WorldWideScience

Sample records for hepatic dna fragmentation

  1. DNA fragmentation in spermatozoa

    Rex, A S; Aagaard, J.; Fedder, J

    2017-01-01

    Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

  2. Complementary DNA-amplified fragment length polymorphism ...

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  3. Fragment Length of Circulating Tumor DNA.

    Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay

    2016-07-01

    Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.

  4. Supramolecular gel electrophoresis of large DNA fragments.

    Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi

    2017-10-01

    Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Fragmentation in DNA double-strand breaks

    Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

    2005-01-01

    DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

  6. Menadione-induced DNA fragmentation without 8-hydroxy-2'-deoxyguanosine formation in isolated rat hepatocytes

    Fischer-Nielsen, Anne; Corcoran, George B.; Poulsen, Henrik E.

    1995-01-01

    Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade......Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade...

  7. High efficiency hydrodynamic DNA fragmentation in a bubbling system

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling

    2017-01-01

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling

  8. Perinatal hepatitis B virus detection by hepatitis B virus-DNA analysis.

    De Virgiliis, S; Frau, F; Sanna, G; Turco, M P; Figus, A L; Cornacchia, G; Cao, A

    1985-01-01

    Maternal transmission of hepatitis B virus infection in relation to the hepatitis B e antigen/antibody system and serum hepatitis B virus-DNA were evaluated. Results indicate that hepatitis B virus-DNA analysis can identify hepatitis B serum antigen positive mothers who may transmit infection to their offspring.

  9. Endogenous hepatitis C virus homolog fragments in European rabbit and hare genomes replicate in cell culture.

    Eliane Silva

    Full Text Available Endogenous retroviruses, non-retroviral RNA viruses and DNA viruses have been found in the mammalian genomes. The origin of Hepatitis C virus (HCV, the major cause of chronic hepatitis, liver cirrhosis, and hepatocellular carcinoma in humans, remains unclear since its discovery. Here we show that fragments homologous to HCV structural and non-structural (NS proteins present in the European rabbit (Oryctolagus cuniculus and hare (Lepus europaeus genomes replicate in bovine cell cultures. The HCV genomic homolog fragments were demonstrated by RT-PCR, PCR, mass spectrometry, and replication in bovine cell cultures by immunofluorescence assay (IFA and immunogold electron microscopy (IEM using specific MAbs for HCV NS3, NS4A, and NS5 proteins. These findings may lead to novel research approaches on the HCV origin, genesis, evolution and diversity.

  10. Sperm DNA fragmentation affects epigenetic feature in human male pronucleus.

    Rajabi, H; Mohseni-Kouchesfehani, H; Eslami-Arshaghi, T; Salehi, M

    2018-02-01

    To evaluate whether the sperm DNA fragmentation affects male pronucleus epigenetic factors, semen analysis was performed and DNA fragmentation was assessed by the method of sperm chromatin structure assay (SCSA). Human-mouse interspecies fertilisation was used to create human male pronucleus. Male pronucleus DNA methylation and H4K12 acetylation were evaluated by immunostaining. Results showed a significant positive correlation between the level of sperm DNA fragmentation and DNA methylation in male pronuclei. In other words, an increase in DNA damage caused an upsurge in DNA methylation. In the case of H4K12 acetylation, no correlation was detected between DNA damage and the level of histone acetylation in the normal group, but results for the group in which male pronuclei were derived from sperm cells with DNA fragmentation, increased DNA damage led to a decreased acetylation level. Sperm DNA fragmentation interferes with the active demethylation process and disrupts the insertion of histones into the male chromatin in the male pronucleus, following fertilisation. © 2017 Blackwell Verlag GmbH.

  11. A mechanism of gene amplification driven by small DNA fragments.

    Kuntal Mukherjee

    Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

  12. Fragmentation of DNA affects the accuracy of the DNA quantitation by the commonly used methods

    Sedlackova Tatiana

    2013-02-01

    Full Text Available Abstract Background Specific applications and modern technologies, like non-invasive prenatal testing, non-invasive cancer diagnostic and next generation sequencing, are currently in the focus of researchers worldwide. These have common characteristics in use of highly fragmented DNA molecules for analysis. Hence, for the performance of molecular methods, DNA concentration is a crucial parameter; we compared the influence of different levels of DNA fragmentation on the accuracy of DNA concentration measurements. Results In our comparison, the performance of the currently most commonly used methods for DNA concentration measurement (spectrophotometric, fluorometric and qPCR based were tested on artificially fragmented DNA samples. In our comparison, unfragmented and three specifically fragmented DNA samples were used. According to our results, the level of fragmentation did not influence the accuracy of spectrophotometric measurements of DNA concentration, while other methods, fluorometric as well as qPCR-based, were significantly influenced and a decrease in measured concentration was observed with more intensive DNA fragmentation. Conclusions Our study has confirmed that the level of fragmentation of DNA has significant impact on accuracy of DNA concentration measurement with two of three mostly used methods (PicoGreen and qPCR. Only spectrophotometric measurement was not influenced by the level of fragmentation, but sensitivity of this method was lowest among the three tested. Therefore if it is possible the DNA quantification should be performed with use of equally fragmented control DNA.

  13. Amplification of deoxyribonucleic acid (DNA) fragment using two ...

    user

    2011-04-11

    Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

  14. Linkage map of the fragments of herpesvirus papio DNA.

    Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

    1981-01-01

    Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

  15. Bacterial natural transformation by highly fragmented and damaged DNA

    Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic Antoine Alexandre

    2013-01-01

    for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake......DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often DNA is recognized as nutrient source...... of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations...

  16. (PCR) for direct cloning of blunt-end DNA fragments

    Administrator

    2011-09-19

    Sep 19, 2011 ... Key words: Blunt-end cloning, phosphorylated DNA fragment, dephosphorylated blunt-end vector. INTRODUCTION ... With this method, a lot of steps are saved, which includes restriction .... pBSK-blunt (data not shown).

  17. Sperm DNA fragmentation, recurrent implantation failure and recurrent miscarriage

    Carol Coughlan

    2015-01-01

    Full Text Available Evidence is increasing that the integrity of sperm DNA may also be related to implantation failure and recurrent miscarriage (RM. To investigate this, the sperm DNA fragmentation in partners of 35 women with recurrent implantation failure (RIF following in vitro fertilization, 16 women diagnosed with RM and seven recent fathers (control were examined. Sperm were examined pre- and post-density centrifugation by the sperm chromatin dispersion (SCD test and the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL assay. There were no significant differences in the age of either partner or sperm concentration, motility or morphology between three groups. Moreover, there were no obvious differences in sperm DNA fragmentation measured by either test. However, whilst on average sperm DNA fragmentation in all groups was statistically lower in prepared sperm when measured by the SCD test, this was not seen with the results from the TUNEL assay. These results do not support the hypothesis that sperm DNA fragmentation is an important cause of RIF or RM, or that sperm DNA integrity testing has value in such patients. It also highlights significant differences between test methodologies and sperm preparation methods in interpreting the data from sperm DNA fragmentation tests.

  18. Electronic transport in methylated fragments of DNA

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; Moura, F. A. B. F. de; Lyra, M. L.

    2015-01-01

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics

  19. Electronic transport in methylated fragments of DNA

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L., E-mail: umbertofulco@gmail.com; Albuquerque, E. L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Freire, V. N. [Departamento de Física, Universidade Federal do Ceará, 60455-760 Fortaleza, CE (Brazil); Caetano, E. W. S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531 Fortaleza, CE (Brazil); Moura, F. A. B. F. de; Lyra, M. L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2015-11-16

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  20. Agarose gel electrophoresis for the separation of DNA fragments.

    Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

    2012-04-20

    Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate

  1. High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

    2017-01-18

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

  2. DNA fragments assembly based on nicking enzyme system.

    Rui-Yan Wang

    Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.

  3. Real-time Tracking of DNA Fragment Separation by Smartphone.

    Tao, Chunxian; Yang, Bo; Li, Zhenqing; Zhang, Dawei; Yamaguchi, Yoshinori

    2017-06-01

    Slab gel electrophoresis (SGE) is the most common method for the separation of DNA fragments; thus, it is broadly applied to the field of biology and others. However, the traditional SGE protocol is quite tedious, and the experiment takes a long time. Moreover, the chemical consumption in SGE experiments is very high. This work proposes a simple method for the separation of DNA fragments based on an SGE chip. The chip is made by an engraving machine. Two plastic sheets are used for the excitation and emission wavelengths of the optical signal. The fluorescence signal of the DNA bands is collected by smartphone. To validate this method, 50, 100, and 1,000 bp DNA ladders were separated. The results demonstrate that a DNA ladder smaller than 5,000 bp can be resolved within 12 min and with high resolution when using this method, indicating that it is an ideal substitute for the traditional SGE method.

  4. Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.

    Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh

    2016-04-01

    Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.

  5. Hepatitis B virus DNA integration and transactivation of cellular genes

    Vijay Kumar

    2007-02-01

    Full Text Available

    Chronic hepatitis B virus (HBV infection is etiologically related to human hepatocellular carcinoma (HCC. Most HCCs contain integrated HBV DNA in hepatocyte, suggesting that the integration may be involved in carcinogenesis. Available data on the integrants from human hepatocellular carcinomas seem to represent primary integrants as well as the products of secondary rearrangements. By means of structural analyses of the possible primary integrants, it has been observed that the replication intermediates of the viral genome are the preferred substrates for integration. The integrated HBV DNA and the target cellular DNA are invariably associated with deletions, possibly reflecting the substrate for, and the mechanism of, the integration reaction. The host DNA sequences as well as the target site of integration in chromosomes are selected randomly suggesting that HBV DNA integration should bring about random mutagenic effects. Analysis of the samples recovered from hepatocellular carcinomas show that the integrated HBV DNA can mediate secondary rearrangements of chromosomes, such as translocations, inversions, deletions and (possibly amplifications. The integration of HBV DNA into the host genome occurs at early steps of clonal tumor expansion. The integration has been shown in a number of cases to affect a variety of cancer-related genes and to exert insertional mutagenesis. However, in contrast to the woodchuck model, in which specific HBV-DNA integration is detectable in most cases, insertional activation or inactivation of cellular genes appears to be a rare event in man. The discovery of transactivating functions exerted by HBx and truncated HBs(urface proteins supports the notion that these could be relevant to hepatocarcinogenesis as these transactivator sequences have been found in a large number of HCC tumors or hepatoma-derived cell lines. The HBx

  6. DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

    García-Vilchis, David; Aranda-Anzaldo, Armando

    2017-12-01

    Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  7. Hepatitis B virus DNA polymerase gene polymorphism based ...

    Hepatitis B virus DNA polymerase gene polymorphism based prediction of genotypes in chronic HBV patients from Western India. Yashwant G. Chavan, Sharad R. Pawar, Minal Wani, Amol D. Raut, Rabindra N. Misra ...

  8. Fragmentation of sperm DNA using the TUNEL method.

    Chenlo, P H; Curi, S M; Pugliese, M N; Ariagno, J I; Sardi-Segovia, M; Furlan, M J; Repetto, H E; Zeitler, E; Cohen, M; Mendeluk, G R

    2014-11-01

    To establish the validity of the TUNEL assay in determining sperm DNA fragmentation, the relationship between the degree of fragmentation and the seminal parameters and the sample needed to conduct the test. We used semen samples from healthy fertile men (n=33), patients who consulted for infertility with a prescription for the TUNEL assay (n=77) and patients with intracytoplasmic sperm injection failure (n=20), analyzed according to the 2010 WHO. The TUNEL/propidium iodide test was performed by flow cytometry, on baseline and post-swim-up samples. The cutoff value for the TUNEL assay (ROC curves) was 26%, with a sensitivity and specificity of 85% and 89%, respectively. The pre-swim-up and post-swim-up medians of the results from the TUNEL assay showed no significant differences (17.0% vs. 12.9%, respectively). However, 39.1% of the samples showed a difference greater than 15 in absolute value between the results of the baseline and post-swim-up TUNEL assays. The linear correlation study of the morphology, mobility and vitality using the post-swim-up TUNEL assay showed a greater correlation than preselection, with significant results (r: -0.394, P<.0001; r: -0.461, P<.0001; r: -0.526, P<.0001). The TUNEL assay is a valid test for clinical use. DNA fragmentation is a factor independent from traditional semen tests. We found a greater susceptibility to damage generated in the laboratory procedures in the samples with lower quality. The sample of choice for evaluating DNA fragmentation will depend on whether the clinician is treating a natural or assisted fertilization. Copyright © 2014 AEU. Published by Elsevier Espana. All rights reserved.

  9. DNA fragmentation and cytotoxicity by recombinant human tumor necrosis factor in L929 fibroblast cells

    Kosaka, T.; Kuwabara, M.; Koide, F.

    1992-01-01

    Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking

  10. Nondetectability of restriction fragments and independence of DNA fragment sizes within and between loci in RFLP typing of DNA

    Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))

    1994-08-01

    The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.

  11. Integration of hepatitis B virus DNA in chromosome-specific satellite sequences

    Shaul, Y.; Garcia, P.D.; Schonberg, S.; Rutter, W.J.

    1986-01-01

    The authors previously reported the cloning and detailed analysis of the integrated hepatitis B virus sequences in a human hepatoma cell line. They report here the integration of at least one of hepatitis B virus at human satellite DNA sequences. The majority of the cellular sequences identified by this satellite were organized as a multimeric composition of a 0.6-kilobase EcoRI fragment. This clone hybridized in situ almost exclusively to the centromeric heterochromatin of chromosomes 1 and 16 and to a lower extent to chromosome 2 and to the heterochromatic region of the Y chromosome. The immediate flanking host sequence appeared as a hierarchy of repeating units which were almost identical to a previously reported human satellite III DNA sequence

  12. Effect of superoxide dismutase supplementation on sperm DNA fragmentation

    Luciano Negri

    2017-10-01

    Full Text Available Background: antioxidants supplementation improves sperm quality, but few trials have analyzed the effects on sperm DNA fragmentation (SDF. This study compares the effectiveness of SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol in reducing SDF with other antioxidants without SOD, hydroxytyrosol, and carnosol. Materials and methods: men with high SDF at baseline were selected in our clinical database. The patients taken into account had a 2-month control. SDF was measured by Sperm Chromatin Dispersion test (SCD. Untreated men were used as a control group. The remaining subjects received some oral antioxidant supplements (12 different combinations of both hydrophilic and lipophilic antioxidants, with some of them receiving nutritional support with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Results: 118 men were selected for a retrospective study. Mean age 39.3 ± 5.4 years. Fifteen had no treatment, 55 were treated with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol, and 48 took some antioxidant supplements for 2 months. Clinically, variations of at least 10% in baseline values of classic semen parameters and sperm DNA fragmentation were taken into consideration. Classic seminal parameters did not vary significantly in the three groups, with the exception of viability (p = 0.001. We assessed which of the active substances (no. 19 in different formulations were associated with variations in SDF. In the multivariable analysis of the 7 active substances that passed the univariable analysis, only the SOD molecule appeared to be linked to an improvement in SDF (< 0.0001. In detail, only one patient in the control group showed a spontaneous improvement in SDF (6%, compared to 16/48 (33% of those taking various oral antioxidant supplements, and 31/55 (56% of those taking a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Conclusions: SOD

  13. Accumulation of linear mitochondrial DNA fragments in the nucleus shortens the chronological life span of yeast.

    Cheng, Xin; Ivessa, Andreas S

    2012-10-01

    Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.

  14. Subacute Low Dose Nerve Agent Exposure Causes DNA Fragmentation in Guinea Pig Leukocytes

    2005-10-01

    1 SUBACUTE LOW DOSE NERVE AGENT EXPOSURE CAUSES DNA FRAGMENTATION IN GUINEA PIG LEUKOCYTES. Jitendra R. Dave1, John R. Moffett1, Sally M...DNA fragmentation in blood leukocytes from guinea pigs by ‘Comet’ assay after exposure to soman at doses ranging from 0.1LD50 to 0.4 LD50, once per...computer. Data obtained for exposure to soman demonstrated significant increases in DNA fragmentation in circulating leukocytes in CWNA treated guinea pigs as

  15. Detection of Hepatitis B virus DNA and Hepatitis δ virus RNA

    Smedile, A.; Chiaberge, E.; Brunetto, M.R.; Negro, F.; Baldi, M.; Lavarini, C.; Maran, E.

    1987-01-01

    The recent availability of DNA probes of the Hepatitis B Virus DNA (HBV-DNA) and of Hepatitis Delta Virus RNA (HDV-RNA) allows the application of nucleic acid hybridization techniques to solve a variety of clinical problems. DNA probes of HBV-DNA and HDV-RNA are labeled by nick translation using 32 P or biotinylated nucleotides and hybridized to filters containing test nucleic acids. Complementary sequences are identified and the degree of blackening of the film at autoradiography or the enzymatic staining of the filter is proportional to the amount of viral nucleic acid hybridized to the probe and present in the sample. These procedures allow rapid examination of multiple specimens and are sensitive and reproducible. Viral nucleic acids can be measured quantitatively and their quantity correlates with the infectivity of sera titered in experimentally infected animals

  16. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    Jackson, Christopher B.; Gallati, Sabina; Schaller, André

    2012-01-01

    Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two

  17. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

  18. Study of hepatitis B virus gene mutations with enzymatic colorimetry-based DNA microarray.

    Mao, Hailei; Wang, Huimin; Zhang, Donglei; Mao, Hongju; Zhao, Jianlong; Shi, Jian; Cui, Zhichu

    2006-01-01

    To establish a modified microarray method for detecting HBV gene mutations in the clinic. Site-specific oligonucleotide probes were immobilized to microarray slides and hybridized to biotin-labeled HBV gene fragments amplified from two-step PCR. Hybridized targets were transferred to nitrocellulose membranes, followed by intensity measurement using BCIP/NBT colorimetry. HBV genes from 99 Hepatitis B patients and 40 healthy blood donors were analyzed. Mutation frequencies of HBV pre-core/core and basic core promoter (BCP) regions were found to be significantly higher in the patient group (42%, 40% versus 2.5%, 5%, P colorimetry method exhibited the same level of sensitivity and reproducibility. An enzymatic colorimetry-based DNA microarray assay was successfully established to monitor HBV mutations. Pre-core/core and BCP mutations of HBV genes could be major causes of HBV infection in HBeAg-negative patients and could also be relevant to chronicity and aggravation of hepatitis B.

  19. Clusters of DNA induced by ionizing radiation: formation of short DNA fragments. I. Theoretical modeling

    Holley, W. R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the

  20. [Molecular dynamics of immune complex of photoadduct-containing DNA with Fab-Anti-DNA antibody fragment].

    Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I

    2016-01-01

    Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.

  1. Molecular studies of fibroblasts transfected with hepatitis B virus DNA

    Chen, M.L.; Hood, A.; Thung, S.N.; Gerber, M.A.

    1987-01-01

    Two subclones (D7 and F8) derived from an NIH 3T3 mouse fibroblast cell line after transfection with hepatitis B virus (HBV) genomes, secreted significantly different amounts of HBsAg and HBeAg. DNA extracted from the subclones revealed only integrated and no extrachromosomal HBV DNA sequences as determined by the Southern blot technique with a /sup 32/P-labeled full length HBV DNA probe. The amount and integration sites of HBV sequences were significantly different in the two subclones. HBV DNA sequences coding for HBsAg and HBcAg were detected by alkaline phosphatase-conjugated, single-stranded synthetic gene-specific oligonucleotide probes revealing a larger number of copies in D7 DNA than in F8 DNA. Using a biotinylated probe for in situ hybridization, HBV DNA was found in the nuclei of all D7 cells with predominant localization to a single chromsome, but only in 10-20% of F8 cells. These observations demonstrate different integration patterns of HBV and DNA in two subclones derived from a transfected cell line and suggest that the amount of integrated HBV DNA is proportional to the amount of HBV antigens produced

  2. General method of preparation of uniformly 13C, 15N-labeled DNA fragments for NMR analysis of DNA structures

    Rene, Brigitte; Masliah, Gregoire; Zargarian, Loussine; Mauffret, Olivier; Fermandjian, Serge

    2006-01-01

    Summary 13 C, 15 N labeling of biomolecules allows easier assignments of NMR resonances and provides a larger number of NMR parameters, which greatly improves the quality of DNA structures. However, there is no general DNA-labeling procedure, like those employed for proteins and RNAs. Here, we describe a general and widely applicable approach designed for preparation of isotopically labeled DNA fragments that can be used for NMR studies. The procedure is based on the PCR amplification of oligonucleotides in the presence of labeled deoxynucleotides triphosphates. It allows great flexibility thanks to insertion of a short DNA sequence (linker) between two repeats of DNA sequence to study. Size and sequence of the linker are designed as to create restriction sites at the junctions with DNA of interest. DNA duplex with desired sequence and size is released upon enzymatic digestion of the PCR product. The suitability of the procedure is validated through the preparation of two biological relevant DNA fragments

  3. Rapid assessment of the effect of ciprofloxacin on chromosomal DNA from Escherichia coli using an in situ DNA fragmentation assay

    Gosalvez Jaime

    2009-04-01

    Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.

  4. Quantification of DNA fragmentation in processed foods using real-time PCR.

    Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

    2017-07-01

    DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA

    Yakura, Kimitaka; Tanifuji, Shigeyuki.

    1983-01-01

    EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)

  6. Determination of size distribution of small DNA fragments by polyacrylamide gel electrophoresis

    Lau How Mooi

    1998-01-01

    Size distribution determination of DNA fragments can be normally determined by the agarose gel electrophoresis, including the normal DNA banding pattern analysis. However this method is only good for large DNA, such as the DNA of the size of kilo base pairs to mega base pairs range. DNA of size less than kilo base pairs is difficult to be quantified by the agarose gel method. Polyacrylamide gel electrophoresis however can be used to measure the quantity of DNA fragments of size less than kilo base pairs in length, down to less than ten base pairs. This method is good for determining the quantity of the smaller size DNA, single stranded polymers or even some proteins, if the known standards are available. In this report detail description of the method of preparing the polyacrylamide gel, and the experimental set up is discussed. Possible uses of this method, and the comparison with the standard sizes of DNA is also shown. This method is used to determine the distribution of the amount of the fragmented DNA after the Calf-thymus DNA has been exposed to various types of radiation and of different doses. The standards were used to determine the sizes of the fragmented Calf-thymus DNA. The higher the dose the higher is the amount of the smaller size DNA measured

  7. Mitochondrial DNA content in embryo culture medium is significantly associated with human embryo fragmentation.

    Stigliani, S; Anserini, P; Venturini, P L; Scaruffi, P

    2013-10-01

    Is the amount of cell-free DNA released by human embryos into culture medium correlated with embryo morphological features? The mitochondrial DNA (mtDNA) content of culture medium is significantly associated with the fragmentation rate on Days 2 and 3 of embryo development, whether the oocyte came from women ≤ 35 or >35 years old. Cellular fragmentation is often utilized as one of the morphological parameters for embryo quality assessment. The amount of cellular fragments is considered to be an important morphological parameter for embryo implantation potential. It has been hypothesized that fragments are apoptotic bodies or anuclear cytoplasmatic pieces of blastomeres, although no definitive conclusion has been drawn about their pathogenesis. Human fertilized oocytes were individually cultured from Day 1 to Days 2 and 3. A total of 800 samples (166 spent media from Day 2 and 634 from Day 3) were enrolled into the present study. Double-stranded DNA (dsDNA) was quantified in 800 spent embryo culture media by Pico Green dye fluorescence assay. After DNA purification, genomic DNA (gDNA) and mtDNA were profiled by specific quantitative PCR. Statistical analyses defined correlations among DNA contents, embryo morphology and maternal age. Different independent tests confirmed the presence of DNA into embryo culture medium and, for the first time, we demonstrate that both gDNA and mtDNA are detectable in the secretome. The amount of DNA is larger in embryos with bad quality cleavage compared with high-grade embryos, suggesting that the DNA profile of culture medium is an objective marker for embryo quality assessment. In particular, DNA profiles are significantly associated with fragmentation feature (total dsDNA: P = 0.0010; mtDNA; P = 0.0247) and advanced maternal age. It is necessary to establish whether DNA profiling of spent embryo culture medium is a robust onsite test that can improve the prediction of blastulation, implantation and/or pregnancy rate. The

  8. Menadione-induced DNA fragmentation without 8-oxo-2'-deoxyguanosine formation in isolated rat hepatocytes

    Fischer-Nielsen, A; Corcoran, G B; Poulsen, H E

    1995-01-01

    Menadione (2-methyl-1,4-naphthoquinone) induces oxidative stress in cells causing perturbations in the cytoplasm as well as nicking of DNA. The mechanisms by which DNA damage occurs are still unclear, but a widely discussed issue is whether menadione-generated reactive oxygen species (ROS) directly...... damage DNA. In the present study, we measured the effect of menadione on formation of 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxodG), an index of oxidative DNA base modifications, and on DNA fragmentation. Isolated hepatocytes from phenobarbital-pretreated rats were exposed to menadione, 25-400 micro......M, for 15, 90 or 180 min with or without prior depletion of reduced glutathione (GSH) by diethyl maleate. Menadione caused profound GSH depletion and internucleosomal DNA fragmentation, which was demonstrated by a prominent fragmentation ladder on agarose gel electrophoresis. We found no oxidative...

  9. Clusters of DNA damage induced by ionizing radiation: Formation of short DNA fragments. I. Theoretical modeling

    Holley, W.R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber composed of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and δ rays due to knock-on collisions involving energy transfers > 100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of circ OH, circ H, e aq , etc.; circ OH attack on sugar molecules leading to strand breaks; circ OH attack on bases; direct ionization of the sugar molecules leading to strand breaks; direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 hp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the chromatin fibers in mammalian DNA. 27 refs., 7 figs

  10. Crystallization of DNA fragments from water-salt solutions, containing 2-methylpentane-2,3-diol.

    Osica, V D; Sukharevsky, B Y; Vasilchenko, V N; Verkin, B I; Polyvtsev, O F

    1976-09-01

    Fragments of calf thymus DNA have been crystallized by precipitation from water-salt solutions, containing 2-methylpentane-2,3-diol (MPD). DNA crystals usually take the form either of spherulites up to 100 mu in diameter or of needles with the length up to 50 mu. No irreversible denaturation of DNA occurs during the crystallization process. X-ray diffraction from dense slurries of DNA crystals yields crystalline powder patterns.

  11. No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus

    Kaspersen, Maja Døvling; Bungum, Mona; Fedder, Jens

    2013-01-01

    It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR......-based hybridization array that identifies all HHVs and 35 of the most common HPVs. Sperm DNA integrity was determined by the sperm chromatin structure assay. HPVs or HHVs, or both, were found in 57% of semen samples; however, sperm DNA fragmentation index was not increased in semen containing these viruses....

  12. Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

    Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

    2010-01-01

    Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

  13. Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.

    De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C

    2015-03-01

    Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.

  14. SPERM MORPHOLOGICAL ABNORMALITIES AS INDICATORS OF DNA FRAGMENTATION AND FERTILIZATION IN ASSISTED REPRODUCTION

    Barbara Dariš

    2018-02-01

    Full Text Available Background. To determine the relationship between sperm morphological abnormalities, DNA fragmentation and fertilization rate in IVF and ICSI. Methods. Sperm samples from 10 IVF and 20 ICSI cycles were analyzed. Morphology was assessed according to strict criteria, and DNA fragmentation was measured by terminal deoxynucleotidyl transferase (TdT-mediated fluorescein-dUTP nick end labelling (TUNEL using a flow cytometry. Results. There was a significant difference in the amount of morphological abnormalities between sperm samples with low (< 20 % and high (≥ 20 % degree of DNA fragmentation. The percentages of amorphous heads (10 vs. 4 % and overall head abnormalities (42 vs. 30 % were significantly higher in sperm samples with elevated degree of DNA fragmentation. No correlation was found between sperm DNA fragmentation and fertilization rate after IVF and ICSI. When the predominant morphological abnormality in sperm samples was determined, a negative correlation was found between the percentage of spermatozoa with elongated heads and fertilization rate in ICSI (r = –0.45, P < 0.05. The fertilization rate after IVF was lower in the case of acrosomal abnormalities (35.3 %, compared to the cases of other predominant morphological abnormalities. Conclusions. Head abnormalities, especially amorphous heads, are related to elevated degree of DNA fragmentation. Predominant abnormal form in sperm samples, such as elongated heads and acrosomal abnormalities, may affect fertilization in ART.

  15. Lower sperm DNA fragmentation after r-FSH administration in functional hypogonadotropic hypogonadism.

    Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana

    2013-04-01

    An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .

  16. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)

    2000-06-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.

  17. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.

    2000-01-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America

  18. Antiviral strategies to eliminate hepatitis B virus covalently closed circular DNA (cccDNA).

    Revill, Peter; Locarnini, Stephen

    2016-10-01

    It has been over 50 years since the discovery of hepatitis B virus (HBV), yet 240 million people worldwide live with chronic HBV, resulting in up to 800000 deaths per year. A cure is yet to be achieved, due largely to a viral nuclear reservoir of transcriptionally active covalently closed circular DNA (cccDNA). While current antiviral therapies are effective at reducing viral replication, they have no impact on the existing cccDNA reservoir. Identifying mechanisms to either eliminate (complete cure) or inactivate (functional cure) HBV cccDNA are a major focus of HBV research worldwide. This review discusses recent advances in efforts to eliminate and/or regulate cccDNA, as well as future directions that may be considered in efforts to cure chronic HBV. Crown Copyright © 2016. Published by Elsevier Ltd. All rights reserved.

  19. DNA Sequences of RAPD Fragments in the Egyptian cotton ...

    Random Amplified Polymorphic DNAs (RAPDs) is a DNA polymorphism assay based on the amplification of random DNA segments with single primers of arbitrary nucleotide sequence. Despite the fact that the RAPD technique has become a very powerful tool and has found use in numerous applications, yet, the nature of ...

  20. Luciferase assay to study the activity of a cloned promoter DNA fragment.

    Solberg, Nina; Krauss, Stefan

    2013-01-01

    Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

  1. AN IMAGE-ANALYSIS TECHNIQUE FOR DETECTION OF RADIATION-INDUCED DNA FRAGMENTATION AFTER CHEF ELECTROPHORESIS

    ROSEMANN, M; KANON, B; KONINGS, AWT; KAMPINGA, HH

    CHEF-electrophoresis was used as a technique to detect radiation-induced DNA breakage with special emphasis to biological relevant X-ray doses (0-10 Gy). Fluorescence detection of DNA-fragments using a sensitive image analysis system was directly compared with conventional scintillation counting of

  2. Natural transformation of bacteria by fragmented, damaged and ancient DNA

    Overballe-Petersen, Søren

    with fullgenome comparisons that the process has general relevance in extant bacteria. Our findings reveal that the large environmental reservoir of short and damaged DNA retains capacity for natural transformation, even after thousands of years. This describes for the first time a process by which cells can...... transfer playing an important role early in the evolution of life. The published article explains the chemical structure behind an observed degradation difference between the two purine-nucleotides guanosine and adenosine in ancient DNA. We also point at new uses for high-through-put DNA sequencing...

  3. In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

    Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

    2008-12-15

    The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

  4. Sperm DNA fragmentation in boars is delayed or abolished by using sperm extenders.

    Pérez-Llano, Begoña; Enciso, María; García-Casado, Pedro; Sala, Rubén; Gosálvez, Jaime

    2006-12-01

    The semen quality of seven young adult boars was assessed for percentages of sperm motility, normal acrosomes, abnormal sperm, cells positive to sHOST (short Hipoosmotic Swelling Test), HPNA cells (sHOST Positive with Normal Acrosome cells) and the percentage of sperm heads, which exhibited DNA fragmentation using the Sperm Chromatin Dispersion test (SCD). These parameters were analysed in sperm samples both undiluted and diluted using a commercial extender and stored at 15 degrees C for 21 days. Results showed that semen quality decreases faster in the undiluted semen samples from day 0 to day 7 compared to diluted semen samples that remained with a high quality up to day 11. The undiluted semen exhibited a low DNA fragmentation index (DFI) during the first days and then a significant increase from day 7 up to day 21. This increase in the DFI coincided with the lowest levels of the other semen quality parameters. On the contrary, the samples diluted in the commercial extender showed very low levels of DNA fragmentation in all boars during the preservation period. When the evolution of DNA fragmentation was analysed in the undiluted samples, differences were found among boars. These differences were not shown in the samples diluted in the extender where the basal DFI remained stable during the 21 days. The main conclusion of this study was that some sperm extenders delay or partially prevent sperm DNA fragmentation.

  5. A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food

    Jones, J.L.; Bulford, B.B.

    1990-07-01

    The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)

  6. Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

    Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

    2005-01-01

    AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

  7. Synthesis and NMR of {sup 15}N-labeled DNA fragments

    Jones, R.A. [Rutgers, The State Univ. of New Jersey, Piscataway, NJ (United States)

    1994-12-01

    DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

  8. Accurate phylogenetic classification of DNA fragments based onsequence composition

    McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis; Hugenholtz, Philip; Rigoutsos, Isidore

    2006-05-01

    Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequence characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.

  9. FragIdent – Automatic identification and characterisation of cDNA-fragments

    Goehler Heike

    2009-03-01

    Full Text Available Abstract Background Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Results Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. Conclusion We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  10. FragIdent--automatic identification and characterisation of cDNA-fragments.

    Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

    2009-03-02

    Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  11. Development of procedures for the identification of human papilloma virus DNA fragments in laser plume

    Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas

    1996-01-01

    For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.

  12. Nature of defects produced on thymine fragment by gamma irradiation of DNA

    Teoule, R.; Bonicel, A.

    1975-01-01

    A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions

  13. Circulating Elastin Fragments Are Not Affected by Hepatic, Renal and Hemodynamic Changes, But Reflect Survival in Cirrhosis with TIPS.

    Nielsen, M J; Lehmann, J; Leeming, D J; Schierwagen, R; Klein, S; Jansen, C; Strassburg, C P; Bendtsen, F; Møller, S; Sauerbruch, T; Karsdal, M A; Krag, A; Trebicka, J

    2015-11-01

    Progressive fibrosis increases hepatic resistance and causes portal hypertension with complications. During progressive fibrosis remodeling and deposition of collagens and elastin occur. Elastin remodeling is crucially involved in fibrosis progression in animal models and human data. This study investigated the association of circulating elastin with the clinical outcome in cirrhotic patients with severe portal hypertension receiving transjugular intrahepatic porto-systemic shunt (TIPS). We analyzed portal and hepatic venous samples of 110 cirrhotic patients obtained at TIPS insertion and 2 weeks later. The circulating levels of elastin fragments (ELM) were determined using specific monoclonal ELISA. The relationship of ELM with clinical short-time follow-up and long-term outcome was investigated. Circulating levels of ELM showed a gradient across the liver before TIPS with higher levels in the hepatic vein. Interestingly, the circulating ELM levels remained unchanged after TIPS. The circulating levels of ELM in portal and hepatic veins correlated with platelet counts and inversely with serum sodium. Hepatic venous levels of ELM were higher in CHILD C compared to CHILD A and B and were associated with the presence of ascites. Patients with high levels of ELM in the hepatic veins before TIPS showed poorer survival. In multivariate analysis ELM levels in the hepatic veins and MELD were independent predictors of mortality in these patients. This study demonstrated that circulating levels of ELM are not associated with hemodynamic changes, but might reflect fibrosis remodeling and predict survival in patients with severe portal hypertension receiving TIPS independently of MELD.

  14. Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.

    Warwicker, J; Ollis, D; Richards, F M; Steitz, T A

    1985-12-05

    The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.

  15. Ionization and fragmentation of DNA-RNA bases: a density functional theory study

    Sadr-Arani, Leila

    2014-01-01

    Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)

  16. Analysis of different DNA fragments of Corynebacterium glutamicum complementing dapE of Escherichia coli.

    Wehrmann, A; Eggeling, L; Sahm, H

    1994-12-01

    In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.

  17. Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

    Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

    1987-01-01

    DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

  18. [Cleavage of DNA fragments induced by UV nanosecond laser excitation at 193 nm].

    Vtiurina, N N; Grokhovskiĭ, S L; Filimonov, I V; Medvedkov, O I; Nechipurenko, D Iu; Vasil'ev, S A; Nechipurenko, Iu D

    2011-01-01

    The cleavage of dsDNA fragments in aqueous solution after irradiation with UV laser pulses at 193 nm has been studied. Samples were investigated using polyacrylamide gel electrophoresis. The intensity of damage of particular phosphodiester bond after hot alkali treatment was shown to depend on the base pair sequence. It was established that the probability of cleavage is twice higher for sites of DNA containing two or more successively running guanine residues. A possible mechanism of damage to the DNA molecule connected with the migration of holes along the helix is discussed.

  19. Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

    Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

    2014-11-01

    Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates

  20. Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments.

    Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

    2013-09-24

    Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.

  1. Prophagic DNA Fragments in Streptococcus agalactiae Strains and Association with Neonatal Meningitis

    van der Mee-Marquet, Nathalie; Domelier, Anne-Sophie; Mereghetti, Laurent; Lanotte, Philippe; Rosenau, Agnès; van Leeuwen, Willem; Quentin, Roland

    2006-01-01

    We identified—by randomly amplified polymorphic DNA (RAPD) analysis at the population level followed by DNA differential display, cloning, and sequencing—three prophage DNA fragments (F5, F7, and F10) in Streptococcus agalactiae that displayed significant sequence similarity to the DNA of S. agalactiae and Streptococcus pyogenes. The F5 sequence aligned with a prophagic gene encoding the large subunit of a terminase, F7 aligned with a phage-associated cell wall hydrolase and a phage-associated lysin, and F10 aligned with a transcriptional regulator (ArpU family) and a phage-associated endonuclease. We first determined the prevalence of F5, F7, and F10 by PCR in a collection of 109 strains isolated in the 1980s and divided into two populations: one with a high risk of causing meningitis (HR group) and the other with a lower risk of causing meningitis (LR group). These fragments were significantly more prevalent in the HR group than in the LR group (P S. agalactiae strains to invade the neonatal brain endothelium. We then determined the prevalence of F5, F7, and F10 by PCR in a collection of 40 strains recently isolated from neonatal meningitis cases for comparison with the cerebrospinal fluid (CSF) strains isolated in the 1980s. The prevalence of the three prophage DNA fragments was similar in these two populations isolated 15 years apart. We suggest that the prophage DNA fragments identified have remained stable in many CSF S. agalactiae strains, possibly due to their importance in virulence or fitness. PMID:16517893

  2. Oncogenic transformation of rat lung epithelioid cells by SV40 DNA and restriction enzyme fragments

    Daya-Grosjean, L.; Lasne, C.; Nardeux, P.; Chouroulinkov, I.; Monier, R.

    1979-01-01

    Rat epithelioid lung cells were transformed with various preparations of SV40 DNA using the Ca 2+ -precipitation technique. The amount of SV40 genetic information integrated into transformed clones was evaluated by DNA-DNA renaturation kinetics. The growth properties on plastic and in soft-agar were examined, as well as the ability to induce tumors in syngeneic newborn animals or in adult nude mice. One particular transformed line, which had received the HpaII/BamHIA (59 per cent) fragment, was found to contain about 3 integrated copies of this fragment per cell and no significant amount of the HpaII/BamHIB (41 per cent fragment). This line which grew to high saturatio densities and efficiently formed clones in low serum on plastic, produced tumors in both syngeneic rats and nude mice. Thus the HpaII/BamHIA fragment, which mainly includes early viral information, was sufficient to impart these properties to rat epithelioid lung cells. (author)

  3. [Fingerprints identification of Gynostemma pentaphyllum by RAPD and cloning and analysis of its specific DNA fragment].

    Jiang, Jun-fu; Li, Xiong-ying; Wu, Yao-sheng; Luo, Yu; Zhao, Rui-qiang; Lan, Xiu-wan

    2009-02-01

    To identify the resources of Gynostemma pentaphyllum and its spurious breed plant Cayratia japonica at level of DNA. Two random primers ( WGS001, WGS004) screened were applied to do random amplification with genomic DNA extracted from Gynostemma pentaphyllum and Cayratia japonica which were collected from different habitats. After amplificated with WGS004, one characteristic fragment about 500 bp which was common to all Gynostemma pentaphyllum samples studied but not to Cayratia japonica was cloned and sequenced. Then these sequences obtained were analyzed for identity and compared by Blastn program in GenBank. There were obvious different bands amplified by above two primers in their fingerprints of genomic DNA. On the basis of these different bands of DNA fingerprints, they could distinguish Gynostemma pentaphyllum and Cayratia japonica obviously. Sequence alignment of seven cloned bands showed that their identities ranged from 45.7% - 94.5%. There was no similar genome sequences searched in GenBank. This indicated that these seven DNA fragments had not been reported before and they should be new sequences. RAPD technique can be used for the accurate identification of Gynostemma pentaphyllum and its counterfeit goods Cayratia japonica. Besides, these specific DNA sequences for Gynostemmna pentaphyllum in this study are useful for the further research on identification of species and assisted selection breeding in Gynostemma pentaphyllum.

  4. Characterization of hepatic DNA damage induced in rats by the pyrrolizidine alkaloid monocrotaline

    Petry, T.W.; Bowden, G.T.; Huxtable, R.J.; Sipes, I.G.

    1984-04-01

    Hepatic DNA damage induced by the pyrrolizidine alkaloid monocrotaline was evaluated following i.p. administration to adult male Sprague-Dawley rats. Animals were treated with various doses ranging upward from 5 mg/kg, and hepatic nuclei were isolated 4 hr later. Hepatic nuclei were used as the DNA source in all experiments. DNA damage was characterized by the alkaline elution technique. A mixture of DNA-DNA interstrand cross-links and DNA-protein cross-links was induced. Following an injection of monocrotaline, 30 mg/kg i.p., DNA-DNA interstrand cross-linking reached a maximum within 12 hr or less and thereafter decreased over a protracted period of time. By 96 hr postadministration, the calculated cross-linking factor was no longer statistically different from zero. No evidence for the induction of DNA single-strand breaks was observed, although the presence of small numbers of DNA single-strand breaks could have been masked by the overwhelming predominance of DNA cross-links. These DNA cross-links may be related to the hepatocarcinogenic, hepatotoxic, and/or antimitotic effects of monocrotaline.

  5. Historic and current hepatitis B viral DNA and quantitative HBsAg level are not associated with cirrhosis in non-Asian women with chronic hepatitis B

    Harkisoen, S.; Arends, J. E.; van den Hoek, J. A. R.; Whelan, J.; van Erpecum, K. J.; Boland, G. J.; Hoepelman, A. I. M.

    2014-01-01

    Some studies done in Asian patients have shown that serum levels of hepatitis B virus (HBV) DNA predict the development of cirrhosis. However, it is unclear whether this also applies for non-Asian patients. This study investigated historic and current HBV DNA and quantitative hepatitis B surface

  6. A systematic review on sperm DNA fragmentation in male factor infertility: Laboratory assessment

    Manesh Kumar Panner Selvam

    2018-03-01

    Full Text Available Objective: To review sperm DNA fragmentation (SDF testing as an important sperm function test in addition to conventional semen analysis. High SDF is negatively associated with semen quality, the fertilisation process, embryo quality, and pregnancy outcome. Over recent decades, different SDF assays have been developed and reviewed extensively to assess their applicability and accuracy as advanced sperm function tests. Amongst them, the standardisation of the terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL assay with a bench top flow cytometer in clinical practice deserves special mention with a threshold value of 16.8% to differentiate infertile men with DNA damage from fertile men. Materials and methods: A systematic literature search was performed through the PubMed, Medline, and ScienceDirect databases using the keywords ‘sperm DNA fragmentation’ and ‘laboratory assessment’. Non-English articles were excluded and studies related to humans were only included. Results: Of the 618 identified, 87 studies (original research and reviews and in addition eight book chapters meeting the selection criteria were included in this review. In all, 366 articles were rejected in the preliminary screening and a further 165 articles related to non-human subjects were excluded. Conclusion: There are pros and cons to all the available SDF assays. TUNEL is a reliable technique with greater accuracy and as an additional diagnostic test in Andrology laboratories along with basic semen analysis can predict fertility outcome, and thus direct the choice of an assisted reproductive technology procedure for infertile couples. Also, the TUNEL assay can be used as a prognostic test and results are beneficial in deciding personalised treatment for infertile men. Keywords: Sperm DNA fragmentation (SDF, Terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL, DNA damage, Sperm DNA fragmentation (SDF assay

  7. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

    Focke, Frauke; Schuermann, David; Kuster, Niels; Schaer, Primo

    2010-01-01

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  8. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

    Focke, Frauke; Schuermann, David [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland); Kuster, Niels [IT' IS Foundation, Zeughausstrasse 43, CH-8004 Zurich (Switzerland); Schaer, Primo, E-mail: primo.schaer@unibas.ch [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland)

    2010-01-05

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  9. DNA Barcoding for Identification of "Candidatus Phytoplasmas" Using a Fragment of the Elongation Factor Tu Gene

    Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

    2012-01-01

    Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...

  10. Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing

    Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor

    2001-09-15

    We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.

  11. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Cheah, Yew-Hoong [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur (Malaysia); Meenakshii, Nallappan [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)

    2012-04-20

    Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  12. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    Tee, Thiam-Tsui; Cheah, Yew-Hoong; Meenakshii, Nallappan; Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie

    2012-01-01

    Highlights: ► We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. ► Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. ► Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. ► DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. ► DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X L expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  13. Modulation of immune response to rDNA hepatitis B vaccination by psychological stress

    L. Jabaaij (Lea); J. van Hattum (Jan); A.J.J.M. Vingerhoets (Ad); F.G. Oostveen (Frank); H.J. Duivenvoorden (Hugo); R.E. Ballieux (Rudy)

    1996-01-01

    textabstractIn a previous study it was shown that antibody formation after vaccination with a low-dose recombinant DNA (rDNA) hepatitis B vaccine was negatively influenced by psychological stress. The present study was designed to assess whether the same inverse relation between HBs-antibody levels

  14. Correlation of HBV DNA PCR and HBeAg in hepatitis carriers

    Hussain, A.B.; Karamat, K.A.; Kazmi, S.Y.; Anwar, M.; Tariq, W.Z.

    2004-01-01

    Objective: To correlate hepatitis B HBV DNA polymerase chain reaction (PCR) results with HBeAg and serum ala- nine transferase (ALT) in carriers. Materials and Methods: Fifty hepatitis B carriers, with known HBsAg positive serostatus, raised serum ALT and detectable HBV DNA, were selected out of the patients reporting at AFIP for their blood test for HBV DNA. HBV DNA testing in these cases was carried out using PCR kit of Accugen-USA. After confirmation of their carrier status and raised serum ALT levels, the sera were tested for HBeAg and results of HBeAg testing were correlated with those of HBV DNA testing. Results: Out of the total 50 HBV DNA PCR positive hepatitis B carriers, 48 samples were positive for HBeAg. All the 50 HBV DNA positive cases had raised serum ALT levels. Conclusion: In case of non-availability of facility for HBV PCR, detectable HBeAg should be taken as a surrogate marker for HBV DNA in hepatitis B carriers with raised serum ALT. (author)

  15. A Role for the Host DNA Damage Response in Hepatitis B Virus cccDNA Formation—and Beyond?

    Sabrina Schreiner

    2017-05-01

    Full Text Available Chronic hepatitis B virus (HBV infection puts more than 250 million people at a greatly increased risk to develop end-stage liver disease. Like all hepadnaviruses, HBV replicates via protein-primed reverse transcription of a pregenomic (pg RNA, yielding an unusually structured, viral polymerase-linked relaxed-circular (RC DNA as genome in infectious particles. Upon infection, RC-DNA is converted into nuclear covalently closed circular (ccc DNA. Associating with cellular proteins into an episomal minichromosome, cccDNA acts as template for new viral RNAs, ensuring formation of progeny virions. Hence, cccDNA represents the viral persistence reservoir that is not directly targeted by current anti-HBV therapeutics. Eliminating cccDNA will thus be at the heart of a cure for chronic hepatitis B. The low production of HBV cccDNA in most experimental models and the associated problems in reliable cccDNA quantitation have long hampered a deeper understanding of cccDNA molecular biology. Recent advancements including cccDNA-dependent cell culture systems have begun to identify select host DNA repair enzymes that HBV usurps for RC-DNA to cccDNA conversion. While this list is bound to grow, it may represent just one facet of a broader interaction with the cellular DNA damage response (DDR, a network of pathways that sense and repair aberrant DNA structures and in the process profoundly affect the cell cycle, up to inducing cell death if repair fails. Given the divergent interactions between other viruses and the DDR it will be intriguing to see how HBV copes with this multipronged host system.

  16. Cloning and expression of NS3 helicase fragment of hepatitis C virus and the study of its immunoreactivity in HCV infected patients

    Mahrou Sadri

    2015-02-01

    Full Text Available Objective(s: Hepatitis C is a major cause of liver failure worldwide. Current therapies applied for this disease are not fully effective and produce side effects in most cases. Non-structural protein 3 helicase (NS3 of HCV is one of the key enzymes in viral replication and infection. Therefore, this region is a promising target to design new drugs and therapies against HCV infection. The aim of this study was cloning and expression of HCV NS3 helicase fragment in Escherichia coli BL21 (DE3 using pET102/D-TOPO expression vector and studying immunoreactivity of the expressed antigen in Iranian infected with hepatitis C. Materials and Methods: The viral RNA was extracted from the serum of HCV infected patient. The NS3 helicase region was amplified by RT-PCR. The PCR product was directionally cloned into the expression vector pET102/D-TOPO and transformed into the BL21 strain of E. coli (DE3. The transformed bacteria were then induced by adding 1mM isopropyl-β-D-thiogalactopyranoside (IPTG into the culture medium to enhance the protein expression. SDS-PAGE and western blotting were carried out to identify the protein under investigation, and finally purified recombinant fusion protein was used as the antigen for ELISA method. Results: Theinsertion of theDNA fragment of the NS3 regioninto the expression vectorwas further confirmed by PCR and sequencing. SDS-PAGE analysis showed the successful expression of the recombinant protein of interest. Furthermore, immunoreactivity of fusion NS3 helicase was confirmed by ELISA and western blotting. Conclusion: It seems that this recombinant protein could be a useful source of antigen for future studies on HCV diagnosis and therapy.

  17. DNA barcoding for identification of 'Candidatus Phytoplasmas' using a fragment of the elongation factor Tu gene.

    Olga Makarova

    Full Text Available Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf gene for phytoplasma identification is reported.We designed a new set of primers and amplified a 420-444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX. Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter-/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases.This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification.

  18. Hepatitis B virus DNA integration in hepatocellular carcinoma after interferon-induced disappearance of hepatitis C virus.

    Tamori, Akihiro; Nishiguchi, Shuhei; Shiomi, Susumu; Hayashi, Takehiro; Kobayashi, Sawako; Habu, Daiki; Takeda, Tadashi; Seki, Shuichi; Hirohashi, Kazuhiro; Tanaka, Hiromu; Kubo, Shoji

    2005-08-01

    Hepatocellular carcinoma (HCC) has been reported in patients in whom hepatitis C virus (HCV) was eliminated by interferon (IFN) therapy. We examined the pathogenesis of HCC in patients with sustained viral response. Operable HCC developed in 7 of 342 patients cured of HCV infection by IFN monotherapy. No patient abused alcohol or had diabetes mellitus or obesity. Resected specimens of HCC were histologically evaluated. DNA extracted from HCC was examined by polymerase chain reaction (PCR) to locate hepatitis B virus (HBV) DNA. HBV integration sites in human genome were identified by cassette-ligation-mediated PCR. HBV DNA was not amplified in serum samples from any of the seven patients with HCC and was found in liver in four patients. In the latter four patients, HBV DNA was integrated into the human genome of HCC. In two of these patients, covalently closed circular HBV (cccHBV) was also detected. The patients with HBV DNA integration were free of HCV for more than 3 yr. In two of the three patients without HBV DNA integration, the surrounding liver showed cirrhosis. The liver of HCC with HBV DNA integration had not progressed to cirrhosis. Three of the four tumors with HBV integration had one integration site each, located at chromosomes 11q12, 11q22-23, and 22q11, respectively. The other tumor had two integration sites, situated at chromosomes 11q13 and 14q32. At chromosome 11q12, HBV DNA was integrated into protein-coding genome, the function of which remains unclear. Integrated HBV DNA may play a role in hepatocarcinogenesis after the clearance of HCV by IFN treatment.

  19. Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction

    Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka

    2005-01-01

    AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152

  20. Environmental toxicants cause sperm DNA fragmentation as detected by the Sperm Chromatin Structure Assay (SCSA[reg])

    Evenson, Donald P.; Wixon, Regina

    2005-01-01

    Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to ∼1-2 x 106 sperm/ml, treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for elevated

  1. Hepatitis B virus DNA quantification with the three-in-one (3io) method allows accurate single-step differentiation of total HBV DNA and cccDNA in biopsy-size liver samples.

    Taranta, Andrzej; Tien Sy, Bui; Zacher, Behrend Johan; Rogalska-Taranta, Magdalena; Manns, Michael Peter; Bock, Claus Thomas; Wursthorn, Karsten

    2014-08-01

    Hepatitis B virus (HBV) replicates via reverse transcription converting its partially double stranded genome into the covalently closed circular DNA (cccDNA). The long-lasting cccDNA serves as a replication intermediate in the nuclei of hepatocytes. It is an excellent, though evasive, parameter for monitoring the course of liver disease and treatment efficiency. To develop and test a new approach for HBV DNA quantification in serum and small-size liver samples. The p3io plasmid contains an HBV fragment and human β-actin gene (hACTB) as a standard. Respective TaqMan probes were labeled with different fluorescent dyes. A triplex real-time PCR for simultaneous quantification of total HBV DNA, cccDNA and hACTB could be established. Three-in-one method allows simultaneous analysis of 3 targets with a lower limit of quantification of 48 copies per 20 μl PCR reaction and a wide range of linearity (R(2)>0.99, pDNA samples from HBV infected patients. Total HBV DNA and cccDNA could be quantified in 32 and 22 of 33 FFPE preserved liver specimens, respectively. Total HBV DNA concentrations quantified by the 3io method remained comparable with Cobas TaqMan HBV Test v2.0. The three-in-one protocol allows the single step quantification of viral DNA in samples from different sources. Therefore lower sample input, faster data acquisition, a lowered error and significantly lower costs are the advantages of the method. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Duck hepatitis B virus covalently closed circular DNA appears to survive hepatocyte mitosis in the growing liver

    Reaiche-Miller, Georget Y.; Thorpe, Michael; Low, Huey Chi; Qiao, Qiao; Scougall, Catherine A.; Mason, William S.; Litwin, Samuel; Jilbert, Allison R.

    2013-01-01

    Nucleos(t)ide analogues that inhibit hepatitis B virus (HBV) DNA replication are typically used as monotherapy for chronically infected patients. Treatment with a nucleos(t)ide analogue eliminates most HBV DNA replication intermediates and produces a gradual decline in levels of covalently closed circular DNA (cccDNA), the template for viral RNA synthesis. It remains uncertain if levels of cccDNA decline primarily through hepatocyte death, or if loss also occurs during hepatocyte mitosis. To determine if cccDNA survives mitosis, growing ducklings infected with duck hepatitis B virus (DHBV) were treated with the nucleoside analogue, Entecavir. Viremia was suppressed at least 10 5 -fold, during a period when average liver mass increased 23-fold. Analysis of the data suggested that if cccDNA synthesis was completely inhibited, at least 49% of cccDNA survived hepatocyte mitosis. However, there was a large duck-to-duck variation in cccDNA levels, suggesting that low level cccDNA synthesis may contribute to this apparent survival through mitosis. - Highlights: • The hepatitis B virus nuclear template is covalently closed circular DNA (cccDNA). • cccDNA was studied during liver growth in duck hepatitis B virus infected ducks. • Virus DNA replication and new cccDNA synthesis were inhibited with Entecavir. • At least 49% of cccDNA appeared to survive hepatocyte mitosis. • Low level virus DNA synthesis may contribute to survival of cccDNA through mitosis

  3. Duck hepatitis B virus covalently closed circular DNA appears to survive hepatocyte mitosis in the growing liver

    Reaiche-Miller, Georget Y.; Thorpe, Michael; Low, Huey Chi; Qiao, Qiao; Scougall, Catherine A. [School of Molecular and Biomedical Science, University of Adelaide, Adelaide, SA 5005 (Australia); Mason, William S.; Litwin, Samuel [Institute for Cancer Research, Fox Chase Cancer Center, Philadelphia, PA 19111 (United States); Jilbert, Allison R., E-mail: allison.jilbert@adelaide.edu.au [School of Molecular and Biomedical Science, University of Adelaide, Adelaide, SA 5005 (Australia)

    2013-11-15

    Nucleos(t)ide analogues that inhibit hepatitis B virus (HBV) DNA replication are typically used as monotherapy for chronically infected patients. Treatment with a nucleos(t)ide analogue eliminates most HBV DNA replication intermediates and produces a gradual decline in levels of covalently closed circular DNA (cccDNA), the template for viral RNA synthesis. It remains uncertain if levels of cccDNA decline primarily through hepatocyte death, or if loss also occurs during hepatocyte mitosis. To determine if cccDNA survives mitosis, growing ducklings infected with duck hepatitis B virus (DHBV) were treated with the nucleoside analogue, Entecavir. Viremia was suppressed at least 10{sup 5}-fold, during a period when average liver mass increased 23-fold. Analysis of the data suggested that if cccDNA synthesis was completely inhibited, at least 49% of cccDNA survived hepatocyte mitosis. However, there was a large duck-to-duck variation in cccDNA levels, suggesting that low level cccDNA synthesis may contribute to this apparent survival through mitosis. - Highlights: • The hepatitis B virus nuclear template is covalently closed circular DNA (cccDNA). • cccDNA was studied during liver growth in duck hepatitis B virus infected ducks. • Virus DNA replication and new cccDNA synthesis were inhibited with Entecavir. • At least 49% of cccDNA appeared to survive hepatocyte mitosis. • Low level virus DNA synthesis may contribute to survival of cccDNA through mitosis.

  4. Multiple Determinations of Sperm DNA Fragmentation Show That Varicocelectomy Is Not Indicated for Infertile Patients with Subclinical Varicocele

    Agustín García-Peiró

    2014-01-01

    Full Text Available Varicocele is one of the most common causes of low semen quality, which is reflected in high percentages of sperm cells with fragmented DNA. While varicocelectomy is usually performed to ameliorate a patient’s fertility, its impact on sperm DNA integrity in the case of subclinical varicocele is poorly documented. In this study, multiple DNA fragmentation analyses (TUNEL, SCD, and SCSA were performed on semen samples from sixty infertile patients with varicocele (15 clinical varicoceles, 19 clinical varicoceles after surgical treatment, 16 subclinical varicoceles, and 10 subclinical varicoceles after surgical treatment. TUNEL, SCD, and SCSA assays all showed substantial sperm DNA fragmentation levels that were comparable between subclinical and clinical varicocele patients. Importantly, varicocelectomy did improve sperm quality in patients with clinical varicocele; however, this was not the case in patients with subclinical varicocele. In summary, although infertile patients with clinical and subclinical varicocele have similar sperm DNA quality, varicocelectomy should only be advised for patients with clinical varicocele.

  5. Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

    Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

    2015-07-01

    Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

  6. Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation

    Wei Kang; Liu Xueying; Zhu Xuefen

    1984-01-01

    The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)

  7. The Effect of Glyphosate on Human Sperm Motility and Sperm DNA Fragmentation

    George Anifandis

    2018-05-01

    Full Text Available Glyphosate is the active ingredient of Roundup®, which is one of the most popular herbicides worldwide. Although many studies have focused on the reproductive toxicity of glyphosate or glyphosate-based herbicides, the majority of them have concluded that the effect of the specific herbicide is negligible, while only a few studies indicate the male reproductive toxicity of glyphosate alone. The aim of the present study was to investigate the effect of 0.36 mg/L glyphosate on sperm motility and sperm DNA fragmentation (SDF. Thirty healthy men volunteered to undergo semen analysis for the purpose of the study. Sperm motility was calculated according to WHO 2010 guidelines at collection time (zero time and 1 h post-treatment with glyphosate. Sperm DNA fragmentation was evaluated with Halosperm® G2 kit for both the control and glyphosate-treated sperm samples. Sperm progressive motility of glyphosate-treated samples was significantly reduced after 1 h post-treatment in comparison to the respective controls, in contrast to the SDF of glyphosate-treated samples, which was comparable to the respective controls. Conclusively, under these in vitro conditions, at high concentrations that greatly exceed environmental exposures, glyphosate exerts toxic effects on sperm progressive motility but not on sperm DNA integrity, meaning that the toxic effect is limited only to motility, at least in the first hour.

  8. DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser

    de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson

    2015-03-01

    Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.

  9. DNA Polymerase κ Is a Key Cellular Factor for the Formation of Covalently Closed Circular DNA of Hepatitis B Virus.

    Yonghe Qi

    2016-10-01

    Full Text Available Hepatitis B virus (HBV infection of hepatocytes begins by binding to its cellular receptor sodium taurocholate cotransporting polypeptide (NTCP, followed by the internalization of viral nucleocapsid into the cytoplasm. The viral relaxed circular (rc DNA genome in nucleocapsid is transported into the nucleus and converted into covalently closed circular (ccc DNA to serve as a viral persistence reservoir that is refractory to current antiviral therapies. Host DNA repair enzymes have been speculated to catalyze the conversion of rcDNA to cccDNA, however, the DNA polymerase(s that fills the gap in the plus strand of rcDNA remains to be determined. Here we conducted targeted genetic screening in combination with chemical inhibition to identify the cellular DNA polymerase(s responsible for cccDNA formation, and exploited recombinant HBV with capsid coding deficiency which infects HepG2-NTCP cells with similar efficiency of wild-type HBV to assure cccDNA synthesis is exclusively from de novo HBV infection. We found that DNA polymerase κ (POLK, a Y-family DNA polymerase with maximum activity in non-dividing cells, substantially contributes to cccDNA formation during de novo HBV infection. Depleting gene expression of POLK in HepG2-NTCP cells by either siRNA knockdown or CRISPR/Cas9 knockout inhibited the conversion of rcDNA into cccDNA, while the diminished cccDNA formation in, and hence the viral infection of, the knockout cells could be effectively rescued by ectopic expression of POLK. These studies revealed that POLK is a crucial host factor required for cccDNA formation during a de novo HBV infection and suggest that POLK may be a potential target for developing antivirals against HBV.

  10. Analysis of human blood plasma cell-free DNA fragment size distribution using EvaGreen chemistry based droplet digital PCR assays.

    Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

    2018-04-12

    Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  11. Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments

    Sage, E.; Moustacchi, E.

    1987-01-01

    The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA

  12. Electron microscopic observations and DNA chain fragmentation studies on apoptosis in bone tumor cells induced by 153Sm-EDTMP

    Zhu Shoupeng; Xiao Dong; Han Xiaofeng

    1997-01-01

    The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis

  13. The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F

    2015-05-15

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.

    2015-01-01

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667

  15. Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

    M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

    1994-01-01

    A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

  16. The effect of swim-up and gradient sperm preparation techniques on deoxyribonucleic acid (DNA) fragmentation in subfertile patients.

    Oguz, Yuksel; Guler, Ismail; Erdem, Ahmet; Mutlu, Mehmet Firat; Gumuslu, Seyhan; Oktem, Mesut; Bozkurt, Nuray; Erdem, Mehmet

    2018-03-23

    To compare the effect of two different sperm preparation techniques, including swim-up and gradient methods on sperm deoxyribonucleic acid (DNA) fragmentation status of semen samples from unexplained and mild male factor subfertile patients undergoing intrauterine insemination (IUI). A prospective randomized study was conducted in 65 subfertile patients, including 34 unexplained and 31 male factor infertility to compare basal and post-procedure DNA fragmentation rates in swim-up and gradient techniques. Sperm DNA fragmentation rates were evaluated by a sperm chromatin dispersion (SCD) test in two portions of each sample of semen that was prepared with either swim-up or gradient techniques. Sperm motility and morphology were also assessed based on WHO 2010 criteria. Swim-up but not gradient method yielded a statistically significant reduction in the DNA fragmented sperm rate after preparation as compared to basal rates, in the semen samples of both unexplained (41.85 ± 22.04 vs. 28.58 ± 21.93, p gradient) and mild male factor (46.61 ± 19.38 vs. 30.32 ± 18.20, p gradient) subgroups. Swim-up method significantly reduces sperm DNA fragmentation rates and may have some prognostic value on intrauterine insemination in patients with decreased sperm DNA integrity.

  17. Hepatitis B virus DNA in saliva from children with chronic hepatitis B infection: implications for saliva as a potential mode of horizontal transmission

    Heiberg, Ida Louise; Hoegh, Mette; Ladelund, Steen

    2010-01-01

    To explore the mechanism of horizontal transmission of hepatitis B virus (HBV) among children, we investigated the quantitative relationship between HBV in saliva and blood from 46 children with chronic hepatitis B. We found high levels of HBV DNA in saliva of HBeAg (+) children, suggesting saliva...... as a vehicle for horizontal transmission of HBV among children....

  18. HEPATITIS B VIRUS DNA IN SALIVA FROM CHILDREN WITH CHRONIC HEPATITIS B INFECTION IMPLICATIONS FOR SALIVA AS A POTENTIAL MODE OF HORIZONTAL TRANSMISSION

    Heiberg, Ida Louise; Hoegh, Mette; Ladelund, Steen; Niesters, Hubert G. M.; Hogh, Birthe

    2010-01-01

    To explore the mechanism of horizontal transmission of hepatitis B virus (HBV) among children, we investigated the quantitative relationship between HBV in saliva and blood from 46 children with chronic hepatitis B. We found high levels of HBV DNA in saliva of HBeAg (+) children, suggesting saliva

  19. Hepatitis B virus DNA in saliva from children with chronic hepatitis B infection: implications for saliva as a potential mode of horizontal transmission

    Heiberg, Ida Louise; Hoegh, Mette; Ladelund, Steen

    2010-01-01

    To explore the mechanism of horizontal transmission of hepatitis B virus (HBV) among children, we investigated the quantitative relationship between HBV in saliva and blood from 46 children with chronic hepatitis B. We found high levels of HBV DNA in saliva of HBeAg (+) children, suggesting saliva...

  20. A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

    Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

    2009-11-01

    Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

  1. Seasonal changes of DNA fragmentation and quality of raw and cold-stored stallion spermatozoa.

    Wach-Gygax, L; Burger, D; Malama, E; Bollwein, H; Fleisch, A; Jeannerat, E; Thomas, S; Schuler, G; Janett, F

    2017-09-01

    In this study annual fluctuations of DNA fragmentation and quality of cold-stored equine sperm were evaluated. Ejaculates were collected weekly during one year from 15 stallions. Ejaculate volume, sperm concentration and total sperm count were determined and semen was then extended and cold-stored for 48 h. Sperm motility was evaluated by CASA before and after 24 as well as 48 h of cold storage. In addition, the percentages of sperm with intact plasma membrane and acrosome (PMAI %) and with low intracellular Ca 2+ level were determined in cold-stored semen (24 h, 48 h). SCSA™ was performed to assess mean DFI, SD of DFI and % DFI in raw frozen-thawed as well as in extended sperm after 24 and 48 h of storage. The month of semen collection affected (P sperm concentration lower in summer compared to winter and motility lower in July than in any other month of the year (P sperm with low intracellular Ca +2 level (%) after storage for 24 and 48 h, higher values were measured in winter and in October compared to April, June and July (P sperm. Semen quality was impaired in midsummer when low sperm motility and viability were combined with an elevated DNA fragmentation and Ca 2+ level of sperm. Copyright © 2017. Published by Elsevier Inc.

  2. Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

    Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

    1996-01-01

    We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

  3. Enhanced resolution of DNA restriction fragments: A procedure by two-dimensional electrophoresis and double-labeling

    Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O.

    1990-01-01

    A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map

  4. Hepatitis B virus (HBV) DNA levels and the management of HBV-infected health care workers

    van der Eijk, A A; de Man, R A; Niesters, H G M; Schalm, S W; Zaaijer, H L

    Different guidelines exist for the management of hepatitis B virus (HBV)-infected health care workers (HCWs). Various HBV DNA levels are used as a cutoff level to determine whether an HBV-infected HCW is allowed to perform exposure-prone procedures (EPPs) or not. In this paper we discuss the factors

  5. Hepatitis B virus (HBV) DNA levels and the management of HBV-infected health care workers

    van der Eijk, A. A.; de Man, R. A.; Niesters, H. G. M.; Schalm, S. W.; Zaaijer, H. L.

    2006-01-01

    Different guidelines exist for the management of hepatitis B virus (HBV)-infected health care workers (HCWs). Various HBV DNA levels are used as a cutoff level to determine whether an HBV-infected HCW is allowed to perform exposure-prone procedures (EPPs) or not. In this paper we discuss the factors

  6. Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

    Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan, E-mail: irfan_rahman@urmc.rochester.edu

    2016-09-02

    Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

  7. Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

    Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan

    2016-01-01

    Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

  8. Is there a relationship between the chromatin status and DNA fragmentation of boar spermatozoa following freezing-thawing?

    Fraser, L; Strzezek, J

    2007-07-15

    In this study a radioisotope method, which is based on the quantitative measurements of tritiated-labeled actinomycin D ((3)H-AMD) incorporation into the sperm nuclei ((3)H-AMD incorporation assay), was used to assess the chromatin status of frozen-thawed boar spermatozoa. This study also tested the hypothesis that frozen-thawed spermatozoa with altered chromatin were susceptible to DNA fragmentation measured with the neutral comet assay (NCA). Boar semen was diluted in lactose-hen egg yolk-glycerol extender (L-HEY) or lactose ostrich egg yolk lipoprotein fractions-glycerol extender (L-LPFo), packaged into aluminum tubes or plastic straws and frozen in a controlled programmable freezer. In Experiment 1, the chromatin status and DNA fragmentation were measured in fresh and frozen-thawed spermatozoa from the same ejaculates. There was a significant increase in sperm chromatin destabilization and DNA fragmentation in frozen-thawed semen as compared with fresh semen. The proportions of spermatozoa labeled with (3)H-AMD were concurrent with elevated levels of sperm DNA fragmentation in K-3 extender, without cryoprotective substances, compared with L-HEY or L-LPFo extender. Regression analysis revealed that the results of the (3)H-AMD incorporation assay and NCA for frozen-thawed spermatozoa were correlated. Boars differed significantly in terms of post-thaw sperm DNA damage. In Experiment 2, the susceptibility of sperm chromatin to decondensation was assessed using a low concentration of heparin. Treatment of frozen-thawed spermatozoa with heparin revealed enhanced (3)H-AMD binding, suggesting nuclear chromatin decondensation. The deterioration in post-thaw sperm viability, such as motility, mitochondrial function and plasma membrane integrity, was concurrent with increased chromatin instability and DNA fragmentation. This is the first report to show that freezing-thawing procedure facilitated destabilization in the chromatin structure of boar spermatozoa, resulting in

  9. Hepatitis

    ... most common types of viral hepatitis. What Is Hepatitis A? For kids, hep A is the most common ... they recover, it does not come back. Can Hepatitis A Be Prevented? The following will help keep people ...

  10. Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

    Boyko, Alex; Kovalchuk, Igor

    2010-01-01

    Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

  11. DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

    Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

    2011-07-15

    presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types.

  12. TbPIF5 is a Trypanosoma brucei mitochondrial DNA helicase involved in processing of minicircle Okazaki fragments.

    Beiyu Liu

    2009-09-01

    Full Text Available Trypanosoma brucei's mitochondrial genome, kinetoplast DNA (kDNA, is a giant network of catenated DNA rings. The network consists of a few thousand 1 kb minicircles and several dozen 23 kb maxicircles. Here we report that TbPIF5, one of T. brucei's six mitochondrial proteins related to Saccharomyces cerevisiae mitochondrial DNA helicase ScPIF1, is involved in minicircle lagging strand synthesis. Like its yeast homolog, TbPIF5 is a 5' to 3' DNA helicase. Together with other enzymes thought to be involved in Okazaki fragment processing, TbPIF5 localizes in vivo to the antipodal sites flanking the kDNA. Minicircles in wild type cells replicate unidirectionally as theta-structures and are unusual in that Okazaki fragments are not joined until after the progeny minicircles have segregated. We now report that overexpression of TbPIF5 causes premature removal of RNA primers and joining of Okazaki fragments on theta structures. Further elongation of the lagging strand is blocked, but the leading strand is completed and the minicircle progeny, one with a truncated H strand (ranging from 0.1 to 1 kb, are segregated. The minicircles with a truncated H strand electrophorese on an agarose gel as a smear. This replication defect is associated with kinetoplast shrinkage and eventual slowing of cell growth. We propose that TbPIF5 unwinds RNA primers after lagging strand synthesis, thus facilitating processing of Okazaki fragments.

  13. Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

    Bertolotto, Jorge A.; Umazano, Juan P.

    2016-06-01

    In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

  14. In Silico Screening Hepatitis B Virus DNA Polymerase Inhibitors from Medicinal Plants

    Mokhtar Nosrati

    2017-08-01

    Full Text Available Abstract Background: Hepatitis B virus infection (HBV is a significant global health problem and is a major cause of morbidity and mortality worldwide. Therefore, currently, introducing novel anti Hepatitis B drugs is taken into consideration. This study was planned to in silico screening novel Hepatitis B virus DNA polymerase inhibitors from two medicinal plants Terminalis chebula and Caesalpinia sappan. Materials and Methods: This is a descriptive-analytic study. In the study, three-dimensional structure of the Hepatitis B virus DNA polymerase was predicted using homology modeling method. A set of phytochemicals from mentioned plants were retrieved from Pubchem database in SDF format. In silico screening was carried out using molecular docking between mentioned phytochemicals and modeled polymerase by iGemdock 2.1 software. Results: Results of the study confirmed that all evaluated ligands have appropriate interactions to the polymerase with least toxicity and without genotoxicity potential. Results also showed that most interactions occur in reverse transcriptase domain which located in 354-694 area in the amino acid sequence of tested polymerase. Analysis of energy and amino acids involved in ligand-polymerase interaction revealed that Terchebin, Chebulinic Acid and Terflavin A have more effective interaction with the polymerase in compared to other ligands. Conclusion: Based on the results it can be concluded that evaluated compounds could be good candidates for in vitro and in vivo research in order to develop novel anti- Hepatitis B drugs.

  15. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  16. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  17. Curcumin inhibits hepatitis B virus infection by down-regulating cccDNA-bound histone acetylation.

    Wei, Zhi-Qiang; Zhang, Yong-Hong; Ke, Chang-Zheng; Chen, Hong-Xia; Ren, Pan; He, Yu-Lin; Hu, Pei; Ma, De-Qiang; Luo, Jie; Meng, Zhong-Ji

    2017-09-14

    To investigate the potential effect of curcumin on hepatitis B virus (HBV) covalently closed circular DNA (cccDNA) and the underlying mechanism. A HepG2.2.15 cell line stably transfected with HBV was treated with curcumin, and HBV surface antigen (HBsAg) and e antigen (HBeAg) expression levels were assessed by ELISA. Intracellular HBV DNA replication intermediates and cccDNA were detected by Southern blot and real-time PCR, respectively. The acetylation levels of histones H3 and H4 were measured by Western blot. H3/H4-bound cccDNA was detected by chromatin immunoprecipitation (ChIP) assays. The deacetylase inhibitors trichostatin A and sodium butyrate were used to study the mechanism of action for curcumin. Additionally, short interfering RNAs (siRNAs) targeting HBV were tested along with curcumin. Curcumin treatment led to time- and dose-dependent reductions in HBsAg and HBeAg expression and significant reductions in intracellular HBV DNA replication intermediates and HBV cccDNA. After treatment with 20 μmol/L curcumin for 2 d, HBsAg and cccDNA levels in HepG2.2.15 cells were reduced by up to 57.7% ( P curcumin, accompanied by reductions in H3- and H4-bound cccDNA. Furthermore, the deacetylase inhibitors trichostatin A and sodium butyrate could block the effects of curcumin. Additionally, transfection of siRNAs targeting HBV enhanced the inhibitory effects of curcumin. Curcumin inhibits HBV gene replication via down-regulation of cccDNA-bound histone acetylation and has the potential to be developed as a cccDNA-targeting antiviral agent for hepatitis B.

  18. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  19. Dietary supplementation with docosahexaenoic acid (DHA) improves seminal antioxidant status and decreases sperm DNA fragmentation.

    Martínez-Soto, Juan Carlos; Domingo, Joan Carles; Cordobilla, Begoña; Nicolás, María; Fernández, Laura; Albero, Pilar; Gadea, Joaquín; Landeras, José

    2016-12-01

    The purpose of this study was to evaluate the effect of docosahexaenoic acid (DHA) dietary supplementation on semen quality, fatty acid composition, antioxidant capacity, and DNA fragmentation. In this randomized, double blind, placebo-controlled, parallel-group study, 74 subjects were recruited and randomly assigned to either the placebo group (n=32) or to the DHA group (n=42) to consume three 500-mg capsules of oil per day over 10 weeks. The placebo group received 1,500 mg/day of sunflower oil and the DHA group 1,500 mg/day of DHA-enriched oil. Seminal parameters (semen volume, sperm concentration, motility, morphology, and vitality), total antioxidant capacity, deoxyribonucleic acid fragmentation, and lipid composition were evaluated prior to the treatment and after 10 weeks. Finally, 57 subjects were included in the study with 25 in the placebo group and 32 in the DHA group. No differences were found in traditional sperm parameters or lipid composition of the sperm membrane after treatment. However, an increase in DHA and Omega-3 fatty acid content in seminal plasma, an improvement in antioxidant status, and a reduction in the percentage of spermatozoa with deoxyribonucleic acid damage were observed in the DHA group after 10 weeks of treatment.

  20. A DNA metabarcoding study of a primate dietary diversity and plasticity across its entire fragmented range.

    Erwan Quéméré

    Full Text Available In tropical regions, most primary ecosystems have been replaced by mosaic landscapes in which species must cope with a large shift in the distribution of their habitat and associated food resources. Primates are particularly vulnerable to habitat modifications. Most species persist in small fragments surrounded by complex human-mediated matrices whose structure and connectivity may strongly influence their dispersal and feeding behavior. Behavioral plasticity appears to be a crucial parameter governing the ability of organisms to exploit the resources offered by new matrix habitats and thus to persist in fragmented habitats. In this study, we were interested in the dietary plasticity of the golden-crowned sifaka (Propithecus tattersalli, an endangered species of lemur, found only in the Daraina region in north-eastern Madagascar. We used a DNA-based approach combining the barcoding concept and Illumina next-generation sequencing to (i describe the species diet across its entire range and (ii evaluate the influence of landscape heterogeneity on diet diversity and composition. Faeces from 96 individuals were sampled across the entire species range and their contents were analyzed using the trnL metabarcoding approach. In parallel, we built a large DNA reference database based on a checklist of the plant species of the Daraina region. Our results suggest that golden-crowned sifakas exhibit remarkable dietary diversity with at least 130 plant species belonging to 80 genera and 49 different families. We highlighted an influence of both habitat type and openness on diet composition suggesting a high flexibility of foraging strategies. Moreover, we observed the presence of numerous cultivated and naturalized plants in the faeces of groups living in forest edge areas. Overall, our findings support our initial expectation that P. tattersalli is able to cope with the current level of alteration of the landscape and confirm our previous results on the

  1. Influence of vinyl chloride monomer and vinyl chloride monomer derivatives on hepatic DNA synthesis

    Brenner, E.A.

    1982-01-01

    Vinyl chloride monomer (VCM) is used extensively in the chemical industry, mainly in the production of polyvinyl chloride. It has recently been found to cause hepatic angiosarcoma. As VCM has also been shown to be mutagenic after metabolic activation the effect of VCM on DNA synthesis was investigated. [ 3 H]Thymidine incorporation into DNA was used to measure the rate of DNA synthesis in regenerating rat liver. A possible direct toxic effect of VCM or its metabolites on liver cell metabolism was examined by two unrelated techniques, viz. the measurement of adenine nucleotide concentrations in regenerating livers and the influence on transmembrane potentials in hepatocytes. The distribution of radioactivity in subcellular fractions following [ 14 C]VCM administration suggested microsomal conversion of VCM to an active form which was selectively retained in the nuclear fraction. Measurement of the activities of thymidine kinase and DNA polymerase in regenerating liver indicated that the induction of these enzymes which normally occurs after partial hepatectomy was not prevented by VCM treatment. Three techniques were used to test the hypothesis that the retardation in DNA synthesis was due to DNA damage: the prophage lambda induction test for DNA damage, autoradiographic detection of unscheduled thymidine incorporation into DNA, and detection of DNA strand breaks in alkaline sucrose gradients. All three provided evidence of DNA damage and led to the development of a novel technique to confirm these findings. This involved centrifugation in neutral sucrose gradients on intact double-stranded DNA contained in hepatocyte nucleoids and showed conclusively that VCM administration causes DNA strand breaks. Subsequent repair of DNA was also assessed by this technique. The site of the VCM/metabolite: DNA reaction was characterized by DNA thermal denaturation and renaturation studies

  2. [Real-time quantification to analyze historical Colombian samples detecting a short fragment of hypervariable region II of mitochondrial DNA].

    Pérez, Luz Adriana; Rodríguez, Freddy; Langebaek, Carl Henrik; Groot, Helena

    2016-09-01

    Unlike other molecular biology studies, the analysis of ancient DNA (aDNA) requires special infrastructure and methodological conditions to guarantee the quality of the results. One of the main authenticity criteria is DNA quantification, where quantitative real-time PCR is often used given its sensitivity and specificity. Nevertheless, the implementation of these conditions and methodologies to fulfill authenticity criteria imply higher costs. Objective: To develop a simple and less costly method for mitochondrial DNA quantification suitable for highly degraded samples. Materials and methods: The proposed method is based on the use of mini-primers for the specific amplification of short fragments of mitochondrial DNA. The subsequent purification of these amplified fragments allows a standard curve to be constructed with concentrations in accordance to the state of degradation of the samples. Results: The proposed method successfully detected DNA from ancient samples including bone remains and mummified tissue. DNA inhibitory substances were also detected. Conclusion: The proposed method represents a simpler and cost-effective way to detect low amounts of aDNA, and a tool to differentiate DNA-free samples from samples with inhibitory substances.

  3. A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

    Hahn, P.J.; Giddings, L.; Lane, M.J.

    1989-01-01

    Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

  4. Identifying the Genotypes of Hepatitis B Virus (HBV) with DNA Origami Label.

    Liu, Ke; Pan, Dun; Wen, Yanqin; Zhang, Honglu; Chao, Jie; Wang, Lihua; Song, Shiping; Fan, Chunhai; Shi, Yongyong

    2018-02-01

    The hepatitis B virus (HBV) genotyping may profoundly affect the accurate diagnosis and antiviral treatment of viral hepatitis. Existing genotyping methods such as serological, immunological, or molecular testing are still suffered from substandard specificity and low sensitivity in laboratory or clinical application. In a previous study, a set of high-efficiency hybridizable DNA origami-based shape ID probes to target the templates through which genetic variation could be determined in an ultrahigh resolution of atomic force microscopy (AFM) nanomechanical imaging are established. Here, as a further confirmatory research to explore the sensitivity and applicability of this assay, differentially predesigned DNA origami shape ID probes are also developed for precisely HBV genotyping. Through the specific identification of visualized DNA origami nanostructure with clinical HBV DNA samples, the genetic variation information of genotypes can be directly identified under AFM. As a proof-of-concept, five genotype B and six genotype C are detected in 11 HBV-infected patients' blood DNA samples of Han Chinese population in the single-blinded test. The AFM image-based DNA origami shape ID genotyping approach shows high specificity and sensitivity, which could be promising for virus infection diagnosis and precision medicine in the future. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

    Jiabing Ji

    Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

  6. The metabolic enhancer piracetam attenuates mitochondrion-specific endonuclease G translocation and oxidative DNA fragmentation.

    Gupta, Sonam; Verma, Dinesh Kumar; Biswas, Joyshree; Rama Raju, K Siva; Joshi, Neeraj; Wahajuddin; Singh, Sarika

    2014-08-01

    This study was performed to investigate the involvement of mitochondrion-specific endonuclease G in piracetam (P)-induced protective mechanisms. Studies have shown the antiapoptotic effects of piracetam but the mechanism of action of piracetam is still an enigma. To assess the involvement of endonuclease G in piracetam-induced protective effects, astrocyte glial cells were treated with lipopolysaccharide (LPS) and piracetam. LPS treatment caused significantly decreased viability, mitochondrial activity, oxidative stress, chromatin condensation, and DNA fragmentation, which were attenuated by piracetam cotreatment. Cotreatment of astrocytes with piracetam showed its significantly time-dependent absorption as observed with high-performance liquid chromatography. Astrocytes treated with piracetam alone showed enhanced mitochondrial membrane potential (MMP) in comparison to control astrocytes. However, in LPS-treated cells no significant alteration in MMP was observed in comparison to control cells. Protein and mRNA levels of the terminal executor of the caspase-mediated pathway, caspase-3, were not altered significantly in LPS or LPS + piracetam-treated astrocytes, whereas endonuclease G was significantly translocated to the nucleus in LPS-treated astrocytes. Piracetam cotreatment attenuated the LPS-induced endonuclease G translocation. In conclusion this study indicates that LPS treatment of astrocytes caused decreased viability, oxidative stress, mitochondrial dysfunction, chromatin condensation, DNA damage, and translocation of endonuclease G to the nucleus, which was inhibited by piracetam cotreatment, confirming that the mitochondrion-specific endonuclease G is one of the factors involved in piracetam-induced protective mechanisms. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

    Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

    2012-03-01

    The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.

  8. Analysis of DNA restriction fragments greater than 5.7 Mb in size from the centromeric region of human chromosomes.

    Arn, P H; Li, X; Smith, C; Hsu, M; Schwartz, D C; Jabs, E W

    1991-01-01

    Pulsed electrophoresis was used to study the organization of the human centromeric region. Genomic DNA was digested with rare-cutting enzymes. DNA fragments from 0.2 to greater than 5.7 Mb were separated by electrophoresis and hybridized with alphoid and simple DNA repeats. Rare-cutting enzymes (Mlu I, Nar I, Not I, Nru I, Sal I, Sfi I, Sst II) demonstrated fewer restriction sites at centromeric regions than elsewhere in the genome. The enzyme Not I had the fewest restriction sites at centromeric regions. As much as 70% of these sequences from the centromeric region are present in Not I DNA fragments greater than 5.7 and estimated to be as large as 10 Mb in size. Other repetitive sequences such as short interspersed repeated segments (SINEs), long interspersed repeated segments (LINEs), ribosomal DNA, and mini-satellite DNA that are not enriched at the centromeric region, are not enriched in Not I fragments of greater than 5.7 Mb in size.

  9. Multiplex electrochemiluminescence DNA sensor for determination of hepatitis B virus and hepatitis C virus based on multicolor quantum dots and Au nanoparticles

    Liu, Linlin; Wang, Xinyan; Ma, Qiang; Lin, Zihan; Chen, Shufan; Li, Yang [Department of Analytical Chemistry, College of Chemistry, Jilin University, Changchun, 130012 (China); Lu, Lehui [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun, 130022 (China); Qu, Hongping [Department of Biotechnology, College of Life Science, Jilin Normal University, Siping, 136000 (China); Su, Xingguang, E-mail: suxg@jlu.edu.cn [Department of Analytical Chemistry, College of Chemistry, Jilin University, Changchun, 130012 (China)

    2016-04-15

    In this work, a novel multiplex electrochemiluminescence (ECL) DNA sensor has been developed for determination of hepatitis B virus (HBV) and hepatitis C virus (HCV) based on multicolor CdTe quantum dots (CdTe QDs) and Au nanoparticles (Au NPs). The electrochemically synthesized graphene nanosheets (GNs) were selected as conducting bridge to anchor CdTe QDs{sub 551}-capture DNA{sub HBV} and CdTe QDs{sub 607}-capture DNA{sub HCV} on the glassy carbon electrode (GCE). Then, different concentrations of target DNA{sub HBV} and target DNA{sub HCV} were introduced to hybrid with complementary CdTe QDs-capture DNA. Au NPs-probe DNA{sub HBV} and Au NPs-probe DNA{sub HCV} were modified to the above composite film via hybrid with the unreacted complementary CdTe QDs-capture DNA. Au NPs could quench the electrochemiluminescence (ECL) intensity of CdTe QDs due to the inner filter effect. Therefore, the determination of target DNA{sub HBV} and target DNA{sub HCV} could be achieved by monitoring the ECL DNA sensor based on Au NPs-probe DNA/target DNA/CdTe QDs-capture DNA/GNs/GCE composite film. Under the optimum conditions, the ECL intensity of CdTe QDs{sub 551} and CdTe QDs{sub 607} and the concentration of target DNA{sub HBV} and target DNA{sub HCV} have good linear relationship in the range of 0.0005–0.5 nmol L{sup −1} and 0.001–1.0 nmol L{sup −1} respectively, and the limit of detection were 0.082 pmol L{sup −1} and 0.34 pmol L{sup −1} respectively (S/N = 3). The DNA sensor showed good sensitivity, selectivity, reproducibility and acceptable stability. The proposed DNA sensor has been employed for the determination of target DNA{sub HBV} and target DNA{sub HCV} in human serum samples with satisfactory results. - Highlights: • A novel electrochemiluminescence DNA sensor has been developed for the determination of target DNA{sub HBV} and target DNA{sub HCV}. • The DNA sensor shows good sensitivity, reproducibility and stability. • The ECL provided a

  10. Impact of the Z potential technique on reducing the sperm DNA fragmentation index, fertilization rate and embryo development.

    Duarte, Carlos; Núñez, Víctor; Wong, Yat; Vivar, Carlos; Benites, Elder; Rodriguez, Urso; Vergara, Carlos; Ponce, Jorge

    2017-12-01

    In assisted reproduction procedures, we need to develop and enhance new protocols to optimize sperm selection. The aim of this study is to evaluate the ability of the Z potential technique to select sperm with intact DNA in non-normospermic patients and evaluate the impact of this selection on embryonic development. We analyzed a total of 174 human seminal samples with at least one altered parameter. We measured basal, post density gradients, and post density gradients + Z potential DNA fragmentation index. To evaluate the impact of this technique on embryo development, 54 cases were selected. The embryo development parameters evaluated were fertilization rate, cleavage rate, top quality embryos at the third day and blastocysts rate. We found significant differences in the study groups when we compared the sperm fragmentation index by adding the Z potential technique to density gradient selection vs. density gradients alone. Furthermore, there was no significant difference in the embryo development parameters between the low sperm fragmentation index group vs. the moderate and high sperm fragmentation index groups, when selecting sperms with this new technique. The Z potential technique is a very useful tool for sperm selection; it significantly reduces the DNA fragmentation index and improves the parameters of embryo development. This technique could be considered routine for its simplicity and low cost.

  11. Inhibition of hepatitis B virus (HBV) by LNA-mediated nuclear interference with HBV DNA transcription

    Sun, Zhen; Xiang, Wenqing; Guo, Yajuan; Chen, Zhi; Liu, Wei; Lu, Daru

    2011-01-01

    Highlights: → LNA-modified oligonucleotides can pass through the plasma membrane of cultured cells even without using transfection machinery. → LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. → LNA-oligonucleotide designed to target nuclear HBV DNA efficiently suppresses HBV replication and transcription in cultured hepatic cells. -- Abstract: Silencing target genes with small regulatory RNAs is widely used to investigate gene function and therapeutic drug development. Recently, triplex-based approaches have provided another attractive means to achieve targeted gene regulation and gene manipulation at the molecular and cellular levels. Nuclear entry of oligonucleotides and enhancement of their affinity to the DNA targets are key points of such approaches. In this study, we developed lipid-based transport of a locked-nucleic-acid (LNA)-modified oligonucleotide for hepatitis B virus (HBV) DNA interference in human hepatocytes expressing HBV genomic DNA. In these cells, the LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. The oligonucleotide specifically targeting HBV DNA clearly interfered with HBV DNA transcription as shown by a block in pregenomic RNA (pgRNA) production. The HBV DNA-targeted oligonucleotide suppressed HBV DNA replication and HBV protein production more efficiently than small interfering RNAs directed to the pgRNA. These results demonstrate that fusion with lipid can carry LNA-modified oligonucleotides to the nucleus where they regulate gene expression. Interfering with HBV DNA transcription by LNA-modified oligonucleotides has strong potential as a new strategy for HBV inhibition.

  12. Inhibition of hepatitis B virus (HBV) by LNA-mediated nuclear interference with HBV DNA transcription

    Sun, Zhen [The State Key Laboratory of Genetic Engineering and The MOE Key Laboratory of Contemporary Anthropology, School of Life Science, Fudan University, Shanghai 200433 (China); Department of Biochemistry and Molecular Biology, Program in Molecular Cell Biology, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310058 (China); Xiang, Wenqing; Guo, Yajuan [Department of Biochemistry and Molecular Biology, Program in Molecular Cell Biology, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310058 (China); Chen, Zhi [The State Key Laboratory for Infectious Disease, Institute of Infectious Disease, First Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310003 (China); Liu, Wei, E-mail: liuwei666@zju.edu.cn [Department of Biochemistry and Molecular Biology, Program in Molecular Cell Biology, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310058 (China); Lu, Daru, E-mail: drlu@fudan.edu.cn [The State Key Laboratory of Genetic Engineering and The MOE Key Laboratory of Contemporary Anthropology, School of Life Science, Fudan University, Shanghai 200433 (China)

    2011-06-10

    Highlights: {yields} LNA-modified oligonucleotides can pass through the plasma membrane of cultured cells even without using transfection machinery. {yields} LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. {yields} LNA-oligonucleotide designed to target nuclear HBV DNA efficiently suppresses HBV replication and transcription in cultured hepatic cells. -- Abstract: Silencing target genes with small regulatory RNAs is widely used to investigate gene function and therapeutic drug development. Recently, triplex-based approaches have provided another attractive means to achieve targeted gene regulation and gene manipulation at the molecular and cellular levels. Nuclear entry of oligonucleotides and enhancement of their affinity to the DNA targets are key points of such approaches. In this study, we developed lipid-based transport of a locked-nucleic-acid (LNA)-modified oligonucleotide for hepatitis B virus (HBV) DNA interference in human hepatocytes expressing HBV genomic DNA. In these cells, the LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. The oligonucleotide specifically targeting HBV DNA clearly interfered with HBV DNA transcription as shown by a block in pregenomic RNA (pgRNA) production. The HBV DNA-targeted oligonucleotide suppressed HBV DNA replication and HBV protein production more efficiently than small interfering RNAs directed to the pgRNA. These results demonstrate that fusion with lipid can carry LNA-modified oligonucleotides to the nucleus where they regulate gene expression. Interfering with HBV DNA transcription by LNA-modified oligonucleotides has strong potential as a new strategy for HBV inhibition.

  13. Pioglitazone retrieves hepatic antioxidant DNA repair in a mice model of high fat diet

    Yang Ching-Hsiu

    2008-09-01

    Full Text Available Abstract Background Pioglitazone was reported to improve hepatic steatosis and necroinflammation in human studies. To investigate whether the hepato-protective effect of pioglitazone was associated with an improvement of antioxidant defense mechanism, oxidative DNA damage and repair activity were determined in a high fat diet model. Male C57BL/6 mice were respectively fed with a 30% fat diet, the same diet with pioglitazone 100 mg/kg/day, or a chow diet as control for 8 weeks. Tissue oxidative stress was indicated by malondialdehyde concentration. Oxidative DNA damage was detected by immunohistochemical 8-oxoG staining. Enzymatic antioxidant defense was detected by the real-time PCR of superoxide dismutase (Sod1, Sod2 and DNA glycosylase (Ogg1, MutY. Oxidative DNA repair was detected by immunohistochemical staining and western blotting of OGG1 expression. Results Our results show that hepatic steatosis was induced by a high-fat diet and improved by adding pioglitazone. Malondialdehyde concentration and 8-oxoG staining were strongly increased in the high-fat diet group, but attenuated by pioglitazone. Gene expressions of antioxidant defense mechanism: Sod1, Sod2, Ogg1 and MutY significantly decreased in the high-fat diet group but reversed by pioglitazone co-administration. Conclusion The attenuation of hepatic oxidative DNA damage by pioglitazone in a high-fat diet may be mediated by up-regulation of the antioxidant defense mechanism and oxidative DNA repair activity. The diminution of oxidative damage may explain the clinical benefit of pioglitazone treatment in patients with non-alcoholic fatty liver disease.

  14. Pioglitazone retrieves hepatic antioxidant DNA repair in a mice model of high fat diet

    Hsiao, Pi-Jung; Hsieh, Tusty-Jiuan; Kuo, Kung-Kai; Hung, Wei-Wen; Tsai, Kun-Bow; Yang, Ching-Hsiu; Yu, Ming-Lung; Shin, Shyi-Jang

    2008-01-01

    Background Pioglitazone was reported to improve hepatic steatosis and necroinflammation in human studies. To investigate whether the hepato-protective effect of pioglitazone was associated with an improvement of antioxidant defense mechanism, oxidative DNA damage and repair activity were determined in a high fat diet model. Male C57BL/6 mice were respectively fed with a 30% fat diet, the same diet with pioglitazone 100 mg/kg/day, or a chow diet as control for 8 weeks. Tissue oxidative stress was indicated by malondialdehyde concentration. Oxidative DNA damage was detected by immunohistochemical 8-oxoG staining. Enzymatic antioxidant defense was detected by the real-time PCR of superoxide dismutase (Sod1, Sod2) and DNA glycosylase (Ogg1, MutY). Oxidative DNA repair was detected by immunohistochemical staining and western blotting of OGG1 expression. Results Our results show that hepatic steatosis was induced by a high-fat diet and improved by adding pioglitazone. Malondialdehyde concentration and 8-oxoG staining were strongly increased in the high-fat diet group, but attenuated by pioglitazone. Gene expressions of antioxidant defense mechanism: Sod1, Sod2, Ogg1 and MutY significantly decreased in the high-fat diet group but reversed by pioglitazone co-administration. Conclusion The attenuation of hepatic oxidative DNA damage by pioglitazone in a high-fat diet may be mediated by up-regulation of the antioxidant defense mechanism and oxidative DNA repair activity. The diminution of oxidative damage may explain the clinical benefit of pioglitazone treatment in patients with non-alcoholic fatty liver disease. PMID:18822121

  15. Menadione-Induced DNA Damage Leads to Mitochondrial Dysfunction and Fragmentation During Rosette Formation in Fuchs Endothelial Corneal Dystrophy.

    Halilovic, Adna; Schmedt, Thore; Benischke, Anne-Sophie; Hamill, Cecily; Chen, Yuming; Santos, Janine Hertzog; Jurkunas, Ula V

    2016-06-20

    Fuchs endothelial corneal dystrophy (FECD), a leading cause of age-related corneal edema requiring transplantation, is characterized by rosette formation of corneal endothelium with ensuing apoptosis. We sought to determine whether excess of mitochondrial reactive oxygen species leads to chronic accumulation of oxidative DNA damage and mitochondrial dysfunction, instigating cell death. We modeled the pathognomonic rosette formation of postmitotic corneal cells by increasing endogenous cellular oxidative stress with menadione (MN) and performed a temporal analysis of its effect in normal (HCEnC, HCECi) and FECD (FECDi) cells and ex vivo specimens. FECDi and FECD ex vivo specimens exhibited extensive mtDNA and nDNA damage as detected by quantitative PCR. Exposure to MN triggered an increase in mitochondrial superoxide levels and led to mtDNA and nDNA damage, while DNA amplification was restored with NAC pretreatment. Furthermore, MN exposure led to a decrease in ΔΨm and adenosine triphosphate levels in normal cells, while FECDi exhibited mitochondrial dysfunction at baseline. Mitochondrial fragmentation and cytochrome c release were detected in FECD tissue and after MN treatment of HCEnCs. Furthermore, cleavage of caspase-9 and caspase-3 followed MN-induced cytochrome c release in HCEnCs. This study provides the first line of evidence that accumulation of oxidative DNA damage leads to rosette formation, loss of functionally intact mitochondria via fragmentation, and subsequent cell death during postmitotic cell degeneration of ocular tissue. MN induced rosette formation, along with mtDNA and nDNA damage, mitochondrial dysfunction, and fragmentation, leading to activation of the intrinsic apoptosis via caspase cleavage and cytochrome c release. Antioxid. Redox Signal. 24, 1072-1083.

  16. Fluorographic determination of /sup 3/H-labelled hepatitis B virus DNA and other viral DNAs

    Jantschak, J; Meisel, H

    1986-01-01

    The radioactivity of aqueous samples of /sup 3/H-labelled DNA can easily be determined by a quantitative fluorographic assay. 25 samples were collected and fixed simultaneously onto a membrane filter. Their fluorographic film blackening is compared densitometrically or visually to that of standard samples. The lower limit of detection is 1.7 Bq (100 dpm). This procedure is very effective when dealing with high numbers of samples and presents an economically favorable alternative to scintillation counting. The efficiency of the method for the assay of different DNA polymerase activities (hepatitis B virus, bovine leukemia virus, bacteriophage T 4) could be demonstrated.

  17. A comparison of synthetic oligodeoxynucleotides, DNA fragments and AAV-1 for targeted episomal and chromosomal gene repair

    Leclerc Xavier

    2009-04-01

    Full Text Available Abstract Background Current strategies for gene therapy of inherited diseases consist in adding functional copies of the gene that is defective. An attractive alternative to these approaches would be to correct the endogenous mutated gene in the affected individual. This study presents a quantitative comparison of the repair efficiency using different forms of donor nucleic acids, including synthetic DNA oligonucleotides, double stranded DNA fragments with sizes ranging from 200 to 2200 bp and sequences carried by a recombinant adeno-associated virus (rAAV-1. Evaluation of each gene repair strategy was carried out using two different reporter systems, a mutated eGFP gene or a dual construct with a functional eGFP and an inactive luciferase gene, in several different cell systems. Gene targeting events were scored either following transient co-transfection of reporter plasmids and donor DNAs, or in a system where a reporter construct was stably integrated into the chromosome. Results In both episomal and chromosomal assays, DNA fragments were more efficient at gene repair than oligonucleotides or rAAV-1. Furthermore, the gene targeting frequency could be significantly increased by using DNA repair stimulating drugs such as doxorubicin and phleomycin. Conclusion Our results show that it is possible to obtain repair frequencies of 1% of the transfected cell population under optimized transfection protocols when cells were pretreated with phleomycin using rAAV-1 and dsDNA fragments.

  18. A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

    Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

    1986-09-01

    The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

  19. Detection of hepatitis B virus DNA sequences in infected hepatocytes by in situ cytohybridisation

    Gowans, E.J.; Burrell, C.J.; Jilbert, A.R.; Marmion, B.P.

    1981-01-01

    Plasmid pHBV 114 DNA, which contains 73% of the genome of hepatitis B virus (HBV), was radiolabelled with tritium to 1-2 X 10(8) dpm/microgram by nick translation and used as a radioactive probe to detect HBV DNA present in sections of infected liver tissue by in situ hybridisation followed by autoradiography. Factors affecting the sensitivity of the reaction were examined, including different methods of fixation, hybridisation time, temperature, and buffers. The specificity of the reaction for detecting viral DNA was carefully established by the use of unrelated DNA probes, pretreatment of sections with DNAase, and comparing the stability of the binding of DNA probe at different temperatures, with the melting curve of double-stranded DNA in solution. In the one liver studied in detail, cells containing large amounts of viral DNA were distributed in foci corresponding to areas containing morphologically damaged hepatocytes. This observation suggested a relationship between active viral replication and cell damage. Viral DNA was found mainly in the cytoplasm, although a minority of nuclei in these foci were also positive

  20. Cloning Should Be Simple: Escherichia coli DH5α-Mediated Assembly of Multiple DNA Fragments with Short End Homologies

    Richardson, Ruth E.; Suzuki, Yo

    2015-01-01

    Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330

  1. Assessment of Hepatitis B Virus DNA Stability in Serum by the Chiron Quantiplex Branched-DNA Assay

    Krajden, Mel; Comanor, Lorraine; Rifkin, Oretta; Grigoriew, Anna; Minor, James M.; Kapke, Gordon F.

    1998-01-01

    Quantification of hepatitis B virus (HBV) DNA in serum is used to establish eligibility for treatment and to monitor therapeutic response. With the trend toward centralized testing, defining the conditions that preserve sample integrity is of paramount importance. We therefore evaluated the stability of HBV DNA in 26 previously frozen (PF) and 5 fresh, never previously frozen serum specimens. PF specimens, covering a 3-log10 HBV DNA dynamic range, were thawed and stored at −70, 4, 23, 37, and 45°C (±1.5°C) for 0, 24, 72, and 120 h (±2 h) and were refrozen at −70°C prior to testing. Five fresh specimens were split into two groups. Both group FG1 and group FG2 specimens were handled as described above; however, group FG1 specimens were subsequently maintained at 4°C and were never frozen prior to testing. Linear regression analysis of PF specimens demonstrated no significant HBV DNA degradation at ≤4°C over 5 days; however, HBV DNA levels decreased by 1.8, 3.4, and 20% per day at 23, 37, and 45°C, respectively. Three independent statistical methods confirmed that the probability of specimen failure, defined as a loss of 20% or more of HBV DNA and/or coagulation of serum, was lowest at ≤4°C and increased with temperature. Because only 10 to 20% of individual patient specimens demonstrated losses of HBV DNA of ≥20% at 23 or 37°C, sufficient numbers of serum specimens must be evaluated to determine overall statistical trends. In conclusion, HBV DNA integrity in separated serum specimens is preserved for at least 5 days when the specimens are stored at −70 or 4°C. PMID:9466745

  2. Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

    Jorge A. Bertolotto

    2016-06-01

    Full Text Available In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

  3. DNA fragmentation and apoptosis induced by safranal in human prostate cancer cell line

    Saeed Samarghandian

    2013-01-01

    Full Text Available Objectives: Apoptosis, an important mechanism that contributes to cell growth reduction, is reported to be induced by Crocus sativus (Saffron in different cancer types. However, limited effort has been made to correlate these effects to the active ingredients of saffron. The present study was designed to elucidate cytotoxic and apoptosis induction by safranal, the major coloring compound in saffron, in a human prostate cancer cell line (PC-3. Materials and Methods: PC-3 and human fetal lung fibroblast (MRC-5 cells were cultured and exposed to safranal (5, 10, 15, and 20 μg/ml. The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay was performed to assess cytotoxicity. DNA fragmentation was assessed by gel electrophoresis. Cells were incubated with different concentrations of safranal, and cell morphologic changes and apoptosis were determined by the normal inverted microscope, Annexin V, and propidium iodide, followed by flow cytometric analysis, respectively. Results: MTT assay revealed a remarkable and concentration-dependent cytotoxic effect of safranal on PC-3 cells in comparison with non-malignant cell line. The morphologic alterations of the cells confirmed the MTT results. The IC 50 values against PC-3 cells were found to be 13.0 ΁ 0.07 and 6.4 ΁ 0.09 μg/ml at 48 and 72 h, respectively. Safranal induced an early and late apoptosis in the flow cytometry histogram of treated cells, indicating apoptosis is involved in this toxicity. DNA analysis revealed typical ladders as early as 48 and 72 h after treatment, indicative of apoptosis. Conclusions: Our preclinical study demonstrated a prostate cancer cell line to be highly sensitive to safranal-mediated growth inhibition and apoptotic cell death. Although the molecular mechanisms of safranal action are not clearly understood, it appears to have potential as a therapeutic agent.

  4. Circulating bacterial-derived DNA fragment level is a strong predictor of cardiovascular disease in peritoneal dialysis patients.

    Cheuk-Chun Szeto

    Full Text Available Circulating bacterial DNA fragment is related to systemic inflammatory state in peritoneal dialysis (PD patients. We hypothesize that plasma bacterial DNA level predicts cardiovascular events in new PD patients.We measured plasma bacterial DNA level in 191 new PD patients, who were then followed for at least a year for the development of cardiovascular event, hospitalization, and patient survival.The average age was 59.3 ± 11.8 years; plasma bacterial DNA level 34.9 ± 1.5 cycles; average follow up 23.2 ± 9.7 months. At 24 months, the event-free survival was 86.1%, 69.8%, 55.4% and 30.8% for plasma bacterial DNA level quartiles I, II, III and IV, respectively (p < 0.0001. After adjusting for confounders, plasma bacterial DNA level, baseline residual renal function and malnutrition-inflammation score were independent predictors of composite cardiovascular end-point; each doubling in plasma bacterial DNA level confers a 26.9% (95% confidence interval, 13.0 - 42.5% excess in risk. Plasma bacterial DNA also correlated with the number of hospital admission (r = -0.379, p < 0.0001 and duration of hospitalization for cardiovascular reasons (r = -0.386, p < 0.0001. Plasma bacterial DNA level did not correlate with baseline arterial pulse wave velocity (PWV, but with the change in carotid-radial PWV in one year (r = -0.238, p = 0.005.Circulating bacterial DNA fragment level is a strong predictor of cardiovascular event, need of hospitalization, as well as the progressive change in arterial stiffness in new PD patients.

  5. Molecular and FISH analyses of a 53-kbp intact DNA fragment inserted by biolistics in wheat (Triticum aestivum L.) genome.

    Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P

    2017-10-01

    A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.

  6. Effect of DNA sequence of Fab fragment on yield characteristics and cell growth of E. coli.

    Kulmala, Antti; Huovinen, Tuomas; Lamminmäki, Urpo

    2017-06-19

    Codon usage is one of the factors influencing recombinant protein expression. We were interested in the codon usage of an antibody Fab fragment gene exhibiting extreme toxicity in the E. coli host. The toxic synthetic human Fab gene contained domains optimized by the "one amino acid-one codon" method. We redesigned five segments of the Fab gene with a "codon harmonization" method described by Angov et al. and studied the effects of these changes on cell viability, Fab yield and display on filamentous phage using different vectors and bacterial strains. The harmonization considerably reduced toxicity, increased Fab expression from negligible levels to 10 mg/l, and restored the display on phage. Testing the impact of the individual redesigned segments revealed that the most significant effects were conferred by changes in the constant domain of the light chain. For some of the Fab gene variants, we also observed striking differences in protein yields when cloned from a chloramphenicol resistant vector into an identical vector, except with ampicillin resistance. In conclusion, our results show that the expression of a heterodimeric secretory protein can be improved by harmonizing selected DNA segments by synonymous codons and reveal additional complexity involved in heterologous protein expression.

  7. Hairpin and duplex formation in DNA fragments CCAATTTTGG, CCAATTTTTTGG, and CCATTTTTGG: a proton NMR study

    Pramanik, P.; Kanhouwa, N.; Kan, L.

    1988-01-01

    Three DNA fragments, CCAATTTTGG (1), CCAATTTTTTGG (2), AND CCATTTTTGG (3), were studied by proton NMR spectroscopy in aqueous solution. All these oligodeoxyribonucleotides contain common sequences at the 5' and 3' ends (5'-CCA and TGG-3'). 2 as well as 3 forms only hairpin structures with four unpaired thymidylyl units, four and three base pair stems, respectively, in neutral solution under low and high NaCl concentrations. At high salt concentration the oligomer 1 forms a duplex structure with -TT- internal loop. On the other hand, the same oligomer forms a stable hairpin structure at low salt and low strand concentrations at pH 7. The hairpin structure of 1 has a stem containing only three base pairs (CCA x TGG) and a loop containing four nucleotides (-ATTT-) that includes a dissociated A x T base pair. The two secondary structures of 1 coexist in an aqueous solution containing 0.1 M NaCl, at pH 7. The equilibrium shifts to the hairpin side when the temperature is raised. The stabilities and base-stacking modes of all three oligonucleotides in tow different structures are reported

  8. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Birla, Bhagyashree S; Chou, Hui-Hsien

    2015-01-01

    Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  9. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Bhagyashree S Birla

    Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  10. Detection of Hepatocyte Clones Containing Integrated Hepatitis B Virus DNA Using Inverse Nested PCR.

    Tu, Thomas; Jilbert, Allison R

    2017-01-01

    Chronic hepatitis B virus (HBV) infection is a major cause of liver cirrhosis and hepatocellular carcinoma (HCC), leading to ~600,000 deaths per year worldwide. Many of the steps that occur during progression from the normal liver to cirrhosis and/or HCC are unknown. Integration of HBV DNA into random sites in the host cell genome occurs as a by-product of the HBV replication cycle and forms a unique junction between virus and cellular DNA. Analyses of integrated HBV DNA have revealed that HCCs are clonal and imply that they develop from the transformation of hepatocytes, the only liver cell known to be infected by HBV. Integrated HBV DNA has also been shown, at least in some tumors, to cause insertional mutagenesis in cancer driver genes, which may facilitate the development of HCC. Studies of HBV DNA integration in the histologically normal liver have provided additional insight into HBV-associated liver disease, suggesting that hepatocytes with a survival or growth advantage undergo high levels of clonal expansion even in the absence of oncogenic transformation. Here we describe inverse nested PCR (invPCR), a highly sensitive method that allows detection, sequencing, and enumeration of virus-cell DNA junctions formed by the integration of HBV DNA. The invPCR protocol is composed of two major steps: inversion of the virus-cell DNA junction and single-molecule nested PCR. The invPCR method is highly specific and inexpensive and can be tailored to DNA extracted from large or small amounts of liver. This procedure also allows detection of genome-wide random integration of any known DNA sequence and is therefore a useful technique for molecular biology, virology, and genetic research.

  11. The mechanism of thioacetamide-induced apoptosis in the L37 albumin-SV40 T-antigen transgenic rat hepatocyte-derived cell line occurs without DNA fragmentation.

    Bulera, S J; Sattler, C A; Gast, W L; Heath, S; Festerling, T A; Pitot, H C

    1998-10-01

    The hepatotoxicant thioacetamide (TH) has classically been used as a model to study hepatic necrosis; however, recent studies have shown that TH can also induce apoptosis. In this report we demonstrate that 2.68+/-0.54% of the albumin-SV40 T-antigen transgenic rat hepatocytes undergo TH-induced apoptosis, a level comparable to other in vivo models of liver apoptosis. In addition, TH could induce apoptosis and necrosis in the L37 albumin-SV40 T-antigen transgenic rat liver-derived cell line. Examination of dying L37 cells treated with 100 mM TH by electron microscopy revealed distinct morphological characteristics that could be attributed to apoptosis. Quantitation of apoptosis by FACS analysis 24 h after treatment with 100 mM TH revealed that 81.3+/-1.6% of the cells were undergoing apoptosis. In contrast, when L37 cells were treated with 250 mM TH, cells exhibited characteristics consistent with necrotic cell death. DNA fragmentation ladders were produced by growth factor withdrawal-induced apoptosis; however, in 100 mM TH-induced apoptosis, DNA fragmentation ladders were not observed. Analysis of endonuclease activity in L37 cells revealed that the enzymes were not inactivated in the presence of 100 mM TH. The data presented in this report indicate that the L37 cell line could be used to study the mechanism of TH-induced apoptosis that was not mediated through a mechanism requiring DNA fragmentation.

  12. Plasmid DNA loaded chitosan nanoparticles for nasal mucosal immunization against hepatitis B.

    Khatri, Kapil; Goyal, Amit K; Gupta, Prem N; Mishra, Neeraj; Vyas, Suresh P

    2008-04-16

    This work investigates the preparation and in vivo efficacy of plasmid DNA loaded chitosan nanoparticles for nasal mucosal immunization against hepatitis B. Chitosan pDNA nanoparticles were prepared using a complex coacervation process. Prepared nanoparticles were characterized for size, shape, surface charge, plasmid loading and ability of nanoparticles to protect DNA against nuclease digestion and for their transfection efficacy. Nasal administration of nanoparticles resulted in serum anti-HBsAg titre that was less compared to that elicited by naked DNA and alum adsorbed HBsAg, but the mice were seroprotective within 2 weeks and the immunoglobulin level was above the clinically protective level. However, intramuscular administration of naked DNA and alum adsorbed HBsAg did not elicit sIgA titre in mucosal secretions that was induced by nasal immunization with chitosan nanoparticles. Similarly, cellular responses (cytokine levels) were poor in case of alum adsorbed HBsAg. Chitosan nanoparticles thus produced humoral (both systemic and mucosal) and cellular immune responses upon nasal administration. The study signifies the potential of chitosan nanoparticles as DNA vaccine carrier and adjuvant for effective immunization through non-invasive nasal route.

  13. Enhanced immunogenicity of DNA fusion vaccine encoding secreted hepatitis B surface antigen and chemokine RANTES

    Kim, Seung Jo; Suh, Dongchul; Park, Sang Eun; Park, Jeong-Sook; Byun, Hyang-Min; Lee, Chan; Lee, Sun Young; Kim, Inho; Oh, Yu-Kyoung

    2003-01-01

    To increase the potency of DNA vaccines, we constructed genetic fusion vaccines encoding antigen, secretion signal, and/or chemokine RANTES. The DNA vaccines encoding secreted hepatitis B surface antigen (HBsAg) were constructed by inserting HBsAg gene into an expression vector with an endoplasmic reticulum (ER)-targeting secretory signal sequence. The plasmid encoding secretory HBsAg (pER/HBs) was fused to cDNA of RANTES, generating pER/HBs/R. For comparison, HBsAg genes were cloned into pVAX1 vector with no signal sequence (pHBs), and further linked to the N-terminus of RANTES (pHBs/R). Immunofluorescence study showed the cytoplasmic localization of HBsAg protein expressed from pHBs and pHBs/R, but not from pER/HBs and pER/HBs/R at 48 h after transfection. In mice, RANTES-fused DNA vaccines more effectively elicited the levels of HBsAg-specific IgG antibodies than pHBs. All the DNA vaccines induced higher levels of IgG 2a rather than IgG 1 antibodies. Of RANTES-fused vaccines, pER/HBs/R encoding the secreted fusion protein revealed much higher humoral and CD8 + T cell-stimulating responses compared to pHBs/R. These results suggest that the immunogenicity of DNA vaccines could be enhanced by genetic fusion to a secretory signal peptide sequence and RANTES

  14. Rapid and label-free electrochemical DNA biosensor for detecting hepatitis A virus.

    Manzano, Marisa; Viezzi, Sara; Mazerat, Sandra; Marks, Robert S; Vidic, Jasmina

    2018-02-15

    Diagnostic systems that can deliver highly specific and sensitive detection of hepatitis A virus (HAV) in food and water are of particular interest in many fields including food safety, biosecurity and control of outbreaks. Our aim was the development of an electrochemical method based on DNA hybridization to detect HAV. A ssDNA probe specific for HAV (capture probe) was designed and tested on DNAs from various viral and bacterial samples using Nested-Reverse Transcription Polymerase Chain Reaction (nRT-PCR). To develop the electrochemical device, a disposable gold electrode was functionalized with the specific capture probe and tested on complementary ssDNA and on HAV cDNA. The DNA hybridization on the electrode was measured through the monitoring of the oxidative peak potential of the indicator tripropylamine by cyclic voltammetry. To prevent non-specific binding the gold surface was treated with 3% BSA before detection. High resolution atomic force microscopy (AFM) confirmed the efficiency of electrode functionalization and on-electrode hybridization. The proposed device showed a limit of detection of 0.65pM for the complementary ssDNA and 6.94fg/µL for viral cDNA. For a comparison, nRT-PCR quantified the target HAV cDNA with a limit of detection of 6.4fg/µL. The DNA-sensor developed can be adapted to a portable format to be adopted as an easy-to- use and low cost method for screening HAV in contaminated food and water. In addition, it can be useful for rapid control of HAV infections as it takes only a few minutes to provide the results. Copyright © 2017. Published by Elsevier B.V.

  15. A Saccharomyces cerevisiae mitochondrial DNA fragment activates Reg1p-dependent glucose-repressible transcription in the nucleus.

    Santangelo, G M; Tornow, J

    1997-12-01

    As part of an effort to identify random carbon-source-regulated promoters in the Saccharomyces cerevisiae genome, we discovered that a mitochondrial DNA fragment is capable of directing glucose-repressible expression of a reporter gene. This fragment (CR24) originated from the mitochondrial genome adjacent to a transcription initiation site. Mutational analyses identified a GC cluster within the fragment that is required for transcriptional induction. Repression of nuclear CR24-driven transcription required Reg1p, indicating that this mitochondrially derived promoter is a member of a large group of glucose-repressible nuclear promoters that are similarly regulated by Reg1p. In vivo and in vitro binding assays indicated the presence of factors, located within the nucleus and the mitochondria, that bind to the GC cluster. One or more of these factors may provide a regulatory link between the nucleus and mitochondria.

  16. Fibered confocal fluorescence microscopy for imaging apoptotic DNA fragmentation at the single-cell level in vivo

    Al-Gubory, Kais H.

    2005-01-01

    The major characteristic of cell death by apoptosis is the loss of nuclear DNA integrity by endonucleases, resulting in the formation of small DNA fragments. The application of confocal imaging to in vivo monitoring of dynamic cellular events, like apoptosis, within internal organs and tissues has been limited by the accessibility to these sites. Therefore, the aim of the present study was to test the feasibility of fibered confocal fluorescence microscopy (FCFM) to image in situ apoptotic DNA fragmentation in surgically exteriorized sheep corpus luteum in the living animal. Following intra-luteal administration of a fluorescent DNA-staining dye, YO-PRO-1, DNA cleavage within nuclei of apoptotic cells was serially imaged at the single-cell level by FCFM. This imaging technology is sufficiently simple and rapid to allow time series in situ detection and visualization of cells undergoing apoptosis in the intact animal. Combined with endoscope, this approach can be used for minimally invasive detection of fluorescent signals and visualization of cellular events within internal organs and tissues and thereby provides the opportunity to study biological processes in the natural physiological environment of the cell in living animals

  17. Branched-DNA signal amplification combined with paper chromatography hybridization assay and used in hepatitis B virus DNA detection

    Fu, F.Z.; Liu, L.X.; Wang, W.Q.; Sun, S. H.; Liu, L.B.

    2002-01-01

    Nucleic acids detection method is vital to the clinical pathogen diagnosis. The established method can be classified into target direct amplification and signal amplification format according to the target DNA or RNA being directly amplified or not. Those methods have advantages and disadvantages respectively in the clinical application. In the United States of American, branched-DNA as a strong signal amplifier is broadly used in the quantification of the nucleic acids. To gain satisfied sensitivity, some expensive label molecular and instruments should be adopted. Personnel should be special trained to perform. Hence, those can't be widely carried out in the Third World. To avoid those disadvantages, we used the branched-DNA amplifier in the paper chromatography hybridization assay. Methods: Branched DNA signal amplifier and series of probes complementary to the nucleic acid sequence of hepatitis B virus (HBV) have been synthesized. HBV-DNA or it's capture probe were immobilized on the high flow nitrocellulose strip. Having loaded at one end of the strip in turn, probes or HBV-DNA in the hybridization solution migrate to the opposite end of the strip by capillary forces and hybridizes to the immobilized DNA. The branched-DNA signal amplifier and probe labeled with biotin or 32P were then loaded. Through streptavidin-alkaline phosphatase (SA-AP) conjugate and NBT/BCIP ( the specific chromogenic substrate of AP) or autoradiography, the result can be visualized by color reaction or image production on the X-ray film. Results: The sensitivity of this HBV-DNA detection method used probe labeled with biotin and 32P are 1ng and 10pg. The method using the probe labeled with biotin is simple and rapid (2h) without depending on special instruments, it also avoids the pollution of EtBr which can lead to tumor. And the method using the probe labeled with 32P is simple and sensitive, with the exception of long time autoradiography and the inconvenient isotopic disposal

  18. Sperm DNA fragmentation index does not correlate with blastocyst aneuploidy or morphological grading.

    Itai Gat

    Full Text Available High DNA fragmentation index (DFI may be associated with poor outcome after IVF. Our aim was to determine whether DFI impacts blastocyst quality or clinical outcome. This retrospective study included 134 couples who underwent 177 IVF-ICSI and pre-implantation genetic screening (PGS cycles during January 1st, 2014-March 31st, 2016 and had documented previous DFI. Group 1 (DFI>30% encompassed 25 couples who underwent 36 cycles; Group 2 (DFI 15-30% included 45 couples and 57 cycles; group 3 (DFI<15% included 64 couples and 83 cycles. Male partners within group 1 were older (45.1 compared to 40.6 and 38.3 years, respectively, p<0.05, had higher BMI (32.4 compared to 26.6 and 25.8 respectively, p<0.05 and lower sperm count and motility (46*106/ml and 35.5%, respectively compared to groups 2 (61.8*106/ml and 46.6%, respectively and 3 (75.8*106/ml and 55.1%, respectively, p<0.05. Female parameters including ovarian reserve and response and embryo development were similar. Total numbers of biopsied blastocysts were 116, 175 and 259 in groups 1, 2 and 3, respectively. PGS for 24 chromosomes revealed comparable euploidy rate of 46-50.4%, with a similar morphological classification. No significant differences were found regarding pregnancy rates or pregnancy loss. It seems that DFI doesn't correlate with blastocyst aneuploidy or morphological grading.

  19. Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

    Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

    2013-01-01

    A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

  20. Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

    Yuming Lu

    Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

  1. A polymer, random walk model for the size-distribution of large DNA fragments after high linear energy transfer radiation

    Ponomarev, A. L.; Brenner, D.; Hlatky, L. R.; Sachs, R. K.

    2000-01-01

    DNA double-strand breaks (DSBs) produced by densely ionizing radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. Stochastic DSB clustering at large scales, from > 100 Mbp down to simulations and analytic equations. A random-walk, coarse-grained polymer model for chromatin is combined with a simple track structure model in Monte Carlo software called DNAbreak and is applied to data on alpha-particle irradiation of V-79 cells. The chromatin model neglects molecular details but systematically incorporates an increase in average spatial separation between two DNA loci as the number of base-pairs between the loci increases. Fragment-size distributions obtained using DNAbreak match data on large fragments about as well as distributions previously obtained with a less mechanistic approach. Dose-response relations, linear at small doses of high linear energy transfer (LET) radiation, are obtained. They are found to be non-linear when the dose becomes so large that there is a significant probability of overlapping or close juxtaposition, along one chromosome, for different DSB clusters from different tracks. The non-linearity is more evident for large fragments than for small. The DNAbreak results furnish an example of the RLC (randomly located clusters) analytic formalism, which generalizes the broken-stick fragment-size distribution of the random-breakage model that is often applied to low-LET data.

  2. Findings on sperm alterations and DNA fragmentation, nutritional, hormonal and antioxidant status in an elite triathlete: case report

    Vaamonde, D.; Silva-Grigoletto, M.E. Da; Fernandez, J.M.; Algar-Santacruz, C.; García-Manso, J.M.

    2014-01-01

    Objective: The present case study analyzes semen quality, nutritional patterns, and hormonal and oxidative status of an international high-level triathlete with a low-volume, high-intensity training load. Method: The athlete was 26 years old, having participated in competitions since he was 13 years old, and practiced professional triathlon for the last five years. The qualitative sperm parameters analyzed were volume, sperm count, motility, morphology, and DNA fragmentation (additional testi...

  3. Findings on sperm alterations and DNA fragmentation, nutritional, hormonal and antioxidant status in an elite triathlete. Case report

    D. Vaamonde

    2014-12-01

    Conclusions: In this high-intensity endurance athlete, sperm parameters, mainly sperm morphology and DNA fragmentation, are altered. Further knowledge is needed with regards nutritional antioxidant intake and other dietetic strategies oriented toward avoiding oxidative damage in semen of high-performance triathletes. Moreover, adequate nutritional strategies must be found and nutritional advice given to athletes so as to palliate or dampen the effects of exercise on semen quality.

  4. HYPOLIPEDEMIC EFFECT OF CYNODON DACTYLON ON HISTOPATHOLOGICAL STUDY AND DNA FRAGMENTATION ANALYSIS IN EXPERIMENTALLY INDUCED HYPERCHOLESTEREMIC RATS

    C. Selva Kumar

    2011-01-01

    Hypercholesteremia is one of the risk factors for coronary artery disease. The present study highlights the efficacy of Ayurvedic herbal formulation Cynodon dactylon (Bermuda grass) on histopathological study and DNA fragmentation analysis in experimentally induced hypercholesteremic rats. Four groups of rats were employed namely control, hypercholesterolemia rats (4% Cholesterol+1% cholic acid), Cynodon dactylon treatment in hypercholesteremic rats and Cynodon dactylon alone treated rats. Re...

  5. cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

    D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

    1988-01-01

    cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

  6. Preparation of methacrylate-based anion-exchange monolithic microbore column for chromatographic separation of DNA fragments and oligonucleotides

    Sabarudin, Akhmad, E-mail: sabarjpn@ub.ac.id [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Department of Chemistry, Faculty of Science, Brawijaya University, Jl Veteran Malang 65145 (Indonesia); Huang, Junchao; Shu, Shin; Sakagawa, Shinnosuke [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Umemura, Tomonari, E-mail: umemura@apchem.nagoya-u.ac.jp [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan)

    2012-07-29

    Highlights: Black-Right-Pointing-Pointer Microbore-scale (1 mm i.d.) anion-exchange monolithic column. Black-Right-Pointing-Pointer Potentially preparative applications. Black-Right-Pointing-Pointer Separation of oligodeoxythymidylic acids and DNA fragments. - Abstract: In this paper, we report on the preparation of a microbore-scale (1 mm i.d.) anion-exchange monolithic column suitable not only for analytical purposes but also for potentially preparative applications. In order to meet the conflicting requirements of high permeability and good mechanical strength, the following two-step procedure was applied. First, an epoxy-containing monolith was synthesized by in situ copolymerization of glycidyl methacrylate (GMA) and ethylene dimethacrylate (EDMA) within the confines of a silicosteel tubing of 1.02 mm i.d. and 1/16 Double-Prime o.d. in the presence of a ternary porogenic mixture of 1-propanol, 1,4-butanediol, and water. The monolithic matrix was subsequently converted into weak anion-exchanger via the ring-opening reaction of epoxy group with diethyl amine. The dynamic binding capacity was 21.4 mg mL{sup -1} for bovine serum albumin (BSA) at 10% breakthrough. The morphology and porous structure of this monolith were assessed by scanning electron microscope (SEM) and inverse size exclusion chromatography (ISEC). To optimize the separation efficiency, the effects of various chromatographic parameters upon the separation of DNA fragments were investigated. The resulting monolithic anion exchanger demonstrated good potential for the separation of both single- and double-stranded DNA molecules using a gradient elution with NaCl in Tris-HCl buffer (20 mM). Oligodeoxythymidylic acids (dT{sub 12}-dT{sub 18}) were successfully resolved at pH 8, while the fragments of 20 bp DNA ladder, 100 bp DNA ladder, and pBR322-HaeIII digest were efficiently separated at pH 9.

  7. Inhibition of hepatitis B virus replication with linear DNA sequences expressing antiviral micro-RNA shuttles

    Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie; Weinberg, Marc S.; Arbuthnot, Patrick

    2009-01-01

    RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR) shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.

  8. Inhibition of hepatitis B virus replication with linear DNA sequences expressing antiviral micro-RNA shuttles

    Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie; Weinberg, Marc S. [Antiviral Gene Therapy Research Unit, University of the Witwatersrand (South Africa); Arbuthnot, Patrick, E-mail: Patrick.Arbuthnot@wits.ac.za [Antiviral Gene Therapy Research Unit, University of the Witwatersrand (South Africa)

    2009-11-20

    RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR) shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.

  9. New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA.

    1987-10-13

    after multiple passages in vivo and in vitro. J. Gen. Virol. 67, 1741- 1744. Sabin , A.B. (1985). Oral poliovirus vaccine : history of its development...IN (N NEW APPROACHES TO ATTENUATED HEPATITIS A VACCINE DEVELOPMENT: Q) CLONING AND SEQUENCING OF CELL-CULTURE ADAPTED VIRAL cDNA I ANNUAL REPORT...6ll02Bsl0 A 055 11. TITLE (Include Security Classification) New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell

  10. Serum hepatitis B core-related antigen is a satisfactory surrogate marker of intrahepatic covalently closed circular DNA in chronic hepatitis B.

    Chen, En-Qiang; Feng, Shu; Wang, Meng-Lan; Liang, Ling-Bo; Zhou, Ling-Yun; Du, Ling-Yao; Yan, Li-Bo; Tao, Chuan-Min; Tang, Hong

    2017-03-14

    Recently, hepatitis B core-related antigen (HBcrAg) has been suggested as an additional marker of hepatitis B virus (HBV) infection. This study aimed to investigate whether serum quantitative HBcrAg (qHBcrAg) was a satisfactory surrogate marker of intrahepatic covalently closed circular DNA (cccDNA). A total of 139 patients with liver biopsy were enrolled, consisting of 59 patients in immune tolerance (IT) phase, 52 patients in immune clearance (IC) phase, 18 patients in low-replication (LR) phase, and 10 patients in reactivation phase. All patients in IC phase have received entecavir (ETV) therapy, and 32 of them undergone a second liver biopsy at 24 months. Among those patients, qHBcrAg was strongly correlated with intrahepatic cccDNA, which is superior to that of qHBsAg and HBV DNA. And similar findings were also observed in patients in IT, IC, LR and reactivation phases. Among the 32 ETV-treated patients with a second liver biopsy in IC phase, the decline of intrahepatic cccDNA was accompanied by changes in both qHBcrAg and qHBsAg. However, as compared to qHBsAg, the change of qHBcrAg was more strongly associated with intrahepatic cccDNA-decline. In summary, serum qHBcrAg should be a satisfactory surrogate of intrahepatic HBV cccDNA in CHB patients.

  11. Inhibition of Hepatitis B virus cccDNA replication by siRNA

    Li Guiqiu; Gu Hongxi; Li Di; Xu Weizhen

    2007-01-01

    The development of an effective therapy for Hepatitis B virus (HBV) infection is still a challenge. Progress in RNA interference (RNAi) has shed slight on developing a new anti-HBV strategy. Here, we present a series of experiments showing a significant reduction in HBV transcripts and replication intermediates in HepG2.2.15 cells by vector-based siRNA targeted nuclear localization signal (NLS) region. More importantly, we showed that siRNA1 markedly inhibited HBV covalently closed circular DNA (cccDNA) replication. Our results indicated that HBV NLS may serve as a novel RNAi target to combat HBV infection, which can enhance anti-HBV efficacy and overcome the drawbacks of current therapies

  12. Preparation of genosensor for detection of specific DNA sequence of the hepatitis B virus

    Honorato Castro, Ana C.; França, Erick G.; de Paula, Lucas F.; Soares, Marcia M. C. N.; Goulart, Luiz R.; Madurro, João M.; Brito-Madurro, Ana G.

    2014-09-01

    An electrochemical genosensor was constructed for detection of specific DNA sequence of the hepatitis B virus, based on graphite electrodes modified with poly(4-aminophenol) and incorporating a specific oligonucleotide probe. The modified electrode containing the probe was evaluated by differential pulse voltammetry, before and after incubation with the complementary oligonucleotide target. Detection was performed by monitoring oxidizable DNA bases (direct detection) or using ethidium bromide as indicator of the hybridization process (indirect detection). The device showed a detection limit for the oligonucleotide target of 2.61 nmol L-1. Indirect detection using ethidium bromide was promising in discriminating mismatches, which is a very desirable attribute for detection of disease-related point mutations. In addition, it was possible to observe differences between hybridized and non-hybridized surfaces by atomic force microscopy.

  13. Bisphenol A induces oxidative stress and DNA damage in hepatic tissue of female rat offspring

    Jehane I. Eid

    2015-08-01

    Full Text Available Bisphenol A (BPA is an endocrine disrupting compound widely spread in our living environment. It is a contaminant with increasing exposure to it and exerts both toxic and estrogenic effects on mammalian cells. Due to the limited information concerning the effect of BPA on the liver, the present study was designed to assess hepatic tissue injury induced by early life exposure to BPA in female rat offspring. Rat dams (n = 9 were gavaged with 0.5 and 50 mg of BPA/kg b.w./day throughout lactation until weaning. The sham group received olive oil for the same duration while the control group did not receive any injection. The liver tissue was collected from female pups at different pubertal periods (PND50, 90 and 110 to evaluate oxidative stress biomarkers, extent of DNA damage and histopathological changes. Our results indicated that early life exposure to BPA significantly increased oxidative/nitrosative stress, decreased antioxidant enzyme activities, induced DNA damage and chronic severe inflammation in the hepatic tissue in a time dependent manner. These data suggested that BPA causes long-term adverse effects on the liver, which leads to deleterious effects in the liver of female rat offspring.

  14. Preparation of genosensor for detection of specific DNA sequence of the hepatitis B virus

    Honorato Castro, Ana C.; França, Erick G.; Paula, Lucas F. de; Soares, Marcia M.C.N.; Goulart, Luiz R.; Madurro, João M.; Brito-Madurro, Ana G.

    2014-01-01

    Graphical abstract: - Highlights: • Specific oligonucleotide detection for hepatitis B based on poly-4-aminophenol matrix. • Electrochemical detection of the gene specific using ethidium bromide as indicator. • The detection limit was 2.61 nmol L −1 , with a correlation coefficient of 0.998 (n = 3). • The system discriminates three-base mismatches and non-complementary target. - Abstract: An electrochemical genosensor was constructed for detection of specific DNA sequence of the hepatitis B virus, based on graphite electrodes modified with poly(4-aminophenol) and incorporating a specific oligonucleotide probe. The modified electrode containing the probe was evaluated by differential pulse voltammetry, before and after incubation with the complementary oligonucleotide target. Detection was performed by monitoring oxidizable DNA bases (direct detection) or using ethidium bromide as indicator of the hybridization process (indirect detection). The device showed a detection limit for the oligonucleotide target of 2.61 nmol L −1 . Indirect detection using ethidium bromide was promising in discriminating mismatches, which is a very desirable attribute for detection of disease-related point mutations. In addition, it was possible to observe differences between hybridized and non-hybridized surfaces by atomic force microscopy

  15. Preparation of genosensor for detection of specific DNA sequence of the hepatitis B virus

    Honorato Castro, Ana C.; França, Erick G. [Institute of Genetics and Biochemistry, Federal University of Uberlândia, Uberlândia (Brazil); Paula, Lucas F. de [Institute of Chemistry, Federal University of Uberlândia, Uberlândia (Brazil); Soares, Marcia M.C.N. [Adolfo Lutz Institute, Regional Laboratory in São José do Rio Preto (Brazil); Goulart, Luiz R. [Institute of Genetics and Biochemistry, Federal University of Uberlândia, Uberlândia (Brazil); Madurro, João M. [Institute of Chemistry, Federal University of Uberlândia, Uberlândia (Brazil); Brito-Madurro, Ana G., E-mail: agbrito@iqufu.ufu.br [Institute of Genetics and Biochemistry, Federal University of Uberlândia, Uberlândia (Brazil)

    2014-09-30

    Graphical abstract: - Highlights: • Specific oligonucleotide detection for hepatitis B based on poly-4-aminophenol matrix. • Electrochemical detection of the gene specific using ethidium bromide as indicator. • The detection limit was 2.61 nmol L{sup −1}, with a correlation coefficient of 0.998 (n = 3). • The system discriminates three-base mismatches and non-complementary target. - Abstract: An electrochemical genosensor was constructed for detection of specific DNA sequence of the hepatitis B virus, based on graphite electrodes modified with poly(4-aminophenol) and incorporating a specific oligonucleotide probe. The modified electrode containing the probe was evaluated by differential pulse voltammetry, before and after incubation with the complementary oligonucleotide target. Detection was performed by monitoring oxidizable DNA bases (direct detection) or using ethidium bromide as indicator of the hybridization process (indirect detection). The device showed a detection limit for the oligonucleotide target of 2.61 nmol L{sup −1}. Indirect detection using ethidium bromide was promising in discriminating mismatches, which is a very desirable attribute for detection of disease-related point mutations. In addition, it was possible to observe differences between hybridized and non-hybridized surfaces by atomic force microscopy.

  16. Detection of Hepatitis B Virus M204I Mutation by Quantum Dot-Labeled DNA Probe

    Cheng Zhang

    2017-04-01

    Full Text Available Quantum dots (QDs are semiconductor nanoparticles with a diameter of less than 10 nm, which have been widely used as fluorescent probes in biochemical analysis and vivo imaging because of their excellent optical properties. Sensitive and convenient detection of hepatitis B virus (HBV gene mutations is important in clinical diagnosis. Therefore, we developed a sensitive, low-cost and convenient QDs-mediated fluorescent method for the detection of HBV gene mutations in real serum samples from chronic hepatitis B (CHB patients who had received lamivudine or telbivudine antiviral therapy. We also evaluated the efficiency of this method for the detection of drug-resistant mutations compared with direct sequencing. In CHB, HBV DNA from the serum samples of patients with poor response or virological breakthrough can be hybridized to probes containing the M204I mutation to visualize fluorescence under fluorescence microscopy, where fluorescence intensity is related to the virus load, in our method. At present, the limits of the method used to detect HBV genetic variations by fluorescence quantum dots is 103 IU/mL. These results show that QDs can be used as fluorescent probes to detect viral HBV DNA polymerase gene variation, and is a simple readout system without complex and expensive instruments, which provides an attractive platform for the detection of HBV M204I mutation.

  17. Multiplex electrochemiluminescence DNA sensor for determination of hepatitis B virus and hepatitis C virus based on multicolor quantum dots and Au nanoparticles

    Liu, Linlin; Wang, Xinyan; Ma, Qiang; Lin, Zihan; Chen, Shufan; Li, Yang; Lu, Lehui; Qu, Hongping; Su, Xingguang

    2016-01-01

    In this work, a novel multiplex electrochemiluminescence (ECL) DNA sensor has been developed for determination of hepatitis B virus (HBV) and hepatitis C virus (HCV) based on multicolor CdTe quantum dots (CdTe QDs) and Au nanoparticles (Au NPs). The electrochemically synthesized graphene nanosheets (GNs) were selected as conducting bridge to anchor CdTe QDs_5_5_1-capture DNA_H_B_V and CdTe QDs_6_0_7-capture DNA_H_C_V on the glassy carbon electrode (GCE). Then, different concentrations of target DNA_H_B_V and target DNA_H_C_V were introduced to hybrid with complementary CdTe QDs-capture DNA. Au NPs-probe DNA_H_B_V and Au NPs-probe DNA_H_C_V were modified to the above composite film via hybrid with the unreacted complementary CdTe QDs-capture DNA. Au NPs could quench the electrochemiluminescence (ECL) intensity of CdTe QDs due to the inner filter effect. Therefore, the determination of target DNA_H_B_V and target DNA_H_C_V could be achieved by monitoring the ECL DNA sensor based on Au NPs-probe DNA/target DNA/CdTe QDs-capture DNA/GNs/GCE composite film. Under the optimum conditions, the ECL intensity of CdTe QDs_5_5_1 and CdTe QDs_6_0_7 and the concentration of target DNA_H_B_V and target DNA_H_C_V have good linear relationship in the range of 0.0005–0.5 nmol L"−"1 and 0.001–1.0 nmol L"−"1 respectively, and the limit of detection were 0.082 pmol L"−"1 and 0.34 pmol L"−"1 respectively (S/N = 3). The DNA sensor showed good sensitivity, selectivity, reproducibility and acceptable stability. The proposed DNA sensor has been employed for the determination of target DNA_H_B_V and target DNA_H_C_V in human serum samples with satisfactory results. - Highlights: • A novel electrochemiluminescence DNA sensor has been developed for the determination of target DNA_H_B_V and target DNA_H_C_V. • The DNA sensor shows good sensitivity, reproducibility and stability. • The ECL provided a convenient, low-cost, sensitive, and specific method for target DNA

  18. Transcription of hepatitis B virus covalently closed circular DNA is regulated by CpG methylation during chronic infection.

    Yongmei Zhang

    Full Text Available The persistence of hepatitis B virus (HBV infection is maintained by the nuclear viral covalently closed circular DNA (cccDNA, which serves as transcription template for viral mRNAs. Previous studies suggested that cccDNA contains methylation-prone CpG islands, and that the minichromosome structure of cccDNA is epigenetically regulated by DNA methylation. However, the regulatory effect of each CpG island methylation on cccDNA activity remains elusive. In the present study, we analyzed the distribution of CpG methylation within cccDNA in patient samples and investigated the impact of CpG island methylation on cccDNA-driven virus replication. Our study revealed the following observations: 1 Bisulfite sequencing of cccDNA from chronic hepatitis B patients indicated that CpG island I was seldom methylated, 2 CpG island II methylation was correlated to the low level of serum HBV DNA in patients, and in vitro methylation studies confirmed that CpG island II methylation markedly reduced cccDNA transcription and subsequent viral core DNA replication, 3 CpG island III methylation was associated with low serum HBsAg titers, and 4 Furthermore, we found that HBV genotype, HBeAg positivity, and patient age and liver fibrosis stage were also relevant to cccDNA CpG methylation status. Therefore, we clearly demonstrated that the status of cccDNA methylation is connected to the biological behavior of HBV. Taken together, our study provides a complete profile of CpG island methylation within HBV cccDNA and new insights for the function of CpG methylation in regulating HBV cccDNA transcription.

  19. Screening and identification of male-specific DNA fragments in common carps Cyprinus carpio using suppression subtractive hybridization.

    Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J

    2010-08-01

    In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.

  20. Analysis of Endonuclease R·EcoRI Fragments of DNA from Lambdoid Bacteriophages and Other Viruses by Agarose-Gel Electrophoresis

    Helling, Robert B.; Goodman, Howard M.; Boyer, Herbert W.

    1974-01-01

    By means of agarose-gel electrophoresis, endonuclease R·EcoRI-generated fragments of DNA from various viruses were separated, their molecular weights were determined, and complete or partial fragment maps for lambda, φ80, and hybrid phages were constructed. Images PMID:4372397

  1. Application of k-means clustering algorithm in grouping the DNA sequences of hepatitis B virus (HBV)

    Bustamam, A.; Tasman, H.; Yuniarti, N.; Frisca, Mursidah, I.

    2017-07-01

    Based on WHO data, an estimated of 15 millions people worldwide who are infected with hepatitis B (HBsAg+), which is caused by HBV virus, are also infected by hepatitis D, which is caused by HDV virus. Hepatitis D infection can occur simultaneously with hepatitis B (co infection) or after a person is exposed to chronic hepatitis B (super infection). Since HDV cannot live without HBV, HDV infection is closely related to HBV infection, hence it is very realistic that every effort of prevention against hepatitis B can indirectly prevent hepatitis D. This paper presents clustering of HBV DNA sequences by using k-means clustering algorithm and R programming. Clustering processes are started with collecting HBV DNA sequences from GenBank, then performing extraction HBV DNA sequences using n-mers frequency and furthermore the extraction results are collected as a matrix and normalized using the min-max normalization with interval [0, 1] which will later be used as an input data. The number of clusters is two and the initial centroid selected of the cluster is chosen randomly. In each iteration, the distance of every object to each centroid are calculated using the Euclidean distance and the minimum distance is selected to determine the membership in a cluster until two convergent clusters are created. As the result, the HBV viruses in the first cluster is more virulent than the HBV viruses in the second cluster, so the HBV viruses in the first cluster can potentially evolve with HDV viruses that cause hepatitis D.

  2. Use of testicular sperm for intracytoplasmic sperm injection in men with high sperm DNA fragmentation: a SWOT analysis.

    Esteves, Sandro C; Roque, Matheus; Garrido, Nicolás

    2018-01-01

    Spermatozoa retrieved from the testis of men with high levels of sperm DNA fragmentation (SDF) in the neat semen tend to have better DNA quality. Given the negative impact of SDF on the outcomes of Assisted Reproductive Technology (ART), an increased interest has emerged about the use of testicular sperm for intracytoplasmic sperm injection (Testi-ICSI). In this article, we used a SWOT (strengths, weaknesses, opportunities, and threats) analysis to summarize the advantages and drawbacks of this intervention. The rationale of Testi-ICSI is bypass posttesticular DNA fragmentation caused by oxidative stress during sperm transit through the epididymis. Hence, oocyte fertilization by genomically intact testicular spermatozoa may be optimized, thus increasing the chances of creating a normal embryonic genome and the likelihood of achieving a live birth, as recently demonstrated in men with high SDF. However, there is still limited evidence as regards the clinical efficacy of Testi-ICSI, thus creating opportunities for further confirmatory clinical research as well as investigation of Testi-ICSI in clinical scenarios other than high SDF. Furthermore, Testi-ICSI can be compared to other laboratory preparation methods for deselecting sperm with damaged DNA. At present, the available literature supports the use of testicular sperm when performing ICSI in infertile couples whose male partners have posttesticular SDF. Due to inherent risks of sperm retrieval, Testi-ICSI should be offered when less invasive treatments for alleviating DNA damage have failed. A call for continuous monitoring is nonetheless required concerning the health of generated offspring and the potential complications of sperm retrieval.

  3. Detection of antibody against antigen expressed by molecularly cloned hepatitis C virus cDNA: Application to diagnosis and blood screening for posttransfusion hepatitis

    Miyamura, Tatsuo; Saito, Izumu (National Institute of Health, Tokyo (Japan)); Katayama, Tohru (Tokyo National Chest Hospital (Japan)); Kikuchi, Shu; Tateda, Akira (Sendai National Hospital (Japan)); Houghton, M.; Choo, Quilim; Kuo, G. (Chiron Corporation, Emeryville, CA (USA))

    1990-02-01

    A cDNA clone has been derived from the plasma of a chimpanzee with chronic non-A, non-B viral hepatits (NANBH). The authors have assayed for antibodies reacting with the encoded antigen in sera from posttransfusion hepatitis patients (643 samples from 23 patients) and their corresponding donors collected during the past 10 years in Japan. The antibody was detected in 15 out of 17 (88.2%) posttransfusion NANBH (PT-NANBH) patients whose sera over time displayed multiple alanine aminotransferase (ALT) peaks. In general, the antibody was detected after several peaks of serum ALT elevations and, once detected, it persisted for years. Of the 15 well-defined cases of PT-NANBH that showed multiple ALT peaks and hepatitis C virus seroconversions, 11 (73.3%) were shown to be transfused with at least one unit of blood positive for the antibody. The retrospective analysis showed that all tested donor blood found to be positive for the antibody had been transfused to recipients who afterwards developed NANBH. These data strongly suggest that the cloned cDNA originated from an etiological agent of NANBH termed the hepatitis C virus. Furthermore, the present study demonstrates that had the screening been done with the anti-hepatitis C virus assay, 11 out of 17 (64.7%) cases of chronic PT-NANBH and 1 out of 6 (16.6%) acute PT-NANBH would have been prevented.

  4. Detection of antibody against antigen expressed by molecularly cloned hepatitis C virus cDNA: Application to diagnosis and blood screening for posttransfusion hepatitis

    Miyamura, Tatsuo; Saito, Izumu; Katayama, Tohru; Kikuchi, Shu; Tateda, Akira; Houghton, M.; Choo, Quilim; Kuo, G.

    1990-01-01

    A cDNA clone has been derived from the plasma of a chimpanzee with chronic non-A, non-B viral hepatits (NANBH). The authors have assayed for antibodies reacting with the encoded antigen in sera from posttransfusion hepatitis patients (643 samples from 23 patients) and their corresponding donors collected during the past 10 years in Japan. The antibody was detected in 15 out of 17 (88.2%) posttransfusion NANBH (PT-NANBH) patients whose sera over time displayed multiple alanine aminotransferase (ALT) peaks. In general, the antibody was detected after several peaks of serum ALT elevations and, once detected, it persisted for years. Of the 15 well-defined cases of PT-NANBH that showed multiple ALT peaks and hepatitis C virus seroconversions, 11 (73.3%) were shown to be transfused with at least one unit of blood positive for the antibody. The retrospective analysis showed that all tested donor blood found to be positive for the antibody had been transfused to recipients who afterwards developed NANBH. These data strongly suggest that the cloned cDNA originated from an etiological agent of NANBH termed the hepatitis C virus. Furthermore, the present study demonstrates that had the screening been done with the anti-hepatitis C virus assay, 11 out of 17 (64.7%) cases of chronic PT-NANBH and 1 out of 6 (16.6%) acute PT-NANBH would have been prevented

  5. Analysis of trichloroethylene-induced global DNA hypomethylation in hepatic L-02 cells by liquid chromatography-electrospray ionization tandem mass spectrometry.

    Zhang, Hang; Hong, Wen-Xu; Ye, Jinbo; Yang, Xifei; Ren, Xiaohu; Huang, Aibo; Yang, Linqing; Zhou, Li; Huang, Haiyan; Wu, Desheng; Huang, Xinfeng; Zhuang, Zhixiong; Liu, Jianjun

    2014-04-04

    Trichloroethylene (TCE), a major occupational and environmental pollutant, has been recently associated with aberrant epigenetic changes in experimental animals and cultured cells. TCE is known to cause severe hepatotoxicity; however, the association between epigenetic alterations and TCE-induced hepatotoxicity are not yet well explored. DNA methylation, catalyzed by enzymes known as DNA methyltransferases (DNMT), is a major epigenetic modification that plays a critical role in regulating many cellular processes. In this study, we analyzed the TCE-induced effect on global DNA methylation and DNMT enzymatic activity in human hepatic L-02 cells. A sensitive and quantitative method combined with liquid chromatography and electrospray ionization tandem mass spectrometry (LC-ESI-MS/MS) was validated and utilized for assessing the altered DNA methylation in TCE-induced L-02 cells. Quantification was accomplished in multiple reaction monitoring (MRM) mode by monitoring a transition pair of m/z 242.1 (molecular ion)/126.3 (fragment ion) for 5-mdC and m/z 268.1/152.3 for dG. The correlation coefficient of calibration curves between 5-mdC and dG was higher than 0.9990. The intra-day and inter-day relative standard derivation values (RSD) were on the range of 0.53-7.09% and 0.40-2.83%, respectively. We found that TCE exposure was able to significantly decrease the DNA methylation and inhibit DNMT activity in L-02 cells. Our results not only reveal the association between TCE exposure and epigenetic alterations, but also provide an alternative mass spectrometry-based method for rapid and accurate assessment of chemical-induced altered DNA methylation in mammal cells. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Inhibition of hepatitis B virus replication via HBV DNA cleavage by Cas9 from Staphylococcus aureus.

    Liu, Yu; Zhao, Miaoxian; Gong, Mingxing; Xu, Ying; Xie, Cantao; Deng, Haohui; Li, Xueying; Wu, Hongkai; Wang, Zhanhui

    2018-04-01

    Chronic hepatitis B virus (HBV) infection is difficult to cure due to the presence of covalently closed circular DNA (cccDNA). Accumulating evidence indicates that the CRISPR/Cas9 system effectively disrupts HBV genome, including cccDNA, in vitro and in vivo. However, efficient delivery of CRISPR/Cas9 system to the liver or hepatocytes using an adeno-associated virus (AAV) vector remains challenging due to the large size of Cas9 from Streptococcus pyogenes (Sp). The recently identified Cas9 protein from Staphylococcus aureus (Sa) is smaller than SpCas9 and thus is able to be packaged into the AAV vector. To examine the efficacy of SaCas9 system on HBV genome destruction, we designed 5 guide RNAs (gRNAs) that targeted different HBV genotypes, 3 of which were shown to be effective. The SaCas9 system significantly reduced HBV antigen expression, as well as pgRNA and cccDNA levels, in Huh7, HepG2.2.15 and HepAD38 cells. The dual expression of gRNAs/SaCas9 in these cell lines resulted in more efficient HBV genome cleavage. In the mouse model, hydrodynamic injection of gRNA/SaCas9 plasmids resulted in significantly lower levels of HBV protein expression. We also delivered the SaCas9 system into mice with persistent HBV replication using an AAV vector. Both the AAV vector and the mRNA of Cas9 could be detected in the C3H mouse liver cells. Decreased hepatitis B surface antigen (HBsAg), HBV DNA and pgRNA levels were observed when a higher titer of AAV was injected, although this decrease was not significantly different from the control. In summary, the SaCas9 system accurately and efficiently targeted the HBV genome and inhibited HBV replication both in vitro and in vivo. The system was delivered by an AAV vector and maybe used as a novel therapeutic strategy against chronic HBV infection. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. EFFECT OF PROSTATILEN® AC ON SPERM DNA FRAGMENTATION DURING TREATMENT OF PATIENTS WITH CHRONIC NONBACTERIAL PROSTATITIS AND CONCOMITANT DISORDERS OF THE REPRODUCTIVE FUNCTION

    S. Yu. Borovets

    2017-01-01

    Full Text Available The study objective is to analyze the effect of Prostatilen® AC on sperm DNA fragmentation during treatment of patients with chronic nonbacterial prostatitis and concomitant disorders of the reproductive function.Materials and methods. The study is based on the results of treatment of 25 men aged 24 to 45 years (mean age 35.3 ± 4.4 years with a verified diagnosis of chronic nonbacterial prostatitis and complaints of early-stage missed miscarriage in a spouse/sexual partner. All patients received Prostatilen® AC daily in rectal suppositories formulation. The duration of treatment was 10 days with retreatment after 20 days. In all patients before treatment and 20 days after it, spermiogram parameters (5th ed., WHO, 2010 and sperm DNA fragmentation level using SCSA (sperm chromatin structure assay by FACSCantoll with monoclonal antibodies (Roche, Germany were determined, and all patients underwent the MAR (mixed antiglobulin reaction test with normal value considered to be 10 % or less. The normal value of sperm DNA fragmentation was considered to be 15 % or less (low risk of fertility impairment. The analysis of the obtained data was carried out using the IBM SPSS Statistics program 22.Results. Before the treatment, pathologic level of sperm DNA fragmentation was observed in 6 (43 % of 14 patients with normozoospermia and in 7 (63 % of 11 patients with pathozoospermia (χ² = 1.06; p <0.3. Thus, there weren’t any significant difference between the rates of occurrence of increased sperm DNA fragmentation in patients with normo- and pathozoospermia. A correlation was found between the level of sperm DNA fragmentation and the results of MAR test before treatment (r = 0.8, p <0.05, which varied between 0 and 99 % (mean 16.48 ± 31.64 %. Meanwhile, increased sperm DNA fragmentation was observed in 7 (53 % of 13 patients with pathological MAR test results, and in 2 (40 % of 5 patients with normal MAR test results (χ² = 0.67; p <0.01. The level

  8. DNA fragmentation and membrane damage of bocachico Prochilodus magdalenae (Ostariophysi: Prochilodontidae sperm following cryopreservation with dimethylsulfoxide and glucose

    José Gregorio Martínez

    Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.

  9. Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

    van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

    1994-01-01

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  10. Excessive cytosolic DNA fragments as a potential trigger of Graves’ disease: an encrypted message sent by animal models

    Yuqian Luo

    2016-11-01

    Full Text Available Graves’ hyperthyroidism is caused by autoantibodies directed against the thyroid stimulating hormone receptor (TSHR that mimic the action of TSH. The establishment of Graves’ hyperthyroidism in experimental animals has proven to be an important approach to dissect the mechanisms of self-tolerance breakdown that lead to the production of thyroid-stimulating TSHR autoantibodies (TSAbs. ‘Shimojo’s model was the first successful Graves’ animal model, wherein immunization with fibroblasts cells expressing TSHR and a major histocompatibility complex (MHC class II molecule, but not either alone, induced TSAb production in AKR/N (H-2k mice. This model highlights the importance of coincident MHC class II expression on TSHR-expressing cells in the development of Graves’ hyperthyroidism. These data are also in agreement with the observation that Graves’ thyrocytes often aberrantly express MHC class II antigens via mechanisms that remain unclear. Our group demonstrated that cytosolic self-genomic DNA fragments derived from sterile injured cells can induce aberrant MHC class II expression and production of multiple inflammatory cytokines and chemokines in thyrocytes in vitro, suggesting that severe cell injury may initiate immune responses in a way that is relevant to thyroid autoimmunity mediated by cytosolic DNA signaling. Furthermore, more recent successful Graves’ animal models were primarily established by immunizing mice with TSHR-expressing plasmids or adenovirus. In these models, double-stranded DNA vaccine contents presumably exert similar immune-activating effect in cells at inoculation sites and thus might pave the way toward successful Graves’ animal models. This review focuses on evidence suggesting that cell injury-derived self-DNA fragments could act as Graves’ disease triggers.

  11. Hepatitis B virus X protein suppresses caveolin-1 expression in hepatocellular carcinoma by regulating DNA methylation

    Yan, Jun; Lu, Qian; Dong, Jiahong; Li, Xiaowu; Ma, Kuansheng; Cai, Lei

    2012-01-01

    To understand the molecular mechanisms of caveolin-1 downregulation by hepatitis B virus X protein (HBx). The DNA methylation status of the caveolin-1 promoter was examined by nested methylation-specific PCR of 33 hepatitis B virus (HBV)-infected hepatocellular carcinoma (HCC) samples. The SMMC-7721 hepatoma cell line was transfected with a recombinant HBx adenoviral vector, and the effects of HBx protein on caveolin-1 expression and promoter methylation were examined and confirmed by sequencing. A reporter gene containing the caveolin-1 promoter region was constructed, and the effects of HBx on the transcriptional activity of the promoter were also studied. Methylation of the caveolin-1 promoter was detected in 84.8% (28/33) of HBV-infected HCC samples. Expression of caveolin-1 was significantly downregulated (P = 0.022), and multiple CpG sites in the promoter region of caveolin-1 were methylated in SMMC-7721 cells after HBx transfection. Transfected HBx significantly suppressed caveolin-1 promoter activity (P = 0.001). HBx protein induces methylation of the caveolin-1 promoter region and suppresses its expression

  12. The metabolic activator FOXO1 binds hepatitis B virus DNA and activates its transcription

    Shlomai, Amir; Shaul, Yosef

    2009-01-01

    Hepatitis B virus (HBV) is a small DNA virus that targets the liver and infects humans worldwide. Recently we have shown that the metabolic regulator PGC-1α coactivates HBV transcription thereby rendering the virus susceptible to fluctuations in the nutritional status of the liver. PGC-1α coactivation of HBV is mediated through the liver-enriched nuclear receptor HNF4α and through another yet unknown transcription factor(s). Here we show that the forkhead transcription factor FOXO1, a known target for PGC-1α coactivation and a central mediator of glucose metabolism in the liver, binds HBV core promoter and activates its transcription. This activation is further enhanced in the presence of PGC-1α, implying that FOXO1 is a target for PGC-1α coactivation of HBV transcription. Thus, our results identify another key metabolic regulator as an activator of HBV transcription, thereby supporting the principle that HBV gene expression is regulated in a similar way to key hepatic metabolic genes.

  13. Absence of superoxide dismutase activity causes nuclear DNA fragmentation during the aging process

    Muid, Khandaker Ashfaqul; Karakaya, Hüseyin Çaglar; Koc, Ahmet

    2014-01-01

    Highlights: • Aging process increases ROS accumulation. • Aging process increases DNA damage levels. • Absence of SOD activity does not cause DNA damage in young cells. • Absence of SOD activity accelerate aging and increase oxidative DNA damages during the aging process. - Abstract: Superoxide dismutases (SOD) serve as an important antioxidant defense mechanism in aerobic organisms, and deletion of these genes shortens the replicative life span in the budding yeast Saccharomyces cerevisiae. Even though involvement of superoxide dismutase enzymes in ROS scavenging and the aging process has been studied extensively in different organisms, analyses of DNA damages has not been performed for replicatively old superoxide dismutase deficient cells. In this study, we investigated the roles of SOD1, SOD2 and CCS1 genes in preserving genomic integrity in replicatively old yeast cells using the single cell comet assay. We observed that extend of DNA damage was not significantly different among the young cells of wild type, sod1Δ and sod2Δ strains. However, ccs1Δ mutants showed a 60% higher amount of DNA damage in the young stage compared to that of the wild type cells. The aging process increased the DNA damage rates 3-fold in the wild type and more than 5-fold in sod1Δ, sod2Δ, and ccs1Δ mutant cells. Furthermore, ROS levels of these strains showed a similar pattern to their DNA damage contents. Thus, our results confirm that cells accumulate DNA damages during the aging process and reveal that superoxide dismutase enzymes play a substantial role in preserving the genomic integrity in this process

  14. Absence of superoxide dismutase activity causes nuclear DNA fragmentation during the aging process

    Muid, Khandaker Ashfaqul; Karakaya, Hüseyin Çaglar; Koc, Ahmet, E-mail: ahmetkoc@iyte.edu.tr

    2014-02-07

    Highlights: • Aging process increases ROS accumulation. • Aging process increases DNA damage levels. • Absence of SOD activity does not cause DNA damage in young cells. • Absence of SOD activity accelerate aging and increase oxidative DNA damages during the aging process. - Abstract: Superoxide dismutases (SOD) serve as an important antioxidant defense mechanism in aerobic organisms, and deletion of these genes shortens the replicative life span in the budding yeast Saccharomyces cerevisiae. Even though involvement of superoxide dismutase enzymes in ROS scavenging and the aging process has been studied extensively in different organisms, analyses of DNA damages has not been performed for replicatively old superoxide dismutase deficient cells. In this study, we investigated the roles of SOD1, SOD2 and CCS1 genes in preserving genomic integrity in replicatively old yeast cells using the single cell comet assay. We observed that extend of DNA damage was not significantly different among the young cells of wild type, sod1Δ and sod2Δ strains. However, ccs1Δ mutants showed a 60% higher amount of DNA damage in the young stage compared to that of the wild type cells. The aging process increased the DNA damage rates 3-fold in the wild type and more than 5-fold in sod1Δ, sod2Δ, and ccs1Δ mutant cells. Furthermore, ROS levels of these strains showed a similar pattern to their DNA damage contents. Thus, our results confirm that cells accumulate DNA damages during the aging process and reveal that superoxide dismutase enzymes play a substantial role in preserving the genomic integrity in this process.

  15. Real-time PCR assays for hepatitis B virus DNA quantification may require two different targets.

    Liu, Chao; Chang, Le; Jia, Tingting; Guo, Fei; Zhang, Lu; Ji, Huimin; Zhao, Junpeng; Wang, Lunan

    2017-05-12

    Quantification Hepatitis B virus (HBV) DNA plays a critical role in the management of chronic HBV infections. However, HBV is a DNA virus with high levels of genetic variation, and drug-resistant mutations have emerged with the use of antiviral drugs. If a mutation caused a sequence mismatched in the primer or probe of a commercial DNA quantification kit, this would lead to an underestimation of the viral load of the sample. The aim of this study was to determine whether commercial kits, which use only one pair of primers and a single probe, accurately quantify the HBV DNA levels and to develop an improved duplex real-time PCR assay. We developed a new duplex real-time PCR assay that used two pairs of primers and two probes based on the conserved S and C regions of the HBV genome. We performed HBV DNA quantitative detection of HBV samples and compared the results of our duplex real-time PCR assays with the COBAS TaqMan HBV Test version 2 and Daan real-time PCR assays. The target region of the discordant sample was amplified, sequenced, and validated using plasmid. The results of the duplex real-time PCR were in good accordance with the commercial COBAS TaqMan HBV Test version 2 and Daan real-time PCR assays. We showed that two samples from Chinese HBV infections underestimated viral loads when quantified by the Roche kit because of a mismatch between the viral sequence and the reverse primer of the Roche kit. The HBV DNA levels of six samples were undervalued by duplex real-time PCR assays of the C region because of mutations in the primer of C region. We developed a new duplex real-time PCR assay, and the results of this assay were similar to the results of commercial kits. The HBV DNA level could be undervalued when using the COBAS TaqMan HBV Test version 2 for Chinese HBV infections owing to a mismatch with the primer/probe. A duplex real-time PCR assay based on the S and C regions could solve this problem to some extent.

  16. Single-Cell-Based Platform for Copy Number Variation Profiling through Digital Counting of Amplified Genomic DNA Fragments.

    Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi

    2017-04-26

    We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.

  17. DNA fragmentation and cell cycle arrest: a hallmark of apoptosis induced by Ruta graveolens in human colon cancer cells.

    Arora, Shagun; Tandon, Simran

    2015-01-01

    In the present study, we investigated the anti-cancer effect of various potencies of Ruta graveolens (Ruta) on COLO-205 cell line, as evidenced by cytotoxicity, migration, clonogenecity, morphological and biochemical changes and modification in the levels of genes associated with apoptosis and cell cycle. On treatment of COLO-205 cells maximal effects were seen with mother tincture (MT) and 30C potencies, wherein decrease in cell viability along with reduced clonogenecity and migration capabilities were noted. In addition morphological and biochemical alterations such as nuclear changes (fragmented nuclei with condensed chromatin) and DNA ladder-like pattern (increased amount of fragmented DNA) in COLO-205 cells indicating apoptotic related cell death were seen. The expression of apoptosis and cell-cycle related regulatory genes assessed by reverse transcriptase-PCR revealed an up-regulation of caspase 9, caspase-3, Bax, p21 and p27 expression and down-regulation of Bcl-2 expression in treated cells. The mode of cell death was suggestive of intrinsic apoptotic pathway along with cell cycle arrest at the G2/M of the cell cycle. Our findings indicate that phytochemicals present in Ruta showed potential for natural therapeutic product development for colon carcinoma. Copyright © 2014 The Faculty of Homeopathy. Published by Elsevier Ltd. All rights reserved.

  18. IRMA iterative relaxation matrix approach for NMR structure determination application to DNA fragments

    Koning, M.M.G.

    1990-01-01

    The subject of this thesis is the structure determination of DNA molecules in solution with the use of NMR. For this purpose a new relaxation matrix approach is introduced. The emphasis is on the interpretation of nuclear Overhauser effects (NOEs) in terms of proton-proton distances and related three dimensional structures. The DNA molecules studied are obligonucleotides, unmodifief as well as modified molecules bu UV radiation. From comparison with unmodified molecules it turned out that UV irradiation scarcely influences the helical structure of the DNA string. At one place of the string a nucleotide is rotated towards the high-ANTI conformation which results in a slight unwinding of the DNA string but sufficient for blocking of the normal reading of genetic information. (H.W.). 456 refs.; 50 figs.; 30 tabs

  19. Trans-activation function of a 3' truncated X gene-cell fusion product from integrated hepatitis B virus DNA in chronic hepatitis tissues

    Takada, Shinako; Koike, Katsuro

    1990-01-01

    To investigate the expression and transactivation function of the X gene in integrated hepatitis B virus (HBV) DNA from chronic hepatitis tissues, a series of transfectants containing cloned integrated HBV DNAs was made and analyzed for X mRNA expression and trans-activation activity by using a chloramphenicol acetyltransferase assay. Most of the integrated HBV DNAs expressed X mRNA and encoded a product with trans-activation activity in spite of the loss of the 3' end region of the X gene due to integration. From cDNA cloning and sequence analysis of X mRNA transcribed from native or integrated HBV DNA, the X protein was found to be translated from the X open reading frame without splicing. For integrated HBV DNA, transcription was extended to a cellular flanking DNA and an X gene-cell fusion transcript was terminated by using a cellular poly(A) signal. The amino acid sequence deduced from an X-cell fusion transcript indicated truncation of the carboxyl-terminal five amino acids, but the upstream region of seven amino acids conserved among hepadnaviruses was retained in the integrated HBV DNA, suggesting that this conserved region is essential for the transactivation function of the X protein. These findings support the following explanation for hepatocarcinogenesis by HBV DNA integration: the expression of a cellular oncogene(s) is transactivated at the time of chronic infection by the increasing amounts of the integrated HBV gene product(s), such as the X-cell fusion product

  20. Unusual structures are present in DNA fragments containing super-long Huntingtin CAG repeats.

    Daniel Duzdevich

    2011-02-01

    Full Text Available In the R6/2 mouse model of Huntington's disease (HD, expansion of the CAG trinucleotide repeat length beyond about 300 repeats induces a novel phenotype associated with a reduction in transcription of the transgene.We analysed the structure of polymerase chain reaction (PCR-generated DNA containing up to 585 CAG repeats using atomic force microscopy (AFM. As the number of CAG repeats increased, an increasing proportion of the DNA molecules exhibited unusual structural features, including convolutions and multiple protrusions. At least some of these features are hairpin loops, as judged by cross-sectional analysis and sensitivity to cleavage by mung bean nuclease. Single-molecule force measurements showed that the convoluted DNA was very resistant to untangling. In vitro replication by PCR was markedly reduced, and TseI restriction enzyme digestion was also hindered by the abnormal DNA structures. However, significantly, the DNA gained sensitivity to cleavage by the Type III restriction-modification enzyme, EcoP15I."Super-long" CAG repeats are found in a number of neurological diseases and may also appear through CAG repeat instability. We suggest that unusual DNA structures associated with super-long CAG repeats decrease transcriptional efficiency in vitro. We also raise the possibility that if these structures occur in vivo, they may play a role in the aetiology of CAG repeat diseases such as HD.

  1. Alkaline DNA fragmentation, DNA disentanglement evaluated viscosimetrically and sister chromatid exchanges, after treatment in vivo with nitrofurantoin.

    Parodi, S; Pala, M; Russo, P; Balbi, C; Abelmoschi, M L; Taningher, M; Zunino, A; Ottaggio, L; de Ferrari, M; Carbone, A; Santi, L

    1983-07-01

    Nitrofurantoin was not positive as a carcinogen in long term assays. In vitro it was positive in some short term tests and negative in others. We have examined Nitrofurantoin for its capability of inducing DNA damage in vivo. With the alkaline elution technique, Nitrofurantoin appeared clearly positive in all the tissues examined (liver, kidney, lung, spleen and bone marrow). In the liver we also observed some cross-linking effect. In bone marrow cells Nitrofurantoin was also clearly positive in terms of sister chromatid exchanges (SCEs) induction. DNA damage in vivo was also examined with a viscosimetric method, more sensitive than alkaline elution. With this method the results were essentially negative, suggesting that the two methods detect different types of damage. In view of its positivity in many organs and in two short term tests in vivo, the carcinogenic potential of Nitrofurantoin should be reconsidered.

  2. Positive and negative ion mode comparison for the determination of DNA/peptide noncovalent binding sites through the formation of "three-body" noncovalent fragment ions.

    Brahim, Bessem; Tabet, Jean-Claude; Alves, Sandra

    2018-02-01

    Gas-phase fragmentation of single strand DNA-peptide noncovalent complexes is investigated in positive and negative electrospray ionization modes.Collision-induced dissociation experiments, performed on the positively charged noncovalent complex precursor ions, have confirmed the trend previously observed in negative ion mode, i.e. a high stability of noncovalent complexes containing very basic peptidic residues (i.e. R > K) and acidic nucleotide units (i.e. Thy units), certainly incoming from the existence of salt bridge interactions. Independent of the ion polarity, stable noncovalent complex precursor ions were found to dissociate preferentially through covalent bond cleavages of the partners without disrupting noncovalent interactions. The resulting DNA fragment ions were found to be still noncovalently linked to the peptides. Additionally, the losses of an internal nucleic fragment producing "three-body" noncovalent fragment ions were also observed in both ion polarities, demonstrating the spectacular salt bridge interaction stability. The identical fragmentation patterns (regardless of the relative fragment ion abundances) observed in both polarities have shown a common location of salt bridge interaction certainly preserved from solution. Nonetheless, most abundant noncovalent fragment ions (and particularly three-body ones) are observed from positively charged noncovalent complexes. Therefore, we assume that, independent of the preexisting salt bridge interaction and zwitterion structures, multiple covalent bond cleavages from single-stranded DNA/peptide complexes rely on an excess of positive charges in both electrospray ionization ion polarities.

  3. Uracil DNA glycosylase counteracts APOBEC3G-induced hypermutation of hepatitis B viral genomes: excision repair of covalently closed circular DNA.

    Kouichi Kitamura

    Full Text Available The covalently closed circular DNA (cccDNA of the hepatitis B virus (HBV plays an essential role in chronic hepatitis. The cellular repair system is proposed to convert cytoplasmic nucleocapsid (NC DNA (partially double-stranded DNA into cccDNA in the nucleus. Recently, antiviral cytidine deaminases, AID/APOBEC proteins, were shown to generate uracil residues in the NC-DNA through deamination, resulting in cytidine-to-uracil (C-to-U hypermutation of the viral genome. We investigated whether uracil residues in hepadnavirus DNA were excised by uracil-DNA glycosylase (UNG, a host factor for base excision repair (BER. When UNG activity was inhibited by the expression of the UNG inhibitory protein (UGI, hypermutation of NC-DNA induced by either APOBEC3G or interferon treatment was enhanced in a human hepatocyte cell line. To assess the effect of UNG on the cccDNA viral intermediate, we used the duck HBV (DHBV replication model. Sequence analyses of DHBV DNAs showed that cccDNA accumulated G-to-A or C-to-T mutations in APOBEC3G-expressing cells, and this was extensively enhanced by UNG inhibition. The cccDNA hypermutation generated many premature stop codons in the P gene. UNG inhibition also enhanced the APOBEC3G-mediated suppression of viral replication, including reduction of NC-DNA, pre-C mRNA, and secreted viral particle-associated DNA in prolonged culture. Enhancement of APOBEC3G-mediated suppression by UNG inhibition was not observed when the catalytic site of APOBEC3G was mutated. Transfection experiments of recloned cccDNAs revealed that the combination of UNG inhibition and APOBEC3G expression reduced the replication ability of cccDNA. Taken together, these data indicate that UNG excises uracil residues from the viral genome during or after cccDNA formation in the nucleus and imply that BER pathway activities decrease the antiviral effect of APOBEC3-mediated hypermutation.

  4. Covalent Bonding of Pyrrolobenzodiazepines (PBDs) to Terminal Guanine Residues within Duplex and Hairpin DNA Fragments

    Mantaj, Julia; Jackson, Paul J. M.; Karu, Kersti; Rahman, Khondaker M.; Thurston, David E.

    2016-01-01

    Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal guanine of DNA, with the PBD skeleton spanning only two base pairs. Control experiments with the non-C8-conjugated anthramycin along with molecular dynamics simulations suggest that the C8-substituent of a PBD Monomer, or one-half of a PBD Dimer, may provide stability for the adduct. This observation highlights the importance of PBD C8-substituents, and also suggests that PBDs may bind to terminal guanines within stretches of DNA in cells, thus representing a potentially novel mechanism of action at the end of DNA strand breaks. PMID:27055050

  5. Expansion during PCR of short single-stranded DNA fragments carrying nonselfcomplementary dinucleotide or trinucleotide repeats

    Reichová, Naďa; Kypr, Jaroslav

    2003-01-01

    Roč. 30, č. 3 (2003), s. 155-163 ISSN 0301-4851 R&D Projects: GA ČR GA301/01/0590 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA * PCR * expansion Subject RIV: BO - Biophysics Impact factor: 0.565, year: 2003

  6. Solution structure of a short dna fragment studied by neutron scattering

    Lederer, H.; May, R. P.; Kjems, Jørgen

    1986-01-01

    -DNA. The neutron scattering curve is well fitted by that of a rigid rod with a length of 44 nm and a diameter of 2 nm. The result were confirmed by quasi-elastic light scattering and analytical centrifugation. The neutron measurements in H2O and D2O buffer reveal a cross-sectional in homogeneity not detected by X...

  7. Comparison of Hybrid Capture 2 Assay with Real-time-PCR for Detection and Quantitation of Hepatitis B Virus DNA.

    Majid, Farjana; Jahan, Munira; Lutful Moben, Ahmed; Tabassum, Shahina

    2014-01-01

    Both real-time-polymerase chain reaction (PCR) and hybrid capture 2 (HC2) assay can detect and quantify hepatitis B virus (HBV) DNA. However, real-time-PCR can detect a wide range of HBV DNA, while HC2 assay could not detect lower levels of viremia. The present study was designed to detect and quantify HBV DNA by real-time-PCR and HC2 assay and compare the quantitative data of these two assays. A cross-sectional study was conducted in between July 2010 and June 2011. A total of 66 serologically diagnosed chronic hepatitis B (CHB) patients were selected for the study. Real-time-PCR and HC2 assay was done to detect HBV DNA. Data were analyzed by statistical Package for the social sciences (SPSS). Among 66 serologically diagnosed chronic hepatitis B patients 40 (60.61%) patients had detectable and 26 (39.39%) had undetectable HBV DNA by HC2 assay. Concordant results were obtained for 40 (60.61%) out of these 66 patients by real-time-PCR and HC2 assay with mean viral load of 7.06 ± 1.13 log 10 copies/ml and 6.95 ± 1.08 log 10 copies/ml, respectively. In the remaining 26 patients, HBV DNA was detectable by real-time-PCR in 20 patients (mean HBV DNA level was 3.67 ± 0.72 log 10 copies/ml. However, HBV DNA could not be detectable in six cases by the both assays. The study showed strong correlation (r = 0.915) between real-time-PCR and HC2 assay for the detection and quantification of HBV DNA. HC2 assay may be used as an alternative to real-time-PCR for CHB patients. How to cite this article: Majid F, Jahan M, Moben AL, Tabassum S. Comparison of Hybrid Capture 2 Assay with Real-time-PCR for Detection and Quantitation of Hepatitis B Virus DNA. Euroasian J Hepato-Gastroenterol 2014;4(1):31-35.

  8. Generation of covalently closed circular DNA of hepatitis B viruses via intracellular recycling is regulated in a virus specific manner.

    Josef Köck

    Full Text Available Persistence of hepatitis B virus (HBV infection requires covalently closed circular (cccDNA formation and amplification, which can occur via intracellular recycling of the viral polymerase-linked relaxed circular (rc DNA genomes present in virions. Here we reveal a fundamental difference between HBV and the related duck hepatitis B virus (DHBV in the recycling mechanism. Direct comparison of HBV and DHBV cccDNA amplification in cross-species transfection experiments showed that, in the same human cell background, DHBV but not HBV rcDNA converts efficiently into cccDNA. By characterizing the distinct forms of HBV and DHBV rcDNA accumulating in the cells we find that nuclear import, complete versus partial release from the capsid and complete versus partial removal of the covalently bound polymerase contribute to limiting HBV cccDNA formation; particularly, we identify genome region-selectively opened nuclear capsids as a putative novel HBV uncoating intermediate. However, the presence in the nucleus of around 40% of completely uncoated rcDNA that lacks most if not all of the covalently bound protein strongly suggests a major block further downstream that operates in the HBV but not DHBV recycling pathway. In summary, our results uncover an unexpected contribution of the virus to cccDNA formation that might help to better understand the persistence of HBV infection. Moreover, efficient DHBV cccDNA formation in human hepatoma cells should greatly facilitate experimental identification, and possibly inhibition, of the human cell factors involved in the process.

  9. i-Motif of cytosine-rich human telomere DNA fragments containing natural base lesions

    Dvořáková, Zuzana; Renčiuk, Daniel; Kejnovská, Iva; Školáková, Petra; Bednářová, Klára; Sagi, J.; Vorlíčková, Michaela

    2018-01-01

    Roč. 46, č. 4 (2018), s. 1624-1634 ISSN 1362-4962 R&D Projects: GA ČR(CZ) GA15-06785S; GA ČR GA17-12075S; GA ČR(CZ) GJ17-19170Y; GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : pair opening kinetics * g-quadruplex dna Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology

  10. [Comet assay of DNA fragmentation: modification of silver staining for obtaining permanent preparations].

    Kamins'kyĭ, V O; Lutsyk, M D; Stoĭka, R S

    2005-01-01

    Modification of comet analysis is proposed for obtaining permanent preparations by DNA staining with silver compounds. The sensitivity of staining is similar to that observed at the treatment by ethidium bromide and other fluorochromes. The advantages of the method are stability of slides and possibility of their reinvestigation by light microscopy. The method does not need expensive fluorescent microscope and lacks contacting with carcinogenic compounds and UV light irradiation.

  11. Influence of serum HBV-DNA content on the expression of TGF-β1 and TNF-α in patients with chronic hepatitis B

    Gao Yujie; Nan Chunhong; Yan Lijuan; Yue Zhijun; Yang Zhicai

    2004-01-01

    Objective: To study the relationship between the serum HBV-DNA content and levels of transforming growth factor β1 (TGF-β1), tumor necrosis factor-α (TNF-α) as well as the degree of hepatic fibrosis in patients with chronic hepatitis B. Methods: Serum HBV-DNA content quantification was determined with PCR-real time fluorescence method; TGF-β1 and TNF-α with ELISA and the hepatic fibrosis indicators HA, LN, IV-C, P-III with RIA. Altogether 89 patients with clinical chronic hepatitis B of various degrees (mild 25, moderate 35, advanced 29) were tested. Results: With the progress of hepatic injury, the serum contents of HBV-DNA, TGF-β1, TNF-α were correspondingly increased with significant differences among the patients groups (p<0.01). The TGF-β1, TNF-α, HA, IV-C, PC III, levels were positively correlated to the degree of hepatic injury with r=0.9561, 0.8123, 0.8561, 0.7723, 0.7150 respectively and p<0.01; for LN it was r=0.542 and p<0.05. Conclusion: In patients with chronic hepatitis B, hepatic fibrosis is the fundamental process in the pathogenesis of liver cirrhosis. High concentration of HBV is the crucial factor for development of hepatic fibrosis, which works synergically with many cytokines especially TGF-β1 and TNF-α

  12. Quantification of apoptotic DNA fragmentation in a transformed uterine epithelial cell line, HRE-H9, using capillary electrophoresis with laser-induced fluorescence detector (CE-LIF).

    Fiscus, R R; Leung, C P; Yuen, J P; Chan, H C

    2001-01-01

    Apoptotic cell death of uterine epithelial cells is thought to play an important role in the onset of menstruation and the successful implantation of an embryo during early pregnancy. Abnormal apoptosis in these cells can result in dysmenorrhoea and infertility. In addition, decreased rate of epithelial apoptosis likely contributes to endometriosis. A key step in the onset of apoptosis in these cells is cleavage of the genomic DNA between nucleosomes, resulting in polynucleosomal-sized fragments of DNA. The conventional technique for assessing apoptotic DNA fragmentation uses agarose (slab) gel electrophoresis (i.e. DNA laddering). However, recent technological advances in the use of capillary electrophoresis (CE), particularly the introduction of the laser-induced fluorescence detector (LIF), has made it possible to perform DNA laddering with improved automation and much greater sensitivity. In the present study, we have further developed the CE-LIF technique by using a DNA standard curve to quantify accurately the amount of DNA in the apoptotic DNA fragments and have applied this new quantitative technique to study apoptosis in a transformed uterine epithelial cell line, the HRE-H9 cells. Apoptosis was induced in the HRE-H9 cells by serum deprivation for 5, 7 and 24 h, resulting in increased DNA fragmentation of 2.2-, 3.1- and 6.2-fold, respectively, above the 0 h or plus-serum controls. This ultrasensitive CE-LIF technique provides a novel method for accurately measuring the actions of pro- or anti-apoptotic agents or conditions on uterine epithelial cell lines. Copyright 2001 Academic Press.

  13. [Value of specific 16S rDNA fragment of algae in diagnosis of drowning: an experiment with rabbits].

    Li, Peng; Xu, Qu-Yi; Chen, Ling; Liu, Chao; Zhao, Jian; Wang, Yu-Zhong; Yu, Zheng-Liang; Hu, Sun-Lin; Wang, Hui-Jun

    2015-08-01

    To establish a method for amplifying specific 16S rDNA fragment of algae related with drowning and test its value in drowning diagnosis. Thirty-five rabbits were randomly divided into 3 the drowning group (n=15), postmortem water immersion group (n=15, subjected to air embolism before seawater immersion), and control group(n=5, with air embolism only). Twenty samples of the liver tissues from human corpses found in water were also used, including 14 diatom-positive and 6 diatom-negative samples identified by microwave digestion-vacuum filtration-automated scanning electron microscopy (MD-VF-Auto SEM). Seven known species of algae served as the control algae (Melosira sp, Nitzschia sp, Synedra sp, Navicula sp, Microcystis sp, Cyclotella meneghiniana, and Chlorella sp). The total DNA was extracted from the tissues and algae to amplify the specific fragment of algae followed by 8% polyacrylamide gelelectrophoresis and sliver-staining. In the drowning group, algae was detected in the lungs (100%), liver (86%), and kidney (86%); algae was detected in the lungs in 2 rabbits in the postmortem group (13%) and none in the control group. The positivity rates of algae were significantly higher in the drowning group than in the postmortem group (Palgae, including sample that had been identified as diatom-negative by MD-VF-Auto SEM. All the 7 control algae samples yielded positive results in PCR. The PCR-based method has a high sensitivity in algae detection for drowning diagnosis and allows simultaneous detection of multiple algae species related with drowning.

  14. Protective effects of Opuntia ficus-indica extract on ram sperm quality, lipid peroxidation and DNA fragmentation during liquid storage.

    Allai, Larbi; Druart, Xavier; Öztürk, Mehmet; BenMoula, Anass; Nasser, Boubker; El Amiri, Bouchra

    2016-12-01

    The present study aimed to assess the phenolic composition of the acetone extract from Opuntia ficus indica cladodes (ACTEX) and its effects on ram semen variables, lipid peroxidation and DNA fragmentation during liquid storage at 5°C for up to 72h in skim milk and Tris egg yolk extenders. Semen samples from five rams were pooled extended with Tris-egg yolk (TEY) or skim milk (SM) extenders containing ACTEX (0%, 1%, 2%, 4% and 8%) at a final concentration of 0.8×10 9 sperm/ml and stored for up to 72h at 5°C. The sperm variables were evaluated at different time periods (8, 24, 48 and 72h). Sperm total motility and viability were superior in TEY than in SM whereas the progressive motility, membrane integrity, abnormality and spontaneous lipid peroxidation were greater in SM compared to TEY (P<0.05). The results also indicated that the inclusion of 1% ACTEX in the SM or TEY extender increased the sperm motility, viability, membrane integrity, and decreased the abnormality, lipids peroxidation up to 72h in storage compared to control group. Similarly, even at 72h of storage, 1% ACTEX can efficiently decrease the negative effects of liquid storage on sperm DNA fragmentation (P<0.05). In conclusion, SM and TEY supplemented with 1% of ACTEX can improve the quality of ram semen. Further studies are required to identify the active components in ACTEX involved in its effect on ram sperm preservation. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Predictors of hepatitis B cure using gene therapy to deliver DNA cleavage enzymes: a mathematical modeling approach.

    Joshua T Schiffer

    Full Text Available Most chronic viral infections are managed with small molecule therapies that inhibit replication but are not curative because non-replicating viral forms can persist despite decades of suppressive treatment. There are therefore numerous strategies in development to eradicate all non-replicating viruses from the body. We are currently engineering DNA cleavage enzymes that specifically target hepatitis B virus covalently closed circular DNA (HBV cccDNA, the episomal form of the virus that persists despite potent antiviral therapies. DNA cleavage enzymes, including homing endonucleases or meganucleases, zinc-finger nucleases (ZFNs, TAL effector nucleases (TALENs, and CRISPR-associated system 9 (Cas9 proteins, can disrupt specific regions of viral DNA. Because DNA repair is error prone, the virus can be neutralized after repeated cleavage events when a target sequence becomes mutated. DNA cleavage enzymes will be delivered as genes within viral vectors that enter hepatocytes. Here we develop mathematical models that describe the delivery and intracellular activity of DNA cleavage enzymes. Model simulations predict that high vector to target cell ratio, limited removal of delivery vectors by humoral immunity, and avid binding between enzyme and its DNA target will promote the highest level of cccDNA disruption. Development of de novo resistance to cleavage enzymes may occur if DNA cleavage and error prone repair does not render the viral episome replication incompetent: our model predicts that concurrent delivery of multiple enzymes which target different vital cccDNA regions, or sequential delivery of different enzymes, are both potentially useful strategies for avoiding multi-enzyme resistance. The underlying dynamics of cccDNA persistence are unlikely to impact the probability of cure provided that antiviral therapy is given concurrently during eradication trials. We conclude by describing experiments that can be used to validate the model, which

  16. [Applylication of new type combined fragments: nrDNA ITS+ nad 1-intron 2 for identification of Dendrobium species of Fengdous].

    Geng, Li-xia; Zheng, Rui; Ren, Jie; Niu, Zhi-tao; Sun, Yu-long; Xue, Qing-yun; Liu, Wei; Ding, Xiao-yu

    2015-08-01

    In this study, 17 kinds of Dendrobium species of Fengdous including 39 individuals were collected from 4 provinces. Mitochondrial gene sequences co I, nad 5, nad 1-intron 2 and chloroplast gene sequences rbcL, matK amd psbA-trnH were amplified from these materials, as well as nrDNA ITS. Furthermore, suitable sequences for identification of Dendrobium species of Fengdous were screened by K-2-P and P-distance. The results showed that during the mentioned 7 sequences, nrDNA ITS, nad 1-intron 2 and psbA-trnH which had a high degree of variability could be used to identify Dendrobium species of Fengdous. However, single fragment could not be used to distinguish D. moniliforme and D. huoshanense. Moreover, compared to other combined fragments, new type combined fragments nrDNA ITS+nad 1-intron 2 was more effective in identifying the original plants of Dendrobium species and could be used to identify D. huoshanense and D. moniliforme. Besides, according to the UPGMA tree constructed with nrDNA ITS+nad 1-intron 2, 3 inspected Dendrobium plants were identified as D. huoshanense, D. moniliforme and D. officinale, respectively. This study identified Dendrobium species of Fengdous by combined fragments nrDNA ITS+nad 1-intron 2 for the first time, which provided a more effective basis for identification of Dendrobium species. And this study will be helpful for regulating the market of Fengdous.

  17. Effects of cyanoacrylate fuming, time after recovery, and location of biological material on the recovery and analysis of DNA from post-blast pipe bomb fragments*.

    Bille, Todd W; Cromartie, Carter; Farr, Matthew

    2009-09-01

    This study investigated the effects of time, cyanoacrylate fuming, and location of the biological material on DNA analysis of post-blast pipe bomb fragments. Multiple aliquots of a cell suspension (prepared by soaking buccal swabs in water) were deposited on components of the devices prior to assembly. The pipe bombs were then deflagrated and the fragments recovered. Fragments from half of the devices were cyanoacrylate fumed. The cell spots on the fragments were swabbed and polymerase chain reaction/short tandem repeat analysis was performed 1 week and 3 months after deflagration. A significant decrease in the amount of DNA recovered was observed between samples collected and analyzed within 1 week compared with the samples collected and analyzed 3 months after deflagration. Cyanoacrylate fuming did not have a measurable effect on the success of the DNA analysis at either time point. Greater quantities of DNA were recovered from the pipe nipples than the end caps. Undeflagrated controls showed that the majority (>95%) of the DNA deposited on the devices was not recovered at a week or 3 months.

  18. Correlation between the e-antigen, Pre-S2 antigen and DNA of hepatitis B virus

    Cai Changhui; Liang Jinsheng

    2006-01-01

    Objective: To study the relationship between the hepatitis B e-antigen (HBeAg), Pre-S1 antigen (Pre-S1), Pre-S2 antigen (Pre-S2) and DNA of hepatitis B virus (HBV). Methods: The blood samples of 268 cases of viral B hepatitis were collected. The HBV DNA of all samples were tested by fluorescent-quantitating PCR method, and HBeAg were assayed by time-resolved fluoro-immunoassay method, and their Pre-S1 and Pre-S2 were assayed by enzyme linked immunosorbentassay method. Results: The positive rates of HBeAg, Pre-S1 and Pre-S2 in HBV DNA positive group were 48.2%, 76.4% and 100% respectively, and 1.6%, 36.3% and 32.3% respectively in HBV DNA negative group. There was significantly difference between the HBeAg, Pre-S1 and Pre-S2 positive rates of the two groups (Chi-square test, P<0.01). Conclusions: There was positive relationship between the HBeAg, Pre-S1, Pre-S2 and DNA which all were indicators of HBV reproduction. Comparing to HBV DNA, Pre-S2 was the most, Pre-S1 the second, and HBeAg the third sensitive indicator for evaluating HBV reproduction. Pre-S1 and Pre-S2 could be used as the supplementary indicator for the reproduction of HBV. (authors)

  19. Circulating Elastin Fragments Are Not Affected by Hepatic, Renal and Hemodynamic Changes, But Reflect Survival in Cirrhosis with TIPS

    Nielsen, M J; Lehmann, J; Leeming, D J

    2015-01-01

    at TIPS insertion and 2 weeks later. The circulating levels of elastin fragments (ELM) were determined using specific monoclonal ELISA. The relationship of ELM with clinical short-time follow-up and long-term outcome was investigated. RESULTS: Circulating levels of ELM showed a gradient across the liver...

  20. Investigation of interaction between magnetic silica particles and lambda phage DNA fragment.

    Smerkova, Kristyna; Dostalova, Simona; Vaculovicova, Marketa; Kynicky, Jindrich; Trnkova, Libuse; Kralik, Miroslav; Adam, Vojtech; Hubalek, Jaromir; Provaznik, Ivo; Kizek, Rene

    2013-12-01

    Nucleic acids belong to the most important molecules and therefore the understanding of their properties, function and behavior is crucial. Even though a range of analytical and biochemical methods have been developed for this purpose, one common step is essential for all of them - isolation of the nucleic acid from the from complex sample matrix. The use of magnetic particles for the separation of nucleic acids has many advantages over other isolation methods. In this study, an isolation procedure for extraction of DNA was optimized. Each step of the isolation process including washing, immobilization and elution was optimized and therefore the efficiency was increased from 1.7% to 28.7% and the total time was shortened from 75 to 30min comparing to the previously described method. Quantification of the particular parameter influence was performed by square-wave voltammetry using hanging drop mercury electrode. Further, we compared the optimized method with standard chloroform extraction and applied on isolation of DNA from Staphylococcus aureus and Escherichia coli. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Towards the onset of fruit tree growing north of the Alps: ancient DNA from waterlogged apple (Malus sp.) seed fragments.

    Schlumbaum, Angela; van Glabeke, Sabine; Roldan-Ruiz, Isabel

    2012-01-20

    Wild apples (Malus sp.) have been a major food source in the northern Alpine region since prehistory and their use is well understood. The onset of deliberate fruit tree growing in the area is, however, less clear. It is generally assumed that horticulture was practised in Roman times, but it might be even earlier. In the archaeological record seed testa and pericarp remains are particularly frequent at sites with waterlogged preservation such as lakeshore settlements or wells, pits and ditches, but the distinction between wild and domestic plants is not morphologically possible. With waterlogged remains being one main source of information about past fruit cultivation, we have tested the feasibility of analysing ancient DNA from waterlogged preserved bulk samples of testa fragments. We studied apple seeds from three Neolithic and three Roman sites with waterlogged preservation in the Alpine foreland. Chloroplast markers failed in all samples, but nuclear ITS1 (internal transcribed spacer region 1) of the ribosomal DNA was successfully typed in two Roman samples from the site Oedenburg/Biesheim-Kunheim (Haut-Rhin, F). The retrieved ITS1 sequences are identical to each other and are shared with wild Malus sylvestris and Malus sieversii, and with domestic apple cultivars, supporting the potential of using waterlogged remains for identifying the genetic status of apple diachronically. Copyright © 2011 Elsevier GmbH. All rights reserved.

  2. Rapid identification and classification of bacteria by 16S rDNA restriction fragment melting curve analyses (RFMCA).

    Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T

    2007-08-01

    The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.

  3. Episodic air pollution is associated with increased DNA fragmentation in human sperm without other changes in semen quality

    Rubes, J.; Selevan, S.G.; Evenson, D.P.; Zudova, D.; Vozdova, M.; Zudova, Z.; Robbins, W.A.; Perreault, S.D. [US EPA, Research Triangle Park, NC (United States)

    2005-10-01

    This study examined potential associations between exposure to episodes of air pollution and alterations in semen quality. The air pollution, resulting from combustion of coal for industry and home heating in the Teplice district of the Czech Republic, was much higher during the winter than at other times of year with peaks exceeding US air quality standards. Young men from Teplice were sampled up to seven times over 2 years allowing evaluation of semen quality after periods of exposure to both low and high air pollution. Routine semen analysis (sperm concentration, motility and morphology) and tests for sperm aneuploidy and chromatin integrity were performed, comparing measurements within each subject. Exposure was classified as high or low based on data from ambient air pollution monitoring. Using repeated measures analysis, a significant association was found between exposure to periods of high air pollution (at or above the upper limit of US air quality standards) and the percentage of sperm with DNA fragmentation according to sperm chromatin structure assay (SCSA). Other semen measures were not associated with air pollution. It is concluded that exposure to intermittent air pollution may result in sperm DNA damage and thereby increase the rates of male-mediated infertility, miscarriage, and other adverse reproductive outcomes.

  4. Preclinical evaluation of multi antigenic HCV DNA vaccine for the prevention of Hepatitis C virus infection.

    Lee, Hyojin; Jeong, Moonsup; Oh, Jooyeon; Cho, Youngran; Shen, Xuefei; Stone, John; Yan, Jian; Rothkopf, Zachary; Khan, Amir S; Cho, Byung Mun; Park, Young K; Weiner, David B; Son, Woo-Chan; Maslow, Joel N

    2017-03-07

    Direct-acting antiviral treatment for hepatitis C virus (HCV) infection is costly and does not protect from re-infection. For human and chimpanzees, recovery from acute HCV infection correlates with host CD4+ and CD8+ T cell responses. DNA plasmids targeting the HCV non-structural antigens NS3, NS4, and NS5, were previously reported to induce robust and sustained T cell responses in mice and primates. These plasmids were combined with a plasmid encoding cytokine IL-28B, together named as VGX-6150. The dose-dependent T cell response and safety of VGX-6150 administered intramuscularly and followed by electroporation was assessed in mice. Immune responses plateaued at 20 μg/dose with IL-28B demonstrating significant immunoadjuvant activity. Mice administered VGX-6150 at 40, 400, and 800 μg given either as a single injection or as 14 injections given bi-weekly over 26 weeks showed no vaccine related changes in any clinical parameter compared to placebo recipients. There was no evidence of VGX-6150 accumulation at the injection site or in any organ 1 month following the 14 th vaccination. Based on these studies, the approximate lethal dose (ALD) exceeds 800 μg/dose and the NOAEL was 800 μg/dose in mouse. In conclusion, VGX-6150 appears safe and a promising preventive vaccine candidate for HCV infection.

  5. DNA double-strand breaks in mammalian cells exposed to γ-rays and very heavy ions. Fragment-size distributions determined by pulsed-field gel electrophoresis

    Kraxenberger, F.; Friedl, A.A.; Eckardt-Schupp, F.; Weber, K.J.; Flentje, M.; Quicken, P.; Kellerer, A.M.; Ludwig-Maximilians University, Munich

    1998-01-01

    The spatial distribution of DNA double-strand breaks (DSB) was assessed after treatment of mammalian cells (V79) with densely ionizing radiation. Cells were exposed to beams of heavy charged particles (calcium ions: 6.9 MeV/u, 2.1.10 3 keV/μm; uranium ions: 9.0 MeV/u, 1.4.10 4 keV/μm) at the linear accelerator UNILAC of GSI, Darmstadt. DNA was isolated in agarose plugs and subjected to pulsed-field gel electrophoresis under conditions that separated DNA fragments of size 50 kbp to 5 Mbp. The measured fragment distributions were compared to those obtained after γ-irradiation and were analyzed by means of a convolution and a deconvolution technique. In contrast to the finding for γ-radiation, the distributions produced by heavy ions do not correspond to the random breakage model. Their marked overdispersion and the observed excess of short fragments reflect spatial clustering of DSB that extends over large regions of the DNA, up to several mega base pairs (Mbp). At fluences of 0.75 and 1.5/μm 2 , calcium ions produce nearly the same shape of fragment spectrum, merely with a difference in the amount of DNA entering the gel; this suggests that the DNA is fragmented by individual calcium ions. At a fluence of 0.8/μm 2 uranium ions produce a profile that is shifted to smaller fragment sizes in comparison to the profile obtained at a fluence of 0.4/μm 2 ; this suggests cumulative action of two separate ions in the formation of fragments. These observations are not consistent with the expectation that the uranium ions, with their much larger LET, should be more likely to produce single particle action than the calcium ions. However, a consideration of the greater lateral extension of the tracks of the faster uranium ions explains the observed differences; it suggests that the DNA is closely coiled so that even DNA locations several Mbp apart are usually not separated by less than 0.1 or 0.2 μm. (orig.)

  6. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

    Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

    2017-01-01

    Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

  7. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

    Kotoka Masuyama

    Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

  8. Historic and current hepatitis B viral DNA and quantitative HBsAg level are not associated with cirrhosis in non-Asian women with chronic hepatitis B.

    Harkisoen, S; Arends, J E; van den Hoek, J A R; Whelan, J; van Erpecum, K J; Boland, G J; Hoepelman, A I M

    2014-12-01

    Some studies done in Asian patients have shown that serum levels of hepatitis B virus (HBV) DNA predict the development of cirrhosis. However, it is unclear whether this also applies for non-Asian patients. This study investigated historic and current HBV DNA and quantitative hepatitis B surface antigen (HBsAg) levels as predictors of cirrhosis in non-Asian women with chronic HBV. A retrospective cohort study of non-Asian women with chronic HBV was performed. Among other variables, HBV DNA and quantitative HBsAg levels were measured in stored historic serum samples obtained during pregnancy (period 1990-2004) and current serum samples (period 2011-2012) to determine any association with liver cirrhosis by liver stiffness measurement (LSM). One hundred and nineteen asymptomatic, treatment-naïve non-Asian women were included; the median number of years between the historic sample and the current sample was 17 (interquartile range (IQR) 13-20). The median historic log HBV DNA and quantitative log HBsAg levels were 2.5 (IQR 1.9-3.4) IU/ml and 4.2 (IQR 3.6-4.5) IU/ml, respectively. LSM diagnosed 14 patients (12%) with F3-F4 fibrosis, i.e. stiffness >8.1kPa. No association of cirrhosis was found with historic HBV DNA (relative risk (RR) 0.34, 95% confidence interval (CI) 0.05-2.44) or with the quantitative HBsAg level (HBsAg level >1000 IU/ml, RR 0.35, 95% CI 0.11-1.11). Multivariable analysis identified alcohol consumption (odds ratio (OR) 6.4, 95% CI 1.3-30.1), aspartate aminotransferase >0.5 times the upper limit of normal (OR 15.4, 95% CI 1.9-122.6), and prothrombin time (OR 12.0, 95% CI 1.2-120.4), but not HBV DNA or quantitative HBsAg level, to be independent predictors of the presence of cirrhosis. Neither historic nor current HBV DNA or the quantitative HBsAg level is associated with the development of HBV-related cirrhosis in non-Asian women. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  9. Evaluation of hepatitis B surface antigen and hepatitis B virus-DNA results in postmortem plasma specimens

    Nihan Ziyade

    2015-03-01

    Full Text Available Objective: To assess the presence of hepatitis B surface antigen, one of the serologic markers of hepatitis B virus (HBV infection, in postmortem blood samples from autopsy cases using ELISA, and to compare the results with those obtained by PCR, which is the gold standard method in assessing HBV infection. Methods: The HBV test results of the blood samples from 880 autopsy cases determined in our laboratory, were retrospectively studied. Results: When compared with the gold standard method PCR, the sensitivity and specificity of postmortem ELISA were 100% and 84.1%, respectively. Conclusions: The increasingly used molecular diagnostic methods, such as PCR, should be used in cases where serological tests remain insufficient.We think that prospective studies on the comparison of ELISA and PCR assessment of postmortem blood samples with larger material should be carried out.

  10. Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

    Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

    2002-01-01

    , were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...

  11. Detection of supercoiled hepatitis B virus DNA and related forms by means of molecular hybridization to an oligonucleotide probe

    Lin, H.J.; Chung, H.T.; Lai, C.L.; Leong, S.; Tam, O.S.

    1989-01-01

    A novel assay for supercoiled and other fully double-stranded forms of hepatitis B virus (HBV) DNA in blood is presented that utilizes molecular hybridisation to a radiophosphorous-labeled oligonucleotide probe. The probe [5'-d(ACGTGCAGAGGTGAAGCGA)] is complementary to the S(+)-strand sequence furthest downstream, at the end of the gap. We examined blood specimens from 137 healthy HBsAg-positive individuals, applying the probe to dots representing 2-3.5 ml serum or plasma. We found that supercoiled HBV is present in many HBV DNA-positive blood specimens albeit in small quantities. Of the 104 specimens that were positive for HBV DNA of any form, 53 annealed to the probe. Serial specimens from the same subject taken over a period of months showed that the proportion of supercoil to other HBV DNA forms was variable. The presence of supercoil HBV DNA was not closely correlated with the level of serum HBV DNA polymerase. The supercoil is an HBV DNA form that can persist in the liver in the presence or absence of other replicative intermediates. This assay may enable further characterization of the status of HBV infection

  12. Preventive effects of a major component of green tea, epigallocathechin-3-gallate, on hepatitis-B virus DNA replication.

    Karamese, Murat; Aydogdu, Sabiha; Karamese, Selina Aksak; Altoparlak, Ulku; Gundogdu, Cemal

    2015-01-01

    Hepatitis B virus infection is one of the major world health problems. Epigallocatechin-3 gallate is the major component of the polyphenolic fraction of green tea and it has an anti-viral, anti-mutagenic, anti- tumorigenic, anti-angiogenic, anti-proliferative, and/or pro-apoptotic effects on mammalian cells. In this study, our aim was to investigate the inhibition of HBV replication by epigallocatechin-3 gallate in the Hep3B2.1-7 hepatocellular carcinoma cell line. HBV-replicating Hep3B2.1-7 cells were used to investigate the preventive effects of epigallocatechin-3 gallate on HBV DNA replication. The expression levels of HBsAg and HBeAg were determined using ELISA. Quantitative real-time-PCR was applied for the determination of the expression level of HBV DNA. Cytotoxicity of epigallocathechin-3-gallate was not observed in the hepatic carcinoma cell line when the dose was lower than 100 μM. The ELISA method demonstrated that epigallocatechin-3 gallate have strong effects on HBsAg and HBeAg levels. Also it was detected by real-time PCR that epigallocatechin-3 gallate could prevent HBV DNA replication. The obtained data pointed out that although the exact mechanism of HBV DNA replication and related diseases remains unclear, epigallocatechin-3 gallate has a potential as an effective anti-HBV agent with low toxicity.

  13. DNA fragmentation and membrane damage of bocachico Prochilodus magdalenae (Ostariophysi: Prochilodontidae sperm following cryopreservation with dimethylsulfoxide and glucose

    José Gregorio Martínez

    2012-09-01

    Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.O curimba Prochilodus magdalenae, é uma espécie nativa de água doce da Colômbia ameaçada de extinção, sendo a mais capturada localmente e uma das mais importantes para a conservação ex-situ (bancos de germoplasma. O objetivo deste estudo foi avaliar o efeito de três concentrações de dimetilsulfóxido (DMSO (5%, 10%, 15% e três de glicose (305, 333, 361 mM no diluente sobre a fragmentação do ADN espermático (F-DNA (através de Halomax®, dispersão da cromatina e danos em

  14. A Multiantigenic DNA Vaccine That Induces Broad Hepatitis C Virus-Specific T-Cell Responses in Mice.

    Gummow, Jason; Li, Yanrui; Yu, Wenbo; Garrod, Tamsin; Wijesundara, Danushka; Brennan, Amelia J; Mullick, Ranajoy; Voskoboinik, Ilia; Grubor-Bauk, Branka; Gowans, Eric J

    2015-08-01

    There are 3 to 4 million new hepatitis C virus (HCV) infections annually around the world, but no vaccine is available. Robust T-cell mediated responses are necessary for effective clearance of the virus, and DNA vaccines result in a cell-mediated bias. Adjuvants are often required for effective vaccination, but during natural lytic viral infections damage-associated molecular patterns (DAMPs) are released, which act as natural adjuvants. Hence, a vaccine that induces cell necrosis and releases DAMPs will result in cell-mediated immunity (CMI), similar to that resulting from natural lytic viral infection. We have generated a DNA vaccine with the ability to elicit strong CMI against the HCV nonstructural (NS) proteins (3, 4A, 4B, and 5B) by encoding a cytolytic protein, perforin (PRF), and the antigens on a single plasmid. We examined the efficacy of the vaccines in C57BL/6 mice, as determined by gamma interferon enzyme-linked immunosorbent spot assay, cell proliferation studies, and intracellular cytokine production. Initially, we showed that encoding the NS4A protein in a vaccine which encoded only NS3 reduced the immunogenicity of NS3, whereas including PRF increased NS3 immunogenicity. In contrast, the inclusion of NS4A increased the immunogenicity of the NS3, NS4B, andNS5B proteins, when encoded in a DNA vaccine that also encoded PRF. Finally, vaccines that also encoded PRF elicited similar levels of CMI against each protein after vaccination with DNA encoding NS3, NS4A, NS4B, and NS5B compared to mice vaccinated with DNA encoding only NS3 or NS4B/5B. Thus, we have developed a promising "multiantigen" vaccine that elicits robust CMI. Since their development, vaccines have reduced the global burden of disease. One strategy for vaccine development is to use commercially viable DNA technology, which has the potential to generate robust immune responses. Hepatitis C virus causes chronic liver infection and is a leading cause of liver cancer. To date, no vaccine is

  15. Anethole induces apoptotic cell death accompanied by reactive oxygen species production and DNA fragmentation in Aspergillus fumigatus and Saccharomyces cerevisiae.

    Fujita, Ken-Ichi; Tatsumi, Miki; Ogita, Akira; Kubo, Isao; Tanaka, Toshio

    2014-02-01

    trans-Anethole (anethole), a major component of anise oil, has a broad antimicrobial spectrum, and antimicrobial activity that is weaker than that of other antibiotics on the market. When combined with polygodial, nagilactone E, and n-dodecanol, anethole has been shown to possess significant synergistic antifungal activity against a budding yeast, Saccharomyces cerevisiae, and a human opportunistic pathogenic yeast, Candida albicans. However, the antifungal mechanism of anethole has not been completely determined. We found that anethole stimulated cell death of a human opportunistic pathogenic fungus, Aspergillus fumigatus, in addition to S. cerevisiae. The anethole-induced cell death was accompanied by reactive oxygen species production, metacaspase activation, and DNA fragmentation. Several mutants of S. cerevisiae, in which genes related to the apoptosis-initiating execution signals from mitochondria were deleted, were resistant to anethole. These results suggest that anethole-induced cell death could be explained by oxidative stress-dependent apoptosis via typical mitochondrial death cascades in fungi, including A. fumigatus and S. cerevisiae. © 2014 FEBS.

  16. 125IdUrd-induced chromosome fragments, assayed by premature chromosome condensation, and DNA double-strand breaks have similar repair kinetics in G1-phase CHO-cells

    Iliakis, George; Pantelias, G.E.; Okayasu, Ryuichi; Seaner, Robert

    1987-01-01

    The effect of 125 I-decay on cell lethality, and induction of chromosome and DNA damage, was studied in synchronous non-cycling, G 1 -phase CHO-cells. Neutral filter elution was used to assay repair of DNA double-strand breaks (dsbs), and premature chromosome condensation was used to assay repair of chromosome fragments and induction of ring chromosomes. The results indicate very little repair at the cell survival level (repair of PLD). At the DNA level an efficient repair of DNA dsbs was observed, with kinetics similar to those observed after exposure to X-rays. At the chromosome level a fast repair of prematurely condensed chromosome fragments was observed, with a concomitant increase in the number of ring chromosomes induced. The repair kinetics of chromosome fragments and DNA dsbs were very similar, suggesting that DNA dsbs may underlie chromosome fragmentation. (author)

  17. Hepatic deficiency of the pioneer transcription factor FoxA restricts hepatitis B virus biosynthesis by the developmental regulation of viral DNA methylation.

    Vanessa C McFadden

    2017-02-01

    Full Text Available The FoxA family of pioneer transcription factors regulates hepatitis B virus (HBV transcription, and hence viral replication. Hepatocyte-specific FoxA-deficiency in the HBV transgenic mouse model of chronic infection prevents the transcription of the viral DNA genome as a result of the failure of the developmentally controlled conversion of 5-methylcytosine residues to cytosine during postnatal hepatic maturation. These observations suggest that pioneer transcription factors such as FoxA, which mark genes for expression at subsequent developmental steps in the cellular differentiation program, mediate their effects by reversing the DNA methylation status of their target genes to permit their ensuing expression when the appropriate tissue-specific transcription factor combinations arise during development. Furthermore, as the FoxA-deficient HBV transgenic mice are viable, the specific developmental timing, abundance and isoform type of pioneer factor expression must permit all essential liver gene expression to occur at a level sufficient to support adequate liver function. This implies that pioneer transcription factors can recognize and mark their target genes in distinct developmental manners dependent upon, at least in part, the concentration and affinity of FoxA for its binding sites within enhancer and promoter regulatory sequence elements. This selective marking of cellular genes for expression by the FoxA pioneer factor compared to HBV may offer the opportunity for the specific silencing of HBV gene expression and hence the resolution of chronic HBV infections which are responsible for approximately one million deaths worldwide annually due to liver cirrhosis and hepatocellular carcinoma.

  18. Changing serum levels of quantitative hepatitis B surface antigen and hepatitis B virus DNA in hepatitis B virus surface antigen carriers: A follow-up study of an elderly cohort

    Yuan-Hung Kuo

    2015-02-01

    Full Text Available This study was to elucidate longitudinally quantitative changes of hepatitis B virus (HBV surface antigen (HBsAg and HBV DNA in elder HBsAg carriers in a community. Among 1002 residents screened for HBsAg in 2005, 405 responded to this follow-up study in 2010. Fifty-nine (14.6% were HBsAg carriers in 2005; HBsAg quantification and HBV DNA were measured. HBsAg quantification (cutoff 1600 IU/mL and HBV DNA (cutoff 2000 IU/mL were combined to stratify the participants between two screens. A total of 30 men and 29 women with a mean age of 63.9 ± 7.9 years were enrolled. Quantitative levels of HBsAg and HBV DNA were significantly correlated in 2005 (r = 0.509, p < 0.001 and 2010 (r = 0.777, p < 0.001. Concentrations of HBsAg (IU/mL significantly decreased from 2.2 ± 1.0 log in 2005 to 1.7 ± 1.5 log in 2010 (p < 0.001. The level of HBsAg was decreased in 48 (81.4% individuals and HBsAg was undetectable in eight (13.6%. The annual incidence of HBsAg clearance was 2.7%. These 59 HBsAg carriers in 2005 were divided into four groups: low HBsAg low HBV DNA (n = 32, high HBsAg low HBV DNA (n = 5, low HBsAg high HBV DNA (n = 12 and high HBsAg high HBV DNA (n = 10. All 32 individuals in the low HBsAg low HBV DNA group were still in that group in 2010, whereas only two of the high HBsAg high HBV DNA group became inactive. As with a younger cohort in hospital, HBsAg quantification was still well correlated with HBV DNA in elderly HBsAg carriers in the community. Lower levels of both HBsAg and HBV DNA might represent an inactive HBV infection.

  19. The Influence of Hepatitis C Virus Therapy on the DNA Base Excision Repair System of Peripheral Blood Mononuclear Cells.

    Czarny, Piotr; Merecz-Sadowska, Anna; Majchrzak, Kinga; Jabłkowski, Maciej; Szemraj, Janusz; Śliwiński, Tomasz; Karwowski, Bolesław

    2017-07-01

    Hepatitis C virus (HCV) can infect extrahepatic tissues, including lymphocytes, creating reservoir of the virus. Moreover, HCV proteins can interact with DNA damage response proteins of infected cells. In this article we investigated the influence of the virus infection and a new ombitasvir/paritaprevir/ritonavir ± dasabuvir ± ribavirin (OBV/PTV/r ± DSV ± RBV) anti-HCV therapy on the PBMCs (peripheral blood mononuclear cells, mainly lymphocytes) DNA base excision repair (BER) system. BER protein activity was analyzed in the nuclear and mitochondrial extracts (NE and ME) of PBMC isolated from patients before and after therapy, and from subjects without HCV, using modeled double-strand DNA, with 2'-deoxyuridine substitution as the DNA damage. The NE and ME obtained from patients before therapy demonstrated lower efficacy of 2'-deoxyuridine removal and DNA repair polymerization than those of the control group or patients after therapy. Moreover, the extracts from the patients after therapy had similar activity to those from the control group. However, the efficacy of apurinic/apyrimidinic site excision in NE did not differ between the studied groups. We postulate that infection of lymphocytes by the HCV can lead to a decrease in the activity of BER enzymes. However, the use of novel therapy results in the improvement of glycosylase activity as well as the regeneration of endonuclease and other crucial repair enzymes.

  20. Characterization of Timed Changes in Hepatic Copper Concentrations, Methionine Metabolism, Gene Expression, and Global DNA Methylation in the Jackson Toxic Milk Mouse Model of Wilson Disease

    Anh Le

    2014-05-01

    Full Text Available Background: Wilson disease (WD is characterized by hepatic copper accumulation with progressive liver damage to cirrhosis. This study aimed to characterize the toxic milk mouse from The Jackson Laboratory (Bar Harbor, ME, USA (tx-j mouse model of WD according to changes over time in hepatic copper concentrations, methionine metabolism, global DNA methylation, and gene expression from gestational day 17 (fetal to adulthood (28 weeks. Methods: Included liver histology and relevant biochemical analyses including hepatic copper quantification, S-adenosylmethionine (SAM and S-adenosylhomocysteine (SAH liver levels, qPCR for transcript levels of genes relevant to methionine metabolism and liver damage, and DNA dot blot for global DNA methylation. Results: Hepatic copper was lower in tx-j fetuses but higher in weanling (three weeks and adult tx-j mice compared to controls. S-adenosylhomocysteinase transcript levels were significantly lower at all time points, except at three weeks, correlating negatively with copper levels and with consequent changes in the SAM:SAH methylation ratio and global DNA methylation. Conclusion: Compared to controls, methionine metabolism including S-adenosylhomocysteinase gene expression is persistently different in the tx-j mice with consequent alterations in global DNA methylation in more advanced stages of liver disease. The inhibitory effect of copper accumulation on S-adenosylhomocysteinase expression is associated with progressively abnormal methionine metabolism and decreased methylation capacity and DNA global methylation.

  1. A DNA fragment from Xq21 replaces a deleted region containing the entire FVIII gene in a severe hemophilia A patient

    Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others

    1994-09-15

    In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.

  2. Relationships between sperm DNA fragmentation, sperm apoptotic markers and serum levels of CB-153 and p,p'-DDE in European and Inuit populations

    Stronati, A; Manicardi, G C; Cecati, M

    2006-01-01

    Persistent organochlorine pollutants (POPs) are suspected to interfere with hormone activity and the normal homeostasis of spermatogenesis. We investigated the relationships between sperm DNA fragmentation, apoptotic markers identified on ejaculated spermatozoa and POP levels in the blood of 652...... adult males (200 Inuits from Greenland, 166 Swedish, 134 Polish and 152 Ukrainian). Serum levels of 2, 2', 4, 4', 5, 5'-hexachlorobiphenyl (CB-153), as a proxy of the total POP burden, and of 1,1-dichloro-2,2-bis(p-chlorophenyl)-ethylene (p,p'-DDE), as a proxy of the total DDT exposure were determined...... neither sperm DNA fragmentation nor apoptotic sperm parameters and the large variations in POPs exposure was observed for the separate study groups. However, considering the European populations taken together, we showed that both %TUNEL positivity and Bcl-xL were related to CB-153 serum levels, whereas...

  3. ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

    Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

    2004-10-01

    Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

  4. Sperm DNA fragmentation induced by cryopreservation: new insights and effect of a natural extract from Opuntia ficus-indica.

    Meamar, Mehrdad; Zribi, Nassira; Cambi, Marta; Tamburrino, Lara; Marchiani, Sara; Filimberti, Erminio; Fino, Maria Grazia; Biggeri, Annibale; Menezo, Yves; Forti, Gianni; Baldi, Elisabetta; Muratori, Monica

    2012-08-01

    To analyze the effect of cryopreservation on sperm DNA fragmentation (SDF) in two cytometric sperm populations, PI(brighter) and PI(dimmer), and to test the effects of Opuntia ficus-indica (OFI) extracts, which contain antioxidants and flavanoids, and of resveratrol on cryopreservation of human semen. In vitro prospective study. Institutional study. Twenty-one normozoospermic men undergoing semen analysis for couple infertility. Cryopreservation using the routine method in the presence of OFI extracts or resveratrol. Measurement of SDF by TUNEL/PI flow cytometric method to evaluate sperm motility (by automated motion analysis, CASA system) and viability (by eosin/nigrosin staining) in the two populations of sperm PI(br) and PI(dim). Cryopreservation induced an increase of SDF only in the PI(br) sperm population. The increase was negatively dependent on the basal values of SDF in the same population. Addition of OFI extracts and resveratrol to the cryopreservation medium slightly but statistically significantly reduced SDF in the PI(br) population without affecting the deleterious effect of cryopreservation on sperm motion parameters or viability. The increase of SDF in the PI(br) population, which is unrelated to semen quality, suggests that caution must be taken in using cryopreserved semen, as morphologically normal and motile sperm may be damaged. The addition of substances with multifunctional properties such as OFI extracts to cryopreservation medium is only slightly effective in preventing the dramatic effects on SDF. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  5. The influence of ginger (Zingiber officinale on human sperm quality and DNA fragmentation: A double-blind randomized clinical trial

    Jalil Hosseini

    2016-08-01

    Full Text Available Background: Although the effectiveness of ginger as an antioxidant agent has been exploited, little human research has been conducted on its activity on male reproductive functions. Objective: This study was designed to investigate the effects of ginger (Zingiber officinale on sperm DNA fragmentation (SDF in infertile men. Materials and Methods: This randomized double-blind, placebo-controlled trial with a 1:1 allocation was performed on 100 infertility treatment candidates who were admitted to Royan Institute for Reproductive Biomedicine, Tehran, Iran. Patients were randomly assigned to receive one of two treatments: ginger and placebo. Patients were given a 3-month oral treatment (members received capsules containing 250 mg of ginger powder twice a day in ginger and a placebo in other group. Before and after treatment, standardized semen samples were obtained to determine sperm concentration, motility, and SDF according to World Health Organization. Results: There was no significant difference between two groups regarding SDF at baseline (53.48. 95%CI: 37.95-69.02 in cases and (56.75, 95%CI: 40.01-73.5 in controls. The average positive percentage of SDF in patients receiving ginger (17.77, 95%CI: 6.16-29.39 was lower compared with placebo (40.54, 95%CI: 23.94-57.13 after three month of treatment (p=0.02. In multivariate analysis, SDF was significantly lower in patients receiving ginger compared with placebo (mean difference: 3.21, 95%CI: 0.78-5.63, p=0.009. There were no significant differences between two groups regarding to semen parameters. Conclusion: The present study has demonstrated that ginger in a controlled study of efficacy was effective in decreasing SDF in infertile men.

  6. Morphometric comparison by the ISAS® CASA-DNAf system of two techniques for the evaluation of DNA fragmentation in human spermatozoa.

    Sadeghi, Sara; García-Molina, Almudena; Celma, Ferran; Valverde, Anthony; Fereidounfar, Sogol; Soler, Carles

    2016-01-01

    DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA) were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained), and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001). In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA). The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.

  7. Morphometric comparison by the ISAS® CASA-DNAf system of two techniques for the evaluation of DNA fragmentation in human spermatozoa

    Sara Sadeghi

    2016-01-01

    Full Text Available DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained, and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001. In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA. The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.

  8. [Serologic response to a DNA recombinant vaccine against hepatitis B in natives of the Peruvian Amazonian jungle].

    Colichón, A; Vildósola, H; Sjogren, M; Cantella, R; Rojas, C

    1990-01-01

    Large areas of the Amazon basin in Brazil, Colombia, Ecuador, and in the nonoriental region of the peruvian jungle have been found to be hyperendemic to Hepatitis B with high prevalence of asymptomatic carriers (11 to 25%) and, in more selected areas, Hepatitis Delta has been also reported. In the present report, we have studied 108 volunteers from six different Jivaroes communities living in a hyperendemic Hepatitis B area. They received 2 doses of DNA recombinant yeast derivated HBV vaccine. All the selected persons were HBsAb negatives, but many (80%) had antibodies to HBc. Following immunization schedule, 80% responded with the formation of HBsAb; a better seroconversion was achieved in those negatives to anticore IgG compared with those having HBcAb. We obtained 90% of seroconversion in spite of the fact that our vaccination schedule was prolonged up to 10 months from the one recommended by the manufacturer. The vaccination schedule 0,4, 14 months, and the schedule 0,4 months, had 76 and 29% of seroconversion, respectively. We want to point out three observations: 1) It is quite possible that many of the Anti-core positives, that did not respond to vaccination were carriers of HBsAg undetectable by the conventional EIA test carried out; 2) The seroconversion rate in these natives was low (up to six months after the vaccination schedule); and 3) Many of the HBcAb were false positives and many of them were recently infected. We conclude: A) It is highly important to assess the anti-HBs hyperendemic areas before attempting vaccinations; B) All persons negative to anti-HBs should be vaccinated in spite to anticore antibodies; C) Areas with difficult access could be vaccinated even until 10 months without affecting good results, and D) DNA recombinant vaccine (ENGERIX B) was well tolerated. No side effects were observed.

  9. Apoptotic DNA Degradation into Oligonucleosomal Fragments, but Not Apoptotic Nuclear Morphology, Relies on a Cytosolic Pool of DFF40/CAD Endonuclease*

    Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Gabernet, Gisela; García-Belinchón, Mercè; Sánchez-Osuna, María; Casanelles, Elisenda; Comella, Joan X.; Yuste, Victor J.

    2012-01-01

    Apoptotic cell death is characterized by nuclear fragmentation and oligonucleosomal DNA degradation, mediated by the caspase-dependent specific activation of DFF40/CAD endonuclease. Here, we describe how, upon apoptotic stimuli, SK-N-AS human neuroblastoma-derived cells show apoptotic nuclear morphology without displaying concomitant internucleosomal DNA fragmentation. Cytotoxicity afforded after staurosporine treatment is comparable with that obtained in SH-SY5Y cells, which exhibit a complete apoptotic phenotype. SK-N-AS cell death is a caspase-dependent process that can be impaired by the pan-caspase inhibitor q-VD-OPh. The endogenous inhibitor of DFF40/CAD, ICAD, is correctly processed, and dff40/cad cDNA sequence does not reveal mutations altering its amino acid composition. Biochemical approaches show that both SH-SY5Y and SK-N-AS resting cells express comparable levels of DFF40/CAD. However, the endonuclease is poorly expressed in the cytosolic fraction of healthy SK-N-AS cells. Despite this differential subcellular distribution of DFF40/CAD, we find no differences in the subcellular localization of both pro-caspase-3 and ICAD between the analyzed cell lines. After staurosporine treatment, the preferential processing of ICAD in the cytosolic fraction allows the translocation of DFF40/CAD from this fraction to a chromatin-enriched one. Therefore, the low levels of cytosolic DFF40/CAD detected in SK-N-AS cells determine the absence of DNA laddering after staurosporine treatment. In these cells DFF40/CAD cytosolic levels can be restored by the overexpression of their own endonuclease, which is sufficient to make them proficient at degrading their chromatin into oligonucleosome-size fragments after staurosporine treatment. Altogether, the cytosolic levels of DFF40/CAD are determinants in achieving a complete apoptotic phenotype, including oligonucleosomal DNA degradation. PMID:22253444

  10. DNA fragmentation dynamics allows the assessment of cryptic sperm damage in human: Evaluation of exposure to ionizing radiation, hyperthermia, acidic pH and nitric oxide

    Santiso, Rebeca; Tamayo, Maria [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain); Gosalvez, Jaime [Genetics Unit, Facultad de Biologia, Universidad Autonoma de Madrid, Ciudad Universitaria de Cantoblanco, 28049 Madrid (Spain); Johnston, Steve [School of Agriculture and Food Science, University of Queensland, Gatton 4343 (Australia); Marino, Alfonso [Servicio de Oncologia Radioterapica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Carlos; Losada, Carlos [Servicio de Radiofisica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Jose Luis, E-mail: Jose.Luis.Fernandez.Garcia@sergas.es [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain)

    2012-06-01

    Sperm DNA fragmentation (SDF) is not a static seminal parameter, since the longevity of sperm DNA decreases progressively with time following ejaculation or thawing. While the dynamics of SDF is a species-specific characteristic, in the case of humans, there is still significant variation within patients. To evaluate the suitability of the dynamic SDF assay to assess the adverse effects of agents that cause genetic damage, fresh semen samples from different donors were exposed in vitro to (1) increasing acute doses of ionizing radiation, (2) elevated temperature (41 Degree-Sign C and 45 Degree-Sign C), (3) acidic pH (pH 4) and (4) the nitric oxide (NO) donor sodium nitroprusside (SNP). Sperm DNA fragmentation was analyzed after an incubation period of chronic (24 h), or acute (1 h) exposure to each treatment followed by incubation at 37 Degree-Sign C over a period of 24 h. SDF was assessed using the sperm chromatin dispersion (SCD) test. Dynamic SDF for each treatment was analyzed using Kaplan-Meier survival curves. All agents, except for ionizing radiation, accelerated SDF kinetics following chronic exposure over a 24 h period. Transient exposure to NO and heat but not acidic pH increased the basal (T0) level of SDF. Despite the removal of the three toxicants, the remaining sperm following acute exposure showed a decrease in their expected DNA longevity. It is concluded that the assessment of sperm DNA fragmentation dynamics is an effective methodological approach for revealing latent damage associated with toxicants that is not initially expressed following a single initial observation of SDF.

  11. Cold-inducible RNA-binding protein through TLR4 signaling induces mitochondrial DNA fragmentation and regulates macrophage cell death after trauma.

    Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie

    2017-05-11

    Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mφ) direct trauma-induced inflammation, and Mφ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mφ and the subsequent regulation of Mφ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)-TLR4-MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mφ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mφ. However, autophagy activation also suppressed Mφ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mφ homeostasis in response to trauma.

  12. Paramecium putrinum (Ciliophora, Protozoa): the first insight into the variation of two DNA fragments - molecular support for the existence of cryptic species.

    Tarcz, Sebastian; Rautian, Maria; Potekhin, Alexey; Sawka, Natalia; Beliavskaya, Alexandra; Kiselev, Andrey; Nekrasova, Irina; Przyboś, Ewa

    2014-04-01

    Paramecium putrinum (Claparede & Lachmann 1858) is one of the smallest (80-140 μm long) species of the genus Paramecium. Although it commonly occurs in freshwater reservoirs, no molecular studies of P. putrinum have been conducted to date. Herein we present an assessment of molecular variation in 27 strains collected from widely separated populations by using two selected DNA fragments (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA). Both the trees and haplotype networks reconstructed for both genome fragments show that the studied strains of P. putrinum form five main haplogroups. The mean distance between the studied strains is p-distance=0.007/0.068 (rDNA/COI) and exhibits similar variability as that between P. bursaria syngens. Based on these data, one could hypothesize that the clusters revealed in the present study may correspond to previously reported syngens and that there are at least five cryptic species within P. putrinum. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Individual and combined effects of ochratoxin A and citrinin on viability and DNA fragmentation in cultured Vero cells and on chromosome aberrations in mice bone marrow cells

    Bouslimi, Amel; Bouaziz, Chayma; Ayed-Boussema, Imen; Hassen, Wafa; Bacha, Hassen

    2008-01-01

    Ochratoxin A (OTA) and citrinin (CTN) are two common contaminant mycotoxins which can occur jointly in a wide range of food commodities. Both mycotoxins have several toxic effects but share a significant nephrotoxic and carcinogenic potential since OTA and CTN were reported to be responsible for naturally occurring human and animal kidney diseases and tumors. Considering the concomitant production of OTA and CTN, it is very likely that humans and animals are always exposed to the mixture rather than to individual compounds. Therefore, the aim of the present study was to investigate, in vivo and in vitro, whether DNA damage is enhanced by combination of both mycotoxins as compared to their effect separately. To this end, we have assessed their effects individually or combined on cell proliferation and DNA fragmentation in cultured Vero cells and in vivo by monitoring the induction of chromosome aberrations. Our results clearly showed that cultured renal cells respond to OTA and CTN exposure by a moderate and weak inhibition of cell proliferation, respectively. However, when combined, they exert a significant increase in inhibition of cell viability. Similar results were found for the investigated genotoxicity endpoints (DNA fragmentation and chromosome aberrations). Altogether, our study showed that OTA and CTN combination effects are clearly synergistic. The synergistic induction of DNA damage observed with OTA and CTN taken concomitantly could be relevant to explain the molecular basis of the renal diseases and tumorogenesis induced by naturally occurring mycotoxins

  14. Mitochondrial outer membrane permeabilization increases reactive oxygen species production and decreases mean sperm velocity but is not associated with DNA fragmentation in human sperm.

    Treulen, F; Uribe, P; Boguen, R; Villegas, J V

    2016-02-01

    Does induction of mitochondrial outer membrane permeabilization (MOMP) in vitro affect specific functional parameters of human spermatozoa? Our findings show that MOMP induction increases intracellular reactive oxygen species (ROS) and decreases mean sperm velocity but does not alter DNA integrity. MOMP in somatic cells is related to a variety of apoptotic traits, such as alteration of mitochondrial membrane potential (ΔΨm), and increase in ROS production and DNA fragmentation. Although the presence of these apoptotic features has been reported in spermatozoa, to date the effects of MOMP on sperm function and DNA integrity have not been analysed. The study included spermatozoa from fertile donors. Motile sperm were obtained using the swim-up method. The highly motile sperm were collected and diluted with human tubal fluid to a final cell concentration of 5 × 10(6) ml(-1). To induce MOMP, selected sperm were treated at 37°C for 4 h with a mimetic of a Bcl-2 pro-apoptotic protein, ABT-737. MOMP was evaluated by relocating of cytochrome c. In addition, the effect of ABT-737 on mitochondrial inner membrane permeabilization was assessed using the calcein-AM/cobalt chloride method. In turn, ΔΨm was evaluated with JC-1 staining, intracellular ROS production with dihydroethidium, sperm motility was analysed by computer-assisted sperm analysis and DNA fragmentation by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) assay. Measurements were performed by flow cytometry. MOMP was associated with ΔΨm dissipation (P < 0.05), increased ROS production (P < 0.05) and decreased mean sperm velocity (P < 0.05), but it was not associated with DNA fragmentation. MOMP did not induce a large increase in ROS, which could explain the negligible effect of MOMP on sperm DNA fragmentation under our experimental conditions. The study was carried out in vitro using highly motile sperm, selected by swim-up, from healthy donors. The results obtained in this

  15. Fluorescence-labeled methylation-sensitive amplified fragment length polymorphism (FL-MS-AFLP) analysis for quantitative determination of DNA methylation and demethylation status.

    Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko

    2008-04-01

    The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.

  16. In vitro and in vivo assay of radio-induced damage in Escherichia Coli, DNA labelled on thymidilic fragment

    Bonicel, A.

    1977-01-01

    A technique of rapid assay for a particular and very important damage, N-formamido (DNA), is described. Using this technique, the importance of radio-induced DNA damage can be evaluated before the repair enzymatic system takes place [fr

  17. Biochemical analyses indicate that binding and cleavage specificities define the ordered processing of human Okazaki fragments by Dna2 and FEN1.

    Gloor, Jason W; Balakrishnan, Lata; Campbell, Judith L; Bambara, Robert A

    2012-08-01

    In eukaryotic Okazaki fragment processing, the RNA primer is displaced into a single-stranded flap prior to removal. Evidence suggests that some flaps become long before they are cleaved, and that this cleavage involves the sequential action of two nucleases. Strand displacement characteristics of the polymerase show that a short gap precedes the flap during synthesis. Using biochemical techniques, binding and cleavage assays presented here indicate that when the flap is ∼ 30 nt long the nuclease Dna2 can bind with high affinity to the flap and downstream double strand and begin cleavage. When the polymerase idles or dissociates the Dna2 can reorient for additional contacts with the upstream primer region, allowing the nuclease to remain stably bound as the flap is further shortened. The DNA can then equilibrate to a double flap that can bind Dna2 and flap endonuclease (FEN1) simultaneously. When Dna2 shortens the flap even more, FEN1 can displace the Dna2 and cleave at the flap base to make a nick for ligation.

  18. Performance Characteristics and Comparison of Abbott and artus Real-Time Systems for Hepatitis B Virus DNA Quantification ▿

    Ismail, Ashrafali M.; Sivakumar, Jayashree; Anantharam, Raghavendran; Dayalan, Sujitha; Samuel, Prasanna; Fletcher, Gnanadurai J.; Gnanamony, Manu; Abraham, Priya

    2011-01-01

    Virological monitoring of hepatitis B virus (HBV) DNA is critical to the management of HBV infection. With several HBV DNA quantification assays available, it is important to use the most efficient testing system for virological monitoring. In this study, we evaluated the performance characteristics and comparability of three HBV DNA quantification systems: Abbott HBV real-time PCR (Abbott PCR), artus HBV real-time PCR with QIAamp DNA blood kit purification (artus-DB), and artus HBV real-time PCR with the QIAamp DSP virus kit purification (artus-DSP). The lower limits of detection of these systems were established against the WHO international standards for HBV DNA and were found to be 1.43, 82, and 9 IU/ml, respectively. The intra-assay and interassay coefficients of variation of plasma samples (1 to 6 log10 IU/ml) ranged between 0.05 to 8.34% and 0.16 to 3.48% for the Abbott PCR, 1.53 to 26.85% and 0.50 to 12.89% for artus-DB, and 0.29 to 7.42% and 0.94 to 3.01% for artus-DSP, respectively. Ninety HBV clinical samples were used for comparison of assays, and paired quantitative results showed strong correlation by linear regression analysis (artus-DB with Abbott PCR, r = 0.95; Abbott PCR with artus-DSP, r = 0.97; and artus-DSP with artus-DB, r = 0.94). Bland-Altman analysis showed a good level of agreement for Abbott PCR and artus-DSP, with a mean difference of 0.10 log10 IU/ml and limits of agreement of −0.91 to 1.11 log10 IU/ml. No genotype-specific bias was seen in all three systems for HBV genotypes A, C, and D, which are predominant in this region. This finding illustrates that the Abbott real-time HBV and artus-DSP systems show more comparable performance than the artus-DB system, meeting the current guidelines for assays to be used in the management of hepatitis B. PMID:21795507

  19. Performance characteristics and comparison of Abbott and artus real-time systems for hepatitis B virus DNA quantification.

    Ismail, Ashrafali M; Sivakumar, Jayashree; Anantharam, Raghavendran; Dayalan, Sujitha; Samuel, Prasanna; Fletcher, Gnanadurai J; Gnanamony, Manu; Abraham, Priya

    2011-09-01

    Virological monitoring of hepatitis B virus (HBV) DNA is critical to the management of HBV infection. With several HBV DNA quantification assays available, it is important to use the most efficient testing system for virological monitoring. In this study, we evaluated the performance characteristics and comparability of three HBV DNA quantification systems: Abbott HBV real-time PCR (Abbott PCR), artus HBV real-time PCR with QIAamp DNA blood kit purification (artus-DB), and artus HBV real-time PCR with the QIAamp DSP virus kit purification (artus-DSP). The lower limits of detection of these systems were established against the WHO international standards for HBV DNA and were found to be 1.43, 82, and 9 IU/ml, respectively. The intra-assay and interassay coefficients of variation of plasma samples (1 to 6 log(10) IU/ml) ranged between 0.05 to 8.34% and 0.16 to 3.48% for the Abbott PCR, 1.53 to 26.85% and 0.50 to 12.89% for artus-DB, and 0.29 to 7.42% and 0.94 to 3.01% for artus-DSP, respectively. Ninety HBV clinical samples were used for comparison of assays, and paired quantitative results showed strong correlation by linear regression analysis (artus-DB with Abbott PCR, r = 0.95; Abbott PCR with artus-DSP, r = 0.97; and artus-DSP with artus-DB, r = 0.94). Bland-Altman analysis showed a good level of agreement for Abbott PCR and artus-DSP, with a mean difference of 0.10 log(10) IU/ml and limits of agreement of -0.91 to 1.11 log(10) IU/ml. No genotype-specific bias was seen in all three systems for HBV genotypes A, C, and D, which are predominant in this region. This finding illustrates that the Abbott real-time HBV and artus-DSP systems show more comparable performance than the artus-DB system, meeting the current guidelines for assays to be used in the management of hepatitis B.

  20. Routine screening of blood donations at Qingdao central blood bank, China, for hepatitis B virus (HBV) DNA with a real-time, multiplex nucleic acid test for HBV, hepatitis C virus, and human immunodeficiency virus Types 1 and 2.

    Yang, Zhongsi; Xu, Lei; Liu, Li; Feng, Qiuxia; Zhang, Longmu; Ma, Weijuan; Saldanha, John; Wang, Mingmin; Zhao, Lin

    2013-10-01

    The Roche cobas TaqScreen MPX test was used to evaluate the rate of hepatitis B surface antigen (HBsAg)-negative donations that were hepatitis B virus (HBV) DNA reactive from June 2010 to January 2011 in Qingdao, China. HBsAg-negative samples from 65,800 voluntary blood donors were tested with the cobas TaqScreen MPX test in pools of 6 on the Roche cobas s 201 blood screening platform. Samples positive for HBV DNA and negative for HBsAg were quantitated with the Roche COBAS AmpliPrep/COBAS TaqMan HBV test. In addition, serologic tests for HBsAg, hepatitis B surface antibody, anti-hepatitis B core antigen (anti-HBc), anti-hepatitis B e antigen (anti-HBe), and hepatitis B e antigen (HBe) were done using the Roche electrochemiluminescence immunoassay. A total of 80 nucleic acid amplification technology (NAT) test-reactive pools were identified and 59 pools (74%) resolved to a reactive sample. All samples were HBV DNA reactive and the viral load in each sample was quantitated. The viral loads of the samples ranged from less than 20 to 34,600 IU/mL; 13 samples (22%) had viral loads of more than 20 IU/mL, 27 samples (45.8%) had viral loads of less than 20 IU/mL, and 19 samples (32.2%) had undetectable viral loads. Of the 59 NAT-reactive samples, 40 (67.8%) were anti-HBc positive. Fifteen of the 59 samples could not be confirmed as NAT reactive either by an alternative NAT test or by serology. The HBV NAT yield in blood donors in Qingdao is 0.06% (38/65,800). This study confirmed the value of NAT for interdicting HBV-positive donations and preventing transfusion-transmitted HBV infections. © 2013 American Association of Blood Banks.

  1. Storage conditions of blood samples and primer selection affect the yield of cDNA polymerase chain reaction products of hepatitis C virus

    Cuypers, H. T.; Bresters, D.; Winkel, I. N.; Reesink, H. W.; Weiner, A. J.; Houghton, M.; van der Poel, C. L.; Lelie, P. N.

    1992-01-01

    We have noticed that suboptimal specimen processing and storage conditions may cause false-negative results in the detection of hepatitis C virus (HCV) RNA in plasma or serum. To establish the influence of specimen handling in a serological laboratory on the rate of detection of HCV RNA by the cDNA

  2. Detection of different categories of hepatitis B virus (HBV) infection in a multi-regional study comparing the clinical sensitivity of hepatitis B surface antigen and HBV-DNA testing

    Lelie, Nico; Bruhn, Roberta; Busch, Michael

    2017-01-01

    BACKGROUND: Twenty-two users of individual donation nucleic acid amplification technology (ID-NAT) in six geographical regions provided detailed hepatitis B virus (HBV) infection data in first-time, lapsed, and repeat donations and classified confirmed HBV-positive donors into different infection...... categories. These data were used to compare the clinical sensitivity of hepatitis B surface antigen (HBsAg) and HBV-DNA testing. STUDY DESIGN AND METHODS: In total 10,981,776 donations from South Africa, Egypt, the Mediterranean, North and Central Europe, South East Asia, and Oceania were screened for HBV...

  3. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  4. The field effect transistor DNA biosensor based on ITO nanowires in label-free hepatitis B virus detecting compatible with CMOS technology.

    Shariati, Mohsen

    2018-05-15

    In this paper the field-effect transistor DNA biosensor for detecting hepatitis B virus (HBV) based on indium tin oxide nanowires (ITO NWs) in label free approach has been fabricated. Because of ITO nanowires intensive conductance and functional modified surface, the probe immobilization and target hybridization were increased strongly. The high resolution transmission electron microscopy (HRTEM) measurement showed that ITO nanowires were crystalline and less than 50nm in diameter. The single-stranded hepatitis B virus DNA (SS-DNA) was immobilized as probe on the Au-modified nanowires. The DNA targets were measured in a linear concentration range from 1fM to 10µM. The detection limit of the DNA biosensor was about 1fM. The time of the hybridization process for defined single strand was 90min. The switching ratio of the biosensor between "on" and "off" state was ~ 1.1 × 10 5 . For sensing the specificity of the biosensor, non-complementary, mismatch and complementary DNA oligonucleotide sequences were clearly discriminated. The HBV biosensor confirmed the highly satisfied specificity for differentiating complementary sequences from non-complementary and the mismatch oligonucleotides. The response time of the DNA sensor was 37s with a high reproducibility. The stability and repeatability of the DNA biosensor showed that the peak current of the biosensor retained 98% and 96% of its initial response for measurements after three and five weeks, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  6. A trans-activator function is generated by integration of hepatitis B virus preS/S sequences in human hepatocellular carcinoma DNA

    Caselmann, W.H.; Meyer, M.; Kekule, A.S.; Lauer, U.; Hofschneider, P.H.; Koshy, R.

    1990-01-01

    The X gene of wild-type hepatitis B virus or integrated DNA has recently been shown to stimulate transcription of a variety of enhancers and promoters. To further delineate the viral sequences responsible for trans-activation in hepatomas, the authors cloned the single hepatitis B virus insert from human hepatocellular carcinoma DNA M1. The plasmid pM1 contains 2004 base of hepatitis B virus DNA subtype adr, including truncated preS/S sequences and the enhancer element. The X promoter and 422 nucleotides of the X coding region are present. The entire preC/C gene is deleted. In transient cotransfection assays using Chang liver cells (CCL 13), pM1 DNA exerts a 6- to 10-fold trans-activating effect on the expression of the pSV2CAT reporter plasmid. The transactivation occurs by stimulation of transcription and is dependent on the simian virus 40 enhancer in the reporter plasmid. Deletion analysis of pM1 subclones reveals that the transactivator is encoded by preS/S and not by X sequences. A frameshift mutation within the preS2 open reading frame shows that this portion is indispensable for the trans-activating function. Initiation of transcription has been mapped to the S1 promoter. A comparable trans-activating effect is also observed with cloned wild-type hepatitis B virus sequences similarly truncated. These results show that a transcriptional trans-activator function not present in the intact gene is generated by 3' truncation of integrated hepatitis B virus DNA preS/S sequences

  7. Identification of DNA Fragments that Showed Linkage to the Radiation-induced Yellow Vein Mosaic Disease Resistance Mutation in Okra

    Boonsirichai, Kanokporn; Phadvibulya, Valailak; Adthalungrong, Amnuai; Srithongchai, Wanphen; Puripunyavanich, Vichai

    2007-08-01

    Full text: The yellow vein mosaic disease resistant mutant of okra was crossed to Pichit 03, a susceptible variety. Their progeny showed prolonged resistance when compared with Pichit 03. DNA fingerprints of F2 and BC1F1 individuals from the cross indicated that most DNA bands did not segregate with either the resistance or the susceptible characteristics. Nonetheless, polymorphic DNA bands could be identified between the mutant and Okura, the parental variety

  8. The impact of partial manganese superoxide dismutase (SOD2)-deficiency on mitochondrial oxidant stress, DNA fragmentation and liver injury during acetaminophen hepatotoxicity

    Ramachandran, Anup; Lebofsky, Margitta; Weinman, Steven A.; Jaeschke, Hartmut

    2011-01-01

    Acetaminophen (APAP) hepatotoxicity is the most frequent cause of acute liver failure in many countries. The mechanism of cell death is initiated by formation of a reactive metabolite that binds to mitochondrial proteins and promotes mitochondrial dysfunction and oxidant stress. Manganese superoxide dismutase (SOD2) is a critical defense enzyme located in the mitochondrial matrix. The objective of this investigation was to evaluate the functional consequences of partial SOD2-deficiency (SOD2+/-) on intracellular signaling mechanisms of necrotic cell death after APAP overdose. Treatment of C57Bl/6J wild type animals with 200 mg/kg APAP resulted in liver injury as indicated by elevated plasma alanine aminotransferase activities (2870 ± 180 U/L) and centrilobular necrosis at 6 h. In addition, increased tissue glutathione disulfide (GSSG) levels and GSSG-to-GSH ratios, delayed mitochondrial GSH recovery, and increased mitochondrial protein carbonyls and nitrotyrosine protein adducts indicated mitochondrial oxidant stress. In addition, nuclear DNA fragmentation (TUNEL assay) correlated with translocation of Bax to the mitochondria and release of apoptosis-inducing factor (AIF). Furthermore, activation of c-jun-N-terminal kinase (JNK) was documented by the mitochondrial translocation of phospho-JNK. SOD2+/- mice showed 4-fold higher ALT activities and necrosis, an enhancement of all parameters of the mitochondrial oxidant stress, more AIF release and more extensive DNA fragmentation and more prolonged JNK activation. Conclusions: the impaired defense against mitochondrial superoxide formation in SOD2+/- mice prolongs JNK activation after APAP overdose and consequently further enhances the mitochondrial oxidant stress leading to exaggerated mitochondrial dysfunction, release of intermembrane proteins with nuclear DNA fragmentation and more necrosis.

  9. Correction of Diabetic Hyperglycemia and Amelioration of Metabolic Anomalies by Minicircle DNA Mediated Glucose-Dependent Hepatic Insulin Production.

    Tausif Alam

    Full Text Available Type 1 diabetes mellitus (T1DM is caused by immune destruction of insulin-producing pancreatic β-cells. Commonly used insulin injection therapy does not provide a dynamic blood glucose control to prevent long-term systemic T1DM-associated damages. Donor shortage and the limited long-term success of islet transplants have stimulated the development of novel therapies for T1DM. Gene therapy-based glucose-regulated hepatic insulin production is a promising strategy to treat T1DM. We have developed gene constructs which cause glucose-concentration-dependent human insulin production in liver cells. A novel set of human insulin expression constructs containing a combination of elements to improve gene transcription, mRNA processing, and translation efficiency were generated as minicircle DNA preparations that lack bacterial and viral DNA. Hepatocytes transduced with the new constructs, ex vivo, produced large amounts of glucose-inducible human insulin. In vivo, insulin minicircle DNA (TA1m treated streptozotocin (STZ-diabetic rats demonstrated euglycemia when fasted or fed, ad libitum. Weight loss due to uncontrolled hyperglycemia was reversed in insulin gene treated diabetic rats to normal rate of weight gain, lasting ∼1 month. Intraperitoneal glucose tolerance test (IPGT demonstrated in vivo glucose-responsive changes in insulin levels to correct hyperglycemia within 45 minutes. A single TA1m treatment raised serum albumin levels in diabetic rats to normal and significantly reduced hypertriglyceridemia and hypercholesterolemia. Elevated serum levels of aspartate transaminase, alanine aminotransferase, and alkaline phosphatase were restored to normal or greatly reduced in treated rats, indicating normalization of liver function. Non-viral insulin minicircle DNA-based TA1m mediated glucose-dependent insulin production in liver may represent a safe and promising approach to treat T1DM.

  10. Protective role of probiotic lactic acid bacteria against dietary fumonisin B1-induced toxicity and DNA-fragmentation in sprague-dawley rats.

    Khalil, Ashraf A; Abou-Gabal, Ashgan E; Abdellatef, Amira A; Khalid, Ahmed E

    2015-08-18

    The genus Fusarium, especially F. verticillioides and F. proliferatum, has been found in several agricultural products worldwide, especially in maize. Regardless the occurrence of symptoms, the presence of Fusarium in maize constitutes an imminent risk due to its ability to produce fumonisins, mycotoxins with proven carcinogenic effect on rats, swine, and equines and already classified as possible carcinogens to humans. The toxicity of incremental levels of fumonisin B1 (FB1), that is, 50, 100, and 200 mg FB1/kg diet, and the role of Lactobacillus delbrueckii subsp. lactis DSM 20076 (LL) and Pediococcus acidilactici NNRL B-5627 (PA) supplementation in counteracting the FB1 effects in intoxicated rats were monitored over a period of 4 weeks. Effects on the feed intake and body weight gain were noticed. A significant (p ≤ 0.05) increase in the level of liver and kidney functions markers and DNA fragmentation was also noticed in rat groups T100 and T200. The lactic acid bacteria (LAB) supplementation could bring back the normal serum biochemical parameters in rats fed on fumonisin B1-contaminated diets (T50 and T100) compared to FB1-treated groups. In rats of high-dosage dietary groups supplemented with LAB (T200-LL and T200-PA), the supplementation reduced the serum activity levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and creatinine by 11.3, 11.9, 32, and 20%, respectively. DNA fragmentations were observed in the rat group treated with 200 mg FB1 after 3 weeks, while fragmentation was noticed in treated groups with 100 and 200 mg FB1 after 4 weeks. No DNA fragmentation was apparent in FB1-treated rats co-administered the LL or PA strain. These results suggest that in male rats consuming diets containing FB1, there is a time- and dose-dependent increase in serum enzyme activities and DNA lesions. Moreover, Lb. delbrueckii subsp. lactis (LL) and P. acidilactici (PA) strains have a protective effect

  11. Toward metrological traceability for DNA fragment ratios in GM quantification. 3. Suitability of DNA calibrants studied with a MON 810 corn model.

    Charels, Diana; Broeders, Sylvia; Corbisier, Philippe; Trapmann, Stefanie; Schimmel, Heinz; Emons, Hendrik

    2007-05-02

    The quantification of GMOs by real-time PCR relies on an external calibrant. In this paper the suitability of two DNA calibrants, genomic DNA from plant leaves and plasmidic DNA, was investigated. The PCR efficiencies, the correlation coefficients of the calibration curves, and the ratios between PCR efficiencies of transgenic and endogenous sequences were compared for both calibrants using 59 data sets produced by 43 laboratories. There were no significant differences between plasmidic and genomic DNA except for the PCR efficiencies of the calibration curves for the transgene of the construct-specific real-time PCR method. In the GM system investigated, PCR efficiencies of plasmidic calibrants were slightly closer to the PCR efficiencies observed for the unknowns than those of the genomic DNA calibrant. Therefore, plasmidic DNA was the more suitable calibrant for the PCR measurements on genomic DNA extracted from MON 810 seeds. It is shown that plasmidic DNA is an appropriate choice for the calibration of measurements of MON 810 corn with respect to the DNA copy number ratio.

  12. GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

    VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  13. Isolation and characterization of DNA probes from a flow-sorted human chromosome 8 library that detect restriction fragment length polymorphism (RFLP).

    Wood, S; Starr, T V; Shukin, R J

    1986-01-01

    We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441

  14. How much DNA is lost? Measuring DNA loss of short-tandem-repeat length fragments targeted by the PowerPlex 16® system using the Qiagen MinElute Purification Kit.

    Kemp, Brian M; Winters, Misa; Monroe, Cara; Barta, Jodi Lynn

    2014-01-01

    The success in recovering genetic profiles from aged and degraded biological samples is diminished by fundamental aspects of DNA extraction, as well as its long-term preservation, that are not well understood. While numerous studies have been conducted to determine whether one extraction method was superior to others, nearly all of them were initiated with no knowledge of the actual starting DNA quantity in the samples prior to extraction, so they ultimately compared the outcome of all methods relative to the best. Using quantitative PCR to estimate the copy count of synthetic standards before (i.e., "copies in") and after (i.e., "copies out") purification by the Qiagen MinElute PCR Purification Kit, we documented DNA loss within a pool of 16 different-sized fragments ranging from 106 to 409 bp in length, corresponding to those targeted by the PowerPlex 16 System (Promega, Madison, WI). Across all standards from 10(4) to 10(7) copies/μL, loss averaged between 21.75% and 60.56% (mean, 39.03%), which is not congruent with Qiagen's claim that 80% of 70 bp to 4 kb fragments are retained using this product (i.e., 20% loss). Our study also found no clear relationship either between DNA strand length and retention or between starting copy number and retention. This suggests that there is no molecule bias across the MinElute column membrane and highlights the need for manufacturers to clearly and accurately describe on what their claims are based, and should also encourage researchers to document DNA retention efficiencies of their own methods and protocols. Understanding how and where to reduce loss of molecules during extraction and purification will serve to generate clearer and more accurate data, which will enhance the utility of ancient and low-copy-number DNA as a tool for closing forensic cases or in reconstructing the evolutionary history of humans and other organisms.

  15. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  16. PCR typing of DNA fragments of the short tandem repeat (STR) system HUMTH01 in Danes and Greenland Eskimos

    Nellemann, L J; Møller, A; Morling, N

    1994-01-01

    /child pairs were analyzed. Significant differences were observed between the distribution of fragments ('alleles'), whereby allele number 7 was considerably more frequent in Eskimos (0.687) than in Danes (0.201). The distributions of HUMTH01 phenotypes were in Hardy-Weinberg equilibrium in both the Eskimo...

  17. HBV-Specific shRNA is Capable of Reducing the Formation of Hepatitis B Virus Covalently Closed Circular DNA, but has No Effect on Established Covalently Closed Circular DNA in vitro

    Starkey, Jason L.; Chiari, Estelle F.; Isom, Harriet C.

    2009-01-01

    Hepatitis B virus (HBV) covalently closed circular DNA (CCC DNA) is the source of HBV transcripts and persistence in chronically infected patients. The novel aspect of this study was to determine the effect of RNA interference (RNAi) on HBV CCC DNA when administered prior to establishment of HBV replication or during chronic HBV infection. HBV replication was initiated in HepG2 cells by transduction with HBV baculovirus. Subculture of HBV expressing HepG2 cells at 10 days post-transduction ge...

  18. Biological activity of cloned mammary tumor virus DNA fragments that bind purified glucocorticoid receptor protein in vitro

    Yamamoto, K.R.; Payvar, F.; Firestone, G.L.; Maler, B.A.; Wrange, O.; Carlstedt-Duke, J.; Gustafsson, J.A.; Chandler, V.L.; Karolinska Institutet, Stockholm, Sweden)

    1983-01-01

    To test whether high-affinity receptor:DNA interactions can be correlated with receptor effects on promoter function in vivo, we have mapped in greater detail the receptor-binding regions on murine mammary tumor virus DNA, using both nitrocellulose-filter binding and electron microscopy. Recombinant plasmids bearing these receptor-binding domains have been transfected into cultured cells, and the expression of the plasmid sequences has been monitored for hormonal regulation. The results are considered in terms of a speculative proposal that the glucocorticoid receptor may effect changes in promoter activity via specific alteration of chromatin and/or DNA structure. 37 references, 6 figures, 2 tables

  19. Validation of a new test for Schistosoma haematobium based on detection of Dra1 DNA fragments in urine: evaluation through latent class analysis.

    Olufunmilola Ibironke

    2012-01-01

    Full Text Available Diagnosis of urogenital schistosomiasis in chronically infected adults is challenging but important, especially because long term infection of the bladder and urinary tract can have dire consequences. We evaluated three tests for viable infection: detection of parasite specific DNA Dra1 fragments, haematuria and presence of parasite eggs for sensitivity (Se and specificity (Sp.Over 400 urine specimens collected from adult volunteers in an endemic area in Western Nigeria were assessed for haematuria then filtered in the field, the filter papers dried and later examined for eggs and DNA. The results were stratified according to sex and age and subjected to Latent Class analysis.Presence of Dra1 in males (Se=100%; Sp=100% exceeded haematuria (Se=87.6%: Sp=34.7% and detection of eggs (Se=70.1%; Sp=100%. In females presence of Dra1 was Se=100%: Sp=100%, exceeding haematuria (Se=86.7%: Sp=77.0% and eggs (Se=70.1%; Sp=100%. Dra1 became undetectable 2 weeks after praziquantel treatment. We conclude detection of Dra1 fragment is a definitive test for the presence of Schistosoma haematobium infection.

  20. Reactive oxygen species levels and DNA fragmentation on astrocytes in primary culture after acute exposure to low intensity microwave electromagnetic field.

    Campisi, Agata; Gulino, Marisa; Acquaviva, Rosaria; Bellia, Paolo; Raciti, Giuseppina; Grasso, Rosaria; Musumeci, Francesco; Vanella, Angelo; Triglia, Antonio

    2010-03-31

    The exposure of primary rat neocortical astroglial cell cultures to acute electromagnetic fields (EMF) in the microwave range was studied. Differentiated astroglial cell cultures at 14 days in vitro were exposed for 5, 10, or 20min to either 900MHz continuous waves or 900MHz waves modulated in amplitude at 50Hz using a sinusoidal waveform and 100% modulation index. The strength of the electric field (rms value) at the sample position was 10V/m. No change in cellular viability evaluated by MTT test and lactate dehydrogenase release was observed. A significant increase in ROS levels and DNA fragmentation was found only after exposure of the astrocytes to modulated EMF for 20min. No evident effects were detected when shorter time intervals or continuous waves were used. The irradiation conditions allowed the exclusion of any possible thermal effect. Our data demonstrate, for the first time, that even acute exposure to low intensity EMF induces ROS production and DNA fragmentation in astrocytes in primary cultures, which also represent the principal target of modulated EMF. Our findings also suggest the hypothesis that the effects could be due to hyperstimulation of the glutamate receptors, which play a crucial role in acute and chronic brain damage. Furthermore, the results show the importance of the amplitude modulation in the interaction between EMF and neocortical astrocytes. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  1. Hepatic Encephalopathy

    Full Text Available ... Disease Type 1 (von Gierke) Hemochromatosis Hepatic Encephalopathy Hepatitis A Hepatitis B Hepatitis C Intrahepatic Cholestasis of Pregnancy ( ... Disease Type 1 (von Gierke) Hemochromatosis Hepatic Encephalopathy Hepatitis A Hepatitis B Hepatitis C Intrahepatic Cholestasis of Pregnancy ( ...

  2. Effect of ovarian tissue storage in Morus nigra extract on the morphology and DNA fragmentation of ovine preantral follicles

    Agnes Yasmin Pitombeira Cavalcante

    2017-08-01

    Full Text Available This study demonstrated the effect of Morus nigra leaf extract during ovine ovarian tissue transportation on the survival and apoptosis of preantral follicles in vitro. High Performance Liquid Chromatography (HPLC was used to determine the fingerprint chromatogram of the crude ethanolic extract. Four pairs of ovaries from four sheep were collected. The ovarian cortex was fragmented and one fragment was fixed in 10% buffered formaldehyde and processed for histological and TUNEL analysis (fresh control. The other fragments were placed in Minimal Essential Medium (MEM – control medium or M. nigra extract (0.025; 0.05 or 0.1 mg/mL and stored (simulating transport at 4ºC for 6, 12 or 24 h. Preserved fragments (6 h were also destined to histological and TUNEL analysis. HPLC analysis confirmed the presence of antioxidant compounds (rutin, isoquercetin e kaempferitrin in the extract. There was a decrease (P 0.05 to 0.1 mg/mL of the extract. Apoptosis increased (P < 0.05 after conservation for 6 h in all treatments compared to the fresh control. Moreover, TUNEL positive cells decreased (P < 0.05 after preservation in 0.05 or 0.1 mg/mL M. nigra compared to MEM or 0.025 mg/mL M. nigra. In conclusion, 0.05 mg/mL M. nigra extract can be used as a preservation medium for ovine ovarian tissue at 4°C for up to 6 h.

  3. Expression of the hepatitis B virus genome in chronic hepatitis B carriers and patients with hepatocellular carcinoma

    Bowyer, S.M.; Dusheiko, G.M.; Schoub, B.D.; Kew, M.C.

    1987-01-01

    The authors examined the methylation status of CCGG sites in hepatitis B virus (HBV) DNA to determine whether methylation could be responsible for the selective expression of the HBV surface gene in chronic hepatitis B infection and hepatocellular carcinoma. Infected liver tissue from patients with low levels of viral replication was analyzed for HBV DNA copy number per haploid cell genome. Total cellular DNA, with sufficient HBV DNA, was digested with the restriction endonucleases Msp I and Hpa II, to determine whether the HBV DNA was methylated, or HindIII, to determine whether the HBV DNA was integrated or episomal. The cleavage fragments were analyzed by Southern blotting and hybridization to 32 P-labeled HBV DNA. In replicative chronic hepatitis B, hypomethylation of the HBV genome correlated with HBV expression in both virions and infected tissue. In carriers with nonreplicative infection, it was difficult to ascertain the role of methylation as copy number was low. HBV DNA copy number was also low in 17 out of 29 of the rumor tissues tested and as many as 14 out of 16 of the adjacent non-neoplastic tissues tested. Integrated sequences were hypermethylated in the PLC/PRF/5 cell line and in six of the tumor tissues suggesting that methylation plays a role in HBV gene repression. However, since DNA from five other tumors was hypomethylated, the belief that methylation per se is an absolute determinant of HBV core gene repression does not hold for human hepatocellular carcinoma tissue

  4. Sodium phenylbutyrate ameliorates focal cerebral ischemic/reperfusion injury associated with comorbid type 2 diabetes by reducing endoplasmic reticulum stress and DNA fragmentation.

    Srinivasan, Krishnamoorthy; Sharma, Shyam S

    2011-11-20

    Endoplasmic reticulum (ER) stress has been postulated to play a crucial role in the pathophysiology of cerebral ischemic/reperfusion (I/R) injury and diabetes. Diabetes is a major risk factor and also common amongst the people who suffer from stroke. In this study, we have investigated the neuroprotective potential of sodium 4-phenylbutyrate (SPB; 30-300mg/kg), a chemical chaperone by targeting ER stress in a rat model of transient focal cerebral ischemia associated with comorbid type 2 diabetes. Intraperitoneal treatment with SPB (100 and 300mg/kg) significantly ameliorated brain I/R damage as evidenced by reduction in cerebral infarct and edema volume. It also significantly improved the functional recovery of various neurobehavioral impairments (neurological deficit score, grip strength and rota rod) evoked by I/R compared with vehicle-treatment. Further, SPB (100mg/kg) significantly reduced the DNA fragmentation as shown by prominent reduction in terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL)-positive cells. This effect was observed concomitantly with significant attenuation in upregulation of 78kDa glucose regulated protein (GRP78), CCAAT/enhancer binding protein homologous protein or growth arrest DNA damage-inducible gene 153 (CHOP/GADD153) and activation of caspase-12, specific markers of ER stress/apoptosis. The neuroprotection observed with SPB was independent of its effect on cerebral blood flow and blood glucose. In conclusion, this study demonstrates the neuroprotective effect of SPB owing to amelioration of ER stress and DNA fragmentation. It also suggest that targeting ER stress might offer a promising therapeutic approach and benefits against ischemic stroke associated with comorbid type 2 diabetes. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Hepatitis B virus DNA integration occurs early in the viral life cycle in an in vitro infection model via NTCP-dependent uptake of enveloped virus particles.

    Tu, Thomas; Budzinska, Magdalena A; Vondran, Florian W R; Shackel, Nicholas A; Urban, Stephan

    2018-02-07

    Chronic infection by the Hepatitis B Virus (HBV) is the major contributor to liver disease worldwide. Though HBV replicates via a nuclear episomal DNA (cccDNA), integration of HBV DNA into the host cell genome is regularly observed in the liver of infected patients. While reported as a pro-oncogenic alteration, the mechanism(s) and timing of HBV DNA integration are not well-understood, chiefly due to the lack of in vitro infection models that have detectable integration events. Here, we have established an in vitro system in which integration can be reliably detected following HBV infection. We measured HBV DNA integration using inverse nested PCR in primary human hepatocytes, HepaRG-NTCP, HepG2-NTCP, and Huh7-NTCP cells after HBV infection. Integration was detected in all cell types at a rate of >1 per 10000 cells, with the most consistent detection in Huh7-NTCP cells. Integration rate remained stable between 3 and 9 days post-infection. HBV DNA integration was efficiently blocked by treatment with 200nM of the HBV entry inhibitor Myrcludex B, but not with 10μM Tenofovir, 100U Interferon alpha, or 1μM of the capsid assembly inhibitor GLS4. This suggests integration of HBV DNA occurs immediately after infection of hepatocytes and is likely independent of de novo HBV replication in this model. Site analysis revealed that HBV DNA integrations were distributed over the entire human genome. Further, integrated HBV DNA sequences were consistent with double-stranded linear HBV DNA being the major precursor. Thus, we have established an in vitro system to interrogate the mechanisms of HBV DNA integration. Importance Hepatitis B Virus (HBV) is a common blood-borne pathogen and, following a chronic infection, can cause liver cancer and liver cirrhosis. Integration of HBV DNA into the host genome occurs in all known members of the hepadnaviridae family, despite this form not being necessary for viral replication. HBV DNA integration has been reported to drive liver cancer

  6. Chronic hepatitis B infection and HBV DNA-containing capsids: Modeling and analysis

    Manna, Kalyan; Chakrabarty, Siddhartha P.

    2015-05-01

    We analyze the dynamics of chronic HBV infection taking into account both uninfected and infected hepatocytes along with the intracellular HBV DNA-containing capsids and the virions. While previous HBV models have included either the uninfected hepatocytes or the intracellular HBV DNA-containing capsids, our model accounts for both these two populations. We prove the conditions for local and global stability of both the uninfected and infected steady states in terms of the basic reproduction number. Further, we incorporate a time lag in the model to encompass the intracellular delay in the production of the infected hepatocytes and find that this delay does not affect the overall dynamics of the system. The results for the model and the delay model are finally numerically illustrated.

  7. Usefulness of in-house PCR methods for hepatitis B virus DNA detection.

    Portilho, Moyra Machado; Baptista, Marcia Leite; da Silva, Messias; de Sousa, Paulo Sérgio Fonseca; Lewis-Ximenez, Lia Laura; Lampe, Elisabeth; Villar, Livia Melo

    2015-10-01

    The aim of the present study was to evaluate the performance of three in-house PCR techniques for HBV DNA detection and compare it with commercial quantitative methods to evaluate the usefulness of in-house methods for HBV diagnosis. Three panels of HBsAg reactive sera samples were evaluated: (i) 50 samples were examined using three methods for in-house qualitative PCR and the Cobas Amplicor HBV Monitor Assay; (ii) 87 samples were assayed using in-house semi-nested PCR and the Cobas TaqMan HBV test; (iii) 11 serial samples obtained from 2 HBV-infected individuals were assayed using the Cobas Amplicor HBV test and semi-nested PCR. In panel I, HBV DNA was detected in 44 samples using the Cobas Amplicor HBV test, 42 samples using semi-nested PCR (90% concordance with Cobas Amplicor), 22 samples using PCR for the core gene (63.6% concordance) and 29 samples using single-round PCR for the pre-S/S gene (75% concordance). In panel II, HBV DNA was quantified in 78 of the 87 HBsAg reactive samples using Cobas TaqMan but 52 samples using semi-nested PCR (67.8% concordance). HBV DNA was detected in serial samples until the 17th and 26th week after first donation using in-house semi-nested PCR and the Cobas Amplicor HBV test, respectively. In-house semi-nested PCR presented adequate concordance with commercial methods as an alternative method for HBV molecular diagnosis in low-resource settings. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Identification of Candida species by PCR and restriction fragment length polymorphism analysis of intergenic spacer regions of ribosomal DNA.

    Williams, D W; Wilson, M J; Lewis, M A; Potts, A J

    1995-01-01

    The PCR was used to amplify a targeted region of the ribosomal DNA from 84 Candida isolates. Unique product sizes were obtained for Candida guilliermondii, Candida (Torulopsis) glabrata, and Candida pseudotropicalis. Isolates of Candida albicans, Candida tropicalis, Candida stellatoidea, Candida parapsilosis, and Candida krusei could be identified following restriction digestion of the PCR products.

  9. Grapefruit juice intake does not enhance but rather protects against aflatoxin B1-induced liver DNA damage through a reduction in hepatic CYP3A activity.

    Miyata, Masaaki; Takano, Hiroki; Guo, Lian Q; Nagata, Kiyoshi; Yamazoe, Yasushi

    2004-02-01

    Influence of grapefruit juice intake on aflatoxin B1 (AFB1)-induced liver DNA damage was examined using a Comet assay in F344 rats given 5 mg/kg AFB1 by gavage. Rats allowed free access to grapefruit juice for 5 days prior to AFB1 administration resulted in clearly reduced DNA damage in liver, to 65% of the level in rats that did not receive grapefruit juice. Furthermore, rats treated with grapefruit juice extract (100 mg/kg per os) for 5 days prior to AFB1 treatment also reduced the DNA damage to 74% of the level in rats that did not receive grapefruit juice. No significant differences in the portal blood and liver concentrations of AFB1 were observed between grapefruit juice intake rats and the controls. In an Ames assay with AFB1 using Salmonella typhimurium TA98, lower numbers of revertant colonies were detected with hepatic microsomes prepared from rats administered grapefruit juice, compared with those from control rats. Microsomal testosterone 6beta-hydroxylation was also lower with rats given grapefruit juice than with control rats. Immunoblot analyses showed a significant decrease in hepatic CYP3A content, but not CYP1A and CYP2C content, in microsomes of grapefruit juice-treated rats than in non-treated rats. No significant difference in hepatic glutathione S-transferase (GST) activity and glutathione content was observed in the two groups. GSTA5 protein was not detected in hepatic cytosol of the two groups. In microsomal systems, grapefruit juice extract inhibited AFB1-induced mutagenesis in the presence of a microsomal activation system from livers of humans as well as rats. These results suggest that grapefruit juice intake suppresses AFB1-induced liver DNA damage through inactivation of the metabolic activation potency for AFB1 in rat liver.

  10. Analysis of hepatitis B virus intrahepatic covalently closed circular DNA and serum viral markers in treatment-naive patients with acute and chronic HBV infection.

    Weijie Li

    Full Text Available BACKGROUND: This study aimed to investigate the relationships of intrahepatic cccDNA with serum HBsAg and with HBV DNA in treatment-naive patients throughout acute and chronic HBV infection. METHODS: A total of 120 patients who had a liver biopsy were enrolled, including 19 with acute hepatitis B (AHB, and 101 patients with chronic HBV infection (CHB of whom were 10 in immune-tolerant (IT phase, 59 in immune-clearance (IC phase, 8 in low-replicative (LR phase, and 24 in HBeAg-negative hepatitis (ENH phase. Intrahepatic cccDNA, serum HBsAg and serum HBV DNA levels were comparatively analyzed. RESULTS: The median intrahepatic cccDNA levels were 0.18 4.80, 3.81, 0.22 and 0.97 copies/cell for patients with AHB, CHB-IT, CHB-IC, CHB-LR, and CHB-ENH, respectively. In AHB patients, intrahepatic cccDNA was positively correlated with serum HBsAg (r = 0.665, P = 0.003, as well as serum HBV DNA (r = 0.536, P = 0.022. In CHB patients, intrahepatic cccDNA was positively correlated with serum HBsAg in the IC phase (r = 0.392, P = 0.005, and with serum HBV DNA in the IC phase (r = 0.301, P = 0.036 and ENH phase (r = 0.588, P = 0.013. HBV replicative efficiency, defined as the ratio of serum HBV DNA to intrahepatic cccDNA, was obviously lower in AHB and CHB-LR patients than in CHB-IT, CHB-IC and CHB-ENH patients (0.70 and 0.53 vs. 1.12, 1.09 and 0.99, P<0.001, values were logarithmic transformed for analysis. In CHB-IC patients, HBV replicative efficiency was positively correlated with histological activity index of liver inflammation (r = 0.308, P = 0.009. CONCLUSION: Serum HBsAg and HBV DNA levels may reflect the amount of active intrahepatic cccDNA in treatment-naive AHB and CHB-IC patients. Reduced intrahepatic cccDNA and HBV replicative efficiency may imply effective immune control of HBV infection.

  11. Elicitation of strong immune responses by a DNA vaccine expressing a secreted form of hepatitis C virus envelope protein E2 in murine and porcine animal models

    Li, Yiping; Kang, H.N.; Babiuk, L.A.

    2006-01-01

    boosting with a recombinant E2 protein vaccine formulated with CpG ODN and 10% Emulsigen. The immunogenicity of HCV E2 vaccines was analyzed by ELISA for antibody responses, MTT assay for lymphocyte proliferation, ELISPOT for the number of interferon-gamma secreting cells, and cytotoxic T lymphocyte assays...... and shifted the immune response towards Th2-like ones in piglets. CONCLUSION: A DNA vaccine expressing a secreted form of HCV E2 protein elicited E2-specific immune responses in mice and piglets. Recombinant E2 protein vaccination following DNA immunization significantly increased the antibody response......AIM: To characterize the immunogenicity of a hepatitis C virus (HCV) E2 DNA vaccine alone or with a protein vaccine boost in murine and porcine animal models. METHODS: A DNA vaccine expressing a secreted form of HCV E2 protein was constructed and used to vaccinate mice and piglets with or without...

  12. Physical and chemical properties of chromatin and its fragments formed in the rat thymus during postirradiation autolysis and under the influence of DNA-ase and protease on DNP preparations

    Ermolaeva, N.V.; Vodolazskaya, N.A.

    1978-01-01

    It has been shown that the thymus chromatin degradation 2-8 hr after irradiation is followed by its cross-splitting and accumulation of several types of fragments differing in the degree of DNA association with the protein. Participation of proteases in the formation of fragments is hardly probable. Acid DNAase is involved in the autolysis perhaps in his maximum later 6 hr after irradiation

  13. Plasma Epstein-Barr virus and Hepatitis B virus in non-Hodgkin lymphomas: Two lymphotropic, potentially oncogenic, latently occurring DNA viruses.

    Sinha, Mahua; Rao, Clementina Rama; Premalata, C S; Shafiulla, Mohammed; Lakshmaiah, K C; Jacob, Linu Abraham; Babu, Govind K; Viveka, B K; Appaji, L; Subramanyam, Jayshree R

    2016-01-01

    There is a need to study potential infective etiologies in lymphomas. Lymphocyte-transforming viruses can directly infect lymphocytes, disrupt normal cell functions, and promote cell division. Epstein-Barr virus (EBV) is known to be associated with several lymphomas, especially Hodgkin lymphomas (HLs). And recently, the lymphocyte-transforming role of hepatitis B virus (HBV) has been emphasized. The aim of this study was to elucidate the association of two potentially oncogenic, widely prevalent latent DNA viruses, EBV and HBV, in non-HL (NHL). In this prospective study, we estimated plasma EBV and HBV DNA in NHL patients. Peripheral blood was obtained from newly diagnosed, treatment na ïve, histologically confirmed NHL patients. Plasma EBV DNA was quantified by real-time polymerase chain reaction (PCR) targeting Epstein-Barr Nucleic acid 1 while the plasma HBV DNA was detected using nested PCR targeting HBX gene. In a small subset of patients, follow-up plasma samples post-anticancer chemotherapy were available and retested for viral DNA. Of the 110 NHL patients, ~79% were B-cell NHL and ~21% were T-cell NHL. Plasma EBV-DNA was detected in 10% NHLs with a higher EBV association in Burkitt lymphoma (33.3%) than other subtypes. Pretherapy HBV DNA was detected in 21% NHLs; most of them being diffuse large B-cell lymphoma (DLBCL). Moreover, 42% of DLBCL patients had HBV DNA in plasma. Since all patients were HBV surface antigen seronegative at diagnosis, baseline plasma HBV-DNAemia before chemotherapy was indicative of occult hepatitis B infection. Our findings indicate a significant association of HBV with newly diagnosed DLBCL.

  14. Toward metrological traceability for DNA fragment ratios in GM quantification. 1. Effect of DNA extraction methods on the quantitative determination of Bt176 corn by real-time PCR.

    Corbisier, Philippe; Broothaerts, Wim; Gioria, Sabrina; Schimmel, Heinz; Burns, Malcolm; Baoutina, Anna; Emslie, Kerry R; Furui, Satoshi; Kurosawa, Yasunori; Holden, Marcia J; Kim, Hyong-Ha; Lee, Yun-Mi; Kawaharasaki, Mamoru; Sin, Della; Wang, Jing

    2007-05-02

    An international CCQM-P60 pilot study involving eight national metrological institutes was organized to investigate if the quantification of genetically modified (GM) corn powder by real-time PCR was affected by the DNA extraction method applied. Four commonly used extraction methods were compared for the extraction of DNA from a GM Bt176 corn powder. The CTAB-based method yielded the highest DNA template quantity and quality. A difference in the 260 nm/230 nm absorbance ratio was observed among the different extraction methods. Real-time amplification of sequences specific for endogenous genes zein and hmg as well as transgenic sequences within the cryIA(b) gene and a fragment covering the junction between the transformed DNA and the plant genome were used to determine the GM percentage. The detection of the transgenic gene was affected by the quantity and quality of template used for the PCR reaction. The Bt176 percentages measured on diluted or purified templates were statistically different depending on the extraction method applied.

  15. Electrochemical sensors based on stationary electrodes and immobilized DNA or its fragments and the assessment of their analytical potentials

    Babkina, S. S.; Paleček, Emil; Jelen, František; Fojta, Miroslav

    2005-01-01

    Roč. 60, č. 6 (2005), s. 567-572 ISSN 1061-9348. [VII All-Russia Conference (with international participation) on Electrochemical Methods of Analysis. Ufa, 23.05.2004-27.05.2004] R&D Projects: GA MPO(CZ) 1H-PK/42 Institutional research plan: CEZ:AV0Z50040507 Keywords : electrochemical biosensor * DNA imobilization * nitrocellulose matrix Subject RIV: BO - Biophysics Impact factor: 0.496, year: 2005

  16. A homicide in the Ukraine: DNA-based identification of a boiled, skeletonized, and varnished human skull, and of bone fragments found in a fireplace.

    Sivolap, Y; Krivda, G; Kozhuhova, N; Chebotar, S; Benecke, M

    2001-12-01

    In an apartment, bone fragments were found in a fireplace. Furthermore, a varnished skull was found elsewhere in the same apartment. The tenant confessed to a murder and stated that the head of a victim, a girl, was boiled for 12 hours. He stated that the soft tissue was then removed and the skull was varnished. Other parts of the body were burned to ashes in an open field. Comparison of loci D19S252, CD4, CYAR04, TII01, F13A01, F13B, and D6S366 from the skull and the bone remains to loci of the mother of a missing girl showed that the skull came from that missing child. Biological maternity was calculated as 99.99%. The bone pieces were DNA typed as male and did not share alleles with the mother in several systems. Therefore, they belonged to a different (human) victim.

  17. Nucleolin forms a specific complex with a fragment of the viral (minus) strand of minute virus of mice DNA.

    Barrijal, S; Perros, M; Gu, Z; Avalosse, B L; Belenguer, P; Amalric, F; Rommelaere, J

    1992-01-01

    Nucleolin, a major nucleolar protein, forms a specific complex with the genome (a single-stranded DNA molecule of minus polarity) of parvovirus MVMp in vitro. By means of South-western blotting experiments, we mapped the binding site to a 222-nucleotide motif within the non-structural transcription unit, referred to as NUBE (nucleolin-binding element). The specificity of the interaction was confirmed by competitive gel retardation assays. DNaseI and nuclease S1 probing showed that NUBE folds into a secondary structure, in agreement with a computer-assisted conformational prediction. The whole NUBE may be necessary for the interaction with nucleolin, as suggested by the failure of NUBE subfragments to bind the protein and by the nuclease footprinting experiments. The present work extends the previously reported ability of nucleolin to form a specific complex with ribosomal RNA, to a defined DNA substrate. Considering the tropism of MVMp DNA replication for host cell nucleoli, these data raise the possibility that nucleolin may contribute to the regulation of the parvoviral life-cycle. Images PMID:1408821

  18. Characterization of a human MSX-2 cDNA and its fragment isolated as a transformation suppressor gene against v-Ki-ras oncogene.

    Takahashi, C; Akiyama, N; Matsuzaki, T; Takai, S; Kitayama, H; Noda, M

    1996-05-16

    A cDNA (termed CT124) encoding a carboxyl-terminal fragment of the human homeobox protein MSX-2 was found to induce flat reversion when expressed in v-Ki-ras-transformed NIH3T3 cells. Although the expression of endogenous MSX-2 gene is low in most of the normal adult tissues examined, it is frequently activated in carcinoma-derived cell lines. Likewise, the gene is inactive in NIH3T3 cells but is transcriptionally activated after transformation by v-Ki-ras oncogene, suggesting that the intact MSX-2 may play a positive, rather than suppressive, role in cell transformation. To test this possibility, we isolated a near full-length human MSX-2 cDNA and tested its activities in two cell systems, i.e. fibroblast and myoblast. In NIH3T3 fibroblasts, although the gene by itself failed to confer a transformed phenotype, antisense MSX-2 cDNA as well as truncated CT124 cDNA interfered with the transforming activities of v-Ki-ras oncogene. In C2C12 myoblasts, MSX-2 was found to suppress MyoD gene expression, as do activated ras oncogenes, under certain culture conditions, and CT124 was found to inhibit the activities of both MSX-2 and ras in this system as well. Our findings not only suggest that CT124 may act as a dominant suppressor of MSX-2 but also raise the possibility that MSX-2 gene may be an important downstream target for the Ras signaling pathways.

  19. Next-Generation Sequencing of Genomic DNA Fragments Bound to a Transcription Factor in Vitro Reveals Its Regulatory Potential

    Yukio Kurihara

    2014-12-01

    Full Text Available Several transcription factors (TFs coordinate to regulate expression of specific genes at the transcriptional level. In Arabidopsis thaliana it is estimated that approximately 10% of all genes encode TFs or TF-like proteins. It is important to identify target genes that are directly regulated by TFs in order to understand the complete picture of a plant’s transcriptome profile. Here, we investigate the role of the LONG HYPOCOTYL5 (HY5 transcription factor that acts as a regulator of photomorphogenesis. We used an in vitro genomic DNA binding assay coupled with immunoprecipitation and next-generation sequencing (gDB-seq instead of the in vivo chromatin immunoprecipitation (ChIP-based methods. The results demonstrate that the HY5-binding motif predicted here was similar to the motif reported previously and that in vitro HY5-binding loci largely overlapped with the HY5-targeted candidate genes identified in previous ChIP-chip analysis. By combining these results with microarray analysis, we identified hundreds of HY5-binding genes that were differentially expressed in hy5. We also observed delayed induction of some transcripts of HY5-binding genes in hy5 mutants in response to blue-light exposure after dark treatment. Thus, an in vitro gDNA-binding assay coupled with sequencing is a convenient and powerful method to bridge the gap between identifying TF binding potential and establishing function.

  20. Maternal exposure to a mixture of persistent organic pollutants (POPs) affects testis histology, epididymal sperm count and induces sperm DNA fragmentation in mice.

    Khezri, Abdolrahman; Lindeman, Birgitte; Krogenæs, Anette K; Berntsen, Hanne F; Zimmer, Karin E; Ropstad, Erik

    2017-08-15

    Persistent organic pollutants (POPs) are widespread throughout the environment and some are suspected to induce reproductive toxicity. As animals and humans are exposed to complex mixtures of POPs, it is reasonable to assess how such mixtures could interact with the reproductive system. Our aim is to investigate how maternal exposure to a mixture of 29 different persistent organic pollutants, formulated to mimic the relative POP levels in the food basket of the Scandinavian population, could alter reproductive endpoints. Female mice were exposed via feed from weaning, during pregnancy and lactation in 3 exposure groups (control (C), low (L) and high (H)). Testicular morphometric endpoints, epididymal sperm concentration and sperm DNA integrity were assessed in adult male offspring. We found that the number of tubules, proportion of tubule compartments and epididymal sperm concentration significantly decreased in both POP exposed groups. Epididymal sperm from both POP exposed groups showed increased DNA fragmentation. It is concluded that maternal exposure to a defined POP mixture relevant to human exposure can affect testicular development, sperm production and sperm chromatin integrity. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. KERAGAMAN GENETIK BENIH IKAN KERAPU SUNU, Plectrophomus leopardus TURUNAN PERTAMA (F1 DENGAN ANALISIS RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP MT-DNA

    Gusti Ngurah Permana

    2016-11-01

    The variability of differences size was occurred on every culture period of coral trout. The aimed of this study was to know genetics variability and evaluated of which are expressed on large, medium, and small size fry on total of length sizes and different weight. Amplification of single fragment using set primer 16 SrDNA (F5’CGCCTG TTTAACAAAAACAT-3’ and reverse (R: 5’-CCGGTCTGAACTCAGATCATGT-3’. Result showed that PCR amplification of mt-DNA was 625 bp. Restriction digestion processed with Mnl I enzyme showed that polymorphism in large size and monomorphic in both medium and small sizes. Two types of haplotype were found in large size (ABABB and ABAAB while one haplotype observed in medium and small sizes ABABB. The heterozygosities value of large, medium and small sizes from Bali location were 0.480, 0.000, and 0.000 restectively. Heterozygosities value of samples from East Java were 0.211, 0.000, and 0.000 restectively. Samples from Lampung were monomorphic (0.000.

  2. DNA fragmentation and cell cycle arrest: a hallmark of apoptosis induced by crocin from kashmiri saffron in a human pancreatic cancer cell line.

    Bakshi, Hamid; Sam, Smitha; Rozati, Roya; Sultan, Phalisteen; Islam, Tajamul; Rathore, Babita; Lone, Zahoor; Sharma, Manik; Triphati, Jagrati; Saxena, Ramesh Chand

    2010-01-01

    Apoptosis, a widely important mechanism that contributes to cell growth reduction, is reported to be induced by Crocus sativus in different cancer types. The present study was designed to elucidate apoptosis induction by crocin, a main component of Crocus sativus in a human pancreatic cancer cell line (BxPC-3). Cell viability was measured by MTT assay, Hoechest33258 staining was used to detect the chromatin condensation characteristic of apoptosis, and DNA fragmentation was assessed by gel electrophoresis and cell cycle analysis by flow cytometry. Crocin induced apoptosis and G1-phase cell cycle arrest of BxPC-3 cells, while decreasing cell viability in a dose dependent and time dependent manner. Cells treated with 10μg/L crocin exhibited apoptotic morphology (brightly blue-fluorescent condensed nuclei on Hoechst 33258 staining) and reduction of volume. DNA analysis revealed typical ladders as early as 12 hours after treatment indicative of apoptosis. Our preclinical study demonstrated a pancreatic cancer cell line to be highly sensitive to crocin-mediated growth inhibition and apoptotic cell death. Although the molecular mechanisms of crocin action are not yet clearly understood, it appears to have potential as a therapeutic agent.

  3. DNA fragmentation: manifestation of target cell destruction mediated by cytotoxic T-cell lines, lymphotoxin-secreting helper T-cell clones, and cell-free lymphotoxin-containing supernatant

    Schmid, D.S.; Tite, J.P.; Ruddle, N.H.

    1986-01-01

    A Lyt-2 + , trinitrophenyl-specific, lymphotoxin-secreting, cytotoxic T-cell line, PCl 55, mediates the digestion of target cell DNA into discretely sized fragments. This phenomenon manifests itself within 30 min after effector cell encounter as measured by the release of 3 H counts from target cells prelabeled with [ 3 H]deoxythymidine and occurs even at very low effector to target cell ratios (0.25:1). A Lyt-1 + , ovalbumin-specific, lymphotoxin-secreting T-helper cell clone, 5.9.24, is also able to mediate fragmentation of target cell DNA over a time course essentially indistinguishable from the cytotoxic T lymphocyte-mediated hit. Cell-free lymphotoxin-containing supernatants also cause release of DNA from targets, although they require a longer time course, on the order of 24 hr. In contrast, lysis of cells by antibody plus complement or Triton X-100 does not result in DNA release even after extended periods of incubation (24 hr). All three treatments that result in the release of DNA from cells cause fragmentation of that DNA into discretely sized pieces that are multiples of 200 base pairs. The results thus suggest that cytotoxic T cells, lymphotoxin-secreting helper clones with cytolytic activity, and lymphotoxin all effect target cell destruction by means of a similar mechanism and that observed differences in time course and the absence of target cell specificity in killing mediated by lymphotoxin may simply reflect differences in the mode of toxin delivery

  4. Tip-enhanced fluorescence with radially polarized illumination for monitoring loop-mediated isothermal amplification on Hepatitis C virus cDNA

    Wei, Shih-Chung; Chuang, Tsung-Liang; Wang, Da-Shin; Lu, Hui-Hsin; Gu, Frank X.; Sung, Kung-Bin; Lin, Chii-Wann

    2015-02-01

    A tip nanobiosensor for monitoring DNA replication was presented. The effects of excitation power and polarization on tip-enhanced fluorescence (TEF) were assessed with the tip immersed in fluorescein isothiocyanate solution first. The photon count rose on average fivefold with radially polarized illumination at 50 mW. We then used polymerase-functionalized tips for monitoring loop-mediated isothermal amplification on Hepatitis C virus cDNA. The amplicon-SYBR Green I complex was detected and compared to real-time loop-mediated isothermal amplification. The signals of the reaction using 4 and 0.004 ng/μl templates were detected 10 and 30 min earlier, respectively. The results showed the potential of TEF in developing a nanobiosensor for real-time DNA amplification.

  5. Biologically important conformational features of DNA as interpreted by quantum mechanics and molecular mechanics computations of its simple fragments.

    Poltev, V; Anisimov, V M; Dominguez, V; Gonzalez, E; Deriabina, A; Garcia, D; Rivas, F; Polteva, N A

    2018-02-01

    Deciphering the mechanism of functioning of DNA as the carrier of genetic information requires identifying inherent factors determining its structure and function. Following this path, our previous DFT studies attributed the origin of unique conformational characteristics of right-handed Watson-Crick duplexes (WCDs) to the conformational profile of deoxydinucleoside monophosphates (dDMPs) serving as the minimal repeating units of DNA strand. According to those findings, the directionality of the sugar-phosphate chain and the characteristic ranges of dihedral angles of energy minima combined with the geometric differences between purines and pyrimidines determine the dependence on base sequence of the three-dimensional (3D) structure of WCDs. This work extends our computational study to complementary deoxydinucleotide-monophosphates (cdDMPs) of non-standard conformation, including those of Z-family, Hoogsteen duplexes, parallel-stranded structures, and duplexes with mispaired bases. For most of these systems, except Z-conformation, computations closely reproduce experimental data within the tolerance of characteristic limits of dihedral parameters for each conformation family. Computation of cdDMPs with Z-conformation reveals that their experimental structures do not correspond to the internal energy minimum. This finding establishes the leading role of external factors in formation of the Z-conformation. Energy minima of cdDMPs of non-Watson-Crick duplexes demonstrate different sequence-dependence features than those known for WCDs. The obtained results provide evidence that the biologically important regularities of 3D structure distinguish WCDs from duplexes having non-Watson-Crick nucleotide pairing.

  6. Pre-Steady State Kinetic Investigation of the Incorporation of Anti-Hepatitis B Nucleotide Analogs Catalyzed by Non-Canonical Human DNA Polymerases

    Brown, Jessica A.; Pack, Lindsey R.; Fowler, Jason D.; Suo, Zucai

    2011-01-01

    Antiviral nucleoside analogs have been developed to inhibit the enzymatic activities of the hepatitis B virus (HBV) polymerase, thereby preventing the replication and production of HBV. However, the usage of these analogs can be limited by drug toxicity because the 5′-triphosphates of these nucleoside analogs (nucleotide analogs) are potential substrates for human DNA polymerases to incorporate into host DNA. Although they are poor substrates for human replicative DNA polymerases, it remains to be established whether these nucleotide analogs are substrates for the recently discovered human X- and Y-family DNA polymerases. Using pre-steady state kinetic techniques, we have measured the substrate specificity values for human DNA polymerases β, λ, η, ι, κ, and Rev1 incorporating the active forms of the following anti-HBV nucleoside analogs approved for clinical use: adefovir, tenofovir, lamivudine, telbivudine, and entecavir. Compared to the incorporation of a natural nucleotide, most of the nucleotide analogs were incorporated less efficiently (2 to >122,000) by the six human DNA polymerases. In addition, the potential for entecavir and telbivudine, two drugs which possess a 3′-hydroxyl, to become embedded into human DNA was examined by primer extension and DNA ligation assays. These results suggested that telbivudine functions as a chain terminator while entecavir was efficiently extended by the six enzymes and was a substrate for human DNA ligase I. Our findings suggested that incorporation of anti-HBV nucleotide analogs catalyzed by human X- and Y-family polymerases may contribute to clinical toxicity. PMID:22132702

  7. Internalization of Staphylococcus aureus in Lymphocytes Induces Oxidative Stress and DNA Fragmentation: Possible Ameliorative Role of Nanoconjugated Vancomycin

    Subhankari Prasad Chakraborty

    2011-01-01

    Full Text Available Staphylococcus aureus is the most frequently isolated pathogen causing bloodstream infections, skin and soft tissue infections and pneumonia. Lymphocyte is an important immune cell. The aim of the present paper was to test the ameliorative role of nanoconjugated vancomycin against Vancomycin-sensitive Staphylococcus aureus (VSSA and vancomycin-resistant Staphylococcus aureus (VRSA infection-induced oxidative stress in lymphocytes. VSSA and VRSA infections were developed in Swiss mice by intraperitoneal injection of 5×106 CFU/mL bacterial solutions. Nanoconjugated vancomycin was adminstrated to VSSA- and VRSA-infected mice at its effective dose for 10 days. Vancomycin was adminstrated to VSSA- and VRSA-infected mice at a similar dose, respectively, for 10 days. Vancomycin and nanoconjugated vancomycin were adminstrated to normal mice at their effective doses for 10 days. The result of this study reveals that in vivo VSSA and VRSA infection significantly increases the level of lipid peroxidation, protein oxidation, oxidized glutathione level, nitrite generation, nitrite release, and DNA damage and decreases the level of reduced glutathione, antioxidant enzyme status, and glutathione-dependent enzymes as compared to control group, which were increased or decreased significantly near to normal in nanoconjugated vancomycin-treated group. These findings suggest the potential use and beneficial role of nanoconjugated vancomycin against VSSA and VRSA infection-induced oxidative stress in lymphocytes.

  8. Hepatitis C

    ... Workshops Follow Us Home Health Information Liver Disease Hepatitis (Viral) Hepatitis C Related Topics English English Español Section Navigation Hepatitis (Viral) What Is Viral Hepatitis? Hepatitis A Hepatitis B ...

  9. Genotyping of major histocompatibility complex Class II DRB gene in Rohilkhandi goats by polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing

    Kush Shrivastava

    2015-10-01

    Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.

  10. DNA fragmentation and cell death mediated by T cell antigen receptor/CD3 complex on a leukemia T cell line.

    Takahashi, S; Maecker, H T; Levy, R

    1989-10-01

    An anti-T cell receptor (TcR) monoclonal antibody (mAb), LC4, directed against a human leukemic T cell line, SUP-T13, caused DNA fragmentation ("apoptosis") and cell death upon binding to this cell line. Cross-linking of receptor molecules was necessary for this effect since F(ab')2, but not Fab', fragments of LC4 could induce cell death. Five anti-CD3 mAb tested also caused apoptosis, but only when they were presented on a solid phase. Interestingly, soluble anti-CD3 mAb induced calcium flux and had an additive effect on the calcium flux and interleukin 2 receptor expression induced by LC4, but these anti-CD3 mAb reversed the growth inhibition and apoptosis caused by LC4. The calcium ionophore A23187, but not the protein kinase C activator phorbol 12-myristate 13-acetate (PMA), also induced apoptosis, suggesting that protein kinase C activation alone does not cause apoptosis, although PMA is growth inhibitory. These results suggest that two distinct biological phenomena can accompany stimulation of the TcR/CD3 complex. In both cases, calcium flux and interleukin 2 receptor expression is induced, but only in one case is apoptosis and cell death seen. The signal initiating apoptosis can be selectively prevented by binding CD3 portion of the receptor in this cell line. This difference in signals mediated by the TcR/CD3 complex may be important in explaining the process of thymic selection, as well as in choosing anti-TcR mAb for therapeutic use.

  11. A Strengths-Weaknesses-Opportunities-Threats (SWOT) analysis on the clinical utility of sperm DNA fragmentation testing in specific male infertility scenarios.

    Esteves, Sandro C; Agarwal, Ashok; Cho, Chak-Lam; Majzoub, Ahmad

    2017-09-01

    Sperm DNA fragmentation (SDF) is recognized as a leading cause of male infertility because it can impair the paternal genome through distinct pathophysiological mechanisms. Current evidence supports SDF as a major factor in the pathophysiology of several conditions, including varicocele, unexplained infertility, assisted reproductive technology failure, and environmental lifestyle factors, although the mechanisms involved have not been fully described yet. Measurement of the levels of DNA fragmentation in semen provides valuable information on the integrity of paternal chromatin and may guide therapeutic strategies. A recently published clinical practice guideline (CPG) highlighted how to use the information provided by SDF testing in daily practice, which triggered a series of commentaries by leading infertility experts. These commentaries contained an abundance of information and conflicting views about the clinical utility of SDF testing, which underline the complex nature of SDF. A search of papers published in response to the CPG entitled "Clinical utility of sperm DNA fragmentation testing: practice recommendations based on clinical scenarios" was performed within the Translational Andrology and Urology ( TAU ) website (http://tau.amegroups.com/). The start and end dates for the search were May 2017 and August 2017, respectively. Each commentary meeting our inclusion criteria was rated as "supportive without reservation", "supportive with reservation", "not supportive" or "neutral". We recorded whether articles discussed either SDF characteristics as a laboratory test method or clinical scenarios, or both. Subsequently, we extracted the particulars from each commentary and utilized the 'Strengths-Weaknesses-Opportunities-Threats' (SWOT) analysis to understand the perceived advantages and drawbacks of SDF as a specialized sperm function method in clinical practice. Fifty-eight fertility experts from six continents and twenty-two countries contributed

  12. Characterization of primary biogenic aerosol particles in urban, rural, and high-alpine air by DNA sequence and restriction fragment analysis of ribosomal RNA genes

    V. R. Després

    2007-12-01

    Full Text Available This study explores the applicability of DNA analyses for the characterization of primary biogenic aerosol (PBA particles in the atmosphere. Samples of fine particulate matter (PM2.5 and total suspended particulates (TSP have been collected on different types of filter materials at urban, rural, and high-alpine locations along an altitude transect in the south of Germany (Munich, Hohenpeissenberg, Mt. Zugspitze.

    From filter segments loaded with about one milligram of air particulate matter, DNA could be extracted and DNA sequences could be determined for bacteria, fungi, plants and animals. Sequence analyses were used to determine the identity of biological organisms, and terminal restriction fragment length polymorphism analyses (T-RFLP were applied to estimate diversities and relative abundances of bacteria. Investigations of blank and background samples showed that filter materials have to be decontaminated prior to use, and that the sampling and handling procedures have to be carefully controlled to avoid artifacts in the analyses.

    Mass fractions of DNA in PM2.5 were found to be around 0.05% in urban, rural, and high-alpine aerosols. The average concentration of DNA determined for urban air was on the order of ~7 ng m−3, indicating that human adults may inhale about one microgram of DNA per day (corresponding to ~108 haploid bacterial genomes or ~105 haploid human genomes, respectively.

    Most of the bacterial sequences found in PM2.5 were from Proteobacteria (42 and some from Actinobacteria (10 and Firmicutes (1. The fungal sequences were characteristic for Ascomycota (3 and Basidiomycota (1, which are known to actively discharge spores into the atmosphere. The plant sequences could be attributed to green plants (2 and moss spores (2, while animal DNA was found only for one unicellular eukaryote (protist.

  13. Jet fragmentation

    Saxon, D.H.

    1985-10-01

    The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)

  14. Liver ultrastructural morphology and mitochondrial DNA levels in HIV/hepatitis C virus coinfection: no evidence of mitochondrial damage with highly active antiretroviral therapy.

    Matsukura, Motoi; Chu, Fanny F S; Au, May; Lu, Helen; Chen, Jennifer; Rietkerk, Sonja; Barrios, Rolando; Farley, John D; Montaner, Julio S; Montessori, Valentina C; Walker, David C; Côté, Hélène C F

    2008-06-19

    Liver mitochondrial toxicity is a concern, particularly in HIV/hepatitis C virus (HCV) coinfection. Liver biopsies from HIV/HCV co-infected patients, 14 ON-highly active antiretroviral therapy (HAART) and nine OFF-HAART, were assessed by electron microscopy quantitative morphometric analyses. Hepatocytes tended to be larger ON-HAART than OFF-HAART (P = 0.05), but mitochondrial volume, cristae density, lipid volume, mitochondrial DNA and RNA levels were similar. We found no evidence of increased mitochondrial toxicity in individuals currently on HAART, suggesting that concomitant HAART should not delay HCV therapy.

  15. Stable expression and replication of hepatitis B virus genome in an integrated state in a human hepatoma cell line transfected with the cloned viral DNA

    Tsurimoto, T.; Fujiyama, A.; Matsubara, K.

    1987-01-01

    A human hepatocellular carcinoma cell line (Huh6-c15) was transfected with a recombinant DNA molecule that consists of tandemly arranged hepatitis B virus (HBV) genome and a neomycin-resistant gene. One clone resistant to G-418 produces and releases surface antigen and e antigen into medium at a high level and accumulates core particles intracellularly. This clone has a chromosomally integrated set of the original recombinant DNA and produces a 3.5-kilobase transcript corresponding to the pregenome RNA as well as HBV DNAs in an extrachromosomal form. Most of these DNAs were in single-stranded or partially double-stranded form and were packaged in the intracellular core particles. In the medium, particles were detected that contained HBV DNA and were morphologically indistinguishable from Dane particles. These results demonstrate that the HBV genome in an integrated state acted as a template for viral gene expression and replication. The cells were maintained for more than 6 months without losing the ability to produce the extrachromosomal HBV DNA and Dane-like particles. Thus, the cells can be used as a model system for analyses of gene expression and DNA replication of HBV in human hepatocytes

  16. Molecular diversity of leuconostoc mesenteroides and leuconostoc citreum isolated from traditional french cheeses as revealed by RAPD fingerprinting, 16S rDNA sequencing and 16S rDNA fragment amplification.

    Cibik, R; Lepage, E; Talliez, P

    2000-06-01

    For a long time, the identification of the Leuconostoc species has been limited by a lack of accurate biochemical and physiological tests. Here, we use a combination of RAPD, 16S rDNA sequencing, and 16S rDNA fragment amplification with specific primers to classify different leuconostocs at the species and strain level. We analysed the molecular diversity of a collection of 221 strains mainly isolated from traditional French cheeses. The majority of the strains were classified as Leuconostoc mesenteroides (83.7%) or Leuconostoc citreum (14%) using molecular techniques. Despite their presence in French cheeses, the role of L. citreum in traditional technologies has not been determined, probably because of the lack of strain identification criteria. Only one strain of Leuconostoc lactis and Leuconostoc fallax were identified in this collection, and no Weissella paramesenteroides strain was found. However, dextran negative variants of L. mesenteroides, phenotypically misclassified as W. paramesenteroides, were present. The molecular techniques used did not allow us to separate strains of the three L. mesenteroides subspecies (mesenteroides, dextranicum and cremoris). In accordance with previously published results, our findings suggest that these subspecies may be classified as biovars. Correlation found between phenotypes dextranicum and mesenteroides of L. mesenteroides and cheese technology characteristics suggests that certain strains may be better adapted to particular technological environments.

  17. An efficient system for deletion of large DNA fragments in Escherichia coli via introduction of both Cas9 and the non-homologous end joining system from Mycobacterium smegmatis.

    Zheng, Xuan; Li, Shi-Yuan; Zhao, Guo-Ping; Wang, Jin

    2017-04-15

    Accompanied with the internal non-homologous end joining (NHEJ) system, Cas9 can be used to easily inactivate a gene or delete a fragment through introduction of DNA double-stranded breaks (DSBs) in eukaryotic cells. While in most prokaryotes (e.g. Escherichia coli), due to the lack of NHEJ, homologous recombination (HR) is required for repair of DSBs, which is less convenient. Here, a markerless system was developed for rapid gene inactivation or fragment deletion in E. coli via introduction of both Cas9 and a bacterial NHEJ system. Three bacterial NHEJ systems, i.e. Mycobacterium smegmatis (Msm), Mycobacterium tuberculosis (Mtb) and Bacillus subtilis (Bs), were tested in E. coli, and the MsmNHEJ system showed the best efficiency. With the employment of Cas9 and MsmNHEJ, we efficiently mutated lacZ gene, deleted glnALG operon and two large DNA fragments (67 kb and 123 kb) in E. coli, respectively. Moreover, the system was further designed to allow for continuous inactivation of genes or deletion of DNA fragments in E. coli. We envision this system can be extended to other bacteria, especially those with low HR efficiency. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Comprehensive analysis of sperm DNA fragmentation by five different assays: TUNEL assay, SCSA, SCD test and alkaline and neutral Comet assay.

    Ribas-Maynou, J; García-Peiró, A; Fernández-Encinas, A; Abad, C; Amengual, M J; Prada, E; Navarro, J; Benet, J

    2013-09-01

    Sperm DNA fragmentation (SDF) is becoming an important test to assess male infertility. Several different tests are available, but no consensus has yet been reached as to which tests are most predictive of infertility. Few publications have reported a comprehensive analysis comparing these methods within the same population. The objective of this study was to analyze the differences between the five most common methodologies, to study their correlations and to establish their cut-off values, sensitivity and specificity in predicting male infertility. We found differences in SDF between fertile donors and infertile patients in TUNEL, SCSA, SCD and alkaline Comet assays, but none with the neutral Comet assay. The alkaline COMET assay was the best in predicting male infertility followed by TUNEL, SCD and SCSA, whereas the neutral COMET assay had no predictive power. For our patient population, threshold values for infertility were 20.05% for TUNEL assay, 18.90% for SCSA, 22.75% for the SCD test, 45.37% for alkaline Comet and 34.37% for neutral Comet. This work establishes in a comprehensive study that the all techniques except neutral Comet are useful to distinguish fertile and infertile men. © 2013 American Society of Andrology and European Academy of Andrology.

  19. The innate immunity adaptor SARM translocates to the nucleus to stabilize lamins and prevent DNA fragmentation in response to pro-apoptotic signaling.

    Chad R Sethman

    Full Text Available Sterile alpha and armadillo-motif containing protein (SARM, a highly conserved and structurally unique member of the MyD88 family of Toll-like receptor adaptors, plays an important role in innate immunity signaling and apoptosis. Its exact mechanism of intracellular action remains unclear. Apoptosis is an ancient and ubiquitous process of programmed cell death that results in disruption of the nuclear lamina and, ultimately, dismantling of the nucleus. In addition to supporting the nuclear membrane, lamins serve important roles in chromatin organization, epigenetic regulation, transcription, nuclear transport, and mitosis. Mutations and other damage that destabilize nuclear lamins (laminopathies underlie a number of intractable human diseases. Here, we report that SARM translocates to the nucleus of human embryonic kidney cells by using its amino-terminal Armadillo repeat region. Within the nucleus, SARM forms a previously unreported lattice akin to the nuclear lamina scaffold. Moreover, we show that SARM protects lamins from apoptotic degradation and reduces internucleosomal DNA fragmentation in response to signaling induced by the proinflammatory cytokine Tumor Necrosis Factor alpha. These findings indicate an important link between the innate immunity adaptor SARM and stabilization of nuclear lamins during inflammation-driven apoptosis in human cells.

  20. Experience in the use of docosahexaenoic acid (BrudiPlus in patients with increased sperm DNA fragmentation index in Acad. V.I. Kulakov Research Center for Obstetrics, Gynecology and Perinatology

    A. Yu. Popova

    2015-01-01

    Full Text Available Male factor is the reason of infertility in almost half of marriages. Infertile men have the percentage of sperm with violations of DNA integrity of over 30 %; with that, healthy fertile men have that indicator of less than 15 %. Understanding of importance of damages of sperm DNA is growing with distribution ofauxiliary reproductive technologies. As of today, these consequences have not been studies yet, and the therapeutic effect of intake of antioxidants has not direct correlation with the sperm DNA fragmentation level. Docosahexaenoic acid is one of the most valuable omega-3 polyunsaturated fatty acids for human health. Docosahexaenoic acid is the main component of the brain gray matter, retina, testes, and sperm cell membranes. In connection with that, a study was held the purpose of which was to assess the effect of the nutraceutical enzymatic docosahexaenoic acid triglyceride (BrudiPlus in high concentrations on damaged sperm DNA of patients with idiopathic pathozoospermia. 40 patients with idiopathic pathozoospermia and the level of DNA fragmentation over the statutory value took part in this study. The following positive results were received: intake of BrudiPlus allowed decreasing sperm DNA damages and improving of antioxidant system of sperm. 

  1. PRMT5 restricts hepatitis B virus replication through epigenetic repression of covalently closed circular DNA transcription and interference with pregenomic RNA encapsidation.

    Zhang, Wen; Chen, Jieliang; Wu, Min; Zhang, Xiaonan; Zhang, Min; Yue, Lei; Li, Yaming; Liu, Jiangxia; Li, Baocun; Shen, Fang; Wang, Yang; Bai, Lu; Protzer, Ulrike; Levrero, Massimo; Yuan, Zhenghong

    2017-08-01

    Chronic hepatitis B virus (HBV) infection remains a major health problem worldwide. The covalently closed circular DNA (cccDNA) minichromosome, which serves as the template for the transcription of viral RNAs, plays a key role in viral persistence. While accumulating evidence suggests that cccDNA transcription is regulated by epigenetic machinery, particularly the acetylation of cccDNA-bound histone 3 (H3) and H4, the potential contributions of histone methylation and related host factors remain obscure. Here, by screening a series of methyltransferases and demethylases, we identified protein arginine methyltransferase 5 (PRMT5) as an effective restrictor of HBV transcription and replication. In cell culture-based models for HBV infection and in liver tissues of patients with chronic HBV infection, we found that symmetric dimethylation of arginine 3 on H4 on cccDNA was a repressive marker of cccDNA transcription and was regulated by PRMT5 depending on its methyltransferase domain. Moreover, PRMT5-triggered symmetric dimethylation of arginine 3 on H4 on the cccDNA minichromosome involved an interaction with the HBV core protein and the Brg1-based human SWI/SNF chromatin remodeler, which resulted in down-regulation of the binding of RNA polymerase II to cccDNA. In addition to the inhibitory effect on cccDNA transcription, PRMT5 inhibited HBV core particle DNA production independently of its methyltransferase activity. Further study revealed that PRMT5 interfered with pregenomic RNA encapsidation by preventing its interaction with viral polymerase protein through binding to the reverse transcriptase-ribonuclease H region of polymerase, which is crucial for the polymerase-pregenomic RNA interaction. PRMT5 restricts HBV replication through a two-part mechanism including epigenetic suppression of cccDNA transcription and interference with pregenomic RNA encapsidation; these findings improve the understanding of epigenetic regulation of HBV transcription and host

  2. Altered hepatic mRNA expression of immune response-associated DNA damage in mice liver induced by potassium bromate: Protective role of vanillin.

    Ben Saad, Hajer; Driss, Dorra; Ben Amara, Ibtissem; Boudawara, Ons; Boudawara, Tahia; Ellouz Chaabouni, Samia; Mounir Zeghal, Khaled; Hakim, Ahmed

    2016-12-01

    Chronic exposure to potassium bromate (KBrO 3 ), a toxic halogen existing widely in the environment, environment through contaminated drinking water, has become a global problem of public health. The present study investigates the protective role of vanillin against KBrO 3 induced oxidative stress, distruption in inflammatory cytokines expression, DNA damage, and histopathological changes. Adult mice were exposed orally to KBrO 3 (2g/L of drinking water) for 2 weeks The co-administration of vanillin to the KBrO 3 -treated mice significantly prevented the plasma transaminases increase in. Furthermore, it inhibited hepatic lipid peroxidation (malondialdehyde), advanced oxidation protein product (AOPP) and protein carbonyl (PCO) formation and attenuated the KBrO 3 -mediated depletion of enzymatic and non enzymatic antioxidants catalase, superoxide dismutase, and glutathione peroxidase activities and glutathione level in the liver. In addition, vanillin markedly attenuated the expression levels of proinflammatory cytokines, including tumor necrosis factor-α, interleukin-1β, interleukin-6, and COX2 and prevented KBrO 3 -induced hepatic cell alteration and necrosis, as indicated by histopathological data. DNA damage, as assessed by the alkaline comet assay, was also found to be low in the co-treated group. Thus, these findings show that vanillin acts as potent chemopreventive agent against KBrO 3 -mediated liver oxidative stress and genotoxicity through its antioxidant properties. © 2015 Wiley Periodicals, Inc. Environ Toxicol 31: 1796-1807, 2016. © 2015 Wiley Periodicals, Inc.

  3. Polymer fragmentation in extensional flow

    Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

    2001-06-01

    In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.

  4. Hepatic Encephalopathy

    Full Text Available ... Related Liver Disease Alpha-1 Antitrypsin Deficiency Autoimmune Hepatitis Benign Liver Tumors Biliary Atresia Cirrhosis of the ... Disease Type 1 (von Gierke) Hemochromatosis Hepatic Encephalopathy Hepatitis A Hepatitis B Hepatitis C Intrahepatic Cholestasis of ...

  5. Hepatic Encephalopathy

    Full Text Available ... Hemochromatosis Hepatic Encephalopathy Hepatitis A Hepatitis B Hepatitis C Intrahepatic Cholestasis of Pregnancy (ICP) Jaundice In Newborns ... are the common causes of cirrhosis? Hepatitis B & C Alcohol-related Liver Disease Non-alcoholic Fatty Liver ...

  6. The New Aptima HBV Quant Real-Time TMA Assay Accurately Quantifies Hepatitis B Virus DNA from Genotypes A to F.

    Chevaliez, Stéphane; Dauvillier, Claude; Dubernet, Fabienne; Poveda, Jean-Dominique; Laperche, Syria; Hézode, Christophe; Pawlotsky, Jean-Michel

    2017-04-01

    Sensitive and accurate hepatitis B virus (HBV) DNA detection and quantification are essential to diagnose HBV infection, establish the prognosis of HBV-related liver disease, and guide the decision to treat and monitor the virological response to antiviral treatment and the emergence of resistance. Currently available HBV DNA platforms and assays are generally designed for batching multiple specimens within an individual run and require at least one full day of work to complete the analyses. The aim of this study was to evaluate the ability of the newly developed, fully automated, one-step Aptima HBV Quant assay to accurately detect and quantify HBV DNA in a large series of patients infected with different HBV genotypes. The limit of detection of the assay was estimated to be 4.5 IU/ml. The specificity of the assay was 100%. Intra-assay and interassay coefficients of variation ranged from 0.29% to 5.07% and 4.90% to 6.85%, respectively. HBV DNA levels from patients infected with HBV genotypes A to F measured with the Aptima HBV Quant assay strongly correlated with those measured by two commercial real-time PCR comparators (Cobas AmpliPrep/Cobas TaqMan HBV test, version 2.0, and Abbott RealTi m e HBV test). In conclusion, the Aptima HBV Quant assay is sensitive, specific, and reproducible and accurately quantifies HBV DNA in plasma samples from patients with chronic HBV infections of all genotypes, including patients on antiviral treatment with nucleoside or nucleotide analogues. The Aptima HBV Quant assay can thus confidently be used to detect and quantify HBV DNA in both clinical trials with new anti-HBV drugs and clinical practice. Copyright © 2017 American Society for Microbiology.

  7. Short communication: Evaluation of the microbiota of kefir samples using metagenetic analysis targeting the 16S and 26S ribosomal DNA fragments.

    Korsak, N; Taminiau, B; Leclercq, M; Nezer, C; Crevecoeur, S; Ferauche, C; Detry, E; Delcenserie, V; Daube, G

    2015-06-01

    Milk kefir is produced by fermenting milk in the presence of kefir grains. This beverage has several benefits for human health. The aim of this experiment was to analyze 5 kefir grains (and their products) using a targeted metagenetic approach. Of the 5 kefir grains analyzed, 1 was purchased in a supermarket, 2 were provided by the Ministry of Agriculture (Namur, Belgium), and 2 were provided by individuals. The metagenetic approach targeted the V1-V3 fragment of the 16S ribosomal (r)DNA for the grains and the resulting beverages at 2 levels of grain incorporation (5 and 10%) to identify the bacterial species population. In contrast, the 26S rDNA pyrosequencing was performed only on kefir grains with the aim of assessing the yeast populations. In parallel, pH measurements were performed on the kefir obtained from the kefir grains using 2 incorporation rates. Regarding the bacterial population, 16S pyrosequencing revealed the presence of 20 main bacterial species, with a dominance of the following: Lactobacillus kefiranofaciens, Lactococcus lactis ssp. cremoris, Gluconobacter frateurii, Lactobacillus kefiri, Acetobacter orientalis, and Acetobacter lovaniensis. An important difference was noticed between the kefir samples: kefir grain purchased from a supermarket (sample E) harbored a much higher proportion of several operational taxonomic units of Lactococcus lactis and Leuconostoc mesenteroides. This sample of grain was macroscopically different from the others in terms of size, apparent cohesion of the grains, structure, and texture, probably associated with a lower level of Lactobacillus kefiranofaciens. The kefir (at an incorporation rate of 5%) produced from this sample of grain was characterized by a lower pH value (4.5) than the others. The other 4 samples of kefir (5%) had pH values above 5. Comparing the kefir grain and the kefir, an increase in the population of Gluconobacter in grain sample B was observed. This was also the case for Acetobacter orientalis

  8. Relationship of leptin administration with production of reactive oxygen species, sperm DNA fragmentation, sperm parameters and hormone profile in the adult rat.

    Abbasihormozi, Shima; Shahverdi, Abdolhossein; Kouhkan, Azam; Cheraghi, Javad; Akhlaghi, Ali Asghar; Kheimeh, Abolfazl

    2013-06-01

    Leptin, an adipose tissue-derived hormone, plays an important role in energy homeostasis and metabolism, and in the neuroendocrine and reproductive systems. The function of leptin in male reproduction is unclear; however, it is known to affect sex hormones, sperm motility and its parameters. Leptin induces mitochondrial superoxide production in aortic endothelia and may increase oxidative stress and abnormal sperm production in leptin-treated rats. This study aims to evaluate whether exogenous leptin affects sperm parameters, hormone profiles, and the production of reactive oxygen species (ROS) in adult rats. A total of 65 Sprague-Dawley rats were divided into three treated groups and a control group. Treated rats received daily intraperitoneal injections of 5, 10 and 30 μg/kg of leptin administered for a duration of 7, 15, and 42 days. Control rats were given 0.1 mL of 0.9 % normal saline for the same period. One day after final drug administration, we evaluated serum specimens for follicle-stimulating hormone (FSH), leutinizing hormone (LH), free testosterone (FT), and total testosterone (TT) levels. Samples from the rat epididymis were also evaluated for sperm parameters and motility characteristics by a Computer-Aided Semen Analysis (CASA) system. Samples were treated with 2',7'-dichlorofluorescein-diacetate (DCFH-DA) and analyzed using flow cytometry and TUNEL to determine the impact of leptin administration on sperm DNA fragmentation. According to CASA, significant differences in all sperm parameters in leptin-treated rats and their age-matched controls were detected, except for TM, ALH and BCF. Serum FSH and LH levels were significantly higher in rats that received 10 and 30 μg/kg of leptin compared to those treated with 5 μg/kg of leptin in the same group and control rats (P control group (P hormone profile modulation.

  9. DNA Fragmentation Factor 45 (DFF45 Gene at 1p36.2 Is Homozygously Deleted and Encodes Variant Transcripts in Neuroblastoma Cell Line

    Hong Wei Yang

    2001-01-01

    Full Text Available Recently, loss of heterozygosity (LOH studies suggest that more than two tumor suppressor genes lie on the short arm of chromosome 1 (1p in neuroblastoma (NB. To identify candidate tumor suppressor genes in NB, we searched for homozygous deletions in 20 NB cell lines using a high-density STS map spanning chromosome 1 p36, a common LOH region in NB. We found that the 45-kDa subunit of the DNA fragmentation factor (DFF45 gene was homozygously deleted in an NB cell line, NB-1. DFF45 is the chaperon of DFF40, and both molecules are necessary for caspase 3 to induce apoptosis. DFF35, a splicing variant of DFF45, is an inhibitor of DFF40. We examined 20 NB cell lines for expression and mutation of DFF45 gene by reverse transcription (RT-polymerase chain reaction (PCR and RT-PCR-single-strand conformation polymorphism. Some novel variant transcripts of the DFF45 gene were found in NB cell lines, but not in normal adrenal gland and peripheral blood. These variants may not serve as chaperons of DFF40, but as inhibitors like DFF35, thus disrupting the balance between DFF45 and DFF40. No mutations of the DFF45 gene were found in any NB cell line, suggesting that the DFF45 is not a tumor suppressor gene for NB. However, homozygous deletion of the DFF45 gene in the NB-1 cell line may imply the presence of unknown tumor suppressor genes in this region.

  10. Determination of antimicrobial resistance of Enterococcus strains isolated from pigs and their genotypic characterization by method of amplification of DNA fragments surrounding rare restriction sites (ADSRRS fingerprinting).

    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Trościańczyk, Aleksandra; Zięba, Przemysław; Gnat, Sebastian

    2017-03-01

    In this study, we analysed phenotypic resistance profiles and their reflection in the genomic profiles of Enterococcus spp. strains isolated from pigs raised on different farms. Samples were collected from five pig farms (n=90 animals) and tested for Enterococcus. MICs of 12 antimicrobials were determined using the broth microdilution method, and epidemiological molecular analysis of strains belonging to selected species (faecalis, faecium and hirae) was performed using the ADSRRS-fingerprinting (amplification of DNA fragments surrounding rare restriction sites) method with a few modifications. The highest percentage of strains was resistant to tetracycline (73.4 %), erythromycin and tylosin (42.5 %) and rifampin (25.2 %), and a large number of strains exhibited high-level resistance to both kanamycin (25.2 %) and streptomycin (27.6 %). The strains of E. faecalis, E. faecium and E. hirae (n=184) revealed varied phenotypic resistance profiles, among which as many as seven met the criteria for multidrug resistance (30.4 % of strains tested). ADSRRS-fingerprinting analysis produced 17 genotypic profiles of individual strains which were correlated with their phenotypic resistance profiles. Only E. hirae strains susceptible to all of the chemotherapeutics tested had two different ADSRRS profiles. Moreover, eight animals were carriers of more than one genotype belonging to the same Enterococcus spp., mainly E. faecalis. Given the possibility of transmission to humans of the high-resistance/multidrug resistance enterococci and the significant role of pigs as food animals in this process, it is necessary to introduce a multilevel control strategy by carrying out research on the resistance and molecular characteristics of indicator bacterial strains isolated from animals on individual farms.

  11. Melatonin sensitizes human cervical cancer HeLa cells to cisplatin-induced cytotoxicity and apoptosis: effects on oxidative stress and DNA fragmentation.

    Pariente, Roberto; Pariente, José A; Rodríguez, Ana B; Espino, Javier

    2016-01-01

    Melatonin has antitumor activity via several mechanisms including its antiproliferative and pro-apoptotic effects as well as its potent antioxidant actions, although recent evidence has indicated that melatonin may perform pro-oxidant actions in tumor cells. Therefore, melatonin may be useful in the treatment of tumors in association with chemotherapy drugs. This study was intended to evaluate the in vitro effect of melatonin on the cytotoxic and pro-apoptotic actions of various chemotherapeutic agents in cervical cancer HeLa cells. Herein, we found that both melatonin and three of the chemotherapeutic drugs tested, namely cisplatin (CIS), 5-fluorouracil (5-FU), and doxorubicin, induced a decrease in HeLa cell viability. Furthermore, melatonin significantly increased the cytotoxic effect of such chemotherapeutic agents. Consistently, costimulation of HeLa cells with any chemotherapeutic agent in the presence of melatonin further increased caspase-3 activation, particularly in CIS- and 5-FU-challenged cells. Likewise, concomitant treatments with melatonin and CIS significantly enhanced the ratio of cells entering mitochondrial apoptosis due to reactive oxygen species (ROS) overproduction, substantially augmented the population of apoptotic cells, and markedly enlarged DNA fragmentation compared to the treatments with CIS alone. Nonetheless, melatonin only displayed moderate chemosensitizing effects in 5-FU-stimulated HeLa cells, as suggested by slight increments in the percentage of cells stimulated for ROS production and in the proportion of early apoptotic cells compared to the treatments with 5-FU alone. In summary, our findings provided evidence that in vitro melatonin strongly enhances CIS-induced cytotoxicity and apoptosis in HeLa cells and, hence, the indoleamine could be potentially applied to cervical cancer treatment as a powerful synergistic agent. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Certain amplified genomic-DNA fragments (AGFs) may be involved in cell cycle progression and chloroquine is found to induce the production of cell-cycle-associated AGFs (CAGFs) in Plasmodium falciparum

    Li, Gao-De

    2015-01-01

    It is well known that cyclins are a family of proteins that control cell-cycle progression by activating cyclin-dependent kinase. Based on our experimental results, we propose here a novel hypothesis that certain amplified genomic-DNA fragments (AGFs) may also be required for the cell cycle progression of eukaryotic cells and thus can be named as cell-cycle-associated AGFs (CAGFs). Like fluctuation in cyclin levels during cell cycle progression, these CAGFs are amplified and degraded at diffe...

  13. Nuclear fragmentation

    Chung, K.C.

    1989-01-01

    An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

  14. Relationship between changes of blood HBV-DNA viral load and serum liver fibrosis markers (HA, LN, IV-C, PCIII) levels in patients with chronic hepatitis B

    Wang Yuanchi; Huang Jinwei

    2009-01-01

    Objective: To investigate the relationship between changes of blood HBV DNA viral load and serum liver fibrosis markers levels in patients with chronic hepatitis B. Methods: In 2002, 20 patients with hepatitis B were divided into two groups: Group A treated with antiviral ageat (n=10), Group B not treated.Five years later (2007) the blood viral load (with FQ-PCR) and serum levels of hepatic fibrosis markers (with RIA) were determined in these patients. Results: The average log viral load in serum in the tow groups were 3.56 ± 1.12 (treated group) and 7.76 ± 1.23 respectively with significant difference (P<0.05). In 2002, serum liver fibrosis markers (HA, LN, IV-C, PCIII) levels were about the same in the two groups were (82.72 ± 30.62μg/ml, 71.18 ± 26.71μg/ml, 93.77 ± 69.87μg/ml, 91.4 ± 18.64μg/ml and 79.32 ± 31.34μg/ml, 70.25 ± 28.23)μg/ml, 90.35 ± 67.81μg/ml, 85.77 ± 20.56μg/ml respectively). In 2007, in the treated patients, serum liver fibrosis markers HA, LN, IV-C, PCIII levels were 85.72 ± 29.52μg/ml, 70.18 ± 25.4μg/ml, 94.2 ± 70.92μg/ml, 93.4 ± 19.32μg/ml respectively However, in the non-treated groups, the serum HA, LN, IV-C, PCIII levels were105.67 ± 28.54μg/ml, 97.75 ± 26.25μg/ml, 132 ± 72.13μg/ml, 120.72 ± 19.87μg/ml, being significantly higher than those in the treated group (P<0.05). Conclusion: Effective decrease of the viral load might control the progress of hepatic fibrosis in patients with chronic hepatitis B. (authors)

  15. Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting.

    Rashed-Ul Islam, S M; Jahan, Munira; Tabassum, Shahina

    2015-01-01

    Virological monitoring is the best predictor for the management of chronic hepatitis B virus (HBV) infections. Consequently, it is important to use the most efficient, rapid and cost-effective testing systems for HBV DNA quantification. The present study compared the performance characteristics of a one-step HBV polymerase chain reaction (PCR) vs the two-step HBV PCR method for quantification of HBV DNA from clinical samples. A total of 100 samples consisting of 85 randomly selected samples from patients with chronic hepatitis B (CHB) and 15 samples from apparently healthy individuals were enrolled in this study. Of the 85 CHB clinical samples tested, HBV DNA was detected from 81% samples by one-step PCR method with median HBV DNA viral load (VL) of 7.50 × 10 3 lU/ml. In contrast, 72% samples were detected by the two-step PCR system with median HBV DNA of 3.71 × 10 3 lU/ml. The one-step method showed strong linear correlation with two-step PCR method (r = 0.89; p Tabassum S. Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting. Euroasian J Hepato-Gastroenterol 2015;5(1):11-15.

  16. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  17. A putative non-hr origin of DNA replication in the HindIII-K fragment of Autographa californica multiple nucleocapsid nuclear polyhedrosis virus

    Kool, M.; Goldbach, R. W.; Vlak, J. M.

    1994-01-01

    In addition to the seven known homologous regions (hrs) of Autographa californica multiple nucleocapsid polyhedrosis virus (AcMNPV) the HindIII-K fragment was also found to carry a putative ori, although this fragment does not contain an hr. Deletion analysis showed that this ori contains several

  18. Performance verification and comparison of TianLong automatic hypersensitive hepatitis B virus DNA quantification system with Roche CAP/CTM system.

    Li, Ming; Chen, Lin; Liu, Li-Ming; Li, Yong-Li; Li, Bo-An; Li, Bo; Mao, Yuan-Li; Xia, Li-Fang; Wang, Tong; Liu, Ya-Nan; Li, Zheng; Guo, Tong-Sheng

    2017-10-07

    To investigate and compare the analytical and clinical performance of TianLong automatic hypersensitive hepatitis B virus (HBV) DNA quantification system and Roche CAP/CTM system. Two hundred blood samples for HBV DNA testing, HBV-DNA negative samples and high-titer HBV-DNA mixture samples were collected and prepared. National standard materials for serum HBV and a worldwide HBV DNA panel were employed for performance verification. The analytical performance, such as limit of detection, limit of quantification, accuracy, precision, reproducibility, linearity, genotype coverage and cross-contamination, was determined using the TianLong automatic hypersensitive HBV DNA quantification system (TL system). Correlation and Bland-Altman plot analyses were carried out to compare the clinical performance of the TL system assay and the CAP/CTM system. The detection limit of the TL system was 10 IU/mL, and its limit of quantification was 30 IU/mL. The differences between the expected and tested concentrations of the national standards were less than ± 0.4 Log 10 IU/mL, which showed high accuracy of the system. Results of the precision, reproducibility and linearity tests showed that the multiple test coefficient of variation (CV) of the same sample was less than 5% for 10 2 -10 6 IU/mL; and for 30-10 8 IU/mL, the linear correlation coefficient r 2 = 0.99. The TL system detected HBV DNA (A-H) genotypes and there was no cross-contamination during the "checkerboard" test. When compared with the CAP/CTM assay, the two assays showed 100% consistency in both negative and positive sample results (15 negative samples and 185 positive samples). No statistical differences between the two assays in the HBV DNA quantification values were observed ( P > 0.05). Correlation analysis indicated a significant correlation between the two assays, r 2 = 0.9774. The Bland-Altman plot analysis showed that 98.9% of the positive data were within the 95% acceptable range, and the maximum difference

  19. Genome-wide identification of blood DNA methylation patterns associated with early-onset hepatocellular carcinoma development in hepatitis B carriers.

    Kao, Wei-Yi; Yang, Shu-Han; Liu, Wen-Jie; Yeh, Meng-Yin; Lin, Chih-Lin; Liu, Chun-Jen; Huang, Chi-Jung; Lin, Shi-Ming; Lee, Shou-Dong; Chen, Pei-Jer; Yu, Ming-Whei

    2017-02-01

    The etiology of early-onset hepatocellular carcinoma (HCC) among hepatitis B virus (HBV) carriers remains unclear. DNA methylation levels in peripheral leukocytes have been associated with different environmental exposures and immune or inflammatory response. We aimed to identify methylation signatures of peripheral leukocytes that could track hepatitis B progression to HCC, especially for early-onset HCC. We first performed an epigenome-wide association analysis on 48 matched case-control pairs in a nested case-control study within a 22-yr follow-up cohort of HBV carriers. Through this analysis we found that progression to early-onset HCC involved methylation variable positions across the genome, in which a substantial proportion displayed significant variation due to HBV viral load, chronic hepatitis status, and/or leukocyte subtype composition, and these associations were significantly enriched among genes in immune pathways. Methylation at probes cg00300879, cg06872964, and cg07080864, that are located within the proximal promoter of CNKSR1, IFI44L, and PENK, respectively, was validated by bisulfite pyrosequencing and findings were replicated in a case-sibling study of early-onset HCC (134 cases vs. 174 sibling controls). Furthermore, a high methylation score, constructed using the three probes, was predictive for the risk of early-onset HCC in two datasets (adjusted-odds ratios = 0.21-0.32, P ≤ 0.0206). This association was also observed for late-onset HCC (adjusted-odds ratio = 0.42-0.47, P ≤ 0.0194) in a nested case-control study (120 cases vs. 178 controls). In prospective analysis, change in the score was detected 5-9 yr before HCC onset. Blood-based methylation profiling provides new insights into the complexity of virus-host interaction underlying HBV-related HCC, holding promise for the disease risk management. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  20. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    Wang, Yong; Qian, Pei-Yuan

    2009-01-01

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions

  1. Intratumoral delivery of IL-18 naked DNA induces T-cell activation and Th1 response in a mouse hepatic cancer model

    Chang, Chi-Young; Lee, Jienny; Kim, Eun-Young; Park, Hae-Jung; Kwon, Choon-Hyuck; Joh, Jae-Won; Kim, Sung-Joo

    2007-01-01

    The novel cytokine, interleukin (IL)-18, is a strong interferon-γ inducer and costimulatory factor in Th1 cell activation. IL-18 triggers IFN-γ production and enhances cytolytic activity in both T and NK cells. However, the exact mechanism of antitumor action of IL-18 remains to be clarified. To determine the effects of IL-18 plasmid DNA on hepatic cancer in mice, CT26 murine colon adenocarcinoma cells were established in mouse liver. Plasmid vectors encoding IL-18 were transferred directly into the liver 7 days after tumor injection to restrict IL-18 expression within the tumor site. The IL-18 protein level was increased in the liver 4 days after plasmid injection, and a marked antitumoral effect was observed at day 7. Antitumor effects were evaluated by measuring tumor regression, immune cell population, and IFN-γ production. The IL-18 plasmid controlled the growth of hepatic tumors and proliferation of splenic immune cells. Moreover, treatment of CT26 tumors with the IL-18 plasmid significantly enhanced the population of the effector T and NK cells in the spleen and peripheral blood. In spleen, the population of CD4 + CD62 Low cells was augmented in response to IL-18 on day 7. These results are consistent with the increase in CD4 + T cells secreting IFN-γ, but not CD8 + T cells. The marked reduction of tumor growth in tumor-bearing mice was associated with the maintenance of IFN-γ production in spleen in response to IL-18. These antitumoral effects were maintained until 14 days after plasmid injection. Our results suggest that direct plasmid DNA transfer of IL-18 with no accompanying reagents to augment transfection efficiency may be useful in tumor immunotherapy

  2. Establishment of a novel two-probe real-time PCR for simultaneously quantification of hepatitis B virus DNA and distinguishing genotype B from non-B genotypes.

    Wang, Wei; Liang, Hongpin; Zeng, Yongbin; Lin, Jinpiao; Liu, Can; Jiang, Ling; Yang, Bin; Ou, Qishui

    2014-11-01

    Establishment of a simple, rapid and economical method for quantification and genotyping of hepatitis B virus (HBV) is of great importance for clinical diagnosis and treatment of chronic hepatitis B patients. We hereby aim to develop a novel two-probe real-time PCR for simultaneous quantification of HBV viral concentration and distinguishing genotype B from non-B genotypes. Conserved primers and TaqMan probes for genotype B and non-B genotypes were designed. The linear range, detection sensitivity, specificity and repeatability of the method were assessed. 539 serum samples from HBV-infected patients were assayed, and the results were compared with commercial HBV quantification and HBV genotyping kits. The detection sensitivity of the two-probe real-time PCR was 500IU/ml; the linear range was 10(3)-10(9)IU/ml, and the intra-assay CVs and inter-assay CVs were between 0.84% and 2.80%. No cross-reaction was observed between genotypes B and non-B. Of the 539 detected samples, 509 samples were HBV DNA positive. The results showed that 54.0% (275/509) of the samples were genotype B, 39.5% (201/509) were genotype non-B and 6.5% (33/509) were mixed genotype. The coincidence rate between the method and a commercial HBV DNA genotyping kit was 95.9% (488/509, kappa=0.923, PDNA qPCR kit were achieved. A novel two-probe real-time PCR method for simultaneous quantification of HBV viral concentration and distinguishing genotype B from non-B genotypes was established. The assay was sensitive, specific and reproducible which can be applied to areas prevalent with HBV genotypes B and C, especially in China. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Occult hepatitis B among Iranian hepatitis C patients

    Ahmad shavakhi

    2009-02-01

    Full Text Available

    • BACKGROUND: Occult hepatitis B is defined as presence of HBV DNA in tissue or serum without hepatitis B surface antigen. The aim of this study is to determine frequency of occult hepatitis B among hepatitis C patients in Tehran and compare the route of transmission and liver enzymes between positive and negative HBV DNA patients.
    • METHODS: In a cross sectional study, serum of 103 hepatitis C cases (79.6% men and 20.4% women were analyzed for s, x and core genes via a nested polymerase chain reaction technique.
    • RESULTS: HBV DNA was detectable in serum of 20 patients (19.4%. No significant difference in age, sex and route of transmission were seen in HBV DNA positive and negative patients. In HBV DNA positive and negative groups, mean of AST was 73, 47 (p < 0.05 and mean of ALT was 76 and 36 respectively (p < 0.05.
    • CONCLUSION: Occult hepatitis B was observed in a considerable number of hepatitis C patients in Tehran. It was associated with elevation in liver enzyme but was not related to route of transmission.
    • KEY WORD: Occult hepatitis B, hepatitis C, cirrhosis.

  4. Hepatic Encephalopathy

    Full Text Available ... A Hepatitis B Hepatitis C Intrahepatic Cholestasis of Pregnancy (ICP) Jaundice In Newborns Diseases of the Liver ... A Hepatitis B Hepatitis C Intrahepatic Cholestasis of Pregnancy (ICP) Jaundice In Newborns Diseases of the Liver ...

  5. Viral Hepatitis

    ... Home A-Z Health Topics Viral hepatitis Viral hepatitis > A-Z Health Topics Viral hepatitis (PDF, 90 ... liver. Source: National Cancer Institute Learn more about hepatitis Watch a video. Learn who is at risk ...

  6. Hepatitis B

    ... B Entire Lesson Viral Hepatitis Menu Menu Viral Hepatitis Viral Hepatitis Home For Veterans and the Public Veterans ... in their blood (sometimes referred to as the hepatitis B viral load) and an unusually high level of a ...

  7. Circulating levels of chromatin fragments are inversely correlated with anti-dsDNA antibody levels in human and murine systemic lupus erythematosus

    Jørgensen, Mariann H; Rekvig, Ole Petter; Jacobsen, Rasmus S

    2011-01-01

    Anti-dsDNA antibodies represent a central pathogenic factor in Lupus nephritis. Together with nucleosomes they deposit as immune complexes in the mesangial matrix and along basement membranes within the glomeruli. The origin of the nucleosomes and when they appear e.g. in circulation is not known...... an inverse correlation between anti-dsDNA antibodies and the DNA concentration in the circulation in both murine and human serum samples. High titer of anti-DNA antibodies in human sera correlated with reduced levels of circulating chromatin, and in lupus prone mice with deposition within glomeruli....... The inverse correlation between DNA concentration and anti-dsDNA antibodies may reflect antibody-dependent deposition of immune complexes during the development of lupus nephritis in autoimmune lupus prone mice. The measurement of circulating DNA in SLE sera by using qPCR may indicate and detect...

  8. Experimental and molecular docking studies on DNA binding interaction of adefovir dipivoxil: Advances toward treatment of hepatitis B virus infections

    Shahabadi, Nahid; Falsafi, Monireh

    The toxic interaction of adefovir dipivoxil with calf thymus DNA (CT-DNA) was investigated in vitro under simulated physiological conditions by multi-spectroscopic techniques and molecular modeling study. The fluorescence spectroscopy and UV absorption spectroscopy indicated drug interacted with CT-DNA in a groove binding mode. The binding constant of UV-visible and the number of binding sites were 3.33 ± 0.2 × 104 L mol-1and 0.99, respectively. The fluorimetric studies showed that the reaction between the drug and CT-DNA is exothermic (ΔH = 34.4 kJ mol-1; ΔS = 184.32 J mol-1 K-1). Circular dichroism spectroscopy (CD) was employed to measure the conformational change of CT-DNA in the presence of adefovir dipivoxil, which verified the groove binding mode. Furthermore, the drug induces detectable changes in its viscosity. The molecular modeling results illustrated that adefovir strongly binds to groove of DNA by relative binding energy of docked structure -16.83 kJ mol-1. This combination of multiple spectroscopic techniques and molecular modeling methods can be widely used in the investigation on the toxic interaction of small molecular pollutants and drugs with bio macromolecules, which contributes to clarify the molecular mechanism of toxicity or side effect in vivo.

  9. Controlled fragmentation

    Arnold, Werner

    2002-01-01

    Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer

  10. Percutaneous transhepatic fragmentation of gall stones and extraction of fragments

    Guenther, R.; Klose, K.; Schmidt, H.D.; Staritz, M.; Mainz Univ.; Mainz Univ.

    1983-01-01

    Attempts at percutaneous removal have been made in 13 patients with solitary and multiple intra- and extra-hepatic biliary duct stones measuring 5 to 30 mm. The stones were fragmented with a Dormia basket and the fragments removed transhepatically. In ten patients the procedure was successful, including one patient with multiple intra-hepatic stones. The procedure can be recommended for cases of calculous obstruction of biliary anastomoses or of stones which could not be removed by endoscopy, or where there is already biliary drainage being carried out, or in patients with a high opertive risk. In two patients, dilatation of the papilla was also carried out, in four patients a stenosis was dilated and in a further two patients, electro-incision of a stenosis was performed. (orig.) [de

  11. Chameleon fragmentation

    Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)

    2014-02-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.

  12. Chameleon fragmentation

    Brax, Philippe; Upadhye, Amol

    2014-01-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments

  13. Two distinct subtypes of hepatitis B virus-related acute liver failure are separable by quantitative serum immunoglobulin M anti-hepatitis B core antibody and hepatitis B virus DNA levels

    Dao, Doan Y; Hynan, Linda S; Yuan, He-Jun

    2012-01-01

    Hepatitis B virus (HBV)-related acute liver failure (HBV-ALF) may occur after acute HBV infection (AHBV-ALF) or during an exacerbation of chronic HBV infection (CHBV-ALF). Clinical differentiation of the two is often difficult if a previous history of HBV is not available. Quantitative measurements...... of immunoglobulin M (IgM) anti-hepatitis B core antibody (anti-HBc) titers and of HBV viral loads (VLs) might allow the separation of AHBV-ALF from CHBV-ALF. Of 1,602 patients with ALF, 60 met clinical criteria for AHBV-ALF and 27 for CHBV-ALF. Sera were available on 47 and 23 patients, respectively. A quantitative...... immunoassay was used to determine IgM anti-HBc levels, and real-time polymerase chain reaction (rtPCR) was used to determine HBV VLs. AHBV-ALFs had much higher IgM anti-HBc titers than CHBV-ALFs (signal-to-noise [S/N] ratio median: 88.5; range, 0-1,120 versus 1.3, 0-750; P

  14. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    . Isolates with identical DNA profiles were distributed across the spectrum of origin. It was not possible to associate certain types with specific food sectors or clinical cases, which is indicative of the spread of L. monocytogenes clones across species. Overall, AFLP fingerprinting was suitable...

  15. Metabolic Enhancer Piracetam Attenuates the Translocation of Mitochondrion-Specific Proteins of Caspase-Independent Pathway, Poly [ADP-Ribose] Polymerase 1 Up-regulation and Oxidative DNA Fragmentation.

    Verma, Dinesh Kumar; Gupta, Sonam; Biswas, Joyshree; Joshi, Neeraj; Sivarama Raju, K; Wahajuddin, Mu; Singh, Sarika

    2018-03-12

    Piracetam, a nootropic drug, has been clinically used for decades; however, its mechanism of action still remains enigmatic. The present study was undertaken to evaluate the role of mitochondrion-specific factors of caspase-independent pathway like apoptotic-inducing factor (AIF) and endonuclease-G (endo-G) in piracetam-induced neuroprotection. N2A cells treated with lipopolysaccharide (LPS) exhibited significant cytotoxicity, impaired mitochondrial activity, and reactive oxygen species generation which was significantly attenuated with piracetam co-treatment. Cells co-treated with LPS and piracetam exhibited significant uptake of piracetam in comparison to only piracetam-treated cells as estimated by liquid chromatography-mass spectrometry (LC-MSMS). LPS treatment caused significant translocation of AIF and endonuclease-G in neuronal N2A cells which were significantly attenuated with piracetam co-treatment. Significant over-expression of proinflammatory cytokines was also observed after treatment of LPS to cells which was inhibited with piracetam co-treatment demonstrating its anti-inflammatory property. LPS-treated cells exhibited significant oxidative DNA fragmentation and poly [ADP-ribose] polymerase-1 (PARP-1) up-regulation in nucleus, both of which were attenuated with piracetam treatment. Antioxidant melatonin but not z-VAD offered the inhibited LPS-induced DNA fragmentation indicating the involvement of oxidative DNA fragmentation. Further, we did not observe the altered caspase-3 level after LPS treatment initially while at a later time point, significantly augmented level of caspase-3 was observed which was not inhibited with piracetam treatment. In total, our findings indicate the interference of piracetam in mitochondrion-mediated caspase-independent pathway, as well as its anti-inflammatory and antioxidative properties. Graphical Abstract Graphical abstract indicating the novel interference of metabolic enhancer piracetam (P) in neuronal death

  16. Bespoke Fragments

    Kruse Aagaard, Anders

    2017-01-01

    The PhD project Bespoke Fragments is investigating the space emerging in the exploration of the relationship between digital drawing and fabrication, and the field of materials and their properties and capacities. Through a series of different experiments, the project situates itself in a shuttli...

  17. Rock fragmentation

    Brown, W.S.; Green, S.J.; Hakala, W.W.; Hustrulid, W.A.; Maurer, W.C. (eds.)

    1976-01-01

    Experts in rock mechanics, mining, excavation, drilling, tunneling and use of underground space met to discuss the relative merits of a wide variety of rock fragmentation schemes. Information is presented on novel rock fracturing techniques; tunneling using electron beams, thermocorer, electric spark drills, water jets, and diamond drills; and rock fracturing research needs for mining and underground construction. (LCL)

  18. Hepatitis virus genotyping by Polymerase Chain Reaction and DNA Enzyme immunoassay among Saudi patients in the Western Province, Saudi Arabia

    Osoba, A.O.; Ibrahim, M.; Abdelaal, M.A.; Al-Mowallad, A.; Al-Shareef, B.; Hussein, B.A.

    2000-01-01

    The distribution of hepatitis C virus (HCV) genotypes in the Western Province of Saudi Arabia is unknown. The purpose of our study was to determine the prevalent HCV genotypes among HCV seropositive Saudi patients in the Western Province and to study the relationship between types/subtypes, clinical status and liver histology. Serum samples were collected from 140 consecutive patients attending the Hematology Clinic with varying grades of liver diseases, high almandine transferees (ALT) for > 6 months, positive HCV, qualitative PCR and who had liver biopsy. HCV genotyping was determined on patients who had tested positive by both HCV enzyme immunoassay (EIA) and the recombinant immunoblot assay (RIBA). Of the 140 patients, 97 (69.2%) had genotype 4, 18 (12.8%) had genotype 1a, and 16 (11.4%) had genotype 1b. Genotype 2b and 5 were found in two patients (1.4%) each, while 5 patients (3.6%) had mixed infections with genotype 4 and 5. Of the 97 patients infected with genotype 4, 84 (86.6%) had chronic active hepatitis (CAH), two (2.1%) had CAH with active cirrhosis, 9(9.3%) had cirrhosis and two (2.1%) had normal liver histology (NLH). The most prevalent HCV genotype in the Western Province of Saudi Arabia was genotype 4 (69.2%). Genotype 1b was encountered in 16 (11.4%) patients. For the first time, genotype 5 was identified in the Western Province of Saudi Arabia. Genotype 1b and 4 were associated with different histological grades of liver disease. (author)

  19. The combi-targeting concept: in vitro and in vivo fragmentation of a stable combi-nitrosourea engineered to interact with the epidermal growth factor receptor while remaining DNA reactive.

    Qiu, Qiyu; Domarkas, Juozas; Banerjee, Ranjita; Merayo, Nuria; Brahimi, Fouad; McNamee, James P; Gibbs, Bernard F; Jean-Claude, Bertrand J

    2007-01-01

    JDA58 (NSC 741282), a "combi-molecule" optimized in the context of the "combi-targeting concept," is a nitrosourea moiety tethered to an anilinoquinazoline. Here, we sought to show its binary epidermal growth factor receptor (EGFR)/DNA targeting property and to study its fragmentation in vitro and in vivo. The fragmentation of JDA58 was detected in cells in vitro and in vivo by fluorescence microscopy and tandem mass spectrometry. EGFR phosphorylation and DNA damage were determined by Western blotting and comet assay, respectively. Tumor data were examined for statistical significance using the Student's t test. JDA58 inhibited EGFR tyrosine kinase (IC(50), 0.2 micromol/L) and blocked EGFR phosphorylation in human DU145 prostate cancer cells. It induced significant levels of DNA damage in DU145 cells in vitro or in vivo and showed potent antiproliferative activity both in vitro and in a DU145 xenograft model. In cell-free medium, JDA58 was hydrolyzed to JDA35, a fluorescent amine that could be observed in tumor cells both in vitro and in vivo. In tumor cells in vitro or in vivo, or in plasma collected from mice, the denitrosated species JDA41 was the predominant metabolite. However, mass spectrometric analysis revealed detectable levels of the hydrolytic product JDA35 in tumor cells both in vitro and in vivo. The results in toto suggest that growth inhibition in vitro and in vivo may be sustained by the intact combi-molecule plus JDA35 plus JDA41, three inhibitors of EGFR, and the concomitantly released DNA-damaging species. This leads to a model wherein a single molecule carries a complex multitargeted-multidrug combination.

  20. Potential use of serum HBV RNA in antiviral therapy for chronic hepatitis B in the era of nucleos(t)ide analogs.

    Lu, Fengmin; Wang, Jie; Chen, Xiangmei; Xu, Dongping; Xia, Ningshao

    2017-12-01

    Although the efficacy of nucleos(t)ide analogue (NA) has been confirmed for treatment of chronic hepatitis B, long-term therapy has been recommended due to the high frequency of off-therapy viral DNA rebound and disease relapse. In this review, the RNA virion-like particles of hepatitis B virus (HBV) are integrated into the life cycle of HBV replication, and the potential significance of serum HBV RNA is systematically described. The production of HBV RNA virion-like particles should not be blocked by NA; in this regard, serum HBV RNA is found to be a suitable surrogate marker for the activity of intrahepatic covalently closed circular DNA (cccDNA), particularly among patients receiving NA therapy. Therefore, the concept of virological response is redefined as persistent loss of serum HBV DNA and HBV RNA. In contrast to hepatitis B surface antigen (HBsAg) that can originate from either the cccDNA or the integrated HBV DNA fragment, serum HBV RNA, with pregenomic RNA origination, can only be transcribed from cccDNA. Therefore, the loss of serum HBV RNA would likely be a promising predicator for safe drug discontinuation. The clinical status of consistent loss of serum HBV RNA accompanied with low serum HBsAg levels might be implicated as a "para-functional cure," a status nearly close to the functional cure of chronic hepatitis B, to distinguish the "functional cure" characterized as serum HBsAg loss with or without anti-HBs seroconversion.

  1. Architectural fragments

    Bang, Jacob Sebastian

    2018-01-01

    I have created a large collection of plaster models: a collection of Obstructions, errors and opportunities that may develop into architecture. The models are fragments of different complex shapes as well as more simple circular models with different profiling and diameters. In this contect I have....... I try to invent the ways of drawing the models - that decode and unfold them into architectural fragments- into future buildings or constructions in the landscape. [1] Luigi Moretti: Italian architect, 1907 - 1973 [2] Man Ray: American artist, 1890 - 1976. in 2015, I saw the wonderful exhibition...... "Man Ray - Human Equations" at the Glyptotek in Copenhagen, organized by the Philips Collection in Washington D.C. and the Israel Museum in Jerusalem (in 2013). See also: "Man Ray - Human Equations" catalogue published by Hatje Cantz Verlag, Germany, 2014....

  2. The AT-Hook motif as a versatile minor groove anchor for promoting DNA binding of transcription factor fragments? ?Electronic supplementary information (ESI) available: Peptide synthesis, full experimental procedures and analytical data of the peptides and products obtained. See DOI: 10.1039/c5sc01415h Click here for additional data file.

    Rodr?guez, J?ssica; Mosquera, Jes?s; Couceiro, Jose R.; V?zquez, M. Eugenio; Mascare?as, Jos? L.

    2015-01-01

    We report the development of chimeric DNA binding peptides comprising a DNA binding fragment of natural transcription factors (the basic region of a bZIP protein or a monomeric zinc finger module) and an AT-Hook peptide motif. The resulting peptide conjugates display high DNA affinity and excellent sequence selectivity. Furthermore, the AT-Hook motif also favors the cell internalization of the conjugates.

  3. Hepatic Encephalopathy

    Full Text Available ... 1 (von Gierke) Hemochromatosis Hepatic Encephalopathy Hepatitis A Hepatitis B Hepatitis C Intrahepatic Cholestasis of Pregnancy (ICP) Jaundice ... diseases. What are the common causes of cirrhosis? Hepatitis B & C Alcohol-related Liver Disease Non-alcoholic Fatty ...

  4. DNA immunization with fusion of CTLA-4 to hepatitis B virus (HBV core protein enhanced Th2 type responses and cleared HBV with an accelerated kinetic.

    Ying Yin

    Full Text Available BACKGROUND: Typically, DNA immunization via the intramuscular route induces specific, Th1-dominant immune responses. However, plasmids expressing viral proteins fused to cytotoxic T lymphocyte antigen 4 (CTLA-4 primed Th2-biased responses and were able to induced effective protection against viral challenge in the woodchuck model. Thus, we addressed the question in the mouse model how the Th1/Th2 bias of primed immune responses by a DNA vaccine influences hepatitis B virus (HBV clearance. PRINCIPAL FINDINGS: Plasmids expressing HBV core protein (HBcAg or HBV e antigen and HBcAg fused to the extracellular domain of CTLA-4 (pCTLA-4-HBc, CD27, and full length CD40L were constructed. Immunizations of these DNA plasmids induced HBcAg-specific antibody and cytotoxic T-cell responses in mice, but with different characteristics regarding the titers and subtypes of specific antibodies and intensity of T-cell responses. The plasmid pHBc expressing HBcAg induced an IgG2a-dominant response while immunizations of pCTLA-4-HBc induced a balanced IgG1/IgG2a response. To assess the protective values of the immune responses of different characteristics, mice were pre-immunized with pCTLA-4-HBc and pHBc, and challenged by hydrodynamic injection (HI of pAAV/HBV1.2. HBV surface antigen (HBsAg and DNA in peripheral blood and HBcAg in liver tissue were cleared with significantly accelerated kinetics in both groups. The clearance of HBsAg was completed within 16 days in immunized mice while more than 50% of the control mice are still positive for HBsAg on day 22. Stronger HBcAg-specific T-cell responses were primed by pHBc correlating with a more rapid decline of HBcAg expression in liver tissue, while anti-HBs antibody response developed rapidly in the mice immunized with pCTLA-4-HBc, indicating that the Th1/Th2 bias of vaccine-primed immune responses influences the mode of viral clearance. CONCLUSION: Viral clearance could be efficiently achieved by Th1/Th2-balanced

  5. Insulin-like growth factor-1 (IGF-1) promotes primordial follicle growth and reduces DNA fragmentation through the phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) signalling pathway.

    Bezerra, Maria É S; Barberino, Ricássio S; Menezes, Vanúzia G; Gouveia, Bruna B; Macedo, Taís J S; Santos, Jamile M S; Monte, Alane P O; Barros, Vanessa R P; Matos, Maria H T

    2018-05-30

    We investigated the effects of insulin-like growth factor 1 (IGF-1) on the morphology and follicular activation of ovine preantral follicles cultured in situ and whether the phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) pathway is involved in IGF-1 action in the sheep ovary. Ovine ovarian fragments were fixed for histological and terminal deoxynucleotidyl transferase dUTP nick-end labelling (TUNEL) analyses (fresh control) or cultured in supplemented alpha-minimum essential medium (α-MEM+; control) or α-MEM+ with IGF-1 (1, 10, 50, 100 or 200ngmL-1) for 7 days. Follicles were classified as normal or atretic, primordial or growing and the oocyte and follicle diameters were measured. DNA fragmentation was evaluated by TUNEL assay. Proliferating cell nuclear antigen (PCNA) immunohistochemistry was performed on the fresh control, α-MEM+ and 100ngmL-1 IGF-1 samples. Inhibition of PI3K activity was performed through pretreatment with the PI3K inhibitor LY294002 and phosphorylated AKT (pAKT) expression was analysed after culture in the absence or presence of LY294002. IGF-1 at 100ngmL-1 increased (PIGF-1. LY294002 significantly inhibited follicular activation stimulated by α-MEM+ and 100ngmL-1 IGF-1 and reduced pAKT expression in follicles. Overall, IGF-1 at 100ngmL-1 promoted primordial follicle activation, cell proliferation and reduced DNA fragmentation after in situ culture through the PI3K/AKT pathway.

  6. Transcriptional Elongation Control of Hepatitis B Virus Covalently Closed Circular DNA Transcription by Super Elongation Complex and BRD4.

    Francisco, Joel Celio; Dai, Qian; Luo, Zhuojuan; Wang, Yan; Chong, Roxanne Hui-Heng; Tan, Yee Joo; Xie, Wei; Lee, Guan-Huei; Lin, Chengqi

    2017-10-01

    Chronic hepatitis B virus (HBV) infection can lead to liver cirrhosis and hepatocellular carcinoma. HBV reactivation during or after chemotherapy is a potentially fatal complication for cancer patients with chronic HBV infection. Transcription of HBV is a critical intermediate step of the HBV life cycle. However, factors controlling HBV transcription remain largely unknown. Here, we found that different P-TEFb complexes are involved in the transcription of the HBV viral genome. Both BRD4 and the super elongation complex (SEC) bind to the HBV genome. The treatment of bromodomain inhibitor JQ1 stimulates HBV transcription and increases the occupancy of BRD4 on the HBV genome, suggesting the bromodomain-independent recruitment of BRD4 to the HBV genome. JQ1 also leads to the increased binding of SEC to the HBV genome, and SEC is required for JQ1-induced HBV transcription. These findings reveal a novel mechanism by which the HBV genome hijacks the host P-TEFb-containing complexes to promote its own transcription. Our findings also point out an important clinical implication, that is, the potential risk of HBV reactivation during therapy with a BRD4 inhibitor, such as JQ1 or its analogues, which are a potential treatment for acute myeloid leukemia. Copyright © 2017 American Society for Microbiology.

  7. Impact of a Central Scaffold on the Binding Affinity of Fragment Pairs Isolated from DNA-Encoded Self-Assembling Chemical Libraries.

    Bigatti, Martina; Dal Corso, Alberto; Vanetti, Sara; Cazzamalli, Samuele; Rieder, Ulrike; Scheuermann, Jörg; Neri, Dario; Sladojevich, Filippo

    2017-11-08

    The screening of encoded self-assembling chemical libraries allows the identification of fragment pairs that bind to adjacent pockets on target proteins of interest. For practical applications, it is necessary to link these ligand pairs into discrete organic molecules, devoid of any nucleic acid component. Here we describe the discovery of a synergistic binding pair for acid alpha-1 glycoprotein and a chemical strategy for the identification of optimal linkers, connecting the two fragments. The procedure yielded a set of small organic ligands, the best of which exhibited a dissociation constant of 9.9 nm, as measured in solution by fluorescence polarization. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29.

    Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M

    2006-05-01

    The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic

  9. Differences in the ovine HSP90AA1 gene expression rates caused by two linked polymorphisms at its promoter affect rams sperm DNA fragmentation under environmental heat stress conditions.

    Salces-Ortiz, Judit; Ramón, Manuel; González, Carmen; Pérez-Guzmán, M Dolores; Garde, J Julián; García-Álvarez, Olga; Maroto-Morales, Alejandro; Calvo, Jorge H; Serrano, M Magdalena

    2015-01-01

    Heat shock (HS) is one of the best-studied exogenous cellular stresses. Almost all tissues, cell types, metabolic pathways and biochemical reactions are affected in greater or lesser extent by HS. However, there are some especially thermo sensible cellular types such as the mammalian male germ cells. The present study examined the role of three INDELs in conjunction with the -660G/C polymorphism located at the HSP90AA1 promoter region over the gene expression rate under HS. Specially, the -668insC INDEL, which is very close to the -660G/C transversion, is a good candidate to be implied in the transcriptional regulation of the gene by itself or in a cooperative way with this SNP. Animals carrying the genotype II-668 showed higher transcription rates than those with ID-668 (FC = 3.07) and DD-668 (FC = 3.40) genotypes for samples collected under HS. A linkage between gene expression and sperm DNA fragmentation was also found. When HS conditions were present along or in some stages of the spermatogenesis, alternative genotypes of the -668insC and -660G/C mutations are involved in the effect of HS over sperm DNA fragmentation. Thus, unfavorable genotypes in terms of gene expression induction (ID-668GC-660 and DD-668GG-660) do not produce enough mRNA (stored as messenger ribonucleoprotein particles) and Hsp90α protein to cope with future thermal stress which might occur in posterior stages when transcriptional activity is reduced and cell types and molecular processes are more sensible to heat (spermatocytes in pachytene and spermatids protamination). This would result in the impairment of DNA packaging and the consequent commitment of the events occurring shortly after fertilization and during embryonic development. In the short-term, the assessment of the relationship between sperm DNA fragmentation sensitivity and ram's fertility will be of interest to a better understanding of the mechanisms of response to HS and its consequences on animal production and

  10. Intermediate Fragment

    Kruse Aagaard, Anders

    2015-01-01

    This text and its connected exhibition are aiming to reflect both on the thoughts, the processes and the outcome of the design and production of the artefact ‘Intermediate Fragment’ and making as a contemporary architectural tool in general. Intermediate Fragment was made for the exhibition ‘Enga...... of realising an exhibition object was conceived, but expanded, refined and concretised through this process. The context of the work shown here is an interest in a tighter, deeper connection between experimentally obtained material knowledge and architectural design....

  11. Fragmentation based

    Shashank Srivastava

    2014-01-01

    Gaining the understanding of mobile agent architecture and the security concerns, in this paper, we proposed a security protocol which addresses security with mitigated computational cost. The protocol is a combination of self decryption, co-operation and obfuscation technique. To circumvent the risk of malicious code execution in attacking environment, we have proposed fragmentation based encryption technique. Our encryption technique suits the general mobile agent size and provides hard and thorny obfuscation increasing attacker’s challenge on the same plane providing better performance with respect to computational cost as compared to existing AES encryption.

  12. Bespoke Fragments

    Kruse Aagaard, Anders

    2016-01-01

    , investigating levels of control and uncertainty encountering with these. Through tangible experiments, the project discusses materiality and digitally controlled fabrications tools as direct expansions of the architect's digital drawing and workflow. The project sees this expansion as an opportunity to connect...... architectural designs, tectonics and aesthetics. In this Ph.D.-project a series a physical, but conceptual, experiment plays the central role in the knowledge production. The experiments result in materialised architectural fragments and tangible experiences. However, these creations also become the driving...

  13. Artificial Synthesis of Conserved Segment S Gene Fragment of Rift ...

    Fragment of Rift Valley Fever Virus and Preliminary Study of Its Reverse ... blindness, encephalitis, hemorrhagic hepatitis, and, in serious ... over 30 mosquito species [5] of mosquito. As ..... RVFV, as a mosquito-borne virus for a multitude.

  14. Relation between laboratory test results and histological hepatitis activity in individuals positive for hepatitis B surface antigen and antibodies to hepatitis B e antigen

    ter Borg, F.; ten Kate, F. J.; Cuypers, H. T.; Leentvaar-Kuijpers, A.; Oosting, J.; Wertheim-van Dillen, P. M.; Honkoop, P.; Rasch, M. C.; de Man, R. A.; van Hattum, J.; Chamuleau, R. A.; Reesink, H. W.; Jones, E. A.

    1998-01-01

    BACKGROUND: Hepatitis B surface antigen (HBsAg) and antibodies to hepatitis B e antigen (anti-HBe) commonly coexist, and laboratory tests are often requested to assess histological hepatitis activity. An optimum panel of tests has not been found and the usefulness of hepatitis B virus (HBV) DNA

  15. Hepatitis Vaccines

    Ogholikhan, Sina; Schwarz, Kathleen B.

    2016-01-01

    Viral hepatitis is a serious health problem all over the world. However, the reduction of the morbidity and mortality due to vaccinations against hepatitis A and hepatitis B has been a major component in the overall reduction in vaccine preventable diseases. We will discuss the epidemiology, vaccine development, and post-vaccination effects of the hepatitis A and B virus. In addition, we discuss attempts to provide hepatitis D vaccine for the 350 million individuals infected with hepatitis B ...

  16. Prevalence of hepatitis B virus among immunocompromised ...

    Hepatitis B is an infectious inflammatory illness of the liver caused by the hepatitis B virus (HBV) which is transmitted to a large population through blood transfusion or by exposure to other body fluids. HBV is a member of the family Hepadnaviridae and also a DNA virus. In this study, the prevalence of hepatitis B infection ...

  17. Detecting exact breakpoints of deletions with diversity in hepatitis B viral genomic DNA from next-generation sequencing data.

    Cheng, Ji-Hong; Liu, Wen-Chun; Chang, Ting-Tsung; Hsieh, Sun-Yuan; Tseng, Vincent S

    2017-10-01

    Many studies have suggested that deletions of Hepatitis B Viral (HBV) are associated with the development of progressive liver diseases, even ultimately resulting in hepatocellular carcinoma (HCC). Among the methods for detecting deletions from next-generation sequencing (NGS) data, few methods considered the characteristics of virus, such as high evolution rates and high divergence among the different HBV genomes. Sequencing high divergence HBV genome sequences using the NGS technology outputs millions of reads. Thus, detecting exact breakpoints of deletions from these big and complex data incurs very high computational cost. We proposed a novel analytical method named VirDelect (Virus Deletion Detect), which uses split read alignment base to detect exact breakpoint and diversity variable to consider high divergence in single-end reads data, such that the computational cost can be reduced without losing accuracy. We use four simulated reads datasets and two real pair-end reads datasets of HBV genome sequence to verify VirDelect accuracy by score functions. The experimental results show that VirDelect outperforms the state-of-the-art method Pindel in terms of accuracy score for all simulated datasets and VirDelect had only two base errors even in real datasets. VirDelect is also shown to deliver high accuracy in analyzing the single-end read data as well as pair-end data. VirDelect can serve as an effective and efficient bioinformatics tool for physiologists with high accuracy and efficient performance and applicable to further analysis with characteristics similar to HBV on genome length and high divergence. The software program of VirDelect can be downloaded at https://sourceforge.net/projects/virdelect/. Copyright © 2017. Published by Elsevier Inc.

  18. Hepatic Encephalopathy

    Full Text Available ... Donate Today Enroll in 123 What is Hepatic Encephalopathy? Hepatic Encephalopathy, sometimes referred to as portosystemic encephalopathy or PSE, is a condition that causes temporary ...

  19. Selection of an entecavir-resistant mutant despite prolonged hepatitis B virus DNA suppression, in a chronic hepatitis B patient with preexistent lamivudine resistance : successful rescue therapy with tenofovir

    Leemans, Wilhelmus F; Niesters, Hubert G; van der Eijk, Annemiek A; Janssen, Harry L; Schalm, Solko W; de Man, Robert A

    BACKGROUND AND OBJECTIVE: Entecavir has potent activity against hepatitis B virus. Drug resistance has not been reported in nucleoside-naïve patients and is low in lamivudine-refractory patients. METHODS AND RESULTS: A 43-year-old man was treated with lamivudine for hepatitis B e antigen-positive

  20. Crystallization and preliminary X-ray diffraction analysis of two N-terminal fragments of the DNA-cleavage domain of topoisomerase IV from Staphylococcus aureus

    Carr, Stephen B., E-mail: bmbsbc@bmb.leeds.ac.uk [Astbury Centre for Structural Molecular Biology, University of Leeds, Leeds LS2 9JT (United Kingdom); Makris, George [Omega Mediation Hellas Ltd, Clinical and Pharma Consulting, 11525 N. Psychiko, Athens (Greece); Phillips, Simon E. V.; Thomas, Christopher D. [Astbury Centre for Structural Molecular Biology, University of Leeds, Leeds LS2 9JT (United Kingdom)

    2006-11-01

    The crystallization and data collection of topoisomerase IV from S. aureus is described. Phasing by molecular replacement proved difficult owing to the presence of translational NCS and strategies used to overcome this are discussed. DNA topoisomerase IV removes undesirable topological features from DNA molecules in order to help maintain chromosome stability. Two constructs of 56 and 59 kDa spanning the DNA-cleavage domain of the A subunit of topoisomerase IV from Staphylococcus aureus (termed GrlA56 and GrlA59) have been crystallized. Crystals were grown at 291 K using the sitting-drop vapour-diffusion technique with PEG 3350 as a precipitant. Preliminary X-ray analysis revealed that GrlA56 crystals belong to space group P2{sub 1}, diffract to a resolution of 2.9 Å and possess unit-cell parameters a = 83.6, b = 171.5, c = 87.8 Å, β = 90.1°, while crystals of GrlA59 belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 41.5, b = 171.89, c = 87.9 Å. These crystals diffract to a resolution of 2.8 Å. This is the first report of the crystallization and preliminary X-ray analysis of the DNA-cleavage domain of a topoisomerase IV from a Gram-positive organism.

  1. Crystallization and preliminary X-ray diffraction analysis of two N-terminal fragments of the DNA-cleavage domain of topoisomerase IV from Staphylococcus aureus

    Carr, Stephen B.; Makris, George; Phillips, Simon E. V.; Thomas, Christopher D.

    2006-01-01

    The crystallization and data collection of topoisomerase IV from S. aureus is described. Phasing by molecular replacement proved difficult owing to the presence of translational NCS and strategies used to overcome this are discussed. DNA topoisomerase IV removes undesirable topological features from DNA molecules in order to help maintain chromosome stability. Two constructs of 56 and 59 kDa spanning the DNA-cleavage domain of the A subunit of topoisomerase IV from Staphylococcus aureus (termed GrlA56 and GrlA59) have been crystallized. Crystals were grown at 291 K using the sitting-drop vapour-diffusion technique with PEG 3350 as a precipitant. Preliminary X-ray analysis revealed that GrlA56 crystals belong to space group P2 1 , diffract to a resolution of 2.9 Å and possess unit-cell parameters a = 83.6, b = 171.5, c = 87.8 Å, β = 90.1°, while crystals of GrlA59 belong to space group P2 1 2 1 2, with unit-cell parameters a = 41.5, b = 171.89, c = 87.9 Å. These crystals diffract to a resolution of 2.8 Å. This is the first report of the crystallization and preliminary X-ray analysis of the DNA-cleavage domain of a topoisomerase IV from a Gram-positive organism

  2. Effects of DNA Extraction Procedures on Bacteroides Profiles in Fecal Samples From Various Animals Determined by Terminal Restriction Fragment Length Polymorphism Analysis

    A major assumption in microbial source tracking is that some fecal bacteria are specific to a host animal, and thus provide unique microbial fingerprints that can be used to differentiate hosts. However, the DNA information obtained from a particular sample may be biased dependi...

  3. Analysis of endophytic bacterial communities of potato by plating and denaturing gradient gel electrophoresis (DGGE) of 16S rDNA based PCR fragments

    Garbeva, P.; Overbeek, van L.S.; Vuurde, van J.W.L.; Elsas, van J.D.

    2001-01-01

    The diversity of endophytic bacterial populations of potato (Solanum tuberosum cv Desiree) was assessed using a combination of dilution plating of plant macerates followed by isolation and characterization of isolates, and direct PCR-DGGE on the basis of DNA extracted from plants. The culturable

  4. PCR typing of DNA fragments of the two short tandem repeat (STR) systems upstream of the human myelin basic protein (MBP) gene in Danes and Greenland Eskimos

    Nellemann, L J; Frederiksen, J; Morling, N

    1996-01-01

    -A and MBP-B were analyzed by vertical electrophoresis in polyacrylamide gels followed by silver staining. DNA samples from 112 unrelated Danes, 140 unrelated Greenland Eskimos, and 88 Danish mother/child pairs were analyzed. The distributions of MBP phenotypes were in Hardy-Weinberg equilibrium in both...

  5. Circulating levels of chromatin fragments are inversely correlated with anti-dsDNA antibody levels in human and murine systemic lupus erythematosus

    Jørgensen, Mariann H; Rekvig, Ole Petter; Jacobsen, Rasmus S

    2011-01-01

    Anti-dsDNA antibodies represent a central pathogenic factor in Lupus nephritis. Together with nucleosomes they deposit as immune complexes in the mesangial matrix and along basement membranes within the glomeruli. The origin of the nucleosomes and when they appear e.g. in circulation is not known...

  6. Magnetic bead/capture DNA/glucose-loaded nanoliposomes for amplifying the glucometer signal in the rapid screening of hepatitis C virus RNA.

    Tu, Haijian; Lin, Kun; Lun, Yongzhi; Yu, Liuming

    2018-06-01

    A digital detection strategy based on a portable personal glucometer (PGM) was developed for the simple, rapid, and sensitive detection of hepatitis C virus (HCV) RNA, involving the release of glucose-loaded nanoliposomes due to coupling-site-specific cleavage by the endonuclease BamHI. The glucose-loaded nanoliposomes were synthesized using a reversed-phase evaporation method and provided an amplified signal at the PGM in the presence of HCV RNA. Initially, a 21-mer oligonucleotide complementary to HCV RNA was covalently conjugated to a magnetic bead through the amino group at the 5' end of the oligonucleotide, and then bound to a glucose-loaded liposome by typical carbodiimide coupling at its 3' end. In the presence of the target HCV RNA, the target hybridized with the oligonucleotide to form double-stranded DNA. The symmetrical duplex sequence 5'-GGATCC-3' between guanines was then catalytically cleaved by BamHI, which detached the glucose-loaded liposome from the magnetic bead. Following magnetic separation of the bead, the detached glucose-loaded liposome was lysed using Triton X-100 to release the glucose molecules within it, which were then detected as an amplified signal at the digital PGM. Under optimal conditions, the PGM signal increased with increasing HCV RNA, and displayed a strongly linear dependence on the level of HCV RNA for concentrations ranging from 10 pM to 1.0 μM. The detection limit (LOD) of the system was 1.9 pM. Good reproducibility and favorable specificity were achieved in the analysis of the target HCV RNA. Human serum samples containing HCV RNA were analyzed using this strategy, and the developed sensing platform was observed to yield satisfactory results based on a comparison with the corresponding results from a Cobas ® Amplicor HCV Test Analyzer. Graphical abstract A digital detection strategy utilizing a personal glucometer was developed for the detection of hepatitis C virus RNA. The strategy involved the use of the

  7. Framing Fragmentation

    Bundgaard, Charlotte

    2009-01-01

    Contemporary industrialized architecture based on advanced information technology and highly technological production processes, implies a radically different approach to architecture than what we have experienced in the past. Works of architecture composed of prefabricated building components......, contain distinctive architectural traits, not only based on rational repetition, but also supporting composition and montage as dynamic concepts. Prefab architecture is an architecture of fragmentation, individualization and changeability, and this sets up new challenges for the architect. This paper...... tries to develop a strategy for the architect dealing with industrially based architecture; a strategy which exploits architectural potentials in industrial building, which recognizes the rules of mass production and which redefines the architect’s position among the agents of building. If recent...

  8. Hepatitis C: Managing Pain

    ... Pain: Entire Lesson Viral Hepatitis Menu Menu Viral Hepatitis Viral Hepatitis Home For Veterans and the Public Veterans and the Public Home Hepatitis A Hepatitis B Hepatitis C Hepatitis C Home Getting ...

  9. Endometrial Polyps and Benign Endometrial Hyperplasia Present Increased Prevalence of DNA Fragmentation Factors 40 and 45 (DFF40 and DFF45) Together With the Antiapoptotic B-Cell Lymphoma (Bcl-2) Protein Compared With Normal Human Endometria.

    Banas, Tomasz; Pitynski, Kazimierz; Mikos, Marcin; Cielecka-Kuszyk, Joanna

    2017-09-13

    DNA fragmentation factor 40 (DFF40) is a key executor of apoptosis. It localizes to the nucleus together with DNA fragmentation factor 45 (DFF45), which acts as a DFF40 inhibitor and chaperone. B-cell lymphoma (Bcl-2) protein is a proven antiapoptotic factor present in the cytoplasm. In this study, we aimed to investigate DFF40, DFF45, and Bcl-2 immunoexpression in endometrial polyps (EPs) and benign endometrial hyperplasia (BEH) tissue compared with that in normal proliferative endometrium (NPE) and normal secretory endometrium (NSE) as well as normal post menopausal endometrium (NAE). This study used archived samples from 65 and 62 cases of EPs and BEH, respectively. The control group consisted of 52 NPE, 54 NSE, and 54 NAE specimens. Immunohistochemistry was used to detect DFF40, DFF45, and Bcl-2. DFF40, DFF45, and Bcl-2 were more highly expressed in the glandular layer of EPs and BEH compared with the stroma, and this was not influenced by menopausal status. Both glandular and stromal expression of DFF40, DFF45, and Bcl-2 were significantly higher in EPs compared with NPE, NSE, and NAE. Glandular BEH tissue showed significantly higher DFF40, DFF45, and Bcl-2 expression than in NPE, NSE, and NAE. No differences in the glandular expression of DFF40, DFF45, and Bcl-2 were observed between EP and BEH tissues, while Bcl-2 stromal expression in BEH was significantly lower than in EPs. Glandular, menopause-independent DFF40, DFF45, and Bcl-2 overexpression may play an important role in the pathogenesis of EPs and BEH.

  10. CtGEM typing: Discrimination of Chlamydia trachomatis ocular and urogenital strains and major evolutionary lineages by high resolution melting analysis of two amplified DNA fragments.

    Giffard, Philip M; Andersson, Patiyan; Wilson, Judith; Buckley, Cameron; Lilliebridge, Rachael; Harris, Tegan M; Kleinecke, Mariana; O'Grady, Kerry-Ann F; Huston, Wilhelmina M; Lambert, Stephen B; Whiley, David M; Holt, Deborah C

    2018-01-01

    Chlamydia trachomatis infects the urogenital tract (UGT) and eyes. Anatomical tropism is correlated with variation in the major outer membrane protein encoded by ompA. Strains possessing the ocular ompA variants A, B, Ba and C are typically found within the phylogenetically coherent "classical ocular lineage". However, variants B, Ba and C have also been found within three distinct strains in Australia, all associated with ocular disease in children and outside the classical ocular lineage. CtGEM genotyping is a method for detecting and discriminating ocular strains and also the major phylogenetic lineages. The rationale was facilitation of surveillance to inform responses to C. trachomatis detection in UGT specimens from young children. CtGEM typing is based on high resolution melting analysis (HRMA) of two PCR amplified fragments with high combinatorial resolving power, as defined by computerised comparison of 65 whole genomes. One fragment is from the hypothetical gene defined by Jali-1891 in the C. trachomatis B_Jali20 genome, while the other is from ompA. Twenty combinatorial CtGEM types have been shown to exist, and these encompass unique genotypes for all known ocular strains, and also delineate the TI and T2 major phylogenetic lineages, identify LGV strains and provide additional resolution beyond this. CtGEM typing and Sanger sequencing were compared with 42 C. trachomatis positive clinical specimens, and there were no disjunctions. CtGEM typing is a highly efficient method designed and tested using large scale comparative genomics. It divides C. trachomatis into clinically and biologically meaningful groups, and may have broad application in surveillance.

  11. Multicenter evaluation of a commercial multiplex polymerase chain reaction test for screening plasma donations for parvovirus B19 DNA and hepatitis A virus RNA.

    Koppelman, Marco H G M; Cuijpers, H Theo M; Wessberg, Susanna; Valkeajärvi, Anne; Pichl, Lutz; Schottstedt, Volkmar; Saldanha, John

    2012-07-01

    Three European laboratories evaluated the TaqScreen DPX test (DPX test), a multiplex nucleic acid test assay for the simultaneous detection and quantitation of parvovirus B19 (B19V) DNA and the detection of hepatitis A virus (HAV) RNA. The 95% limit of detection of the test for B19V and HAV was determined using the respective WHO International Standards. The reproducibility of the test was evaluated by testing replicate samples of B19V at log 4.0 and 40 IU/mL and HAV at 5 IU/mL. The accuracy of the DPX test for B19V was evaluated by replicate testing of B19V samples containing log 3.0, log 4.0, and log 5.0 IU/mL. Panels of B19V Genotypes 1, 2, and 3 and HAV genotypes were evaluated. Cross-contamination was evaluated. For comparison of the DPX test and the established tests, the sites tested plasma samples in pools of either 96 or 480 donations. The mean 95% lower limits of detection of the three laboratories for B19V and HAV were 20.30 and 1.85 IU/mL. The test showed good reproducibility with the major part of the variance of the test being attributed to intermediate assay variation. The test showed great accuracy for B19V, especially at log 4.0 IU/mL. Spiking of test pools of 480 donations and manufacturing pools with log 4.0 IU/mL B19 DNA and 4 IU/mL HAV RNA showed that the DPX assay was robust. The test was able to detect the three genotypes of B19V and HAV genotypes. No cross-contamination was seen. Test results of routine samples correlated well with those of the established tests. The DPX test is a robust and sensitive test for the detection of B19V and HAV in plasma samples. The quantitative B19V results obtained with the test are accurate, and the test is able to detect all the known genotypes of B19V and HAV and fulfills all the European Pharmacopoeia and Food and Drug Administration requirements for a B19V and HAV test for screening of plasma donations and samples from plasma pools for manufacture. © 2012 American Association of Blood Banks.

  12. Switching patients with lamivudine resistant chronic hepatitis B virus from tenofovir to adefovir results in less potent HBV-DNA suppression

    Leemans, W F; Janssen, H L A; Niesters, H G M; de Man, R A

    The nucleotide analogues, tenofovir disoproxil fumarate and adefovir dipivoxil, inhibit viral replication and are both effective against the hepatitis B virus (HBV). In our department, tenofovir was prescribed in addition to lamivudine for the treatment of lamivudine resistant chronic hepatitis B.

  13. Effect on HBs antigen clearance of addition of pegylated interferon alfa-2a to nucleos(t)ide analogue therapy versus nucleos(t)ide analogue therapy alone in patients with HBe antigen-negative chronic hepatitis B and sustained undetectable plasma hepatitis B virus DNA: a randomised, controlled, open-label trial.

    Bourlière, Marc; Rabiega, Pascaline; Ganne-Carrie, Nathalie; Serfaty, Lawrence; Marcellin, Patrick; Barthe, Yoann; Thabut, Dominique; Guyader, Dominique; Hezode, Christophe; Picon, Magali; Causse, Xavier; Leroy, Vincent; Bronowicki, Jean Pierre; Carrieri, Patrizia; Riachi, Ghassan; Rosa, Isabelle; Attali, Pierre; Molina, Jean Michel; Bacq, Yannick; Tran, Albert; Grangé, Jean Didier; Zoulim, Fabien; Fontaine, Hélène; Alric, Laurent; Bertucci, Inga; Bouvier-Alias, Magali; Carrat, Fabrice

    2017-03-01

    Findings from uncontrolled studies suggest that addition of pegylated interferon in patients with HBe antigen (HBeAg)-negative chronic hepatitis B receiving nucleos(t)ide analogues with undetectable plasma hepatitis B virus (HBV) DNA might increase HBs antigen (HBsAg) clearance. We aimed to assess this strategy. In this randomised, controlled, open-label trial, we enrolled patients aged 18-75 years with HBeAg-negative chronic hepatitis B and documented negative HBV DNA while on stable nucleos(t)ide analogue regimens for at least 1 year from 30 hepatology tertiary care wards in France. Patients had to have an alanine aminotransferase concentration of less than or equal to five times the upper normal range, no hepatocellular carcinoma, and a serum α fetoprotein concentration of less than 50 ng/mL, normal dilated fundus oculi examination, and a negative pregnancy test in women. Patients with contraindications to pegylated interferon were not eligible. A centralised randomisation used computer-generated lists of random permuted blocks of four with stratification by HBsAg titres (sida et les hépatites virales (France Recherche Nord&sud Sida-vih Hepatites). Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Effect of a pre-freezing treatment with cholesterol-loaded cyclodextrins on boar sperm longevity, capacitation dynamics, ability to adhere to porcine oviductal epithelial cells in vitro and DNA fragmentation dynamics.

    Tomás, C; Blanch, E; Fazeli, A; Mocé, E

    2013-01-01

    The aim of this work was to examine how a pre-freezing treatment with cholesterol-loaded cyclodextrins (CLC) affects boar sperm longevity, capacitation dynamics, ability to bind to a porcine telomerase-immortalised oviductal epithelial cell line (TERT-OPEC) in vitro and DNA integrity dynamics after freeze-thawing. Although the samples treated with CLC exhibited lower sperm quality than the control samples (P0.05) after long-term incubation (26h at 37 or 16°C). Additionally, the CLC-treated spermatozoa underwent similar capacitation and DNA fragmentation dynamics as the control spermatozoa (P>0.05). However, CLC-treated spermatozoa were better able to bind to TERT-OPEC in vitro (POPEC in vitro, which could have an effect on the establishment of the sperm reservoir in the ampullary--isthmic junction in vivo. Additionally, frozen-thawed spermatozoa can be stored at 16°C for at least 6h without a significant observable decline in sperm quality, which could be beneficial for the transport of thawed diluted doses of spermatozoa from the laboratory to the farm.

  15. DNA restriction fragment length polymorphism analysis of Mycobacterium tuberculosis isolates from HIV-seropositive and HIV-seronegative patients in Kampala, Uganda

    Katabazi Fred A

    2009-02-01

    Full Text Available Abstract Background The identification and differentiation of strains of Mycobacterium tuberculosis by DNA fingerprinting has provided a better understanding of the epidemiology and tracing the transmission of tuberculosis. We set out to determine if there was a relationship between the risk of belonging to a group of tuberculosis patients with identical mycobacterial DNA fingerprint patterns and the HIV sero-status of the individuals in a high TB incidence peri-urban setting of Kampala, Uganda. Methods One hundred eighty three isolates of Mycobacterium tuberculosis from 80 HIV seropositive and 103 HIV seronegative patients were fingerprinted by standard IS6110-RFLP. Using the BioNumerics software, strains were considered to be clustered if at least one other patient had an isolate with identical RFLP pattern. Results One hundred and eighteen different fingerprint patterns were obtained from the 183 isolates. There were 34 clusters containing 54% (99/183 of the patients (average cluster size of 2.9, and a majority (96.2% of the strains possessed a high copy number (≥ 5 copies of the IS6110 element. When strains with P = 0.615, patients aged P = 0.100, and sex (aOR 1.12, 95%CI 0.60–2.06, P = 0.715. Conclusion The sample showed evidence of a high prevalence of recent transmission with a high average cluster size, but infection with an isolate with a fingerprint found to be part of a cluster was not associated with any demographic or clinical characteristics, including HIV status.

  16. Hepatic Encephalopathy

    Full Text Available ... friend, spouse, life partner, parent, sibling or other family member. What is HE? Hepatic Encephalopathy, sometimes referred ... disease is. It’s important for you and your family to become familiar with the signs of Hepatic ...

  17. Hepatic Encephalopathy

    Full Text Available ... Your Story Spread the Word Give While You Shop Contact Us Donate Now Hepatic Encephalopathy Back Hepatic ... Your Story Spread the Word Give While You Shop Contact Us Donate Now Help ALF Improve This ...

  18. Hepatic Encephalopathy

    Full Text Available ... Now Hepatic Encephalopathy Back Hepatic Encephalopathy is a brain disorder that develops in some individuals with liver ... is a condition that causes temporary worsening of brain function in people with advanced liver disease. When ...

  19. 利用 DDRT-PCR 鉴定芸芥自交不亲和系与自交亲和系的差异表达 cDNA%Identification of cDNA Fragments in Self-incompatible and Self-compatible Lines of Eruca sativa Mill.by DDRT-PCR

    范惠玲; 白生文; 李华清; 孙万仓

    2016-01-01

    Yunjie is closely related to important vegetables an d oil seed crops,and can be considered a genetic resource for all Brassiceae crops.Self compatibility is an important variant traits to Yunjie.This study aimed to probe the expression organ of self-compatible gene and isolate cDNA fragments related to self-compatibility of Yunjie. Leaf,anther and stigma from self-incompatible (SI)and self-compatible (SC)lines of Yunjie were examined by DDRT-PCR.The results showed that the amplification pattern of leaves and anthers were the same in SI and SC lines.However,different bands were obtained in stigmas of SI and SC lines before and after flowering.SC gene of E. sativa was not showing constitutive expression but showed tissue-specific expression in stigma.Only two fragments were amplified in SC lines before flowering,the one was less than 100 bp,the other was 750 -1 000 bp.A 300 bp fragment was found unique to self-compatible line after flowering.These three cDNA fragments might be closely re-lated to the self-compatibility in Yunjie.In addition,two cDNA fragments were generated in SI line before flowering, one was 500 bp,the other was 750 bp.One band of 500 -600 bp was identified in SI line after flowering.These cDNA fragments could efficiently distinguish self-compatible and self-incompatible lines,and could also be useful for cloning self-compatible gene of Yunjie.%芸芥与芸薹属植物具有亲缘关系,也是芸薹属植物的重要育种资源。自交亲和性是芸芥的一种重要变异性状。为了探明芸芥自交亲和基因的表达器官,并分离与自交亲和性有关的 cDNA 片段,以芸芥的一对近等基因系,自交亲和系(SC)与自交不亲和系(SI)为试材,利用差异显示 RT-PCR 技术分别对开花前和开花后的叶片、花药和柱头进行鉴定。结果表明,不论开花前还是开花后,芸芥自交亲和系与自交不亲和系的叶片或花药间的扩增带型是一样的,但在

  20. Alcohol and Hepatitis

    ... Home » Living with Hepatitis » Daily Living: Alcohol Viral Hepatitis Menu Menu Viral Hepatitis Viral Hepatitis Home For ... heavy drinking, most heavy drinkers have developed cirrhosis. Hepatitis C and cirrhosis In general, someone with hepatitis ...

  1. Hepatitis C: Treatment

    ... Public Home » Hepatitis C » Hepatitis C Treatment Viral Hepatitis Menu Menu Viral Hepatitis Viral Hepatitis Home For ... Enter ZIP code here Enter ZIP code here Hepatitis C Treatment for Veterans and the Public Treatment ...

  2. Clinical and virological improvement of hepatitis B virus-related or hepatitis C virus-related chronic hepatitis with concomitant hepatitis A virus infection.

    Sagnelli, Evangelista; Coppola, Nicola; Pisaturo, Mariantonietta; Pisapia, Raffaella; Onofrio, Mirella; Sagnelli, Caterina; Catuogno, Antonio; Scolastico, Carlo; Piccinino, Felice; Filippini, Pietro

    2006-06-01

    We evaluated the clinical and virological characteristics of hepatitis A virus infection in persons concomitantly infected with hepatitis B virus (HBV) or hepatitis C virus (HCV). We enrolled 21 patients with acute hepatitis A and chronic hepatitis with no sign of liver cirrhosis, 13 patients who were positive for hepatitis B surface antigen (case B group), 8 patients who were anti-HCV positive (case C group), and 21 patients with acute hepatitis A without a preexisting liver disease (control A group). Two control groups of patients with chronic hepatitis B (control B group) or C (control C group) were also chosen. All control groups were pair-matched by age and sex with the corresponding case group. Fulminant hepatitis A was never observed, and hepatitis A had a severe course in 1 patient in the case B group and in 1 patient in the control A group. Both patients recovered. On admission, HBV DNA was detected in 1 patient in the case B group (7.7%) and in 13 patients (50%) in the control B group; HCV RNA was found in no patient in the case C group and in 16 patients (81.2%) in the control C group. Of 9 patients in the case B group who were followed up for 6 months, 3 became negative for hepatitis B surface antigen and positive for hepatitis B surface antibody, 2 remained positive for hepatitis B surface antigen and negative for HBV DNA, and 4 became positive for HBV DNA with a low viral load [corrected] Of 6 patients in the case C group who were followed up for 6 months, 3 remained negative for HCV RNA, and 3 had persistently low viral loads. Concomitant hepatitis A was always self-limited, associated with a marked inhibition of HBV and HCV genomes, and possibly had a good prognosis for the underlying chronic hepatitis.

  3. Molecular phylogeny and systematics of the banana family (Musaceae) inferred from multiple nuclear and chloroplast DNA fragments, with a special reference to the genus Musa.

    Li, Lin-Feng; Häkkinen, Markku; Yuan, Yong-Ming; Hao, Gang; Ge, Xue-Jun

    2010-10-01

    Musaceae is a small paleotropical family. Three genera have been recognised within this family although the generic delimitations remain controversial. Most species of the family (around 65 species) have been placed under the genus Musa and its infrageneric classification has long been disputed. In this study, we obtained nuclear ribosomal ITS and chloroplast (atpB-rbcL, rps16, and trnL-F) DNA sequences of 36 species (42 accessions of ingroups representing three genera) together with 10 accessions of ingroups retrieved from GenBank database and 4 accessions of outgroups, to construct the phylogeny of the family, with a special reference to the infrageneric classification of the genus Musa. Our phylogenetic analyses elaborated previous results in supporting the monophyly of the family and suggested that Musella and Ensete may be congeneric or at least closely related, but refuted the previous infrageneric classification of Musa. None of the five sections of Musa previously defined based on morphology was recovered as monophyletic group in the molecular phylogeny. Two infrageneric clades were identified, which corresponded well to the basic chromosome numbers of x=11 and 10/9/7, respectively: the former clade comprises species from the sections Musa and Rhodochlamys while the latter contains sections of Callimusa, Australimusa, and Ingentimusa. Copyright 2010 Elsevier Inc. All rights reserved.

  4. High Aneuploidy Rates Observed in Embryos Derived from Donated Oocytes are Related to Male Aging and High Percentages of Sperm DNA Fragmentation

    Javier García-Ferreyra

    2015-01-01

    Full Text Available Capsule Male aging effects on aneuploidy rates in embryos. Objective Paternal age is associated with decreasing sperm quality; however, it is unknown if it influences chromosomal abnormalities in embryos. The objective of this study is to evaluate if the aneuploidy rates in embryos are affected by advanced paternal age. Methods A total of 286 embryos, obtained from 32 in vitro fertilization/intracytoplasmic sperm injection cycles with donated oocytes in conjunction with preimplantation genetic diagnosis, were allocated according to paternal age in three groups: Group A: ≤39 years (n = 44 embryos; Group B: 40-49 years (n = 154 embryos; and Group C: ≥50 years (n = 88 embryos. Fertilization rates, embryo quality at day 3, blastocyst development, and aneuploidy embryo rates were then compared. Results There was no difference in the seminal parameters (volume, concentration, and motility in the studied groups. Fertilization rate, percentages of zygotes underwent cleavage, and good quality embryos on day 3 were similar between the three evaluated groups. The group of men ≥50 years had significantly more sperm with damaged DNA, low blastocyst development rate, and higher aneuploidy rates in embryos compared to the other two evaluated groups ( P 50 years old.

  5. Hepatitis C

    ... an inflammation of the liver. One type, hepatitis C, is caused by the hepatitis C virus (HCV). It usually spreads through contact with ... childbirth. Most people who are infected with hepatitis C don't have any symptoms for years. If ...

  6. Hepatic Encephalopathy

    Full Text Available ... Caregiver Support Caregiver Stories Home › What is Hepatic Encephalopathy? Why Your Liver is Important The Connection Between HE and Liver ... Why it’s Important to Treat HE Symptoms of Liver Failure Glossary of terms ... is Hepatic Encephalopathy? Hepatic Encephalopathy, sometimes referred to as portosystemic encephalopathy ...

  7. Hepatic Encephalopathy

    ... Caregiver Support Caregiver Stories Home › What is Hepatic Encephalopathy? Why Your Liver is Important The Connection Between HE and Liver ... Why it’s Important to Treat HE Symptoms of Liver Failure Glossary of terms ... is Hepatic Encephalopathy? Hepatic Encephalopathy, sometimes referred to as portosystemic encephalopathy ...

  8. Hepatitis A

    ... is an inflammation of the liver. One type, hepatitis A, is caused by the hepatitis A virus (HAV). The disease spreads through contact with ... suggest medicines to help relieve your symptoms. The hepatitis A vaccine can prevent HAV. Good hygiene can also ...

  9. Diphtheria toxin- and Pseudomonas A toxin-mediated apoptosis. ADP ribosylation of elongation factor-2 is required for DNA fragmentation and cell lysis and synergy with tumor necrosis factor-alpha.

    Morimoto, H; Bonavida, B

    1992-09-15

    We have reported that diphtheria toxin (DTX) mediates target cell lysis and intranucleosomal DNA fragmentation (apoptosis) and also synergizes with TNF-alpha. In this paper, we examined which step in the pathway of DTX-mediated inhibition of protein synthesis was important for induction of cytolytic activity and for synergy. Using a DTX-sensitive tumor cell line, we first examined the activity of the mutant CRM 197, which does not catalyze the ADP ribosylation of elongation factor-2 (EF-2). CRM 197 was not cytolytic for target cells and did not mediate intranucleosomal DNA fragmentation of viable cells. The failure of CRM 197 to mediate target cell lysis suggested that the catalytic activity of DTX is prerequisite for target cell lysis. This was corroborated by demonstrating that MeSAdo, which blocks the biosynthesis of diphthamide, inhibited DTX-mediated protein synthesis inhibition and also blocked target cell lysis. Furthermore, the addition of nicotinamide, which competes with NAD+ on the DTX action site of EF-2, also blocked DTX-mediated lysis. These findings suggest that ADP-ribosylation of EF-2 may be a necessary step in the pathway leading to target cell lysis. In contrast to the sensitive line, the SKOV-3 tumor cell line is sensitive to protein synthesis inhibition by DTX but is not susceptible to cytolysis and apoptosis by DTX. Thus, protein synthesis inhibition by DTX is not sufficient to mediate target cell lysis. The synergy in cytotoxicity obtained with the combination of DTX and TNF-alpha was examined in order to determine the pathway mediated by DTX in synergy. Like the direct lysis by DTX, synergy was significantly reduced by MeSAdo and by nicotinamide. Furthermore, synergy was not observed with combination of CRM 197 and TNF-alpha. These results demonstrate that, in synergy, DTX may utilize the same pathway required for its cytolytic activity. Pseudomonas aeruginosa exotoxin shared most the properties shown for DTX. Altogether, these findings

  10. Hypoksisk hepatitis

    Amadid, Hanan; Schiødt, Frank Vinholt

    2014-01-01

    Hypoxic hepatitis (HH), also known as ischaemic hepatitis or shock liver, is an acute liver injury caused by hepatic hypoxia. Cardiac failure, respiratory failure and septic shock are the main underlying conditions. In each of these conditions, several haemodynamic mechanisms lead to hepatic...... hypoxia. A shock state is observed in only 50% of cases. Thus, shock liver and ischaemic hepatitis are misnomers. HH can be a diagnostic pitfall but the diagnosis can be established when three criteria are met. Prognosis is poor and prompt identification and treatment of the underlying conditions...

  11. Novel infectious cDNA clones of hepatitis C virus genotype 3a (strain S52) and 4a (strain ED43): genetic analyses and in vivo pathogenesis studies

    Gottwein, Judith; Scheel, Troels; Callendret, Benoit

    2010-01-01

    Previously, RNA transcripts of cDNA clones of hepatitis C virus (HCV) genotypes 1a (strains H77, HCV-1, and HC-TN), 1b (HC-J4, Con1, and HCV-N), and 2a (HC-J6 and JFH1) were found to be infectious in chimpanzees. However, only JFH1 was infectious in human hepatoma Huh7 cells. We performed genetic...... analysis of HCV genotype 3a (strain S52) and 4a (strain ED43) prototype strains and generated full-length consensus cDNA clones (pS52 and pED43). Transfection of Huh7.5 cells with RNA transcripts of these clones did not yield cells expressing HCV Core. However, intrahepatic transfection of chimpanzees...... resulted in robust infection with peak HCV RNA titers of approximately 5.5 log(10) international units (IU)/ml. Genomic consensus sequences recovered from serum at the times of peak viral titers were identical to the sequences of the parental plasmids. Both chimpanzees developed acute hepatitis...

  12. Cationic lipid-formulated DNA vaccine against hepatitis B virus: immunogenicity of MIDGE-Th1 vectors encoding small and large surface antigen in comparison to a licensed protein vaccine.

    Anne Endmann

    Full Text Available Currently marketed vaccines against hepatitis B virus (HBV based on the small (S hepatitis B surface antigen (HBsAg fail to induce a protective immune response in about 10% of vaccinees. DNA vaccination and the inclusion of PreS1 and PreS2 domains of HBsAg have been reported to represent feasible strategies to improve the efficacy of HBV vaccines. Here, we evaluated the immunogenicity of SAINT-18-formulated MIDGE-Th1 vectors encoding the S or the large (L protein of HBsAg in mice and pigs. In both animal models, vectors encoding the secretion-competent S protein induced stronger humoral responses than vectors encoding the L protein, which was shown to be retained mainly intracellularly despite the presence of a heterologous secretion signal. In pigs, SAINT-18-formulated MIDGE-Th1 vectors encoding the S protein elicited an immune response of the same magnitude as the licensed protein vaccine Engerix-B, with S protein-specific antibody levels significantly higher than those considered protective in humans, and lasting for at least six months after the third immunization. Thus, our results provide not only the proof of concept for the SAINT-18-formulated MIDGE-Th1 vector approach but also confirm that with a cationic-lipid formulation, a DNA vaccine at a relatively low dose can elicit an immune response similar to a human dose of an aluminum hydroxide-adjuvanted protein vaccine in large animals.

  13. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  14. Crystal structure of an Okazaki fragment at 2-A resolution

    Egli, M.; Usman, N.; Zhang, S. G.; Rich, A.

    1992-01-01

    In DNA replication, Okazaki fragments are formed as double-stranded intermediates during synthesis of the lagging strand. They are composed of the growing DNA strand primed by RNA and the template strand. The DNA oligonucleotide d(GGGTATACGC) and the chimeric RNA-DNA oligonucleotide r(GCG)d(TATACCC) were combined to form a synthetic Okazaki fragment and its three-dimensional structure was determined by x-ray crystallography. The fragment adopts an overall A-type conformation with 11 residues per turn. Although the base-pair geometry, particularly in the central TATA part, is distorted, there is no evidence for a transition from the A- to the B-type conformation at the junction between RNA.DNA hybrid and DNA duplex. The RNA trimer may, therefore, lock the complete fragment in an A-type conformation.

  15. Hepatitis A through E (Viral Hepatitis)

    ... Treatment Eating, Diet, & Nutrition Clinical Trials Wilson Disease Hepatitis (Viral) View or Print All Sections What is Viral Hepatitis? Viral hepatitis is an infection that causes liver inflammation ...

  16. Telomere Restriction Fragment (TRF) Analysis.

    Mender, Ilgen; Shay, Jerry W

    2015-11-20

    While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of

  17. Hepatitis Vaccines

    Sina Ogholikhan

    2016-03-01

    Full Text Available Viral hepatitis is a serious health problem all over the world. However, the reduction of the morbidity and mortality due to vaccinations against hepatitis A and hepatitis B has been a major component in the overall reduction in vaccine preventable diseases. We will discuss the epidemiology, vaccine development, and post-vaccination effects of the hepatitis A and B virus. In addition, we discuss attempts to provide hepatitis D vaccine for the 350 million individuals infected with hepatitis B globally. Given the lack of a hepatitis C vaccine, the many challenges facing the production of a hepatitis C vaccine will be shown, along with current and former vaccination trials. As there is no current FDA-approved hepatitis E vaccine, we will present vaccination data that is available in the rest of the world. Finally, we will discuss the existing challenges and questions facing future endeavors for each of the hepatitis viruses, with efforts continuing to focus on dramatically reducing the morbidity and mortality associated with these serious infections of the liver.

  18. Hepatitis Vaccines

    Ogholikhan, Sina; Schwarz, Kathleen B.

    2016-01-01

    Viral hepatitis is a serious health problem all over the world. However, the reduction of the morbidity and mortality due to vaccinations against hepatitis A and hepatitis B has been a major component in the overall reduction in vaccine preventable diseases. We will discuss the epidemiology, vaccine development, and post-vaccination effects of the hepatitis A and B virus. In addition, we discuss attempts to provide hepatitis D vaccine for the 350 million individuals infected with hepatitis B globally. Given the lack of a hepatitis C vaccine, the many challenges facing the production of a hepatitis C vaccine will be shown, along with current and former vaccination trials. As there is no current FDA-approved hepatitis E vaccine, we will present vaccination data that is available in the rest of the world. Finally, we will discuss the existing challenges and questions facing future endeavors for each of the hepatitis viruses, with efforts continuing to focus on dramatically reducing the morbidity and mortality associated with these serious infections of the liver. PMID:26978406

  19. Parvovirus B19 associated acute cholestatic hepatitis

    S. Perrini

    2014-12-01

    Full Text Available There are few reports in the literature of hepatitis as a manifestation of Parvovirus B19 infection. We describe a case of Parvovirus B19 associated acute cholestatic hepatitis diagnosed based on a positive serologic test (IgM and molecular detection of parvovirus B19 DNA in peripheral blood. Parvovirus B19 infection should be considered in the differential diagnosis of patient presenting with acute hepatitis of unknown etiology.

  20. Genetic mutation analysis of HBV covalently closed circular DNA in peripheral blood mononuclear cells from chronic hepatitis B patients with nucleos(tide analog-resistant mutations in serum virions

    Zhong-bin LI

    2012-06-01

    Full Text Available Objective  To analyze the characteristics of genetic mutations in reverse-transcriptase (RT domain of HBV covalently closed circular DNA (cccDNA in peripheral blood mononuclear cells (PBMCs obtained from chronic hepatitis B (CHB patients with drug-resistant mutations in serum virions during nucleoside/nucleotide analog (NA therapy. Methods  A total of 30 CHB patients admitted to 302 Hospital of PLA from July 2010 to August 2011 were included in this study. All the patients were confirmed to harbor the drug-resistant mutations in serum virions during an NA therapy longer than 6 months. Total DNA was extracted from PBMCs isolated from 30 whole blood samples at the same time point as that of serum analysis. Plasmid-safe ATP-dependent DNase (PSAD digestion in combination with rolling circle amplification and gap-spanning semi-nested PCR were used to amplify the RT region of HBV cccDNA. NA-resistant-associated mutations were analyzed at nine sites. Results  HBV cccDNA was efficiently amplified in 16 out of 30 (53.3% PBMC samples, and the detection rate was not correlated with HBeAg-positive rate, serum ALT level or HBV DNA load. Five of 16 (31.3% patients were sustained to have genotype B HBV infection, and 11 of 16 (68.8% were of genotype C HBV infection, and the result was consistent with the genotyping results using serum HBV. Different from drug-resistant mutations detected in the serum virions, the viruses detected in HBV cccDNA of 16 PBMC samples were all wild-type viruses without NA-resistant-associated mutations in RT region. Conclusions  During NA antiviral treatment, if drug-resistant mutations occur in serum HBV DNA of CHB patients, the dominant species of HBV cccDNA in PBMCs from the same patient is still the original wild-type strains. It is speculated that PBMCs might be the potential "repository" of HBV wild-type strain in vivo.

  1. Fragman: an R package for fragment analysis.

    Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan

    2016-04-21

    Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.

  2. Feature Hepatitis: Hepatitis Can Strike Anyone

    ... Navigation Bar Home Current Issue Past Issues Feature Hepatitis Hepatitis Can Strike Anyone Past Issues / Spring 2009 Table ... from all walks of life are affected by hepatitis, especially hepatitis C, the most common form of ...

  3. Bone fragments a body can make

    Stout, S.D.; Ross, L.M. Jr. (Department of Anthropology, University of Missouri, Columbia (USA))

    1991-05-01

    Data obtained from various analytical techniques applied to a number of small bone fragments recovered from a crime scene were used to provide evidence for the occurrence of a fatality. Microscopic and histomorphometric analyses confirmed that the fragments were from a human skull. X-ray microanalysis of darkened areas on the bone fragments revealed a chemical signature that matched the chemical signature of a shotgun pellet recovered at the scene of the crime. The above findings supported the deoxyribonucleic acid (DNA) fingerprint evidence which, along with other evidence, was used to convict a man for the murder of his wife, even though her body was never recovered.

  4. Hepatic Encephalopathy

    Full Text Available ... Plan Long-Term Considerations Patient Support Finding Support Services Peer Support Groups Financial Assistance Support for My ... is Hepatic Encephalopathy? Why Your Liver is ...

  5. Travelers' Health: Hepatitis C

    ... Chapter 3 - Hepatitis B Chapter 3 - Hepatitis E Hepatitis C Deborah Holtzman INFECTIOUS AGENT Hepatitis C virus ( ... mother to child. Map 3-05. Prevalence of hepatitis C virus infection 1 PDF Version (printable) 1 ...

  6. Travelers' Health: Hepatitis A

    ... 3 - Helminths, Soil-Transmitted Chapter 3 - Hepatitis B Hepatitis A Noele P. Nelson INFECTIOUS AGENT Hepatitis A ... hepatitis/HAV Table 3-02. Vaccines to prevent hepatitis A VACCINE TRADE NAME (MANUFACTURER) AGE (Y) DOSE ...

  7. Hepatitis (For Parents)

    ... Staying Safe Videos for Educators Search English Español Hepatitis KidsHealth / For Parents / Hepatitis Print en español Hepatitis What Is Hepatitis? Hepatitis is an inflammation of the liver. The ...

  8. Travelers' Health: Hepatitis B

    ... Chapter 3 - Hepatitis A Chapter 3 - Hepatitis C Hepatitis B Francisco Averhoff INFECTIOUS AGENT Hepatitis B virus ( ... progression of disease. Map 3-04. Prevalence of hepatitis B virus infection 1 PDF Version (printable) 1 ...

  9. Hepatitis C: Clinical Trials

    ... and Public Home » Hepatitis C » Treatment Decisions Viral Hepatitis Menu Menu Viral Hepatitis Viral Hepatitis Home For ... can I find out about participating in a hepatitis C clinical trial? Many trials are being conducted ...

  10. Hepatitis C: Mental Health

    ... the Public Home Hepatitis A Hepatitis B Hepatitis C Hepatitis C Home Getting Tested Just Diagnosed Treatment Choice Program ... Pain Mental Health Sex and Sexuality (for Hepatitis C) Success Stories FAQs For Health Care Providers Provider ...

  11. Complementary DNA-amplified fragment length polymorphism ...

    owner

    2011-05-09

    May 9, 2011 ... development, 3 ESTs may play a role in energy production and photosynthesis, 2 ESTs are related to ... Environmental stress always affects plant growth, leading to changes in .... electrophoresis and the trend of expression changes in differential ..... nical strength, can affect cell growth rate, transportation.

  12. Alcoholic Hepatitis

    ... yellow color. Confusion, drowsiness and slurred speech (hepatic encephalopathy). A damaged liver has trouble removing toxins from your body. The ... of toxins can damage your brain. Severe hepatic encephalopathy can result in ... of the liver frequently leads to liver failure. Kidney failure. A ...

  13. Protective effect of Mangifera indica L. extract (Vimang) on the injury associated with hepatic ischaemia reperfusion.

    Sánchez, Gregorio Martínez; Rodríguez H, María A; Giuliani, Attilia; Núñez Sellés, Alberto J; Rodríguez, Niurka Pons; León Fernández, Olga Sonia; Re, L

    2003-03-01

    The effect of Mangifera indica L. extract (Vimang) on treatment of injury associated with hepatic ischaemia/reperfusion was tested. Vimang protects from the oxidative damage induced by oxygen-based free radicals as shown in several in vitro test systems conducted. The ability of Vimang to reduce liver damage was investigated in rats undergoing right-lobe blood fl ow occlusion for 45 min followed by 45 min of reperfusion. The ischaemia/reperfusion model leads to an increase of transaminase (ALT and AST), membrane lipid peroxidation, tissue neutrophil in filtration, DNA fragmentation, loss of protein -SH groups, cytosolic Ca2+ overload and a decrease of catalase activity. Oral administration of Vimang (50, 110 and 250 mg/kg, b.w.) 7 days before reperfusion, reduced transaminase levels and DNA fragmentation in a dose dependent manner (p Vimang also restored the cytosolic Ca2+ levels and inhibited polymorphonuclear migration at a dose of 250 mg/kg b.w., improved the oxidation of total and non protein sulfhydryl groups and prevented modification in catalase activity, uric acid and lipid peroxidation markers (p Vimang could be a useful new natural drug for preventing oxidative damage during hepatic injury associated with free radical generation. Copyright 2003 John Wiley & Sons, Ltd.

  14. Universal elements of fragmentation

    Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

    2010-01-01

    A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

  15. Scar-less multi-part DNA assembly design automation

    Hillson, Nathan J.

    2016-06-07

    The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.

  16. Polymorphisms of CCL3L1/CCR5 genes and recurrence of hepatitis B in liver transplant recipients.

    Li, Hong; Xie, Hai-Yang; Zhou, Lin; Wang, Wei-Lin; Liang, Ting-Bo; Zhang, Min; Zheng, Shu-Sen

    2011-12-01

    The genetic diversity of chemokines and chemokine receptors has been associated with the outcome of hepatitis B virus infection. The aim of this study was to evaluate whether the copy number variation in the CCL3L1 gene and the polymorphisms of CCR5Δ32 and CCR5-2459A→G (rs1799987) are associated with recurrent hepatitis B in liver transplantation for hepatitis B virus infection-related end-stage liver disease. A total of 185 transplant recipients were enrolled in this study. The genomic DNA was extracted from whole blood, the copy number of the CCL3L1 gene was determined by a quantitative real-time PCR based assay, CCR5Δ32 was detected by a sizing PCR method, and a single-nucleotide polymorphism in CCR5-2459 was detected by restriction fragment length polymorphism PCR. No CCR5Δ32 mutation was detected in any of the individuals from China. Neither copy number variation nor polymorphism in CCR5-2459 was associated with post-transplant re-infection with hepatitis B virus. However, patients with fewer copies (CCR5 genes might be more likely to have recurrence of hepatitis B after transplantation.

  17. Melatonin mitigates thioacetamide-induced hepatic fibrosis via antioxidant activity and modulation of proinflammatory cytokines and fibrogenic genes.

    Lebda, Mohamed A; Sadek, Kadry M; Abouzed, Tarek K; Tohamy, Hossam G; El-Sayed, Yasser S

    2018-01-01

    The potential antifibrotic effects of melatonin against induced hepatic fibrosis were explored. Rats were allocated into four groups: placebo; thioacetamide (TAA) (200mg/kg bwt, i.p twice weekly for two months); melatonin (5mg/kgbwt, i.p daily for a week before TAA and continued for an additional two months); and melatonin plus TAA. Hepatic fibrotic changes were evaluated biochemically and histopathologically. Hepatic oxidative/antioxidative indices were assessed. The expression of hepatic proinflammatory cytokines (tumor necrosis factor-α, and interleukin-1β), fibrogenic-related genes (transforming growth factor-1β, collagen I, collagen, III, laminin, and autotaxin) and an antioxidant-related gene (thioredoxin-1) were detected by qRT-PCR. In fibrotic rats, melatonin lowered serum aspartate aminotransferase, alanine aminotransferase, and autotaxin activities, bilirubin, hepatic hydroxyproline and plasma ammonia levels. Melatonin displayed hepatoprotective and antifibrotic potential as indicated by mild hydropic degeneration of some hepatocytes and mild fibroplasia. In addition, TAA induced the depletion of glutathione, glutathione s-transferase, glutathione peroxidase, superoxide dismutase, catalase, and paraoxonase-1 (PON-1), while inducing the accumulation of malondialdehyde, protein carbonyl (C=O) and nitric oxide (NO), and DNA fragmentation. These effects were restored by melatonin pretreatment. Furthermore, melatonin markedly attenuated the expression of proinflammatory cytokines and fibrogenic genes via the upregulation of thioredoxin-1 mRNA transcripts. Melatonin exhibits potent anti-inflammatory, antioxidant and fibrosuppressive activities against TAA-induced hepatic fibrogenesis via the suppression of oxidative stress, DNA damage, proinflammatory cytokines and fibrogenic gene transcripts. In addition, we demonstrate that the antifibrotic activity of melatonin is mediated by the induction of thioredoxin-1 with attenuation of autotaxin expressions

  18. Expression of hepatitis C virus envelope protein 2 induces apoptosis in cultured mammalian cells

    Li-Xin Zhu; Jing Liu; You-Hua Xie; Yu-Ying Kong; Ye Ye; Chun-Lin Wang; Guang-Di Li; Yuan Wang

    2004-01-01

    AIM: To explore the role of hepatitis C virus (HCV) envelope protein 2 (E2) in the induction of apoptosis.METHODS: A carboxyterminal truncated E2 (E2-661) was transiently expressed in several cultured mammalian cell lines or stably expressed in Chinese hamster ovary (CHO)cell line. Cell proliferation was assessed by 3H thymidine uptake. Apoptosis was examined by Hoechst 33258staining, flow cytometry and DNA fragmentation analysis.RESULTS: Reduced proliferation was readily observed in the E2-661 expressing cells. These cells manifested the typical features of apoptosis, including cell shrinkage,chromatin condensation and hypodiploid genomic DNA content. Similar apoptotic cell death was observed in an E2-661 stably expressing cell line.CONCLUSION: HCV E2 can induce apoptosis in cultured mammalian cells.

  19. Quantitation of hepatitis B virus DNA in plasma using a sensitive cost-effective "in-house" real-time PCR assay

    Daniel Hubert Darius

    2009-01-01

    Full Text Available Background: Sensitive nucleic acid testing for the detection and accurate quantitation of hepatitis B virus (HBV is necessary to reduce transmission through blood and blood products and for monitoring patients on antiviral therapy. The aim of this study is to standardize an "in-house" real-time HBV polymerase chain reaction (PCR for accurate quantitation and screening of HBV. Materials and Methods: The "in-house" real-time assay was compared with a commercial assay using 30 chronically infected individuals and 70 blood donors who are negative for hepatitis B surface antigen, hepatitis C virus (HCV antibody and human immunodeficiency virus (HIV antibody. Further, 30 HBV-genotyped samples were tested to evaluate the "in-house" assay′s capacity to detect genotypes prevalent among individuals attending this tertiary care hospital. Results: The lower limit of detection of this "in-house" HBV real-time PCR was assessed against the WHO international standard and found to be 50 IU/mL. The interassay and intra-assay coefficient of variation (CV of this "in-house" assay ranged from 1.4% to 9.4% and 0.0% to 2.3%, respectively. Virus loads as estimated with this "in-house" HBV real-time assay correlated well with the commercial artus HBV RG PCR assay ( r = 0.95, P < 0.0001. Conclusion: This assay can be used for the detection and accurate quantitation of HBV viral loads in plasma samples. This assay can be employed for the screening of blood donations and can potentially be adapted to a multiplex format for simultaneous detection of HBV, HIV and HCV to reduce the cost of testing in blood banks.

  20. Universality of fragment shapes.

    Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea

    2015-03-16

    The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.

  1. Hepatic Encephalopathy

    Full Text Available ... to continue to work to my full capacity? Will I be able to drive? Patient Stories Angie M. Caregiver for Brother Charles DiAngelo Hepatic Encephalopathy Jason Dedmon Alcohol-related Cirrhosis ...

  2. Hepatic Encephalopathy

    Full Text Available ... your body when your liver isn’t working well, it may affect your brain and cause HE. ... it apparent that the liver is not doing well. These could be the symptoms of Hepatic Encephalopathy ( ...

  3. Hepatic Encephalopathy

    Full Text Available ... bad. It sends the good things – such as vitamins and nutrients – into your bloodstream for your body ... for Wife Joyce O. Caregiver for Mother Lynette K. Hepatic Encephalopathy Samantha W. Caregiver for Husband Stan ...

  4. Hepatic Encephalopathy

    Full Text Available ... Get Worse? How is HE Diagnosed? Prior to Treatment Who treats HE? Preparing for your Medical Appointment Hepatic Encephalopathy Treatment Options Treatment Basics Treatment Medications Importance of Adhering ...

  5. Hepatic Encephalopathy

    Full Text Available ... become familiar with the signs of Hepatic Encephalopathy so you can tell your doctor right away if ... with continuous treatment, HE can usually be controlled. So it’s important to tell your doctor about any ...

  6. Hepatic Encephalopathy

    Full Text Available ... build-up and painful swelling of the legs (edema) and abdomen (ascites) or hepatic encephalopathy. For more ... build up and painful swelling of the legs (edema) and abdomen (ascites) Bruising and bleeding easily Enlarged ...

  7. Hepatic Encephalopathy

    Full Text Available ... to Treatment Who treats HE? Preparing for your Medical Appointment Hepatic Encephalopathy Treatment Options Treatment Basics Treatment ... treatment. Being a fully-informed participant in your medical care is an important factor in staying as ...

  8. Hepatic Encephalopathy

    Full Text Available ... Hepatic Encephalopathy so you can tell your doctor right away if you think you may have it. ... American Liver Foundation © 2018 American Liver Foundation. All rights reserved. Funding for the HE123 - Diagnosis, Treatment and ...

  9. Hepatic Encephalopathy

    Full Text Available ... important for you and your family to become familiar with the signs of Hepatic Encephalopathy so you ... team evaluates the person’s overall physical and mental health, plan to pay for transplant related medical expenses, ...

  10. Hepatic Encephalopathy

    Full Text Available ... Symptoms to look for Caregiver Support Caregiver Stories Home › What is Hepatic Encephalopathy? Why Your Liver is ... questions about HE, one step at a time. Home About Us Ways to Give Contact Us Privacy ...

  11. Hepatic Encephalopathy

    Full Text Available ... responsible for the daily needs of another person. Caregivers can be a friend, spouse, life partner, parent, sibling or other family member. What is HE? Hepatic Encephalopathy, sometimes referred to as ...

  12. Hepatitis C

    ... viral load (the amount of HCV in your blood), imaging tests, and biopsy results. Treatment is especially important for people who are showing signs liver fibrosis or scarring. Medicines used to treat hepatitis C ...

  13. Hepatic Encephalopathy

    Full Text Available ... that can be corrected . It may also occur as part of a chronic problem from liver disease ... worse over time. Hepatic Encephalopathy, sometimes referred to as portosystemic encephalopathy or PSE, is a condition that ...

  14. Hepatitis A

    ... Acute liver failure requires a stay in the hospital for monitoring and treatment. Some people with acute liver failure may need a liver transplant. Prevention The hepatitis A vaccine can prevent infection with the virus. The vaccine is typically given ...

  15. Hepatic Encephalopathy

    Full Text Available ... OVERVIEW Donate Now Join an Event Volunteer Your Time The Legacy Society Make Gifts of Stock Donate ... problem from liver disease that gets worse over time. Hepatic Encephalopathy, sometimes referred to as portosystemic encephalopathy ...

  16. Hepatic Encephalopathy

    Full Text Available ... Patient Advisory Council Media Center Careers How You Can Help OVERVIEW Donate Now Join an Event Volunteer ... Hepatic Encephalopathy is a short-term problem that can be corrected . It may also occur as part ...

  17. Hepatic Encephalopathy

    Full Text Available ... People ALF Near You Events ALF Blogs Financial Information Policies Advocacy Patient Advisory Council Media Center Careers ... and abdomen (ascites) or hepatic encephalopathy. For more information about cirrhosis of the liver and symptoms, call ...

  18. Hepatic Encephalopathy

    Full Text Available ... Disease (NAFLD) & Non-alcoholic Steatohepatitis (NASH) Autoimmune Hepatitis Bile duct disease such as Primary Biliary Cirrhosis (PBC) ... spleen (splenomegaly) Stone-like particles in gallbladder and bile duct (gallstones) Liver cancer (hepatocellular carcinoma) Chronic liver ...

  19. Autoimmune Hepatitis

    ... hepatitis is the most common form in North America. Type 1 can occur at any age; however, ... eastern time, M-F Follow Us NIH… Turning Discovery Into Health ® Research & Funding Current Funding Opportunities Research ...

  20. Hepatic Encephalopathy

    Full Text Available ... Hepatic Encephalopathy Treatment Options Treatment Basics Treatment Medications Importance of Adhering to Your Treatment Plan Long-Term Considerations Patient Support Finding Support Services Peer Support Groups Financial Assistance Support for My Loved Ones Resources Find ...

  1. Hepatic Encephalopathy

    Full Text Available ... Hepatic Encephalopathy so you can tell your doctor right away if you think you may have it. ... Site Map © COPYRIGHT 2017 AMERICAN LIVER FOUNDATION. ALL RIGHTS RESERVED. Your Liver Overview

    The Faces ...

  2. Hepatic Encephalopathy

    Full Text Available ... is a condition that causes temporary worsening of brain function in people with advanced liver disease. When ... travel through your body until they reach your brain, causing mental and physical symptoms of HE. Hepatic ...

  3. Anomalous nuclear fragments

    Karmanov, V.A.

    1983-01-01

    Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative

  4. Hepatitis B Foundation

    ... worldwide 2 Billion People have been infected with Hepatitis B Worldwide The Hepatitis B Foundation is working ... of people living with hepatitis B. Learn About Hepatitis B in 11 Other Languages . Resource Video See ...

  5. What Is Hepatitis?

    ... Navigation Alt+1 Content Alt+2 What is hepatitis? Online Q&A Reviewed July 2016 Q: What ... Question and answer archives Submit a question World Hepatitis Day Posters: Eliminate hepatitis World Hepatitis Day 2017 ...

  6. Dna fingerprinting - review paper

    Blundell, Renald

    2006-01-01

    Before the Polymerase Chain Reaction (PCR) was established, DNA fingerprinting technology has relied for years on Restriction Fragment Length Polymorphism (RFLP) and Variable Number of Tandom Repeats (VNTR) analysis, a very efficient technique but quite laborious and not suitable for high throughput mapping. Since its, development, PCR has provided a new and powerful tool for DNA fingerprinting.

  7. Feature Hepatitis: Hepatitis Symptoms, Diagnosis, Treatment & Prevention

    ... Navigation Bar Home Current Issue Past Issues Feature Hepatitis Hepatitis: Symptoms, Diagnosis, Treatment & Prevention Past Issues / Spring 2009 ... No appetite Fever Headaches Diagnosis To check for hepatitis viruses, your doctor will test your blood. You ...

  8. Fission fragment angular momentum

    Frenne, D. De

    1991-01-01

    Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs

  9. Synchronization of DNA array replication kinetics

    Manturov, Alexey O.; Grigoryev, Anton V.

    2016-04-01

    In the present work we discuss the features of the DNA replication kinetics at the case of multiplicity of simultaneously elongated DNA fragments. The interaction between replicated DNA fragments is carried out by free protons that appears at the every nucleotide attachment at the free end of elongated DNA fragment. So there is feedback between free protons concentration and DNA-polymerase activity that appears as elongation rate dependence. We develop the numerical model based on a cellular automaton, which can simulate the elongation stage (growth of DNA strands) for DNA elongation process with conditions pointed above and we study the possibility of the DNA polymerases movement synchronization. The results obtained numerically can be useful for DNA polymerase movement detection and visualization of the elongation process in the case of massive DNA replication, eg, under PCR condition or for DNA "sequencing by synthesis" sequencing devices evaluation.

  10. Liver Cancer and Hepatitis B

    ... Clinical Trials Physician Directory HBV Meeting What Is Hepatitis B? What Is Hepatitis B? The ABCs of Viral Hepatitis Liver Cancer and Hepatitis B Hepatitis Delta Coinfection Hepatitis C Coinfection HIV/AIDS ...

  11. Hepatitis C: Sex and Sexuality

    ... with Hepatitis » Sex and Sexuality: Entire Lesson Viral Hepatitis Menu Menu Viral Hepatitis Viral Hepatitis Home For ... hepatitis C virus through sex. Can you pass hepatitis C to a sex partner? Yes, but it ...

  12. Hepatitis C: Diet and Nutrition

    ... with Hepatitis » Daily Living: Diet and Nutrition Viral Hepatitis Menu Menu Viral Hepatitis Viral Hepatitis Home For ... have high cholesterol and have fatty liver. How hepatitis C affects diet If you have hepatitis, you ...

  13. Hepatitis B & C and HIV

    ... Find Services HIV SERVICES LOCATOR Locator Search Search Hepatitis B & C Topics Hepatitis B Hepatitis C Hepatitis ... Infections Sexually Transmitted Diseases Smoking Women's Health Issues Hepatitis B Virus and Hepatitis C Virus Infection People ...

  14. [Autoimmune hepatitis].

    Färkkilä, Martti

    2013-01-01

    Autoimmune hepatitis is chronic liver disease with two subtypes, type 1 with anti nuclear or smooth muscle antibodies and type 2 with LKM1 or LC1 antibodies, and both with hypergammaglobulinemia and typical histology. Prevalence of AIH is between 10 to 17 per 100000 in Europe. Up to 20-40 % of cases present with acute hepatitis. Budesonide can be used as a first line induction therapy in non-cirrhotic patients, and tiopurines, mercaptopurine or mycophenolic acid as maintenance therapies. Patients not responding to conventional therapy can be treated with ciclosporin, tacrolimus or rituximab or finally with liver transplantation.

  15. String fragmentation; La fragmentation des cordes

    Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)

    1997-10-01

    The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.

  16. Dimensional crossover in fragmentation

    Sotolongo-Costa, Oscar; Rodriguez, Arezky H.; Rodgers, G. J.

    2000-11-01

    Experiments in which thick clay plates and glass rods are fractured have revealed different behavior of fragment mass distribution function in the small and large fragment regions. In this paper we explain this behavior using non-extensive Tsallis statistics and show how the crossover between the two regions is caused by the change in the fragments’ dimensionality during the fracture process. We obtain a physical criterion for the position of this crossover and an expression for the change in the power-law exponent between the small and large fragment regions. These predictions are in good agreement with the experiments on thick clay plates.

  17. Hepatitis E

    ... room/fact-sheets/detail/hepatitis-e","@context":"http://schema.org","@type":"Article"}; العربية 中文 français русский español ... E: recognition, investigation and control”. The manual gives information about the epidemiology, clinical manifestations of the disease, ...

  18. Hepatic haemangioma

    Hp 630 Dual Core

    successful usage of transhepatic compression sutures using polytetrafluoroethylene (PTFE) pledgets and selective ligation of large feeding vessels from right hepatic artery. Surgical resection may not be technically safe or possible in certain cases due to the massive or diffuse nature of the lesion, proximity to vascular ...

  19. Hepatitis B

    ... which can lower your chances of developing serious health problems. Your doctor may recommend screening for hepatitis B if you ... see a doctor who specializes in liver diseases. Doctors can treat the health problems related to cirrhosis with medicines, surgery, and other ...

  20. Chronic hepatitis

    infection by four diagnostic systems: first generation and second generation. ELlSA, second generation recombinant immunoblot assay and nested polymerase chain reaction analysis. HepatoJogy 1992; 16: 300-305. 14. Van der Poel CL, ... Alpha-1-antitrypsin deficiency. Alcoholic hepatitis. Non-alcoholic steatohepatitis.