filomena; Bicudo, Nuno; Nunes, Lina; Marcos, Rita S; Arroz, Ana M; Scheffrahn, Rudolf H; Myles, Timothy G

2014-01-01

The dispersal flights of West Indian drywood termite, Cryptotermes brevis (Walker) (Isoptera: Kalotermitidae) were surveyed in the major cities of Azores. The sampling device used to estimate termite density consisted of a yellow adhesive trap (size 45 by 24 cm), placed with an artificial or natural light source in a dark attic environment. In addition, data from two other projects were used to improve the knowledge about the geographical distribution of the species. The level of infestation in the two main Azorean towns differed, with high levels in the houses of Angra do Heroísmo, whereas in Ponta Delgada, there are fewer houses with high levels of infestation. The infestation in Ponta Delgada shows a pattern of spreading from the center outward to the city's periphery, whereas in Angra do Heroísmo, there was a pattern of spreading outward from several foci. The heavy infestation observed in Angra do Heroísmo and the clear increase of infestation levels observed from 2010 to 2011 is a reason for concern and calls for an urgent application of an Integrated Pest Management (IPM) control strategy. © The Author 2014. Published by Oxford University Press on behalf of the Entomological Society of America.

Metaphoric Car Drawings By a 12-Year-Old Congenitally Blind Girl.

Science.gov (United States)

Chao, Hsin-Yi; Kennedy, John M

2015-12-01

A 12-year-old congenitally-blind girl drew a car moving, stationary, and braking. For stationary, she put the wheels inside the car and, for braking, drew the wheels as rough rectangles. At the age verbal metaphor is understood (Winner, 1988), the girl invented metaphoric drawings. In these, what is shown is not what is meant. In late childhood, metaphor may be understood similarly in pictures and words and by the sighted and blind. © The Author(s) 2015.

The ethics of heroism in medieval and American Indian tales.

Science.gov (United States)

Scott, A

1990-01-01

Oral-traditional stories detail their heroes' growth through a narrative pattern of exile and return that places the heroes in situations repeatedly challenging their strength and resolve. Through the motif of the quest, medieval and American Indian tales alike reaffirm general psychological truths that bear upon our understanding of human nature. Stories about heroes are stories about us: about our desires to grow up, to defeat death, to prove ourselves in difficult situations, and to achieve recognition or admiration among our peers (Becker, 1973, p. 4). In this way, medieval and American Indian tales are about self-actualization. They maintain that "one has within oneself proclivity toward growth and unity of personality ... and an automatic thrust toward expression" of these qualities (Yalom, 1980, p. 9). All forms of literature, however, reflect ideas peculiar to their cultures. The ways in which these basic human truths are represented in medieval and American Indian tales suggest the differing religious or social concerns that have informed these truths and have given them shape. To a large degree, the medieval knight's view of "self" and "other" encompasses the view that Western humanity has had (and continues to have) of itself. This is a view conditioned upon the superiority of the "self" as measured against the inferiority of the "other," reinforced through existing social (hierarchial) and religious (Judeo-Christian) codes of behavior. Such codes are not only inadequate to the task of interpreting American Indian perceptions of "self" and "other," they are inimical to the ethical foundation underlying them. Scott Momaday remarks that "you cannot understand how the Indian thinks of himself in relation to the world around him unless you understand his conception of what is appropriate; particularly what is morally appropriate within the context of that relationship" (Basso, 1984, p. 46). For the American Indian hero, self-actualization is self

Environmental Review Records

Data.gov (United States)

Department of Housing and Urban Development — HUD’s Environmental Review Records page houses environmental reviews made publicly available through the HUD Environmental Review Online System (HEROS). This...

Neuropsychological effects and attitudes in patients following electroconvulsive therapy

OpenAIRE

Edwards, Christopher

2008-01-01

Miriam Feliu1,2, Christopher L Edwards1,2,3, Shiv Sudhakar4, Camela McDougald1, Renee Raynor5, Stephanie Johnson6, Goldie Byrd7, Keith Whitfield8, Charles Jonassaint8, Heather Romero1, Lekisha Edwards1, Chante’ Wellington1, LaBarron K Hill9, James Sollers, III9, Patrick E Logue11Department of Psychiatry and Behavioral Sciences; 2Duke Pain and Palliative Care Center; 3Department of Medicine, Division of Hematology; 4Drexel University Medical School; 5Brain Tumor Center, Duke Universi...

On generalized Fibonacci and Lucas polynomials

Energy Technology Data Exchange (ETDEWEB)

Nalli, Ayse [Department of Mathematics, Faculty of Sciences, Selcuk University, 42075 Campus-Konya (Turkey)], E-mail: aysenalli@yahoo.com; Haukkanen, Pentti [Department of Mathematics, Statistics and Philosophy, 33014 University of Tampere (Finland)], E-mail: mapehau@uta.fi

2009-12-15

Let h(x) be a polynomial with real coefficients. We introduce h(x)-Fibonacci polynomials that generalize both Catalan's Fibonacci polynomials and Byrd's Fibonacci polynomials and also the k-Fibonacci numbers, and we provide properties for these h(x)-Fibonacci polynomials. We also introduce h(x)-Lucas polynomials that generalize the Lucas polynomials and present properties of these polynomials. In the last section we introduce the matrix Q{sub h}(x) that generalizes the Q-matrix whose powers generate the Fibonacci numbers.

Millennials: Rendezvous with Destiny?

National Research Council Canada - National Science Library

Fahlbusch, Frederick L

2008-01-01

The Millennial Generation (born between 1982 and about 2002) is showing characteristics and tendencies that lead generational theorists to believe that this generation will become America's next "Hero" generation...

Increasing Effectiveness of U.S. Counterintelligence: Domestic and International Micro-Restructuring Initiatives to Mitigate Cyberespionage

Science.gov (United States)

2012-06-01

keys: Data Breach at the Pentagon’s Largest Supplier,” ITNEWS (30 May 2011). 116 Christopher Drew and John Markoff, “ Data Breach at Security Firm...117 Drew and Markoff, “ Data Breach at Security Firm Linked to Attack on Lockheed Martin.” 118 Hjortdal, “China’s Use of Cyber...John Markoff. “ Data Breach at Security Firm Linked to Attack on Lockheed Martin.” The New York Times, 27 May 2011. http://www.nytimes.com/2011/05/28

Pop / Tõnu Kaalep

Index Scriptorium Estoniae

Kaalep, Tõnu, 1966-2018

2005-01-01

Uutest heliplaatidest Andy Bell "The Electric Blue", Vex'd "Degenerate", "Hendrik Sal-Saller & Estonian Dream Bigband", Ian Brown "The Greatest", Jon Lennon "Working Class Hero", Richard Youngs "The Naive Shaman"

Spiritual Evolution as a Metamorphose (on the base of Victor Pelevin Novel "Life of Insects"

Directory of Open Access Journals (Sweden)

Tetyana Shevchuk

2013-08-01

Full Text Available The article deals with the aesthetic paradigm of the novel "Life of Insects" (1993, written by well-known Russian writer Victor Pelevin. Spiritual evolution or degradation of the heroes is represented by their metamorphosis from person to insect or vice versa. Actual questions of the novel are focused on the problems of spiritual vacuum, lost dignity, the meaning of life, the relationship to life as most rare and precious gift, the horror to live at the level of animal existence. The author models the reality, in which the insect mask captures the essence of the person. The focus is on the anthropocentric code of the novel, the evolutionary and regressive reasons, connected with the transmutations of the heroes.

Duss Fairy Tales: some data from a new evaluation form.

Science.gov (United States)

Mazzeschi, C; Lis, A; Calvo, V; Vallone, V; Superchi, E

2001-12-01

The purpose of this paper is to extend the research on the Duss Fairy Tales in an Italian sample. Attention has been paid, in particular, to the study of some variables identified in a newly devised schedule. The protocols were scored for four indexes: (1) the main hero of the stories, (2) number and types of characters, (3) number of emotions expressed, and (4) number of heroes' and characters' actions and behaviors. Subjects were 70 children aged 3.5 to 10.5 yr. enrolled in kindergartens and elementary schools in Italy. The relationships of scores with age and sex were also investigated. There was an increase across three age groups in the richness of stories in terms of emotions and characters' identification.

High-Resolution Body Wave Tomography of the Ross Sea Embayment, Antarctica

Science.gov (United States)

White-Gaynor, A.; Nyblade, A.; Wiens, D. A.; Aster, R. C.; Gerstoft, P.; Bromirski, P. D.; Stephen, R. A.

2017-12-01

The West Antarctic Rift System (WARS) is one of the least understood continental rift system on the planet. The 1000 km wide WARS includes the Ross Sea Embayment between Marie Byrd Land and the Transantarctic Mountains (TAMS). Active volcanism on Ross Island continues to challenge our understanding of the generally quiescent rift system. Previous regional-scale body wave tomographic investigations have identified areas of low seismic wave speeds to 200 km depth beneath Ross Island. However, the spatial extent of the low velocity structure across the entirety of the WARS remains poorly constrained due to the insufficient resolution of upper mantle structure under the Ross Sea Embayment away from Ross Island. We utilize teleseismic P wave observations recorded on the RIS/DRIS network, which consists of 34 seismometers deployed across the Ross Ice Shelf, along with data from nearby POLENET and TAMSEIS stations to better resolve this region. Relative P wave travel time residuals from 1300 teleseismic events, obtained using a multichannel cross-correlation method, have been inverted for a seismic velocity model of the upper mantle throughout the Ross Sea Embayment. Our results suggest that the low wave speed structure under Ross Island extends roughly halfway across the Embayment and south along the Transantarctic Mountains. This observation is consistent with a two-phase rifting history for the WARS in which broad, late Cretaceous rifting between Marie Byrd Land and the TAMS transitioned to more focused rifting along the TAMS margin in the Cenozoic.

Strategic Insights, Volume 5, Issue 2, February 2006. Uribe's Second Mandate, the War, and the Implications for Civil-Military Relations in Colombia

National Research Council Canada - National Science Library

Porch, Douglas

2006-01-01

.... However, hardly was the ink dry on the Constitutional Court's decision than hero of the hard line, take-no-prisoners strategy in the war against Colombia's insurgents appeared to reverse course...

DREW-UCLA Breast Cancer Research and Training Program: Molecular/Cellular Pathogenesis Model

Science.gov (United States)

2007-03-01

RHS1764-9209568) were designed corresponding to nucleotides 575 to 595 of the coding region (gccctggccgtgctagacaat) of Homo sapiens ERBB2 transcript...variant 1, mRNA sequence (NM_004448, NCBI database), and 2896 to 2917 of the coding region (gctgaactggtgtatgcagatt) of Homo sapiens ERBB2, transcript...responsible for alanine transport. Springer Apoptosis (2007) 12:593–612 599 * T ra n sp o rt V el o ci ty (n m o l/m g p ro te in /m in ) 0.0 0.5 1.0

Using the Literature to Understand Achilles' Fate.

Science.gov (United States)

Rakic, Vesna S

2016-05-01

According to Greek mythology, Achilles was fatally wounded in his heel, bled out, and died. Several unproven hypotheses mention poisoning, infection, allergy, hemophilia, thyrotoxic storm (ie, pain and stress), and suicide. The author, a plastic surgeon who often treats chronic wounds, proposes an additional scenario: Although not mortally wounded, Achilles was considered dead, because in his time a wounded hero was as good as a dead hero, so he lived out the remainder of his life as former hero with a chronic wound far away from everyone. To determine whether his injury was enough to cause fatal bleeding and quick death or if other factors might have been in play, a search of the literature was conducted to enhance what is known about Achilles, basically through the tale related in The Iliad and the clinical impact of an Achilles' injury. Search terms utilized included bleeding tibialis posterior artery (3 manuscripts were found) and chronic wound, Achilles tendon (631 manuscripts were located). Although science may not be able to explain how and why Achilles died, the literature supported the conjecture that Achilles probably had a chronic wound with skin and paratenon defect, de- vitalized tendon tissue, bleeding, granulation, and repeated infections. It is interesting to consider the state of his injury and his mind in the making of this legend.

Popmuusika / Mart Juur

Index Scriptorium Estoniae

Juur, Mart, 1964-

2005-01-01

Uutest heliplaatidest John Lennon "Working Class Hero", Tito Puente y Su Orchestra "Viva Mambo", Sigur Ros "Takk", Ladytron "Witching Hour", Black Rebel Motorcycle Club "Howl", Ans. Andur "Tuled peale", Emmilou Harris "Heartaches & Highways"

75 FR 26877 - Peace Officers Memorial Day and Police Week, 2010

Science.gov (United States)

2010-05-12

... look to them as models of courage and integrity. This week, we honor their extraordinary service and sacrifice, and we remember the fallen heroes whose selfless acts have left behind safer streets and stronger...

Aphasia vs. Apraxia

Science.gov (United States)

... After Stroke Inspirational Stories Stroke Heroes Among Us Aphasia vs. Apraxia Updated:Oct 24,2016 Excerpted from " ... treated by a speech-language pathologist. Read more Aphasia articles: Talking Tech: How technology helps survivors with ...

City shows gratitude for Fermilab relationship

CERN Multimedia

Pierce, Gala

2006-01-01

"Part of last week Batavia Chamber of Commerce celebration wasn't just to salute one of Batavia's heroes - Carla Hill - but to commemorate a 40-year relationship between the city and Fermilab" (1 page)

Chemists boldly go

Science.gov (United States)

Francl, Michelle; Donnay, Michael

2017-01-01

Michael Donnay and Michelle Francl want chemists to share the stories behind the work they do, and not be afraid to identify the heroines and heroes -- and their epic adventures -- that paved the way.

Una red transmedia para el hombre araña: a propósito de Spider-Man Noir

Directory of Open Access Journals (Sweden)

Santiago García Sanz

2014-06-01

Full Text Available An almost one-century old genre, comic books have tried to find their space as a means of artistic expression since the very beginning. Emerging from Stan Lee’s creative genius in 1962 in a complete break with the hero archetype that prevailed for over two decades, and based on a pulp-literature vigilante, the Spider-Man is an atypical teenage hero that became an icon, not only of its publishing house, but of 20th-century Western popular culture. Throughout its history, the myth of the Spider-Man has undergone several revisions that fall within the American uchronic tradition in different media. Spider-Man Noir re-interprets the character as a crime detective and has eventually swung from paper to screens in order to thrive in the new century.

Learning models for multi-source integration

Energy Technology Data Exchange (ETDEWEB)

Tejada, S.; Knoblock, C.A.; Minton, S. [Univ. of Southern California/ISI, Marina del Rey, CA (United States)

1996-12-31

Because of the growing number of information sources available through the internet there are many cases in which information needed to solve a problem or answer a question is spread across several information sources. For example, when given two sources, one about comic books and the other about super heroes, you might want to ask the question {open_quotes}Is Spiderman a Marvel Super Hero?{close_quotes} This query accesses both sources; therefore, it is necessary to have information about the relationships of the data within each source and between sources to properly access and integrate the data retrieved. The SIMS information broker captures this type of information in the form of a model. All the information sources map into the model providing the user a single interface to multiple sources.

Radiotherapy equipment and departments in the European countries

DEFF Research Database (Denmark)

Grau, Cai; Defourny, Noémie; Malicki, Julian

2014-01-01

BACKGROUND: Documenting the distribution of radiotherapy departments and the availability of radiotherapy equipment in the European countries is an important part of HERO - the ESTRO Health Economics in Radiation Oncology project. HERO has the overall aim to develop a knowledge base...... of the provision of radiotherapy in Europe and build a model for health economic evaluation of radiation treatments at the European level. The aim of the current report is to describe the distribution of radiotherapy equipment in European countries. METHODS: An 84-item questionnaire was sent out to European...... countries, principally through their national societies. The current report includes a detailed analysis of radiotherapy departments and equipment (questionnaire items 26-29), analyzed in relation to the annual number of treatment courses and the socio-economic status of the countries. The analysis is based...

La metáfora del viaje del héroe en la narración de nietos de expresos políticos: la postmemoria de la prisión política y tortura en Chile

Directory of Open Access Journals (Sweden)

Ximena Faúndez Abarca

2016-04-01

Full Text Available This article analyzes the post-memory of grandchildren of former political prisoners who were imprisoned under the Chilean civic-military dictatorship. The participants in the study were 14 young people of an average age of 21.4 years, from the regions of Metropolitana and La Araucanía. The life story was the technique used for producing the information. A narrative analysis was done based on interdisciplinary inputs from the theory of interpretation and discourse theory. The results of the analysis made it possible to identify the use of the metaphor of the hero´s journey in the narratives. The tension with respect to the positions of victim, witness and hero is discussed, as well as the need for social confirmation of experiences of political violence.

Myth about immortality in the contemporary pop culture: A case study about Toše Proeski

Directory of Open Access Journals (Sweden)

Stevanović Lada

2013-01-01

Full Text Available This paper explores the intersection of death and ideology in the sphere of popular culture, as exemplified by the afterlife destiny of Toše Proeski, a Macedonian pop singer whose huge popularity continued even after his death. His sudden, untimely death in his twenties had exploded as huge news, preoccupying all sorts of media. What I am interested in this paper is what has happened afterwards. In which way his popularity and his afterlife continue? Can we identify some kind of pop hero cult here, and is it possible to recognize common elements, or even a pattern according to which (newborn stars develop an afterlife destiny? Can we use this opportunity to discuss immortality myths? Do pop stars get monuments or are these reserved just for national heroes?

Karyotype studies on Tagetes erecta L. and Tagetes patula L.

African Journals Online (AJOL)

ARL

2011-11-16

GoldenGate'. Beijing Institute of Landscape and Garden. T. patula L. 'Little Hero'. Beijing Institute of Landscape and Garden. T .patula L. 'Janie'. Beijing Institute of Landscape and Garden. Table 2. Parameters of chromosomes ...

75 FR 67897 - Military Family Month, 2010

Science.gov (United States)

2010-11-04

... inspire us all with their courage, strength, and deep devotion to our country. They endure the challenges... vision of an America that supports and engages these heroes now and for decades to come. [[Page 67898...

Improving Support for America's Hidden Heroes

Science.gov (United States)

Terri, Tanielian; Kathryn E., Bouskill; Rajeev, Ramchand; Esther M., Friedman; Thomas E., Trail; Angela, Clague

2018-01-01

Abstract The United States is home to more than 21 million veterans, many of whom deployed to support combat operations around the globe during their military service and sustained service-related conditions or disabilities. Supporting these wounded, ill, and injured warriors once home are millions of informal caregivers—individuals who provide unpaid support with activities that enable the service member or veteran to live in a noninstitutionalized setting. In this study, researchers describe elements of a research blueprint to inform future efforts to improve support for military and veteran caregivers. To construct this blueprint, researchers inventoried currently available research on caregiving for disabled adults and children and gathered stakeholder input by conducting a survey and facilitating an online panel. The study highlights the need for more studies that examine how military and veteran caregiver needs evolve over time, how programs are working, and how caregiving affects specific subgroups. The resulting blueprint should serve as a guide for the caregiver support community to use in prioritizing and facilitating future research. PMID:29416949

Development of SuperHERO readout electronics

Data.gov (United States)

National Aeronautics and Space Administration — Next-generation solar hard X-ray (HXR) imagers will make high-sensitivity, high-dynamic-range observations of the signatures of accelerated electrons in solar...

Eosinophils: The unsung heroes in cancer?

Science.gov (United States)

Varricchi, Gilda; Galdiero, Maria Rosaria; Loffredo, Stefania; Lucarini, Valeria; Marone, Giancarlo; Mattei, Fabrizio; Marone, Gianni; Schiavoni, Giovanna

2018-01-01

Prolonged low-grade inflammation or smoldering inflammation is a hallmark of a cancer. Eosinophils are components of the immune microenvironment that modulates tumor initiation and progression. Although canonically associated with a detrimental role in allergic disorders, these cells can induce a protective immune response against helminthes, viral and bacterial pathogens. Eosinophils are a source of anti-tumorigenic (e.g., TNF-α, granzyme, cationic proteins, and IL-18) and protumorigenic molecules (e.g., pro-angiogenic factors) depending on the milieu. In several neoplasias (e.g., melanoma, gastric, colorectal, oral and prostate cancer) eosinophils play an anti-tumorigenic role, in others (e.g., Hodgkin's lymphoma, cervical carcinoma) have been linked to poor prognosis, whereas in yet others they are apparently innocent bystanders. These seemingly conflicting results suggest that the role of eosinophils and their mediators could be cancer-dependent. The microlocalization (e.g., peritumoral vs intratumoral) of eosinophils could be another important aspect in the initiation/progression of solid and hematological tumors. Increasing evidence in experimental models indicates that activation/recruitment of eosinophils could represent a new therapeutic strategy for certain tumors (e.g., melanoma). Many unanswered questions should be addressed before we understand whether eosinophils are an ally, adversary or neutral bystanders in different types of human cancers.

Emergency care. From zero to hero.

Science.gov (United States)

Bevington, Jay; Halligan, Aidan; Cullen, Ron

2004-07-29

Essex Ambulance Service trust has achieved a rapid transformation, having last year received the country's worst CHI report. The trust transformed itself through new roles, collaborative working and developing its own model for out-of-hours services. Staff have new confidence in the management team, led by young, relatively inexperienced chief executive Anthony Marsh.

Putting the "Her" in Science Hero

Science.gov (United States)

Wentworth, Sandra

2014-01-01

In this article, Sandra Wentworth invites science teachers to ask a group of students to write the names of three famous scientists on a piece of paper within one minute. Chances are that most students will mention Einstein and be unable to name another scientist, specifically a woman, except for an occasional Marie Curie response. This article…

The Making of a Popular Hero

DEFF Research Database (Denmark)

Lauridsen, Palle Schantz

2011-01-01

modulationer, Holmes-fortællingerne undergik i skiftet fra litteraturen til det folkelige teater. Medieskiftet og dermed skiftet i målgruppe havde betydning for Holmes-universets genreplacering, hvilket også var tilfældet, da Nordisk Film i årene 1908-1911 producerede en række stumfilm med Holmes....

Captain America: A Hero for Education??

Science.gov (United States)

Dorrell, Larry D.; Southall, Carey T.

1982-01-01

Describes a program in which comic books were placed in a junior high school library in order to attract more students. Concludes that the comic books proved to be an aid in helping teachers attain their educational goals. (FL)

Telling Stories: Past and Present Heroes

Science.gov (United States)

Smith, Colin Bridges

2007-01-01

Among the Xhosa tribe in South Africa storytelling is a magnificent art. But these stories are more than mere entertainment. Xhosa scholar Harold Scheub says story-telling for the Xhosa people is "not only a primary means of entertainment and artistic expression in the society, it is also the major educational device." Beyond education,…

Heroes today - but what about tomorrow

DEFF Research Database (Denmark)

Gjerløv-Juel, Pernille; Guenther, Christina

Young high-growth firms, or gazelles, have been investigated predominantly with respect to their outstanding short-term performance. The paper at hand adopts a different approach by analyzing the long-term performance of such firms to shed light on the sustainability of these job-creating machines....... Using the Danish Integrated Database for Labour Market Research, we find that former gazelles are not able to sustain their headstart in terms of performance in the long run. We demonstrate that gazelles are often outperformed by initially slower growing competitors, as high initial growth negatively...... routine structure within the newly founded venture if expansion is undertaken too hastily. In turn, this impediment decreases these firms’ long-term performance, as the initial set of structures and routines or the lack thereof has a long-lasting effect on the organization’s development....

Unseen and unsung heroes: The microbes

Digital Repository Service at National Institute of Oceanography (India)

Raghukumar, S.

Fungi are larger microorganisms and their bodies are mostly filamentous, the filaments being called hyphae. It is now believed that fungi evolved from an ancestor that was also common to animals. The width of the fungal hyphae is just about 3 to 5...

Hamlet the Humanist

Institute of Scientific and Technical Information of China (English)

刘恒

2014-01-01

William Shakespeare has left us the remarkable tragedy Hamlet, a typical novel in which the readers are deeply im-pressed by Hamlet, a special hero of his kind and also a humanist in the Renaissance Period.

Know Stroke: Know the Signs, Act in Time Video

Medline Plus

Full Text Available ... voice]: "I'm calling 911." Announcer: An alert family member or bystander can be a real hero. [ ... example, despite high blood pressure, diabetes and a family history, her stroke came as a surprise. Sylvia ...

Heat-Related Illnesses

Medline Plus

Full Text Available ... a Medical Emergency Childhood Emergencies Careers in Emergency Medicine Seconds Save Lives Be Prepared Safe Citizen Day ... So Long Admission to the Hospital Heroes On Medicine's Front Line Observation Emergency Care Fact Sheet Health & ...

Media influence and violent crimes in the Niger Delta Region of ...

African Journals Online (AJOL)

Media violence is viewed by social psychologists, sociologists, social workers ... to the media via the various channels such as television, radio, video players, ... characters as heroes in the media, children and teens imitate the behaviours of ...

Children in Hot Cars Result in Fatal Consequences

Medline Plus

Full Text Available ... A Medical Emergency Childhood Emergencies Careers in Emergency Medicine Seconds Save Lives Be Prepared Safe Citizen Day ... So Long? Admission to the Hospital Heroes on Medicine's Front Line Observation Emergency Care Fact Sheet Health & ...

Heat-Related Illnesses

Medline Plus

Full Text Available ... A Medical Emergency Childhood Emergencies Careers in Emergency Medicine Seconds Save Lives Be Prepared Safe Citizen Day ... So Long? Admission to the Hospital Heroes on Medicine's Front Line Observation Emergency Care Fact Sheet Health & ...

Figuring It Out

CERN Document Server

Crato, Nuno

2010-01-01

This fun book uses stories to explain mathematics. It tells of villains who steal secrets, heroes who encode messages, highway confusions that result from ignoring Cartesian geometry, mistakes in calendars due to poor numerical approximations, and more.

3 CFR 8444 - Proclamation 8444 of October 30, 2009. Military Family Month, 2009

Science.gov (United States)

2010-01-01

... that while our men and women in uniform discharge their duties, we do all we can to promote and... our fallen heroes who have paid the ultimate price for the freedoms we enjoy. This month, we celebrate...

King Lear Reveals the Tragic Pattern of Shakespeare

Directory of Open Access Journals (Sweden)

Salim Eflih Al-Ibia

2017-04-01

Full Text Available Rather than focusing on the obvious traditions of evaluating Shakespearean tragic heroes, this paper presents a groundbreaking approach to unfold the pattern William Shakespeare follows as he designed his unique characters. This pattern applies to most, if not all, Shakespearean tragic heroes. I argue that Shakespeare himself reveals a great portion of this pattern on the tongue of Lear as the latter disowns Goneril and Regan promising to have “such revenges on [them] both” in King Lear. Lear’s threats bestow four unique aspects that apply not only to his character but they also apply to Shakespearean tragic heroes. Lear’s speech tells us that he is determined to have an awful type of revenge on his daughters. However, the very same speech tells us that he seems uncertain about the method through which he should carry out this revenge. Lear does not express any type of remorse as he pursues his vengeful plans nor should he aim at amnesty. He also admits his own madness as he closes his revealing speech. This research develops these facts about Lear to unfold the unique pattern Shakespeare follows as he portrayed his major tragic figures. This pattern is examined, described and analyzed in King Lear, Othello, and Hamlet. We will find out that the pattern suggested in this study helps us better understand Shakespeare’s tragedies and enables us to provide better explanations for some controversial scenes in the tragedies discussed.

OVERVIEW OF THE INTERNATIONAL SYMPOSIUM “NAPOLEONIC MYTHS IN WORLD CULTURE: EPISTEMOLOGY, AXIOLOGY, AND REPRESENTATIONS IN LITERATURE, HISTORIOGRAPHY, AND ART”

Directory of Open Access Journals (Sweden)

Elena D. Galtsova

2016-12-01

Full Text Available The present publication is an overview of the international symposium “Napoleonic Myths in World Culture: Epistemology, Axiology, and Representation in Literature, Historiography, and Art,” held at IWL RAS on October 3–5, 2016. It was chaired by IWL RAS together with Pasquale Paoli Corsica University, Moscow Center of the French-Russian Studies (CEFR, Institute of World History RAS, Russian State University for the Humanities, Moscow State University, and Committee on French Literature and Intellectual Culture of the Council “History of World Literature” at RAS Presidium. Over 40 literary historians, historians, sociologists, philosophers, and art historians gave their papers at the symposium. The aim of the symposium was to study interdisciplinary representations of Napoleonic myths and detect various mechanisms that enabled transform a hero (or anti-hero of his time into a fantasy that keeps recurring in the cultural consciousness, both in the depths of the human psyche and on the surface of social life. Napoleon is a hero of a “modern myth” that developed only about two hundred years ago. Therefore, one can claim that Napoleonic myth is a myth in the process of its development. The study of the mechanisms of this process is a relevant task for the humanities. The overview discusses certain cognitive dominants that reflect contemporary tendencies of the scholarly reflection on the process of development, functioning, and spread of Napoleonic myths in the world culture of the past two centuries.

A description of stress driven bubble growth of helium implanted tungsten

International Nuclear Information System (INIS)

Sharafat, Shahram; Takahashi, Akiyuki; Nagasawa, Koji; Ghoniem, Nasr

2009-01-01

Low energy (<100 keV) helium implantation of tungsten has been shown to result in the formation of unusual surface morphologies over a large temperature range (700-2100 deg. C). Simulation of these macroscopic phenomena requires a multiscale approach to modeling helium transport in both space and time. We present here a multiscale helium transport model by coupling spatially-resolved kinetic rate theory (KRT) with kinetic Monte Carlo (KMC) simulation to model helium bubble nucleation and growth. The KRT-based HEROS Code establishes defect concentrations as well as stable helium bubble nuclei as a function of implantation parameters and position from the implanted surface and the KMC-based Mc-HEROS Code models the growth of helium bubbles due to migration and coalescence. Temperature- and stress-gradients can act as driving forces, resulting in biased bubble migration. The Mc-HEROS Code was modified to simulate the impact of stress gradients on bubble migration and coalescence. In this work, we report on bubble growth and gas release of helium implanted tungsten W/O stress gradients. First, surface pore densities and size distributions are compared with available experimental results for stress-free helium implantation conditions. Next, the impact of stress gradients on helium bubble evolution is simulated. The influence of stress fields on bubble and surface pore evolution are compared with stress-free simulations. It is shown that near surface stress gradients accelerate helium bubbles towards the free surface, but do not increasing average bubble diameters significantly.

28 clear sentences / Tõnis Saadoja

Index Scriptorium Estoniae

Saadoja, Tõnis, 1980-

2011-01-01

Näitusest "Kaido Ole. Handsome Hero and Plenty of Still Lifes" ("Kaido Ole. Kena kangelane ja küllaga vaikelusid") Kumu Kunstimuuseumis 27.01.-15.04.2012. Kunstnikust ja tema loomingust. Video "Monologue" Kaido Olest tegi Flo Kasearu

THE NAVAL CAMPAIGN IN THE WAR OF THE PACIFIC 1879-1884

African Journals Online (AJOL)

tionships between Chile, Peru, Argentina, Para- guay and ... On 1 March 1879 Bolivia declared war on Chile, knowing that she .... tion and then hoisted the flag signal "Enemy to. North". ... soared and Prat and Condell became national heroes.

Passions au miroir: Hugo et Garibaldi dans la solitude de l’Histoire

Directory of Open Access Journals (Sweden)

Marco Nuti

2009-12-01

Full Text Available In Mythic Imagery, a warrior is a hybrid man – a divine human being or a divinized mortal – who stands out of his own kind for his extraordinary skill to generate power. Being an undefined figure of man, equidistant from deity and humanity, the warrior hero represents the Human Community. Using his knowledge of what Giuseppe Garibaldi had done to unify Italy, Victor Hugo had the chance to annex to his political and literary fighting a contemporary hero who shared his own ideology. An amazing relationship put their destinies together, and the epistolary exchange Garibaldi (1863 strengthened this union. Giuseppe Garibaldi in Mentana (1867 is invested with the heroic legitimacy of a symbolical progressive movement. The experimental brotherhood between the poet and the warrior symbolized for Hugo a continuous questioning of the real power of poetical language.

La mujer tenaza en la emancipación de Colombia

Directory of Open Access Journals (Sweden)

Néstor Emiro Piragauta Montaña

2014-01-01

Full Text Available It should be given more importance to the story, because in the last decades has been relegated in schools to remember a historic date, very few resources and momentum that have been given him. The story has huge advantages because through it we find the reason of human beings, their beliefs, their chants, songs, stories, oral transmission, science, art, their minds, their writing, their heroes, their heroes and heroines and so everything that makes the man and the changes he makes in favor of a society. The story has come to us through research that is done rigorously, so that each part of Colombian territory has something to tell and where it has left its mark, but many times we do not know, or who knows and is lost in time, new generations have lost their attachment to their homeland.

Lithospheric Structure of Antarctica and Implications for Geological and Cryospheric Evolution

Science.gov (United States)

Wiens, Douglas; Heeszel, David; Sun, Xinlei; Lloyd, Andrew; Nyblade, Andrew; Anandakrishnan, Sridhar; Aster, Richard; Chaput, Julien; Huerta, Audrey; Hansen, Samantha; Wilson, Terry

2013-04-01

Recent broadband seismic deployments, including the AGAP/GAMSEIS array of 24 broadband seismographs over the Gamburtsev Subglacial Mountains (GSM) in East Antarctica and the POLENET/ANET deployment of 33 seismographs across much of West Antarctica, reveal the detailed crust and upper mantle structure of Antarctica for the first time. The seismographs operate year-around even in the coldest parts of Antarctica, due to novel insulated boxes, power systems, and modified instrumentation developed in collaboration with the IRIS PASSCAL Instrument Center. We analyze the data using several different techniques to develop high-resolution models of Antarctic seismic structure. We use Rayleigh wave phase velocities at periods of 20-180 s determined using a modified two-plane wave decomposition of teleseismic Rayleigh waves to invert for the three dimensional shear velocity structure. In addition, Rayleigh wave group and phase velocities obtained by ambient seismic noise correlation methods provide constraints at shorter periods and shallower depths. Receiver functions provide precise estimates of crustal structure beneath the stations, and P and S wave tomography provides models of upper mantle structure down to ~ 500 km depth along transects of greater seismic station density. The new seismic results show that the high elevations of the GSM are supported by thick crust (~ 55 km), and are underlain by thick Precambrian continental lithosphere that initially formed during Archean to mid-Proterozoic times. The absence of lithospheric thermal anomalies suggests that the mountains were formed by a compressional orogeny during the Paleozoic, thus providing a locus for ice sheet nucleation throughout a long period of geological time. Within West Antarctica, the crust and lithosphere are extremely thin near the Transantarctic Mountain Front and topographic lows such as the Bentley Trench and Byrd Basin, which represent currently inactive Cenozoic rift systems. Slow seismic

University Administration on a Political Model.

Science.gov (United States)

Walker, Donald E.

1979-01-01

It is suggested that recognizing the university as a political community may lead to better management and organization. The patriarchal role, the president as hero, dispersed power, how the university really functions, and a political model are described. (MLW)

77 FR 23807 - Additional Designations, Foreign Narcotics Kingpin Designation Act

Science.gov (United States)

2012-04-20

.... DE C.V.; c/o TECNOLOGIA OPTIMA CORPORATIVA S. DE R.L. DE C.V.; Paseo de los Heroes 108-104, Tijuana...; Folio Mercantil No. 13537 (Mexico); R.F.C. SFO011205UJ8 (Mexico) [SDNTK] TECNOLOGIA OPTIMA CORPORATIVA S...

Hugo Cowes, devoto esencialmente de Borges, que engendró a Pierre Menard, que engendró a Don Quijote

Directory of Open Access Journals (Sweden)

Miriam Neri Chiani

2005-11-01

Full Text Available The borgesian view runs in the works of Hugo Cowes on El Quijote two paralel roads: the itinerary of the hero as an epistemlogical experience and the raising circumnstances in that course as referentiality difficulties of the language.

Carl Linnaeus: pictures and propaganda.

Science.gov (United States)

Fara, Patricia

2003-03-01

How do scientists become famous? Carl Linnaeus was an expert at self-promotion who used portraits to gain patronage and consolidate his reputation. His sexualized classification system was hugely controversial, yet his successors celebrated him as a great hero of botany.

Pop / Erik Morna

Index Scriptorium Estoniae

Morna, Erik, 1969-

2008-01-01

Heliplaatidest: Lightspeed Champion "Falling Off the Lavender Bridge", Godsmack - "Good Times, Bad Times...Ten Years of Godsmack", Burnt Friedmann "First Night Forever", Steve Jansen "Slope", Vanessa Carlton "Heroes & Thieves", House of Games "Rise and Shine", Op:l Bastards "The Job"

Ressenyes

OpenAIRE

Prats Ferret, Maria

2013-01-01

Obra ressenyada: Eduardo BRITO-HENRIQUES, Distância e connexão : Insularidade, relações culturais e sentido de lugar no espaço da Macaronésia. Angra do Heroísmo : Instituto Açoriano de Cultura, 2009.

Plaadid / Priit Pruul

Index Scriptorium Estoniae

Pruul, Priit

2006-01-01

Uutest heliplaatidest Tutty Moreno ft Joyce "Magica", Five O'Clock Heroes "Bend to the breaks", The Game "Doctor's Advocate", Allan Vainola "Unenäopüüdja", Snax "Love pollution", Zhuut "Vagiina ja 49 kuuli", Lucie Silvas "The Same Side"

Ataxia-Telangiectasia Children's Project

Science.gov (United States)

... T CURE TEAM Walt Disney World® Marathon Weekend Star Wars™ Half Marathon - The Dark Side Pittsburgh Marathon Weekend Hess Lake Run Half Marathon Super Heroes Half Marathon Run Any Race What's New Exploring the Epidemiology of A-T in ...

Team Leadership in Practice.

Science.gov (United States)

Neck, Christopher; Manz, Charles C.; Manz, Karen P.

1998-01-01

Although educational teams can help reduce teachers' feelings of isolation and enhance instruction, ineffective leadership often dooms their efforts. This article describes four team leadership approaches: "strong-man,""transactor,""visionary hero," and "SuperLeadership." The last is superior, since it…

Диалог как средство раскрытия характера (по произведениям Абульгасана)

OpenAIRE

Гусейнова, Ш.

2012-01-01

As with many masters of artistic expression, Abulgasan Alekperzade in their stories sought by various means of expression of artistic styles, including dialogue, portray real human feelings and characters of the people, their heroes. Especially it turned neatly in his dialogues

Understanding personal narratives: an approach to practice.

Science.gov (United States)

Sander, Ruth

2005-04-01

Nurses can collaborate with people to express their stories or life journey portraits through arts such as dance, painting, photography, weaving or story-telling, and to cast themselves as heroes in their own stories rather than victims of life's circumstances.

The Spy in Early America: The Emergence of a Genre

National Research Council Canada - National Science Library

Weir, Alison

1998-01-01

... after the Revolution through the antebellum period. By examining the paradoxical figure of the heroic spy, the dissertation explores how the spy story emerged as the adventure tale of the Revolution, the spy became a potential hero, and how the...

Research Article Special Issue

African Journals Online (AJOL)

2018-02-01

Feb 1, 2018 ... karaoke box in which user sings along with the music, players in this game ... because, the content of local songs is really good for mentality education. ... Karaoke games, such as Singstar and Guitar Hero Vocal, challenge ...