WorldWideScience

Sample records for hendel diptera tephritidae

  1. Annotated world bibliography of host fruits of Bactrocera latifrons (Hendel) (Diptera: Tephritidae)

    Science.gov (United States)

    Bactrocera latifrons (Hendel) (Diptera: Tephritidae) infests many solanaceous plant species, some of which are important horticultural crop species. It has also been found to infest a number of cucurbitaceous plant species as well as a few plant species in other plant families. B. latifrons is of ...

  2. Host plants of Solanum fruit fly, Bactrocera latifrons(Hendel)(Diptera: Tephritidae); and provisional list of suitable host plants of Bactrocera(Bactrocera)latifrons(Hendel)(Diptera: Tephritidae), Version 1.0

    Science.gov (United States)

    Bactrocera latifrons (Hendel)(Diptera: Tephritidae) infests many solanaceous plant species, some of which are important horticultural crop species. It has also been found to infest a number of cucurbitaceous plant species as well as a few plant species in other plant families. Bactrocera latifrons i...

  3. A review of recorded host plants of Oriental Fruit Fly, Bactrocera (Bactrocera)dorsalis(Hendel)(Diptera: Tephritidae), version 3.0

    Science.gov (United States)

    Bactrocera (Bactrocera) dorsalis (Hendel)(Diptera: Tephritidae), commonly known as the Oriental fruit fly, is regulated through the Plant Protection Act of 2000 (7 U.S.C. 7701-7772) and relevant Parts and Subparts of the Code of Federal Regulations (7 CFR – Agriculture). Presented herein is a compre...

  4. Effect of sweeteners on the survival and behaviour of Bactrocera dorsalis (Hendel) (Diptera: Tephritidae).

    Science.gov (United States)

    Zheng, Chunyan; Zeng, Ling; Xu, Yijuan

    2016-05-01

    The oriental fruit fly Bactrocera dorsalis (Hendel) (Diptera: Tephritidae) causes serious damage that affects fruit production. Chemical insecticides have been widely used for the prevention and control of this destructive pest. However, the resistance of B. dorsalis to these compounds has become a serious problem. This study tested six sweeteners for their toxicity to B. dorsalis. B. dorsalis fed on erythritol, aspartame and saccharin exhibited significantly higher mortality than those fed on sucrose. Flies fed on erythritol died faster than did the control flies (water). However, no dose-dependent effects were observed at the concentrations tested. These three sweeteners decreased the climbing ability of B. dorsalis. Notably, adults fed on saccharin exhibited significantly decreased climbing ability after 12 h compared with those fed on sucrose. Additionally, these three sweeteners had a negative effect on the frequency and duration of the flies' behaviour patterns (flying, walking, grooming and inactivity). Saccharin not only induced a marked reduction in the frequency of flights and walks but also induced decreases in the time spent flying and walking and increases in inactivity compared with sucrose. Erythritol induced a reduction in movement and increased the time spent inactive compared with the control and other treatments. Three sweeteners had significant negative effects on the survival of B. dorsalis. Erythritol was toxic to B. dorsalis. Aspartame and saccharin also decreased the survival and behaviour of adult flies and may be toxic to (or contribute to poor nutrition in) B. dorsalis. These sweeteners could therefore be developed as additive ingredients in baits. © 2015 Society of Chemical Industry.

  5. Lethal and sublethal effects of cyantraniliprole on Bactrocera dorsalis (Hendel) (Diptera: Tephritidae).

    Science.gov (United States)

    Zhang, Ruimin; Jang, Eric B; He, Shiyu; Chen, Jiahua

    2015-02-01

    The oriental fruit fly, Bactrocera dorsalis (Hendel), is one of the most globally important insect pests. Studies were conducted with the novel anthranilic diamide insecticide cyantraniliprole to determine its lethal and sublethal effects on B. dorsalis. An ingestion toxicity bioassay showed that cyantraniliprole was active against B. dorsalis, and the 72 h feeding LC50 was 3.22 µg g(-1) in adult diet for a susceptible strain. Sublethal doses of cyantraniliprole (1.30 µg g(-1) adult diet) induced a hormesis effect on B. dorsalis. The mating competitiveness of B. dorsalis treated with cyantraniliprole at 3.27 µg g(-1) adult diet was significantly lower when compared with the controls. The lower dose (1.30 µg g(-1) adult diet) of cyantraniliprole improved the total mating times of both mating pairs in treated groups and also the mating competitiveness of the treated males when compared with the higher dose and controls. Cyantraniliprole-treated females of the mated pairs with the lower dose laid more eggs. On the fifth day, female receptivity in the treated group was significantly reduced when compared with the controls. These results indicate that cyantraniliprole is effective against B. dorsalis. The inhibition and stimulation effect of cyantraniliprole on the adult's mating performance at different concentrations was proved. © 2014 Society of Chemical Industry.

  6. Phenotypes, antioxidant responses, and gene expression changes accompanying a sugar-only diet in Bactrocera dorsalis (Hendel) (Diptera: Tephritidae).

    Science.gov (United States)

    Chen, Er-Hu; Hou, Qiu-Li; Wei, Dan-Dan; Jiang, Hong-Bo; Wang, Jin-Jun

    2017-08-17

    Diet composition (yeast:carbohydrate ratio) is an important determinant of growth, development, and reproduction. Recent studies have shown that decreased yeast intake elicits numerous transcriptomic changes and enhances somatic maintenance and lifespan, which in turn reduces reproduction in various insects. However, our understanding of the responses leading to a decrease in yeast ratio to 0% is limited. In the present study, we investigated the effects of a sugar-only diet (SD) on the gene expression patterns of the oriental fruit fly, Bactrocera dorsalis (Hendel), one of the most economically important pests in the family Tephritidae. RNA sequencing analyses showed that flies reared on an SD induced significant changes in the expression levels of genes associated with specific metabolic as well as cell growth and death pathways. Moreover, the observed upregulated genes in energy production and downregulated genes associated with reproduction suggested that SD affects somatic maintenance and reproduction in B. dorsalis. As expected, we observed that SD altered B. dorsalis phenotypes by significantly increasing stress (starvation and desiccation) resistance, decreasing reproduction, but did not extend lifespan compared to those that received a normal diet (ND) regime. In addition, administration of an SD resulted in a reduction in antioxidant enzyme activities and an increase in MDA concentrations, thereby suggesting that antioxidants cannot keep up with the increase in oxidative damage induced by SD regime. The application of an SD diet induces changes in phenotypes, antioxidant responses, and gene expressions in B. dorsalis. Previous studies have associated extended lifespan with reduced fecundity. The current study did not observe a prolongation of lifespan in B. dorsalis, which instead incurred oxidative damage. The findings of the present study improve our understanding of the molecular, biochemical, and phenotypic response of B. dorsalis to an SD diet.

  7. Cryptodacus Hendel, 1914 (Insecta: Diptera: TEPHRITIDAE): Proposed conservation by suppression of Cryptodacus Gundlach, 1862 (Reptilia: Serpentes: COLUBRIDAE)

    Science.gov (United States)

    The purpose of this application under Articles 78.1, 80.2.2, and 81.2.1 is to conserve current usage of the well-established genus-group name Cryptodacus Hendel, 1914 for a genus of Neotropical fruit flies by suppression of the earlier name Cryptodacus Gundlach, 1862, currently a junior synonym of A...

  8. Case 3693 Cryptodacus Hendel, 1914 (Insecta: Diptera: Tephritidae): Proposed suppression of Cryptodacus Gundlach, 1862 (Reptilia, Serpentes, Colubridae)

    Science.gov (United States)

    Norrbom, Allen L.; McDiarmid, Roy W.; Chen, Xiao-Lin; David, King J.; De Meyer, Marc; Freidberg, Amnon; Han, Ho-Yeon; Steck, Gary J.; Thompson, F. Christian; White, Ian M.; Zucchi, Roberto A.

    2015-01-01

    The purpose of this application, under Article 23.9.3, is to conserve current usage of the well-established genus-group name Cryptodacus Hendel, 1914 for a genus of Neotropical fruit flies by suppression of the earlier, unused name Crypto- dacus Gundlach, 1862, currently a junior synonym of Arrhyton Günther, 1858, a genus of snakes, under the plenary power of the Commission, in the interest of nomenclatural stability. Cryptodacus Gundlach has not been used as a valid name since 1883, whereas Cryptodacus Hendel has been used in a significant body of literature relating to fruit fly systematics, morphology and phylogeny and is the currently used name in various name and molecular databases. 

  9. Humoral immunocompetence shifts in response to developmental stage change and mating access in Bactrocera dorsalis Hendel (Diptera: Tephritidae).

    Science.gov (United States)

    Shi, Z; Lin, Y; Hou, Y; Zhang, H

    2015-04-01

    Because immune defenses are often costly employed, insect immunocompetence cannot be always maintained at its maximum level. Here, the oriental fruit fly, Bactrocera dorsalis (Hendel), was used as a study object to investigate how its immune defenses varied with the developmental stage change and mating access. Our data indicated that both phenoloxidase (PO) activity and antibacterial activity significantly increased from new larvae to pupae but decreased in adults after emergence. Furthermore, both the PO activity and antibacterial activity in the hemolymph of copulated male and female adults were dramatically higher than that of virgin male and female ones, respectively. It provided the evidence that copulation could increase the magnitude of immune defense in hemolymph of B. dorsalis. Together, these results suggest that B. dorsalis possess a flexible investment strategy in immunity to meet its specific needs based on the endo- and exogenous factors, such as their distinct food source and living environments.

  10. The oviposition of the chili fruit fly (Bactrocera latifrons Hendel (Diptera: Tephritidae with reference to reproductive capacity

    Directory of Open Access Journals (Sweden)

    Anothai Wingsanoi

    2012-11-01

    Full Text Available The chili fruit fly, Bactrocera latifrons Hendel, is a serious pest of chili fruit production in Thailand. To determine theeffective control planning of the fly population, the oviposition related to reproductive capacity of the female were observed.The female ovary was daily dissected through the entire life span and the eggs inside the ovary were examined and counted.There were 44.84±19.60 eggs/ovary. The oviposition of female was simultaneously conducted. Eggs inside the ovarypresented on 8th day and the female oviposited on 10th day of the life span. The female laid 4.25±2.28 eggs, which was 12.45±9.56 fold less than the reproductive capacity. The female longevity was 31.1±8.40 days and the oviposition period was 40days.

  11. From eradication to containment: invasion of French Polynesia by Bactrocera dorsalis (Hendel) (Diptera: Tephritidae) and releases of two natural enemies: a 17-year case study

    Science.gov (United States)

    Oriental fruit fly, Bactrocera dorsalis (Hendel), was discovered on Tahiti Island, French Polynesia, in 1996. Two other economically important Bactrocera species were previously established: B. kirki (Froggatt) in 1928, and B. tryoni (Froggatt), Queensland fruit fly, in 1970. This situation provi...

  12. Attraction and Mortality of Oriental Fruit Flies (Diptera: Tephritidae) to SPLAT-MAT- Methyl Eugenol with Spinosad

    Science.gov (United States)

    Studies were conducted in Hawaii to quantify attraction and feeding responses resulting in mortality of male oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), to SPLAT-MAT-methyl eugenol (ME) with spinosad in comparison with Min-U-Gel-ME with naled (Dibrom). Our approach invol...

  13. Functional analysis of a NF-κB transcription factor in the immune defense of Oriental fruit fly, Bactrocera dorsalis Hendel (Diptera: Tephritidae).

    Science.gov (United States)

    Shi, Z; Liang, H; Hou, Y

    2017-04-01

    Although some novel antimicrobial peptides (AMP) have been successfully isolated from Bactrocera dorsalis Hendel, the mechanisms underlying the induction of these peptides are still elusive. The homolog of NF-κB transcription factor Relish, designated as BdRelish, was cloned from B. dorsalis. The full length cDNA of BdRelish is 3954 bp with an open reading frame that encodes 1013 amino acids. Similar to Drosophila Relish and the mammalian p100, it is a compound protein containing a conserved Rel homology domain, an IPT (Ig-like, plexins, transcription factors) domain and an IκB-like domain (four ankyrin repeats), the nuclear localization signal RKRRR is also detected at the residues 449-453, suggesting that it has homology to Relish and it is a member of the Rel family of transcription activator proteins. Reverse transcription quantitative polymerase chain reaction analysis reveals that BdRelish mRNAs are detected in different quantities from various tissues and the highest transcription level of BdRelish is determined in fat body. The injection challenge of Escherichia coli and Staphylococcus aureas significantly upregulated the expression of BdRelish. The injection of BdRelish dsRNA markedly reduced the expression of BdRelish and decreased the transcription magnitude of antimicrobial peptides. Individuals injected BdRelish dsRNA died at a significantly faster rate compared with the control groups. Therefore, BdRelish is vital for the transcription of AMPs to attack the invading bacteria.

  14. Pictorial keys for predominant Bactrocera and Dacus fruit flies (Diptera: Tephritidae) of north western Himalaya

    OpenAIRE

    C. S. Prabhakar; Pankaj Sood; P. K. Mehta

    2012-01-01

    A pictorial key for 13 species of fruit flies under 2 genera namely Bactrocera and Dacus of subfamily Dacinae (Diptera: Tephritidae) is presented in this paper based on actual photographs of fruit flies collected from north western Himalaya of India during 2009-2010. Among these, Bactrocera diversa (Coquillett), Bactrocera scutellaris (Bezzi), Bactrocera tau (Walker), Bactrocera cucurbitae (Coquillett), Bactrocera zonata (Saunders), Bactrocera correcta (Bezzi), Bactrocera dorsalis (Hendel), B...

  15. Identification of Bactrocera invadens (Diptera: Tephritidae) from ...

    African Journals Online (AJOL)

    Bactrocera (Bactrocera) invadens Drew (Diptera: Tephritidae) is a new species of fruit fly in 2005. It belongs to the Bactrocera dorsalis complex, but is difficult to diagnose based on solely morphological identification. It occurs in India, Bhutan and some countries of Africa. In this study, 14 adult samples of fruit flies were ...

  16. Pictorial keys for predominant Bactrocera and Dacus fruit flies (Diptera: Tephritidae of north western Himalaya

    Directory of Open Access Journals (Sweden)

    C. S. Prabhakar

    2012-09-01

    Full Text Available A pictorial key for 13 species of fruit flies under 2 genera namely Bactrocera and Dacus of subfamily Dacinae (Diptera: Tephritidae is presented in this paper based on actual photographs of fruit flies collected from north western Himalaya of India during 2009-2010. Among these, Bactrocera diversa (Coquillett, Bactrocera scutellaris (Bezzi, Bactrocera tau (Walker, Bactrocera cucurbitae (Coquillett, Bactrocera zonata (Saunders, Bactrocera correcta (Bezzi, Bactrocera dorsalis (Hendel, Bactrocera latifrons (Hendel and Dacus ciliatus Loew are the pests of agricultural and horticultural ecosystems. Bactrocera latifrons, Bactrocera nigrofemoralis White and Tsuruta, Dacus longicornis Wiedemann and Dacus sphaeroidalis (Bezzi are the new records from the region of which host range has yet to be investigated. The pictorial keysdeveloped for these species will help the researchers for their easy and accurate identification.

  17. Low Diversity Bacterial Community and the Trapping Activity of Metabolites from Cultivable Bacteria Species in the Female Reproductive System of the Oriental Fruit Fly, Bactrocera dorsalis Hendel (Diptera: Tephritidae)

    Science.gov (United States)

    Shi, Zhanghong; Wang, Lili; Zhang, Hongyu

    2012-01-01

    Our goal was to identify the bacteria inhabiting the reproductive system of the female oriental fruit fly, Bactrocera dorsalis (Hendel), and evaluate the chemotaxis of B. dorsalis to the metabolites produced by the bacteria. Based on 16S rRNA-based polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE), 18 operational taxonomic units (OTUs) were assigned to the five bacterial classes Betaproteobacteria, Alphaproteobacteria, Gammaproteobacteria, Bacilli and Actinobacteria. Nine OTUs were assigned to Gammaproteobacteria, which was the most highly represented class. Enterobacteriaceae constituted the dominant family, and within this family, three genera and five species were identified, including Enterobacter sakazakii, Klebsiella oxytoca, Klebsiella pneumoniae, Raoultella terrigena and Enterobacter amnigenus. In this set, the first two species were the dominant components, and the latter three species were the minor ones. Finally, we found that the metabolites produced by R. terrigena, K. oxytoca and K. pneumoniae were attractive to the B. dorsalis adults, and in field studies, B. dorsalis adults were most attracted to K. oxytoca. Collectively, our results suggest that the female reproductive system plays an important role in the transfer of enterobacteria from the gut to fruit. Our data may prompt the development of a female-targeted population control strategy for this fly. PMID:22754363

  18. Low Diversity Bacterial Community and the Trapping Activity of Metabolites from Cultivable Bacteria Species in the Female Reproductive System of the Oriental Fruit Fly, Bactrocera dorsalis Hendel (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Hongyu Zhang

    2012-05-01

    Full Text Available Our goal was to identify the bacteria inhabiting the reproductive system of the female oriental fruit fly, Bactrocera dorsalis (Hendel, and evaluate the chemotaxis of B. dorsalis to the metabolites produced by the bacteria. Based on 16S rRNA-based polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE, 18 operational taxonomic units (OTUs were assigned to the five bacterial classes Betaproteobacteria, Alphaproteobacteria, Gammaproteobacteria, Bacilli and Actinobacteria. Nine OTUs were assigned to Gammaproteobacteria, which was the most highly represented class. Enterobacteriaceae constituted the dominant family, and within this family, three genera and five species were identified, including Enterobacter sakazakii, Klebsiella oxytoca, Klebsiella pneumoniae, Raoultella terrigena and Enterobacter amnigenus. In this set, the first two species were the dominant components, and the latter three species were the minor ones. Finally, we found that the metabolites produced by R. terrigena, K. oxytoca and K. pneumoniae were attractive to the B. dorsalis adults, and in field studies, B. dorsalis adults were most attracted to K. oxytoca. Collectively, our results suggest that the female reproductive system plays an important role in the transfer of enterobacteria from the gut to fruit. Our data may prompt the development of a female-targeted population control strategy for this fly.

  19. Phytosanitary Treatments Against Bactrocera dorsalis (Diptera: Tephritidae): Current Situation and Future Prospects.

    Science.gov (United States)

    Dohino, Toshiyuki; Hallman, Guy J; Grout, Timothy G; Clarke, Anthony R; Follett, Peter A; Cugala, Domingos R; Minh Tu, Duong; Murdita, Wayan; Hernandez, Emilio; Pereira, Rui; Myers, Scott W

    2017-02-01

    Bactrocera dorsalis (Hendel) (Diptera: Tephritidae) is arguably the most important tephritid attacking fruits after Ceratitis capitata (Wiedemann) (Diptera: Tephritidae). In 2003 it was found in Africa and quickly spread to most of the sub-Saharan part of the continent, destroying fruits and creating regulatory barriers to their export. The insect is causing new nutritional and economic losses across Africa, as well as the losses it has caused for decades in infested areas of Asia, New Guinea, and Hawaii. This new panorama represents a challenge for fruit exportation from Africa. Phytosanitary treatments are required to export quarantined commodities out of infested areas to areas where the pest does not exist and could become established. This paper describes current phytosanitary treatments against B. dorsalis and their use throughout the world, the development of new treatments based on existing research, and recommendations for further research to provide phytosanitary solutions to the problem. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Ceratitis cosyra, een Afrikaanse boorvlieg gevonden in Drenthe (Diptera: Tephritidae)

    NARCIS (Netherlands)

    Smit, J.T.; Aartsen, van B.

    2002-01-01

    Ceratitis cosyra, an African fruitfly found in the Dutch province of Drenthe (Diptera: Tephritidae) A single specimen of Ceratitis (Ceratalaspis) cosyra (Walker, 1849) was collected near Papenvoort (utm ld4768) with a malaisetrap in the period 4-6 september 1993 (leg. L. Witmond). Up till now it was

  1. Assessment of Navel Oranges, Clementine Tangerines, and Rutaceous Fruits as Hosts of Bactrocera cucurbitae and Bactrocera latifrons (Diptera: Tephritidae).

    Science.gov (United States)

    McQuate, Grant T; Follett, Peter A; Liquido, Nicanor J; Sylva, Charmaine D

    2015-01-01

    Export of Citrus spp. fruits may require risk mitigation measures if grown in areas with established tephritid fruit fly (Diptera: Tephritidae) populations capable of infesting the fruits. The host status of Citrus spp. fruits is unclear for two tephritid fruit fly species whose geographic ranges have expanded in recent years: melon fly, Bactrocera cucurbitae (Cocquillett), and Bactrocera latifrons (Hendel). In no choice cage infestation studies, B. latifrons oviposited into intact and punctured Washington navel oranges (Citrus sinensis [L.] Osbeck) and Clementine tangerines (C. reticulata L. var. Clementine), but eggs rarely developed to the adult stage. B. cucurbitae readily infested intact and punctured tangerines, and to a lesser extent punctured oranges, but did not infest intact oranges. Limited cage infestation and only a single literature report of field Citrus spp. infestation suggest that risk mitigation of Citrus spp. for B. latifrons is not needed. Risk mitigation options of Citrus spp. for B. cucurbitae, including heat and cold treatments and systems approaches, are discussed.

  2. Assessment of Navel Oranges, Clementine Tangerines, and Rutaceous Fruits as Hosts of and (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Grant T. Mcquate

    2015-01-01

    Full Text Available Export of Citrus spp. fruits may require risk mitigation measures if grown in areas with established tephritid fruit fly (Diptera: Tephritidae populations capable of infesting the fruits. The host status of Citrus spp. fruits is unclear for two tephritid fruit fly species whose geographic ranges have expanded in recent years: melon fly, Bactrocera cucurbitae (Cocquillett, and Bactrocera latifrons (Hendel. In no choice cage infestation studies, B. latifrons oviposited into intact and punctured Washington navel oranges ( Citrus sinensis [L.] Osbeck and Clementine tangerines ( C. reticulata L. var. Clementine, but eggs rarely developed to the adult stage. B. cucurbitae readily infested intact and punctured tangerines, and to a lesser extent punctured oranges, but did not infest intact oranges. Limited cage infestation and only a single literature report of field Citrus spp. infestation suggest that risk mitigation of Citrus spp. for B. latifrons is not needed. Risk mitigation options of Citrus spp. for B. cucurbitae , including heat and cold treatments and systems approaches, are discussed.

  3. Relative Tolerance of Six Bactrocera (Diptera: Tephritidae) Species to Phytosanitary Cold Treatment.

    Science.gov (United States)

    Myers, Scott W; Cancio-Martinez, Elena; Hallman, Guy J; Fontenot, Emily A; Vreysen, Marc J B

    2016-12-01

    To compare relative cold treatment tolerance across the economically important tephritid fruit flies (Diptera: Tephritidae), Bactrocera carambolae Drew & Hancock, Bactrocera correcta (Bezzi), Bactrocera cucurbitae (Coquillett), four populations of Bactrocera dorsalis (Hendel), Bactrocera zonata (Saunders), and Bactrocera tryoni (Froggatt), eggs (in vitro), and larvae (in infested fruit or on carrot diet) were cold treated at 2.0 ± 0.2 °C for selected durations. The study was performed to assess whether a single (i.e., generic) cold treatment could be developed that would control the entire group of fruit flies that were tested. Probit regression models showed that the hierarchy of cold resistance was third-instar larvae reared on carrot diet > third-instar larvae reared on orange > eggs test in vitro. Differences in mortality responses of third-instar larvae reared in oranges across populations of B. dorsalis were observed only at subefficacious levels of control. The majority of Bactrocera species responded the same at the high levels of control demanded of phytosanitary treatments, which indicated that cold treatments would be similarly effective across the species and populations tested. B. cucurbitae was found to be the most cold tolerant of all the species tested. Published by Oxford University Press on behalf of Entomological Society of America 2016. This work is written by US Government employees and is in the public domain in the US.

  4. Suitability of Bactrocera dorsalis (Diptera: Tephritidae) Pupae for Spalangia endius (Hymenoptera: Pteromalidae).

    Science.gov (United States)

    Tang, Liang-De; Lu, Yong-Yue; Zhao, Hai-Yan

    2015-06-01

    Spalangia endius (Walker) (Hymenoptera: Pteromalidae) is found to be one of the most important natural enemies of Bactrocera dorsalis Hendel (Diptera: Tephritidae) pupae in China. In this study, the influence of host pupal age on the preference for and suitability of the host by the parasitoid S. endius was determined using choice and nonchoice tests. S. endius females accepted the 1-7 d-old B. dorsalis pupae for oviposition, and their offspring developed successfully. However, the S. endius preferentially parasitized the 2-, 3-, and 4-d-old host pupae. The emergence rate of the adult progeny was not affected by the host pupal age, nor was the male body weight, male longevity, and sex ratio of the parasitoid offspring. However, the shortest development time of both male and female progeny and the greatest size and adult longevity of female progeny were observed in hosts that were ≤4 d old. Females emerged later and lived longer than males, and they weighed more than the males. Host mortality decreased as the age of the host increased for 1-7-d-old hosts. Our findings suggest that 2-, 3-, and 4-d-old B. dorsalis pupae would be the best host ages at which to rear S. endius for effective control in field releases. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. Aphaereta ceratitivora sp. n. (Hymenoptera, Braconidae, a new parasitoid of Ceratitis capitata (Wiedemann (Diptera, Tephritidae from the Azores

    Directory of Open Access Journals (Sweden)

    Kees van Achterberg

    2012-09-01

    Full Text Available A new gregarious larval-pupal endoparasitoid of Ceratitis capitata (Wiedemann (Diptera: Tephritidae is described and illustrated: Aphaereta ceratitivora sp. n. (Braconidae: Alysiinae: Alysiini.

  6. Insecticide toxicity to oriental fruit fly Bactrocera dorsalis (Diptera: Tephritidae) is influenced by environmental factors.

    Science.gov (United States)

    Lin, Yuying; Jin, Tao; Zeng, Ling; Lu, Yongyue

    2013-02-01

    In this study, we investigated the effects of environmental factors (temperature, dose, dietary source, and feeding density) on the insecticide tolerance of Bactrocera dorsalis (Hendel) (Diptera: Tephritidae). The results indicated that the toxicities of trichlorphon and abamectin to B. dorsalis increased with an increase in temperature. At 15-35 degrees C, the toxicity of beta-cypermethrin decreased with an increase in temperature at low doses (0.82 and 1.86 mg/L), but was similar at a high dose (4.18 mg/L). These results demonstrated that the temperature coefficient of beta-cypermethrin was related to both temperature and dosage. The insecticide sensitivity of B. dorsalis reared on different dietary sources was significantly different. Trichlorphon sensitivity of B. dorsalis fed on banana was the highest with an LC50 of 1.61 mg/L, followed by on apple, carambola, semiartificial diet, pear, mango, guava, orange, and papaya. With an increasing feeding density, the sensitivity of B. dorsalis adults to trichlorphon increased, while the sensitivities of B. dorsalis adults to abamectin and beta-cypermethrin decreased. The differences between LC50 values of insects reared at densities of 10 and 13 eggs/g of semiartificial diet to trichlorphon, abamectin and beta-cypermethrin were not significant. This result suggested that representative toxicity could be obtained by using adults developed at a feeding density between 10-13 eggs/g of semiartificial diet. Adult body weight was positively correlated with the LC50 value of trichlorphon, but was negatively correlated with the toxicities of abamectin and beta-cypermethrin. These results suggested that the effects of adult body weight on the toxicity of insecticides were different among different chemicals.

  7. Generic phytosanitary radiation treatment for tephritid fruit flies provides quarantine security for Bactrocera latifrons (Diptera: Tephritidae).

    Science.gov (United States)

    Follett, Peter A; Phillips, Thomas W; Armstrong, John W; Moy, James H

    2011-10-01

    Bactrocera latifrons (Hendel) (Diptera: Tephritidae) is a quarantine pest of several solanaceous crops and tropical fruits that are treated using irradiation before export from Hawaii to the U.S. mainland. A dose of 150 Gy is approved as a generic irradiation treatment for tephritid fruit flies, but no confirmation of efficacy has been reported for B. latifrons. Dose response of B. latifrons was used to determine the most tolerant life stage and identify a dose that prevents adult emergence. Data indicated doses (plus 95% confidence limits) required to prevent adult emergence of 13.4 (10.0-29.6), 17.5 (14.4-24.8), and 88.1 (68.0-133.8) Gy for eggs, first instars and third instars, respectively. In large-scale confirmatory tests of the most radiotolerant life stage, a radiation dose of 150 Gy applied to B. latifrons late third instars in bell peppers (Capsicum annuum L.) resulted in no survival to the adult stage of 157,112 individuals, a treatment efficacy consistent with Probit 9-level mortality. The relative radiotolerance of melon fly Bactrocera cucurbitae Coquillet, and B. latifrons also was tested using a diagnostic radiation dose of 30 Gy. In diet, a mean of 6.9% of irradiated B. cucurbitae third instars developed to the adult stage, whereas no B. latifrons third instars developed to adults. In papaya, Carica papaya L., fruit, a mean of 3.3% of irradiated B. cucurbitae third instars developed to the adult stage, whereas 0.5% B. latifrons third instars developed to adults. This report supports the use of a generic radiation dose of 150 Gy in quarantine scenarios to control tephritid fruit flies on fresh commodities.

  8. Capture probability of released males of two Bactrocera species (Diptera: Tephritidae) in detection traps in California.

    Science.gov (United States)

    Shelly, T; Nishimoto, J; Diaz, A; Leathers, J; War, M; Shoemaker, R; Al-Zubaidy, M; Joseph, D

    2010-12-01

    The genus Bactrocera (Diptera: Tephritidae) includes approximately 70 polyphagous species that are major pests of fruit and vegetable crops. Most Bactrocera species have limited geographic distributions, but several species are invasive, and many countries operate continuous trapping programs to detect infestations. In the United States, California maintains approximately 25,000 traps (baited with male lures) specifically for Bactrocera detection distributed over an area of approximately 6,400 km2 (2,500 miles2) in the Los Angeles area. Although prior studies have used male lures to describe movement of Bactrocera males, they do not explicitly relate capture probability with fly distance from lure-baited traps; consequently, they do not address the relative effectiveness of male lures in detecting incipient populations of Bactrocera species. The objective of this study was to measure the distance-dependent capture probability of marked, released males of Bactrocera dorsalis (Hendel) and Bactrocera cucurbitae (Coquillett) (methyl eugenol- and cue lure-responding species, respectively) within the detection trapping grid operating in southern California. These data were then used to compute simple probability estimates for detecting populations of different sizes of the two species. Methyl eugenol was the more powerful attractant, and based on the mark-recapture data, we estimated that B. dorsalis populations with as few as approximately 50 males would always (>99.9%) be detected using the current trap density of five methyl eugenol-baited traps per 2.6 km2 (1 mile2). By contrast, we estimated that certain detection of B. cucurbitae populations would not occur until these contained approximately 350 males. The implications of the results for the California trapping system are discussed, and the findings are compared with mark-release-recapture data obtained for the same two species in Hawaii.

  9. Flight capacity of Bactrocera dorsalis (Diptera: Tephritidae) adult females based on flight mill studies and flight muscle ultrastructure.

    Science.gov (United States)

    Chen, Min; Chen, Peng; Ye, Hui; Yuan, Ruiling; Wang, Xiaowei; Xu, Jin

    2015-01-01

    The oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), is considered a major economic threat in many regions worldwide. To better comprehend flight capacity of B. dorsalis and its physiological basis, a computer-monitored flight mill was used to study flight capacity of B. dorsalis adult females of various ages, and the changes of its flight muscle ultrastructures were studied by transmission electron microscopy. The flight capacity (both speed and distance) changed significantly with age of B. dorsalis female adults, peaking at about 15 d; the myofibril diameter of the flight muscle of test insects at 15-d old was the longest, up to 1.56 µm, the sarcomere length at 15-d old was the shortest, averaging at 1.37 µm, volume content of mitochondria of flight muscle at 15-d old reached the peak, it was 32.64%. This study provides the important scientific data for better revealing long-distance movement mechanism of B. dorsalis. © The Author 2015. Published by Oxford University Press on behalf of the Entomological Society of America.

  10. Assessment of Navel Oranges, Clementine Tangerines, and Rutaceous Fruits as Hosts of Bactrocera cucurbitae and Bactrocera latifrons (Diptera: Tephritidae)

    Science.gov (United States)

    McQuate, Grant T.; Follett, Peter A.; Liquido, Nicanor J.; Sylva, Charmaine D.

    2015-01-01

    Export of Citrus spp. fruits may require risk mitigation measures if grown in areas with established tephritid fruit fly (Diptera: Tephritidae) populations capable of infesting the fruits. The host status of Citrus spp. fruits is unclear for two tephritid fruit fly species whose geographic ranges have expanded in recent years: melon fly, Bactrocera cucurbitae (Cocquillett), and Bactrocera latifrons (Hendel). In no choice cage infestation studies, B. latifrons oviposited into intact and punctured Washington navel oranges (Citrus sinensis [L.] Osbeck) and Clementine tangerines (C. reticulata L. var. Clementine), but eggs rarely developed to the adult stage. B. cucurbitae readily infested intact and punctured tangerines, and to a lesser extent punctured oranges, but did not infest intact oranges. Limited cage infestation and only a single literature report of field Citrus spp. infestation suggest that risk mitigation of Citrus spp. for B. latifrons is not needed. Risk mitigation options of Citrus spp. for B. cucurbitae, including heat and cold treatments and systems approaches, are discussed. PMID:26816484

  11. Evaluation of mass trapping and bait stations to control Anastrepha (Diptera: Tephritidae) fruit flies in mango orchards of Chiapas, Mexico

    National Research Council Canada - National Science Library

    Salvador Flores; Enoc Gómez; Sergio Campos; Fredy Gálvez; Jorge Toledo; Pablo Liedo; Rui Pereira; Pablo Montoya

    2017-01-01

    ...) and Anastrepha ludens (Loew) (Diptera: Tephritidae) in mango orchards in Chiapas, Mexico. Among the bait stations evaluated, we found that a wide-mouth 2 L plastic bottle baited with Cera Trap...

  12. Complete mitochondrial genome of the guava fruit fly, Bactrocera correcta (Diptera: Tephritidae).

    Science.gov (United States)

    Liu, Jian-Hong; Xu, Jin; Li, Yong-He; Dan, Wenli; Pan, Yongzhi

    2016-11-01

    Bactrocera correcta (Diptera: Tephritidae) is one of the most serious pest insects in south China and surrounding Southeast Asian countries. The family Tephritidae includes over 4257 species distributed worldwide, so the complete mitochondrial genome would be helpful for bio-identification, biogeography and phylogeny. The B. correcta genome consists of 15 936 bp. Annotation indicated that the structure and orientation of 13 protein-coding genes (PCGs), 22 tRNA and 2 rRNA sequences were typical of, and similar to, the ten closely related tephritid species. The nucleotide composition shows heavily biased toward As and Ts accounting 73.2% and exhibits a slightly positive AT skew, which is similar to other known tephritid species and other insects. The phylogenetic tree indicated the presence of three distinct families (Tephritidae, Muscidae, Drosophilidae) in Order Diptera.

  13. De invasieve Oost-Amerikaanse kersenboorvlieg Rhagoletis cingulata in Nederland (Diptera: Tephritidae).

    NARCIS (Netherlands)

    Smit, J.T.; Dijkstra, E.G.M.

    2008-01-01

    The invasive American Eastern Cherry Fruitfly Rhagoletis cingulata in the Netherlands (Diptera: Tephritidae) In 2003 the European Invertebrate Survey - Netherlands, on request of the Plant Protection Service of the Netherlands, conducted a survey of the distribution and phenology of the American

  14. Verspreiding en fenologie van de boorvlieg Rhagoletis cingulata in Nederland (Diptera: Tephritidae)

    NARCIS (Netherlands)

    Smit, J.T.

    2003-01-01

    Verspreiding en fenologievan de boorvlieg Rhagoletis cingulata in Nederland (Diptera: Tephritidae) In opdracht van de Plantenziektenkundige Dienst heeft EIS-Nederland van 10 juli t/m 2 oktober 2003 een onderzoek uitgevoerd naar de verspreiding en de fenologie van de boorvlieg Rhagoletis cingulata in

  15. Annotated world bibliography of host plants of the melon fly, Bactrocera cucurbitae (Cocquillett) (Diptera:Tephritidae)

    Science.gov (United States)

    The melon fly, Bactrocera cucurbitae(Coquillett), is a widespread, economically important tephritid fruit fly (Diptera: Tephritidae) species. Bactrocera cucurbitae infests fruits and vegetables of a number of different plant species, with many host plants in the plant family Cucurbitaceae, but with ...

  16. A New Visual Trap for Rhagoletis cerasi (L. (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Claudia Daniel

    2014-07-01

    Full Text Available The European cherry fruit fly, Rhagoletis cerasi (L. (Diptera: Tephritidae, is the most important pest of sweet cherries in Europe. The aim of our experiments was to develop a new, cost-efficient, lead chromate-free and more eco-friendly trap for monitoring and mass trapping of R. cerasi. Five different-colored yellow panels and three different trap shapes were compared to a standard Rebell® amarillo trap in three experimental orchards in 2012. Trap color F, with a strong increase in reflectance at 500–550 nm and a secondary peak in the UV-region at 300–400 nm, captured significantly more flies than the standard Rebell® amarillo trap. Yellow traps with increased reflectance in the blue region (400–500 nm were least attractive. Trap shape was of minor importance, as long as the object was three-dimensional and visible from all directions. Based on economic and practical considerations, a cylinder-shaped trap “UFA-Samen Kirschenfliegenfalle” was developed for commercial use and is currently under on-farm evaluation.

  17. Low-Dose Irradiation With Modified Atmosphere Packaging for Mango Against the Oriental Fruit Fly (Diptera: Tephritidae).

    Science.gov (United States)

    Srimartpirom, Monnipa; Burikam, Intawat; Limohpasmanee, Wanich; Kongratarporn, Titima; Thannarin, Thodsapon; Bunsiri, Apita; Follett, Peter A

    2017-12-27

    Irradiation is used to disinfest the oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae) and other pests on mango fruits before export from Thailand to foreign markets. Modified atmosphere packaging (MAP) used during export of mangoes creates a low-oxygen environment that may reduce the efficacy of quarantine irradiation treatment against B. dorsalis. 'Nam Dok Mai' mangoes infested with third-instar larvae of B. dorsalis, wrapped with three different kinds of MAP bags (CF1, FF5, and H34M) or no MAP, were treated with gamma radiation at 0 (control), 30, 60, 90, 120, and 150 Gy. The average O2 and CO2 concentrations in MAP bags with mangos were 7.2 and 8.7% in the H34M bag, 8.6 and 21.2% in the CF1 bag, and 9.6 and 26.7% in the FF5 bag, respectively. The use of MAP on infested mangoes significantly increased mortality of B. dorsalis under irradiation treatment. The estimated lethal doses to cause 99% mortality (LD99) for no MAP and MAP (CF1, FF5, and H34M bags) treatments were 58.1, 41.6, 43.8, and 47.4 Gy, respectively. Therefore, MAP acted as an additional stressor rather than providing radioprotection in irradiated B. dorsalis. Large-scale confirmatory testing of 35,000 B. dorsalis larvae treated at a radiation dose of 150 Gy in mangoes with H34M MAP bags produced no survivors to the adult stage. Commercial use of MAP producing the O2 levels that we observed for mangos in this study will not reduce the efficacy of the approved 150 Gy quarantine irradiation treatment for B. dorsalis. Published by Oxford University Press on behalf of Entomological Society of America 2017. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  18. Biochemical and molecular characterisation of acetylcholinesterase in four field populations of Bactrocera dorsalis (Hendel) (Diptera: Tephritidae).

    Science.gov (United States)

    Shen, Guang-Mao; Wang, Xiao-Na; Dou, Wei; Wang, Jin-Jun

    2012-12-01

    The oriental fruit fly, Bactrocera dorsalis, is a major pest that infects fruits and agricultural products worldwide. The latest resistance monitoring of B. dorsalis from mainland China has identified high levels of resistance to insecticides. In this study, the biochemical and molecular characteristics of acetylcholinesterase (AChE) in four field populations of B. dorsalis are investigated. Among the four populations, the DG population and its purified AChE were found to be the least susceptible to malathion and five inhibitors, whereas the KM population and its purified AChE were the most susceptible. The highest catalytic activity of purified AChE was found for the KM population, and the catalytic activity of the DG population was the lowest. Among developmental stages, the AChE purified from larvae was found to be the most insusceptible to inhibitors, but its catalytic activity was the highest. Sequence analysis of the cDNA encoding AChE showed that some residue differences existed. However, no significant differences in expression levels of the AChE gene among populations and developmental stages were detected. The results suggest that the decrease in susceptibility of B. dorsalis was mainly caused by decrease in AChE activity, and they provide a broad view on the relation between AChE and resistance. Copyright © 2012 Society of Chemical Industry.

  19. Pos-harvest control of Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae) in guava fruits (Psidium guajava L.).; Controle pos-colheita de Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae) em frutos de goiaba (Psidium guajava L.)

    Energy Technology Data Exchange (ETDEWEB)

    Doria, Hayda Oliveira Souza

    2006-07-01

    The objective of this work is to evaluate the effect of the treatment with steam heating, hot water and gamma radiation of Co-60 on eggs and fruit flies larvae (Ceratitis capitata Wiedemann, 1824) (Diptera: Tephritidae), and analyze the effect of these treatments in the fruit quality (chemical composition)

  20. Host plants of Melon Fly, Bactrocera cucurbitae(Coquillett)(Diptera:Tephritidae); and provisional list of suitable host plants of the Melon Fly, Bactrocera(Zeugodacus)cucurbitae(Coquillett)(Diptera:Tephritidae),Version 2.0

    Science.gov (United States)

    The melon fly, Bactrocera cucurbitae (Coquillett), is a widespread, economically important tephritid fruit fly (Diptera: Tephritidae) species. Bactrocera cucurbitae infests fruits and vegetables of a number of different plant species, with many host plants in the plant family Cucurbitaceae, but with...

  1. The geographic distribution of Rhagoletis pomonella (Diptera:Tephritidae) in the western United States: Introduced species or native population?

    Science.gov (United States)

    The apple maggot fly, Rhagoletis pomonella Walsh (Diptera: Tephritidae), is a major pest of commercially grown domesticated apple (Malus domestica) in North America. The shift of the fly from its native host hawthorn (Crataegus mollis) to apple in the eastern U.S. is often cited as an example of inc...

  2. Assessment of Navel oranges, Clementine tangerines and Rutaceous fruits as hosts of Bactrocera cucurbitae and Bactrocera latifrons (Diptera: Tephritidae)

    Science.gov (United States)

    Export of Citrus spp., widely cultivated throughout the tropics and subtropics, may require risk mitigation measures if grown in areas with established tephritid fruit fly (Diptera: Tephritidae) populations capable of infesting the fruits. Two tephritid fruit fly species whose geographic ranges have...

  3. Peach is an occasional host for Rhagoletis pomonella (Walsh, 1867) (Diptera: Tephritidae) larvae in Western Washington State, USA

    Science.gov (United States)

    Peach, Prunus persica (L.) Batsch (Rosaceae), has been reported to be a host of the apple maggot fly, Rhagoletis pomonella (Walsh), 1867 (Diptera: Tephritidae), an important quarantine pest of apple (Malus domestica Borkhausen) (Rosaceae) in the western U.S.A. However, all reports of peach as a hos...

  4. A revision of the shore-fly genus Hydrochasma Hendel (Diptera, Ephydridae)

    Science.gov (United States)

    Mathis, Wayne N.; Zatwarnicki, Tadeusz

    2013-01-01

    Abstract A revision of the shore-fly genus Hydrochasma Hendel. The species of the genus Hydrochasma Hendel are revised, including 27 new species (type locality in parenthesis): H. andeum (Ecuador. Guayas: Boliche (02°07.7'S, 79°35.5'W)), H. annae (United States. Utah. Grand: Swasey Beach (15.3 km N Green River; 39°07'N, 110°06.6'W; Green River; 1255 m)), H. capsum (Ecuador. Orellana: RíoTiputini (0°38.2'S, 76°8.9'W)), H. castilloi (Ecuador. Loja: Catamayo (03°59'S, 79°21'W)), H. crenulum (Peru. Cuzco: Paucartambo, Atalaya (Río Alto Madre de Dios; 12°53.3'S, 71°21.6'W; 600 m)), H. denticum (Ecuador. Orellana: Río Tiputini (0°38.2'S, 76°8.9'W)), H. digitatum (Peru. Madre de Dios: Diamante (Río Alto Madre de Dios; 12°19.9'S, 70°57.5'W; 400 m)), H. distinctum (Costa Rica. Limón: Parque Nacional Barbilla, Sector Casas Negras, (10°0.8'N, 83°28.1'W; 300 m)), H. dolabrutum (Dominican Republic. Barahona: Barahona (18°12'N, 71°5.3'W)), H. edmistoni (Dominican Republic. Azua: near Pueblo Viejo (18°24.8'N, 70°44.7'W)), H. falcatum (Peru. Madre de Dios: Río Manu, Erika (near Salvación; 12°50.7'S, 71°23.3'W; 550 m)), H. glochium (Dominican Republic. Peravia: San José Ocoa (10 km NE; 18°35'N, 70°25.6'W)), H. kaieteur (Guyana. Kaieteur Falls (05°10.5'N, 59°26.9'W)), H. lineatum (Trinidad and Tobago. Trinidad. St. George: Filette (1 km SE; 10°47'N, 61°21'W)), H. miguelito (Honduras. Cortés: San Pedro Sula (8 km S; 15°25.7'N, 88°01.4'W)), H. octogonum (Ecuador. Manabí: Pichincha (01°02.7'S, 79°49.2'W)), H. parallelum (Trinidad and Tobago. Trinidad. St. Andrew: Lower Manzanilla (16 km S; 10°22'N, 61°01'W)), H. peniculum (Dominican Republic. Pedernales: Pedernales (18°01.8'N, 71°44.7'W)), H. rictum (Honduras. Cortés: San Pedro Sula (8 km S; 15°25.7'N, 88°01.4'W)), H. robustum (Brazil. São Paulo. Ubatuba, Praia Puruba (23°21'S, 44°55.6'W; beach)), H. sagittarium (Trinidad and Tobago. Tobago: St. John: Parlatuvier (creek; 11°17.9'N

  5. A revision of the shore-fly genus Hydrochasma Hendel (Diptera, Ephydridae

    Directory of Open Access Journals (Sweden)

    Wayne Mathis

    2013-12-01

    Full Text Available A revision of the shore-fly genus Hydrochasma Hendel. The species of the genus Hydrochasma Hendel are revised, including 27 new species (type locality in parenthesis: H. andeum (Ecuador. Guayas: Boliche (02°07.7'S, 79°35.5'W, H. annae (United States. Utah. Grand: Swasey Beach (15.3 km N Green River; 39°07'N, 110°06.6'W; Green River; 1255 m, H. capsum (Ecuador. Orellana: RíoTiputini (0°38.2'S, 76°8.9'W, H. castilloi (Ecuador. Loja: Catamayo (03°59'S, 79°21'W, H. crenulum (Peru. Cuzco: Paucartambo, Atalaya (Río Alto Madre de Dios; 12°53.3'S, 71°21.6'W; 600 m, H. denticum (Ecuador. Orellana: Río Tiputini (0°38.2'S, 76°8.9'W, H. digitatum (Peru. Madre de Dios: Diamante (Río Alto Madre de Dios; 12°19.9'S, 70°57.5'W; 400 m, H. distinctum (Costa Rica. Limón: Parque Nacional Barbilla, Sector Casas Negras, (10°0.8'N, 83°28.1'W; 300 m, H. dolabrutum (Dominican Republic. Barahona: Barahona (18°12'N, 71°5.3'W, H. edmistoni (Dominican Republic. Azua: near Pueblo Viejo (18°24.8'N, 70°44.7'W, H. falcatum (Peru. Madre de Dios: Río Manu, Erika (near Salvación; 12°50.7'S, 71°23.3'W; 550 m, H. glochium (Dominican Republic. Peravia: San José Ocoa (10 km NE; 18°35'N, 70°25.6'W, H. kaieteur (Guyana. Kaieteur Falls (05°10.5'N, 59°26.9'W, H. lineatum (Trinidad and Tobago. Trinidad. St. George: Filette (1 km SE; 10°47'N, 61°21'W, H. miguelito (Honduras. Cortés: San Pedro Sula (8 km S; 15°25.7'N, 88°01.4'W, H. octogonum (Ecuador. Manabí: Pichincha (01°02.7'S, 79°49.2'W, H. parallelum (Trinidad and Tobago. Trinidad. St. Andrew: Lower Manzanilla (16 km S; 10°22'N, 61°01'W, H. peniculum (Dominican Republic. Pedernales: Pedernales (18°01.8'N, 71°44.7'W, H. rictum (Honduras. Cortés: San Pedro Sula (8 km S; 15°25.7'N, 88°01.4'W, H. robustum

  6. Do thermal tolerances and rapid thermal responses contribute to the invasion potential of Bactrocera dorsalis (Diptera: Tephritidae)?

    Science.gov (United States)

    Pieterse, Welma; Terblanche, John S; Addison, Pia

    2017-04-01

    Bactrocera dorsalis (Hendel) (Diptera: Tephritidae) has shown remarkable range expansion over the past 10years and invaded several new continents including Africa. Here we report results of a detailed assessment of acute high and low temperature survival ability and the plasticity thereof, to test the hypothesis that traits of the thermal niche have contributed to the species' invasion ability. We also assess life-stage-related variation of thermal tolerances to determine potential stage-related environmental sensitivity. The temperatures at which c. 20% of the population survived of B. dorsalis were determined to be -6.5°C and 42.7°C, respectively, when using 2h exposures. Further, four life stages of B. dorsalis (egg, 3rd instar larvae, pupae and adults) were exposed to high and low discriminating temperatures to compare their thermal survival rates. The egg stage was found to be the most resistant life stage to both high and low temperatures, since 44±2.3% survived the low and 60±4.2% survived the high discriminating temperature treatments respectively. Finally, the potential for adult hardening responses to mediate tolerance of extremes was also considered using a diverse range of acute conditions (using 2h exposures to 15°C, 10°C and 5°C and 30°C, 35°C, 37°C and 39°C as hardening temperatures, and some treatments with and without recovery periods between hardening and discriminating temperature treatment). These showed that although some significant hardening responses could be detected in certain treatments (e.g. after exposure to 37°C and 39°C), the magnitude of this plasticity was generally low compared to two other wide-spread and more geographically-range-restricted con-familial species, Ceratitis capitata and C. rosa. In other words, Bactrocera dorsalis adults were unable to rapidly heat- or cold-harden to the same extent as the other Ceratitis species examined to date. These results suggest a narrower thermal niche in B. dorsalis compared

  7. A revision of the shore-fly genus Lamproclasiopa Hendel (Diptera, Ephydridae

    Directory of Open Access Journals (Sweden)

    Daniel N.R. Costa

    2016-11-01

    Full Text Available The species of the genus Lamproclasiopa Hendel are revised, including 13 new species (type locality in parenthesis: L. aliceae (United States. New Mexico. Grant: Silver City (Big Ditch; 32°46.4'N, 108°16.5'W; 1790 m, L. argentipicta (Costa Rica. San José. Zurquí de Moravia (10°2.8'N, 84°0.6'W, L. auritunica (Bolívia. Oruro: Paznã (S. of the town; 18°36.2'S, 66°54.7'W, 3750 m., L. brunnea (Costa Rica. San José. Zurquí de Moravia (10°2.8'N, 84°0.6'W, L. caligosa (Chile. Osorno: Anticura (1 km W; 40°39'S, 72°10'W; 430 m, L. curva (Chile. Los Lagos: Chiloé Island, Chepu (on seashore; 42°5'S, 73°59.65'W, L. ecuadoriensis (Ecuador. Orellana: Río Tiputini Biodiversity Station (0°38.2'S, 76°8.9'W, L. furvitibia (Costa Rica. San José. Zurquí de Moravia (10°2.8'N, 84°0.6'W, L. lapaz (Bolívia. La Paz: La Paz (6 km NE; 16°25.7'S, 68°04.3'W; 4130m, L. mancha (Brazil. Paraná: Curitiba, Universidade Federal do Paraná, Reserva Biológica (25°26.9'S, 49°14'W; 915 m, L. triangularis (Peru. Madre de Dios: Río Manu, Pakitza (11°56.6'S, 71°16.9'W; 250 m, L. xanthocera (Brazil. Paraná. Curitiba, Universidade Federal do Paraná, Reserva Biológica (25°26.9'S, 49°14'W; 915 m, L. zerafael (Brazil. Amazonas: Reserva Ducke (02°55.8'S, 59°58.5'W; 40 m. All known species are described with an emphasis on structures of the male terminalia, which are fully illustrated. Detailed locality data and distribution maps for all species are provided. For perspective and to facilitate genus-group and species-group recognition, the tribe Discocerinini is diagnosed and a key to genera in the New World is provided.

  8. A revision of the shore-fly genus Lamproclasiopa Hendel (Diptera, Ephydridae).

    Science.gov (United States)

    Costa, Daniel N R; Mathis, Wayne N; Marinoni, Luciane

    2016-01-01

    The species of the genus Lamproclasiopa Hendel are revised, including 13 new species (type locality in parenthesis): Lamproclasiopa aliceae (United States. New Mexico. Grant: Silver City (Big Ditch; 32°46.4'N, 108°16.5'W; 1790 m)), Lamproclasiopa argentipicta (Costa Rica. San José. Zurquí de Moravia (10°2.8'N, 84°0.6'W)), Lamproclasiopa auritunica (Bolívia. Oruro: Paznã (S. of the town; 18°36.2'S, 66°54.7'W, 3750 m).), Lamproclasiopa brunnea (Costa Rica. San José. Zurquí de Moravia (10°2.8'N, 84°0.6'W)), Lamproclasiopa caligosa (Chile. Osorno: Anticura (1 km W; 40°39'S, 72°10'W; 430 m)), Lamproclasiopa curva (Chile. Los Lagos: Chiloé Island, Chepu (on seashore; 42°5'S, 73°59.65'W)), Lamproclasiopa ecuadoriensis (Ecuador. Orellana: Río Tiputini Biodiversity Station (0°38.2'S, 76°8.9'W)), Lamproclasiopa furvitibia (Costa Rica. San José. Zurquí de Moravia (10°2.8'N, 84°0.6'W)), Lamproclasiopa lapaz (Bolívia. La Paz: La Paz (6 km NE; 16°25.7'S, 68°04.3'W; 4130m)), Lamproclasiopa mancha (Brazil. Paraná: Curitiba, Universidade Federal do Paraná, Reserva Biológica (25°26.9'S, 49°14'W; 915 m)), Lamproclasiopa triangularis (Peru. Madre de Dios: Río Manu, Pakitza (11°56.6'S, 71°16.9'W; 250 m)), Lamproclasiopa xanthocera (Brazil. Paraná. Curitiba, Universidade Federal do Paraná, Reserva Biológica (25°26.9'S, 49°14'W; 915 m)), Lamproclasiopa zerafael (Brazil. Amazonas: Reserva Ducke (02°55.8'S, 59°58.5'W; 40 m)). All known species are described with an emphasis on structures of the male terminalia, which are fully illustrated. Detailed locality data and distribution maps for all species are provided. For perspective and to facilitate genus-group and species-group recognition, the tribe Discocerinini is diagnosed and a key to genera in the New World is provided.

  9. A revision of the shore-fly genus Lamproclasiopa Hendel (Diptera, Ephydridae)

    Science.gov (United States)

    Costa, Daniel N. R.; Mathis, Wayne N.; Marinoni, Luciane

    2016-01-01

    Abstract The species of the genus Lamproclasiopa Hendel are revised, including 13 new species (type locality in parenthesis): Lamproclasiopa aliceae (United States. New Mexico. Grant: Silver City (Big Ditch; 32°46.4'N, 108°16.5'W; 1790 m)), Lamproclasiopa argentipicta (Costa Rica. San José. Zurquí de Moravia (10°2.8'N, 84°0.6'W)), Lamproclasiopa auritunica (Bolívia. Oruro: Paznã (S. of the town; 18°36.2'S, 66°54.7'W, 3750 m).), Lamproclasiopa brunnea (Costa Rica. San José. Zurquí de Moravia (10°2.8'N, 84°0.6'W)), Lamproclasiopa caligosa (Chile. Osorno: Anticura (1 km W; 40°39'S, 72°10'W; 430 m)), Lamproclasiopa curva (Chile. Los Lagos: Chiloé Island, Chepu (on seashore; 42°5'S, 73°59.65'W)), Lamproclasiopa ecuadoriensis (Ecuador. Orellana: Río Tiputini Biodiversity Station (0°38.2'S, 76°8.9'W)), Lamproclasiopa furvitibia (Costa Rica. San José. Zurquí de Moravia (10°2.8'N, 84°0.6'W)), Lamproclasiopa lapaz (Bolívia. La Paz: La Paz (6 km NE; 16°25.7'S, 68°04.3'W; 4130m)), Lamproclasiopa mancha (Brazil. Paraná: Curitiba, Universidade Federal do Paraná, Reserva Biológica (25°26.9'S, 49°14'W; 915 m)), Lamproclasiopa triangularis (Peru. Madre de Dios: Río Manu, Pakitza (11°56.6'S, 71°16.9'W; 250 m)), Lamproclasiopa xanthocera (Brazil. Paraná. Curitiba, Universidade Federal do Paraná, Reserva Biológica (25°26.9'S, 49°14'W; 915 m)), Lamproclasiopa zerafael (Brazil. Amazonas: Reserva Ducke (02°55.8'S, 59°58.5'W; 40 m)). All known species are described with an emphasis on structures of the male terminalia, which are fully illustrated. Detailed locality data and distribution maps for all species are provided. For perspective and to facilitate genus-group and species-group recognition, the tribe Discocerinini is diagnosed and a key to genera in the New World is provided. PMID:27917044

  10. Les mouches des fruits (Diptera : Tephritidae) au Togo: inventaire ...

    African Journals Online (AJOL)

    Trois espèces de Tephritidae ont été recensées : Bactrocera invadens Drew, Tsuruta and White, Bactrocera cucurbitae (Coquillett) et Dacus bivittatus (Bigot). Deux espèces (B. invadens et B. cucurbitae) sont invasives et une espèce (D. bivittatus) est indigène. Parmi les espèces invasives, B. invadens est d'une importance ...

  11. Attraction and mortality of Bactrocera dorsalis (Diptera: Tephritidae) to STATIC Spinosad ME weathered under operational conditions in California and Florida: a reduced-risk male annihilation treatment.

    Science.gov (United States)

    Vargas, Roger I; Souder, Steven K; Hoffman, Kevin; Mercogliano, Juan; Smith, Trevor R; Hammond, Jack; Davis, Bobbie J; Brodie, Matt; Dripps, James E

    2014-08-01

    Studies were conducted in 2013-2014 to quantify attraction, feeding, and mortality of male oriental fruit flies, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), to STATIC Spinosad ME a reduced-risk male annihilation treatment (MAT) formulation consisting of an amorphous polymer matrix in combination with methyl eugenol (ME) and spinosad compared with the standard treatment of Min-U-Gel mixed with ME and naled (Dibrom). Our approach used a behavioral methodology for evaluation of slow-acting reduced-risk insecticides. ME treatments were weathered for 1, 7, 14, 21, and 28 d under operational conditions in California and Florida and shipped to Hawaii for bioassays. In field tests using bucket traps to attract and capture wild males, and in toxicity studies conducted in 1-m(3) cages using released males of controlled ages, STATIC Spinosad ME performed equally as well to the standard formulation of Min-U-Gel ME with naled for material aged up to 28 d in both California and Florida. In laboratory feeding tests in which individual males were exposed for 5 min to the different ME treatments, mortality induced by STATIC Spinosad ME recorded at 24 h did not differ from mortality caused by Min-U-Gel ME with naled at 1, 7, 14, and 21 d in California and was equal to or higher for all weathered time periods in Florida during two trials. Spinosad has low contact toxicity, and when mixed with an attractant and slow release matrix, offers a reduced-risk alternative for eradication of B. dorsalis and related ME attracted species, without many of the potential negative effects to humans and nontargets associated with broad-spectrum contact insecticides such as naled.

  12. ANÁLISE FAUNÍSTICA E FLUTUAÇÃO POPULACIONAL DE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE EM BELMONTE, BAHIA

    Directory of Open Access Journals (Sweden)

    MÍRIAN DA SILVA SANTOS

    2011-01-01

    Full Text Available This study was carried out in a mixed orchard in the municipality of Belmonte, in the southernmost region of Bahia and it aimed at characterizing the fruit fly (Diptera: Tephritidae population using faunistic analysis and studying its population fluctuation. The study was conducted from August 2007 to August 2009. Fruit fly captures were carried out using McPhail traps baited with protein hydrolisate at 5%. Weekly, the captured insects found in traps were transferred to plastic vials, one vial per trap, filled with 70% ethanol and taken to the laboratory for identification. A total of 9,709 fruit flies was captured, out of which 9,477 specimens were Anastrepha (5,908 females and 3,569 males and 232 specimens were Ceratitis capitata (Wiedemann (201 females and 31 males. Nine species of Anastrepha were recorded: Anastrepha bahiensis (Lima (2.59%, Anastrepha distincta (Greene (2.71%, Anastrepha fraterculus (Wiedemann (59.37%, Anastrepha leptozona (Hendel (0.02%, Anastrepha manihoti (Lima (0.02%, Anastrepha obliqua (Macquart (2.98%, Anastrepha serpentina (Wiedemann (0.07%, Anastrepha sororcula Zucchi (29.14%, Anastrepha zenildae Zucchi (0.22%, and C. capitata (2.88%. Anastrepha fraterculus and A. sororcula were the dominant species and only A. fraterculus was constant on the orchard. The values of the Simpson (0.51 and of Shannon (01.35 indices were intermediate and the modified Hill index was 0.49, indicating a medium diversity. The high est capturevalues of Anastrepha spp. occurred from July to December 2008, with a population peak in September.

  13. An assessment of cold hardiness and biochemical adaptations for cold tolerance among different geographic populations of the Bactrocera dorsalis (Diptera: Tephritidae) in China.

    Science.gov (United States)

    Wang, Junhua; Zeng, Ling; Han, Zhaojun

    2014-01-01

    The cold hardiness of larvae, pupae, and adults of the oriental fruit fly, Bactrocera Dorsalis (Hendel) (Diptera: Tephritidae) was characterized first, and then body water, total sugar and glycerol contents, and activities of superoxide dismutase (SOD), catalase (CAT), peroxidase (POD), and alcohol dehydrogenase (ADH) of different geographical populations subjected to suitable rearing conditions and under sublethal low-temperature stress were compared. The cold hardiness of different populations was well correlated with the latitudes of distributions. The northern marginal population (31.6° N) had higher cold tolerance than southern populations (23.1° N and 24.3° N). Among different life stages, larvae had the least cold tolerance, whereas pupae had the most tolerance. Under suitable rearing conditions, the marginal population had lower activities of all four tested enzymes than that of the southern populations and also had lower body water and higher total sugar and glycerol contents. The low-temperature stress induced higher SOD, CAT, POD, and ADH activities of all tested life stages and of all tested populations with higher increase intensity in adults and pupae than in larvae. The increase intensity was higher in the marginal population than in the southern populations. Pupae in the marginal population and adults in the southern populations showed the largest activity enhancement, which agreed with the insect's overwinter stages in their respective locations. Lower temperature stress lowered body water and total sugar contents and increased glycerol contents. The results revealed a strong correlation between the cold hardiness of a population and the concentration or activity of various biochemicals and enzymes known to be involved in cold tolerance. The marginal population of B. dorsalis might have evolved a new biotype with better adaption to low temperature. © The Author 2014. Published by Oxford University Press on behalf of the Entomological Society of

  14. Impact of introduction of Bactrocera dorsalis (Diptera: Tephritidae) and classical biological control releases of Fopius arisanus (Hymenoptera: Braconidae) on economically important fruit flies in French Polynesia.

    Science.gov (United States)

    Vargas, Roger I; Leblanc, Luc; Putoa, Rudolph; Eitam, Avi

    2007-06-01

    Oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), was discovered on Tahiti Island in July 1996. Eradication programs were conducted from 1997 to 2001, but failed. From 1998 to 2006, B. dorsalis was recovered from 29 different host fruit from the five Society Islands: Tahiti, Moorea, Raiatea, Tahaa, and Huahine. Analysis of coinfestation patterns by B. dorsalis, Bactrocera tryoni (Froggatt), and Bactrocera kirki (Froggatt) suggested B. dorsalis had displaced these two species and become the most abundant fruit fly in coastal areas. To suppress B. dorsalis populations, a classical biological control program was initiated to introduce the natural enemy Fopius arisanus (Sonan) (Hymenoptera: Braconidae) into French Polynesia from Hawaii. Wasps were released and established on Tahiti, Moorea, Raiatea, Tahaa, and Huahine Islands. In guava, Psidium guajava L., collections for Tahiti, F. arisanus parasitism of fruit flies was 2.1, 31.8, 37.5, and 51.9% for fruit collected for 2003, 2004, 2005 and 2006, respectively. Based on guava collections in 2002 (before releases) and 2006 (after releases), there was a subsequent decrease in numbers of B. dorsalis, B. tryoni, and B. kirki fruit flies emerging (per kilogram of fruit) by 75.6, 79.3, and 97.9%, respectively. These increases in F. arisanus parasitism and decreases in infestation were similar for other host fruit. Establishment of F. arisanus is the most successful example of classical biological control of fruit flies in the Pacific area outside of Hawaii and serves as a model for introduction into South America, Africa, and China where species of the B. dorsalis complex are established.

  15. Description of a new species and new country distribution records of Bactrocera (Diptera: Tephritidae: Dacinae) from Cambodia.

    Science.gov (United States)

    Leblanc, Luc; San Jose, Michael; Rubinoff, Daniel

    2015-09-04

    Bactrocera (Bactrocera) kohkongiae Leblanc (Diptera: Tephritidae: Dacinae), from the Koh Kong Province of Cambodia, is described as new. This species belongs to the Oriental fruit fly (B. dorsalis) complex. Genetic sequences (mitochondrial COI and nuclear EF1α and Period) are deposited in GenBank. A haplotype network, based on the COI sequences for 21 specimens, shows high genetic diversity. New country records from Cambodia are included for 22 species.

  16. Mating compatibility between Bactrocera invadens and Bactrocera dorsalis (Diptera: Tephritidae).

    Science.gov (United States)

    Bo, W; Ahmad, S; Dammalage, T; Tomas, U Sto; Wornoayporn, V; Ul Haq, I; Cáceres, C; Vreysen, M J B; Schutze, M K

    2014-04-01

    The invasive fruit fly, Bactrocera invadens Drew, Tsuruta & White, is a highly polyphagous fruit pest that occurs predominantly in Africa yet has its origins in the Indian subcontinent. It is extremely morphologically and genetically similar to the Oriental fruit fly, Bactrocera dorsalis (Hendel); as such the specific relationship between these two species is unresolved. We assessed prezygotic compatibility between B. dorsalis and B. invadens using standardized field cage mating tests, which have proven effectiveness in tephritid cryptic species studies. These tests were followed by an assessment of postzygotic compatibility by examining egg viability, larval and pupal survival, and sex ratios of offspring produced from parental and subsequent F1 crosses to examine for hybrid breakdown as predicted under a two-species hypothesis. B. dorsalis was sourced from two countries (Pakistan and China), and each population was compared with B. invadens from its type locality of Kenya. B. invadens mated randomly with B. dorsalis from both localities, and there were generally high levels of hybrid viability and survival resulting from parental and F1 crosses. Furthermore, all but one hybrid cross resulted in equal sex ratios, with the single deviation in favor of males and contrary to expectations under Haldane's rule. These data support the hypothesis that B. dorsalis and B. invadens represent the same biological species, an outcome that poses significant implications for pest management and international trade for sub-Saharan Africa.

  17. An Additional Phytosanitary Cold Treatment Against Ceratitis capitata (Diptera: Tephritidae) in 'Oroblanco' Citrus Fruit.

    Science.gov (United States)

    Gazit, Yoav; Kaspi, Roy

    2017-04-01

    For 'Oroblanco' ('Sweetie'), the sweet seedless pummelo-grapefruit hybrid, when exported from Israel to Japan, the standard cold treatment against Ceratitis capitata (Wied.) (Diptera: Tephritidae) is conducted at ≤ 1.5 °C, for 16 d. In recent years, the transportation means of exported citrus was changed from reefer vessels to individual refrigerated containers, where the fruit bulk is relatively small and may be exposed to temperature fluctuations and to the risk of chilling injuries. To reduce this risk, Israel proposed to Japan to increase the treatment temperature and extend its duration to 2.2 °C and 18 d, respectively. This study shows that the proposed treatment effectively kills the third instar larva of C. capitata, in Oroblanco. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  18. Selection of Ceratitis capitata (Diptera: Tephritidae) Specific Recombinant Monoclonal Phage Display Antibodies for Prey Detection Analysis

    Science.gov (United States)

    Monzó, César; Urbaneja, Alberto; Ximénez-Embún, Miguel; García-Fernández, Julia; García, José Luis; Castañera, Pedro

    2012-01-01

    Several recombinant antibodies against the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), one of the most important pests in agriculture worldwide, were selected for the first time from a commercial phage display library of human scFv antibodies. The specificity and sensitivity of the selected recombinant antibodies were compared with that of a rabbit polyclonal serum raised in parallel using a wide range of arthropod species as controls. The selected recombinant monoclonal antibodies had a similar or greater specificity when compared with classical monoclonal antibodies. The selected recombinant antibodies were successfully used to detect the target antigen in the gut of predators and the scFv antibodies were sequenced and compared. These results demonstrate the potential for recombinant scFv antibodies to be used as an alternative to the classical monoclonal antibodies or even molecular probes in the post-mortem analysis studies of generalist predators. PMID:23272105

  19. Natural Field Infestation of and by Oriental Fruit Fly, (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Grant T McQuate

    2017-07-01

    Full Text Available Mango, Mangifera indica (Anacardiaceae, is a crop cultivated pantropically. There are, however, many other Mangifera spp (“mango relatives” which have much more restricted distributions and are poorly known but have potential to produce mango-like fruits in areas where mangoes do not grow well or could be tapped in mango breeding programs. Because of the restricted distribution of many of the Mangifera spp, there has also been limited data collected on susceptibility of their fruits to infestation by tephritid fruit flies which is important to know for concerns both for quality of production and for quarantine security of fruit exports. Here, we report on natural field infestation by the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae, of two mango relatives native to Indonesia: Mangifera casturi and Mangifera lalijiwa . Rates of infestation of fruits of these two Mangifera spp by tephritid fruit flies have not previously been reported.

  20. Grapefruit as a host for the West Indian fruit fly (Diptera: Tephritidae).

    Science.gov (United States)

    Mangan, Robert L; Thomas, Donald B; Moreno, Aleena Tarshis; Robacker, David

    2011-02-01

    The most common hosts for the West Indian fruit fly, Anastrepha obliqua (Macquart) (Diptera: Tephritidae) are fruit in the family Anacardiaceae (mango [Mangifera L.] and mombin [Spondias L.] species). However, similar to many of the tropical fruit flies of major economic importance, this species attacks several other families of crop fruit, including Annonaceae (cherimoya, Annona cherimola Mill.), Myrtaceae (guava, Psidium L.), Oxalidaceae (carambola, Averrhoa carambola L.), Passifloraceae (granadilla, Passiflora quadrangularis Mill.), and Sapotaceae [mamey sapote, Pouteria sapota (Jacq.) H. E. Moore & Steam]. In the family Rutaceae the economically important genus Citrus has been reported and until recently considered a host for this fruit fly. In this study, we reviewed the taxonomy of A. obliqua, tested specific chemicals that may inhibit oviposition, compared egg-to-adult survival of A. obliqua on preferred hosts and on grapefruit (Citrus X paradisi Macfad.), and measured fruit tissue-specific developmental rates of A. obliqua and the known citrus breeding Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae), from egg to pupae. Our literature review shows much confusion concerning the taxonomy of this and related Anastrepha species, including synonymies and confusion with other species. The deterrent effect of the highest concentration of flavonoids for oviposition, although significant, was not absolute. Experiments carried out under laboratory conditions showed 15-40 times greater survival of A. ludens (whose preferred hosts include Rutaceae) on grapefruit compared with A. obliqua for both tree attached and harvested fruit. Experiments of survival of developing stages over time showed that the two species oviposit into different tissues in the fruit, and mortality is much higher for the West Indian fruit fly in the flavedo and albedo of the fruit compared with the Mexican fruit fly.

  1. Development of allele-specific single-nucleotide polymorphism-based polymerase chain reaction markers in cytochrome oxidase I for the differentiation of Bactrocera papayae and Bactrocera carambolae (Diptera: Tephritidae).

    Science.gov (United States)

    Chua, Tock H; Song, B K; Chong, Y V

    2010-12-01

    Differentiation of Bactrocera papayae Drew & Hancock and Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae) based on morphological characters has often been problematical. We describe here a single-nucleotide polymorphism (SNP)-based polymerase chain reaction (PCR) assay to differentiate between these two species. For detection of SNPs, fragments derived from each species were amplified using two primer pairs, COIF/COIR and UEA7/UEA10, sequenced, and aligned to obtain a contiguous 1,517-bp segment. Two new sets of primers were designed based on the 11 SNPs identified in the region. Results of the SNP-PCR test using any one of these species-specific primer sets indicate that these two species could be differentiated on basis of presence or absence of a band in the gel profile. We also tested the SNP-PCR primers on Bactrocera umbrosa F., Bactrocera cucurbitae Coquillett, Bactrocera latifrons Hendel, and Bactrocera tau (Walker) but did not detect any band in the gel, indicating the likelihood of a false positive for B. papayae is nil. This SNP-PCR method is efficient and useful, especially for immature life stages or when only adult body parts of the two species are available for identification, as encountered often in quarantine work.

  2. Development of Rhagoletis pomonella and Rhagoletis indifferens (Diptera: Tephritidae)in mango and other tropical and temperate fruit in the laboratory

    Science.gov (United States)

    Temperate fruit flies in the genus Rhagoletis (Diptera: Tephritidae) have narrow host ranges relative to those of tropical fruit flies, suggesting they will not attack or are incapable of developing in most novel fruit. Here we tested the hypothesis that apple maggot fly, Rhagoletis pomonella (Wals...

  3. A comparative assessment of the response of three fruit fly species (Diptera: Tephritidae) to a spinosad-based bait: Effect of ammonium acetate, female age, and protein hunger

    Science.gov (United States)

    Ammonia-releasing substances are known to play an important role in fruit fly (Diptera: Tephritidae) attraction to food sources and this information has been exploited for the development of effective synthetic food-based lures and insecticidal baits. In field studies conducted in Hawaii, we examine...

  4. Capture of melon flies, Zeugodacus cucurbitae (Diptera: Tephritidae), in a food-baited Multilure trap: influence of distance, diet, and sex

    Science.gov (United States)

    Many countries operate trapping programs to detect invasions of pestiferous fruit fly species (Diptera: Tephritidae). Surveillance relies heavily on traps baited with male lures, which, while powerful, have limited effectiveness, because (i) they are sex-specific and (ii) males of some species do no...

  5. Ammonium acetate enhances the attractiveness of a variety of protein-based baits to female Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    Ammonia and its derivatives are used largely by female fruit 32 flies (Diptera: Tephritidae) as volatile cues to locate protein-rich food needed to produce their eggs. This need for external protein sources has led to the development of behaviorally-based control strategies such a food-based lures a...

  6. An overview of tropical pest species of bactrocera fruit flies (Diptera:Tephritidae) and the integration of biopesticides with other biological approaches for their management

    Science.gov (United States)

    Fruit flies (Diptera:Tephritidae) are among the most economically important pest species in the world, attacking a wide range of fruits and fleshy vegetables throughout tropical and sub-tropical areas of the world. These species are such devastating crop pests that major control and eradication prog...

  7. Host plants of Carambola fruit fly, Bactrocera carambolae Drew & Hancock(Diptera:Tephritidae);and provisional list of suitable host plants of Carambola fruit fly,(Bactrocera(Bactrocera) carambolae Drew & Hancock(Diptera:Tep

    Science.gov (United States)

    Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae), commonly known as the carambola fruit fly, is native to Southeast Asia, but has extended its geographic range to several countries in South America. As with other tephritid fruit fly species, establishment of B.carambolae in areas where it...

  8. Susceptibility of fruit from diverse apple and crabapple germplasm to attack from apple maggot (Diptera: Tephritidae).

    Science.gov (United States)

    Myers, Clayton T; Reissig, W Harvey; Forsline, Phillip L

    2008-02-01

    Apple maggot, Rhagoletis pomonella (Walsh) (Diptera: Tephritidae), is a pest of major concern to apple, Malus x domestica (Borkh.) production in eastern North America. Host plant resistance to apple maggot among apple germplasm has been previously evaluated among a small number of exotic Malus accessions and domestic hybrid selections. However, a large number of exotic accessions housed in USDA collections have never been evaluated for their susceptibility to apple pests. Additionally, previous reports of resistance need to be confirmed under both field conditions and with more rigorous laboratory evaluations. Thus, studies were conducted to evaluate the susceptibility of a number of Malus accessions housed at the USDA Plant Genetic Resources Unit "core" collection. Contrary to earlier published reports, these results suggest that some selections previously described as "resistant" are in fact susceptible to both oviposition damage and larval feeding damage by apple maggot. One domestic, disease-resistant apple accession, 'E36-7' is resistant to survival of apple maggot larvae except when the fruit is nearly ripe in late fall. This is the first report of an apple cultivar that is confirmed to be resistant to larval feeding of apple maggot. Although adults can successfully oviposit on all accessions examined, larval survival was zero in a number of small-fruited crabapple accessions classified as resistant in previous studies and also in two accessions, Malus tschonoskii (Maxim) C. K. Schneid. and M. spectabilis (Aiton) Borkh., that have not been previously evaluated.

  9. Survival and development of immature stages of the Mediterranean fruit fly (Diptera: Tephritidae) in citrus fruit.

    Science.gov (United States)

    Papachristos, Dimitrios P; Papadopoulos, Nikos T; Nanos, George D

    2008-06-01

    We studied, under laboratory conditions, the performance of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), immature stages in intact whole fruit of three sweet orange varieties, lemon, and bitter oranges. Both citrus variety and fruit part (flavedo, albedo, and pulp) had strong effects on larval performance, smaller effects on pupae, and no effects on eggs. Fruit peel was the most critical parameter for larval development and survival, drastically affecting larval survival (inducing very high mortality rates). Among fruit regions, survival of larvae placed in flavedo was zero for all varieties tested except for bitter orange (22.5% survival), whereas survival in albedo was very low (9.8-17.4%) for all varieties except for bitter orange (76%). Survival of pupae obtained from larvae placed in the above-mentioned fruit regions was high for all varieties tested (81.1-90.7%). Fruit pulp of all citrus fruit tested was favorable for larval development. The highest survival was observed on bitter oranges, but the shortest developmental times and heaviest pupae were obtained from orange cultivars. Pulp chemical properties, such as soluble solid contents, acidity, and pH had rather small effects on larval and pupal survival and developmental time (except for juice pH on larvae developmental duration), but they had significant effects on pupal weight.

  10. Olfactory response of the Mexican fruit fly (Diptera: Tephritidae) to Citrus aurantium volatiles.

    Science.gov (United States)

    Rasgado, Milton A; Malo, Edi A; Cruz-López, Leopoldo; Rojas, Julio C; Toledo, Jorge

    2009-04-01

    We investigated the behavioral and electrophysiological responses of male and female Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae), to volatiles of bitter orange fruit, Citrus aurantium L. In field cage tests, the number of A. ludens caught in Multilure traps baited with mature green bitter orange fruit was significantly higher than the number captured in traps baited with ripe yellow bitter orange fruit and control (unbaited traps). Both sexes were more attracted to mature green bitter orange fruit extracts than to controls in both flight tunnel and field cage assays. Gas chromatography-mass spectrometry analysis of the mature green bitter orange fruit volatiles identified 10 different compounds. Limonene was the most abundant volatile compound, followed by an unknown compound, tentatively identified as trans-ocimene. Linalool, beta-pinene, and methyl salicylate were found in lower proportions. Both sexes of A. ludens evoked higher antennal response to linalool, methyl salicylate, and to a blend of these four components in comparison with limonene, and beta-pinene. In flight tunnel, both sexes were more attracted and landed more often on spheres baited with the four-component blend compared with control spheres. In field cage tests, Multilure traps baited with the four-component blend captured significantly more A. ludens flies than traps baited with hydrolyzed protein or control traps.

  11. Conditional embryonic lethality to improve the sterile insect technique in Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    Schetelig, Marc F; Caceres, Carlos; Zacharopoulou, Antigone; Franz, Gerald; Wimmer, Ernst A

    2009-01-01

    Background The sterile insect technique (SIT) is an environment-friendly method used in area-wide pest management of the Mediterranean fruit fly Ceratitis capitata (Wiedemann; Diptera: Tephritidae). Ionizing radiation used to generate reproductive sterility in the mass-reared populations before release leads to reduction of competitiveness. Results Here, we present a first alternative reproductive sterility system for medfly based on transgenic embryonic lethality. This system is dependent on newly isolated medfly promoter/enhancer elements of cellularization-specifically-expressed genes. These elements act differently in expression strength and their ability to drive lethal effector gene activation. Moreover, position effects strongly influence the efficiency of the system. Out of 60 combinations of driver and effector construct integrations, several lines resulted in larval and pupal lethality with one line showing complete embryonic lethality. This line was highly competitive to wildtype medfly in laboratory and field cage tests. Conclusion The high competitiveness of the transgenic lines and the achieved 100% embryonic lethality causing reproductive sterility without the need of irradiation can improve the efficacy of operational medfly SIT programs. PMID:19173707

  12. Oviposition of fruit flies (Diptera: Tephritidae and its relation with the pericarp of citrus fruits

    Directory of Open Access Journals (Sweden)

    N. P. Dias

    2017-10-01

    Full Text Available Abstract Fruit flies (Diptera: Tephritidae represent a threat to fruit growing worldwide, mainly the citrus culture, however, biological studies show that fruit flies are not perfectly adapted to this host. This study investigated oviposition of Anastrepha fraterculus (Wiedemann, 1830 and Ceratitis capitata (Wiedemann, 1824 and its relation with the pericarp of citrus fruits. We evaluated the relationship between depth of oviposition of A. fraterculus and C. capitata and epicarp thickness of orange [Citrus sinensis (L. Osbeck] ‘Navelina’ and tangerine [C. reticulata (L.] ‘Clemenules’ and the influence of fruit mesocarp of tangerine ‘Clemenules’ on oviposition of these species. The study was conducted under controlled conditions of temperature (25 ± 2 °C, relative humidity (70 ± 10% RH and photophase (12 h. A. fraterculus and C. capitata laid their eggs in the flavedo region of orange ‘Navelina’ and between the albedo and flavedo of tangerine ‘Clemenules’. When fruits with mesocarp exposed were offered, there was no oviposition by both fruit fly species. The results show that epicarp thickness of citrus fruits did not influence oviposition of A. fraterculus and C. capitata as oviposition did not occur only in the presence of the mesocarp, suggesting that other factors are involved in oviposition of these species.

  13. Large scale artificial rearing of Anastrepha sp.1 aff. fraterculus (Diptera: Tephritidae in Brazil

    Directory of Open Access Journals (Sweden)

    Julio Marcos Melges Walder

    2014-08-01

    Full Text Available Some species of the genus Anastrepha (Diptera: Tephritidae are successfully managed by matching the sterile insect technique with parasitoid releases. Such strategies used in integrated pest management can be implemented only where insect mass-rearing programs are feasible. In this study, we show the process of domestication, rearing technology and quality control data obtained from 54 generations of Anastrepha sp.1 aff. fraterculus (Wiedemann, 1830 kept under fully artificial conditions. Eggs were collected by an artificial oviposition panel consisting of one side of the cage made of blue voile fabric externally covered with a thin layer of silicon rubber. They were then air-bubbled in water at 25 ºC for 48 h before seeding. Larvae were reared on the regular laboratory artificial diet with 66 % of agar reduction turning over a semi-liquid diet, which reduced costs and improved insect quality. The adult and larval diets were composed of local ingredients including hydrolyzed yeast. When large-scale production of this fly is contemplated, the critical stage is larval development. This system of artificial rearing for A. fraterculus sp.1 developed in Brazil, allows for the production of a large number of insects of excellent quality using local ingredients and less agar in diet composition than the original medium used for this species. By reducing the interval of egg collection, the system might be optimized in terms of insect yield and, therefore, meet the demands of A. fraterculus sp.1 with regard to integrated pest management purposes.

  14. Conditional embryonic lethality to improve the sterile insect technique in Ceratitis capitata (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Franz Gerald

    2009-01-01

    Full Text Available Abstract Background The sterile insect technique (SIT is an environment-friendly method used in area-wide pest management of the Mediterranean fruit fly Ceratitis capitata (Wiedemann; Diptera: Tephritidae. Ionizing radiation used to generate reproductive sterility in the mass-reared populations before release leads to reduction of competitiveness. Results Here, we present a first alternative reproductive sterility system for medfly based on transgenic embryonic lethality. This system is dependent on newly isolated medfly promoter/enhancer elements of cellularization-specifically-expressed genes. These elements act differently in expression strength and their ability to drive lethal effector gene activation. Moreover, position effects strongly influence the efficiency of the system. Out of 60 combinations of driver and effector construct integrations, several lines resulted in larval and pupal lethality with one line showing complete embryonic lethality. This line was highly competitive to wildtype medfly in laboratory and field cage tests. Conclusion The high competitiveness of the transgenic lines and the achieved 100% embryonic lethality causing reproductive sterility without the need of irradiation can improve the efficacy of operational medfly SIT programs.

  15. Desiccation resistance of wild and mass-reared Bactrocera tryoni (Diptera: Tephritidae).

    Science.gov (United States)

    Weldon, C W; Yap, S; Taylor, P W

    2013-12-01

    In pest management programmes that incorporate the sterile insect technique (SIT), the ability of mass-reared insects to tolerate dry conditions may influence their survival after release in the field. In the present study, desiccation resistance of adult mass-reared Queensland fruit flies, Bactrocera tryoni (Frogatt) (Diptera: Tephritidae), that are routinely released in SIT programmes was compared with that of wild flies at 1, 10 and 20 days after adult eclosion. Under dry conditions without access to food or water, longevity of mass-reared B. tryoni was significantly less than that of their wild counterparts. Desiccation resistance of mass-reared flies declined monotonically with age, but this was not the case for wild flies. The sharp decline in desiccation resistance of mass-reared flies as they aged was likely explained by decreased dehydration tolerance. As in an earlier study, desiccation resistance of females was significantly lower than that of males but this was particularly pronounced in mass-reared females. Female susceptibility to dry conditions corresponded with declining dehydration tolerance with age and associated patterns of reproductive development, which suggests that water content of their oocyte load is not available for survival during periods of water stress.

  16. Methyl eugenol aromatherapy enhances the mating competitiveness of male Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae).

    Science.gov (United States)

    Haq, Ihsan; Vreysen, Marc J B; Cacéres, Carlos; Shelly, Todd E; Hendrichs, Jorge

    2014-09-01

    Males of Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae) are strongly attracted to methyl eugenol (ME) (1,2-dimethoxy-4-(2-propenyl)benzene), a natural compound occurring in variety of plant species. ME-feeding is known to enhance male B. carambolae mating competitiveness 3 days after feeding. Enhanced male mating competitiveness due to ME-feeding can increase the effectiveness of sterile insect technique (SIT) manifolds. However, the common methods for emergence and holding fruit flies prior to field releases do not allow the inclusion of any ME feeding treatment after fly emergence. Therefore this study was planned to assess the effects of ME-aromatherapy in comparison with ME feeding on male B. carambolae mating competitiveness as aromatherapy is pragmatic for fruit flies emergence and holding facilities. Effects of ME application by feeding or by aromatherapy for enhanced mating competitiveness were evaluated 3d after treatments in field cages. ME feeding and ME aromatherapy enhanced male mating competitiveness as compared to untreated males. Males treated with ME either by feeding or by aromatherapy showed similar mating success but mating success was significantly higher than that of untreated males. The results are discussed in the context of application of ME by aromatherapy as a pragmatic approach in a mass-rearing facility and its implications for effectiveness of SIT. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  17. Small-Scale Spatio-Temporal Distribution of Bactrocera minax (Enderlein) (Diptera: Tephritidae) Using Probability Kriging.

    Science.gov (United States)

    Wang, S Q; Zhang, H Y; Li, Z L

    2016-10-01

    Understanding spatio-temporal distribution of pest in orchards can provide important information that could be used to design monitoring schemes and establish better means for pest control. In this study, the spatial and temporal distribution of Bactrocera minax (Enderlein) (Diptera: Tephritidae) was assessed, and activity trends were evaluated by using probability kriging. Adults of B. minax were captured in two successive occurrences in a small-scale citrus orchard by using food bait traps, which were placed both inside and outside the orchard. The weekly spatial distribution of B. minax within the orchard and adjacent woods was examined using semivariogram parameters. The edge concentration was discovered during the most weeks in adult occurrence, and the population of the adults aggregated with high probability within a less-than-100-m-wide band on both of the sides of the orchard and the woods. The sequential probability kriged maps showed that the adults were estimated in the marginal zone with higher probability, especially in the early and peak stages. The feeding, ovipositing, and mating behaviors of B. minax are possible explanations for these spatio-temporal patterns. Therefore, spatial arrangement and distance to the forest edge of traps or spraying spot should be considered to enhance pest control on B. minax in small-scale orchards.

  18. MORPHOMETRIC STUDY FOR IDENTIFICATION OF THE BACTROCERA DORSALIS COMPLEX (DIPTERA : TEPHRITIDAE USING WING IMAGE ANALYSIS

    Directory of Open Access Journals (Sweden)

    A. ADSAVAKULCHAI

    1999-01-01

    Full Text Available The Bactrocera dorsalis complex (Diptera: Tephritidae used in this study included B. dorsalis, B. arecae, B. propinqua, B. pyrifoliae, B. verbascifoliae, and three new species complexes are species E, species K and species P. Bactrocera tau was used as an out-group. A total of 424 adults, which emerged from pupae collected from natural populations in Thai land, were prepared for wing measurements. Morphometric analysis was performed on measurements of wing vein characters. Wing images were captured in digital format and taken through digital image processing to calculate the Euclidean distance between wing vein junctions. Discriminant and cluster analyses were used for dichotomy of classification processes. All 424 wing specimens were classified to species in terms of the percentage of "grouped" cases which yielded about 89.6% accurate identificati on compared with the formal description of these species. After clustering, the percentage of "grouped"cases yielded 100.0%, 98.9%, 98.1%, 95.2% and 84.6% accurate identification between the B. dorsalis complex and B. tau; B. arecae and Species E; B. dorsalis and B. verbascifoliae; B. propinqua and B. pyrifoliae; and species K and species P, respectively. This method of numerical taxonomy may be useful for practical identification of other groups of agricultural pests.

  19. Genetic consequences of domestication and mass rearing of pest fruit fly Bactrocera tryoni (Diptera: Tephritidae).

    Science.gov (United States)

    Gilchrist, A S; Cameron, E C; Sved, J A; Meats, A W

    2012-06-01

    Tephritid fruit flies, an important pest of horticulture worldwide, are increasingly targeted for control or eradication by large-scale releases of sterile flies of the same species. For each species treated, strains must be domesticated for mass rearing to provide sufficiently large numbers of individuals for releases. Increases in productivity of domesticated tephritid strains are well documented, but there have been few systematic studies of the genetic consequences of domestication in tephritids. Here, we used nine DNA microsatellite markers to monitor changes in genetic diversity during the early generations of domestication in replicated lines of the fruit fly Bactrocera tryoni (Froggatt) (Diptera: Tephritidae). The observed changes in heterozygosity and allelic richness were compared with the expected changes in heterozygosity generated by a stochastic simulation including genetic drift but not selection. The results showed that repeatable genetic bottlenecks occur in the early generations and that selection occurs in the later generations. Furthermore, using the same simulation, we show that there is inadvertent selection for increased productivity for the entire life on a mass-rearing colony, in addition to intentional selection for increased productivity. That additional selection results from the common practice of establishing the next generation of the breeding colony from a small proportion of one day's pupae collection (the pupal raffle). That selection occurs during all generations and acts only on fecundity variation. Practical methods to counter that unavoidable loss of genetic diversity during the domestication process in B. tryoni are discussed.

  20. Olfactory response of Anastrepha striata (Diptera: Tephritidae) to guava and sweet orange volatiles.

    Science.gov (United States)

    Diaz-Santiz, Edvin; Rojas, Julio C; Cruz-López, Leopoldo; Hernández, Emilio; Malo, Edi A

    2016-10-01

    The behavioral responses of virgin and mated female Anastrepha striata Schiner (Diptera: Tephritidae) to guava (Psidium guajava L.) or sweet orange (Citrus sinensis L.) were evaluated separately using multilure traps in two-choice tests in field cages. The results showed that flies were more attracted to guava and sweet orange volatiles than to control (unbaited trap). The physiological state (virgin or mated) of females did not affect their attraction to the fruit volatiles. Combined analysis of gas chromatography coupled with electroantennography (GC-EAD) of volatile extracts of both fruits showed that 1 and 6 compounds from orange and guava, respectively elicited repeatable antennal responses from mated females. The EAD active compounds in guava volatile extracts were identified by gas chromatography-mass spectrometry (GC-MS) as ethyl butyrate, (Z)-3-hexenol, hexanol, ethyl hexanoate, hexyl acetate, and ethyl octanoate. Linalool was identified as the only antennal active compound in sweet orange extracts. In field cage tests, there were no significant differences between the number of mated flies captured by the traps baited with guava extracts and the number caught by traps baited with the 6-component blend that was formulated according to the relative proportions in the guava extracts. Similar results occurred when synthetic linalool was evaluated against orange extracts. From a practical point of view, the compounds identified in this study could be used for monitoring A. striata populations. © 2015 Institute of Zoology, Chinese Academy of Sciences.

  1. Phylogeographic Structure in Anastrepha ludens (Diptera: Tephritidae) Populations Inferred With mtDNA Sequencing.

    Science.gov (United States)

    Ruiz-Arce, Raul; Owen, Christopher L; Thomas, Donald B; Barr, Norman B; McPheron, Bruce A

    2015-06-01

    Anastrepha ludens (Loew) (Diptera: Tephritidae), the Mexican fruit fly, is a major pest of citrus and mango. It has a wide distribution in Mexico and Central America, with infestations occurring in Texas, California, and Florida with origins believed to have been centered in northeastern Mexico. This research evaluates the utility of a sequence-based approach for two mitochondrial (COI and ND6) gene regions. We use these markers to examine genetic diversity, estimate population structure, and identify diagnostic information for A. ludens populations. We analyzed 543 individuals from 67 geographic collections and found one predominant haplotype occurring in the majority of specimens. We observed 68 haplotypes in all and see differences among haplotypes belonging to northern and southern collections. Mexico haplotypes differ by few bases possibly as a result of a recent bottleneck event. In contrast to the hypothesis suggesting northeastern Mexico as the origin of this species, we see that specimens from two southern collections show high genetic variability delineating three mitochondrial groups. These data suggest that Central America is the origin for A. ludens. We show that COI and ND6 are useful for phylogeographic studies of A. ludens. Published by Oxford University Press on behalf of Entomological Society of America 2015. This work is written by US Government employees and is in the public domain in the US.

  2. Characterization of irritans mariner-like elements in the olive fruit fly Bactrocera oleae (Diptera: Tephritidae): evolutionary implications

    Science.gov (United States)

    Ben Lazhar-Ajroud, Wafa; Caruso, Aurore; Mezghani, Maha; Bouallegue, Maryem; Tastard, Emmanuelle; Denis, Françoise; Rouault, Jacques-Deric; Makni, Hanem; Capy, Pierre; Chénais, Benoît; Makni, Mohamed; Casse, Nathalie

    2016-08-01

    Genomic variation among species is commonly driven by transposable element (TE) invasion; thus, the pattern of TEs in a genome allows drawing an evolutionary history of the studied species. This paper reports in vitro and in silico detection and characterization of irritans mariner-like elements (MLEs) in the genome and transcriptome of Bactrocera oleae (Rossi) (Diptera: Tephritidae). Eleven irritans MLE sequences have been isolated in vitro using terminal inverted repeats (TIRs) as primers, and 215 have been extracted in silico from the sequenced genome of B. oleae. Additionally, the sequenced genomes of Bactrocera tryoni (Froggatt) and Bactrocera cucurbitae (Diptera: Tephritidae) have been explored to identify irritans MLEs. A total of 129 sequences from B. tryoni have been extracted, while the genome of B. cucurbitae appears probably devoid of irritans MLEs. All detected irritans MLEs are defective due to several mutations and are clustered together in a monophyletic group suggesting a common ancestor. The evolutionary history and dynamics of these TEs are discussed in relation with the phylogenetic distribution of their hosts. The knowledge on the structure, distribution, dynamic, and evolution of irritans MLEs in Bactrocera species contributes to the understanding of both their evolutionary history and the invasion history of their hosts. This could also be the basis for genetic control strategies using transposable elements.

  3. Effects of adhesive powders on the mating and flight behavior of Mediterranean fruit fly (Diptera: Tephritidae).

    Science.gov (United States)

    Armsworth, Clare G; Baxter, Ian H; Barton, Lucy E E; Poppy, Guy M; Nansen, Christian

    2006-08-01

    Powders that adhere to insect cuticle can be used as carrier particles for synthetic insecticides, entomopathogens, or pheromones in insect control systems, and insects can be lured into contact with such powder mixtures by using attractants. Secondary transfer of adhesive powders to conspecifics during social interactions has been reported; however, this transfer relies on insects leaving the source of powder and continuing normal behavior when contaminated. We examined the ability of the Mediterranean fruit fly, Ceratitis capitata Wiedemann (Diptera: Tephritidae), to fly and mate after being contaminated with one of two adhesive powders: an electrostatic wax powder, Entostat, and a proprietary metallic powder, Entomag. During continuous observations for 1 h in a flight tunnel, male C. capitata made significantly more flights than females. Treating C. capitata with either powder significantly suppressed the flight activity of male C. capitata compared with untreated controls, whereas powder treatment had a negligible effect on female flight activity. Within 1 h, male C. capitata treated with Entomag recovered normal flight activity, but Entostat-treated males were not fully recovered. Virgin male C. capitata treated with either Entostat or Entomag were able to mate with virgin female C. capitata, but the onset of mating was delayed compared with control C. capitata by approximately 1 h. Even though the effect of powder uptake on behavior seemed to be temporary, scanning electron micrograph images of treated C. capitata showed that both powders were retained for > 24 h on most body parts. The adhesive powders showed potential for use as carrier particles for pesticides, entomopathogens, or pheromones in novel C. capitata control systems.

  4. Host status of grapefruit and Valencia oranges for Anastrepha serpentina and Anastrepha ludens (Diptera: Tephritidae).

    Science.gov (United States)

    Mangan, Robert L; Thomas, Donald B; Moreno, Aleena M Tarshis

    2011-04-01

    Anastrepha serpentina (Wiedemann) (Diptera: Tephritidae) is sporadically captured in the Rio Grande Valley of Texas. Although its preferred hosts are in the Sapotaceae family, several varieties of Citrus, including grapefruit and oranges are listed as alternate hosts. Although Mexican fruit fly, Anastrepha ludens (Loew), is known to be a major pest of Citrus, doubt exists as to the status of Citrus as a breeding host for A. serpentina. To evaluate the host status of commercial Citrus for A. serpentina we compared oviposition and development with that of A. ludens under laboratory conditions with 'Rio Red' grapefruit (Citrus paradisi MacFayden) and 'Valencia' oranges [Citrus sinensis (L.) Osbeck] in different stages of maturity. Both fly species oviposited in early season fruit in which the eggs and larvae died in the fruit albedo. Survival of either species to the adult stage occurred in later season grapefruit. In oranges, no A. serpentina larvae survived compared with 150 A. ludens surviving to adults. Survival on both Citrus species was much lower for A. serpentina, only approximately 5% of eggs eclosed into larvae in grapefruit compared with approximatley 50% for A. ludens. In oranges approximately 16% of A. serpentina eggs eclosed compared with approximately 76% for A. ludens. In grapefruit, only one fourth as many A. serpentina larvae survived to the adult stage compared with A. ludens. Additional experiments were performed in a greenhouse on small, caged trees of la coma (Sideroxylon celastrinum H.B.K.), a Texas species of Sapotaceae. The A. serpentina females readily oviposited into these berries and normal adults emerged. The present low incidence of the adults, coupled with the high mortality during development of the larvae, suggests that Texas citrus is unlikely to support a breeding population of A. serpentina.

  5. Growth and Development of Acanthiophilus helianthi (Diptera: Tephritidae Feeding on Safflower, Carthamus tinctorius

    Directory of Open Access Journals (Sweden)

    Karim SAEIDI

    2015-06-01

    Full Text Available Safflower fly, Acanthiophilus helianthi Rossi (Diptera: Tephritidae, undergoes four stages (egg, larva, pupa and adult during its growth and development. In this study, observation showed that the egg’s stage took 1.16 ± 0.00, larva’s stage took 12.02 ± 0.13 and pupa’s stage took 7.03 ± 0.08 days before the emergence of adults. The male adult survived for 21.97 ± 2.69 days, while the female lived 19.19 ± 1.50 days. It was observed that the eggs were laid in a cluster, with a range between 10 – 50 eggs per cluster. The length and width of the individual egg were 1.12 ± 0.03 mm and 0.20 ± 0.00 mm respectively. The percentages of the survived individual larva decreased from the first instar until third instar. In the experiment, the length and width of the larva reached 7.77 ± 0.08 mm and 1.84 ± 0.03 mm respectively. Pupae were observed changing in colour from pale white to dark brown. The length and the width of the pupae observed were 6.78 ± 0.16 mm and 2.90 ± 0.02 mm. The longevity of the adults Acanthiophilus helianthi Rossi was influenced by the diets they consumed, the presence of other individuals, wideness of the areas, differences in time taken within the life cycle (between different stages and temperature in the laboratory.

  6. Response of melon fly (Diptera: Tephritidae) to weathered SPLAT-Spinosad-Cue-Lure.

    Science.gov (United States)

    Vargas, Roger I; Piñero, Jaime C; Jang, Eric B; Mau, Ronald F L; Stark, John D; Gomez, Luis; Stoltman, Lyndsie; Mafra-Neto, Agenor

    2010-10-01

    Studies were conducted in Hawaii to measure attraction of male melon fly, Bactrocera cucurbitae (Coquillett) (Diptera: Tephritidae), to SPLAT-Cue-Lure (C-L) and SPLAT-Melo-Lure (M-L) (raspberry ketone formate). Direct field comparisons of SPLAT-C-L and SPLAT-M-L at low (5%) and high (20%) concentrations indicated few differences in attraction over a 15-wk period. Subsequently, only SPLAT-Spinosad-C-L (5%) was compared with Min-U-Gel C-L with naled (standard used in California) in weathering studies. Treatments were weathered for 1, 2, 4, and 8 wk in Riverside, CA, and shipped to Hawaii for attraction/toxicity tests under field and semifield conditions by using released males of controlled ages, and for feeding tests in the laboratory. In terms of attraction, SPLAT-Spinosad-C-L compared favorably to, or outperformed the current standard of Min-U-Gel-C-L with naled. In terms of toxicity, the cumulative 24-h mortality did not differ between the two insecticide-containing C-L treatments in field cage studies after 8 wk. However, in feeding studies in which individual males were exposed for 5 min to the different C-L treatments after 4 wk of weathering, SPLAT-Spinosad-C-L demonstrated reduced mortality compared with the Min-U-Gel-C-L with naled, suggesting reduced persistence of the spinosad material. Spinosad has low contact toxicity and when mixed with SPLAT and C-L offers a reduced risk alternative for control of B. cucurbitae and related C-L-responding species, without many of the negative effects to humans and nontargets of broad-spectrum contact poisons such as naled.

  7. Export of commercial Hass avocados from Argentina poses negligible risk of Ceratitis capitata (Diptera: Tephritidae) infestation.

    Science.gov (United States)

    Villagrán, M Elvira; Willink, Eduardo; Vera, M Teresa; Follett, Peter

    2012-08-01

    Argentina has to meet quarantine restrictions because of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), to export 'Hass' avocados, Persea americana Miller, to certain countries. Hass avocado at the hard, mature green stage is potentially a conditional nonhost for C. capitata and could open export markets without the need for a quarantine treatment. Trapping data from 1998 to 2006 showed that C. capitata was present in avocado orchards, particularly early in the harvest season. The host status of hard, mature green Hass avocado to C. capitata was evaluated using laboratory and field cage tests under no-choice conditions and by assessing natural levels of infestation in commercially harvested fruit from the main avocado production area. In total, 2,250 hard, mature green avocado fruit were exposed to 11,250 gravid females for 24 or 48 h after harvest in laboratory or field cages, and no infestations were found. During 11 seasons, 5,949 fruit in total were sampled from the trees and 992 fruit were collected from the ground, and in none of them were any live or dead fruit fly larvae found. Inspection of >198,000 commercial fruit at the packinghouse from 1998 to 2011 showed no symptoms of fruit fly infestation. These data exceed the published standards for determination of nonhost status, as well as the Probit 9 standard for development of quarantine treatments. Hass avocado harvested at the hard, mature green stage was not infested by C. capitata and seems to pose a negligible quarantine risk. As a consequence, no postharvest treatment or other quarantine actions should be required by importing countries.

  8. Genetic Evidence for the Introduction of Rhagoletis pomonella (Diptera: Tephritidae) into the Northwestern United States.

    Science.gov (United States)

    Sim, Sheina B; Doellman, Meredith M; Hood, Glen R; Yee, Wee L; Powell, Thomas H Q; Schwarz, Dietmar; Goughnour, Robert B; Egan, Scott P; Jean, Gilbert St; Smith, James J; Arcella, Tracy E; Dzurisin, Jason D K; Feder, Jeffrey L

    2017-12-05

    The apple maggot fly, Rhagoletis pomonella Walsh (Diptera: Tephritidae), is a serious quarantine pest in the apple-growing regions of central Washington and Oregon. The fly is believed to have been introduced into the Pacific Northwest via the transport of larval-infested apples near Portland, Oregon, within the last 40 yr. However, R. pomonella also attacks native black hawthorn, Crataegus douglasii Lindley (Rosales: Rosaceae), and introduced ornamental hawthorn, Crataegus monogyna Jacquin, in the region. It is, therefore, possible that R. pomonella was not introduced but has always been present on black hawthorn. If true, then the fly may have independently shifted from hawthorn onto apple in the Pacific Northwest within the last 40 yr after apples were introduced. Here, we test the introduction hypothesis through a microsatellite genetic survey of 10 R. pomonella sites in Washington and 5 in the eastern United States, as well as a comparison to patterns of genetic variation between populations of Rhagoletis cingulata Loew and Rhagoletis indifferens Curran, two sister species of cherry-infesting flies known to be native to the eastern and western United States, respectively. We report results based on genetic distance networks, patterns of allelic variation, and estimated times of population divergence that are consistent with the introduction hypothesis for R. pomonella. The results have important implications for R. pomonella management, suggesting that black hawthorn-infesting flies near commercial apple-growing regions of central Washington may harbor sufficient variation to utilize apple as an alternate host, urging careful monitoring, and possible removal of hawthorn trees near orchards. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. Hymenopterous parasitoids attacking Acanthiophilus helianthi Rossi (Diptera: Tephritidae pupae in Kohgiluyeh Safflower farms of Iran

    Directory of Open Access Journals (Sweden)

    K. Saeidi

    2016-12-01

    Full Text Available The Safflower capsule fly (SCF, Acanthiophilus helianthi Rossi (Diptera: Tephritidae is the most destructive insect pest attacking the Safflower Carthamus tinctorius L. plant which are cultivated as an oil crop. It is mainly controlled through application of broad-spectrum insecticides, which can adversely affect safflower farms ecosystem and consequently human health. Since a first step in setting up an integrated pest management program is to assess the biological control agents within the ecosystem. Therefore, in this research work the pupal parasitoids of Safflower capsule fly a main insect pest attacking Safflower plants were identified. The impact of these parasitoids against this pest was evaluated on the varying pest generations and within different locations in Kohgiluyeh province during 2008-2009 seasons. Pupal parasitoid adults of SCF were recorded from fieldreared pupae, which had been collected from heavily infested small flower heads of the first generation as well from large flower heads of the second and third generations. Rate of parasitism on A. helianthi pupae was estimated as the number of parasitoids over the total count of parasitoids and flies. Ten hymenopterous species belonging to different families parasitizing insect pupae were screened as follows: Bracon hebetor (Spinola, 1808 and Bracon luteator (Spinola, 1808 (Braconidae; Isocolus tinctorious (Melika and Gharaei, 2006 (Cynipidae; Pronotalia carlinarum (Szelenyi and Erdos, 1951 (Eulophidae; Eurytoma acroptilae (Zerova, 1986 (Eurytomidae; Ormyrus orientalis (Walker, 1871 (Ormyridae; Colotrechnus viridis (Masi, 1921 and Pteromalus sp. (Walker, 1976 (Pteromalidae; and Antistrophoplex conthurnatus (Zerova, 2000 and Microdontomenus annulatus (Masi, 1899 (Torymidae. The average parasitization rate was 23±1 as revealed through the present study. The highest parasitization rate occurred during the first generation in all localities tested, as well as in years. Statistical

  10. Is the alpine divide becoming more permeable to biological invasions? - Insights on the invasion and establishment of the Walnut Husk Fly, Rhagoletis completa (Diptera: Tephritidae) in Switzerland

    OpenAIRE

    Aluja, M.; Guillén, L.; Rull, J.; Höhn, H.; Frey, J.; Graf, B.; Samietz, J.

    2017-01-01

    The Walnut Husk Fly, Rhagoletis completa Cresson (Diptera: Tephritidae), is native to North America (Midwestern US and north-eastern Mexico) and has invaded several European countries in the past decades by likely crossing the alpine divide separating most parts of Switzerland from Italy. Here, we determined its current distribution in Switzerland by sampling walnuts (Juglans regia L.) in ecologically and climatically distinct regions along potential invasion corridors. R. completa was found ...

  11. A compound produced by fruigivorous Tephritidae (Diptera) larvae promotes oviposition behavior by the biological control agent Diachasmimorpha longicaudata (Hymenoptera: Braconidae).

    Science.gov (United States)

    Stuhl, Charles; Sivinski, John; Teal, Peter; Paranhos, Beatriz; Aluja, Martin

    2011-06-01

    Tephritid fruit fly parasitoids use fruit-derived chemical cues and the vibrations that result from larval movements to locate hosts sequestered inside fruit. However, compounds produced by the larvae themselves have not been previously described nor their significance to parasitoid foraging determined. We collected the volatiles from four species of tropical and subtropical Tephritidae: Anastrepha suspensa (Loew), Bactrocera dorsalis Hendel, Bactrocera cucurbitae Coquillett, and Ceratitis capitata (Wiedemann), representing two subfamilies (Dacinae and Trypetinae). Para-ethylacetophenone, an analog of a known tephritid parasitoid attractant, was a major constituent of all four, and was not associated with larvae of another acalypterate fly, Drosophila melanogaster Meigen, or with the calypterate Musca domestica L. It also was present in volatiles from whole, A. suspensa infested fruits of Eugenia uniflora (L.). Para-ethylacetophenone was not necessarily produced as a direct consequence of fruit consumption because it also was detected from larvae that developed in two artificial diets and in spent diets subsequent to larval development. Sensillae on both the antennae and ovipositor of the opiine braconid fruit fly parasitoid, Diachasmimorpha longicaudata (Ashmead) responded to the para-ethylacetophenone in larval volatiles and as a synthetic. Although a potential cue to foraging parasitoids, para-ethylacetophenone showed no long range (>1m) attractiveness to the adult female parasitoid, but did stimulate ovipositor-insertion and oviposition into both a natural (fruit) and an artificial (parafilm) substrate. Thus it may prove useful in colonizing and mass-rearing opine fruit fly parasitoids.

  12. Effect of Vapor Heat Treatment on the Mortality of Bactrocera dorsalis (Diptera: Tephritidae and the Quality of Mango cv. Arumanis

    Directory of Open Access Journals (Sweden)

    Tri Wulan Widya Lestari

    2017-07-01

    Full Text Available Arumanis is a superior export variety mango from Indonesia. One inhibiting factor on the production of this fruit variety is the infestation of Bactrocera dorsalis (Diptera: Tephritidae fruit fly. Vapor heat treatment was recommended by ISPM No. 28 of 2007 as an effective treatment in eradicating fruit flies. This research was aimed to find out the optimum temperature and the duration of vapor heat treatment on the mortality of egg and larvae of B. dorsalis. The experiment was conducted in the Laboratory of Vapor Heat Treatment, BBPOPT, Jatisari, from October 2016 to January 2017. The observed parameters were temperature, duration of treatment, mortality of egg and larvae of fruit fly, and fruit quality. The results showed that vapor heat treatment at 47°C for 40 minutes (min was effective to reduce the number of eggs and larvae of B. dorsalis and had no negative impact on the fruit quality.   Intisari Buah mangga varietas Arumanis merupakan varietas mangga ekspor unggulan Indonesia. Salah satu faktor pembatas produksi buah mangga varietas Arumanis adalah lalat buah B. dorsalis (Diptera: Tephritidae. Perlakuan uap panas direkomendasikan oleh ISPM Nomor 28 tahun 2007 sebagai tindakan perlakuan yang efektif dalam mengeradikasi lalat buah. Penelitian ini bertujuan untuk mengetahui suhu dan waktu optimum perlakuan uap panas terhadap mortalitas telur dan larva B. dorsalis pada buah mangga varietas Arumanis tanpa merusak kualitas buah. Penelitian dilaksanakan di Laboratorium Vapor Heat Treatment, BBPOPT, Jatisari, pada Oktober 2016 sampai dengan Januari 2017. Parameter yang diamati adalah suhu, lamanya waktu perlakuan, mortalitas telur dan larva lalat buah, dan kualitas buah. Hasil penelitian menunjukkan bahwa perlakuan uap panas pada suhu 47°C selama 40 menit terbukti efektif membunuh telur dan larva B. dorsalis dan tidak berdampak negatif terhadap kualitas buah.

  13. Influence of modified atmosphere packaging on radiation tolerance in the phytosanitary pest melon fly (Diptera: Tephritidae).

    Science.gov (United States)

    Follett, Peter A; Wall, Marisa; Bailey, Woodward

    2013-10-01

    Modified atmosphere packaging (MAP) produces a low-oxygen (O2) environment that can increase produce shelf life by decreasing product respiration and growth of pathogens. However, low O2 is known to increase insect tolerance to irradiation, and the use of MAP with products treated by irradiation before export to control quarantine pests may inadvertently compromise treatment efficacy. Melon fly, Bactrocera cucurbitae Coquillet (Diptera: Tephritidae), is an important economic and quarantine pest of tropical fruits and vegetables, and one of the most radiation-tolerant tephritid fruit flies known. The effect of low O2 generated by MAP on the radiation tolerance of B. cucurbitae was examined. Third-instar larval B. cucurbitae were inoculated into ripe papayas and treated by 1) MAP + irradiation, 2) irradiation alone, 3) MAP alone, or (4) no MAP and no irradiation, and held for adult emergence. Three types of commercially available MAP products were tested that produced O2 concentrations between 1 and 15%, and a sublethal radiation dose (50 Gy) was used to allow comparisons between treatments. Ziploc storage bags (1-4% O2) increased survivorship to adult from 14 to 25%, whereas Xtend PP61 bags (3-8% O2) and Xtend PP53 bags (11-15% O2) did not enhance survivorship to the adult stage in B. cucurbitae irradiated at 50 Gy. Radiation doses approved by the United States Department of Agriculture and the International Plant Protection Commission for B. cucurbitae and Ceratitis capitata (Wiedemann) (Mediterranean fruit fly) are 150 and 100 Gy, respectively. In large-scale tests, 9,000 B. cucurbitae and 3,800 C. capitata larvae infesting papayas in Ziploc bags were irradiated at 150 and 100 Gy, respectively, with no survivors to the adult stage. MAP can increase insect survivorship during irradiation treatment at certain doses and O2 concentrations, but should not compromise the efficacy of the 150-Gy generic radiation treatment for tephritid fruit flies or the 100-Gy radiation

  14. The complete nucleotide sequence of the mitochondrial genome of Bactrocera minax (Diptera: Tephritidae).

    Science.gov (United States)

    Zhang, Bin; Nardi, Francesco; Hull-Sanders, Helen; Wan, Xuanwu; Liu, Yinghong

    2014-01-01

    The complete 16,043 bp mitochondrial genome (mitogenome) of Bactrocera minax (Diptera: Tephritidae) has been sequenced. The genome encodes 37 genes usually found in insect mitogenomes. The mitogenome information for B. minax was compared to the homologous sequences of Bactrocera oleae, Bactrocera tryoni, Bactrocera philippinensis, Bactrocera carambolae, Bactrocera papayae, Bactrocera dorsalis, Bactrocera correcta, Bactrocera cucurbitae and Ceratitis capitata. The analysis indicated the structure and organization are typical of, and similar to, the nine closely related species mentioned above, although it contains the lowest genome-wide A+T content (67.3%). Four short intergenic spacers with a high degree of conservation among the nine tephritid species mentioned above and B. minax were observed, which also have clear counterparts in the control regions (CRs). Correlation analysis among these ten tephritid species revealed close positive correlation between the A+T content of zero-fold degenerate sites (P0FD), the ratio of nucleotide substitution frequency at P0FD sites to all degenerate sites (zero-fold degenerate sites, two-fold degenerate sites and four-fold degenerate sites) and amino acid sequence distance (ASD) were found. Further, significant positive correlation was observed between the A+T content of four-fold degenerate sites (P4FD) and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites; however, we found significant negative correlation between ASD and the A+T content of P4FD, and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites. A higher nucleotide substitution frequency at non-synonymous sites compared to synonymous sites was observed in nad4, the first time that has been observed in an insect mitogenome. A poly(T) stretch at the 5' end of the CR followed by a [TA(A)]n-like stretch was also found. In addition, a highly conserved G+A-rich sequence block was observed in front of the

  15. The complete nucleotide sequence of the mitochondrial genome of Bactrocera minax (Diptera: Tephritidae.

    Directory of Open Access Journals (Sweden)

    Bin Zhang

    Full Text Available The complete 16,043 bp mitochondrial genome (mitogenome of Bactrocera minax (Diptera: Tephritidae has been sequenced. The genome encodes 37 genes usually found in insect mitogenomes. The mitogenome information for B. minax was compared to the homologous sequences of Bactrocera oleae, Bactrocera tryoni, Bactrocera philippinensis, Bactrocera carambolae, Bactrocera papayae, Bactrocera dorsalis, Bactrocera correcta, Bactrocera cucurbitae and Ceratitis capitata. The analysis indicated the structure and organization are typical of, and similar to, the nine closely related species mentioned above, although it contains the lowest genome-wide A+T content (67.3%. Four short intergenic spacers with a high degree of conservation among the nine tephritid species mentioned above and B. minax were observed, which also have clear counterparts in the control regions (CRs. Correlation analysis among these ten tephritid species revealed close positive correlation between the A+T content of zero-fold degenerate sites (P0FD, the ratio of nucleotide substitution frequency at P0FD sites to all degenerate sites (zero-fold degenerate sites, two-fold degenerate sites and four-fold degenerate sites and amino acid sequence distance (ASD were found. Further, significant positive correlation was observed between the A+T content of four-fold degenerate sites (P4FD and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites; however, we found significant negative correlation between ASD and the A+T content of P4FD, and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites. A higher nucleotide substitution frequency at non-synonymous sites compared to synonymous sites was observed in nad4, the first time that has been observed in an insect mitogenome. A poly(T stretch at the 5' end of the CR followed by a [TA(A]n-like stretch was also found. In addition, a highly conserved G+A-rich sequence block was observed in front

  16. Oral and Topical Toxicity of Fipronil to Melon Fly and Oriental Fruit Fly (Diptera: Tephritidae)

    Science.gov (United States)

    BACKGROUND: The objective of this study was to develop basic oral and topical toxicity data for Fipronil in Solulys protein bait to wild melon fly, Bactrocera cucurbitae (Coquillett) and the oriental fruit fly, Bactrocera dorsalis (Hendel). RESULTS: For the oral study, both females and males were ...

  17. Sterilization of fruit flies (Diptera: Tephritidae) with X-rays for sterile insect technique programs; Esterilizacao de moscas-das-frutas (Diptera: Tephritidae) com raios-X para programas de tecnica do inseto esteril

    Energy Technology Data Exchange (ETDEWEB)

    Mastrangelo, Thiago de Araujo

    2009-07-01

    Recent fear of acts of terrorism provoked an increase of delays and denials in the shipment of radioisotopes. This truly represented a menace to sterile insect production projects around the world. In order to validate the use of a new kind of low-energy Xray irradiator, a series of radiobiological studies on Ceratitis capitata (tsl-VIENNA 8 strain) (Wied., 1824) (Diptera: Tephritidae) and an Argentinean strain of Anastrepha fraterculus (Wied., 1830) (Diptera: Tephritidae) were carried out, also comparing biological effectiveness between X-rays and traditional {gamma} radiation from {sup 60}Co. Pupae 48- 24 h before adult emergence of C. capitata males and both sexes of A. fraterculus were irradiated with doses ranging from 15 to 120 Gy and 10 to 70 Gy respectively. Doses that induce 50, 90 and 99% of sterility were estimated and the hypothesis of Parallelism for the Probit equations was tested. Doses of 82.7 Gy of X-rays and 128.2 Gy of {gamma} rays (thus, a RBE{approx}1.5) induced 99% sterility on medfly males. The fertility of A. fraterculus fertile females crossed with 41 Gy of X-rays and 62.7 Gy of {gamma} rays decreased in 99% comparing with the control group (RBE{approx}1.5). 99% sterility of A. fraterculus irradiated females was achieved with 60-80 Gy (RBE{approx}0.7). The standard quality control parameters of fecundity, adult emergence, fliers and survival were not significantly affected by the two types of radiation (RBE{approx}1) either for medfly or A. fraterculus (p>0.01), being averages in conformity with the values required by FAO/IAEA/USDA. Only fecundity of irradiated A. fraterculus females was severely reduced with increasing doses and no egg was laid at 70 Gy of both radiations. There were no significant differences between X-rays and {gamma} rays regarding mating indices (RSI for medfly, RII, ISI, MRPI and FRPI for A. fraterculus) (p>0.05), what indicated more random matings for fertile and sterile insects. The results demonstrated that no

  18. Effect of adult chill treatments on recovery, longevity and flight ability of Queensland fruit fly, Bactrocera tryoni (Froggatt) (Diptera: Tephritidae).

    Science.gov (United States)

    Reynolds, O L; Orchard, B A

    2011-02-01

    Control of Queensland fruit fly, Bactrocera tryoni (Froggatt) (Diptera: Tephritidae), populations or outbreaks may be achieved through the mass-rearing and inundative release of sterile B. tryoni. An alternative release method is to release chilled adult sterile fruit flies to decrease packaging and transport requirements and potentially improve release efficiencies. Two trials were conducted to determine the effect of chilling on the performance of two separate batches of adult B. tryoni, fed either a protein and sucrose diet or sucrose only diet. The first trial compared chill times of 0, 0.5, 2 and 4 h; the second trial compared chill times of 0, 2, 4, 8 and 24 h. Overall, there was little or no affect of chilling on the recovery, longevity and flight ability of B. tryoni chilled at 4°C. Recovery time can take up to 15 min for chilled adult flies. There was no effect of chill time on longevity although females generally had greater longevity on either diet compared with males. Propensity for flight was not adversely affected by chilling at the lower chill times in trial 1; however, in trial 2, adults fed on a protein and sucrose diet had a decreased tendency for flight as the chilling time increased. Fly body size did not affect recovery times although the smaller adult B. tryoni in trial 1 had significantly reduced longevity compared to the larger adults in trial 2. Implications of these findings for B. tryoni SIT are discussed.

  19. First survey of fruit fly (Diptera: Tephritidae and parasitoid diversity among myrtaceae fruit across the state of Bahia, Brazil

    Directory of Open Access Journals (Sweden)

    Lidia Nogueira Silva

    2011-09-01

    Full Text Available The objective of this study was to evaluate the diversity of fruit fly (Diptera: Tephritidae species that use myrtaceous fruit, particularly guava, as hosts in several localities in the state of Bahia and to determine the infestation rates, pupal viability rates, and fruit fly-parasitoid associations. Sampling of myrtaceous fruit was carried out in 24 municipalities in different regions in the state of Bahia. Four fruit fly species, Anastrepha fraterculus, Anastrepha zenildae, Anastrepha sororcula, and Ceratitis capitata were obtained from the collected fruit. Three parasitoid species (Hymenoptera: Braconidae emerged from Anastrepha larvae/pupae, Doryctobracon areolatus, Utetes anastrephae, and Asobara anastrephae. Doryctobracon areolatus emerged from A. fraterculus, A. sororcula and A. zenildae; Utetes anastrephae emerged from A. fraterculus and A. zenildae; and Asobara anastrephae emerged from A. fraterculus. Fruit fly and myrtaceous fruit associations are reported for the first time in several municipalities in the state of Bahia. A. zenildae was found infesting Syzygium malaccense for the first time in Brazil.

  20. Fruit flies (Diptera: Tephritidae and their hosts in the municipality of Quixeré, state of Ceará, Brazil

    Directory of Open Access Journals (Sweden)

    Marcia Mayara de Sousa

    2017-07-01

    Full Text Available The state of Ceará is one of the main producers and exporters of tropical fruits in Brazil. However, the farmers have some problems related with the fruit flies (Diptera: Tephritidae, because these tefritids cause damages to the fruits and the simple presence of some species makes difficult the export of fruits in natura. In the state of Ceará, information about fruit flies and their hosts in fruit producing regions are scarce, such as in the region of Baixo Jaguaribe. This region is located in the Brazilian semiarid and is composed of ten municipalities, among them the municipality of Quixeré. Therefore, the objective of this study was to know the species of fruit flies, their hosts and respective infestation index, in different places of the municipality of Quixeré. For this, fruits were randomly collected in different fruit trees (native and exotic, in the rural and urban area of Quixeré. The collected fruits were transported to the laboratory, where they were counted, weighed and stored in plastic trays on a layer of vermiculite. After seven days, the vermiculite was sieved and the pupae obtained were stored in plastic containers until the emergence of adults. Fruits of 21 species were sampled and only five were infested by fruit flies. The species obtained were Ceratitis capitata (Wiedemann, Anastrepha zenildae Zucchi, Anastrepha sororcula Zucchi and Anastrepha obliqua (Macquart. Guava Psidium guajava L. was the fruit that presented the highest rates of infestation.

  1. Alcohol dehydrogenase activities and ethanol tolerance in Anastrepha (Diptera, Tephritidae fruit-fly species and their hybrids

    Directory of Open Access Journals (Sweden)

    Eneas Carvalho

    2009-01-01

    Full Text Available The ADH (alcohol dehydrogenase system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae. Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

  2. Moscas-das-frutas (Diptera: Tephritidae em um pomar de goiabeira, no semiárido brasileiro

    Directory of Open Access Journals (Sweden)

    Elton Lucio Araujo

    2013-06-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritidae são pragas-chave na cultura da goiabeira Psidium guajava L., com predominância de diferentes espécies de acordo com a região produtora no Brasil. Os objetivos do presente trabalho foram conhecer a diversidade e analisar parâmetros faunísticos das moscas-das-frutas obtidas em um pomar de goiabeira, no município de Cruzeta, Rio Grande do Norte, situado no semiárido brasileiro. As moscas-das-frutas foram coletadas semanalmente, com auxílio de armadilhas McPhail, tendo como atrativo proteína hidrolisada a 5% v/v. Foram registradas cinco espécies no pomar estudado: Ceratitis capitata (Wied., Anastrepha zenildae Zucchi, Anastrepha sororcula Zucchi, Anastrepha obliqua (Macquart e Anastrepha dissimilis Stone. Ceratitis capitata foi a espécie mais frequente, constante e dominante, considerada como uma praga invasiva, potencial em pomares de goiabeira no semiárido brasileiro.

  3. Cold storage enhances the efficacy and margin of security in postharvest irradiation treatments against fruit flies (Diptera: Tephritidae).

    Science.gov (United States)

    Follett, Peter A; Snook, Kirsten

    2013-10-01

    Cold storage is used to preserve fruit quality after harvest during transportation in marketing channels. Low temperature can be a stressor for insects that reduces survivorship, and cold storage may contribute to the efficacy of postharvest quarantine treatments such as irradiation against quarantine insect pests. The combined effect of irradiation and cold storage was examined in a radiation-tolerant fruit fly, Bactrocera cucurbitae Coquillet (melon fly), and a radiation-intolerant fruit fly, Ceratitis capitata (Wiedemann) (Mediterranean fruit fly) (Diptera: Tephritidae). Third instars on diet or in papaya were treated with a sublethal radiation dose of 30 Gy and stored at 4 or 11 degrees C for 3-13 d and held for adult emergence. For both fruit fly species, survival of third instars to the adult stage generally decreased with increasing cold storage duration at 4 or 11 degrees C in diet or papaya. Survivorship differences were highly significant for the effects of substrate (diet > papaya), temperature (11 > 4 degrees C),and irradiation (0 > 30 Gy). Few Mediterranean fruit flies survived in any cold storage treatment after receiving a radiation dose of 30 Gy. No melon fly larvae survived to the adult stage after irradiation and 11 d cold storage at 4 or 11 degrees C in papayas. Cold storage enhances the efficacy and widens the margin of security in postharvest irradiation treatments. Potentially irradiation and cold storage can be used in combination to reduce the irradiation exposure requirements of quarantine treatments.

  4. Feeding preferences and functional responses of Calathus granatensis and Pterostichus globosus (Coleoptera: Carabidae) on pupae of Bactrocera oleae (Diptera: Tephritidae).

    Science.gov (United States)

    Dinis, A M; Pereira, J A; Benhadi-Marín, J; Santos, S A P

    2016-12-01

    Carabid beetles are important predators in agricultural landscapes feeding on a range of prey items. However, their role as predators of the olive fruit fly, Bactrocera oleae (Rossi) (Diptera: Tephritidae), one of the most serious pests of olives, is unknown. In this context, the feeding preferences and the functional responses of two carabid beetle species, Calathus granatensis (Vuillefroy) and Pterostichus globosus (Fabricius), were studied under laboratory conditions. Feeding preference assays involved exposing carabid beetles to different ratios of B. oleae pupae and an alternative prey, the Mediterranean fruit fly, Ceratitis capitata (Wiedemann). Both species fed on B. oleae pupae however, C. granatensis always showed a significant preference for that prey whereas P. globosus switched to C. capitata pupae when the offered ratio was below 0.5. The total prey biomass consumed was significantly higher for P. globosus than for C. granatensis. Functional response curves were estimated based on different densities of B. oleae pupae and both carabid beetle species exhibited a type II functional response using Rogers' random-predator equation. P. globosus showed shorter handling time (1.223 ± 0.118 h) on B. oleae pupae than C. granatensis (3.230 ± 0.627 h). Our results suggest that both species can be important in reducing the densities of B. oleae in olive groves, although P. globosus was more efficient than C. granatensis.

  5. Optimizing methyl-eugenol aromatherapy to maximize posttreatment effects to enhance mating competitiveness of male Bactrocera carambolae (Diptera: Tephritidae).

    Science.gov (United States)

    Haq, Ihsan ul; Vreysen, Marc J B; Cacéres, Carlos; Shelly, Todd E; Hendrichs, Jorge

    2015-10-01

    Methyl-eugenol (ME) (1,2-dimethoxy-4-(2-propenyl)benzene), a natural phytochemical, did enhance male Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae) mating competitiveness 3 d after ingestion. Enhanced male mating competitiveness can significantly increase the effectiveness of the sterile insect technique (SIT). ME application to mass reared sterile flies by feeding is infeasible. ME application by aromatherapy however, would be a very practical way of ME application in fly emergence and release facilities. This approach was shown to enhance mating competitiveness of B. carambolae 3 d posttreatment (DPT). Despite this added benefit, every additional day of delaying release will reduce sterile fly quality and will add cost to SIT application. The present study was planned to assess the effects of ME-aromatherapy on male B. carambolae mating competitiveness 1DPT and 2DPT. ME aromatherapy 1DPT or 2DPT did enhance mating competitiveness of B. carambolae males whereas ME feeding 1DPT and 2DPT did not. Male mating competitiveness was enhanced by the ME aromatherapy irrespective if they received 1DPT, 2DPT or 3DPT. ME aromatherapy, being a viable approach for its application, did enhance mating competitiveness of male B. carambolae 1 d posttreatment as ME feeding did 3 d after ingestion. ©2014 The Authors Journal compliation © Insititute of Zoology, Chinese Academy of Science.

  6. Determination of Opiinae parasitoids (Hymenoptera: Braconidae) associated with crop infesting Bactrocera spp. (Diptera: Tephritidae) using COI and Cyt b sequences

    Science.gov (United States)

    Shariff, Safiah; Yaakop, Salmah; Zain, Badrul Munir Md.

    2013-11-01

    Members of the Opiinae subfamily (Hymenoptera: Braconidae) are well known as important parasitoids of fruit fly larvae (Diptera: Tephritidae). They are widely used as biological control agents of fruit flies, especially the Bactrocera Macquart species that infest fruits. In this study, the larvae of fruit flies were collected from infested crops including star fruit, guava, wax apple and ridge gourd. The parasitized larvae were then reared under laboratory conditions until emergence of the adult parasitoids. Additionally, Malaise trap also was used to collect parasitoid species. The general concept of the multiplex PCR has been performed is to amplify two mitochondrial DNA markers, namely cytochrome oxidase subunit I (COI) and cytochrome b (Cyt b) simultaneously. Therefore, the lengthy process of reaction will be reduced. The status of the fruit fly species has also been confirmed by using COI marker on the early stage of the larvae. Maximum parsimony (MP) and Bayesian Inference (BI) were implemented to help and support the identification of Opiinae species. The result obtained from this study showed three parasitoid genera of the Opiinae viz. Fopius Wharton, Psyttalia Walker and Diachasmimorpha Viereck. Each genus has been determined by clustering together in a similar clade according to their infested crops. Therefore, accurate determination of parasitoids and the fruit fries species was highly useful and necessary for successful biological control of Bactrocera species.

  7. Comparative Efficacy of Insecticides on Bactrocera tryoni and Zeugodacus cucumis (Diptera: Tephritidae) in Laboratory and Semifield Trials in Fruiting Vegetables.

    Science.gov (United States)

    Senior, L J; Missenden, B P; Wright, C

    2017-08-01

    In-field management of Bactrocera tryoni (Froggatt) and Zeugodacus cucumis (French) (Diptera: Tephritidae) in fruiting vegetable crops has relied almost exclusively on organophosphate cover sprays. Laboratory and semifield trials were performed to compare a number of alternative insecticides for efficacy against these species. A novel semifield method was used whereby the insecticides were applied to crops as cover sprays under field conditions, and treated plants bearing fruit were transferred to large cages and exposed to fruit flies. Efficacy was assessed in terms of numbers of pupae developing from treated fruit. A laboratory cage method was also used to assess effects on adult mortality and comparative effects of 1- and 3-d-aged residues. The neonicotinoids clothianidin and thiacloprid were very effective against B. tryoni and Z. cucumis. Clothianidin was the only insecticide other than dimethoate to affect adult mortality. The synthetic pyrethroid alpha-cypermethrin was also very effective, particularly in semifield trials, although higher incidence of aphid and whitefly infestation was observed in this treatment compared to others. Cyantraniliprole was effective against B. tryoni, but less effective against Z. cucumis. Imidacloprid, bifenthrin, spinetoram, and abamectin were all relatively less effective, although all demonstrated a suppressive effect. © Commonwealth of Australia, Department of Agriculture and Fisheries, 2017.

  8. Interspecific hybridization as a source of novel genetic markers for the sterile insect technique in Bactrocera tryoni (Diptera: Tephritidae).

    Science.gov (United States)

    Shearman, D C A; Frommer, M; Morrow, J L; Raphael, K A; Gilchrist, A S

    2010-08-01

    Bactrocera tryoni (Froggatt) (Diptera: Tephritidae) or "Qfly," is the most serious horticultural pest in Australia, with a bioclimatic range that extends from the tropical north to the temperate south. Various Australian horticultural exports depend on certification that they originated from B. tryoni-free areas. To eliminate, rather than suppress, B. tryoni in production areas, a sterile insect technique (SIT) campaign directed at B. tryoni has been in operation in southeastern Australia since 1997. Like many other SIT programs around the world, the B. tryoni SIT program relies on fluorescent dust to mark the sterile insects. However, fluorescent dust marking does not provide 100% accuracy in the identification of sterile insects, as required where the aim is to declare regions completely free of fruit fly. Here, we show that novel mitochondrial markers can be introduced into a strain of B. tryoni by interspecies hybridization between B. tryoni and a related but well-differentiated species, Bactrocera jarvisi (Tryon), followed by backcrossing of the hybrid strain with the parental B. tryoni strain. These novel markers do not affect the viability of the strain as measured by pupation and eclosion rates. A simple polymerase chain reaction-based test is described that distinguishes the marked B. tryoni from wild B. tryoni. As required in practice, the test was shown to work reliably on DNA extracted from dead flies that had remained in field traps for up to two weeks.

  9. Epicuticular chemistry reinforces the new taxonomic classification of the Bactrocera dorsalis species complex (Diptera: Tephritidae, Dacinae).

    Science.gov (United States)

    Vaníčková, Lucie; Nagy, Radka; Pompeiano, Antonio; Kalinová, Blanka

    2017-01-01

    Bactrocera invadens Drew, Tsuruta & White, Bactrocera papayae Drew & Hancock, and Bactrocera philippinensis Drew & Hancock, key pest species within the Bactrocera dorsalis species complex, have been recently synonymized under the name Bactrocera dorsalis (Hendel). The closely related Bactrocera carambolae Drew & Hancock remains as a discrete taxonomic entity. Although the synonymizations have been accepted by most researchers, debate about the species limits remains. Because of the economic importance of this group of taxa, any new information available to support or deny the synonymizations is valuable. We investigated the chemical epicuticle composition of males and females of B. dorsalis, B. invadens, B. papayae, B. philippinensis, and B. carambolae by means of one- and two-dimensional gas chromatography-mass spectrometry, followed by multiple factor analyses and principal component analysis. Clear segregation of complex cuticule profiles of both B. carambolae sexes from B. dorsalis (Hendel) was observed. In addition to cuticular hydrocarbons, abundant complex mixtures of sex-specific oxygenated lipids (three fatty acids and 22 fatty acid esters) with so far unknown function were identified in epicuticle extracts from females of all species. The data obtained supports both taxonomic synonymization of B. invadens, B. papayae, and B. philippinensis with B. dorsalis, as well as the exclusion of B. carambolae from B. dorsalis.

  10. Infestação de cafeeiros por moscas-das-frutas (Diptera: Tephritidae): espécies associadas e parasitismo natural na região sudoeste da Bahia, Brasil Infestation of coffee plantation by fruit flies (Diptera: Tephritidae): associated species and natural parasitism on the Midwest region of Bahia, Brazil La infestación de plantas de café por las moscas de las frutas (Diptera: Tephritidae): las especies asociadas y el parasitismo en la región Suroeste de Bahía, Brasil

    OpenAIRE

    Carlos Alberto Souza Torres; Maria Aparecida Castellani; Raquel Pérez Maluf; José Carlson Gusmão Silva; Antonio Souza Nascimento; Abel Rebouças São José; Aldenise Alves Moreira; Ricardo Falcão de Sá

    2010-01-01

    Fruit flies (Diptera: Tephritidae), the main plague on the global fruitculture, assumed great importance in coffee plantation, since they determine early fall of fruits, increase on the amount of floaters and lost on the dink’s quality. The South-west of the state of Bahia has important fruitculture and coffee plantations, and there are gaps in knowledge about bioecology of tephritid that can support actions of management of these plagues. This work had as objectives ...

  11. First checklist of the fruit flies of Morocco, including new records (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Younes El Harym

    2017-09-01

    Full Text Available The first checklist of the Tephritidae of Morocco, containing 59 species, is presented here. Out of 38 species collected during the present project, three (Campiglossa martii (Becker, 1908, Tephritis divisa (Rondani, 1871, and Terellia sp. near longicauda present new records for North Africa, and ten (Carpomya incompleta (Becker, 1903, Chaetorellia conjuncta (Becker, 1913, Chetostoma curvinerve Rondani, 1856, Dacus frontalis (Becker, 1922, D. longistylus (Wiedemann, 1830, Dioxyna sororcula (Wiedemann, 1830, Ensina sonchi (Linnaeus, 1767, Myopites inulaedyssentericae Blot, 1827, M. stylatus Fabricius, 1794, and Tephritis vespertina (Loew, 1844 are new for Morocco.

  12. Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Anne M. Costa

    2011-09-01

    Full Text Available Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae. Studies on Ceratitis capitata, a world fruit pest, can aid the implementation of control programs by determining the plants with higher vulnerability to attacks and plants able to sustain their population in areas of fly distribution. The objective of the present study was to evaluate the influence of eight tropical fruits on the following biological and behavioral parameters of C. capitata: emergence percentage, life cycle duration, adult size, egg production, longevity, fecundity, egg viability, and oviposition acceptance. The fruits tested were: acerola (Malpighia glabra L., cashew (Anacardium occidentale L., star fruit (Averrhoa carambola L., guava (Psidium guajava L., soursop (Annona muricata L., yellow mombin (Spondias mombin L., Malay apple (Syzygium malaccense L., and umbu (Spondias tuberosa L.. The biological parameters were obtained by rearing the recently hatched larvae on each of the fruit kinds. Acceptance of fruits for oviposition experiment was assessed using no-choice tests, as couples were exposed to two pieces of the same fruit. The best performances were obtained with guava, soursop, and star fruit. Larvae reared on cashew and acerola fruits had regular performances. No adults emerged from yellow mombin, Malay apple, or umbu. Fruit species did not affect adult longevity, female fecundity, or egg viability. Guava, soursop, and acerola were preferred for oviposition, followed by star fruit, Malay apple, cashew, and yellow mombin. Oviposition did not occur on umbu. In general, fruits with better larval development were also more accepted for oviposition.Influência de diferentes frutos tropicais em aspectos biológicos e comportamentais da mosca-das-frutas Ceratitis capitata (Wiedemann (Diptera, Tephritidae. Estudos em Ceratitis capitata, uma praga agrícola, pode auxiliar

  13. Pathogenicity of Beauveria bassiana isolated from Moroccan Argan forests soil against larvae of Ceratitis capitata (Diptera: Tephritidae) in laboratory conditions.

    Science.gov (United States)

    Imoulan, Abdessamad; Elmeziane, Abdellatif

    2014-03-01

    The Mediterranean fruit fly, Ceratitis capitata Wiedemann (Diptera: Tephritidae), is the major tephritid pest in Morocco. This pest survives in Moroccan forests Argania spinosa and continually invades the nearest agricultural areas. Entomopathogenic fungi are an interesting tool for fruit fly control and hold a useful alternative to conventional insecticides. However, primary selection of effective pathogens should be taken in laboratory condition prior to applying them in the field. Here, we used third late instar larvae of C. capitata to investigate the effectiveness of 15 local Beauveria bassiana isolates. Results showed that all isolates were able to infect the larval stage, producing a large mortality rate in puparia ranging from 65 to 95 % and caused significant reduction in adult emergence. The fungal treatments revealed that the mycosis occurred also in adults escaping infection as pupariating larvae. The percentage of mycosed puparia was highest in strain TAM6.2 (95 %) followed by ERS4.16 (90 %), therefore they were the most virulent. Median lethal concentration (LC₅₀) was studied for five isolates at four concentrations ranging from 10⁵ to 10⁸ conidia ml⁻¹. The results showed that the slopes of regression lines for B. bassiana ERS4.16 (slope = 0.386) and TAM6.2 (slope = 0.41) were the most important and had the lowest LC₅₀ values (2.85 × 10³ and 3.16 × 10³ conidia ml⁻¹ respectively). This investigation suggests that the soil of Argan forests contains pathogenic B. bassiana isolates and highlights for the first time their potential as biological control toward C. capitata larval stage in Morocco.

  14. Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Anne M. Costa

    2011-09-01

    Full Text Available Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae. Studies on Ceratitis capitata, a world fruit pest, can aid the implementation of control programs by determining the plants with higher vulnerability to attacks and plants able to sustain their population in areas of fly distribution. The objective of the present study was to evaluate the influence of eight tropical fruits on the following biological and behavioral parameters of C. capitata: emergence percentage, life cycle duration, adult size, egg production, longevity, fecundity, egg viability, and oviposition acceptance. The fruits tested were: acerola (Malpighia glabra L., cashew (Anacardium occidentale L., star fruit (Averrhoa carambola L., guava (Psidium guajava L., soursop (Annona muricata L., yellow mombin (Spondias mombin L., Malay apple (Syzygium malaccense L., and umbu (Spondias tuberosa L.. The biological parameters were obtained by rearing the recently hatched larvae on each of the fruit kinds. Acceptance of fruits for oviposition experiment was assessed using no-choice tests, as couples were exposed to two pieces of the same fruit. The best performances were obtained with guava, soursop, and star fruit. Larvae reared on cashew and acerola fruits had regular performances. No adults emerged from yellow mombin, Malay apple, or umbu. Fruit species did not affect adult longevity, female fecundity, or egg viability. Guava, soursop, and acerola were preferred for oviposition, followed by star fruit, Malay apple, cashew, and yellow mombin. Oviposition did not occur on umbu. In general, fruits with better larval development were also more accepted for oviposition.

  15. Influence of media type and moisture on adult development and pupal mortality in Rhagoletis indifferens (Diptera: Tephritidae).

    Science.gov (United States)

    Yee, Wee L

    2013-06-01

    The influence of media type and moisture on adult development and pupal mortality in western cherry fruit fly, Rhagoletis indifferens Curran (Diptera:Tephritidae), was assessed using the pupal-adult and the larval-pupal stage. Inside containers, a higher percent of flies that emerged from dry loam was deformed (44.2%, 1-cm-depth loam; 84.4%, 5-cm-depth loam) than flies from 16% moist loam and dry and 16% moist lab soil (peat moss-sand mix) (0-14.9%). Percent of flies deformed from dry sand (22.1%, 1-cm depth; 49.5%, 5-cm depth) was greater than from 16% moist sand and dry and 16% moist peat moss (0-10.5%). Percents of flies deformed from 8% moist loam, lab soil, sand, and peat moss (0-5.8%) did not differ. Pupae suffered higher mortality at 7 and 14 d after larvae were dropped onto dry loam and dry sand (68.2-94.0%) than dry lab soil and dry peat moss (3.0-53.0%); respective mortalities at 21 and 28 d were similar (81.3-96.0 versus 64.7-97.9%). Pupal mortality in moist media was lower (0.5-40.3%) than in dry media. In outdoor tests, pupal mortality was also higher in dry loam than other dry media. In nature, 60.9% of pupae in dry sandy loams in late summer were dead. Results suggest R. indifferens has not yet evolved to fully cope with dry soils and that pupation in media with traits similar to those of peat moss or a peat moss-sand mix could reduce negative effects of dry environments on fly survival.

  16. Attraction and consumption of methyl eugenol by male Bactrocera umbrosa Fabricius (Diptera: Tephritidae) promotes conspecific sexual communication and mating performance.

    Science.gov (United States)

    Wee, S L; Abdul Munir, M Z; Hee, A K W

    2018-02-01

    The Artocarpus fruit fly, Bactrocera umbrosa (Fabricius) (Diptera: Tephritidae), is an oligophagous fruit pest infesting Moraceae fruits, including jackfruit (Artocarpus heterophyllus Lamarck), a fruit commodity of high value in Malaysia. The scarcity of fundamental biological, physiological and ecological information on this pest, particularly in relation to behavioural response to phytochemical lures, which are instrumental to the success of many area-wide fruit fly control and management programmes, underpins the need for studies on this much-underrated pest. The positive response of B. umbrosa males to methyl eugenol (ME), a highly potent phytochemical lure, which attracts mainly males of many Bactrocera species, was shown to increase with increasing age. As early as 7 days after emergence (DAE), ca. 22% of males had responded to ME and over 50% by 10 DAE, despite no occurrence of matings (i.e. the males were still sexually immature). Male attraction to ME peaked from 10 to 27 DAE, which corresponded with the flies' attainment of sexual maturity. In wind-tunnel assays during the dusk courtship period, ME-fed males exhibited earlier calling activity and attracted a significantly higher percentage of virgin females compared with ME-deprived males. ME-fed males enjoyed a higher mating success than ME-deprived males at 1-day post ME feeding in semi-field assays. ME consumption also promotes aggregation behaviour in B. umbrosa males, as demonstrated in wind-tunnel and semi-field assays. We suggest that ME plays a prominent role in promoting sexual communication and enhancing mating performance of the Artocarpus fruit fly, a finding that is congruent with previous reports on the consequences of ME acquisition by other economically important Bactrocera species.

  17. Suppression of Mediterranean Fruit Fly (Diptera: Tephritidae) With Trimedlure and Biolure Dispensers in Coffea arabica (Gentianales: Rubiaceae) in Hawaii.

    Science.gov (United States)

    Vargas, Roger I; Souder, Steven K; Rendon, Pedro; Mackey, Bruce

    2017-11-23

    To assess the potential to suppress Mediterranean fruit fly, Ceratitis capitata (Wiedemann; Diptera: Tephritidae), via mass trapping with Trimedlure (TML), we compared fly catch (as catch per trap per time period) provided by either a novel, solid, triple-lure dispenser with TML, methyl eugenol (ME), and raspberry ketone (RK) (TMR) or solid TML plugs, both without insecticides, in addition to Biolure bait stations. Work was done in a coffee plantation that had a dense C. capitata population. Three treatments were compared: 1) TMR or TML (50 traps per ha), 2) Biolure (50 traps per ha), 3) TML (25 per ha) or TMR (25 per ha) + Biolure (25 per ha), and 4) an untreated control. During coffee season, based on C. capitata captures (mean flies per trap per wk) inside plastic McPhail traps, all treatments were significantly different than the control: Biolure (9.57) = TMR (11.28) = Biolure +TMR (13.50) < Control (36.06 flies/trap/wk). During non-coffee season, all treatments were significantly different than the control and TML was significantly lower than Biolure (wax matrix bait stations): TML (0.95) < Biolure (1.43) = Biolure +TML (1.77) < Control (2.81 flies/trap/wk). Surprisingly, captures were not lower in plots treated with combinations of Biolure + TMR or TML, compared to individual plots with Biolure or TML or TMR alone. Mass trapping with either TML or TMR dispensers deserves further study as a component of Integrated Pest Management programs for C. capitata in Hawaii and may have global potential for management of C. capitata. Published by Oxford University Press on behalf of Entomological Society of America 2017. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  18. The complete mitochondrial genome of the pumpkin fruit fly, Bactrocera tau (Diptera: Tephritidae).

    Science.gov (United States)

    Tan, Meihua; Zhang, Rui; Xiang, Caiyu; Zhou, Xin

    2016-07-01

    The pumpkin fruit fly, Bactrocera tau, is an important quarantine pest in many countries because of its mass destructiveness to a variety of vegetable and fruit plants. In this study, we report the complete mitochondrial genome (mitogenome) of B. tau. Its complete mitogenome sequence is 15,687 bp in length, which contains a non-coding control region and all of the 37 genes of bilaterian animals (13 protein-coding genes, 22 tRNA genes and 2 rRNA genes). A phylogenetic tree of the complete mitogenome of all available Tephritidae species was established to approve the accuracy. The base composition of mitogenome sequence and the gene arrangement including directions are rather conservative, compared to other published mitogenomes of Bactrocera species. This first complete mitogenome of B. tau will facilitate the development of new DNA markers for species diagnosis, therefore improving accurate detection of quarantine species.

  19. Mating compatibility among four pest members of the Bactrocera dorsalis fruit fly species complex (Diptera: Tephritidae).

    Science.gov (United States)

    Schutze, M K; Jessup, A; Ul-Haq, I; Vreysen, M J B; Wornoayporn, V; Vera, M T; Clarke, A R

    2013-04-01

    Bactrocera dorsalis (Hendel), Bactrocera papayae Drew & Hancock, Bactrocera philippinensis Drew & Hancock, and Bactrocera carambolae Drew & Hancock are pest members within the B. dorsalis species complex of tropical fruit flies. The species status of these taxa is unclear and this confounds quarantine, pest management, and general research. Mating studies carried out under uniform experimental conditions are required as part of resolving their species limits. These four taxa were collected from the wild and established as laboratory cultures for which we subsequently determined levels of prezygotic compatibility, assessed by field cage mating trials for all pair-wise combinations. We demonstrate random mating among all pair-wise combinations involving B. dorsalis, B. papayae, and B. philippinensis. B. carambolae was relatively incompatible with each of these species as evidenced by nonrandom mating for all crosses. Reasons for incompatibility involving B. carambolae remain unclear; however, we observed differences in the location of couples in the field cage for some comparisons. Alongside other factors such as pheromone composition or other courtship signals, this may lead to reduced interspecific mating compatibility with B. carambolae. These data add to evidence that B. dorsalis, B. papayae, and B. philippinensis represent the same biological species, while B. carambolae remains sufficiently different to maintain its current taxonomic identity. This poses significant implications for this group's systematics, impacting on pest management, and international trade.

  20. Bacterial communities associated with invasive populations of Bactrocera dorsalis (Diptera: Tephritidae) in China.

    Science.gov (United States)

    Liu, L J; Martinez-Sañudo, I; Mazzon, L; Prabhakar, C S; Girolami, V; Deng, Y L; Dai, Y; Li, Z H

    2016-12-01

    The oriental fruit fly Bactrocera dorsalis (Hendel) is a destructive insect pest of a wide range of fruits and vegetables. This pest is an invasive species and is currently distributed in some provinces of China. To recover the symbiotic bacteria of B. dorsalis from different invasion regions in China, we researched the bacterial diversity of this fruit fly among one laboratory colony (Guangdong, China) and 15 wild populations (14 sites in China and one site in Thailand) using DNA-based approaches. The construction of 16S rRNA gene libraries allowed the identification of 24 operational taxonomic units of associated bacteria at the 3% distance level, and these were affiliated with 3 phyla, 5 families, and 13 genera. The higher bacterial diversity was recovered in wild populations compared with the laboratory colony and in samples from early term invasion regions compared with samples from late term invasion regions. Moreover, Klebsiella pneumoniae and Providencia sp. were two of the most frequently recovered bacteria, present in flies collected from three different regions in China where B. dorsalis is invasive. This study for the first time provides a systemic investigation of the symbiotic bacteria of B. dorsalis from different invasion regions in China.

  1. Nonhost status of mangosteen to Bactrocera dorsalis and Bactrocera carambolae (Diptera: Tephritidae) in Thailand.

    Science.gov (United States)

    Unahawutti, Udorn; Intarakumheng, Rachada; Oonthonglang, Pitawat; Phankum, Salukjit; Follett, Peter A

    2014-08-01

    Postharvest quarantine treatments (irradiation or vapor heat) are used to control fruit flies and other pests in mangosteen (Garcinia mangostana L) exported to the United States and Japan from Thailand. No-choice tests were conducted in the laboratory to determine whether Thai mangosteen is a host for Bactrocera dorsalis (Hendel) (oriental fruit fly) and Bactrocera carambolae Drew & Hancock (carambola fruit fly). Ripe commercial quality fruit (1 wk after harvest) that were either undamaged or damaged by puncturing or peeling the pericarp were exposed to a high density of gravid flies in screen cages and then held for 10 d and dissected to inspect for immature life stages. Undamaged mangosteen fruit were not infested by B. dorsalis and B. carambolae. Partially damaged fruit with shallow punctures in the pericarp that did not extend to the aril also were not infested. Both fruit flies could infest damaged fruit if the pericarp damage allowed oviposition in the aril. Results suggest that natural infestation of mangosteen by B. dorsalis and B. carambolae can only occur if fruit exhibit physical cracks or mechanical injury. Resistance appears to be due to the pericarp hardness and thickness as well as latex secretion. Nonhost status could be used without additional quarantine measures to achieve quarantine security against B. dorsalis and B. carambolae in mangosteen exported from Thailand.

  2. Genetic characterization of Bactrocera fruit flies (Diptera: Tephritidae) from Northeastern India based on DNA barcodes.

    Science.gov (United States)

    Manger, Arpana; Behere, G T; Firake, D M; Sharma, Bhagawati; Deshmukh, N A; Firake, P D; Azad Thakur, N S; Ngachan, S V

    2017-07-31

    The Northeastern region of India, one of the mega biodiversity hot spots has enormous potential for the production of fruits and vegetables. Fruit flies of the genus Bactrocera Macquart are important pests of fruits and vegetables, and one of the limiting factors in successful production of these commodities. The relationship among some of the species is unclear due to their high molecular and morphological similarities. Moreover, due to the significant morphological resemblance between fruit fly species, reliable identification is very difficult task. We genetically characterized 10 fruit fly species of the genus Bactrocera by using standard DNA barcoding region of COI gene. The characterization and identification of eight species were straight forward. This study was unable to establish the molecular identity of Bactrocera sp. 2. Within the 547 bp region of partial COI gene, there were 157 variable sites of which 110 sites were parsimony informative, 153 were synonymous substitutions and 4 were non-synonymous substitutions. The estimate of genetic divergence among the ten species was in the range of 0-21.9% and the pairwise genetic distance of Bactrocera. (Bactrocera) dorsalis (Hendel) with B. (B.) carambolae was only 0.7%. Phylogenetic analysis formed separate clades for fruit and vegetable infesting fruit flies. B. (B.) aethriobasis Hardy, B. (B.) thailandica and B. (B.) tuberculata (Bezzi) have been reported for the first time from the Northeastern India. The information generated from this study would certainly have implications for pest management, taxonomy, quarantine and trade.

  3. Inheritance, Realized Heritability, and Biochemical Mechanisms of Malathion Resistance in Bactrocera dorsalis (Diptera: Tephritidae).

    Science.gov (United States)

    Wang, Luo-Luo; Feng, Zi-Jiao; Li, Ting; Lu, Xue-Ping; Zhao, Jia-Jia; Niu, Jin-Zhi; Smagghe, Guy; Wang, Jin-Jun

    2016-02-01

    To better characterize the resistance development and therefore establish effective pest management strategies, this study was undertaken to investigate the inheritance mode and biochemical mechanisms of malathion resistance in the oriental fruit fly, Bactrocera dorsalis (Hendel), which is one of the most notorious pests in the world. After 22 generations of selection with malathion, the malathion-resistant (MR) strain of B. dorsalis developed a 34-fold resistance compared with a laboratory susceptible strain [malathion-susceptible (MS)]. Bioassay results showed that there was no significant difference between the LD50 values of malathion against the progenies from both reciprocal crosses (F(1)-SR and F(1)-RS). The degree of dominance values (D) was calculated as 0.39 and 0.32 for F(1)-RS and F(1)-SR, respectively. The logarithm dosage-probit mortality lines of the F(2) generation and progeny from the backcross showed no clear plateaus of mortality across a range of doses. In addition, Chi-square analysis revealed significant differences between the mortality data and the theoretical expectations. The realized heritability (h(2)) value was 0.16 in the laboratory-selected resistant strain of B. dorsalis. Enzymatic activities identified significant changes of carboxylesterases, cytochrome P450 (general oxidases), and glutathione S-transferases in MR compared with the MS strain of B. dorsalis. Taken together, this study revealed for the first time that malathion resistance in B. dorsalis follows an autosomal, incompletely dominant, and polygenic mode of inheritance and is closely associated with significantly elevated activities of three major detoxification enzymes. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. Monitoring of Bactrocera dorsalis (Diptera: Tephritidae) resistance to cyantraniliprole in the south of China.

    Science.gov (United States)

    Zhang, Ruimin; He, Shiyu; Chen, Jiahua

    2014-06-01

    The oriental fruit fly, Bactrocera dorsalis (Hendel), is a globally important economic insect pest that has evolved resistance to various types of insecticides. Cyantraniliprole (DuPont Cyazypyr) is a new anthranilic diamide insecticide registered to control lepidopteran and sucking insects. The susceptibility of field-collected populations of B. dorsalis to cyantraniliprole was assessed via a diet incorporation bioassay in adults. Based on the obtained LC50 values (ranging from 3.29 to 15.83 microg/g), all the testing populations, including ZZ (Fujian province), HH (Yunnan province), JM (Guangdong province), SY (Hainan province), HZ (Zhejiang province), YL (Guangxi province), SH (Shanghai), WH (Hubei province), and CS (Hunan province), were susceptible to cyantraniliprole, with the samples of WH (Hubei province) being the most tolerant (by 4.80-fold). Two (SY, Hainan province; CS, Hunan province) of the nine field-collected populations of B. dorsalis showed a similar susceptibility to cyantraniliprole, while the remaining populations displayed narrow variations in tolerance compared with the laboratory strain. Synergist assays were performed to determine the potential detoxification mechanisms. Piperonyl butoxide showed significant synergism effects in lab, CS, and resistant strain. S,S,S-tributylphorotrithioate and diethyl maleate also showed obvious synergism effects in resistant strain. A 19.44-fold increase in resistance to cyantraniliprole was observed after 14 generations of selection in the laboratory. The present work clarifies the baseline susceptibility and primary mechanisms of B. dorsalis to cyantraniliprole in the south China and established a cyantraniliprole-resistant strain as well. A sound resistance management strategy is also discussed in relation to the risk of susceptibility.

  5. Inter-regional mating compatibility among Bactrocera dorsalis populations in Thailand (Diptera,Tephritidae)

    Science.gov (United States)

    Chinvinijkul, Suksom; Srikachar, Sunyanee; Kumjing, Phatchara; Weera Kimjong; Sukamnouyporn, Weerawan; Polchaimat, Nongon

    2015-01-01

    Abstract Mating compatibility among recently colonized (wildish) populations of Bactrocera dorsalis (Hendel) from different geographic origins in Thailand was assessed through inter-regional mating tests. Outdoor octagonal nylon screen field cages containing single potted mango trees (Mangifera indica L.) were used. Sexual compatibility was determined using the index of sexual isolation (ISI), the male relative performance index (MRPI), and the female relative performance index (FRPI). The ISI values indicated that the northern population of Bactrocera dorsalis from Chiang Mai province was sexually compatible with the southern population of Bactrocera dorsalis (previously Bactrocera papayae) from Nakhon Si Thammarat province. The MRPI values showed that the northern males had a slightly higher tendency to mate than southern males, while the FRPI data reflected that females of both origins participated equally in matings. In all combinations there were no differences between homotypic and heterotypic couples in mating latency. Southern males tended to mate first with southern females, followed by northern males mating with northern females, while the latest matings involved heterotypic couples, in particular northern males mating with southern females. Overall, more couples were collected from higher parts of the field cage and the upper tree canopy, while there were no differences between the origins of flies in terms of elevation of couples within the cage. Laboratory assessments of fecundity showed no differences in the average number of eggs resulting from inter-regional crosses. Development of immature stages was also equal in the two hybrid crosses, with no differences found in the number of pupae produced, percentage pupal recovery, and percent adult emergence. The practical implication of this study is that colony of Bactrocera dorsalis derived from any northern or southern region of Thailand can potentially be used in sterile insect technique programs

  6. PARASITOIDES (HYMENOPTERA DE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE NO SEMIÁRIDO DO ESTADO DO CEARÁ, BRASIL

    Directory of Open Access Journals (Sweden)

    ELTON LUCIO ARAUJO

    2015-09-01

    Full Text Available RESUMO As moscas-das-frutas (Diptera: Tephritidae, Anastrepha spp. e Ceratitis capitata(Wiedemann, são importantes pragas da fruticultura no Brasil. Para desenvolver um sistema sustentável de manejo integrado para este grupo de pragas, é fundamental conhecer os parasitoides (Hymenoptera que podem regular as populações destes tefritídeos. Portanto, o objetivo deste estudo foi relatar a diversidade, a distribuição geográfica e as relações tritróficas dos himenópteros parasitoides de moscas-das-frutas, na região do Baixo Jaguaribe, no semiárido do Estado do Ceará, Brasil. Foram realizadas coletas de frutos em sete municípios da região, no período de maio de 2010 amaio de 2013. Os frutos foram levados para o laboratório, onde foram contados, pesados, colocados em bandejas plásticas com vermiculita e fechadas com tecido voile. Após sete dias, a vermiculita foi peneirada para a obtenção dos pupários das moscas-das-frutas que, em seguida, foram contados e acondicionados em placas de Petri, onde permaneceram até a emergência dos adultos (moscas e/ou parasitoides. Quatro espécies de parasitoides foram encontradas: Doryctobracon areolatus(Szépligeti, Opius bellus Gahan, Utetes anastrephae(Viereck (Braconidae e Tetrastichus giffardianusSilvestri (Eulophidae,sendo o mais frequente e com maior distribuição geográfica na região, D. areolatus. Doryctobracon areolatusfoi mais comum em associação com espécies de Anastrepha - A. sororcula Zucchi, A. obliqua (Mcquart e A. zenildae Zucchi, em frutos nativos e com C. capitata em frutos exóticos. Tetrastichus giffardianus foi obtido apenas em associação com C. capitata, em frutos nativos e exóticos. Estas informações podem servir de base para inserção de parasitoides em futuros programas de manejo integrado de moscas-das-frutas, nas condições do Semiárido brasileiro.

  7. Generic ionizing radiation quarantine treatments against fruit flies (Diptera: Tephritidae) proposed.

    Science.gov (United States)

    Hallman, Guy J; Loaharanu, Paisan

    2002-10-01

    Tephritid fruit flies comprise the most important group of quarantined pests of fresh produce. Most quarantine treatments of fresh agricultural commodities are directed against these pests, and considerable effort in detection, trapping, and population control is expended worldwide to prevent these pests from invading new territories. Ionizing radiation has been studied for 70 yr for its possible use as a quarantine treatment against fruit flies, but has only been applied commercially on a limited basis since 1995. The treatment has great potential and will probably be used extensively in the future as it is tolerated by more species of fruits than any other major treatment. The U.S. Department Agriculture, Animal and Plant Health Inspection Service only recently proposed allowing irradiation for fresh agricultural imports from other countries, and other countries are studying proposals to do likewise. In 1991, the International Consultative Group on Food Irradiation recommended a generic dose against all tephritid fruit flies of 150 Gy. This article examines the literature dealing with irradiation quarantine treatments against fruit flies and recommends minimum absorbed doses of 70 Gy for Anastrepha spp., 101 Gy for Bactrocera jarvisi and B. tryoni, and 150 Gy for all Tephritidae except when fruits have been stored in hypoxic atmospheres.

  8. In silico cloning and annotation of genes involved in the digestion, detoxification and RNA interference mechanism in the midgut of Bactrocera dorsalis [Hendel (Diptera: Tephritidae)].

    Science.gov (United States)

    Shen, G-M; Dou, W; Huang, Y; Jiang, X-Z; Smagghe, G; Wang, J-J

    2013-08-01

    As the second largest organ in insects, the insect midgut is the major tissue involved in the digestion of food and detoxification of xenobiotics, such as insecticides, and the first barrier and target for oral RNA interference (RNAi). In this study, we performed a midgut-specific transcriptome analysis in the oriental fruit fly, Bactrocera dorsalis, an economically important worldwide pest, with many populations showing high levels of insecticide resistance. Using high-throughput sequencing, 52 838 060 short reads were generated and assembled to 25 236 unigenes with a mean length of 758 bp. Interestingly, 34 unique sequences encoding digestion enzymes were newly described and these included aminopeptidase and trypsin, genes associated with Bacillus thuringiensis resistance and fitness cost. Second, 41 transcripts were annotated to particular detoxification genes such as glutathione S-transferases, carboxylesterases and cytochrome P450s, and the subsequent phylogenetic analysis indicated homology with tissue-specific and insecticide resistance-related genes of Drosophila melanogaster. Third, we identified the genes involved in the mechanism of RNAi and the uptake of double-stranded RNA. The sequences encoding Dicer-2, R2D2, AGO2, and Eater were confirmed, but SID and SR-CI were absent in the midgut transcriptome. In conclusion, the results provide basic molecular information to better understand the mechanisms of food digestion, insecticide resistance and oral RNAi in this important pest insect in agriculture. Specific genes in these systems can be used in the future as potential targets for pest control, for instance, with RNAi technology. © 2013 Royal Entomological Society.

  9. The effect of dietary restriction on longevity, fecundity, and antioxidant responses in the oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae).

    Science.gov (United States)

    Chen, Er-Hu; Wei, Dong; Wei, Dan-Dan; Yuan, Guo-Rui; Wang, Jin-Jun

    2013-10-01

    Recent studies in fruit flies have imposed dietary restriction (DR) by diluting yeast and have reported increased lifespan as the yeast-to-sugar ratio decreased. In this study, the effects of DR on the lifespan of Bactrocera dorsalis were investigated using constant-feeding diets with different yeast:sugar ratios and an intermittent-feeding diet in which flies ate every sixth day. Antioxidant enzyme activities and the malondialdehyde concentration were also measured in virgin females under constant-feeding DR protocols to investigate their relationships with lifespan. The results showed that B. dorsalis lifespan was significantly extended by DR, and carbohydrate-enriched diet may be important for lifespan-extension. Female flies lived significantly longer than males at all dietary levels under both feeding regimes, indicating no interaction between diet and sex in determining lifespan. Antioxidant enzyme activities increased with the amount of yeast increased in the diets (0-4.76%) between starvation and DR treatments, indicating that the antioxidants may have influences in determining lifespan in B. dorsalis under starvation and DR treatments. However, antioxidants cannot keep up with increased oxidative damage induced by the high yeast diet (25%). These results revealed that the extension of lifespan by DR is evolutionarily conserved in B. dorsalis and that yeast:sugar ratios significantly modulate lifespan in this species. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Including climate change in pest risk assessment: the peach fruit fly, Bactrocera zonata (Diptera: Tephritidae).

    Science.gov (United States)

    Ni, W L; Li, Z H; Chen, H J; Wan, F H; Qu, W W; Zhang, Z; Kriticos, D J

    2012-04-01

    Bactrocera zonata (Saunders) is one of the most harmful species of Tephritidae. It causes extensive damage in Asia and threatens many countries located along or near the Mediterranean Sea. The climate mapping program, CLIMEX 3.0, and the GIS software, ArcGIS 9.3, were used to model the current and future potential geographical distribution of B. zonata. The model predicts that, under current climatic conditions, B. zonata will be able to establish itself throughout much of the tropics and subtropics, including some parts of the USA, southern China, southeastern Australia and northern New Zealand. Climate change scenarios for the 2070s indicate that the potential distribution of B. zonata will expand poleward into areas which are currently too cold. The main factors limiting the pest's range expansion are cold, hot and dry stress. The model's predictions of the numbers of generations produced annually by B. zonata were consistent with values previously recorded for the pest's occurrence in Egypt. The ROC curve and the AUC (an AUC of 0.912) were obtained to evaluate the performance of the CLIMEX model in this study. The analysis of this information indicated a high degree of accuracy for the CLIMEX model. The significant increases in the potential distribution of B. zonata projected under the climate change scenarios considered in this study suggest that biosecurity authorities should consider the effects of climate change when undertaking pest risk assessments. To prevent the introduction and spread of B. zonata, enhanced quarantine and monitoring measures should be implemented in areas that are projected to be suitable for the establishment of the pest under current and future climatic conditions.

  11. A global checklist of the 932 fruit fly species in the tribe Dacini (Diptera, Tephritidae)

    Science.gov (United States)

    Doorenweerd, Camiel; Leblanc, Luc; Norrbom, Allen L.; Jose, Michael San; Rubinoff, Daniel

    2018-01-01

    Abstract The correct application of the scientific names of species is neither easy nor trivial. Mistakes can lead to the wrong interpretation of research results or, when pest species are involved, inappropriate regulations and limits on trade, and possibly quarantine failures that permit the invasion of new pest species. Names are particularly challenging to manage when groups of organisms encompass a large number of species, when different workers employ different philosophical views, or when species are in a state of taxonomic flux. The fruit fly tribe Dacini is a species-rich taxon within Tephritidae and contains around a fifth of all known species in the family. About 10% of the 932 currently recognized species are pests of commercial fruits and vegetables, precipitating quarantines and trade embargos. Authoritative species lists consist largely of scattered regional treatments and outdated online resources. The checklist presented here is the first global overview of valid species names for the Dacini in almost two decades, and includes new lure records. By publishing this list both in paper and digitally, we aim to provide a resource for those studying fruit flies as well as researchers studying components of their impact on agriculture. The list is largely a consolidation of previous works, but following the results from recent phylogenetic work, we transfer one subgenus and eight species to different genera: members of the Bactrocera subgenus Javadacus Hardy, considered to belong to the Zeugodacus group of subgenera, are transferred to genus Zeugodacus; Bactrocera pseudocucurbitae White, 1999, stat. rev., is transferred back to Bactrocera from Zeugodacus; Zeugodacus arisanicus Shiraki, 1933, stat. rev., is transferred back to Zeugodacus from Bactrocera; and Z. brevipunctatus (David & Hancock, 2017), comb. n.; Z. javanensis (Perkins, 1938), comb. n.; Z. montanus (Hardy, 1983), comb. n.; Z. papuaensis (Malloch, 1939), comb. n.; Z. scutellarius (Bezzi, 1916

  12. A global checklist of the 932 fruit fly species in the tribe Dacini (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Camiel Doorenweerd

    2018-01-01

    Full Text Available The correct application of the scientific names of species is neither easy nor trivial. Mistakes can lead to the wrong interpretation of research results or, when pest species are involved, inappropriate regulations and limits on trade, and possibly quarantine failures that permit the invasion of new pest species. Names are particularly challenging to manage when groups of organisms encompass a large number of species, when different workers employ different philosophical views, or when species are in a state of taxonomic flux. The fruit fly tribe Dacini is a species-rich taxon within Tephritidae and contains around a fifth of all known species in the family. About 10% of the 932 currently recognized species are pests of commercial fruits and vegetables, precipitating quarantines and trade embargos. Authoritative species lists consist largely of scattered regional treatments and outdated online resources. The checklist presented here is the first global overview of valid species names for the Dacini in almost two decades, and includes new lure records. By publishing this list both in paper and digitally, we aim to provide a resource for those studying fruit flies as well as researchers studying components of their impact on agriculture. The list is largely a consolidation of previous works, but following the results from recent phylogenetic work, we transfer one subgenus and eight species to different genera: members of the Bactrocera subgenus Javadacus Hardy, considered to belong to the Zeugodacus group of subgenera, are transferred to genus Zeugodacus; Bactrocera pseudocucurbitae White, 1999, stat. rev., is transferred back to Bactrocera from Zeugodacus; Zeugodacus arisanicus Shiraki, 1933, stat. rev., is transferred back to Zeugodacus from Bactrocera; and Z. brevipunctatus (David & Hancock, 2017, comb. n.; Z. javanensis (Perkins, 1938, comb. n.; Z. montanus (Hardy, 1983, comb. n.; Z. papuaensis (Malloch, 1939, comb. n.; Z. scutellarius (Bezzi

  13. Field estimates of attraction of Ceratitis capitata to Trimedlure and Bactrocera dorsalis (Diptera: Tephritidae) to methyl eugenol in varying environments

    Science.gov (United States)

    Measuring and modeling the attractiveness of semiochemical-baited traps is of significant importance to detection, delimitation and control of invasive pests. Here we describe the results of field mark-release-recapture experiments with Ceratitis capitata (Wiedemann) and Bactrocera dorsalis (Hendel)...

  14. The gene transformer-2 of Anastrepha fruit flies (Diptera, Tephritidae) and its evolution in insects.

    Science.gov (United States)

    Sarno, Francesca; Ruiz, María F; Eirín-López, José M; Perondini, André L P; Selivon, Denise; Sánchez, Lucas

    2010-05-13

    the ancestral state (which still exists in the Tephritidae, Calliphoridae and Muscidae lineages) of the extant cascade found in the Drosophilidae lineage (in which tra is just another component of the sex determination gene cascade regulated by Sex-lethal). In the phylogenetic lineage that gave rise to the drosophilids, evolution co-opted for Sex-lethal, modified it, and converted it into the key gene controlling sex determination.

  15. An evaluation of the species status of Bactrocera invadens and the Systematics of the Bactrocera dorsalis (Diptera: Tephritidae) complex

    Science.gov (United States)

    The genus Bactrocera (Tephritidae) contains over 500 species, including many severe pests of fruits and vegetables. While native to tropical and sub-tropical areas of Africa, India, Southeast Asia and Australasia, a number of the pest species, largely members of the Bactrocera dorsalis complex, have...

  16. Influence of Pupation Substrate on Mass Production and Fitness of Adult Anastrepha obliqua Macquart (Diptera: Tephritidae) for Sterile Insect Technique Application.

    Science.gov (United States)

    Aceituno-Medina, Marysol; Rivera-Ciprian, José Pedro; Hernández, Emilio

    2017-10-16

    Tephritid mass-rearing systems require an artificial substrate for pupation. Pupation substrate characteristics influence the quality of insects produced. Coconut fiber, as an alternative to the conventional pupation substrate vermiculite, was evaluated for Anastrepha obliqua Macquart (Diptera: Tephritidae) pupation behavior (pupation patterns, distribution, respiration rate, and pupal weight) and adult fitness (adult eclosion time, flight ability, and male mating competitiveness). Pupation percentage at 24 h, pupal weight, and flight ability were not significantly affected by substrate type. Adult eclosion levels of 50% were reached at 29.7 and 41.6 h for coconut fiber and vermiculite, respectively. Pupae distribution patterns differed between substrates because the larval aggregation level was reduced during the pupation process in coconut fiber. The pupae aggregation was three times greater in vermiculite than in coconut fiber. A higher respiratory rate in the last days of pupation and adult eclosion were recorded in the insects maintained in coconut fiber. Coconut fiber suitability as a pupation substrate for quality mass production of pupae and its implications for sterile insect technique are discussed. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  17. Geostatistics and Geographic Information System to Analyze the Spatial Distribution of the Diversity of Anastrepha Species (Diptera: Tephritidae): the Effect of Forest Fragments in an Urban Area.

    Science.gov (United States)

    Garcia, A G; Araujo, M R; Uramoto, K; Walder, J M M; Zucchi, R A

    2017-12-08

    Fruit flies are among the most damaging insect pests of commercial fruit in Brazil. It is important to understand the landscape elements that may favor these flies. In the present study, spatial data from surveys of species of Anastrepha Schiner (Diptera: Tephritidae) in an urban area with forest fragments were analyzed, using geostatistics and Geographic Information System (GIS) to map the diversity of insects and evaluate how the forest fragments drive the spatial patterns. The results indicated a high diversity of species associated with large fragments, and a trend toward lower diversity in the more urbanized area, as the fragment sizes decreased. We concluded that the diversity of Anastrepha species is directly and positively related to large and continuous forest fragments in urbanized areas, and that combining geostatistics and GIS is a promising method for use in insect-pest management and sampling involving fruit flies. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Insecticidal Activity of the Leaf Essential Oil of Peperomia borbonensis Miq. (Piperaceae) and Its Major Components against the Melon Fly Bactrocera cucurbitae (Diptera: Tephritidae).

    Science.gov (United States)

    Dorla, Emmanuelle; Gauvin-Bialecki, Anne; Deuscher, Zoé; Allibert, Agathe; Grondin, Isabelle; Deguine, Jean-Philippe; Laurent, Philippe

    2017-06-01

    The essential oil from the leaves of Peperomia borbonensis from Réunion Island was obtained by hydrodistillation and characterized using GC-FID, GC/MS and NMR. The main components were myristicin (39.5%) and elemicin (26.6%). The essential oil (EO) of Peperomia borbonensis and its major compounds (myristicin and elemicin), pure or in a mixture, were evaluated for their insecticidal activity against Bactrocera cucurbitae (Diptera: Tephritidae) using a filter paper impregnated bioassay. The concentrations necessary to kill 50% (LC 50 ) and 90% (LC 90 ) of the flies in three hours were determined. The LC 50 value was 0.23 ± 0.009 mg/cm 2 and the LC 90 value was 0.34 ± 0.015 mg/cm 2 for the EO. The median lethal time (LT 50 ) was determined to compare the toxicity of EO and the major constituents. The EO was the most potent insecticide (LT 50  = 98 ± 2 min), followed by the mixture of myristicin and elemicin (1.4:1) (LT 50  = 127 ± 2 min) indicating that the efficiency of the EO is potentiated by minor compounds and emphasizing one of the major assets of EOs against pure molecules. © 2017 Wiley-VHCA AG, Zurich, Switzerland.

  19. Is bigger better? Male body size affects wing-borne courtship signals and mating success in the olive fruit fly, Bactrocera oleae (Diptera: Tephritidae).

    Science.gov (United States)

    Benelli, Giovanni; Donati, Elisa; Romano, Donato; Ragni, Giacomo; Bonsignori, Gabriella; Stefanini, Cesare; Canale, Angelo

    2016-12-01

    Variations in male body size are known to affect inter- and intrasexual selection outcomes in a wide range of animals. In mating systems involving sexual signaling before mating, body size often acts as a key factor affecting signal strength and mate choice. We evaluated the effect of male size on courtship displays and mating success of the olive fruit fly, Bactrocera oleae (Diptera: Tephritidae). Wing vibrations performed during successful and unsuccessful courtships by large and small males were recorded by high-speed videos and analyzed through frame-by-frame analysis. Mating success of large and small males was investigated. The effect of male-male competition on mating success was evaluated. Male body size affected both male courtship signals and mating outcomes. Successful males showed wing-borne signals with high frequencies and short interpulse intervals. Wing vibrations displayed by successful large males during copulation attempt had higher frequencies over smaller males and unsuccessful large males. In no-competition conditions, large males achieved higher mating success with respect to smaller ones. Allowing large and small males to compete for a female, large males achieve more mating success over smaller ones. Mate choice by females may be based on selection of the larger males, able to produce high-frequency wing vibrations. Such traits may be indicative of "good genes," which under sexual selection could means good social-interaction genes, or a good competitive manipulator of conspecifics. © 2015 Institute of Zoology, Chinese Academy of Sciences.

  20. Quarantine security of bananas at harvest maturity against Mediterranean and Oriental fruit flies (Diptera: Tephritidae) in Hawaii.

    Science.gov (United States)

    Armstrong, J W

    2001-02-01

    Culled bananas (dwarf 'Brazilian', 'Grand Nain', 'Valery', and 'Williams') sampled from packing houses on the islands of Hawaii, Kauai, Maui, Molokai, and Oahu identified specific "faults" that were at risk from oriental fruit fly, Bactrocera dorsalis (Hendel), infestation. Faults at risk included bunches with precociously ripened bananas, or bananas with tip rot, fused fingers, or damage that compromised skin integrity to permit fruit fly oviposition into fruit flesh. No Mediterranean fruit fly, Ceratitis capitata (Wiedemann), or melon fly, B. cucurbitae (Coquillett), infestations were found in culled banana samples. Field infestation tests indicated that mature green bananas were not susceptible to fruit fly infestation for up to 1 wk past the scheduled harvest date when attached to the plant or within 24 h after harvest. Recommendations for exporting mature green bananas from Hawaii without risk of fruit fly infestation are provided. The research reported herein resulted in a USDA-APHIS protocol for exporting mature green bananas from Hawaii.

  1. Nonhost status of commercial Persea americana 'Hass' to Anastrepha ludens, Anastrepha obliqua, Anastrepha serpentina, and Anastrepha striata (Diptera: Tephritidae) in Mexico.

    Science.gov (United States)

    Aluja, Martín; Díaz-Fleischer, Francisco; Arredondo, José

    2004-04-01

    The objective of this study was to determine the host status in Mexico of commercially cultivated and marketed avocado, Persea americana (Mill.), 'Hass' to Anastrepha ludens (Loew), Anastrepha obliqua (Macquart), Anastrepha serpentina (Wiedemann), and Anastrepha striata (Schiner) (Diptera: Tephritidae). Experiments in Michoacán, Mexico, were carried out in six orchards located at three altitudes above sea level during two times (August-October 2001 and April-June 2002). They included choice ('Hass' avocado plus natural host) and no-choice foraging behavior tests on trees under field cages; no-choice, forced infestation trials on caged, fruit-bearing branches in the field, and with individual fruit under laboratory conditions; infestation trials using 'Hass' avocados left unprotected over 1 and 7 d on the ground of orchards; studies to ascertain depth of oviposition and determine egg hatchability; and experiments to determine susceptibility by using time elapsed since removal of fruit from tree as the experimental variable. We trapped adult Anastrepha (n = 7,936) in all orchards and dissected fruit (n = 7,695) from orchards and packing houses (n = 1,620) in search of eggs or larvae. Most (96.7%) A. ludens, A. obliqua, A. striata, and A. serpentina adults were captured in low-elevation orchards. No eggs or larvae were detected in any of the fruit from foraging behavior studies or dissected fruit from orchards or packing houses. Of 5,200 mature, intact fruit on trees in the field forcibly exposed to no-choice female oviposition activity (five females/fruit), we only found four fruit infested by A. ludens but no adults emerged. 'Hass' avocados only became marginally susceptible to attack by A. ludens (but not A. obliqua, A. serpentina, and A. striata) 24 h after being removed from the tree. Fruit placed on the ground in orchards (n = 3,600) were occasionally infested by Neosilba batesi (Curran) (Diptera: Lonchaeidae), a decomposer, but not Anastrepha spp. Based on our

  2. Development of a Low-Cost and Effective Trapping Device for Apple Maggot Fly (Diptera: Tephritidae) Monitoring and Control in Mexican Commercial Hawthorn Groves.

    Science.gov (United States)

    Tadeo, E; Muñiz, E; Rull, J; Yee, W L; Aluja, M; Lasa, R

    2017-08-01

    Few efforts have been made in Mexico to monitor Rhagoletis pomonella (Walsh) (Diptera: Tephritidae) in commercial hawthorn (Crataegus spp.) crops. Therefore, the main objectives of this study were to evaluate infestation levels of R. pomonella in feral and commercial Mexican hawthorn and to assess the efficacy of different trap-lure combinations to monitor the pest. Wild hawthorn was more infested than commercially grown hawthorn at the sample site. No differences among four commercial baits (Biolure, ammonium carbonate, CeraTrap, and Captor + borax) were detected when used in combination with a yellow sticky gel (SG) adherent trap under field conditions. However, liquid lures elicited a slightly higher, although not statistically different, capture. Cage experiments in the laboratory revealed that flies tended to land more often on the upper and middle than lower-bottom part of polyethylene (PET) bottle traps with color circles. Among red, orange, green, and yellow circles attached to a bottle trap, only yellow circles improved fly captures compared with a colorless trap. A PET bottle trap with a red circle over a yellow background captured more flies than a similar trap with yellow circles. An SG adherent yellow panel trap baited with ammonium carbonate was superior to the improved PET bottle trap (red over a yellow background) baited with different liquid proteins, but a higher proportion of females and no differences in fly detection were measured in PET traps baited with protein lures. These trials open the door for future research into development of a conventional nonadherent trap to monitor or control R. pomonella. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. Effect of cold storage on larval and adult Anastrepha ludens (Diptera: Tephritidae) viability in commercially ripe, artificially infested Persea americana 'Hass'.

    Science.gov (United States)

    Aluja, M; Díaz-Fleischer, F; Arredondo, J; Valle-Mora, J; Rull, J

    2010-12-01

    Commercially ripe 'Hass' avocados, Persea americana Mill, artificially exposed to wild Anastrepha ludens (Loew) (Diptera: Tephritidae) females 24 h after harvest were placed in a cold storage facility to determine the effect of low temperature on larval survival and adult viability. Fruit were left for 3, 6, 9, and 12 d in a cold room at 5 degrees C followed by a 20-25-d period at ambient temperature to allow for larval development and pupation. Hass avocados and grapefruit, Citrus paradisi Macfadyen, maintained at ambient temperature served as controls. Overall, only 0.23% of the Hass avocados and 19.30% of the grapefruit were infested. The number of infested fruit increased with decreasing exposure time to cold. Puparia from cold-treated Hass avocados were significantly smaller than those stemming from cold-treated grapefruit. Hass avocados exposed for 12 d to 5 degrees C yielded no puparia, and those exposed for 6 and 9 d yielded 22 and two puparia, respectively, but no adults. Although Hass avocados exposed to cold temperature for 3 d yielded adults that reached sexual maturity (N = 16), females laid inviable eggs. Grapefruit exposed to cold for 12 d yielded normal-sized puparia (but no adults), whereas those exposed over 9 d yielded females able to lay viable eggs. We conclude that exposing fruit to cold storage after packing and during transport represents an effective risk-mitigating procedure in the highly improbable event that a gravid A. ludens female might lay eggs in a commercially ripe Hass avocado that had been left unprotected in a packinghouse.

  4. Growth and Development of Acanthiophilus helianthi (Diptera: Tephritidae Feeding on Safflower, Carthamus tinctorius

    Directory of Open Access Journals (Sweden)

    Karim SAEIDI

    2015-06-01

    Full Text Available Safflower fly, Acanthiophilus helianthi Rossi (Diptera: Tephritidae, undergoes four stages (egg, larva, pupa and adult during its growth and development. In this study, observation showed that the egg’s stage took 1.16 ± 0.00, larva’s stage took 12.02 ± 0.13 and pupa’s stage took 7.03 ± 0.08 days before the emergence of adults. The male adult survived for 21.97 ± 2.69 days, while the female lived 19.19 ± 1.50 days. It was observed that the eggs were laid in a cluster, with a range between 10 – 50 eggs per cluster. The length and width of the individual egg were 1.12 ± 0.03 mm and 0.20 ± 0.00 mm respectively. The percentages of the survived individual larva decreased from the first instar until third instar. In the experiment, the length and width of the larva reached 7.77 ± 0.08 mm and 1.84 ± 0.03 mm respectively. Pupae were observed changing in colour from pale white to dark brown. The length and the width of the pupae observed were 6.78 ± 0.16 mm and 2.90 ± 0.02 mm. The longevity of the adults Acanthiophilus helianthi Rossi was influenced by the diets they consumed, the presence of other individuals, wideness of the areas, differences in time taken within the life cycle (between different stages and temperature in the laboratory.

  5. Fruit flies (Diptera, Tephritidae and their parasitoids on cultivated and wild hosts in the Cerrado-Pantanal ecotone in Mato Grosso do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Tiago Ledesma Taira

    2013-09-01

    Full Text Available Fruit flies (Diptera, Tephritidae and their parasitoids on cultivated and wild hosts in the Cerrado-Pantanal ecotone in Mato Grosso do Sul, Brazil. Information on frugivorous flies in cultivated or wild host plants and their parasitoids in the Cerrado-Pantanal ecotone in Aquidauana, Mato Grosso do Sul is presented and discussed. Fruit fly samples were collected weekly in specific fruit trees, and McPhail® traps were installed in the same trees for a period of two years. The fruit flies infested ripe and unripe fruits of Averrhoa carambola L., Schoepfia sp., Psidium guajava L. and Pouteria torta (Mart. Radlk and mature fruits of Anacardium occidentale L. and Inga laurina (Sw. Willd. Nineteen fruit fly species were obtained with the combination of sampling methods (collecting fruits and trapping, nine of them obtained with both methods, five found only in fruits and five only in traps. This is the first record of Anastrepha striata Schiner in a species of Sapotaceae, as well as for A. castanea Norrbom and A. daciformes Bezzi in Schoepfia sp. (Olacaceae, and for A. distincta Greene in fruits of P. guajava in the state of Mato Grosso do Sul. Fruit collections simultaneously associated with capture of fruit flies by McPhail traps in the same host plants are essential to understand the diversity of fruit flies and their relationship with hosts and parasitoids. Species of Braconidae and Pteromalidae were recovered, where Doryctobracon areolatus (Szépligeti was the most abundant parasitoid in larvae of tephritids infesting both cultivated and wild host fruits.

  6. Rapid diagnosis of the economically important fruit fly, Bactrocera correcta (Diptera: Tephritidae) based on a species-specific barcoding cytochrome oxidase I marker.

    Science.gov (United States)

    Jiang, F; Li, Z H; Deng, Y L; Wu, J J; Liu, R S; Buahom, N

    2013-06-01

    The guava fruit fly, Bactrocera correcta (Bezzi) (Diptera: Tephritidae), is an invasive pest of fruit and vegetable crops that primarily inhabits Southeast Asia and which has the potential to become a major threat within both the Oriental and Australian oceanic regions as well as California and Florida. In light of the threat posed, it is important to develop a rapid, accurate and reliable method to identify B. correcta in quarantine work in order to provide an early warning to prevent its widespread invasion. In the present study, we describe a species-specific polymerase chain reaction assay for the diagnosis of B. correcta using mitochondrial DNA cytochrome oxidase I (mtDNA COI) barcoding genes. A B. correcta-specific primer pair was designed according to variations in the mtDNA COI barcode sequences among 14 fruit fly species. The specificity and sensitivity of the B. correcta-specific primer pair was tested based on the presence or absence of a band in the gel profile. A pair of species-specific B. correcta primers was successfully designed and named BCOR-F/BCOR-R. An ∼280 bp fragment was amplified from specimens belonging to 17 geographical populations and four life stages of B. correcta, while no such diagnostic bands were present in any of the 14 other related fruit fly species examined. Sensitivity test results demonstrated that successful amplification can be obtained with as little as 1 ng μl⁻¹ of template DNA. The species-specific PCR analysis was able to successfully diagnose B. correcta, even in immature life stages, and from adult body parts. This method proved to be a robust single-step molecular technique for the diagnosis of B. correcta with respect to potential plant quarantine.

  7. Implementing a spinosad-based local bait station to control Bactrocera cucurbitae (Diptera: Tephritidae) in high rainfall areas of Reunion Island.

    Science.gov (United States)

    Delpoux, Camille; Deguine, Jean-Philippe

    2015-01-01

    Three species of fruit flies cause serious damage to cucurbit crops on Reunion Island: Bactrocera cucurbitae (Diptera: Tephritidae) (Coquillett 1899), Dacus ciliatus (Loew 1901), and Dacus demmerezi (Bezzi 1917). To control them, a program of agroecological management of cucurbit flies has been implemented based on the application of Synéis-appât, especially spot sprays on corn borders. However, the high rainfall on Reunion Island limits the long-term efficiency of the bait; in addition, this method cannot be used for large chayote trellises, because corn borders cannot be planted around them. The aim of this study was to design a bait station adapted to prevailing conditions on Reunion Island. An 'umbrella trap' tested in Taiwan was used as a reference to compare its efficacy with our local bait station. Experiments were conducted in field cages on B. cucurbitae to test different characteristics of bait stations and to construct one using local materials. Results were validated in the field. The attractiveness of the bait station was related mainly to the color of the external surface, yellow being the most attractive color. The efficacy of the bait station with respect to fly mortality was found to be linked to the accessibility of the bait, and direct application of Synéis-appât on the bait station was found to be the most efficient. In the field, B. cucurbitae were more attracted to the local bait station than to the umbrella trap, while the two other fly species displayed equal attraction to both trap types. Our local bait station is a useful alternative to spot sprays of Synéis-appât and is now included in a local pest management program and is well accepted by farmers. © The Author 2015. Published by Oxford University Press on behalf of the Entomological Society of America.

  8. Comparison of food-based attractants for Bactrocera invadens (Diptera: Tephritidae) and evaluation of mazoferm-spinosad bait spray for field suppression in mango.

    Science.gov (United States)

    Ekesi, Sunday; Mohamed, Samira; Tanga, Chrysantus M

    2014-02-01

    Catches of Bactrocera invadens Drew, Tsuruta, & White (Diptera: Tephritidae) in Multi-lure traps baited with six commercial food-based attractants, Mazoferm E802, Torula yeast, GF-120, Hymlure, Biolure, and Nulure were compared in mango orchards in Kenya. In 2007, Mazoferm E802 and Torula yeast were the most effective attractants and captured 2.4-2.6 times more females and 3.4-4.0 times more males than the standard Nulure. All attractants captured more females than males (ranging from 63 to 74%). In 2008, Mazoferm E802 was the most effective bait capturing 5.6 and 9.1 times more females and males, respectively, than the standard Nulure. Among all the attractants, in both years, Nulure captured the greatest proportion of females: 74% compared with 51-68% for the other attractants. In 2008, the use of Mazoferm E802 in combination with spinosad as a bait spray in mango orchards reduced B. invadens catches relative to the control by 87% within 4 wk and 90% within 8 wk. At harvest, the proportion of fruit infested was significantly lower in the treated orchards (8%) compared with the control orchards (59%). Estimated mango yield was significantly higher in orchards receiving the bait sprays (12,487 kg/ha) compared with control orchards (3,606 kg/ha). Based on bait spray costs, yield data, and monetary gains, a cost-benefit ratio of 1:9.1 was realized, which is acceptable for growers. In 2009, the experiment was repeated with similar results. We have demonstrated that Mazoferm E802, used alone for monitoring of B. invadens or in conjunction with spinosad for population suppression, shows great promise in Kenya.

  9. Is the alpine divide becoming more permeable to biological invasions? - Insights on the invasion and establishment of the Walnut Husk Fly, Rhagoletis completa (Diptera: Tephritidae) in Switzerland.

    Science.gov (United States)

    Aluja, M; Guillén, L; Rull, J; Höhn, H; Frey, J; Graf, B; Samietz, J

    2011-08-01

    The Walnut Husk Fly, Rhagoletis completa Cresson (Diptera: Tephritidae), is native to North America (Midwestern US and north-eastern Mexico) and has invaded several European countries in the past decades by likely crossing the alpine divide separating most parts of Switzerland from Italy. Here, we determined its current distribution in Switzerland by sampling walnuts (Juglans regia L.) in ecologically and climatically distinct regions along potential invasion corridors. R. completa was found to be firmly established in most low altitude areas of Switzerland where walnuts thrive, but notably not a single parasitoid was recovered from any of the samples. Infested fruit was recovered in 42 of the 71 localities that were surveyed, with mean fruit infestation rate varying greatly among sites. The incidence of R. completa in Switzerland is closely related to meteorological mean spring temperature patterns influencing growing season length, but not to winter temperatures, reflecting survival potential during hibernation. Importantly, areas in which the fly is absent correspond with localities where the mean spring temperatures fall below 7°C. Historical data records show that the natural cold barrier around the Alpine divide in the central Swiss Alps corresponding to such minimal temperatures has shrunk significantly from a width of more than 40 km before 1990 to around 20 km after 2000. We hypothesize on possible invasion/expansion routes along alpine valleys, dwell on distribution patterns in relation to climate, and outline future research needs as the incursion of R. completa into Switzerland; and, more recently, other European countries, such as Germany, Austria, France and Slovenia, represent an example of alien species that settle first in the Mediterranean Basin and from there become invasive by crossing the Alps.

  10. Response of Ceratitis capitata, Bactrocera dorsalis, and Bactrocera cucurbitae (Diptera: Tephritidae) to metabolic stress disinfection and disinfestation treatment.

    Science.gov (United States)

    Arévalo-Galarza, Lourdes; Follett, Peter A

    2011-02-01

    Metabolic stress disinfection and disinfestation (MSDD) is a postharvest treatment designed to control pathogens and arthropod pests on commodities that combines short cycles of low pressure/vacuum and high CO2 with ethanol vapor. Experiments were conducted to evaluate the effect of MSDD treatment on various life stages of Ceratitis capitata (Wiedemann), Mediterranean fruit fly; Bactrocera dorsalis Hendel, oriental fruit fly; and Bactrocera cucurbitae Coquillett, melon fly, in petri dishes and in papaya, Carica papaya L., fruit. In some experiments, the ethanol vapor phase was withheld to separate the effects of the physical (low pressure/ambient pressure cycles) and chemical (ethanol vapor plus low pressure) phases of treatment. In the experiments with tephritid fruit fly larvae and adults in petri dishes, mortality was generally high when insects were exposed to ethanol and low when ethanol was withheld during MSDD treatment, suggesting that ethanol vapor is highly lethal but that fruit flies are quite tolerant of short periods of low pressure treatment alone. When papaya fruit infested with fruit fly eggs or larvae were treated by MSDD, they produced fewer pupae than untreated control fruit, but a substantial number of individuals developed nonetheless. This suggests that internally feeding insects in fruit may be partially protected from the toxic effects of the ethanol because the vapor does not easily penetrate the fruit pericarp and pulp. MSDD treatment using the atmospheric conditions tested has limited potential as a disinfestation treatment for internal-feeding quarantine pests such as fruit flies infesting perishable commodities.

  11. Interspecific Competition Between Ceratitis capitata and Two Bactrocera Spp. (Diptera: Tephritidae) Evaluated via Adult Behavioral Interference Under Laboratory Conditions.

    Science.gov (United States)

    Liu, Hui; Zhang, Can; Hou, Bo-Hua; Ou-Yang, Ge-Cheng; Ma, Jun

    2017-06-01

    The Mediterranean fruit fly, Ceratitis capitata (Wiedemann), is considered one of the most invasive tephritid species. It has spread and established populations successfully throughout many of the tropical temperate regions, partially owing to the increase in global trading activity that facilitates diffusion of species. However, C. capitata has never been detected in China, even though some areas of the country have favorable climate and ample food resources. Historically, some researchers have hypothesized that the principal reasons for its absence are the defenses mounted by native Bactrocera species against C. capitata. We evaluated the modes and strengths of interspecific competition between C. capitata and two Bactrocera species (Bactrocera dorsalis Hendel and Bactrocera correcta Bezzi) by conducting experiments on behavioral interference between the adults of these fruit fly species. Under appropriate conditions, the two Bactrocera species showed a distinct advantage in competition for oviposition, noticeably suppressing C. capitata. Although no mating interference between C. capitata and the two Bactrocera species was observed, the role of interference competition in the prevention of C. capitata invasion is still worthy of being discussed. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. Molecular characterization and functional analysis of BdFoxO gene in the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae).

    Science.gov (United States)

    Wu, Yi-Bei; Yang, Wen-Jia; Xie, Yi-Fei; Xu, Kang-Kang; Tian, Yi; Yuan, Guo-Rui; Wang, Jin-Jun

    2016-03-10

    The forkhead box O transcription factor (FoxO) is an important downstream transcription factor in the well-conserved insulin signaling pathway, which regulates the body size and development of insects. In this study, the FoxO gene (BdFoxO) was identified from the oriental fruit fly, Bactrocera dorsalis (Hendel). The open reading frame of BdFoxO (2732 bp) encoded a 910 amino acid protein, and the sequence was well conserved with other insect species. The BdFoxO was highly expressed in larvae and pupae among different development stages, and the highest tissue-specific expression level was found in the fat bodies compared to the testis, ovary, head, thorax, midgut, and Malpighian tubules of adults. Interestingly, we found BdFoxO expression was also up-regulated by starvation, but down-regulated when re-fed. Moreover, the injection of BdFoxO double-stranded RNAs into third-instar larvae significantly reduced BdFoxO transcript levels, which in turn down-regulated the expression of other four genes in the insulin signaling pathway. The silencing of BdFoxO resulted in delayed pupation, and the insect body weight increased significantly compared with that of the control. These results suggested that BdFoxO plays an important role in body size and development in B. dorsalis. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Field Estimates of Attraction of Ceratitis capitata to Trimedlure and Bactrocera dorsalis (Diptera: Tephritidae) to Methyl Eugenol in Varying Environments.

    Science.gov (United States)

    Manoukis, Nicholas C; Siderhurst, Matthew; Jang, Eric B

    2015-06-01

    Measuring and modeling the attractiveness of semiochemical-baited traps is of significant importance to detection, delimitation, and control of invasive pests. Here, we describe the results of field mark-release-recapture experiments with Ceratitis capitata (Wiedemann) and Bactrocera dorsalis (Hendel) to estimate the relationship between distance from a trap baited with trimedlure and methyl eugenol, respectively, and probability of capture for a receptive male insect. Experiments were conducted using a grid of traps with a central release point at two sites on Hawaii Island, a Macadamia orchard on the East side of the island and a lava field on the West side. We found that for B. dorsalis and methyl eugenol there is a 65% probability of capture at ∼36 m from a single trap, regardless of habitat. For C. capitata, we found a 65% probability of capture at a distance of ∼14 m from a single trap in the orchard and 7 m in the lava field. We also present results on the spatial and temporal pattern of recaptures. The attraction data are analyzed via a hyperbolic secant-based capture probability model. Published by Oxford University Press on behalf of Entomological Society of America 2015. This work is written by US Government employees and is in the public domain in the US.

  14. Use of alpha-ionol + cade oil for detection and monitoring of Bactrocera latifrons (Diptera: Tephritidae) populations

    Energy Technology Data Exchange (ETDEWEB)

    McQuate, Grant T.; Jang, Eric B., E-mail: grant.mcquate@ars.usda.go, E-mail: eric.jang@ars.usda.go [U.S. Department of Agriculture (USDA/ARS), Hilo, HI (United States). Pacific Basin Agricultural Research Center; Bokonon-Ganta, Aime H., E-mail: aimehbg@hawaii.ed [University of Hawaii (CTAHR/PEPS/UH), Honolulu, HI (United States). Coll. of Tropical Agriculture and Human Resources. Dept. of Plant and Environmental Protection Sciences

    2006-07-01

    Bactrocera latifrons (Hendel) is a tephritid fruit fly that primarily infests solanaceous fruits. Although primarily of Asian distribution, it has invaded Hawaii and, more recently, the continent of Africa (Tanzania and Kenya). Male B. latifrons uniquely respond to alpha-ionol + cade oil, rather than to either methyl eugenol or cuelure, to which males of the majority of other Dacine fruit flies respond. Here we present research results detailing the age of male B. latifrons response to alpha-ionol + cade oil, the persistence of wick attractiveness, and the effectiveness of alpha-ionol + cade oil in detecting B. latifrons populations. Based on wind tunnel studies with wild flies, male response steadily increased from 5% at age 2 to 45% at age 28, with male response exceeding 50% of the peak response by Day 7 and exceeding 75% and 90% by days 14 and 21, respectively. The attractiveness of wicks treated with 2.0 ml alpha-ionol and 1.0 ml cade oil (on separate wicks) declined over time, with wick response reduced to about 50% of the fresh catch after 6 1/2 weeks. Based on concurrent alpha-ionol + cade oil based trapping and collections of turkey berry, Solanum torvum (Solanaceae), fruits, the presence of B. latifrons was detected at the time of fruit collection, 75.5 % of the time. (author)

  15. Akdeniz Meyve Sineğinin Feromon Tuzaklarla (Ceratitis capitata Wied.) (Diptera: Tephritidae)’nin Nar ve Hurmadaki Populasyon Takibi ve Zarar Oranının Tespiti

    OpenAIRE

    KASAP, Aziz; ASLAN, Mahmut

    2016-01-01

    ÖZET: Bu çalışma 2015 yılında Adana ilinde trabzon hurma (Rojo brillante) çeşidi ve nar (Acco) çeşidinin bulunduğu bahçelerde yürütülmüştür. Çalışmada; Akdeniz meyve sineği (Ceratitis capitata Wied.) (Diptera: Tephritidae)’nin nar ve trabzon hurması çeşidindeki popülasyon gelişimleri ve meyvedeki zarar oranının belirlenmesi amaçlanmıştır. Akdeniz meyve sineğinin popülasyon gelişimi SEDQ sarı tuzak+feromon (cezbedici+insektisit) kullanılarak yapılmıştır. Popülasyon takibi sonucu tuzaklarda yak...

  16. An Overview of Pest Species of Bactrocera Fruit Flies (Diptera: Tephritidae) and the Integration of Biopesticides with Other Biological Approaches for Their Management with a Focus on the Pacific Region

    Science.gov (United States)

    Vargas, Roger I.; Piñero, Jaime C.; Leblanc, Luc

    2015-01-01

    Fruit flies (Diptera: Tephritidae) are among the most economically important pest species in the world, attacking a wide range of fruits and fleshy vegetables throughout tropical and sub-tropical areas. These species are such devastating crop pests that major control and eradication programs have been developed in various parts of the world to combat them. The array of control methods includes insecticide sprays to foliage and soil, bait-sprays, male annihilation techniques, releases of sterilized flies and parasitoids, and cultural controls. During the twenty first century there has been a trend to move away from control with organophosphate insecticides (e.g., malathion, diazinon, and naled) and towards reduced risk insecticide treatments. In this article we present an overview of 73 pest species in the genus Bactrocera, examine recent developments of reduced risk technologies for their control and explore Integrated Pest Management (IPM) Programs that integrate multiple components to manage these pests in tropical and sub-tropical areas. PMID:26463186

  17. An Overview of Pest Species of Bactrocera Fruit Flies (Diptera: Tephritidae) and the Integration of Biopesticides with Other Biological Approaches for Their Management with a Focus on the Pacific Region.

    Science.gov (United States)

    Vargas, Roger I; Piñero, Jaime C; Leblanc, Luc

    2015-04-03

    Fruit flies (Diptera: Tephritidae) are among the most economically important pest species in the world, attacking a wide range of fruits and fleshy vegetables throughout tropical and sub-tropical areas. These species are such devastating crop pests that major control and eradication programs have been developed in various parts of the world to combat them. The array of control methods includes insecticide sprays to foliage and soil, bait-sprays, male annihilation techniques, releases of sterilized flies and parasitoids, and cultural controls. During the twenty first century there has been a trend to move away from control with organophosphate insecticides (e.g., malathion, diazinon, and naled) and towards reduced risk insecticide treatments. In this article we present an overview of 73 pest species in the genus Bactrocera, examine recent developments of reduced risk technologies for their control and explore Integrated Pest Management (IPM) Programs that integrate multiple components to manage these pests in tropical and sub-tropical areas.

  18. Diversity of Anastrepha spp. (Diptera: Tephritidae) and associated braconid parasitoids from native and exotic hosts in southeastern Bahia, Brazil.

    Science.gov (United States)

    Silva, Janisete G; Dutra, Vivian S; Santos, Mirian S; Silva, Nívea M O; Vidal, Daniela B; Nink, Ricardo A; Guimarães, Jorge A; Araujo, Elton L

    2010-10-01

    We documented fruit fly-host associations and infestation rates over 5 yr in the state of Bahia, Brazil, by systematically collecting native and introduced fruits in backyard and commercial orchards, experimental stations, and patches of native vegetation. Fruit were collected in multiple sites in the southern and southernmost regions of Bahia. A total of 942.22 kg from 27 fruit species in 15 plant families was collected throughout this study. Of these, 15 plant species from six families were infested by Anastrepha species. A total of 11,614 fruit flies was reared from the fruit (5,178 females and 6,436 males). No specimens of Ceratitis capitata (Wiedemann) were recovered. Eleven Anastrepha species were recovered from the collected fruit: Anastrepha antunesi Lima (0.04%), Anastrepha distincta Greene (0.1%), Anastrepha fraterculus (Wiedemann) (53.5%), Anastrepha leptozona Hendel (4.5%), Anastrepha manihoti Lima (0.1%), Anastrepha montei Lima (1.0%), Anastrepha obliqua (Macquart) (33.0%), Anastrepha pickeli Lima (2.0%), Anastrepha serpentina (Wiedemann) (1.0%), Anastrepha sororcula Zucchi (3.0%), and Anastrepha zenildae Zucchi (1.8%). We recovered 1,265 parasitoids (Hymenoptera: Braconidae) from Anastrepha pupae. Three species of braconids were found to parasitize larvae of nine Anastrepha species. The most common parasitoid species recovered was Doryctobracon areolatus (Szépligeti) (81.7%), followed by Utetes anastrephae (Viereck) (12.2%) and Asobara anastrephae (Muesebeck) (6.1%). We report A. fraterculus infesting Malay apple Syzygium malaccense (L.) Merr. & L. M. Perry and A. fraterculus, A. sororcula, and A. zenildae infesting araza Eugenia stipitata McVaugh for the first time in Brazil.

  19. Susceptibility of low-chill blueberry cultivars to Mediterranean fruit fly, oriental fruit fly, and melon fly (Diptera: Tephritidae).

    Science.gov (United States)

    Follett, Peter A; Zee, Francis T; Hamasaki, Randall T; Hummer, Kim; Nakamoto, Stuart T

    2011-04-01

    No-choice tests were conducted to determine whether fruit of southern highbush blueberry, Vaccinium corymbosum L., hybrids are hosts for three invasive tephritid fruit flies in Hawaii. Fruit of various blueberry cultivars was exposed to gravid female flies of Bactrocera dorsalis Hendel (oriental fruit fly), Ceratitis capitata (Wiedemann) (Mediterranean fruit fly), or Bactrocera cucurbitae Coquillet (melon fly) in screen cages outdoors for 6 h and then held on sand in the laboratory for 2 wk for pupal development and adult emergence. Each of the 15 blueberry cultivars tested were infested by oriental fruit fly and Mediterranean fruit fly, confirming that these fruit flies will oviposit on blueberry fruit and that blueberry is a suitable host for fly development. However, there was significant cultivar variation in susceptibility to fruit fly infestation. For oriental fruit fly, 'Sapphire' fruit produced an average of 1.42 puparia per g, twice as high as that of the next most susceptible cultivar 'Emerald' (0.70 puparia per g). 'Legacy', 'Biloxi', and 'Spring High' were least susceptible to infestation, producing only 0.20-0.25 oriental fruit fly puparia per g of fruit. For Mediterranean fruit fly, 'Blue Crisp' produced 0.50 puparia per g of fruit, whereas 'Sharpblue' produced only 0.03 puparia per g of fruit. Blueberry was a marginal host for melon fly. This information will aid in development of pest management recommendations for blueberry cultivars as planting of low-chill cultivars expands to areas with subtropical and tropical fruit flies. Planting of fruit fly resistant cultivars may result in lower infestation levels and less crop loss.

  20. SUSCETIBILIDADE DE GENÓTIPOS DE MACIEIRA A Anastrepha fraterculus (DIPTERA: TEPHRITIDAE EM DIFERENTES CONDIÇÕES DE INFESTAÇÃO

    Directory of Open Access Journals (Sweden)

    JANAÍNA PEREIRA DOS SANTOS

    2015-03-01

    Full Text Available RESUMO O estudo objetivou registrar as injúrias de Anastrepha fraterculus (Diptera: Tephritidae, em dois estádios de desenvolvimento dos frutos das macieiras M-11/00 e ‘Catarina’, submetidos a três condições de infestação a campo, na safra de 2011/2012. O experimento foi conduzido em pomar mantido sob manejo orgânico, na Estação Experimental da Epagri de Caçador-SC. O número médio de moscas foi avaliado semanalmente, com quatro armadilhas do tipo McPhail. Frutos imaturos e maduros da seleção M-11/00 e da cultivar Catarina foram submetidos às condições de infestação artificial, controlada e natural. No início da frutificação, após o raleio, em cada genótipo, 500 frutos foram aleatoriamente ensacados com embalagens de tecido não texturizado (TNT. Os frutos submetidos à infestação artificial foram envoltos, individualmente, por uma gaiola contendo duas fêmeas acasaladas de A. fraterculus, que permaneceram por três dias para oviposição. Na infestação controlada, no mesmo dia da instalação das gaiolas, frutos protegidos tiveram as embalagens retiradas para que ficassem por três dias expostos. Frutos não ensacados foram utilizados para avaliar a infestação natural. Em cada estádio de desenvolvimento, foram registrados os valores dos atributos físico-químicos dos frutos. O número médio de A. fraterculus durante a safra foi de 3,08 moscas/armadilha/ semana. Na seleção M-11/00, em todas as condições de infestação, o número médio de larvas e pupários foi maior em frutos maduros. Na cv. Catarina, estes números não diferiram entre as condições de infestação nem entre os estádios de desenvolvimento. Pupários de A. fraterculus não foram observados em frutos de ‘Catarina’, e nesta cultivar constatou-se maior acidez e menor relação sólidos solúveis/acidez.

  1. Evaluation of Quality Production Parameters and Mating Behavior of Novel Genetic Sexing Strains of the Mediterranean Fruit Fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae)

    Science.gov (United States)

    Haq, Ihsan ul; Wornayporn, Viwat; Ahmad, Sohel; Sto Tomas, Ulysses; Dammalage, Thilakasiri; Gembinsky, Keke; Franz, Gerald; Cáceres, Carlos; Vreysen, Marc J. B.

    2016-01-01

    The Mediterranean fruit fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) is one of the most important pest of fruits and vegetables in tropical and subtropical countries. The sterile insect technique (SIT) as a component of area-wide integrated pest management (AW-IPM) approaches is being used for the successful management of this pest. VIENNA 8 is a genetic sexing strain (GSS) that has a white pupae (wp) and temperature sensitive lethal (tsl) mutation, the latter killing all female embryos when eggs are exposed to high temperatures (34°C). The use of this GSS permits production and the release of only males which has increased the cost effectiveness of the SIT several fold for this pest. An efficient method of identification of recaptured sterile males can further increase the cost effectiveness of the SIT for this pest. Therefore, VIENNA 8-Sergeant2 (Sr2) strain and the transgenic strain VIENNA 8–1260 having visible markers were constructed. All three strains were evaluated for egg production, egg hatch, and egg sterility parameters under semi mass-rearing conditions and mating competitiveness in field cages. VIENNA 8–1260 females produced significantly fewer eggs as compared with the two other strains, which produced similar numbers of eggs. However, egg hatch of all strains was similar. Egg hatch of eggs produced by untreated females that had mated with adult males that had been irradiated with 100 Gy as pupae 2 days before emergence, was different for the three strains, i.e., egg hatch of 0.63%, 0.77%, 0.89% for VIENNA 8, VIENNA 8–1260, and VIENNA 8-Sr2, respectively. Differences in male mating competitiveness of the three strains against wild-type males were gradually reduced with successive generations under semi mass-rearing conditions. However, VIENNA 8 males adapted faster to laboratory conditions as compared with VIENNA 8-Sr2 and VIENNA 8–1260 males with respect to mating competitiveness. VIENNA 8 males of the F10 generation were

  2. Evaluation of Quality Production Parameters and Mating Behavior of Novel Genetic Sexing Strains of the Mediterranean Fruit Fly Ceratitis capitata (Wiedemann (Diptera: Tephritidae.

    Directory of Open Access Journals (Sweden)

    Polychronis Rempoulakis

    Full Text Available The Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera: Tephritidae is one of the most important pest of fruits and vegetables in tropical and subtropical countries. The sterile insect technique (SIT as a component of area-wide integrated pest management (AW-IPM approaches is being used for the successful management of this pest. VIENNA 8 is a genetic sexing strain (GSS that has a white pupae (wp and temperature sensitive lethal (tsl mutation, the latter killing all female embryos when eggs are exposed to high temperatures (34°C. The use of this GSS permits production and the release of only males which has increased the cost effectiveness of the SIT several fold for this pest. An efficient method of identification of recaptured sterile males can further increase the cost effectiveness of the SIT for this pest. Therefore, VIENNA 8-Sergeant2 (Sr2 strain and the transgenic strain VIENNA 8-1260 having visible markers were constructed. All three strains were evaluated for egg production, egg hatch, and egg sterility parameters under semi mass-rearing conditions and mating competitiveness in field cages. VIENNA 8-1260 females produced significantly fewer eggs as compared with the two other strains, which produced similar numbers of eggs. However, egg hatch of all strains was similar. Egg hatch of eggs produced by untreated females that had mated with adult males that had been irradiated with 100 Gy as pupae 2 days before emergence, was different for the three strains, i.e., egg hatch of 0.63%, 0.77%, 0.89% for VIENNA 8, VIENNA 8-1260, and VIENNA 8-Sr2, respectively. Differences in male mating competitiveness of the three strains against wild-type males were gradually reduced with successive generations under semi mass-rearing conditions. However, VIENNA 8 males adapted faster to laboratory conditions as compared with VIENNA 8-Sr2 and VIENNA 8-1260 males with respect to mating competitiveness. VIENNA 8 males of the F10 generation were

  3. Anastrepha ludens and Anastrepha serpentina (Diptera: Tephritidae) do not infest Psidium guajava (Myrtaceae), but Anastrepha obliqua occasionally shares this resource with Anastrepha striata in nature.

    Science.gov (United States)

    Birke, Andrea; Aluja, Martin

    2011-08-01

    This study examined whether economically important fruit fly species Anastrepha ludens (Loew), Anastrepha serpentina (Wiedemann), and Anastrepha obliqua (Macquart) (Diptera: Tephritidae) may opportunistically exploit guavas, Psidium guajava L. (Myrtaceae), growing near preferred natural hosts. We collected 3,459 kg of guavas and 895 kg of other known host species [sour orange, Citrus aurantium L.; grapefruit, Citrus paradisi Macfadyen; mango, Mangifera indica L.; white sapote, Casimiroa edulis La Llave and Lex.; sapote, Pouteria sapota (Jacq.); sapodilla, Manilkara zapota L.; and wild plum, Spondias purpurea L. and Spondias mombin L.] along an altitudinal gradient over a 4-yr period (2006-2009). Plants were growing in sympatry in 23 localities where the guavas are usually infested in the state of Veracruz, M6xico. The guava samples yielded 20,341 Anastrepha spp. pupae in total (overall mean, 5.88 pupae per kg of fruit). Confirming previous reports, Anastrepha fraterculus (Wiedemann) and Anastrepha striata (Schiner) were found heavily infesting guavas in Veracruz. Importantly, although we did not find evidence that A. ludens and A. serpentina are able to attack this valuable commodity, we document for the first time in the agriculturally important state of Veracruz that P. guajava is an alternative natural host plant of A. obliqua. We recovered two fruit in the mango-growing locality of la Vibora, Tlalixcoyan, that harbored larvae of A. striata and A. obliqua. This finding has important practical implications for management of A. obliqua. Over the entire altitudinal gradient, when individual fruit infestation was examined, a dynamic pattern of species dominance was unveiled with guavas growing below 800 m above sea level mainly attacked by A. striata and a progressive replacement with increasing altitude by A. fraterculus. Interestingly, most individual fruit examined (97%) harbored a single species of fruit fly, a finding that may be taken as evidence of

  4. KEANEKARAGAMAN DAN KEKERABATAN LALAT BUAH (DIPTERA: TEPHRITIDAE DI KALIMANTAN SELATAN BERDASARKAN KARAKTER MORFOLOGI DAN MOLEKULAR (RAPD-PCR DAN SEKUENSING DNA

    Directory of Open Access Journals (Sweden)

    M Indar Prambudi

    2014-08-01

    Full Text Available Diversity and phylogeny of fruit fly (Diptera: Tephritidae in South Kalimantan based on morphology and molecular (RAPD-PCR and DNA sequencing. Seven species of fruit fly was known by morphological identification. The fruit flies were found from  trapping with methyl eugenol and fruit collecting at all study sites in South Kalimantan. The results showed that as much as 17  plants were infected by fruit fly. Dendrogram based on morphological identification analyzed by using UPGMA with MEGA 4 program consisted in a group consisting of 5 sub-groups. Bactrocera carambolae and Bactrocera papayae of morphology were still a closely related fruit fly at 0.935. Whereas, based on RAPD result analized by UPGMA using 20 character of DNA based, showed that out of seven species consisted 2 groups, 1st group were B. umbrosa,  B. occipitalis and sub-group of B. latifrons. The second group consists of sub-groups B.carambolae, B. papaya, sub-group B. albistrigata and B. cucurbitae. The results of dendrogram from sequencing DNA fruit fly analysis comprised one of group and three sub-groups. The first sub-groups were B. papayae, B. carambolae, B. occipitalis, B.latifrons. The second subgroup were B. cucurbitae and B. umbrosa. While B. albistrigata separate but still one group with another fruit flies. The results of DNA sequencing showed that there were a homology of the seven species of the fruit fly i.e at 83 base pair / bp (C, 101 bp (T, 265 bp (G, 420 bp (A, 432 bp (T, 600 bp (A . The length of the base pair for B. occipitalis, B. cucurbitae, B. albistrigata, B. carambolae, B. papayae, B. latifrons were respectively 615, 898, 570.969, 898 and 615 bp. The results of morphological analysis and RAPD methods showed difference in the distribution of groups and sub-groups. But based on morphologycal and DNA identification seven species of fruit flies found were all same as the genebank.

  5. DEZ ANOS DE PESQUISAS SOBRE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE NO ESTADO DO AMAPÁ: AVANÇOS OBTIDOS E DESAFIOS FUTUROS.

    Directory of Open Access Journals (Sweden)

    Ezequiel da Glória de Deus

    2013-12-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritidae estão entre as principais pragas da agricultura mundial, sendo motivo de preocupação especialmente para países tropicais em desenvolvimento, os quais têm na fruticultura um importante componente de sua balança comercial. Esta revisão tem por objetivo compilar informações geradas nos últimos 10 anos sobre moscas-das-frutasno estado do Amapá, com ênfase em distribuição, hospedeiros e parasitoides. Além disso, visa indicar as prioridades de pesquisa para os próximos anos.No estado do Amapá, os estudos com moscas-das-frutas e seus inimigos naturais apresentaram, nos últimos anos, significativo crescimento. Atualmente, além Bactrocera carambolae, estão assinaladas para o Estado 34 espécies de Anastrepha. Anastrepha distincta, Anastrepha coronilli, Anastrepha fraterculus e Anastrepha striata são as espécies mais amplamente distribuídas. Estão assinaladas para o estado 37 espécies vegetais hospedeiras (pertencentes a 19 famílias botânicas de moscas-das-frutas. Anastrepha striata é espécie mais polífaga, estando associada a 25 hospedeiros. Nove espécies de parasitoides específicos de moscas-das-frutas estão registrados, sendo Doryctobracon areolatuso mais abundante. Apesar do significativo avanço, novos estudos sobre biologia, genética, ecologia, distribuição e dispersão populacional, bem como fatores reguladores dos níveis populacionais são necessários, com vista a desenvolver estratégias de controle menos onerosas com efeitos não nocivos ao ambiente. Palavras-chave: Anastrepha, Bactrocera carambolae, parasitoides, Amazônia. DOI: http://dx.doi.org/10.18561/2179-5746/biotaamazonia.v3n3p157-168

  6. A phylogenetic assessment of the polyphyletic nature and intraspecific color polymorphism in the Bactrocera dorsalis complex (Diptera, Tephritidae)

    Science.gov (United States)

    Leblanc, Luc; San Jose, Michael; Barr, Norman; Rubinoff, Daniel

    2015-01-01

    Abstract The Bactrocera dorsalis complex (Tephritidae) comprises 85 species of fruit flies, including five highly destructive polyphagous fruit pests. Despite significant work on a few key pest species within the complex, little has been published on the majority of non-economic species in the complex, other than basic descriptions and illustrations of single specimens regarded as typical representatives. To elucidate the species relationships within the Bactrocera dorsalis complex, we used 159 sequences from one mitochondrial (COI) and two nuclear (elongation factor-1α and period) genes to construct a phylogeny containing 20 described species from within the complex, four additional species that may be new to science, and 26 other species from Bactrocera and its sister genus Dacus. The resulting concatenated phylogeny revealed that most of the species placed in the complex appear to be unrelated, emerging across numerous clades. This suggests that they were placed in the Bactrocera dorsalis complex based on the similarity of convergent characters, which does not appear to be diagnostic. Variations in scutum and abdomen color patterns within each of the non-economic species are presented and demonstrate that distantly-related, cryptic species overlap greatly in traditional morphological color patterns used to separate them in keys. Some of these species may not be distinguishable with confidence by means other than DNA data. PMID:26798267

  7. Battling the un-dead: the status of the Diptera genus-group names originally proposed in Johann Wilhelm Meigen's 1800 pamphlet.

    Science.gov (United States)

    Evenhuis, Neal L; Pape, Thomas

    2017-06-08

    Hendel, 1908 under Blera Billberg, 1820, n. syn. [Syrphidae]; Petaurista Meigen in Hendel, 1908 under Trichocera Meigen, 1803, n. syn. [Trichoceridae]; Phalaenula Desmarest, 1818 under Psychoda Latreille, 1797, n. syn. [Psychodidae]; Philia Meigen in Hendel, 1908 under Dilophus Meigen, 1803, n. syn. [Bibionidae]; Phryne Meigen in Hendel, 1908 under Sylvicola Harris, 1776, n. syn. [Anisopodidae]; Polymeda Meigen in Hendel, 1908 under Erioptera Meigen, 1803, n. syn. [Limoniidae]; Polyxena Meigen in Hendel, 1908 under Cordyla Meigen, 1803, n. syn. [Mycetophilidae]; Potamida Hendel, 1903 under Clitellaria Meigen, 1803, n. syn. [Stratiomyidae]; Rhodogyne Meigen in Hendel, 1908 under Gymnosoma Meigen, 1803, n. syn. [Tachinidae]; Salmacia Meigen in Hendel, 1908 under Gonia Meigen, 1803, n. syn. [Tachinidae]; Scathophaga Meigen, 1803 under Scopeuma Latreille, 1802, n. syn. [Scathophagidae]; Coremacera Rondani, 1856 under Statinia Latreille, 1802, n. syn. [Sciomyzidae]; Tendipes Meigen in Hendel, 1908 under Chironomus Meigen, 1803, n. syn. [Chironomidae]; Titania Meigen in Hendel, 1908 under Chlorops Meigen, 1803, n. syn. [Chloropidae]; Trepidaria Meigen in Hendel, 1908 under Calobata Meigen, 1803, n. syn. [Micropezidae]; Tritonia Meigen in Hendel, 1908 under Temnostoma Le Peletier & Audinet-Serville, 1828, n. syn. [Syrphidae]; Tubifera Meigen in Hendel, 1908 under Eristalis Latreille, 1804, n. syn. [Syrphidae]; Urophora Robineau-Desvoidy, 1830 under Euribia Latreille, 1802, n. syn. [Tephritidae]; Zelima Hendel, 1903 under Xylota Meigen, 1822, n. syn. [Syrphidae]; Zelmira Meigen in Hendel, 1908 under Orfelia Costa, 1857, n. syn. [Keroplatidae].        The following three names have not been found to be synonymous with any other taxon, and are treated here as nomina dubia: Orithea Meigen in Hendel, 1908; Salpyga Meigen in Hendel, 1908; Titia Meigen in Hendel, 1908 (preoccupied).      The following four names are found to be senior synonyms of more commonly used genus

  8. Evaluation of endogenous references for gene expression profiling in different tissues of the oriental fruit fly Bactrocera dorsalis (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Wang Jin-Jun

    2010-10-01

    Full Text Available Abstract Background Quantitative real-time reverse transcriptase PCR (RT-qPCR has been widely used for quantification of mRNA as a way to determine key genes involved in different biological processes. For accurate gene quantification analysis, normalization of RT-qPCR data is absolutely essential. To date, normalization is most frequently achieved by the use of internal controls, often referred to as reference genes. However, several studies have shown that the reference genes used for the quantification of mRNA expression can be affected by the experimental set-up or cell type resulting in variation of the expression level of these key genes. Therefore, the evaluation of reference genes is critical for gene expression profiling, which is often neglected in gene expression studies of insects. For this purpose, ten candidate reference genes were investigated in three different tissues (midgut, Malpighian tubules, and fat body of the oriental fruit fly, Bactrocera dorsalis (Hendel. Results Two different programs, geNorm and Normfinder, were used to analyze the data. According to geNorm, α-TUB + ACT5 are the most appropriate reference genes for gene expression profiling across the three different tissues in the female flies, while ACT3 + α-TUB are considered as the best for males. Furthermore, we evaluated the stability of the candidate reference genes to determine the sexual differences in the same tissue. In the midgut and Malpighian tubules, ACT2 + α-TUB are the best choice for both males and females. However, α-TUB + ACT1 are the best pair for fat body. Meanwhile, the results calculated by Normfinder are quite the same as the results with geNorm; α-TUB is always one of the most stable genes in each sample validated by the two programs. Conclusions In this study, we validated the suitable reference genes for gene expression profiling in different tissues of B. dorsalis. Moreover, appropriate reference genes were selected out for gene

  9. A high-throughput detection method for invasive fruit fly (Diptera: Tephritidae) species based on microfluidic dynamic array.

    Science.gov (United States)

    Jiang, Fan; Fu, Wei; Clarke, Anthony R; Schutze, Mark Kurt; Susanto, Agus; Zhu, Shuifang; Li, Zhihong

    2016-11-01

    Invasive species can be detrimental to a nation's ecology, economy and human health. Rapid and accurate diagnostics are critical to limit the establishment and spread of exotic organisms. The increasing rate of biological invasions relative to the taxonomic expertise available generates a demand for high-throughput, DNA-based diagnostics methods for identification. We designed species-specific qPCR primer and probe combinations for 27 economically important tephritidae species in six genera (Anastrepha, Bactrocera, Carpomya, Ceratitis, Dacus and Rhagoletis) based on 935 COI DNA barcode haplotypes from 181 fruit fly species publically available in BOLD, and then tested the specificity for each primer pair and probe through qPCR of 35 of those species. We then developed a standardization reaction system for detecting the 27 target species based on a microfluidic dynamic array and also applied the method to identify unknown immature samples from port interceptions and field monitoring. This method led to a specific and simultaneous detection for all 27 species in 7.5 h, using only 0.2 μL of reaction system in each reaction chamber. The approach successfully discriminated among species within complexes that had genetic similarities of up to 98.48%, while it also identified all immature samples consistent with the subsequent results of morphological examination of adults which were reared from larvae of cohorts from the same samples. We present an accurate, rapid and high-throughput innovative approach for detecting fruit flies of quarantine concern. This is a new method which has broad potential to be one of international standards for plant quarantine and invasive species detection. © 2016 John Wiley & Sons Ltd.

  10. Evaluation of Cuelure and Methyl Eugenol solid lure and insecticide dispensers for fruit fly (Diptera: Tephritidae) monitoring and control in Tahiti

    Science.gov (United States)

    Performance of solid male lure (cuelure (C-L)/raspberry ketone (RK) - against Bactrocera tyroni (Froggatt), and methyl eugenol (ME) - against oriental fruit fly, B. dorsalis (Hendel) and insecticide formulations, were evaluated in Tahiti Island (French Polynesia), as alternatives to current monitori...

  11. Characterizing the developmental transcriptome of the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae) through comparative genomic analysis with Drosophila melanogaster utilizing modENCODE datasets

    Science.gov (United States)

    Background The oriental fruit fly, Bactrocera dorsalis, is an important pest of fruit and vegetable crops throughout Asia, and is considered a high risk pest for establishment in the mainland United States. It is a member of the family Tephritidae, which are the most agriculturally important family ...

  12. Compatibility of entomopathogenic nematodes and aqueous plant extracts aiming at the control of fruit fly Ceratitis capitata (Wiedemann (Diptera: TephritidaeCompatibilidade de nematóides entomopatogênicos e extratos vegetais aquosos visando o controle da mosca-das-frutas Ceratitis capitata (Wiedemann (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Cristhiane Rohde

    2013-06-01

    Full Text Available Currently, the fruit fly Ceratitis capitata (Diptera: Tephritidae has been controlled mainly by the chemical method, which is responsible for environmental and public health impacts. It has often been ineffective due to development of resistant insect populations. Thus, it has necessary to research new effective and less impacting control forms. In this sense, the use of entomopathogenic nematodes and plant extracts has been effective for controlling this pest. However, studies are needed to assess the compatibility between these methods, aiming at their use in integrated management programs for this pest. The aim of this study was to evaluate the compatibility of the nematodes Steinernema carpocapsae ALL and Heterorhabditis sp. JPM4 with aqueous extracts prepared from dried plant of cinnamon leaf, twig and fruit (Melia azedarach, rue leaf (Ruta graveolens, ginger (Zingiber officinale and garlic (Allium sativum for the control of C. capitata. The bioassay was carried out in completely randomized design with four replicates per treatment. Each replication consisted of a glass tube containing 1 mL of plant extract 40% w/v and 1 mL suspension of entomopathogenic nematodes with 1800 JI/mL for S. carpocapsae ALL and 600 JI/mL for Heterorhabditis sp. JPM4. The viability and infectivity of this nematode were evaluated on C. capitata larvae after 48 and 120 hours. It was found that all extracts reduced the viability and infectivity of both nematodes and they were incompatible after 120 hours of exposure. The nematode Heterorhabditis sp. JPM4 was more sensitive than the S. carpocapsae ALL as it showed, in the first 48 hours, a reduction in the viability and infectivity of more than 80 and 75%, respectively, when exposed to all the extracts except the ginger.A mosca-das-frutas Ceratitis capitata (Diptera: Tephritidae tem sido controlada, principalmente, pelo método químico, que é o responsável por impactos ambientais e na saúde pública e, muitas

  13. Machos Virgens e Acasalados de Ceratitis capitata Wiedemann (Diptera: Tephritidae Apresentam o mesmo Sucesso de Cópula e a mesma Capacidade de Inibição de Recópula das Fêmeas?

    Directory of Open Access Journals (Sweden)

    Luiza Santana

    2014-08-01

    Virgin and Mated Males of Ceratitis capitata Wiedemann (Diptera: Tephritidae Have the Same Mating Success and the Same Ability to Inhibit Female Remating? Abstract. Ceratitis capitata Wiedemann is a polyphagous species that damages fruits and affects their production and consumption. One of the techniques to manage this pest is the Sterile Insect Technique, which consists in releasing sterile males in nature to compete with wild males for mating. The success of this technique is associated with the ability of sterile male in being selected by the female and in preventing female remating with other males. This paper aims to evaluate the influence of male reproductive status in mating success and in female remating inhibition. Tests for evaluating the latency to mate and copula duration were performed to evaluate latency to mate and copula duration based on different male status. In remating inhibition tests, females mated with virgin and mated males, were exposed to other males one day after the first mating so the rate of remating could be evaluated. The results showed that males of different reproductive status had no differences in mating success and in female remating inhibition. The latency to mate and copula duration were similar for both male status as well. Our results suggest that, assuming that the sterile males have the same basic biology of no sterile males, in SIT, after released in nature, mated males can have the same success in mating and female remating inhibition as virgin males.

  14. An Overview of Pest Species of Bactrocera Fruit Flies (Diptera: Tephritidae and the Integration of Biopesticides with Other Biological Approaches for Their Management with a Focus on the Pacific Region

    Directory of Open Access Journals (Sweden)

    Roger I. Vargas

    2015-04-01

    Full Text Available Fruit flies (Diptera: Tephritidae are among the most economically important pest species in the world, attacking a wide range of fruits and fleshy vegetables throughout tropical and sub-tropical areas. These species are such devastating crop pests that major control and eradication programs have been developed in various parts of the world to combat them. The array of control methods includes insecticide sprays to foliage and soil, bait-sprays, male annihilation techniques, releases of sterilized flies and parasitoids, and cultural controls. During the twenty first century there has been a trend to move away from control with organophosphate insecticides (e.g., malathion, diazinon, and naled and towards reduced risk insecticide treatments. In this article we present an overview of 73 pest species in the genus Bactrocera, examine recent developments of reduced risk technologies for their control and explore Integrated Pest Management (IPM Programs that integrate multiple components to manage these pests in tropical and sub-tropical areas.

  15. Construction, implementation and testing of an image identification system using computer vision methods for fruit flies with economic importance (Diptera: Tephritidae).

    Science.gov (United States)

    Wang, Jiang-Ning; Chen, Xiao-Lin; Hou, Xin-Wen; Zhou, Li-Bing; Zhu, Chao-Dong; Ji, Li-Qiang

    2017-07-01

    Many species of Tephritidae are damaging to fruit, which might negatively impact international fruit trade. Automatic or semi-automatic identification of fruit flies are greatly needed for diagnosing causes of damage and quarantine protocols for economically relevant insects. A fruit fly image identification system named AFIS1.0 has been developed using 74 species belonging to six genera, which include the majority of pests in the Tephritidae. The system combines automated image identification and manual verification, balancing operability and accuracy. AFIS1.0 integrates image analysis and expert system into a content-based image retrieval framework. In the the automatic identification module, AFIS1.0 gives candidate identification results. Afterwards users can do manual selection based on comparing unidentified images with a subset of images corresponding to the automatic identification result. The system uses Gabor surface features in automated identification and yielded an overall classification success rate of 87% to the species level by Independent Multi-part Image Automatic Identification Test. The system is useful for users with or without specific expertise on Tephritidae in the task of rapid and effective identification of fruit flies. It makes the application of computer vision technology to fruit fly recognition much closer to production level. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  16. The mitochondrial genome of the peach fruit fly, Bactrocera zonata (Saunders) (Diptera: Tephritidae): Complete DNA sequence, genome organization, and phylogenetic analysis with other tephritids using next generation DNA sequencing.

    Science.gov (United States)

    Choudhary, Jaipal S; Naaz, Naiyar; Prabhakar, Chandra S; Rao, Mathukumalli Srinivasa; Das, Bikash

    2015-09-15

    Mitochondrial genome can provide information for genomic structure as well as for phylogenetic analysis and evolutionary biology. The complete 15,935 bp mitochondrial genome of Bactrocera zonata (Diptera: Tephritidae), is assembled from Illumina MiSeq read data. The mitogenome information for B. zonata was compared to the homologous sequences of other tephritids. Annotation indicated that the structure and orientation of 13 protein coding genes (PCGs), 22 tRNA and 2 rRNA sequences were typical of, and similar to, the ten closely related tephritid species. The nucleotide composition shows heavily biased toward As and Ts accounting 73.34% and exhibits a slightly positive AT skew, which is similar to other known tephritid species. All PCGs are initiated by ATN codons, except for cox1 with TCG and atp8 with GTG. Nine PCGs use a common stop codon of TAA or TAG, whereas the remaining four use an incomplete termination codon T or TA likely to be completed by adenylation. All tRNAs have the typical clover-leaf structure, with an exception for trnS((AGN)). Four short intergenic spacers showed high degree of conservation among B. zonata and other ten tephritids. A poly(T) stretch at the 5' end followed by [TA(A)]n-like stretch and a tandem repeats of 39 bp has been observed in CR. The analysis of gene evolutionary rate revealed that the cox1 and atp6 exhibits lowest and highest gene substitution rates, respectively than other genes. The phylogenetic relationships based on Maximum Likelihood method using all protein-coding genes and two ribosomal RNA genes confirmed that B. zonata is closely related to Bactrocera correcta, Bactrocera carambolae, Bactrocera papayae, and Bactrocera philippinensis and Bactrocera dorsalis belonging to B. dorsalis species complex forms a monophyletic clade, which is in accordance with the traditional morphological classification and recent molecular works. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Captures of Wild Ceratitis capitata, Bactrocera dorsalis, and Bactrocera cucurbitae (Diptera: Tephritidae) in Traps with Improved Multilure TMR Dispensers Weathered in California.

    Science.gov (United States)

    Vargas, Roger I; Souder, Steven K; Morse, Joseph G; Grafton-Cardwell, Elizabeth E; Haviland, David R; Kabashima, John N; Faber, Ben A; Mackey, Bruce; Cook, Peter

    2016-04-01

    During 2012–2013, solid Mallet TMR (trimedlure [TML], methyl eugenol [ME], raspberry ketone [RK]) wafers impregnated with DDVP (2, 2-dichlorovinyl dimethyl phosphate) insecticide were weathered during summer (8 wk) and winter (12 wk) in five California citrus-growing counties (Kern, Ventura, Orange, Tulare, and Riverside). In addition, TMR wafers without DDVP and with a Hercon Vaportape II insecticidal strip were compared with TMR dispensers with DDVP at Exeter and Riverside. Weathered treatments were shipped every week (overnight delivery) to Hawaii and frozen for a later bioassay in a 1,335-ha coffee plantation near Numila, Kauai Island, HI, where Mediterranean fruit fly, Ceratitis capitata (Wiedemann), oriental fruit fly, Bactrocera dorsalis Hendel, and melon fly, Bactrocera cucurbitae Coquillett, were all present. We compared trap captures of the three species, C. capitata, B. dorsalis, and B. cucurbitae, for the five different weathering locations. Captures of C. capitata, B. dorsalis, and B. cucurbitae with Mallet TMR dispensers (with DDVP) were not significantly different for the five locations. Captures with the Mallet TMR dispenser without DDVP and Vaportape were similar to those for Mallet TMR with DDVP, although there were some slight location differences. In conclusion, based on these results, the Mallet TMR dispenser could potentially be used in California habitats where large numbers of detection traps are currently deployed. Use of Vaportape with dispensers would not require them to be registered with US Environmental Protection Agency (EPA). Dispensers for use as Male Annihilation Technique (MAT) devices will be tested further in Hawaii.

  18. Ecdysis Triggering Hormone Signaling (ETH/ETHR-A Is Required for the Larva-Larva Ecdysis in Bactrocera dorsalis (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Yan Shi

    2017-08-01

    Full Text Available Insects must undergo ecdysis for successful development and growth, and the ecdysis triggering hormone (ETH, released by the Inka cells, is a master hormone in this process. In this study, we determined the sequence of the ETH precursor and receptors in an agriculturally important pest insect, the oriental fruit fly Bactrocera dorsalis (Hendel. We identified two functionally distinct splice receptor isoforms: BdETH-R-A and BdETH-R-B, and when expressed in Chinese hamster ovary (CHO-WTA11 cells, they exhibited a high sensitivity to the two mature peptides BdETH1 and BdETH2. The BdETH transcript was detected in the tracheal tissue of the larvae. Inka cells were identified with immunohistochemical antibody staining against Drosophila melanogaster ETH1, and in situ hybridization with specific DNA probes. Selective RNA silencing of BdETH or BdETH-R-A, but not of BdETH-R-B, caused developmental failure at ecdysis. The dsRNA-treated larvae displayed tracheal defects and could not shed the old cuticle followed by death. Our results demonstrated that BdETH, via activation of BdETH-R-A but not ETH-R-B, plays an essential role in regulating the process of larva-larva ecdysis in B. dorsalis.

  19. cDNA CLONING AND TRANSCRIPTIONAL REGULATION OF THE CECROPIN AND ATTACIN FROM THE ORIENTAL FRUIT FLY, Bactrocera dorsalis (DIPTERA: TEPHRITIDAE).

    Science.gov (United States)

    Liao, Yin-Yin; Zuo, Yu-Han; Tsai, Cheng-Lung; Hsu, Chia-Ming; Chen, Mei-Er

    2015-06-01

    We described the cDNA cloning of two antimicrobial peptides (AMPs), cecropin (BdCec), and attacin C (BdAttC), from the oriental fruit fly, Bactrocera dorsalis (Hendel), a serious insect pest of fruit trees. Using rapid amplification of cDNA ends, fragments encompassing the entire open reading frames of BdCec and BdAttC were cloned and sequenced. The complete 425 bp cDNA of BdCec encodes a protein of 64 amino acids with a predicted molecular weight of 6.84 kDa. The 931 bp cDNA of BdAttC encodes a protein of 239 residues with a predicted molecular weight of 24.97 kDa. Real-time quantitative RT-PCR demonstrated that the developmental transcription profiles of BdCec and BdAttC were similar in each larvae, pupae, and adults. The constitutive expression levels of both AMPs were high in the first-instar and late third-instar larvae, suggesting that their antimicrobial activity is active in the newly hatched larvae and just before pupation. The basal expression levels were not significant different in adult fat bodies. The expression of BdCec and BdAttC was upregulated after bacterial challenge in adult fat bodies. The ratio of inducible expression to constitutive expression was lower in males compared to females. © 2015 Wiley Periodicals, Inc.

  20. Adult population dynamics of the bolivian fruit flies Anastrepha sp. (Diptera: Tephritidae at Municipality Coroico, Department of The La Paz, Bolivia

    Directory of Open Access Journals (Sweden)

    Gonzáles Manuel

    2011-08-01

    Full Text Available The investigation was carried out in Paco (1603 msnm communities, it Marca (1511 msnm and Capellania (1720 msnm, of the Municipality of Coroico, department of La Paz, Bolivia. In orchards frutícolas semicomerciales, they settled 15 traps distributed McPhail in a similar way among areas, five for community, sampling" "points. The censuses were carried out with an interval of 15 days, they were identified and they quantified the mature flies of the fruit. For the captures of the individuals, they settled the traps McPhail, using the attractive (Buminal one and as conserving borax. The traps were distributed in representative parcels, having as main cultivations, orange, mandarin, grapefruit, guava and avocado. The identification taxonómica of the captured species was carried out in the laboratory of the National Program of Control of Flies of the fruit (PROMOSCA, clerk of the National Service of Agricultural Sanity and Alimentary (SENASAG Inocuidad. 1210 mature flies of the fruit were captures, those that grouped for species, sex, capture dates and community, corresponding to the seven carried out censuses. The species of Anastrepha fraterculus (Wiedeman were identified, Anastrepha striata Schiner, Anastrepha serpentine (Wiedeman, Anastrepha sp, Ceratitis capitata (Wiedemann, Blepharoneura sp Loew, Hexaresta sp Hering, Hexachaeta sp Loew, Tomoplagia sp Coquillett, Tetreuaresta sp Hendel, being that of more presence Anastrepha fraterculus (Wiedeman with 818 and Ceratitis capitata (Wiedemann, with 354. The temperature and presence of spices put up frutícolas of flies of the fruit in maturation state explain the observed fluctuations.

  1. Weathering and Chemical Degradation of Methyl Eugenol and Raspberry Ketone Solid Dispensers for Detection, Monitoring, and Male Annihilation of Bactrocera dorsalis and Bactrocera cucurbitae (Diptera: Tephritidae) in Hawaii.

    Science.gov (United States)

    Vargas, Roger I; Souder, Steven K; Nkomo, Eddie; Cook, Peter J; Mackey, Bruce; Stark, John D

    2015-08-01

    Solid male lure dispensers containing methyl eugenol (ME) and raspberry ketone (RK), or mixtures of the lures (ME + RK), and dimethyl dichloro-vinyl phosphate (DDVP) were evaluated in area-wide pest management bucket or Jackson traps in commercial papaya (Carica papaya L.) orchards where both oriental fruit fly, Bactrocera dorsalis (Hendel), and melon fly, Bactrocera cucurbitae (Coquillett), are pests. Captures of B. dorsalis with fresh wafers in Jackson and bucket traps were significantly higher on the basis of ME concentration (Mallet ME [56%] > Mallet MR [31.2%] > Mallet MC [23.1%]). Captures of B. cucurbitae with fresh wafers in Jackson and bucket traps were not different regardless of concentration of RK (Mallet BR [20.1%] = Mallet MR [18.3%] = Mallet MC [15.9%]). Captures of B. dorsalis with fresh wafers, compared with weathered wafers, were significantly different after week 12; captures of B. cucurbitae were not significantly different after 16 wk. Chemical analyses revealed presence of RK in dispensers in constant amounts throughout the 16-wk trial. Degradation of both ME and DDVP over time was predicted with a high level of confidence by nonlinear asymptotic exponential decay curves. Results provide supportive data to deploy solid ME and RK wafers (with DDVP) in fruit fly traps for detection programs, as is the current practice with solid TML dispensers placed in Jackson traps. Wafers with ME and RK might be used in place of two separate traps for detection of both ME and RK responding fruit flies and could potentially reduce cost of materials and labor by 50%. Published by Oxford University Press on behalf of Entomological Society of America 2015. This work is written by US Government employees and is in the public domain in the US.

  2. Two Chitin Biosynthesis Pathway Genes in Bactrocera dorsalis (Diptera: Tephritidae): Molecular Characteristics, Expression Patterns, and Roles in Larval-Pupal Transition.

    Science.gov (United States)

    Yang, Wen-Jia; Wu, Yi-Bei; Chen, Li; Xu, Kang-Kang; Xie, Yi-Fei; Wang, Jin-Jun

    2015-10-01

    Glucose-6-phosphate isomerase (G6PI) and UDP-N-acetylglucosamine pyrophosphorylase (UAP), two key components in the chitin biosynthesis pathway, are critical for insect growth and metamorphosis. In this study, we identified the genes BdG6PI and BdUAP from the oriental fruit fly, Bactrocera dorsalis (Hendel). The open reading frames (ORFs) of BdG6PI (1,491 bp) and BdUAP (1,677 bp) encoded 496 and 558 amino acid residues, respectively. Multiple sequence alignments showed that BdG6PI and BdUAP had high amino acid sequence identity with other insect homologues. Quantitative real-time polymerase chain reaction (qPCR) analysis indicated that BdG6PI was mainly expressed in the early stages of third-instar larvae and adults, while significantly higher expression of BdUAP was observed in adults. Both transcripts were expressed highly in the Malpighian tubules, but only slightly in the tracheae. The expression of both BdG6PI and BdUAP was significantly up-regulated by 20-hydroxyecdysone exposure and down-regulated by starvation. Moreover, injection of double-stranded RNAs of BdG6PI and BdUAP into third-instar larvae significantly reduced the corresponding gene expressions. Additionally, silencing of BdUAP resulted in 65% death and abnormal phenotypes of larvae, while silencing of BdG6PI had a slight effect on insect molting. These findings provide some data on the roles of BdG6PI and BdUAP in B. dorsalis and demonstrate the potential role for BdUAP in larval-pupal transition. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. Combining Cue-Lure and Methyl Eugenol in Traps Significantly Decreases Catches of Most Bactrocera, Zeugodacus and Dacus Species (Diptera: Tephritidae: Dacinae) in Australia and Papua New Guinea.

    Science.gov (United States)

    Royer, Jane E; Mayer, David G

    2018-02-09

    Male fruit fly attractants, cue-lure (CL) and methyl eugenol (ME), are important in the monitoring and control of pest fruit fly species. Species respond to CL or ME but not both, and there are conflicting reports on whether combining CL (or its hydroxy analogue raspberry ketone) and ME decreases their attractiveness to different species. Fruit fly monitoring programs expend significant effort using separate CL and ME traps and avoiding lure cross-contamination, and combining the two lures in one trap would create substantial savings. To determine if combining lures has an inhibitory effect on trap catch, CL and ME wicks placed in the same Steiner trap were field tested in comparison to CL alone and ME alone in Australia and Papua New Guinea (PNG). In Australia, 24 out of 27 species trapped were significantly more attracted to CL or ME alone than the combination ME/CL lure, including the pests Bactrocera bryoniae (Tryon), B. frauenfeldi (Schiner), B. kraussi (Hardy), B. neohumeralis (Hardy), B. tryoni (Froggatt) (CL-responsive), and B. musae (Tryon) (ME-responsive). In PNG, 13 out of 16 species trapped were significantly more attracted to CL or ME alone than the ME/CL combination, including the pests B. bryoniae, B. frauenfeldi, B. neohumeralis, B. trivialis (Drew), Zeugodacus cucurbitae (Coquillett) (CL-responsive) and B. dorsalis (Hendel), B. musae, and B. umbrosa (Fabricius) (ME-responsive). This study shows that combining CL and ME in the one trap in equal parts significantly reduces catches of most species of Dacini fruit flies in Australia and PNG. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Etude de la dynamique de Bactrocera dorsalis (Hendel) (Diptera ...

    African Journals Online (AJOL)

    Au Sénégal, la filière mangue contribue à la lutte contre la pauvreté et l'insécurité alimentaire en milieu rural. Toutefois, elle est confrontée à des contraintes phytosanitaires notamment celles liées à Bactrocera dorsalis. La présente étude qui vise à comprendre la dynamique B. dorsalis a consisté à placer dans 4 vergers de ...

  5. Regional Suppression of Bactrocera Fruit Flies (Diptera: Tephritidae in the Pacific through Biological Control and Prospects for Future Introductions into Other Areas of the World

    Directory of Open Access Journals (Sweden)

    Roger I. Vargas

    2012-08-01

    Full Text Available Bactrocera fruit fly species are economically important throughout the Pacific. The USDA, ARS U.S. Pacific Basin Agricultural Research Center has been a world leader in promoting biological control of Bactrocera spp. that includes classical, augmentative, conservation and IPM approaches. In Hawaii, establishment of Bactrocera cucurbitae (Coquillett in 1895 resulted in the introduction of the most successful parasitoid, Psyttalia fletcheri (Silvestri; similarly, establishment of Bactrocera dorsalis (Hendel in 1945 resulted in the introduction of 32 natural enemies of which Fopius arisanus (Sonan, Diachasmimorpha longicaudata (Ashmead and Fopius vandenboschi (Fullaway were most successful. Hawaii has also been a source of parasitoids for fruit fly control throughout the Pacific region including Australia, Pacific Island Nations, Central and South America, not only for Bactrocera spp. but also for Ceratitis and Anastrepha spp. Most recently, in 2002, F. arisanus was introduced into French Polynesia where B. dorsalis had invaded in 1996. Establishment of D. longicaudata into the new world has been important to augmentative biological control releases against Anastrepha spp. With the rapid expansion of airline travel and global trade there has been an alarming spread of Bactrocera spp. into new areas of the world (i.e., South America and Africa. Results of studies in Hawaii and French Polynesia, support parasitoid introductions into South America and Africa, where B. carambolae and B. invadens, respectively, have become established. In addition, P. fletcheri is a candidate for biological control of B. cucurbitae in Africa. We review past and more

  6. Development of a genetic sexing strain in Bactrocera carambolae (Diptera: Tephritidae) by introgression of sex sorting components from B. dorsalis, Salaya1 strain.

    Science.gov (United States)

    Isasawin, Siriwan; Aketarawong, Nidchaya; Lertsiri, Sittiwat; Thanaphum, Sujinda

    2014-01-01

    The carambola fruit fly, Bactrocera carambolae Drew & Hancock is a high profile key pest that is widely distributed in the southwestern ASEAN region. In addition, it has trans-continentally invaded Suriname, where it has been expanding east and southward since 1975. This fruit fly belongs to Bactrocera dorsalis species complex. The development and application of a genetic sexing strain (Salaya1) of B. dorsalis sensu stricto (s.s.) (Hendel) for the sterile insect technique (SIT) has improved the fruit fly control. However, matings between B. dorsalis s.s. and B. carambolae are incompatible, which hinder the application of the Salaya1 strain to control the carambola fruit fly. To solve this problem, we introduced genetic sexing components from the Salaya1 strain into the B. carambolae genome by interspecific hybridization. Morphological characteristics, mating competitiveness, male pheromone profiles, and genetic relationships revealed consistencies that helped to distinguish Salaya1 and B. carambolae strains. A Y-autosome translocation linking the dominant wild-type allele of white pupae gene and a free autosome carrying a recessive white pupae homologue from the Salaya1 strain were introgressed into the gene pool of B. carambolae. A panel of Y-pseudo-linked microsatellite loci of the Salaya1 strain served as markers for the introgression experiments. This resulted in a newly derived genetic sexing strain called Salaya5, with morphological characteristics corresponding to B. carambolae. The rectal gland pheromone profile of Salaya5 males also contained a distinctive component of B. carambolae. Microsatellite DNA analyses confirmed the close genetic relationships between the Salaya5 strain and wild B. carambolae populations. Further experiments showed that the sterile males of Salaya5 can compete with wild males for mating with wild females in field cage conditions. Introgression of sex sorting components from the Salaya1 strain to a closely related B. carambolae

  7. Developing diagnostic SNP panels for the identification of true fruit flies (Diptera: Tephritidae) within the limits of COI-based species delimitation.

    Science.gov (United States)

    Frey, Juerg E; Guillén, Larissa; Frey, Beatrice; Samietz, Joerg; Rull, Juan; Aluja, Martín

    2013-05-29

    Rapid and reliable identification of quarantine pests is essential for plant inspection services to prevent introduction of invasive species. For insects, this may be a serious problem when dealing with morphologically similar cryptic species complexes and early developmental stages that lack distinctive characters useful for taxonomic identification. DNA based barcoding could solve many of these problems. The standard barcode fragment, an approx. 650 base pairs long sequence of the 5'end of the mitochondrial cytochrome oxidase I (COI), enables differentiation of a very wide range of arthropods. However, problems remain in some taxa, such as Tephritidae, where recent genetic differentiation among some of the described species hinders accurate molecular discrimination. In order to explore the full species discrimination potential of COI, we sequenced the barcoding region of the COI gene of a range of economically important Tephritid species and complemented these data with all GenBank and BOLD entries for the systematic group available as of January 2012. We explored the limits of species delimitation of this barcode fragment among 193 putative Tephritid species and established operational taxonomic units (OTUs), between which discrimination is reliably possible. Furthermore, to enable future development of rapid diagnostic assays based on this sequence information, we characterized all single nucleotide polymorphisms (SNPs) and established "near-minimal" sets of SNPs that differentiate among all included OTUs with at least three and four SNPs, respectively. We found that although several species cannot be differentiated based on the genetic diversity observed in COI and hence form composite OTUs, 85% of all OTUs correspond to described species. Because our SNP panels are developed based on all currently available sequence information and rely on a minimal pairwise difference of three SNPs, they are highly reliable and hence represent an important resource for

  8. Characterizing the developmental transcriptome of the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae) through comparative genomic analysis with Drosophila melanogaster utilizing modENCODE datasets.

    Science.gov (United States)

    Geib, Scott M; Calla, Bernarda; Hall, Brian; Hou, Shaobin; Manoukis, Nicholas C

    2014-10-28

    The oriental fruit fly, Bactrocera dorsalis, is an important pest of fruit and vegetable crops throughout Asia, and is considered a high risk pest for establishment in the mainland United States. It is a member of the family Tephritidae, which are the most agriculturally important family of flies, and can be considered an out-group to well-studied members of the family Drosophilidae. Despite their importance as pests and their relatedness to Drosophila, little information is present on B. dorsalis transcripts and proteins. The objective of this paper is to comprehensively characterize the transcripts present throughout the life history of B. dorsalis and functionally annotate and analyse these transcripts relative to the presence, expression, and function of orthologous sequences present in Drosophila melanogaster. We present a detailed transcriptome assembly of B. dorsalis from egg through adult stages containing 20,666 transcripts across 10,799 unigene components. Utilizing data available through Flybase and the modENCODE project, we compared expression patterns of these transcripts to putative orthologs in D. melanogaster in terms of timing, abundance, and function. In addition, temporal expression patterns in B. dorsalis were characterized between stages, to establish the constitutive or stage-specific expression patterns of particular transcripts. A fully annotated transcriptome assembly is made available through NCBI, in addition to corresponding expression data. Through characterizing the transcriptome of B. dorsalis through its life history and comparing the transcriptome of B. dorsalis to the model organism D. melanogaster, a database has been developed that can be used as the foundation to functional genomic research in Bactrocera flies and help identify orthologous genes between B. dorsalis and D. melanogaster. This data provides the foundation for future functional genomic research that will focus on improving our understanding of the physiology and

  9. Survival and development of Bactrocera oleae Gmelin (Diptera ...

    African Journals Online (AJOL)

    Bactrocera oleae Gmelin (Diptera:Tephritidae) is the most important and widespread pest in the olive growing countries in the Mediterranean basin. The development and survival of olive fruit fly, B. oleae from egg to adult stage was studied in the laboratory at 16, 22, 27 and 35°C. The objective of the study was to get ...

  10. Cytogenetic and symbiont analysis of five members of the B. dorsalis complex (Diptera, Tephritidae): no evidence of chromosomal or symbiont-based speciation events.

    Science.gov (United States)

    Augustinos, Antonios A; Drosopoulou, Elena; Gariou-Papalexiou, Aggeliki; Asimakis, Elias D; Cáceres, Carlos; Tsiamis, George; Bourtzis, Kostas; Penelope Mavragani-Tsipidou; Zacharopoulou, Antigone

    2015-01-01

    The Bactrocera dorsalis species complex, currently comprising about 90 entities has received much attention. During the last decades, considerable effort has been devoted to delimiting the species of the complex. This information is of great importance for agriculture and world trade, since the complex harbours several pest species of major economic importance and other species that could evolve into global threats. Speciation in Diptera is usually accompanied by chromosomal rearrangements, particularly inversions that are assumed to reduce/eliminate gene flow. Other candidates currently receiving much attention regarding their possible involvement in speciation are reproductive symbionts, such as Wolbachia, Spiroplasma, Arsenophonus, Rickettsia and Cardinium. Such symbionts tend to spread quickly through natural populations and can cause a variety of phenotypes that promote pre-mating and/or post-mating isolation and, in addition, can affect the biology, physiology, ecology and evolution of their insect hosts in various ways. Considering all these aspects, we present: (a) a summary of the recently gained knowledge on the cytogenetics of five members of the Bactrocera dorsalis complex, namely Bactrocera dorsalis s.s., Bactrocera invadens, Bactrocera philippinensis, Bactrocera papayae and Bactrocera carambolae, supplemented by additional data from a Bactrocera dorsalis s.s. colony from China, as well as by a cytogenetic comparison between the dorsalis complex and the genetically close species, Bactrocera tryoni, and, (b) a reproductive symbiont screening of 18 different colonized populations of these five taxa. Our analysis did not reveal any chromosomal rearrangements that could differentiate among them. Moreover, screening for reproductive symbionts was negative for all colonies derived from different geographic origins and/or hosts. There are many different factors that can lead to speciation, and our data do not support chromosomal and/or symbiotic

  11. Odour-mediated foraging by yellowjacket wasps (Hymenoptera: Vespidae): predation on leks of pheromone-calling Mediterranean fruit fly males (Diptera: Tephritidae).

    Science.gov (United States)

    Hendrichs, J; Katsoyannos, B I; Wornoayporn, V; Hendrichs, M A

    1994-09-01

    . On ripe fruit, particularly fig, V. germanica visual prey hunting also included the capture of feeding medfly males, other feeding Diptera, as well as medfly larvae extracted from wasp-made perforations in the fruit.

  12. Rediscovery Of Tephritis kogardtauica (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Korneyev S. V.

    2015-04-01

    Full Text Available A species, previously known from a short description based on the holotype lost in the bombing of Hamburg before description, T. kogardtauica Hering, 1944, was collected recently in great numbers in the Middle East, from Iran to Kyrgyzstan; it is redescribed, and the neotype is designated. Th e flies were found to infest flower heads of Inula stenocalathia (Rech. f. Soldano, I. peacockiana (Aitch. & Hemsl. Korovin, and I. grandis Schrenk ex Fisch. & C. A. Mey.

  13. Catalogue of Tephritidae of Colombia

    Science.gov (United States)

    The present Catalogue includes 93 species and 23 genera of Tephritidae that have been recorded in Colombia. Four subfamilies (Blepharoneurinae, Dacinae, Trypetinae and Tephritinae), and eight tribes (Acrotaeniini, Carpomyini, Dacini, Eutretini, Myopitini, Noeetini, Tephritini, and Toxotrypanini) are...

  14. Cytogenetic Analysis of the South American Fruit Fly Anastrepha fraterculus (Diptera:Tephritidae Species Complex: Construction of Detailed Photographic Polytene Chromosome Maps of the Argentinian Af. sp.1 Member.

    Directory of Open Access Journals (Sweden)

    Angeliki Gariou-Papalexiou

    Full Text Available Genetic and cytogenetic studies constitute a significant basis for understanding the biology of insect pests and the design and the construction of genetic tools for biological control strategies. Anastrepha fraterculus is an important pest of the Tephritidae family. It is distributed from southern Texas through eastern Mexico, Central America and South America causing significant crop damage and economic losses. Currently it is considered as a species complex; until now seven members have been described based on multidisciplinary approaches. Here we report the cytogenetic analysis of an Argentinian population characterized as Af. sp.1 member of the Anastrepha fraterculus species complex. The mitotic karyotype and the first detailed photographic maps of the salivary gland polytene chromosomes are presented. The mitotic metaphase complement consists of six (6 pairs of chromosomes, including one pair of heteromorphic sex chromosomes, with the male being the heterogametic sex. The analysis of the salivary gland polytene complement shows a total number of five long chromosomes that correspond to the five autosomes of the mitotic karyotype and a heterochromatic network corresponding to the sex chromosomes. Comparison of the polytene chromosome maps between this species and Anastrepha ludens shows significant similarity. The polytene maps presented here are suitable for cytogenetic studies that could shed light on the species limits within this species complex and support the development of genetic tools for sterile insect technique (SIT applications.

  15. International Journal of Biological and Chemical Sciences - Vol 9 ...

    African Journals Online (AJOL)

    Etude de la dynamique de Bactrocera dorsalis (Hendel) (Diptera: Tephritidae) dans les vergers de mangues en Basse Casamance : influence des facteurs climatiques · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Ibrahima Solo Konta, Saliou Djiba, Seyni Sane, ...

  16. Author Details

    African Journals Online (AJOL)

    Etude de la dynamique de Bactrocera dorsalis (Hendel) (Diptera: Tephritidae) dans les vergers de mangues en Basse Casamance : influence des facteurs climatiques. Abstract PDF · Vol 10, No 1 (2016) - Articles Révision du genre Digitaria Haller (Poaceae) au Sénégal : proposition d'une clé de détermination pour une ...

  17. International Journal of Biological and Chemical Sciences - Vol 10 ...

    African Journals Online (AJOL)

    Étude comparative du développement de Bactrocera dorsalis (Hendel) (Diptera : Tephritidae) sur Irvingia gabonensis et Musa sp. EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Micheline V. Hintenou, Espérantos O. de Souza, Aimé H. Bokonon-Ganta, Inès G.

  18. Survivorship of male and female Bactrocera dorsalis in the field and the effect of male annihilation technique

    Science.gov (United States)

    Male Annihilation Technique (MAT) is a key component of the Oriental fruit fly Bactrocera dorsalis Hendel (Diptera: Tephritidae) management because of the “strong” attraction of males to the lure methyl eugenol. The optimal application density for MAT has not been investigated for this economically ...

  19. SISTEMA DE CROMOSSOMOS SEXUAIS MÚLTIPLOS X1X1X2X2/X1X2Y NA MOSCA-DAS-FRUTAS Anastrepha sororcula (DIPTERA: TEPHRITIDAE

    Directory of Open Access Journals (Sweden)

    Inês Regina de Araújo Moura Cunha

    2014-08-01

    Full Text Available Sistemas de cromossomos sexuais simples estão difundidos entre os Tephritidae do gênero Anastrepha. Espécies deste gênero apresentam enorme importância pelo impacto que causam em frutíferas cultivadas, sobretudo no nordeste do Brasil. Análises citogenéticas desenvolvidas em Anastrepha sororcula, através da análise da estrutura cariotípica e bandamento C revelaram a presença de um sistema de cromossomos sexuais múltiplos do tipo X1X1X2X2/X1X2Y nesta espécie. Enquanto as fêmeas apresentam um cariótipo homomórfico com 2n=12, os machos possuem 2n=11, onde se destaca um grande cromossomo Y despareado. O nível de divergência cariotípica da espécie A. sororcula do nordeste, com a presença de um sistema de cromossomos sexuais múltiplos, em relação às regiões central e sudeste do Brasil, podem indicar a ocorrência de impedimentos reprodutivos entre os exemplares das duas áreas e que possivelmente, como outros exemplos que existem neste gênero, A. sororcula constitua um complexo de espécies ainda não inteiramente definido. Palavras-chave: Alossomos, peste agrícola, citogenética de insetos, heterocromatina. DOI: http://dx.doi.org/10.18561/2179-5746/biotaamazonia.v4n2p1-4

  20. A revision of the Anastrepha robusta species group (Diptera: Tephritidae)

    Science.gov (United States)

    The Anastrepha robusta species group is revised to include the following 29 species: A. amaryllis Tigrero (Ecuador), A. amazonensis, n. sp. (Brazil: Amazonas), A. bella, n. sp. (Panamá), A. binodosa Stone (Colombia, Brazil: Amazonas, Pará), A. concava Greene (Costa Rica to Ecuador and Brazil: Amazon...

  1. Quantifying individual fruit fly consumption with Anastrepha suspensa (Diptera: Tephritidae).

    Science.gov (United States)

    Nigg, H N; Schumann, R A; Yang, J J; Yang, L K; Simpson, S E; Etxeberria, E; Burns, R E; Harris, D L; Fraser, S

    2004-12-01

    We needed a technique to compare the consumption of baits by individual Carribbean fruit fly, Anastrepha suspensa (Loew). By improving consumption and determining individual dose, we could lower pesticide concentration while retaining bait/pesticide efficacy and potentially reduce the environmental impact of fruit fly bait/pesticide eradication methods. We report here a precise dye-based technique for the quantification of consumption by individual adult A. suspensa fruit flies. Fluorescein, measured at 491 nm, and cresol red, measured at 573 nm, were efficiently extracted with 0.1 M NaOH and quantified with a spectrophotometer. The lower limit for this method with 0.1% dye concentration is 300 nl consumed by an individual fly. Dye movement to the hindgut and possible defecation occurred in approximately 4 h; maximum ingestion occurred in approximately 1 h. Maximum experimental time is limited to 4 h. Flies preferred feeding upside down compared with right side up when given a choice; consumption was equal when flies were given no choice of feeding position. Thus, maximum bait/pesticide efficacy might be achieved with an upside-down presentation. Regurgitation led to a 100% overestimation of actual consumption with the J-tube presentation of food. Our individual fly consumption technique will be useful in comparing consumption in phagostimulant studies, estimating dose in oral toxicity tests, differentiating behavioral and physiological resistance in toxicant studies, ultimately leading to improved bait/pesticide methods and reduced environmental impact of area wide fruit fly eradication programs. This technique could be applied to studies of tephritid consumption, to the consumption of other insects, and to regurgitation studies.

  2. Biodiversity and Bionomics for Fruit Flies ( Diptera: Tephritidae ) in ...

    African Journals Online (AJOL)

    The invasive fruit fly, Bactrocera invadens Drew, Tsuruta and White is the key pest in the low and medium altitude areas. On the other hand, the Natal fruit fly, Ceratitis rosa Karsch is the key frugivorous pest in the high altitude areas. Other native species like C. capitata (Wiedemann) and Ceratitis cosyra (Walker) were less ...

  3. Diversity of fruit fly species (Diptera: Tephritidae) associated with ...

    African Journals Online (AJOL)

    The fruit fly detection trapping showed that Bactrocera invadens Drew Tsuruta & White followed by Dacus bivittatus (Bigot), was the most predominant species recorded in Citrus orchards. Bactrocera cucurbitae (Coquillett) was also recorded along with six species of Ceratitis. From all fruits sampled, the emerged fruit fly ...

  4. Fecundity and longevity of Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Cristiane Ramos Jesus-Barros

    2017-12-01

    Full Text Available Bactrocera carambolae Drew & Hancock is an exotic species considered a quarantine pest in Brazil, with distribution limited to the states of Amapá and Roraima. Knowledge of its biology under Brazilian conditions is still limited. The objective of this work was to determine the fecundity and longevity of B. carambolae females, reared on artificial diet, under laboratory conditions. The experiment was carried out at Embrapa Amapá, where 20 newly emerged B. carambolae couples were selected (F3 generation. Each couple was placed in a plastic cage containing feed, distilled water and an artificial oviposition device and stored in an air-conditioned room (26 ± 1°C, 60 ± 10% R. H. and 12-hour photoperiod. The eggs deposited on each device were counted daily. Mean survival was 90.70 ± 9.97 days and the maximum longevity was 150 days. The mean duration of the pre-oviposition period was 25.15 ± 3.54 days and the oviposition period was 62.73 ± 7.84 days. Fecundity was variable over time, with an oviposition peak on the 28th day. The mean number of eggs per female was 1,088.26 ± 167.82. These results suggest that B. carambolae uses high fecundity and longevity as a reproductive strategy.

  5. Effective chemical control of fruit flies (Diptera: Tephritidae) pests in ...

    African Journals Online (AJOL)

    Fruit flies are major pest in West Africa. In Côte-d'Ivoire, they caused heavy losses. Thus, preventive measures are taken to reduce their damage. The objective was to evaluate the effectiveness of Success Appat® and Proteus 170 O-TEQ against fruit. Traps baited with sexual attractants were set in mango orchards and their ...

  6. The fruit flies (Tephritidae) of Ontario

    Science.gov (United States)

    Thirteen species of Tephritidae are newly recorded from Ontario, and alternative format keys are provided to the 31 genera and 72 species of fruit fly now known from, or likely to occur, in the province. Standard dichotomous keys to genera, and simplified field keys to genera and species are provide...

  7. Ring-fluorinated analog of methyl eugenol: Attractiveness to and metabolism in the oriental fruit fly, Bactrocera dorsalis (Hendel)

    Science.gov (United States)

    Oriental fruit fly, Bactrocera dorsalis (Hendel), males are highly attractive to the natural phenylpropanoid methyl eugenol (ME). They compulsively feed on ME and metabolize it to ring and side-chain hydroxylated compounds which have both pheromonal and allomonal functions. Side-chain metabolic act...

  8. Pre and post harvest IPM for the mango fruit fly, Bactrocera dorsalis (Hendel)

    Energy Technology Data Exchange (ETDEWEB)

    Verghese, Abraham; Sreedevi, K.; Nagaraju, D.K., E-mail: avergis@iihr.ernet.i [Indian Institute of Horticultural Research, Bangalore, Karnataka (India)

    2006-07-01

    The fruit fly, Bactrocera dorsalis (Hendel) is a major pest of mango in India. So, investigations were carried out to standardize an Integrated Pest Management (IPM) for fruit fly-free and residue-free mango fruits. The study required orchard and laboratory studies, which were conducted on the commercial variety Banganapalli, at the Indian Institute of Horticultural Research, Hessaraghatta Lake P.O., Bangalore, India, during 2004 and 2005. Results showed that a pre harvest IPM combination of male annihilation technique (MAT) (using methyl eugenol as a lure) + sanitation brought down B. dorsalis infestation to 5.00% from an infestation ranging from 17 to 66% in control in both years. An additional cover spray of Decamethrin 2.8EC 0.5ml/l (which is half the recommended dose) + Azadirachtin (0.03 %) 2ml/l (neem based botanical) gave 100% control in both the years. Post harvest treatments with hot water at 48 degree C for 60 and 75 min resulted in 100% control at both the time regimes in 2004 and 2005. The untreated fruits, which were also exposed to gravid females (but not treated in hot water) showed 30% and 5.5% infestations, respectively, in 2004 and 2005. (author)

  9. Spatial distribution pattern and sequential sampling plans for Bactrocera oleae (Gmelin (Dip: Tephritidae in olive orchards

    Directory of Open Access Journals (Sweden)

    A. Arbab

    2016-04-01

    Full Text Available The distribution of adult and larvae Bactrocera oleae (Diptera: Tephritidae, a key pest of olive, was studied in olive orchards. The first objective was to analyze the dispersion of this insect on olive and the second was to develop sampling plans based on fixed levels of precision for estimating B. oleae populations. The Taylor’s power law and Iwao’s patchiness regression models were used to analyze the data. Our results document that Iwao’s patchiness provided a better description between variance and mean density. Taylor’s b and Iwao’s β were both significantly more than 1, indicating that adults and larvae had aggregated spatial distribution. This result was further supported by the calculated common k of 2.17 and 4.76 for adult and larvae, respectively. Iwao’s a for larvae was significantly less than 0, indicating that the basic distribution component of B. oleae is the individual insect. Optimal sample sizes for fixed precision levels of 0.10 and 0.25 were estimated with Iwao’s patchiness coefficients. The optimum sample size for adult and larvae fluctuated throughout the seasons and depended upon the fly density and desired level of precision. For adult, this generally ranged from 2 to 11 and 7 to 15 traps to achieve precision levels of 0.25 and 0.10, respectively. With respect to optimum sample size, the developed fixed-precision sequential sampling plans was suitable for estimating flies density at a precision level of D=0.25. Sampling plans, presented here, should be a tool for research on pest management decisions of B. oleae.

  10. Di- and Tri-flourinated analogs of methyl eugenol: attractiveness to and metabolism in the oriental fruit fly, bactrocera dorsalis (hendel)

    Science.gov (United States)

    Oriental fruit fly, Bactrocera dorsalis (Hendel), males are highly 1 attracted to the natural phenylpropanoid methyl eugenol (ME). They compulsively feed on ME and metabolize it to ring and side-chain hydroxylated compounds that have both pheromonal and allomonal properties. Previously, we demonstra...

  11. Controle químico de Anastrepha fraterculus (Wied. (Diptera: Tephritidae em laboratório Chemical control of Anastrepha fraterculus (Wied. (Diptera: Tephritidae in laboratory

    Directory of Open Access Journals (Sweden)

    Priscila Lang Scoz

    2004-12-01

    Full Text Available O efeito de quatro novos grupos químicos de inseticidas incluindo avermectina (benzoato de emamectina, éter piretróide (etofemprox, neoniconitnóide (imidacloprid, thiacloprid e thiamethoxan e naturalyte (spinosad foram avaliados em laboratório (25 ± 3ºC, umidade relativa de 70 ± 10% e fotofase de 12 horas, visando ao controle de adultos e ovos/larvas de Anastrepha fraterculus comparando-os com os fosforados fenthion e thrichlorphon. O benzoato de emamectina não foi eficiente no controle de adultos de A. fraterculus via contato e ingestão. O etofenprox, imidacloprid, spinosad e thiamethoxan foram eficientes no controle de adultos de A. fraterculus via contato e ingestão, proporcionando maior mortalidade via ingestão. Os novos inseticidas não provocaram mortalidade significativa de ovos/larvas de A. fraterculus localizados no interior de maçãs, enquanto que os fosforados fenthion e thrichlorphon resultaram em 100% de mortalidade das fases imaturas e adultos. Os novos inseticidas apresentam potencial para uso nas iscas tóxicas, substituindo os fosforados para o controle de adultos.The South American Fruit Fly, Anastrepha fraterculus is one of the most important pest of temperate fruit crops. The effect of four new inseticide groups to replace organophosphate compounds for A. fraterculus control was evaluated under laboratory conditions (25 ± 3ºC, relative humity of 70 ± 10% and 12:12 L:D. Emamectin benzoate, etofenprox, imidacloprid, spinosad, thiacloprid and thiamethoxan were evaluated to control adults by contact and ingestion and against eggs/larvae inside apple fruits compared with fenthion and thrichlorphon. Emamectin benzoate was not efficient to control adults of A. fraterculus by contact and ingestion. Etofenprox, imidacloprid, spinosad and thiamethoxan were efficient to control adults by contact and ingestion being more toxic by ingestion. No new insecticide controlled eggs/larvae inside apple fruit while organophosphate compounds caused 100% of mortality of immature stages and adults. The new insecticides showed more potential to substitute organophosphate compounds in bait sprays for adult control.

  12. Effects of acoustic waves on pupas of Ceratitis capitata. (Wied., 1824) (Diptera: Tephritidae); Efeitos das ondas acusticas em pupas de Ceratitis capitata. (Wied., 1824) (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Barros, Adilson Camilo de

    2007-07-01

    The aim of this research has been to investigate the hypothesis that acoustic waves would provoke a measurable effect on a population of fruit flies, a treatment denominated sonication. Ionizing radiation, the causative agent for the treatment designated by irradiation has been used as a reference, as long as its effects on living beings and particularly on insects are widely known. This research also enquiries into the possible effects of acoustic waves and gamma rays. The experiments of sonication were carried out in the Laboratory of Entomology of the Instituto Biologico de Sao Paulo. The experiments of radiation were carried out in the Centro de Tecnologia das Radiacoes - IPEN, located within the campus of the University of Sao Paulo. It has been employed a Gamma cell source model 220 with average activity of 757.069 {+-} 293.484 curies (Ci) and an average doses rate of 3.106 {+-} 0.245 kilo grays per hour (kGy/h). Levels applied to the sonication treatment, in hertz and kilo Hertz were: 0 Hz (control) ; 5.0 Hz; 10.0 Hz; 20.0 Hz; 40.0 Hz; 60.0 Hz; 80.0 Hz; 1.0 k Hz; 2.0 k Hz; 10.0 k Hz; 15.0 k Hz e 20.0 k Hz. Irradiation doses applied in Grays were: 5.0 Gy; 7.5 Gy; 10.0 Gy; 12.5 Gy; 15 Gy; 50 Gy; 100 Gy; 150 Gy and 200 Gy. It has been used an acoustic tube made of glass - 40.6 cm in length and 9.1 cm in diameter - and sinusoidal waves originated from three acoustic sources, with response in decibels, which sound intensity varied from 93.60 {+-} 1.51 dB to 123.96 {+-} 0.23 dB. Final results have pointed to evidences that would justify the rejection of null hypothesis H{sub 0}, to which the average of the treatments due to acoustic waves do not differ significantly from each other.(author)

  13. Comportamento sexual de Anastrepha sororcula Zucchi (Diptera, Tephritidae em laboratório Sexual behavior of Anastrepha sororcula Zucchi (Diptera, Tephritidae in laboratory

    Directory of Open Access Journals (Sweden)

    Michelli C. N. Facholi-Bendassolli

    2006-09-01

    Full Text Available Anastrepha sororcula Zucchi, 1979, é uma das espécies de mosca-das-frutas mais disseminadas no País, sendo considerada a praga-chave que causa os maiores danos à produção de goiaba (Psidium guajava L., 1758 no Brasil. Em vista da importância desta espécie no complexo de pragas naturais da fruticultura brasileira e, em face à escassez de dados sobre sua biologia e comportamento, este trabalho teve por objetivo obter informações sobre a idade de maturação sexual de A. sororcula em laboratório e descrever seu comportamento reprodutivo. Os machos atingiram a maturidade sexual entre 7 e 18 dias após a emergência, com a maioria dos indivíduos tornando-se sexualmente maduros entre 10 e 13 dias de idade. Exibiram comportamento de sinalização às fêmeas, caracterizado pela distensão da região pleural do abdome, formando uma pequena bolsa de cada lado e, eversão de uma diminuta bolsa membranosa de cutícula retal que circunda a área anal. Durante este processo, os machos realizaram rápidos movimentos de vibração das asas, produzindo sinais audíveis. Uma gotícula foi liberada da região anal durante os movimentos de vibração alar. Após a atração das fêmeas, os machos realizaram uma série de movimentos elaborados de cortejo. As fêmeas alcançaram a maturação sexual entre 14 e 24 dias da emergência, com a maioria tornando-se sexualmente madura aos 19 dias de idade. A exibição diária das atividades sexuais foi confinada quase que exclusivamente ao período das 16:00-17:30h. A. sororcula apresentou um acentuado padrão de protandria.Anastrepha sororcula Zucchi, 1979, is a fruit fly species that can be considered a key pest to the production of guava (Psidium guajava L., 1758, fruit tree which has a wide distribution in Brazil. In view of the importance of this species as a natural pest of Brazilian horticulture and, considering the lack of data about its biology and behavior, the aim of this paper is to obtain information about the age of sexual maturation of A. sororcula in the laboratory and to describe its reproductive behavior. The males reached sexual maturity between 7 and 18 days after emergence, with most of the individuals becoming sexually mature between 10 and 13 days of age. They exhibited signalling behavior to the females, characterized by the distension of the pleural area of the abdomen, forming a small pouch on each side, and by the protrusion of a tiny membranous pouch of rectal cuticle that surrounds the anal area. During this display, the males produced rapid movements of vibration of the wings, producing audible sounds. A droplet was liberated from the anal area during the vibration movements of the wings. After attracting the females, the males accomplished a series of elaborated movements of courtship behavior. The females reached sexual maturation between 14 and 24 days after emergence, with the majority becoming sexually mature at 19 days. The daily exhibition of sexual activities was confined almost exclusively to the period of 16:00-17:30h. A. sororcula presented a sharp protandry pattern.

  14. Development of phytosanitary cold treatments for oranges infested with Bactrocera invadens and B. zonata (Diptera: Tephritidae) by comparison...existing cold treatment schedules for Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    Phytosanitary cold treatments are attempted for Bactrocera invadens Drew, Tsuruta, and White and Bactrocera zonata (Saunders) by comparison with Ceratitis capitata (Wiedemann). Oranges were infested by puncturing holes in the peel and allowing tephritids to oviposit in the holes. The treatments were...

  15. Development of phytosanitary cold treatments for oranges infested with Bactrocera invadens and Bactrocera zonata (Diptera: Tephritidae) by comparison with existing cold treatment schedules for Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Hallman, Guy J; Myers, Scott W; El-Wakkad, Mokhtar F; Tadrous, Meshil D; Jessup, Andrew J

    2013-08-01

    Phytosanitary cold treatments were tested for Bactrocera invadens Drew, Tsuruta, and White and Bactrocera zonata (Saunders) using comparisons with Ceratitis capitata (Wiedemann). Oranges were infested by puncturing holes in the peel and allowing tephritids to oviposit in the holes. The treatments were initiated when the larvae reached late third instar because previous research had shown that stage to be the most cold tolerant for all three species. Results show that B. invadens is not more cold tolerant than C. capitata and B. zonata at 1.0 +/- 0.1 degrees C and lend support to the use of C. capitata cold treatment schedules for B. invadens. It cannot be concluded that B. zonata is not more cold tolerant than C. capitata.

  16. Fauna europaea: Diptera - brachycera.

    Science.gov (United States)

    Pape, Thomas; Beuk, Paul; Pont, Adrian Charles; Shatalkin, Anatole I; Ozerov, Andrey L; Woźnica, Andrzej J; Merz, Bernhard; Bystrowski, Cezary; Raper, Chris; Bergström, Christer; Kehlmaier, Christian; Clements, David K; Greathead, David; Kameneva, Elena Petrovna; Nartshuk, Emilia; Petersen, Frederik T; Weber, Gisela; Bächli, Gerhard; Geller-Grimm, Fritz; Van de Weyer, Guy; Tschorsnig, Hans-Peter; de Jong, Herman; van Zuijlen, Jan-Willem; Vaňhara, Jaromír; Roháček, Jindřich; Ziegler, Joachim; Majer, József; Hůrka, Karel; Holston, Kevin; Rognes, Knut; Greve-Jensen, Lita; Munari, Lorenzo; de Meyer, Marc; Pollet, Marc; Speight, Martin C D; Ebejer, Martin John; Martinez, Michel; Carles-Tolrá, Miguel; Földvári, Mihály; Chvála, Milan; Barták, Miroslav; Evenhuis, Neal L; Chandler, Peter J; Cerretti, Pierfilippo; Meier, Rudolf; Rozkosny, Rudolf; Prescher, Sabine; Gaimari, Stephen D; Zatwarnicki, Tadeusz; Zeegers, Theo; Dikow, Torsten; Korneyev, Valery A; Richter, Vera Andreevna; Michelsen, Verner; Tanasijtshuk, Vitali N; Mathis, Wayne N; Hubenov, Zdravko; de Jong, Yde

    2015-01-01

    Fauna Europaea provides a public web-service with an index of scientific names (including important synonyms) of all extant multicellular European terrestrial and freshwater animals and their geographical distribution at the level of countries and major islands (east of the Urals and excluding the Caucasus region). The Fauna Europaea project comprises about 230,000 taxonomic names, including 130,000 accepted species and 14,000 accepted subspecies, which is much more than the originally projected number of 100,000 species. Fauna Europaea represents a huge effort by more than 400 contributing taxonomic specialists throughout Europe and is a unique (standard) reference suitable for many user communities in science, government, industry, nature conservation and education. The Diptera-Brachycera is one of the 58 Fauna Europaea major taxonomic groups, and data have been compiled by a network of 55 specialists. Within the two-winged insects (Diptera), the Brachycera constitute a monophyletic group, which is generally given rank of suborder. The Brachycera may be classified into the probably paraphyletic 'lower brachyceran grade' and the monophyletic Eremoneura. The latter contains the Empidoidea, the Apystomyioidea with a single Nearctic species, and the Cyclorrhapha, which in turn is divided into the paraphyletic 'aschizan grade' and the monophyletic Schizophora. The latter is traditionally divided into the paraphyletic 'acalyptrate grade' and the monophyletic Calyptratae. Our knowledge of the European fauna of Diptera-Brachycera varies tremendously among families, from the reasonably well known hoverflies (Syrphidae) to the extremely poorly known scuttle flies (Phoridae). There has been a steady growth in our knowledge of European Diptera for the last two centuries, with no apparent slow down, but there is a shift towards a larger fraction of the new species being found among the families of the nematoceran grade (lower Diptera), which due to a larger number of small

  17. A review of hymenopterous parasitoid guilds attacking Anastrepha spp. and Ceratitis capitata (Diptera: Tephritidae) in Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Ovruski, Sergio M.; Orono, Luis E.; Nunez-Campero, Segundo; Schliserman, Pablo; Albornoz-Medina, Patricia; Bezdjian, Laura P.; Nieuwenhove, Guido A. Van; Martin, Cristina B. [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Tucuman (Argentina). Planta Piloto de Procesos Industriales Microbiologicos y Biotecnologia. Div. Control Biologico de Plagas

    2006-07-01

    This study provides detailed information on the diversity, abundance, guilds, host plant and host fly ranges, distribution, and taxonomic status of hymenopterous parasitoid species associated with Ceratitis capitata (Wiedemann) and Anastrepha spp. (A. fraterculus (Wiedemann) and A. schultzi Blanchard) in Argentina. Moreover, the article also argues future needs regarding the use of some parasitoid species as an alternative tool in fruit fly management programs of the National Fruit Fly Control and Eradication Program (PROCEM-Argentina). Data used for this work were obtained from numerous old and recent published articles on fruit fly parasitoids in Argentina. (author)

  18. Concentrations of Imidacloprid and Olefin-Imidacloprid Metabolite in the Walnut Husk Maggot (Diptera:Tephritidae)

    National Research Council Canada - National Science Library

    Katheryne Nix; Carla Coots; Paris Lambdin; Jerome Grant; David Paulsen; Greg Wiggins; Paul Merten

    2014-01-01

    .... Because imidacloprid has been used successfully against pests of other host plants, we investigated how it would impact larvae of the walnut husk maggot, Rhagoletis suavis (Loew), on black walnuts...

  19. Status of Bactrocera invadens (Diptera: Tephritidae) in Mango-Producing Areas of Arba Minch, Southwestern Ethiopia

    Science.gov (United States)

    Massebo, Fekadu; Tefera, Zenebe

    2015-01-01

    Bactrocera invadens, the Asian fruit fly, was first reported in Kenya in 2003, and it spread fast to most tropical countries in Africa. To our knowledge, there is no detailed data on the fruit damage and status of fruit flies in Arba Minch and elsewhere in Ethiopia. Hence, information on the species composition and pest status of the fruit fly species is urgent to plan management strategies in the area. Fruit flies were captured using male parapheromone-baited traps. Matured mango (Mangifera indica) fruits were collected from randomly selected mango trees and incubated individually in cages (15 by 15 by 15 cm) with sandy soil. B. invadens was the predominant (96%; 952 of 992) captured species and the only fruit fly species emerging from mango fruits incubated in the laboratory. The mean number of adult B. invadens emerging per mango fruit was 35.25, indicating that the species is the most devastating mango fruit fly in the area. The loss due to this species would be serious if no management strategies are implemented. PMID:25612742

  20. A new species of Molynocoelia Giglio-Tos (Diptera: Tephritidae) from Ecuador

    Science.gov (United States)

    Molynocoelia erwini, a new species of fruit fly from Ecuador is described and illustrated. It differs from its previously known congeners in wing pattern (not banded, distal half brown), scutal and scutellar markings, and male femoral setation....

  1. Oviposition deterrents for the Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae) from fly faeces extracts.

    Science.gov (United States)

    Arredondo, J; Díaz-Fleischer, F

    2006-02-01

    After oviposition, females of the Mediterranean fruit fly Ceratitis capitata Wiedemann deposit a host-marking pheromone on the fruit surface that deters oviposition by conspecifics. Methanolic extracts of fruit fly faeces elicit a similar deterrent effect. The results of laboratory and field experiments using raw methanolic extracts of C. capitata faeces as an oviposition deterrent are reported. Laboratory bioassays revealed a significant positive relationship between concentration of faeces and the inhibition of oviposition responses by C. capitata. Treatment of halves of coffee bushes with methanolic extracts containing 0.1, 1.0 and 10 mg faeces ml(-1) resulted in a significant reduction of infestation only at the highest concentration (P=0.03). Treatment of blocks of coffee bushes with an extract of 10 mg faeces ml(-1) resulted in an 84% reduction in infestation by C. capitata in sprayed plants and a 56% reduction in adjacent untreated coffee bushes surrounding treated plots, probably due to the deterrent effect of host-marking pheromone on fly oviposition. We conclude that faeces contain oviposition deterrent substances that effectively reduce fruit infestations by C. capitata, suggesting a clear potential for the use of this infochemical in integrated management programmes targeted at this pest.

  2. [Mating choice of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae): influence of male ageing on mating success].

    Science.gov (United States)

    Silva Neto, Alberto M da; Dias, Vanessa S; Joachim-Bravo, Iara S

    2009-01-01

    The objective of this study was to evaluate the effect of male ageing on male pheromone release and mating success of Ceratitis capitata (Wiedemann). The effects of male ageing on mating were evaluated on five and 21 d-old males by assessing their mating success (males chosen by a female for copulation) and the amount of males releasing the sex pheromone. The mating success was evaluated by using several ratios of young to older males by increasing the number of older males:young males from 1:1 to 5:1. The mating success of the 1:1 ratio was also evaluated in field cages. The evaluation of the mating success (in the 1:1 ratio) showed a clear preference of the females for young males. Sex pheromone emission was much more common on young than older males. Even in cases were older males were more abundant (ratios 2:1 and 3:1), females still chose the young males. However, females could not distinguish young from older males in ratios of 4:1 or 5:1. Our data indicate that the ageing of C. capitata males has a considerable negative effect on their reproductive success, especially if they are found in a proportion any lower than 3:1.

  3. Chilled packing systems for fruit flies (Diptera: Tephritidae) in the sterile insect technique

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez, Emilio; Escobar, Arseny; Bravo, Bigail; Montoya, Pablo [Instituto Interamericano de Cooperacion para la Agricultura (IICA), Chiapas (Mexico); Secretaria de Agricultura, Ganaderia, Desarrollo Rural, Pesca y Alimentacion (SAGARPA), Mexico, D.F. (Mexico). Programa Moscafrut

    2010-07-15

    We evaluated three packing systems (PARC boxes, 'GT' screen towers and 'MX' screen towers) for the emergence and sexual maturation of sterile fruit flies, at three adult fl y densities (1, 1.2 and 1.3 fly/cm 2) and three food types. At the lowest density, results showed no significant differences in the longevity and flight ability of adult Anastrepha ludens (Loew) and Anastrepha obliqua Macquart among the three packing systems. Higher densities resulted in a decrease in these parameters. In the evaluation of the three food types, no significant differences were found either on longevity or flight ability of A. ludens. However, the greatest longevity for both sexes A. obliqua was obtained with commercial powdered Mb and the mix of sugar, protein and corn starch on paper (SPCP) food types. The highest value for flight ability in A. obliqua males was obtained with powdered Mb and SPCP food types, and for females with Mb powdered food. Our data indicated that GT and MX screen tower packing systems are an alternative to the PARC boxes, since they were suitable for adult fl y sexual maturation without any harm to their longevity or flight ability. The tested foods were equivalent in both fruit fl y species, with the exception of the agar type for A. obliqua, which yielded the lowest biological parameters evaluated. Our results contribute to the application of new methods for the packing and release of sterile flies in large-scale programs. (author)

  4. First record of the fruit fly Bactrocera (Bactrocera) nigrofemoralis White & Tsuruta(Diptera: Tephritidae) in Bangladesh

    Science.gov (United States)

    The presence of the fruit fly Bactrocera (Bactrocera) nigrofemoralis White & Tsuruta was recorded in Bangladesh for the first time. B.nigrofemoralis was captured in traps baited with sweet orange oil and cue-lure at the Atomic Energy Research Establishment campus, Ganak bari, Savar, Dhaka, Banglades...

  5. Gut bacterial community structure of two Australian tropical fruit fly species (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Narit Thaochan

    2015-12-01

    Full Text Available The community structure of the alimentary tract bacteria of two Australian fruit fly species, Bactrocera cacuminata (Hering and Bactrocera tryoni (Froggatt, was studied using a molecular cloning method based on the 16S rRNA gene. Differences in the bacterial community structure were shown between the crops and midguts of the two species and sexes of each species. Proteobacteria was the dominant bacterial phylum in the flies, especially bacteria in the order Gammaproteobacteria which was prominent in all clones. The total bacterial community consisted of Proteobacteria (more than 75% of clones, except in the crop of B. cacuminata where more than 50% of clones belonged to Firmicutes. Firmicutes gave the number of the secondary community structure in the fly’s gut. Four orders, Alpha-, Beta-, Delta- and Gammaproteobacteria and the phyla Firmicutes and Actinobacteria were found in both fruit fly species, while the order Epsilonproteobacteria and the phylum Bacteroidetes were found only in B. tryoni. Two phyla, Actinobacteria and Bacteroidetes, were rare and less frequent in the flies. There was a greater diversity of bacteria in the crop of the two fruit fly species than in the midgut. The midgut of B. tryoni females and the midgut of B. cacuminata males had the lowest bacterial diversity.

  6. Pest fruit fly (Diptera: Tephritidae) in northwestern Australia: one species or two?

    Science.gov (United States)

    Cameron, E C; Sved, J A; Gilchrist, A S

    2010-04-01

    Since 1985, a new and serious fruit fly pest has been reported in northwestern Australia. It has been unclear whether this pest was the supposedly benign endemic species, Bactrocera aquilonis, or a recent introduction of the morphologically near-identical Queensland fruit fly, B. tryoni. B. tryoni is a major pest throughout eastern Australia but is isolated from the northwest region by an arid zone. In the present study, we sought to clarify the species status of these new pests using an extensive DNA microsatellite survey across the entire northwest region of Australia. Population differentiation tests and clustering analyses revealed a high degree of homogeneity within the northwest samples, suggesting that just one species is present in the region. That northwestern population showed minimal genetic differentiation from B. tryoni from Queensland (FST=0.015). Since 2000, new outbreaks of this pest fruit fly have occurred to the west of the region, and clustering analysis suggested recurrent migration from the northwest region rather than Queensland. Mitochondrial DNA sequencing also showed no evidence for the existence of a distinct species in the northwest region. We conclude that the new pest fruit fly in the northwest is the endemic population of B. aquilonis but that there is no genetic evidence supporting the separation of B. aquilonis and B. tryoni as distinct species.

  7. Longevity of Mass-Produced Bactrocera tryoni (Diptera: Tephritidae) Held Without Food or Water.

    Science.gov (United States)

    Dominiak, Bernard C; Sundaralingam, Selliah; Jiang, Laura; Nicol, Helen I

    2014-12-01

    The sterile insect technique is used to manage or control fruit flies throughout the world. The technique relies on large scale production before delivery to release managers. As part of the mass production phase, there are many quality control tests to demonstrate and maintain high quality pupae and flies. One highly desirable characteristic is adults with a long life so that these adults can reach sexual maturity and sterile males mate with wild fertile flies in the field and thus produce no viable offspring. Originally longevity was assessed allowing adults to have unlimited access to food and water. As quality and longevity increased, this methodology added significantly to workload and space demands and many facilities moved to testing longevity under stress where no food or water was provided. Here we examined >27,000 Queensland fruit fly Bactrocera tryoni (Froggatt) from 160 weekly production batches from July 2004 to October 2009 where flies were not provided food or water. The mean longevity was 54.4 ± SE hours. Longevity was significantly shorter from August to March, and the longevity was significantly longer in June. Longevity was not related to pupal weight, contrary to expectations. Weights were significantly lower in June and highest in summer. © 2014 Entomological Society of America.

  8. Yeast: An Overlooked Component of Bactrocera tryoni (Diptera: Tephritidae) Larval Gut Microbiota.

    Science.gov (United States)

    Deutscher, Ania T; Reynolds, Olivia L; Chapman, Toni A

    2017-02-01

    Yeasts, often in hydrolyzed form, are key ingredients in the larval and adult diets of tephritid fruit fly colonies. However, very little is known about the presence or role of yeasts in the diets of tephritid fruit flies in nature. Previous studies have identified bacteria but not detected yeasts in the gut of Queensland fruit fly, Bactrocera tryoni (Froggatt), one of Australia's most economically damaging insect pests of horticultural crops and of significant biosecurity concern domestically and internationally. Here we demonstrate that cultivable yeasts are commonly found in the gut of B. tryoni larvae from fruit hosts. Analysis of the ITS1, 5.8S rRNA gene, and ITS2 sequences of randomly selected isolates identified yeasts and yeast-like fungi of the genera Aureobasidium, Candida, Cryptococcus, Hanseniaspora, Pichia, and Starmerella. The prevalence of these yeasts in fruits suggests that larvae consume the yeasts as part of their diet. This work highlights that yeasts should be considered in future tephritid larval gut microbiota studies. Understanding tephritid-microbial symbiont interactions will lead to improvements in artificial diets and the quality of mass-reared tephritids for the sterile insect technique. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Host susceptibility of citrus cultivars to Queensland fruit fly (Diptera: Tephritidae).

    Science.gov (United States)

    Lloyd, A C; Hamacek, E L; Smith, D; Kopittke, R A; Gu, H

    2013-04-01

    Citrus crops are considered to be relatively poor hosts for Queensland fruit fly, Bactrocera tryoni (Froggatt), as for other tephritid species. Australian citrus growers and crop consultants have reported observable differences in susceptibility of different citrus cultivars under commercial growing conditions. In this study we conducted laboratory tests and field surveys to determine susceptibility to B. tryoni of six citrus cultivars [(Eureka lemon (Citrus limon (L.) Osbeck); Navel and Valencia oranges (C. sinensis (L.) Osbeck); and Imperial, Ellendale, and Murcott mandarins (C. reticulata Blanco). The host susceptibility of these citrus cultivars was quantified by a Host Susceptibility Index, which is defined as the number of adult flies produced per gram of fruit infested at a calculated rate of one egg per gram of fruit. The HSI was ranked as Murcott (0.083) > Imperial (0.052) > Navel (0.026) - Ellendale (0.020) > Valencia (0.008) > Eureka (yellow) (0.002) > Eureka (green) (0). Results of the laboratory study were in agreement with the level of field infestation in the four citrus cultivars (Eureka lemon, Imperial, Ellendale, and Murcott mandarins) that were surveyed from commercial orchards under baiting treatments against fruit flies in the Central Burnett district of Queensland. Field surveys of citrus hosts from the habitats not subject to fruit fly management showed that the numbers of fruit flies produced per gram of fruit were much lower, compared with the more susceptible noncitrus hosts, such as guava (Psidium guajava L.), cherry guava (P. littorale Raddi), mulberry (Morus nigra L.), loquat (Eriobotrya japonica (Thunb.) Lindl.), and pear (Pyrus communis L.). Therefore, the major citrus crops commercially cultivated in Australia have a relatively low susceptibility to B. tryoni, with Eureka lemons being a particularly poor host for this tephritid fruit fly.

  10. Raspberry ketone supplement promotes early sexual maturation in male Queensland fruit fly, Bactrocera tryoni (Diptera: Tephritidae).

    Science.gov (United States)

    Akter, Humayra; Mendez, Vivian; Morelli, Renata; Pérez, Jeanneth; Taylor, Phillip W

    2017-08-01

    Raspberry ketone (RK) is highly attractive to sexually mature, but not immature, males of many Bactrocera species, including Queensland fruit fly ('Qfly', Bactrocera tryoni), and acts as a metabolic enhancer in a wide diversity of animals. We considered the possibility that, as a metabolic enhancer, RK in adult diet might accelerate sexual maturation of male Qflies. Recently emerged adult Qfly males (0-24 h old) were exposed to RK-treated food for 48 h and were then provided only sugar and water. Four doses of RK (1.25, 2.5, 3.75 and 5%) along with control (0%) were tested with two types of food: sugar alone and sugar mixed with yeast hydrolysate (3:1). For flies tested when 4-10 days old all RK doses increased mating probability of flies fed sugar mixed with yeast hydrolysate but did not show any effect on mating probability of flies fed only sugar. No effects of RK were found for flies tested when 10-30 days old for either diet group. There was no evidence that RK affected longevity at any of the doses tested. Feeding of RK together with yeast hydrolysate to immature Qfly increases mating propensity at young ages and accordingly shows significant potential as a pre-release supplement that might increase the proportion of released flies that attain sexual maturation in Sterile Insect Technique programmes. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  11. Mitotic and polytene chromosome analyses in the Queensland fruit fly, Bactrocera tryoni (Diptera: Tephritidae).

    Science.gov (United States)

    Zhao, J T; Frommer, M; Sved, J A; Zacharopoulou, A

    1998-08-01

    The Queensland fruit fly, Bactrocera tryoni, like the Mediterranean fruit fly, Ceratitis capitata, has a diploid complement of 12 chromosomes, including five pairs of autosomes and a XX/XY sex chromosome pair. Characteristic features of each chromosome are described. Chromosomal homology between B. tryoni and C. capitata has been determined by comparing chromosome banding pattern and in situ hybridisation of cloned genes to polytene chromosomes. Although the evidence indicates that a number of chromosomal inversions have occurred since the separation of the two species, synteny of the chromosomes appears to have been maintained.

  12. A new species of Anastrepha (Diptera: Tephritidae) from Colombia, Costa Rica and Panama

    Science.gov (United States)

    Anastrepha woodi, new species, is described and illustrated based on specimens from Colombia and Costa Rica. It is compared with A. loewi Stone, the most similar species, which is also redescribed....

  13. Mobility of olive fruit fly (Diptera: Tephritidae) late third instars and teneral adults in test arenas

    Science.gov (United States)

    The mobility of olive fruit fly, Bactrocera oleae (Rossi), late third instars before pupation, teneral adults before flight, and mature adults restricted from flight was studied under mulches in greenhouse cage tests, in horizontal pipes, vertical bottles and pipes filled with sand, and by observati...

  14. Electroantennogram and behavioral responses of Anastrepha suspensa (Diptera: Tephritidae) to putrescine and ammonium bicarbonate lures

    Science.gov (United States)

    At present, the most effective synthetic lures for pest Anastrepha fruit flies are multi-component blends that include an ammonia-emitting substrate and the diamine synergist, putrescine (1,4-diaminobutane). Both chemicals are regarded as protein-feeding cues which result in female-biased attractio...

  15. The Effects of a Modified Hot Water Treatment on Anastrepha ludens (Diptera: Tephritidae)-Infested Mango.

    Science.gov (United States)

    Hernández, Emilio; Aceituno-Medina, Marysol; Toledo, Jorge; Bravo, Bigail; Caro-Corrales, José; Montoya, Pablo; Mangan, Robert

    2017-04-01

    The Mexican fruit fly, Anastrepha ludens (Loew), is a quarantine pest in mango (Mangifera indica L.) that can be controlled by using a hot water treatment (HWT). This treatment is normally followed by a 30-min hydrocooling (HYC) process that reduces the negative effects that the treatment has on fruit quality. However, if hot water-treated fruits are immediately immersed in water at 21 °C, the survival rate of third-instar A. ludens may be increased. The current approved treatment protocol states that if HYC is used, then treated fruit should undergo an additional 10-min HWT or on platform for 30 min before HYC. We aimed to determine the efficacy of HWT without an additional 10-min treatment before being subjected to HYC, while taking into consideration that the most important conditions are the temperature of the fruit core throughout treatment and the type of infestation, either oviposition or inoculation. Two experimental tests were conducted. Our first aim was to determine the effectiveness of HWT followed by HYC using three varieties and different size classes of mangoes ('Ataulfo' 200-375 and 401-570 g; 'Tommy Atkins' 401-500 and 501-700 g; 'Kent' 401-500 g). The four treatment combinations used to test HWT and immediate HYC at 21 °C were 1) HWT, 2) HWT/HYC, 3) HWT + 10 min/HYC, and 4) HWT/30 min on platform/HYC; an independent experiment was used for each variety. The second aim was to validate the HWT/HYC combination by performing confirmatory tests in commercial packing houses. The results showed that as long as the mango core temperature reached 45 °C during the HWT, it was not necessary to add the 10-min treatment to the HWT before HYC at 21 °C was applied. To ensure that the larvae are subjected to the HWT treatment for sufficient time to be lethal, the temperature of the fruit core throughout the treatment must be recorded. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  16. Population dynamics of safflower capsule flies (Diptera: Tephritidae in Kohgiluyeh safflower farms of Iran

    Directory of Open Access Journals (Sweden)

    K. Saeidi

    2015-08-01

    Full Text Available Oilseeds such as flax, canola, safflower, soybean and sunflower, which are annual plants, provide the world’s major source of vegetable oils, although the highest oil yield comes from oil-bearing tree fruits. One of the most popular oil seeds is safflower (Carthamus tinctorius L., which belongs to the Asteraceae family. Due to the ability of this plant to grow in dry and semi-dry conditions, safflower oil has the potential to be a commercially profitable product in Iran. Seasonal populations of safflower capsule flies were studied in Kohgiluyeh safflower farms, Iran, from March to May in 2008 and 2009. Four yellow sticky traps were used to monitor populations of fruit flies in the safflower farms. Traps were checked once a week during the sampling period. The traps were emptied weekly into insect collection vials containing 70% ethanol. Data were analysed with a two-way ANOVA. The relation between abiotic factors and species abundance was analysed with multiple linear regression. The results emphasized that Acanthiophilus helianthi was the most serious pest of safflower under the ecological conditions found in Gachsaran, being present in the field throughout three months of the year (March to May. Chaetorellia carthami was present in safflower fields from March to May, but in significant numbers only during April and May. Terellia luteola was present in safflower fields from March to May and in significant numbers only in late April, it does not seem to be a serious pest in safflower farms under Gachsaran’s ecological conditions.

  17. Fluorescent sperm marking to improve the fight against the pest insect Ceratitis capitata (Wiedemann; Diptera: Tephritidae).

    Science.gov (United States)

    Scolari, Francesca; Schetelig, Marc F; Bertin, Sabrina; Malacrida, Anna R; Gasperi, Giuliano; Wimmer, Ernst A

    2008-06-01

    The Sterile Insect Technique (SIT) involving area-wide release of mass-reared and sterilized pest insects has proven successful to reduce, control and eradicate economically important pest species, such as the Mediterranean fruit fly (medfly). For the efficient application, effective monitoring to assess the number and mating success of the released medflies is essential. Here, we report sperm-specific marking systems based on the spermatogenesis-specific Ceratitis capitata beta2-tubulin (Ccbeta2t) promoter. Fluorescent sperm can be isolated from testes or spermathecae. The marking does not cause general disadvantages in preliminary laboratory competitiveness assays. Therefore, transgenic sperm marking could serve as a major improvement for monitoring medfly SIT programs. The use of such harmless transgenic markers will serve as an ideal initial condition to transfer insect transgenesis technology from the laboratory to field applications. Moreover, effective and easily recognizable sperm marking will make novel studies possible on medfly reproductive biology which will help to further improve SIT programs.

  18. The Effect of Ginger Oil on the Sexual Performance of Anastrepha Males (Diptera: Tephritidae)

    National Research Council Canada - National Science Library

    Salvador Flores; J. Pedro Rivera; Emilio Hernandez; Pablo Montoya

    2011-01-01

    .... In this study, we evaluated the effect of ginger oil treatment on the sexual performance of males of 3 Anastrepha fruit fly species of economic importance (A. ludens (Loew), A. obliqua (Macquart), and A. serpentina (Wiedemann...

  19. Sexual behavior of mutant strains of the medfly Ceratitis capitata (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    R.D Briceño

    2003-09-01

    Full Text Available Males of the mutant strains (blind, vestigal-winged of the Mediterranean fruit fly (medfly, Ceratits capitata (Wiedmann showed differences in behavior compared with control (mass-reared males. Mutant males made fewer mating attempts and achieved fewer matings than control males. Vestigal-winged females copulated less frequently with both mutants. Blind males climbed rather than jumped onto females and copulated in very low numbers compared with control and vestigal males. Blind females copulated normally with control, males and in very low numbers with both types of mutant malesMachos mutantes (ciegos, alas vestigiales de la mosca del mediterráneo Ceratitis capitata (Wiedmann mostraron diferencias en conducta comparados con los machos testigo (cría masiva. Los machos mutantes, realizaron menos intentos por aparearse y lograron menos apareamientos que los machos testigo. Las hembras con alas vestigiales, copularon menos con ambas clases de mutantes. Los machos ciegos, subieron en lugar de saltar sobre las hembras y copularon en números muy bajos comparados con los machos testigo y con los de alas vestigiales. Las hembras ciegas, copularon de forma normal con los machos testigo y en números muy bajos con ambos tipos de machos mutantes

  20. Phylogeographic patterns of host-race evolution in Tephritis conura (Diptera: Tephritidae).

    Science.gov (United States)

    Diegisser, Thorsten; Seitz, Alfred; Johannesen, Jes

    2006-03-01

    Host-race evolution is a prime candidate for sympatric speciation because host shifts must take place in the presence of both hosts. However, the geographic context in which the shift takes place may have strong allopatric or peripatric components if the primary host within a localized area is scarce or even goes extinct. Inference of the relative importance of the geographic mode of speciation may be gained from phylogeographic imprints. Here, we investigate the phylogeography of host races of the tephritid fly Tephritis conura from sympatric, parapatric and allopatric populations of Cirsium heterophyllum and Cirsium oleraceum (Asteraceae) in Europe, for addressing the age and direction, and the geographic context of host-race formation. Haplotype networks of the host races differed significantly in molecular diversity and topology. However, host-race haplotypes were nested within the same network, with a central haplotype H1 being the most common haplotype in both host races. C. heterophyllum flies were genetically more diverse and substructured than flies from C. oleraceum, suggesting that the latter is the derived race. The phylogeographic imprint indicates either that C. heterophyllum flies colonized C. oleraceum during range expansion or that heterophyllum flies went extinct in an area where oleraceum flies persisted (followed by re-immigration). These imprints are in concordance with peripatric diversification, probably in the European Alps and related to the last ice age, where the host-race diversification was largely completed before the postglacial range expansion on C. oleraceum to current areas of sympatry and parapatry with C. heterophyllum.

  1. Effect of dietary components on larval life history characteristics in the medfly (Ceratitis capitata: Diptera, Tephritidae.

    Directory of Open Access Journals (Sweden)

    William J Nash

    Full Text Available BACKGROUND: The ability to respond to heterogenous nutritional resources is an important factor in the adaptive radiation of insects such as the highly polyphagous Medfly. Here we examined the breadth of the Medfly's capacity to respond to different developmental conditions, by experimentally altering diet components as a proxy for host quality and novelty. METHODOLOGY/PRINCIPAL FINDINGS: We tested responses of larval life history to diets containing protein and carbohydrate components found in and outside the natural host range of this species. A 40% reduction in the quantity of protein caused a significant increase in egg to adult mortality by 26.5%±6% in comparison to the standard baseline diet. Proteins and carbohydrates had differential effects on larval versus pupal development and survival. Addition of a novel protein source, casein (i.e. milk protein, to the diet increased larval mortality by 19.4%±3% and also lengthened the duration of larval development by 1.93±0.5 days in comparison to the standard diet. Alteration of dietary carbohydrate, by replacing the baseline starch with simple sugars, increased mortality specifically within the pupal stage (by 28.2%±8% and 26.2%±9% for glucose and maltose diets, respectively. Development in the presence of the novel carbohydrate lactose (milk sugar was successful, though on this diet there was a decrease of 29.8±1.6 µg in mean pupal weight in comparison to pupae reared on the baseline diet. CONCLUSIONS: The results confirm that laboratory reared Medfly retain the ability to survive development through a wide range of fluctuations in the nutritional environment. We highlight new facets of the responses of different stages of holometabolous life histories to key dietary components. The results are relevant to colonisation scenarios and key to the biology of this highly invasive species.

  2. Transgenic sexing system for Ceratitis capitata (Diptera: Tephritidae) based on female-specific embryonic lethality

    Science.gov (United States)

    Fruit fly pest species have been successfully controlled and managed via the Sterile Insect Technique (SIT), a control strategy that uses infertile matings of sterile males to wild females to reduce pest populations. Biological efficiency in the field is higher if only sterile males are released in...

  3. Seasonal occurrence of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann, 1824 (Diptera: Tephritidae in southern Syria

    Directory of Open Access Journals (Sweden)

    Mansour Mohammed

    2016-09-01

    Full Text Available Population fluctuations of the Mediterranean fruit fly (medfly, Ceratitis capitata, were investigated between 1999 and 2001 at several locations representing fruit production areas in the southern part of Syria (Damascus Ghota, Zabadani, Sargaiah, Rankus, Orneh and Ain Al-Arab. Medfly adults were monitored weekly all year around using Jackson traps baited with trimedlure dispensers. Larvae were also sampled in Damascus Ghota by collecting fruits from ripe or ripening fruit trees and recording the number of larvae emerged from these fruits. In addition, suspected overwintering refuges were sampled at weekly intervals during the three coldest months of the year (December – February and the number of collected larvae was recorded. The results of trap catches and fruit sampling studies showed a similar pattern of occurrence of medfly populations in the study areas, particularly in Damascus Ghota, during the three years of the study. In Damascus Ghota, flies were caught continuously from early June to late December with some variability between years. Two distinct periods of high fly activity were observed: the first one occurred in August and the second in November with a much higher amplitude. In general, seasonal fluctuations in the pattern of occurrence were influenced by differences in temperature and abundance of preferred host fruits. Traps on fig Ficus carica and oriental persimmon Diospyros kaki trees caught the highest numbers of flies, and fruits collected from these trees showed the highest level of infestation, reaching 100% for fig fruit late in the season. Sampling fruits (in Damascus Ghota from trees during the three coldest months of the year showed that a small population of medfly larvae was able to survive winter conditions in prickly pear Opuntia vulgaris fruit left on the trees. In the other areas of the study (Zabadani, Sargaiah, Rankus, Orneh and Ain Al-Arab, only a few flies were caught.

  4. Oviposition preference hierarchy in Ceratitis capitata (Diptera, Tephritidae: influence of female age and experience

    Directory of Open Access Journals (Sweden)

    Joachim-Bravo Iara S.

    2001-01-01

    Full Text Available The influence of two factors, age and previous experience, on the oviposition hierarchy preference of Ceratitis capitata (Wiedemann, 1824 females was studied. Two populations were analyzed: one reared in laboratory during 17 years and the other captured in nature. In the first experiment the oviposition preference for four fruits, papaya, orange, banana and apple was tested at the beginning of oviposition period and 20 days past. The results showed that the wild females as much the laboratory ones had an oviposition preference hierarchy at the beginning of peak period of oviposition. However this hierarchic preference disappeared in a later phase of life. In the second experiment the females were previously exposed to fruits of different hierarchic positions and afterwards their choice was tested in respect to the oviposition preference for those fruits. The results showed that there was an influence of the previous experience on the posterior choice of fruits to oviposition when the females were exposed to fruits of lower hierarchic position.

  5. Export of commercial 'Hass' avocados from Argentina poses negligible risk of ceratitis capitata (Diptera: Tephritidae) infestation

    Science.gov (United States)

    Quarantine restrictions due to the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), prevent Argentina from exporting avocados, Persea americana Miller, cv. Hass, to certain countries. Hass avocado at the hard, mature green stage is potentially a conditional nonhost for C. capitata, which cou...

  6. Efficacy of wax matrix bait stations for Mediterranean Fruit Flies (Diptera: Tephritidae)

    Science.gov (United States)

    Tests were conducted that evaluated efficacy of wax matrix bait stations for Ceratitis capitata (Wiedemann) adults in Guatemala. Bait stations were exposed to outdoor conditions to determine effect of weathering on longevity as indicated by bait station age. Results of laboratory tests found that ba...

  7. Seasonal occurrence of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae) in southern Syria

    National Research Council Canada - National Science Library

    Mohammed Mansour; Fater Mohamad

    2016-01-01

      Population fluctuations of the Mediterranean fruit fly (medfly), [Ceratitis capitata], were investigated between 1999 and 2001 at several locations representing fruit production areas in the southern part of Syria...

  8. Global Assessment of Seasonal Potential Distribution of Mediterranean Fruit Fly, Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    Szyniszewska, Anna M.; Tatem, Andrew J.

    2014-01-01

    The Mediterranean fruit fly (Medfly) is one of the world's most economically damaging pests. It displays highly seasonal population dynamics, and the environmental conditions suitable for its abundance are not constant throughout the year in most places. An extensive literature search was performed to obtain the most comprehensive data on the historical and contemporary spatio-temporal occurrence of the pest globally. The database constructed contained 2328 unique geo-located entries on Medfly detection sites from 43 countries and nearly 500 unique localities, as well as information on hosts, life stages and capture method. Of these, 125 localities had information on the month when Medfly was recorded and these data were complemented by additional material found in comprehensive databases available online. Records from 1980 until present were used for medfly environmental niche modeling. Maximum Entropy Algorithm (MaxEnt) and a set of seasonally varying environmental covariates were used to predict the fundamental niche of the Medfly on a global scale. Three seasonal maps were also produced: January-April, May-August and September-December. Models performed significantly better than random achieving high accuracy scores, indicating a good discrimination of suitable versus unsuitable areas for the presence of the species. PMID:25375649

  9. Seasonality of the Mediterranean Fruit Fly (Diptera: Tephritidae) on Terceira and Sao Jorge Islands, Azores, Portugal

    Science.gov (United States)

    Lopes, D.J.H.; Mexia, A.M.M.; Mumford, J.D.

    2017-01-01

    Population dynamics studies are very important for any area-wide control program as they provide detailed knowledge about the relationship of Medfly [Ceratitis capitata (Wiedemann)] life cycle with host availability and abundance. The main goal of this study is to analyse seasonality of C. capitata in Terceira and Sao Jorge Islands (Azores archipelago) using field and laboratory data collected during (2010–2014) CABMEDMAC (MAC/3/A163) project. The results from Sao Jorge Island indicate significantly lower male/female ratio than on Terceira Island. This is an important finding specially regarding when stablishing the scenario parameters for a sterile insect technique application in each island. The population dynamics of C. capitata are generally linked with host fruit availability and abundance. However, on Terceira Island fruit infestation levels are not synchronized with the trap counts. For example, there was Medfly infestations in some fruits [e.g., Solanum mauritianum (Scop.)] while in the nearby traps there were no captures at the same time. From this perspective, it is important to denote the importance of wild invasive plants, on the population dynamics of C. capitata, as well important to consider the possibility of having different densities of traps according to the characteristics of each area in order to improve the network of traps surveillance’s sensitivity on Terceira Island. PMID:28082349

  10. Exposure to tea tree oil enhances the mating success of male Mediterranean fruit flies (Diptera: Tephritidae)

    Science.gov (United States)

    The aroma of various plant essential oils has been shown to enhance the mating competitiveness of males of the Mediterranean fruit fly (medfly), Ceratitis capitata (Wiedemann). Laboratory observations revealed that male medflies show strong short-range attraction to tea tree oil (TTO hereafter) deri...

  11. Nonhost status of mangosteen to Bactrocera dorsalis and Bactrocera carambolae (Diptera:Tephritidae) in Thailand

    Science.gov (United States)

    Postharvest quarantine treatments (irradiation or vapor heat) are used to control fruit flies and other pests in mangosteen (Garcinia mangostana L) exported to the United States and Japan from Thailand. No-choice tests were conducted in the laboratory to determine whether Thai mangosteen is a host f...

  12. IMPROVING MASS REARING TECHNOLOGY FOR SOUTH AMERICAN FRUIT FLY (DIPTERA:TEPHRITIDAE

    Directory of Open Access Journals (Sweden)

    Raimundo Braga Sobrinho

    2006-01-01

    Full Text Available Studies on availability of suitable and economic diets for adults and larvae of the South American fruit fly Anastrepha fraterculus (Wiedemann, 1830 were carried out at the Entomology Unit of the FAO/IAEA Agriculture and Biotechnology Laboratories in Seibersdorf, Austria with the aim to find the best diets to fit in a large scale mass rearing production. The best diet for adult was the combination of Hydrolysate Corn Protein + Yeast Hydrolysate Enzymatic + Sugar (3:1:3. This diet resulted in the highest numbers of egg/female/day, spermatozoid in the spermathecae, percentages of egg hatch, the lowest mortality rate of adults and the highest average mating duration compared with the standard adult diet based on Yeast Hydrolysate Enzymatic + Sugar (1:3. Among eleven larval diets tested, diets based on sugarcane and sugarbeet bagases plus 7% brewer yeast, 8% sugar, 0.2% sodium benzoate, 0.8% of hydrochloric acid and 60% water (adjusted, yielded the highest percentages of egg hatching, pupal recovery, pupal weight and adult emergence. There was no statistical difference with the standard larval diet based on wheat germ 3%, corncob 15%, corn flower 8%, brewer yeast 6%, sugar 8%, sodium benzoate 0.23%, hydrochloric acid 0.63%, nipagin 0.14% and water 59% (adjusted. The significant performance of these adult and larval diets open discussion for future researches on improvement of rearing techniques required for the establishment of sterile insect technique (SIT program focused on the South American fruit fly.

  13. Monitoring and application of reduced-risk pesticides for managing Anastrepha suspensa (Diptera: Tephritidae)

    Science.gov (United States)

    Tropical guava, Psidium guajava, is an important fruit crop that is rich in several nutrients including vitamin C. In the U. S. it is commonly cultivated in southern Florida, Texas and California. Caribbean fruit fly, Anastrepha suspensa Loew, is a key pest of tropical guava, causing significant yie...

  14. Influence of quantities of brewer yeast on the performance of Anastrepha obliqua wild females (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Cresoni-Pereira Carla

    2001-01-01

    Full Text Available Using artificial solid diets, experiments were performed with Anastrepha obliqua (Macquart, 1835 wild females in order to verify the influence of different quantities of brewer yeast on the performance and compensation behavior to unbalanced diets ingestion. The observed parameters were egg production, ingestion, diet efficiency and survival in the reproductive phase. Results indicated that there was no compensatory ingestion to different quantities of yeast and that the diet with 12.5g of yeast provided the best performance. The absence of compensatory ingestion is discussed based on the yeast phagostimulation and on the costs involved in solid diets ingestion. The relation between the analyzed parameters and the protein quantities in the diet were discussed.

  15. Diversité des espèces de mouches des fruits (Diptera : Tephritidae ...

    African Journals Online (AJOL)

    L'espèce invasive Bactrocera invadens Drew Tsuruta & White est la plus abondante dans les pièges (66,55% des captures), suivie de Dacus punctatifrons (Karsch) (29,92% des captures). La troisième espèce par ordre d'importance est Ceratitis cosyra (Walker) (3,38% des captures). Six autres espèces sont présentes mais ...

  16. A liquid larval diet for rearing Bactrocera invadens and Ceratitis fasciventris (Diptera:Tephritidae)

    Science.gov (United States)

    Bactrocera invadens Drew, Tsuruta & White and Ceratitis fasciventris (Bezzi) are the major fruit fly pests of fruits and vegetables in Africa. The effects of two types of larval diet, liquid and solid (carrot based), on various quality control parameters (pupal recovery, pupal weight, adult emergenc...

  17. Susceptibility of olive fruit fly, Bactrocera oleae (Diptera: Tephritidae pupae to entomopathogenic nematodes

    Directory of Open Access Journals (Sweden)

    Torrini Giulia

    2017-09-01

    Full Text Available The olive fruit fly Bactrocera oleae is one of the most serious and economically damaging insects worldwide, affecting the quality and quantity of both olive oil and table olives. Laboratory bioassays were conducted for the first time to evaluate the susceptibility of B. oleae pupae to two entomopathogenic nematodes (EPN species, Steinernema carpocapsae and Heterorhabditis bacteriophora. The nematodes tested caused pupal mortality of 62.5% and 40.6%, respectively. The most noteworthy result was obtained with S. carpocapsae which was able to infect 21.9% of the emerged adults. Since this tephritid fly spent several months in the soil as pupa, the use of EPNs could be a promising method to control this pest.

  18. The gene transformer of anastrepha fruit flies (Diptera, tephritidae and its evolution in insects.

    Directory of Open Access Journals (Sweden)

    María Fernanda Ruiz

    Full Text Available In the tephritids Ceratitis capitata and Bactrocera oleae, the gene transformer acts as the memory device for sex determination, via an auto-regulatory function; and functional Tra protein is produced only in females. This paper investigates the evolution of the gene tra, which was characterised in twelve tephritid species belonging to the less extensively analysed genus Anastrepha. Our study provided the following major conclusions. Firstly, the memory device mechanism used by this gene in sex determination in tephritids likely existed in the common ancestor of the Ceratitis, Bactrocera and Anastrepha phylogenetic lineages. This mechanism would represent the ancestral state with respect to the extant cascade seen in the more evolved Drosophila lineage. Secondly, Transformer2-specific binding intronic splicing silencer sites were found in the splicing regulatory region of transformer but not in doublesex pre-mRNAs in these tephritids. Thus, these sites probably provide the discriminating feature for the putative dual splicing activity of the Tra-Tra2 complex in tephritids. It acts as a splicing activator in dsx pre-mRNA splicing (its binding to the female-specific exon promotes the inclusion of this exon into the mature mRNA, and as a splicing inhibitor in tra pre-mRNA splicing (its binding to the male-specific exons prevents the inclusion of these exons into the mature mRNA. Further, a highly conserved region was found in the specific amino-terminal region of the tephritid Tra protein that might be involved in Tra auto-regulatory function and hence in its repressive splicing behaviour. Finally, the Tra proteins conserved the SR dipeptides, which are essential for Tra functionality.

  19. POTENTIAL OF TURMERIC EXTRACT AND ITS FRACTIONS TO CONTROL PEACH FRUIT FLY (DIPTERA: TEPHRITIDAE

    Directory of Open Access Journals (Sweden)

    Muhammad Rizwan Riaz

    2015-12-01

    Full Text Available ABSTRACT Potential of turmeric extract and its chemical fractions were evaluated to control the infestation of Bactrocera zonata peach fruit fly in a mortality-based bioassay. The turmeric extract (TE was taken on Soxhelt's extraction apparatus and chemically fractioned by thin layer followed by column chromatography into 6 fractions (F1 ...F6. Fifty pairs of the flies were fed in cages with 250 and 500 ppm TE and its fractions separately for 20 days along with flies fed on untreated diet to serve as control. The toxicity of TE and each of its fractions was evaluated by calculating percent mortality of fly population after every 5th day in 4 consecutive intervals. Mortality of fly population was observed to be positively correlated with increasing concentrations of TE and its fractions in diet. The mortality of flies fed at 250 and 500 ppm TE was significantly higher at 44.17 and 66.33% compared to 28.88% in control. Percent mortality was much higher in case of flies fed with fractions F1, F3 and F6 i.e. 72.22, 50.00 and 48.76 respectively. Maximum rise of mortality was observed at the end of 3rd interval; in case of flies fed at 500 ppm TE, 52.45 percent mortality was observed at the end of 3rd interval; highest mortality was caused by fraction F1, 51.39% in case of flies fed at 250 ppm and 70.37% in case of those fed at 500 ppm.

  20. Populations of Bactrocera oleae (Diptera: Tephritidae) and Its Parasitoids in Himalayan Asia

    Science.gov (United States)

    For a biological control program against olive fruit fly, Bactrocera oleae Rossi, olives were collected in the Himalayan foothills (China, Nepal, India, and Pakistan) to discover new natural enemies. Wild olives, Olea europaea ssp. cuspidata (Wall ex. G. Don), were sparsely distributed and fly-infes...

  1. Description of a new species and record of Bactrocera Macquart (Diptera,Tephritidae) from China.

    Science.gov (United States)

    Zhou, Li-bing; Chen, Xiao-lin; Deng, Yu-liang; Wang, Shao-jun

    2013-01-01

    One new species, Bactrocera (Zeugodacus) anala Chen et Zhou, sp.nov, and one newly recorded species, B. (Z.) armillata (Hering, 1938), from China are described and illustrated. The male of B. (Z.) armillata (Hering) was discovered for the first time and as a result the species is moved from subgenus Bactrocera to subgenus Zeugodacus. In addition, the morphological differences and comparing illustrations of B. (Z.) adusta (Wang et Zhao) and B. (Z.) biguttata (Bezzi), are provided.

  2. Isolation and Molecular Characterization of the Transformer Gene From Bactrocera cucurbitae (Diptera: Tephritidae).

    Science.gov (United States)

    Luo, Ya; Zhao, Santao; Li, Jiahui; Li, Peizheng; Yan, Rihui

    2017-01-01

    transformer (tra) is a switch gene of sex determination in many insects, particularly in Dipterans. However, the sex determination pathway in Bactrocera cucurbitae (Coquillett), a very destructive pest on earth, remains largely uncharacterized. In this study, we have isolated and characterized one female-specific and two male-specific transcripts of the tra gene (Bcutra) of B. cucurbitae. The genomic structure of Bcutra has been determined and the presence of multiple conserved Transformer (TRA)/TRA-2 binding sites in Bcutra has been found. BcuTRA is highly conservative with its homologues in other tephritid fruit flies. Gene expression analysis of Bcutra at different developmental stages demonstrates that the female transcript of Bcutra appears earlier than the male counterparts, indicating that the maternal TRA is inherited in eggs and might play a role in the regulation of TRA expression. The conservation of protein sequence and sex-specific splicing of Bcutra and its expression patterns during development suggest that Bcutra is probably the master gene of sex determination of B. cucurbitae. Isolation of Bcutra will facilitate the development of a genetic sexing strain for its biological control. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.

  3. Novel toxicity of Bacillus thuringiensis strains against the melon fruit fly, Bactrocera cucurbitae (Diptera: Tephritidae).

    Science.gov (United States)

    Shishir, Md Asaduzzaman; Akter, Asma; Bodiuzzaman, Md; Hossain, M Aftab; Alam, Md Musfiqul; Khan, Shakil Ahmed; Khan, Shakila Nargis; Hoq, M Mozammel

    2015-01-01

    Bactrocera cucurbitae (melon fruit fly) is one of the most detrimental vegetable-damaging pests in Bangladesh. The toxicity of Bacillus thuringiensis (Bt) has been reported against a few genera of Bactrocera in addition to numerous other insect species. Bt strains, harbouring cry1A-type genes were, therefore, assayed in vivo against the 3(rd) instar larvae of B. cucurbitae in this study. The biotype-based prevalence of cry1 and cry1A genes was calculated to be 30.8% and 11.16%, respectively, of the test strains (n=224) while their prevalence was greatest in biotype kurstaki. Though three indigenous Bt strains from biotype kurstaki with close genetic relationship exhibited higher toxicity, maximum mortalities were recorded for Btk HD-73 (96%) and the indigenous Bt JSc1 (93%). LC50 and LC99 values were determined to be 6.81 and 8.32 for Bt JSc1, 7.30 and 7.92 for Bt SSc2, and 6.99 and 7.67 for Btk HD-73, respectively. The cause of toxicity and its variation among the strains was found to be correlated with the synergistic toxic effects of cry1, cry2, cry3 and cry9 gene products, i.e. relevant Cry proteins. The novel toxicity of the B. thuringiensis strains against B. cucurbitae revealed in the present study thus will help in developing efficient and eco-friendly control measures such as Bt biopesticides and transgenic Bt cucurbits.

  4. Gamma Irradiation as a Phytosanitary Treatment of Bactrocera tau (Diptera: Tephritidae) in Pumpkin Fruits.

    Science.gov (United States)

    Guoping, Zhan; Lili, Ren; Ying, Shao; Qiaoling, Wang; Daojian, Yu; Yuejin, Wang; Tianxiu, Li

    2015-02-01

    The fruit fly Bactrocera tau (Walker) is an important quarantine pest that damages fruits and vegetables throughout Asian regions. Host commodities shipped from infested areas should undergo phytosanitary measures to reduce the risk of shipping viable flies. The dose-response tests with 1-d-old eggs and 3-, 5-, 7-, 8-d-old larvae were initiated to determine the most resistant stages in fruits, and the minimum dose for 99.9968% prevention of adult eclosion at 95% confidence level was validated in the confirmatory tests. The results showed that 1) the pupariation rate was not affected by gamma radiation except for eggs and first instars, while the percent of eclosion was reduced significantly in all instars at all radiation dose; 2) the tolerance to radiation increased with increasing age and developmental stage; 3) the estimated dose to 99.9968% preventing adult eclosion from late third instars was 70.9 Gy (95% CL: 65.6-78.2, probit model) and 71.8 Gy (95% CL: 63.0-87.3, logit model); and iv) in total, 107,135 late third instars cage infested in pumpkin fruits were irradiated at the target dose of 70 Gy (62.5-85.0, Gy measured), which resulted in no adult emergence in the two confirmatory tests. Therefore, a minimum dose of 85 and 72 Gy, which could prevent adult emergence at the efficacy of 99.9972 and 99.9938% at the 95% confidence level, respectively, can be recommended as a minimum dose for phytosanitary treatment of B. tau in any host fruits and vegetables under ambient atmospheres. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. Population Susceptibility to Insecticides and the Development of Resistance in Bactrocera cucurbitae (Diptera: Tephritidae).

    Science.gov (United States)

    Jin, Tao; Lin, Yu-Ying; Jin, Qi-An; Wen, Hai-Bo; Peng, Zheng-Qiang

    2016-04-01

    Excessive insecticide applications are commonly used to manage Bactrocera cucurbitae Coquillett in China. Resistance status, resistance development trends, and patterns of cross-resistance to insecticides in B. cucurbitae were investigated. Among 21 populations from Hainan Island, two populations expressed high resistance to beta-cypermethrin; seven, eight, and ten populations expressed intermediate resistance to spinosad, avermectin, and beta-cypermethrin, respectively; four, six, one, five, and four populations expressed low resistance to spinosad, avermectin, trichlorfon, beta-cypermethrin, and fipronil, respectively; and the remaining populations exhibited either minor resistance or remained susceptible. Analysis of the development of resistance showed that resistance levels to spinosad and avermectin were readily developed at 40.68- and 18.42-fold, respectively, and a spinosad-resistant strain also showed relative positive cross-resistance to beta-cypermethrin and avermectin, but relative negative cross-resistance to trichlorfon and fipronil. These data represent the most extensive survey of insecticide resistance conducted in B. cucurbitae to date, and the level of insecticide resistance in populations should be considered when designing control measures and pest management strategies.

  6. Male Fruit Fly, Bactrocera tau (Diptera; Tephritidae) attractants from Elsholtzia pubescens Bth

    NARCIS (Netherlands)

    Hasyim, A.; Muryati,; Mizu Istianto,; Kogel, de W.J.

    2007-01-01

    Studies on the ability of different plant extracts to attract male fruit flies indicated that an extract of Elsholtzia pubescens attracted male Bactrocera tau fruit flies in Passion fruit orchards in West Sumatra, Indonesia. Analyses of the plant extract showed that the major compound present was

  7. Ketertarikan Bactrocera carambolae (Diptera: Tephritidae pada Senyawa Volatil Olahan Limbah Kakao

    Directory of Open Access Journals (Sweden)

    Dyah Rini Indriyanti

    2013-03-01

    Full Text Available Tanaman kakao (Theobroma cacao menghasilkan biji. Biji ditutupi oleh pulp pada saat dipanen, kemudian difermentasi selama tiga hari untuk diambil biji kakao dan dihasilkan limbah cair. Penelitian ini bertujuan untuk menguji ketertarikan lalat buah pada olahan limbah kakao dan mengidentifikasi senyawa kimia volatil yang menarik lalat buah. Penelitian dilakukan di laboratorium, dimulai dari pengolahan limbah kakao, pengujian ketertarikan B. carambolae pada limbah dan mengidentifikasi senyawa volatil olahan limbah kakao. Hasil penelitian menunjukkan bahwa jantan dan betina B. carambolae tertarik pada limbah. Olahan limbah kakao berisi berbagai senyawa volatil yakni: amonia; etil-2-hidroksi propanoat ; 7-dodesenil asetat; senyawa asetamida; 3,5-dihidroksi-2-metil-5,6-dihidropiran; hidroksi metilfurfurol; dan derivat-1-undekuna.The cocoa plants (Theobroma cacao produce seeds. The seeds are covered by pulp when it is harvested. Then these seeds were fermented for three days to transform them becoming cocoa seeds and the fermentation would produce liquid wastes. The study aims to test the attractiveness of fruit flies to the processed liquid cocoa wastes and to identify the chemical compounds which attract fruit flies. The study was conducted in the laboratory, beginning from the processing of cocoa wastes, the testing of the attractiveness of B. carambolae to wastes and to identify the chemical compounds of the processed cocoa wastes. The result showed that males and females B. carambolae were attracted to the wastes.The processed cocoa wastes contain various chemical compounds, i.e. ammonia; ethyl-2-hydroxy propanoate; 7-dodecenyl acetate; acetamide compounds; 3,5 dihydroxy-2-methyl-5,6-dihydropyrane; hydroxyl methylfurfurol; and 1-undecyne derivates.

  8. Kunci identifikasi lalat buah (Diptera: Tephritidae) di Kabupaten Bogor dan sekitarnya

    OpenAIRE

    Anik Larasati; Purnama Hidayat; Damayanti Buchori

    2016-01-01

    Identification key was developed for 18 species of fruit flies (Bactocera spp.) found in Bogor district. Morphological characters were used as background information for key development: 2 genus and 4 subgenus were identified in the process. Fruit fly species in this identification was Bactrocera (Bactrocera) albistrigata de meijere, Bactrocera (Bactrocera) carambolae Drew & Hancock, Bactrocera (Bactrocera) caudata Fabricus, Bactrocera (Bactrocera) latifrons White & Liquido, Bactrocer...

  9. Kunci identifikasi lalat buah (Diptera: Tephritidae di Kabupaten Bogor dan sekitarnya

    Directory of Open Access Journals (Sweden)

    Anik Larasati

    2016-12-01

    Full Text Available Identification key was developed for 18 species of fruit flies (Bactocera spp. found in Bogor district. Morphological characters were used as background information for key development: 2 genus and 4 subgenus were identified in the process. Fruit fly species in this identification was Bactrocera (Bactrocera albistrigata de meijere, Bactrocera (Bactrocera carambolae Drew & Hancock, Bactrocera (Bactrocera caudata Fabricus, Bactrocera (Bactrocera latifrons White & Liquido, Bactrocera (Bactrocera limbifera Bezzi, Bactrocera (Bactrocera melastomatos Drew & Hancock, Bactrocera (Bactrocera moluccensis Perkins, Bactrocera (Bactrocera occipitalis Drew & Hancock, Bactrocera (Bactrocera papayae Drew & Hancock, Bactrocera (Bactrocera tau Walker, Bactrocera (Bactrocera umbrosa Fabricius, Bactrocera (Bactrocera usitata Drew & Hancock, Bactrocera (Bactrocera verbascifoliae Drew & Hancock, Bactrocera (Bactrocera vulta Hardy, Bactrocera (Bulladacus mcgregori Bezzi, Bactrocera (Zeugodacus calumniata Hardy, Bactrocera (Bactrocera cucurbitae Coquillet, Dacus (Callantra longicornis Wiedemann. Preparation of identification keys were done by created a matrix of characters, through comparing several characters such as face spot, lateral postsutural vittae, the color of the legs, wide and narrow costal band, medial longitudinal band, as well as the lateral margin of terga III to V.

  10. Kunci Identifikasi Lalat Buah (Diptera: Tephritidae) Di Kabupaten Bogor Dan Sekitarnya

    OpenAIRE

    Larasati, Anik; Hidayat, Purnama; Buchori, Damayanti

    2016-01-01

    Identification key was developed for 18 species of fruit flies (Bactocera spp.) found in Bogor district. Morphological characters were used as background information for key development: 2 genus and 4 subgenus were identified in the process. Fruit fly species in this identification was Bactrocera (Bactrocera) albistrigata de meijere, Bactrocera (Bactrocera) carambolae Drew & Hancock, Bactrocera (Bactrocera) caudata Fabricus, Bactrocera (Bactrocera) latifrons White & Liquido, Bactrocer...

  11. Effect of Low-Temperature Phosphine Fumigation on the Survival of Bactrocera correcta (Diptera: Tephritidae).

    Science.gov (United States)

    Liu, Tao; Li, Li; Zhang, Fanhua; Gong, Shaorun; Li, Tianxiu; Zhan, Guoping; Wang, Yuejin

    2015-08-01

    This laboratory-based study examined the effects of low-temperature phosphine fumigation on the survival of the eggs and larvae of the guava fruit fly, Bactrocera correcta (Bezzi). Individual flies at different developmental stages, from 6-h-old eggs to third instars, were exposed to 0.92 mg/liter phosphine for 1-7 d at 5°C. We found that 12-h-old eggs and third instars were the most tolerant to phosphine. Increasing phosphine concentrations from 0.46 to 4.56 mg/liter increased mortality in these two stages. However, increased exposure times were required to achieve equal mortality rates in 12-h-old eggs and third instars when phosphine concentrations were ≥4.56 and ≥3.65 mg/liter, respectively. C(n)t = k expression was obtained at 50, 90, and 99% mortality levels, and the toxicity index (n) ranged from 0.43 to 0.77 for the two stages. The synergistic effects of a controlled atmosphere (CA) with elevated CO(2) levels were also investigated, and we found that a CO(2) concentration between 10% and 15% under CA conditions was optimal for low-temperature phosphine fumigation. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Esther Lantero

    2017-07-01

    Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

  13. Keanekaragaman dan persebaran lalat buah Tribe Dacini (Diptera: Tephritidae di Kabupaten Bogor dan sekitarnya

    Directory of Open Access Journals (Sweden)

    Anik Larasati

    2015-09-01

    Full Text Available Bogor and its surrounding area is known as one of the region in West Java that has high diversity of horticultural plants that may have an affect on fruit fly diversity. Research on fruit fly diversity is not merely provide information on the species richness of fruit flys but also provide information on its distribution and dispersion. The aim of this research was to investigate the diversity and distribution of fruit flies species and their hosts in Bogor and its surrounding area. Fruit flies were collected from 119 sampling areas in Bogor Cianjur, Bekasi and Depok. Fruit flies were sampled using two methods, i.e. host rearing and trapping. Traps were modified from Lynfield traps and combined with two different attractants, i.e. metil eugenol (ME and Cue lure (CL. We found 18 species of fruit flies collected from traps and 24 host plants. The result showed that distribution, diversity and abundance of fruit flies was influenced by the diversity of host plants.

  14. IDENTIFIKASI SENYAWA VOLATIL DALAM OLAHAN LIMBAH KAKAO SEBAGAI POTENSI ATRAKTAN BACTROCERA CARAMBOLAE (DIPTERA:TEPHRITIDAE

    Directory of Open Access Journals (Sweden)

    Dyah Rini Indriyanti

    2011-02-01

    Full Text Available Limbah kakao cair yang diolah dengan cara pemanasan dan pemberian enzim proteolitik dapat menarik lalat buah Bactrocera carambolae di laboratorium. Olahan limbah kakao menghasilkan senyawa volatil yang menarik B. carambolae. Lalat buah Bactrocera spp. merupakan hama penting tanaman buah dan sayuran. Penelitian bertujuan mengidentifikasi senyawa atraktan olahan limbah kakao. Senyawa volatil tersebut diidentifikasi dengan GC-MS menggunakan pelarut metanol dan diperkuat dengan analisis infra merah. Hasil identifikasi berdasarkan analisis fragmentasi GC-MS menunjukkan bahwa olahan limbah kakao mengandung enam senyawa volatil: etil-2-hidroksi propanoat (5,96%; cis-7-dodesenil asetat (2,28%; senyawa asetami- da (1,36%; 3,5-dihidroksi-2metil-5,6-dihidropiran (16,64%; hidroksimetilfurfurol (52,31%; dan derivat1-undekuna (3,34%. Senyawa ini diperkuat oleh identifikasi beberapa gugus fungsional yang ditunjukkan dalam spektra infra merah olahan limbah kakao.

  15. Dampak Konsumsi Metil Egenol terhadap Perilaku dan Keberhasilan Perkawinan Lalat Buah Bactrocera carambolae (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Suryati Syamsuclin Tati-Subahar

    1999-12-01

    Full Text Available Methyl eugenol (= ME is an insect attractant. It is known that male Bactrocera dorsalis is attracted to ME. The objective of this research is to examine the effects of ME consumption on mating behavior and its success of Bactrocera carambolae. Observations were done daily from 17.00 to 18.00 hours. Mating success was characterized by the occurrence of copulation between male and female flies while mating behavior analysed by their fight intensities and wing vibrations. The results showed that the fighting and wing vibration periods of ME consuming flies were longer than those which did not. Mating success of those flies which fed on ME was relatively higher. It was concluded that ME is a stimulant for enhancing mating success of Bactrocera carambolae.

  16. Status of Bactrocera invadens (Diptera: Tephritidae) in mango-producing areas of Arba Minch, southwestern Ethiopia.

    Science.gov (United States)

    Massebo, Fekadu; Tefera, Zenebe

    2015-01-01

    Bactrocera invadens, the Asian fruit fly, was first reported in Kenya in 2003, and it spread fast to most tropical countries in Africa. To our knowledge, there is no detailed data on the fruit damage and status of fruit flies in Arba Minch and elsewhere in Ethiopia. Hence, information on the species composition and pest status of the fruit fly species is urgent to plan management strategies in the area. Fruit flies were captured using male parapheromone-baited traps. Matured mango (Mangifera indica) fruits were collected from randomly selected mango trees and incubated individually in cages (15 by 15 by 15 cm) with sandy soil. B. invadens was the predominant (96%; 952 of 992) captured species and the only fruit fly species emerging from mango fruits incubated in the laboratory. The mean number of adult B. invadens emerging per mango fruit was 35.25, indicating that the species is the most devastating mango fruit fly in the area. The loss due to this species would be serious if no management strategies are implemented. © The Author 2015. Published by Oxford University Press on behalf of the Entomological Society of America.

  17. Genetic and cytogenetic characterization of genetic sexing strains of Bactrocera dorsalis and Bactrocera cucurbitae (Diptera: Tephritidae).

    Science.gov (United States)

    Zacharopoulou, A; Franz, G

    2013-04-01

    In the current study, we performed genetic and cytogenetic analyses of two genetic sexing strains (GSSs), one for Bactrocera dorsalis s.s. and one for melon fly, Bactrocera cucurbitae Coquillett, the first such strains ever constructed in these species. In both strains, the genetic sexing mechanism is based on a pupal color dimorphism (white or brown) and is the result of a reciprocal translocation between the Y chromosome and the autosome bearing the white pupae (wp) locus. Based on genetic analysis and cytological data on mitotic metaphases and larval salivary gland polytene chromosomes, we succeeded in mapping the autosome breakpoints in the two Y-autosome translocations even though the Y chromosome is not visible in polytene nuclei. We show that polytene chromosomes can be used in cytogenetic analyses toward the development of genetic control methods in these pest species. The results of the genetic analysis are in full agreement with the cytological description of the strains.

  18. Effect of six insecticides on three populations of Bactrocera (Tetradacus) minax (Diptera: Tephritidae).

    Science.gov (United States)

    Liu, Haoqiang; Jiang, Gaofei; Zhang, Yunfei; Chen, Fei; Li, Xiaojiao; Yue, Jiansu; Ran, Chun; Zhao, Zhimo

    2015-01-01

    The Chinese citrus fruit fly, Bactrocera minax is one of the most economically important and aggressive pests threatening the Chinese citrus industry. In order to provide some recommendations for the improvement of integrated pest management of this species, the authors evaluated the toxicity of 6 insecticides on the second stage larvae, fourth stage larvae, and adult flies from multiple geographical B. minax populations. In addition, the influences of each pesticide on pupation and emergence were examined for one population, from Hanzhong. The 6 reagents displayed a wide range of toxicity on various stages of B. minax. Abamectin and Dichlorphos displayed the highest and lowest toxicities, respectively. All of the insecticides had negative effects on pupation and emergence of B. minax from Hanzhong, while Chlorpvrifos had the strongest impact on pupation, and Phoxim had the strongest influence on emergence. Though Phoxim and Chlorpvrifos were both effective, these insecticides belong to the class of organophosphorus pesticides, and their use should be reduced in orchards because of their high toxicity and long residual period.

  19. Artificial rearing of the peach fruit fly Bactrocera zonata (Diptera:Tephritidae)

    Science.gov (United States)

    Integration of the sterile insect technique (SIT) into the area-wide management of the peach fruit fly Bactrocera zonata (Saunders) is a promising althernative to the localized use of chemical control tactics. Implementation of the SIT requires adequate numbers of sterile male insects that are produ...

  20. Two new species and a new record of Bactrocera Macquart (Diptera: Tephritidae: Dacinae: Dacini) from India.

    Science.gov (United States)

    David, K J; Ramani, S; Whitmore, Daniel; Ranganath, H R

    2016-04-11

    Two new species of Bactrocera Macquart, namely Bactrocera (Calodacus) harrietensis Ramani & David, sp. nov. and Bactrocera (Calodacus) chettalli David & Ranganath, sp. nov., are described from the Andaman and Nicobar Islands and Karnataka, India, respectively. Bactrocera (Zeugodacus) semongokensis Drew & Romig is recorded for the first time from India.

  1. The exploration of fruit flies Bactrocera (Diptera:Tephritidae and its parasitoid in Madura Island regions

    Directory of Open Access Journals (Sweden)

    Tjipto Haryono

    2016-07-01

    Full Text Available Madura is enriched by great diversity despite of its infertile natural condition. This condition influences fruit flies existence and diversity. Purpose of this study was to investigate the diversity and distribution of fruit flies with their host in Madura region. Sampling methods in this study were fruit host collection (rearing and trapping using Steiner-type trap that were set in 48 locations in several villages in Bangkalan, Sampang, Pamekasan, and Sumenep regencies. Steiner traps were combined with 2 different attractants, such as methyl eugenol (ME and Cue Lure (CL. There were 5 species of fruit flies obtained from trapping and rearing, namely Bactrocera carambolae, B. papayae, B. umbrosa, B. albistrigata, and B. cucurbitae. Results indicate that the distribution, diversity, and abundance of fruit flies were influenced by the diversity of fruit host, air temperature, and relative air humidity. It is also identified two species of parasitoid imago from rotten fruits collection, namely Biosteres vandenboschi and Fopius arisanus. Keywords: distribution, Bactrocera, parasitoid

  2. Gut bacterial community structure of two Australian tropical fruit fly species (Diptera: Tephritidae)

    OpenAIRE

    Narit Thaochan; Richard A.I. Drew; Anuchit Chinajariyawong; Anurag Sunpapao; Chaninun Pornsuriya

    2015-01-01

    The community structure of the alimentary tract bacteria of two Australian fruit fly species, Bactrocera cacuminata (Hering) and Bactrocera tryoni (Froggatt), was studied using a molecular cloning method based on the 16S rRNA gene. Differences in the bacterial community structure were shown between the crops and midguts of the two species and sexes of each species. Proteobacteria was the dominant bacterial phylum in the flies, especially bacteria in the order Gammaproteobacteria w...

  3. Genetic and cytogenetic analysis of the olive fruit fly Bactrocera oleae (Diptera: Tephritidae).

    Science.gov (United States)

    Mavragani-Tsipidou, P

    2002-09-01

    The genetic and cytogenetic characteristics of one of the major agricultural pests, the olive fruit fly Bactmcera oleae, are presented here. The mitotic metaphase complement of this insect consists of six pairs of chromosomes including one pair of heteromorphic sex chromosomes, with the male being the heterogametic sex. The analysis of the polytene complements of three larval tissues, the fat body, the salivary glands and the Malpighian tubules of this pest has shown (a) a total number of five long chromosomes (10 polytene arms) that correspond to the five autosomes of the mitotic nuclei and a heterochromatic mass corresponding to the sex chromosomes, (b) the constancy of the banding pattern of the three somatic tissues, (c) the absence of a typical chromocenter as an accumulation of heterochromatin, (d) the existence of reverse tandem duplications, and (e) the presence of toroid tips of the chromosome arms. The in situ hybridization of genes or DNA sequences to the salivary gland polytene chromosomes of B. oleae provided molecular markers for all five autosomes and permitted the establishment of chromosomal homologies among B. olea, B. tryoni and Ceratitis capitata. The heat shock response of B. oleae, as revealed by heat-inducible puffing and protein pattern, shows a higher thermotolerance than Drosophila melanogaster.

  4. Genetic delineation of sibling species of the pest fruit fly Bactocera (Diptera: Tephritidae) using microsatellites.

    Science.gov (United States)

    Gilchrist, A S; Wang, Y; Yu, H; Raphael, K; Gilchrist, A S

    2003-08-01

    Using a large set of microsatellites, the genetic relationships between three closely related Australian fruit fly species, Bactrocera tryoni (Froggatt), B. neohumeralis (Hardy) and B. aquilonis(May) were investigated. Bactrocera tryoni and B. neohumeralis are sympatric, while B. aquilonisis allopatric to both. The sympatric species, B. tryoni and B. neohumeralis, were found to be genetically distinct. It is likely that despite differences in mating time between these two species, some gene flow still occurs. In contrast, the sibling species B. tryoni and B. aquilonis were found to be closely related, despite allopatry. The level of genetic divergence was similar to that found within eastern Australian populations of B. tryoni. Consideration of all available genetic data suggests that this similarity is not due to recent (i.e. within the last 30 years) displacement of B. aquilonis by B. tryoni from the B. aquilonis region (north-western Australia). Instead the data suggests that, at least in the areas sampled, asymmetrical hybridization may have occurred over a longer timescale.

  5. Native and introduced host plants of Anastrepha fraterculus and Ceratitis capitata (Diptera: Tephritidae) in northwestern Argentina.

    Science.gov (United States)

    Ovruski, Sergio; Schliserman, Pablo; Aluja, Martín

    2003-08-01

    Wild or commercially grown, native and exotic fruit were collected in 30 localities in the Tucumán province (NW Argentina) from January 1990 to December 1995 to determine their status as hosts of Anastrepha fraterculus (Wiedemann) and/or Ceratitis capitata (Wiedemann), the only two fruit fly species of economic and quarantine importance in Argentina. A total of 84,094 fruit (3,466.1 kg) representing 33 species (7 native and 26 exotic) in 15 plant families were sampled. We determined the following 17 host plant associations: Annona cherimola Miller (Annonaceae), Citrus paradisi Macfadyn (Rutaceae), Diospyros kaki L. (Ebenaceae), Eugenia uniflora L., Psidium guajava L., Myrcianthes pungens (Berg) Legrand (Myrtaceae), Ficus carica L. (Moraceae), Juglans australis Grisebach (Juglandaceae), Mangifera indica L. (Anacardiaceae), Eriobotrya japonica (Thunb.) Lindl., Prunus armeniaca L., P. domestica L., and P. persica (L.) Batsch (Rosaceae) were infested by both A. fraterculus and C. capitata. Citrus aurantium L., Citrus reticulata Blanco, Citrus sinensis (L.) Osbeck (Rutaceae), and Passiflora caerulea L. (Passifloraceae) were only infested by Ceratitis capitata. Out of a total of 99,627 adults that emerged from pupae, 69,180 (approximately 69.5%) were Anastrepha fraterculus, 30,138 (approximately 30.2%) were C. capitata, and 309 (approximately 0.3%) were an unidentified Anastrepha species. Anastrepha fraterculus predominated in native plant species while C. capitata did so in introduced species. Infestation rates (number of larvae/kg of fruit) varied sharply from year to year and between host plant species (overall there was a significant negative correlation between fruit size and infestation level). We provide information on fruiting phenology of all the reported hosts and discuss our findings in light of their practical (e.g., management of A. fraterculus and C. capitata in citrus groves) implications.

  6. First Records of the Fruit Flies (Diptera, Tephritidae in the Fauna of Iran

    Directory of Open Access Journals (Sweden)

    Zarghani E.

    2016-04-01

    Full Text Available As a result of studies on fruit flies in Iran during 2013-2015, two genera (Eurasimona Korneyev & White 1991 and Inuromaesa Korneyev & White 1991 and eight species: Eurasimona stigma (Loew, 1840 Inuromaesa maura (Frauenfeld, 1857, Myopites inulaedyssentericae Blot, 1827, Oxyna flavipennis (Loew, 1846, Terellia ermolenkoi Korneyev, 1985, T. odontolophi Korneyev 1993, T. pseudovirens (Hering, 1940, and Euleia kovalevi (Korneyev 1991, are recorded for the first time from Iran. The host plants, collection data as well as general distribution and diagnostic characters of them are given. Detailed illustrated redescription for T. ermolenkoi previously known from a unique holotype male is provided. The presence of Noeeta pupillata (Fallén, 1814 in the fauna of Iran is confirmed.

  7. Influence of quantities of brewer yeast on the performance of Anastrepha obliqua wild females (Diptera, Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Cresoni-Pereira, Carla; Zucoloto, Fernando Sergio [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia, Ciencias e Letras. Dept. de Biologia

    2001-11-15

    Using artificial solid diets, experiments were performed with Anastrepha obliqua (Macquart, 1835) wild females in order to verify the influence of different quantities of brewer yeast on the performance and compensation behavior to unbalanced diets ingestion. The observed parameters were egg production, ingestion, diet efficiency and survival in the reproductive phase. Results indicated that there was no compensatory ingestion to different quantities of yeast and that the diet with 12.5g of yeast provided the best performance. The absence of compensatory ingestion is discussed based on the yeast phagostimulation and on the costs involved in solid diets ingestion. The relation between the analyzed parameters and the protein quantities in the diet were discussed. (author)

  8. New species and host plants of Anastrepha (Diptera: Tephritidae) primarily from Peru and Bolivia.

    Science.gov (United States)

    Norrbom, Allen L; Rodriguez, Erick J; Steck, Gary J; Sutton, Bruce A; Nolazco, Norma

    2015-11-16

    Twenty-eight new species of Anastrepha are described and illustrated: A. acca (Bolivia, Peru), A. adami (Peru), A. amplidentata (Bolivia, Peru), A. annonae (Peru), A. breviapex (Peru), A. caballeroi (Peru), A. camba (Bolivia, Peru), A. cicra (Bolivia, Peru), A. disjuncta (Peru), A. durantae (Peru), A. echaratiensis (Peru), A. eminens (Peru), A. ericki (Peru), A. gonzalezi (Bolivia, Peru), A. guevarai (Peru), A. gusi (Peru), A. kimi (Colombia, Peru), A. korytkowskii (Bolivia, Peru), A. latilanceola (Bolivia, Peru), A. melanoptera (Peru), A. mollyae (Bolivia, Peru), A. perezi (Peru), A. psidivora (Peru), A. robynae (Peru), A. rondoniensis (Brazil, Peru), A. tunariensis (Bolivia, Peru), A. villosa (Bolivia), and A. zacharyi (Peru). The following host plant records are reported: A. amplidentata from Spondias mombin L. (Anacardiaceae); A. caballeroi from Quararibea malacocalyx A. Robyns & S. Nilsson (Malvaceae); A. annonae from Annona mucosa Jacq. and Annona sp. (Annonaceae); A. durantae from Duranta peruviana Moldenke (Verbenaceae); and A. psidivora from Psidium guajava L. (Myrtaceae).

  9. The role of the transformer gene in sex determination and reproduction in the tephritid fruit fly, Bactrocera dorsalis (Hendel).

    Science.gov (United States)

    Peng, Wei; Zheng, Wenping; Handler, Alfred M; Zhang, Hongyu

    2015-12-01

    Transformer (tra) is a switch gene in the somatic sex-determination hierarchy that regulates sexual dimorphism based on RNA splicing in many insects. In tephritids, a Y-linked male determining gene (M) controls sex in the sex-determination pathway. Here, homologues of Drosophila tra and transformer-2 (tra-2) genes were isolated and characterized in Bactrocera dorsalis (Hendel), one of the most destructive agricultural insect pests in many Asian countries. Two male-specific and one female-specific isoforms of B. dorsalis transformer (Bdtra) were identified. The presence of multiple TRA/TRA-2 binding sites in Bdtra suggests that the TRA/TRA-2 proteins are splicing regulators promoting and maintaining, epigenetically, female sex determination by a tra positive feedback loop in XX individuals during development. The expression patterns of female-specific Bdtra transcripts during early embryogenesis shows that a peak appears at 15 h after egg laying. Using dsRNA to knock-down Bdtra expression in the embryo and adult stages, we showed that sexual formation is determined early in the embryo stage and that parental RNAi does not lead to the production of all male progeny as in Tribolium castaneum. RNAi results from adult abdominal dsRNA injections show that Bdtra has a positive influence on female yolk protein gene (Bdyp1) expression and fecundity.

  10. Ring-fluorinated analog of methyl eugenol: attractiveness to and metabolism in the oriental fruit fly, Bactrocera dorsalis (Hendel).

    Science.gov (United States)

    Khrimian, Ashot; Siderhurst, Matthew S; Mcquate, Grant T; Liquido, Nicanor J; Nagata, Janice; Carvalho, Lori; Guzman, Filadelfo; Jang, Eric B

    2009-02-01

    Oriental fruit fly, Bactrocera dorsalis (Hendel), males are highly attracted to the natural phenylpropanoid methyl eugenol (ME). They compulsively feed on ME and metabolize it to ring and side-chain hydroxylated compounds that have both pheromonal and allomonal functions. Side-chain metabolic activation of ME leading to (E)-coniferyl alcohol has long been recognized as a primary reason for hepatocarcinogenicity of this compound in rodents. Earlier, we demonstrated that introduction of a fluorine atom at the terminal carbon of the ME side chain significantly depressed metabolism and specifically reduced formation of coniferyl alcohol but had little effect on field attractiveness to B. dorsalis. In the current paper, we demonstrate that fluorination of ME at the 4 position of the aromatic ring blocks metabolic ring-hydroxylation but overall enhances side-chain metabolism by increasing production of fluorinated (E)-coniferyl alcohol. In laboratory experiments, oriental fruit fly males were attracted to and readily consumed 1,2-dimethoxy-4-fluoro-5-(2-propenyl)benzene (I) at rates similar to ME but metabolized it faster. Flies that consumed the fluorine analog were as healthy post feeding as ones fed on methyl eugenol. In field trials, the fluorine analog I was approximately 50% less attractive to male B. dorsalis than ME.

  11. Characterization of a β-Adrenergic-Like Octopamine Receptor in the Oriental Fruit Fly, Bactrocera dorsalis (Hendel

    Directory of Open Access Journals (Sweden)

    Hui-Min Li

    2016-09-01

    Full Text Available The biogenic amine octopamine plays a critical role in the regulation of many physiological processes in insects. Octopamine transmits its action through a set of specific G-protein coupled receptors (GPCRs, namely octopamine receptors. Here, we report on a β-adrenergic-like octopamine receptor gene (BdOctβR1 from the oriental fruit fly, Bactrocera dorsalis (Hendel, a destructive agricultural pest that occurs in North America and the Asia-Pacific region. As indicated by RT-qPCR, BdOctβR1 was highly expressed in the central nervous system (CNS and Malpighian tubules (MT in the adult flies, suggesting it may undertake important roles in neural signaling in the CNS as well as physiological functions in the MT of this fly. Furthermore, its ligand specificities were tested in a heterologous expression system where BdOctβR1 was expressed in HEK-293 cells. Based on cyclic AMP response assays, we found that BdOctβR1 could be activated by octopamine in a concentration-dependent manner, confirming that this receptor was functional, while tyramine and dopamine had much less potency than octopamine. Naphazoline possessed the highest agonistic activity among the tested agonists. In antagonistic assays, mianserin had the strongest activity and was followed by phentolamine and chlorpromazine. Furthermore, when the flies were kept under starvation, there was a corresponding increase in the transcript level of BdOctβR1, while high or low temperature stress could not induce significant expression changes. The above results suggest that BdOctβR1 may be involved in the regulation of feeding processes in Bactrocera dorsalis and may provide new potential insecticide leads targeting octopamine receptors.

  12. Capability of Glossina tachinoides Westwood (Diptera: Glossinidae ...

    African Journals Online (AJOL)

    Capability of Glossina tachinoides Westwood (Diptera: Glossinidae) males to made and inseminate female flies in different mating ratios to sustain a laboratory tsetsefly colony for sterile insect technique control programme in Ghana.

  13. Percepção química e visual de Anastrepha fraterculus (Diptera, Tephritidae em laboratório Chemical and visual perception of Anastrepha fraterculus (Diptera, Tephritidae in laboratory

    Directory of Open Access Journals (Sweden)

    Patrícia L. F. Gregorio

    2010-06-01

    Full Text Available A mosca-das-frutas-sul-americana, Anastrepha fraterculus (Wiedemann, 1830, é uma das principais pragas da fruticultura no Brasil. Durante a alimentação, as larvas fazem galerias nos frutos, alterando o sabor e prejudicando a produção e comercialização dos mesmos. O presente trabalho teve como objetivo estudar fatores envolvidos na escolha do hospedeiro por A. fraterculus. Foram avaliadas as respostas eletroantenográficas de machos e fêmeas a extratos etanólicos de frutos verdes e maduros de pessegueiro - Prunus persica, cultivar Chimarrita (Rosaceae, pitangueira - Eugenia uniflora (Myrtaceae, guabirobeira - Campomanesia xanthocarpa (Myrtaceae e araçazeiro - Psidium cattleianum (Myrtaceae. Foram também observadas as influências da cor (amarela, verde e vermelha e da composição do substrato de oviposição (polpas de araçá, guabiroba, pitanga e pêssego na fecundidade da espécie. As respostas eletroantenográficas de fêmeas foram significativamente distintas para os extratos de guabiroba verde e madura, araçá maduro e pitanga verde. Em antenas de machos, as maiores despolarizações médias foram registradas em resposta aos extratos de guabiroba verde e madura, araçá verde e maduro e pitanga verde. As respostas eletrofisiológicas geradas não diferiram estatisticamente entre os sexos, para todos os tratamentos. A cor do substrato não afetou a oviposição. As fêmeas ovipositaram mais nos substratos contendo polpa de pêssego e de guabiroba, quando comparados aos respectivos controles.The South American fruit fly Anastrepha fraterculus (Wiedemann, 1830 is one of the greatest threats to the fruit growing industry in Brazil. During the feeding process, the larvae build galleries within the fruit, altering the flavor and damaging its production and commercialization. The present work had as its objective to study the factors involved in the choice of the host by A. fraterculus. Electroantennographic responses of the males and females to the ethanolic extracts of the fruits of the peach tree - Prunus persica, cultivar Chimarrita (Rosaceae, Surinam cherry tree - Eugenia uniflora (Myrtaceae, Guabirobeira tree - Campomanesia xanthocarpa (Myrtaceae and Brazilian guava tree - Psidium cattleianum (Myrtaceae were considered. Also recorded was the influence of the color (yellow, green and red and the composition of the substratum of oviposition (pulps of Brazilian guava, Guabiroba, Surinam cherry and peaches in the fecundity. Electroantennographic responses of the females were distinct to the extracts of the unripe and ripe Guabiroba, ripe Brazilian guava and unripe Surinam cherry. In antennae of the males, the greatest depolarization average was registered in the responses to the extracts of ripe and unripe Guabiroba, ripe and unripe Brazilian guava and unripe Surinam cherry. Electrophysiologic responses did not differ statistically between the sexes for all the treatments. The colors of the substratum of oviposition did not affect the fecundity. The females ovipositioned more on the substratum containing pulp of peaches and of Guabiroba, when compared to the respective controls.

  14. Quarantine treatment to Ceratitis capitata (Wied., 1824) (Diptera: Tephritidae) in orange fruits (Citrus sinensis).; Tratamento quarentenario para Ceratitis capitata (Wied., 1824) (Diptera: Tephritidae) em frutos de laranja (Citrus sinensis)

    Energy Technology Data Exchange (ETDEWEB)

    Albergaria, Nuno Miguel Mendes Soares de

    2005-07-01

    This work was carried out to evaluate the effect of thermal treatments (vapour heat and hot water) and irradiation on Ceratitis capitata eggs and larvae (first, second and third instars), in 'Valencia' oranges; the relation between temperature and exposition time to vapour heat and hot water on fruit fly immature; the relation among the different doses of radiation on fruit fly immature and evaluate the effect of the treatments (thermal treatments and irradiation) on the chemical composition of the fruits. It was evaluated the heat absorption and loose of heat by the fruit. For thermal treatments it was used temperatures of 44 and 46 deg C for 15,30,60, 90 and 120 minutes and a control. For irradiation were used the doses: 10,20, 30, 40, 50, 100, 150 and 200 Gy. By the results obtained it is possible to conclude that: to the control of eggs and larvae (first, second and third instars) the treatment with vapour heat was less efficient than the hot water treatment; the thermal treatments of C. capitata eggs and larvae (first and second and third instars) can be recommended with vapor heat at 46 deg C at 152.2 minutes or with hot water at 46 deg C at 84.8 minutes, achieving the quarantine request; third instar larvae are more tolerant to the thermal and irradiation treatments; the treatment with irradiation can be recommended for quarantine treatment of ali immature stages evaluated with the dose of 72.88 Gy; the dose of 50 Gy causes sterility to the adults emerged from ali immature stages irradiated; treatments do not cause any change in the chemical proprieties in the orange fruits var. 'Valencia'. (author)

  15. Importance of adult protein ingestion on the mating success of Ceratitis capitata Wiedemann males (Diptera: Tephritidae); Importancia da ingestao de proteina na fase adulta para o sucesso de acasalamento dos machos de Ceratitis capitata Wiedemann (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Silva Neto, Alberto M. da; Dias, Vanessa S.; Joachim-Bravo, Iara S., E-mail: bio.alberto@gmail.co, E-mail: vanessasidias@hotmail.co, E-mail: ibravo@ufba.b [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Inst. de Biologia. Dept. de Biologia Geral

    2010-04-15

    The importance of the protein ingestion during the adult stage on the mating success of males of Ceratitis capitata Wiedemann was evaluated in experiments of laboratory and fi eld cage. In laboratory, the effects of protein ingestion during the fi rst four or 12 days of the male adult life was assessed by the following parameters: mating success (capacity of being chosen by the female) and the number of males that give out pheromonal signals. Some experiments of mating success had been carried through with males in different ratios. In these tests, the number of males which had ingested protein (an unique male) was remained constant and the number of males fed without protein was gradually increased from 1:1 to 1:5. In the fi eld cages, the mating success experiments were done using a 1:1 ratio. The results showed that the protein ingestion in the fi rst four days of life did not influence any of the analyzed parameters. When the period of ingestion of protein was extended to 12 days, protein-fed males fed produced more pheromonal signals and had a higher mating success when at a 1:1 ratio in laboratory and fi eld cage assays. In laboratory, females randomly chose males in any other tested ratio (1:2, 1:3, 1:4 and 1:5), indicating that the female may lose the perception to identify the male who ingested protein in the fi rst 12 days. (author)

  16. Producción masiva y simultánea de machos de Ceratitis capitata (Diptera: Tephritidae y parasitoides Dichasmimorpha longicaudata (Hymenoptera: Braconidae Massive and simultaneous production of Ceratitis capitata (Diptera: Tephritidae males and Diachasmimorpha longicaudata (Hymenoptera: Braconidae parasitoids

    Directory of Open Access Journals (Sweden)

    Silvia N. López

    2006-12-01

    Full Text Available En la línea de sexado genético «Cast191» las hembras de Ceratitis capitata son homocigotas para el gen slow , lo que reduce su velocidad de desarrollo; los machos son heterocigotas y muestran una velocidad de desarrollo normal. Esta característica permitió producir, con Cast191, machos estériles por un lado, y parasitoides criados sobre las larvas remanentes por el otro. Nuestro objetivo con este trabajo fue producir ambos insumos simultáneamente y a una escala mayor que hasta ahora. Además, bajo estas condiciones, y en un intento por aumentar la separación entre sexos, se aplicó a las larvas del primer estadío un pulso de 15º C, durante 1 ó 2 días, luego del cual se las mantuvo a 20º C ó 25º C, hasta que entraron al estado de pupa, luego se mantuvo todo el material a 25º C. La mejor separación de sexos, lograda con el tratamiento a 20º C sin pulso de frío, se usó para comparar la calidad del parasitoide Diachasmimorpha longicaudata, criado sobre las larvas obtenidas tras la separación de los machos, con aquellos criados sobre la línea salvaje. Para ello, este tratamiento de separación fue aplicado en la cría de la mosca, y el material remanente de dieta con larvas fue expuesto al parasitoide. La tasa de parasitismo obtenida fue semejante a la hallada sobre la línea salvaje, y la tasa sexual de la F 1 del parasitoide presentó un sesgo hacia las hembras aún mayor. Se discute la factibilidad de utilizar la línea Cast191 de C. Capitata, para la producción a mayor escala de machos de mosca y para la cría masiva del parasitoide D. longicaudata.In the genetic sexing strain «Cast191», the females of Ceratitis capitata are homozygous for the mutation slow , slowing down their rate of development, and the males are heterozygous, having a normal rate of development. This feature made Cast191 capable of producing sterile males, on one hand, and parasitoids that are reared on the remaining larvae, on the other. The objective of the present work was to do this two thing simultaneously and at a larger scale than previously. Besides, in an attempt to improve malefemale separation under this conditions, a pulse of 15ºC was applied to first stage larva during 1 or 2 days; these larvae were later held either at 20ºC or, at 25ºC until pupation, both groups of pupae being then kept at 25ºC . The best separation between male and female, achieved rearing larvae at 20ºC without any pulse of 15ºC , was then used to evaluate the quality of the parasitoids Diachasmimorpha longicaudata reared on the larvae remaining after male separation. These larvae were exposed to the parasitoid under standard conditions. The rate of parasitism obtained was similar to the one found when parasitoids are exposed to wild strain, and the F1 sex rate was even more biased toward females. The potential use at larger scale of the Cast191 strain of C. capitata for producing sterile males and D. longicaudata parasitoids is discussed.

  17. Mating choice of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae): influence of male ageing on mating success; Escolha de parceiro para acasalamento em Ceratitis capitata (Wiedemann)(Diptera: Tephritidae): influencia do envelhecimento dos machos no sucesso de copula

    Energy Technology Data Exchange (ETDEWEB)

    Silva Neto, Alberto M. da; Dias, Vanessa S.; Joachim-Bravo, Iara S. [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Inst. de Biologia. Dept. de Biologia Geral], e-mail: bio.alberto@gmail.com, e-mail: vanessasidias@hotmail.com, e-mail: ibravo@ufba.br

    2009-09-15

    The objective of this study was to evaluate the effect of male ageing on male pheromone release and mating success of Ceratitis capitata (Wiedemann). The effects of male ageing on mating were evaluated on fi ve and 21 d-old males by assessing their mating success (males chosen by a female for copulation) and the amount of males releasing the sex pheromone. The mating success was evaluated by using several ratios of young to older males by increasing the number of older males:young males from 1:1 to 5:1. The mating success of the 1:1 ratio was also evaluated in fi eld cages. The evaluation of the mating success (in the 1:1 ratio) showed a clear preference of the females for young males. Sex pheromone emission was much more common on young than older males. Even in cases were older males were more abundant (ratios 2:1 and 3:1), females still chose the young males. However, females could not distinguish young from older males in ratios of 4:1 or 5:1. Our data indicate that the ageing of C. capitata males has a considerable negative effect on their reproductive success, especially if they are found in a proportion any lower than 3:1. (author)

  18. Irradiation of Ceratitis capitata, Anastrepha fraterculus and Anastrepha obliqua larvae (Diptera: Tephritidae) on an artificial diet; Irradiacao de larvas de Ceratitis capitata, Anastrepha fraterculus e Anastrepha obliqua (Diptera: Tephritidae) em dieta artificial

    Energy Technology Data Exchange (ETDEWEB)

    Raga, A.; Sato, M.E.; Suplicy Filho, N.; Potenza, M.R. [Instituto Biologico, Sao Paulo, SP (Brazil); Yamazaki, M.C.R. [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil)

    1992-01-01

    The aim of the experiment was to establish gamma radiation dose levels sufficient to prevent the emergence of adults, and thus to serve as parameters for disinfestation of hosts of the fruit-flies Ceratitis capitata, Anastrepha fraterculus, and Anastrepha obliqua. Four-, 5,6-, and 7-day-old larvae of the 3 species were tested. Pupation was unaffected by 40 Gy for C. capitata, and by 100 Gy for A. fraterculus and A. obliqua. Gamma radiation doses necessary to prevent development of adults from larvae were 30 Gy, 20 Gy and 20 Gy for C. capitata, A. obliqua respectively. (author). 10 refs, 6 tabs.

  19. Some aspects of the behavior at different ages of Ceratitis capitata (Wiedemann, 1824) (Diptera-Tephritidae) irradiated with gamma rays; Alguns aspectos do comportamento em diferentes idades de Ceratitis capitata (Wiedemann, 1824) (Diptera-tephritidae) irradiadas com radiacao gama

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, Ivone Midori

    1988-08-01

    The present work was carried out in the laboratory of the Entomology Section of the Nuclear Energy for Agriculture Center (CENA) in Piracicaba, Sao Paulo state, Brazil, to determine the effects different gamma radiation doses on the reproductive potential of males and the flight behavior of Ceratitis capitata (Wied.). For all the treatments with gamma radiation a Cobalt-60 source type Gamma beam-650 was used, with activity of approximately 13,410 x 10{sup B} Bq. (4,967 Ci.), and the dose rate of 2.000 Gy per hour. The doses used were 80 Gy, 100 Gy and 120 Gy. The three doses employed affected more the longevity of males than the females and the number of spermatozoid found lower in the irradiated insects compared with the control, with no significant differences between doses. The insects irradiated with 80 Gy showed activity similar to the control population until four days after emergence: afterwards they were more active than the unirradiated. The gamma irradiation diminished the take-off ability of the insects. (author). 59 refs., 9 figs., 9 tabs.

  20. Relación entre tiempo de desarrollo larvario y fecundidad de la hembra en Ceratitis capitata (Diptera:Tephritidae Relationship between time of larval development and fecundity in the female of Ceratitis capitata (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Fanny C. Manso

    2006-07-01

    Full Text Available Se estudió la relación entre tiempo de desarrollo larvario y fecundidad en la hembra de Ceratitis capitata Wiedemann, comparando individuos de una cepa salvaje, con individuos de una cepa portadora de la mutación sw , la cual provoca atrasos en el desarrollo larvario. Se observaron caracteres de la morfología del ovario y su herencia entre los segregantes, para «tiempo de desarrollo» en la progenie del cruzamiento entre mutante y silvestre. El estudio mostró que las hembras sw (- que quedan muy retrasadas en su desarrollo, tienen menos ovariolas y una distribución de tamaños de óvulos menos homogénea que las que se desarrollan antes. Se encontró asimismo que entre las larvas de tipo salvaje, las más retrasadas también producen hembras con menor número de ovariolas y menos huevos totalmente desarrollados, que las que se desarrollan antes. Tanto en las hembras sw (- como en las sw(+ , los atrasos del desarrollo obran en desmedro de la postura de huevos de las hembras que se desarrollan más tarde, efecto que se manifiesta en el número menor de ovariolas y en las diferencias del ritmo de maduración del ovario. Bajo condiciones apropiadas de cría, las hembras mutantes para sw son capaces de alcanzar la misma fecundidad que las normales.We studied the relationship between the development time in the larva stage and the resulting female fecundity, in Ceratitis capitata Wiedemann wild-type individuals compared to mutant individuals showing slow development (sw. We observed the morphology of the ovaries in the progenies of the crossing between mutant and wild-type strains, comparing females segregating by «development time». This study showed that sw(- females developing later have got less ovarioles, and a more heterogeneous distribution of ovules, than females developing earlier. It was also found that the wild type females developing late also produce lower numbers both of ovarioles and fully developed ova, than those developing earlier. In sw females as well as in wildtype females, delays in development reduce the fecundity of the females, which is expressed as lower number of ovarioles and slower maturation of the ovary. When the rearing conditions are appropriate, the sw females are as fertile as wild-type ones.

  1. Avaliação da qualidade de frutos de café atacados por Ceratitis capitata (Wiedemann, 1824 (Diptera: Tephritidae Evaluation of the quality of coffee fruit attacked by Ceratitis capitata (Wiedemann, 1824 (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    F.J. Cividanes

    1993-09-01

    Full Text Available Foram usadas plantas de Coffea arabica L., variedade Catuaí Vermelho, localizadas no Campus da Escola Superior de Agricultura "Luiz de Queiroz" - USP, Piracicaba,SP, para avaliação dos danos que Ceratitis capitata (Wied., 1824 pode causar aos frutos do cafeeiro. Os resultados mostraram que o ataque de C. capitula não causou queda prematura dos frutos, mas aumentou a queda de cerejas e foram encontradas, fortes evidências, com base na atividade da enzima polifenol oxidase e lixiviação de potássio, que cerejas atacadas podem produzir bebida de café de qualidade inferior.The present work was carried out using trees of Coffea arabica L. variety Red Catuaí grown at Escola Superior de Agricultura "Luiz de Queiroz" - Campus of the University of São Paulo, Piracicaba,SP. The objective was to estimate damages that Ceratitis capitata (Wied., 1824 can cause to coffee fruits. The results showed that C.capitata did not cause premature fruit fall, but it increased berry fall. The activity of the enzyme polyphenol oxidase and potassium lixiviatiou give strong evidences that atacked coffee beans produce coffee beverage of inferior quality.

  2. Parasitóides (Hymenoptera: Braconidae de Anastrepha Schiner (Diptera: Tephritidae no estado do Acre Parasitoids (Hymenoptera: Braconidae of Anastrepha Schiner (Diptera: Tephritidae in the state of Acre, Brazil

    Directory of Open Access Journals (Sweden)

    Marcílio José Thomazini

    2009-03-01

    Full Text Available Este trabalho relata a primeira ocorrência de parasitóides em moscas-das-frutas do gênero Anastrepha Schiner no estado do Acre. No município de Bujari foram encontrados os braconídeos Opius bellus Gahan (72,5%, Doryctobracon areolatus (Szépligeti (26,8% e Utetes anastrephae (Viereck (0,7% associados a A. obliqua (Macquart em frutos de taperebá (Spondias mombin L., com parasitismo de 29,5%. No município de Rio Branco, em frutos de goiaba (Psidium guajava L., ocorreu somente D. areolatus em A. obliqua com parasitismo de 2,7%.This paper records the first parasitoids occurrence on Anastrepha Schiner fruit flies in the state of Acre, Brazil. In the Bujari County there occurred the braconids Opius bellus Gahan (72.5%, Doryctobracon areolatus (Szépligeti (26.8% e Utetes anastrephae (Viereck (0.7% associated with A. obliqua (Macquart in tapereba fruits (Spondias mombin L., with parasitism of 29.5%. In guajava fruits (Psidium guajava L. at Rio Branco County, only D. areolatus on A. obliqua occurred, with parasitism of 2.7%.

  3. Effects of Curcuma longa extracts on mortality and fecundity of Bactrocera zonata (Diptera: Tephritidae Efeitos dos extratos de Curcuma longa sobre mortalidade e fecundidade de Bactrocera zonata (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Abdul Rauf Siddiqi

    2011-12-01

    Full Text Available The peach fruit fly, Bactrocera zonata, is a significant pest of fruit and vegetable crops in South East Asia and Pacific region. Ccontrol strategies of fruit flies, relying chiefly on insecticides, have serious environmental consequences, disturbing the agro-ecosystem as well as eliminating natural enemies. This study was oriented at exploring the potential of turmeric, Curcuma longa, extracts to control the peach fruit fly. Freshly emerged female adults of Bactrocera zonata were continuously fed for 16 days on diet containing 1000, 500 and 250 ppm of acetone extract of Curcuma longa separately in laboratory cages. The extract caused 85.00, 66.67 and 56.67 percent mortality at 1000, 500 and 250 ppm respectively. The surviving females were mated and allowed to reproduce on clean guava fruits in separate cages. The inhibition in pupal progeny was 67.90, 60.74 and 51.96 percent in the flies fed on 1000, 500 and 250 ppm, the inhibition observed in adult progeny was 84.68, 79.03 and 67.74 percent, respectively.A mosca do pêssego, Bactrocera zonata, é uma importante praga das frutas e produtos hortícolas no Sudeste Asiático e Pacífico. As estratégias de controle de moscas-das-frutas, que se baseia principalmente no uso de inseticidas, têm consequências ambientais graves, perturbando o agroecossistema, bem como eliminando os inimigos naturais. Este estudo foi orientado a explorar as potencialidades dos extratos de açafrão Curcuma longa para controle de B. zonata. Após a emergência, adultos de fêmeas de B. zonata foram continuamente alimentados, durante 16 dias, com dieta contendo 1000, 500 e 250 ppm de extrato acetônico de C. longa separadamente em gaiolas no laboratório. O extrato causou 85,00, 66,67 e 56,67 % de mortalidade em 1000, 500 e 250 ppm, respectivamente. As fêmeas foram acasaladas e postas para ovipositar separadamente em goiabas dentro das gaiolas. A inibição na progênie pupal foi 67,90, 60,74 e 51,96 % nos insetos alimentados em 1000, 500 e 250 ppm, a inibição observada na progênie adulta foi 84,68, 79,03 e 67,74%, respectivamente.

  4. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae Viability of eggs and screen cage model for mass artificial rearing of Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Juliana García

    2011-12-01

    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de ía con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.The aim of this study was to determine the viability of eggs and cage model suitable for artificial mass rearing of Anastrepha fraterculus (Wiedemann. The results show that the period of maximum oviposition occurs during the first 10 days in Medium cages which allows to obtain the necessary volume of eggs to feed the foot of rearing of A. fraterculus in a mass rearing. Considering that a positive relationship was found between the volume of eggs oviposited and the hatchability percentage in a period of 21 days of collection, this period coincides with the highest values of hatching. Among the evaluated cage models: Medium, Large and Mission, Medium model showed the best results when assessing the number of eggs/female/day with an average of 11.4. The cage that showed lower results was Mission model with an average of 4.6 eggs/female/day. The Large cages showed values lower than the Medium cages but the differences were not significant. Good values recorded in the Medium cages were likely due to their structure, with the inside of the cage divided into several compartments, which improves the distribution of adult flies and prevents early mortality due to the overcrowding of the base or the roof of the cage.

  5. RNAi-Mediated Knock-Down of transformer and transformer 2 to Generate Male-Only Progeny in the Oriental Fruit Fly, Bactrocera dorsalis (Hendel).

    Science.gov (United States)

    Liu, Guiqing; Wu, Qiang; Li, Jianwei; Zhang, Guifen; Wan, Fanghao

    2015-01-01

    The transformer (tra) gene appears to act as the genetic switch that promotes female development by interaction with the transformer2 (tra-2) gene in several dipteran species including the Medfly, housefly and Drosophila melanogaster. In this study, we describe the isolation, expression and function of tra and tra-2 in the economically important agricultural pest, the oriental fruit fly, Bactrocera dorsalis (Hendel). Bdtra and Bdtra-2 are similar to their homologs from other tephritid species. Bdtra demonstrated sex-specific transcripts: one transcript in females and two transcripts in males. In contrast, Bdtra-2 only had one transcript that was common to males and females, which was transcribed continuously in different adult tissues and developmental stages. Bdtra-2 and the female form of Bdtra were maternally inherited in eggs, whereas the male form of Bdtra was not detectable until embryos of 1 and 2 h after egg laying. Function analyses of Bdtra and Bdtra-2 indicated that both were indispensable for female development, as nearly 100% males were obtained with embryonic RNAi against either Bdtra or Bdtra-2. The fertility of these RNAi-generated males was subsequently tested. More than 80% of RNAi-generated males could mate and the mated females could lay eggs, but only 40-48.6% males gave rise to progeny. In XX-reversed males and intersex individuals, no clear female gonadal morphology was observed after dissection. These results shed light on the development of a genetic sexing system with male-only release for this agricultural pest.

  6. Fauna Europaea: Diptera – Brachycera

    Science.gov (United States)

    Beuk, Paul; Pont, Adrian Charles; Shatalkin, Anatole I.; Ozerov, Andrey L.; Woźnica, Andrzej J.; Merz, Bernhard; Bystrowski, Cezary; Raper, Chris; Bergström, Christer; Kehlmaier, Christian; Clements, David K.; Greathead, David; Kameneva, Elena Petrovna; Nartshuk, Emilia; Petersen, Frederik T.; Weber, Gisela; Bächli, Gerhard; Geller-Grimm, Fritz; Van de Weyer, Guy; Tschorsnig, Hans-Peter; de Jong, Herman; van Zuijlen, Jan-Willem; Vaňhara, Jaromír; Roháček, Jindřich; Ziegler, Joachim; Majer, József; Hůrka, Karel; Holston, Kevin; Rognes, Knut; Greve-Jensen, Lita; Munari, Lorenzo; de Meyer, Marc; Pollet, Marc; Speight, Martin C. D.; Ebejer, Martin John; Martinez, Michel; Carles-Tolrá, Miguel; Földvári, Mihály; Chvála, Milan; Barták, Miroslav; Evenhuis, Neal L.; Chandler, Peter J.; Cerretti, Pierfilippo; Meier, Rudolf; Rozkosny, Rudolf; Prescher, Sabine; Gaimari, Stephen D.; Zatwarnicki, Tadeusz; Zeegers, Theo; Dikow, Torsten; Korneyev, Valery A.; Richter, Vera Andreevna; Michelsen, Verner; Tanasijtshuk, Vitali N.; Mathis, Wayne N.; Hubenov, Zdravko

    2015-01-01

    Abstract Fauna Europaea provides a public web-service with an index of scientific names (including important synonyms) of all extant multicellular European terrestrial and freshwater animals and their geographical distribution at the level of countries and major islands (east of the Urals and excluding the Caucasus region). The Fauna Europaea project comprises about 230,000 taxonomic names, including 130,000 accepted species and 14,000 accepted subspecies, which is much more than the originally projected number of 100,000 species. Fauna Europaea represents a huge effort by more than 400 contributing taxonomic specialists throughout Europe and is a unique (standard) reference suitable for many user communities in science, government, industry, nature conservation and education. The Diptera–Brachycera is one of the 58 Fauna Europaea major taxonomic groups, and data have been compiled by a network of 55 specialists. Within the two-winged insects (Diptera), the Brachycera constitute a monophyletic group, which is generally given rank of suborder. The Brachycera may be classified into the probably paraphyletic 'lower brachyceran grade' and the monophyletic Eremoneura. The latter contains the Empidoidea, the Apystomyioidea with a single Nearctic species, and the Cyclorrhapha, which in turn is divided into the paraphyletic 'aschizan grade' and the monophyletic Schizophora. The latter is traditionally divided into the paraphyletic 'acalyptrate grade' and the monophyletic Calyptratae. Our knowledge of the European fauna of Diptera–Brachycera varies tremendously among families, from the reasonably well known hoverflies (Syrphidae) to the extremely poorly known scuttle flies (Phoridae). There has been a steady growth in our knowledge of European Diptera for the last two centuries, with no apparent slow down, but there is a shift towards a larger fraction of the new species being found among the families of the nematoceran grade (lower Diptera), which due to a larger

  7. Asymmetry of frontal bristles and postocular setae in species and hybrids of the Anastrepha fraterculus complex (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    João Maria G.A. Souza

    2007-01-01

    Full Text Available Asymmetry of the frontal bristles and postocular setae was studied in samples from natural populations and laboratory colonies of Anastrepha sp. 1 aff. fraterculus, of A. sp. 2 aff. fraterculus, and in F1 hybrids obtained from laboratory reciprocal crosses. Natural populations were sampled in a zone of sympatry and in two geographically distant regions with different climatic conditions. Asymmetry was scored as the differences between the number of bristles and of setae on the right and left sides of the head, males and females analyzed independently. The two traits exhibited variability according to the model of fluctuating asymmetry (FA. No significant differences among samples were found in the FA of frontal bristles. A significant FA was observed for the postocular setae of A. sp. 1 males from a southern population (Vacaria, RS as compared to the asymmetry exhibited by males and females of some other samples. No significant differences in FA were observed among the interspecific hybrids and the laboratory samples of both parental species. The higher FA found in the males from Vacaria was attributed to climatic conditions prevailing in that region. The absence of a higher FA in hybrids may be related to the relatively recent evolutionary history of the two species.

  8. Ammonium carbonate is more attractive than apple and hawthorn fruit volatile lures to Rhagoletis pomonella (Diptera: Tephritidae) in Washington State.

    Science.gov (United States)

    Yee, Wee L; Nash, Meralee J; Goughnour, Robert B; Cha, Dong H; Linn, Charles E; Feder, Jeffrey L

    2014-08-01

    The apple maggot fly, Rhagoletis pomonella (Walsh), is an introduced, quarantine pest of apple (Malus domestica Borkhausen) in the Pacific Northwest of the United States. In the eastern United States where the fly is native, fruit volatiles have been reported to be more attractive than ammonia compounds to R. pomonella. However, the opposite may be true in the western United States. Here, we determined whether newly identified western apple and western hawthorn fruit volatiles are more attractive than ammonium carbonate (AC) to R. pomonella in apple, black hawthorn, and ornamental hawthorn trees in western Washington State. In all three host trees, sticky red sphere or yellow panel traps baited with AC generally caught more flies than traps baited with lures containing the four newly developed fruit blends (modified eastern apple, western apple, western ornamental hawthorn, and western black hawthorn) or two older blends (eastern apple and eastern downy hawthorn). Fruit volatiles also displayed more variation among trapping studies conducted at different sites, in different host trees, and across years than AC. The results imply that traps baited with AC represent the best approach to monitoring R. pomonella in Washington State.

  9. Are apple and hawthorn fruit volatiles more attractive than ammonium carbonate to Rhagoletis pomonella (Diptera: Tephritidae) in Washington state?

    Science.gov (United States)

    The apple maggot fly, Rhagoletis pomonella (Walsh), is an introduced, quarantine pest of apple (Malus domestica Borkhausen) in the Pacific Northwest of the U.S. In the eastern U.S. where the fly is native, fruit volatiles have been reported to be more attractive than ammonia compounds to R. pomonel...

  10. RHAGOLETIS COMPLETA (DIPTERA; TEPHRITIDAE DISTRIBUTION, FLIGHT DYNAMICS AND INFLUENCE ON WALNUT KERNEL QUALITY IN THE CONTINENTAL CROATIA

    Directory of Open Access Journals (Sweden)

    Božena Barić

    2015-06-01

    Full Text Available Walnut husk fly (WHF, Rhagoletis completa Cresson 1929 is an invasive species spreading quickly and damaging walnuts in Croatia and neighbouring countries. We researched distribution of this pest in the continental part of Croatia, flight dynamics in Međimurje County and its influence on quality of walnut kernels. CSALOMON®PALz traps were used for monitoring the spread and flight dynamics of R. completa. Weight and the protein content of kernels and the presence of mycotoxin contamination were measured. Walnut husk fly was found in six counties (Istria County: pest reconfirmation, Zagreb County, The City of Zagreb, Varaždin County, Međimurje County and Koprivnica-Križevci County. The presence of the fly was not confirmed on one site in Koprivnica-Križevci County (locality Ferdinandovac and in the eastern part of Croatia (Vukovar-Srijem County: Vinkovci locality. The flight dynamics showed rapid increase in number of adults only a year after the introduction into new area. The weight of infested kernels was 5.81% lower compared to not infested. Protein content was 14.04% in infested kernels and 17.31% in not infested kernels. There was no difference in mycotoxins levels. Additional researches on mycotoxin levels in stored nuts, ovipositional preferences of walnut husk fly and protection measures against this pest are suggested.

  11. Costly nutritious diets do not necessarily translate into better performance of artificaially reared fruit files (Diptera: Tephritidae)

    Science.gov (United States)

    Protein, lipid, carbohydrate and energy contents of three artificial diets (Xal2, Met1 and Met2) used for laboratory-rearing and mass-rearing the Mexican fruit fly, Anastrepha ludens (Loew), for a sterile insect technique (SIT) program were measured. The larval survival, pupation, pupal weight, adu...

  12. Solid phase microextraction of volatile emissions of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae): influence of fly sex, age, and mating status.

    Science.gov (United States)

    Alfaro, Cristina; Vacas, Sandra; Zarzo, Manuel; Navarro-Llopis, Vicente; Primo, Jaime

    2011-01-12

    Considerable efforts have been devoted to understanding the courtship behavior and pheromone communication of medflies; however, the sex pheromone composition is still a controversial subject. The discovery of new components affecting medfly behavior would be of interest for medfly control methods based on semiochemicals. This work describes volatile compounds emitted by Ceratitis capitata collected using solid phase microextraction. The volatile study was conducted according to an experimental design with three factors (sex, age, and mating status) assumed to be relevant for better understanding the chemical communication. Emission data were treated by means of principal component analysis, a statistical methodology not previously applied to the study of volatiles emitted by fruit flies. The characterization of emission patterns could be useful for the selection of compounds to be further investigated in biological assays to improve knowledge of the key semiochemicals involved in medfly behavior.

  13. Early detection and population monitoring of Ceratitis capitata (Diptera: Tephritidae) in a mixed-fruit orchard in northern Greece.

    Science.gov (United States)

    Papadopoulos, N T; Katsoyannos, B I; Kouloussis, N A; Hendrichs, J; Carey, J R; Heath, R R

    2001-08-01

    Population monitoring of the Mediterranean fruit fly,Ceratitis capitata (Wiedemann), was studied in 1998 in a mixed-fruit orchard in northern Greece, using International Pheromone McPhail traps (IPMT) baited with the female targeted attractants ammonium acetate, putrescine, and trimethylamine, and Jackson traps baited with the male specific parapheromone trimedlure. Special emphasis was placed on detecting the low initial adult population resulting from surviving overwintering larvae as early as possible in the spring and early summer. Traps were suspended on various host trees, using trap grid densities of either 15 or 1.5 traps per hectare. The first adults detected were females captured on 24 June in IPMT traps suspended on apricot trees, which are among the earliest maturing hosts in the area. From the end of July, the most effective trap was the IPMT trap placed on peaches, which followed apricots in the fruit ripening sequence. IPMT traps captured predominately females (approximately 80% of the total captures) and by far outperformed Jackson traps in early detection (the first males in Jackson traps were captured in August) as well as in total captures until mid-October. After mid-October, however, more flies were captured in Jackson traps. Comparing the performance of two trap grid densities on apple trees (the common host in the two grids), we found that in the high-density trap grid the first adults were detected 1 wk earlier than in the low-density trap grid. Our findings for this locality suggest that trap type and plant species on which traps are suspended are of key importance in early detection and population monitoring of C. capitata.

  14. Establishment of a colony of Anastrepha ludens (Diptera: Tephritidae) under relaxed mass-rearing conditions in Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Orozco-Davila, Dina; Hernandez, Refugio; Solis, Eduardo; Quintero, J. Luis; Dominguez, Julio, E-mail: dorozco1@prodigy.net.m [United States Department of Agriculture, Gainesville, FL (United States). Agricultural Research Service. Center for Medical, Agricultural, and Veterinary Entomology; Sigma Space Corporation, MD(United States); Programa Moscamed Moscafrut-Desarrollo de Metodos, Chiapas (Mexico)

    2006-07-01

    Several studies have suggested that maintaining a line of insects under laboratory conditions reduces their biological attributes. With this principle in mind, the mass production of Anastrepha ludens originating from a colony raised under relaxed rearing conditions was evaluated over a period of three years. The results of the evaluation indicated that insects kept under these conditions reached their larval maturity in 10 days, and attained a greater weight, which has a direct influence on pupal quality. In adult cages having a fly density of 70,000 individuals, there was a lower level of stress which favored fecundity. Fertility was apparently not affected by the cage density. These results suggest that keeping a production line under relaxed conditions optimizes insect production and promotes higher quality. (author)

  15. Characterisation of the chemical profiles of Brazilian and Andean morphotypes belonging to the Anastrepha fraterculus complex (Diptera, Tephritidae).

    Science.gov (United States)

    Vaníčková, Lucie; Břízová, Radka; Pompeiano, Antonio; Ferreira, Luana Lima; de Aquino, Nathaly Costa; Tavares, Raphael de Farias; Rodriguez, Laura D; Mendonça, Adriana de Lima; Canal, Nelson Augusto; do Nascimento, Ruth Rufino

    2015-01-01

    Fruit fly sexual behaviour is directly influenced by chemical and non-chemical cues that play important roles in reproductive isolation. The chemical profiles of pheromones and cuticular hydrocarbons (CHs) of eight fruit fly populations of the Andean, Brazilian-1 and Brazilian-3 morphotypes of the Anastrepha fraterculus cryptic species complex originating from Colombia (four populations) and Brazil (four populations) were analysed using two-dimensional gas chromatography with mass spectrometric detection. The resulting chemical diversity data were studied using principal component analyses. Andean morphotypes could be discriminated from the Brazilian-1 and Brazilian-3 morphotypes by means of male-borne pheromones and/or male and female CH profiles. The Brazilian-1 and Brazilian-3 morphotypes were found to be monophyletic. The use of chemical profiles as species- and sex-specific signatures for cryptic species separations is discussed.

  16. Capture of Anastrepha sororcula (Diptera: Tephritidae in McPhail and Jackson traps with food attractant and virgin adults

    Directory of Open Access Journals (Sweden)

    Christiane dos Santos Felix

    2009-02-01

    Full Text Available This stady evaluated the capture of A. sororcula in the traps baited with the conspecific virgin adults and food attractant in two orchards. The first was the orchard of the Universidade Federal da Grande Dourados (OUFGD and the second, the orchard of the Sindicato Rural de Dourados (OSRD. The capture of A. sororcula in McPhail and Jackson traps was carried out using the corn hydrolysed protein (CHP, control (no flies, virgin males (5, 10 and 15, five virgin females and five virgin couples. The average number of the flies caught in the traps with the corn hydrolysed protein was signifícantly higher than all the other treatments. There was no significant capture of A. sororcula females in the traps baited with the conspecific virgin males, females or the couples.As moscas-das-frutas constituem um grupo de pragas responsáveis por grandes prejuízos econômicos à fruticultura mundial. Anastrepha sororcula Zucchi, é a principal espécie de tefritídeo que ataca a goiaba em Mato Grosso do Sul. O objetivo desta pesquisa foi avaliar a captura de adultos de A. sororcula em armadilhas com atrativo alimentar e adultos virgens, em dois ambientes. Os bioensaios iniciaram-se com a criação de A. sororcula no Laboratório de Insetos Frugívoros da Universidade Federal da Grande Dourados (UFGD. As pesquisas de campo foram desenvolvidas nos pomares da UFGD e do Sindicato Rural de Dourados (SRD-MS. A captura de adultos de A. sororcula em armadilhas McPhail e Jackson foi avaliada para os tratamentos: proteína hidrolisada de milho, testemunha (sem moscas, machos virgens (5, 10 e 15, 5 fêmeas virgens e 5 casais. O número médio de indivíduos capturados nas armadilhas com proteína foi significativamente maior que nos demais tratamentos. O número médio de adultos de A. sororcula, capturado com o tratamento proteína no SRD foi significativamente superior ao do pomar da UFGD. Não ocorreu captura significativa de fêmeas de A. sororcula nas armadilhas com machos virgens co-específicos como atrativo.

  17. Ecological studies of Eastern Australian fruit flies (Diptera: Tephritidae) in their endemic habitat : I. Temporal variation in abundance.

    Science.gov (United States)

    Drew, R A I; Zalucki, M P; Hooper, G H S

    1984-10-01

    Fortnightly fruit fly captures for a 2-year period at Cooloola (south-east Queensland) contained 11 species. Three species, viz., D. tryoni, D. neohumeralis and D. endiandrae predominated. The peak trap catches of 7 species corresponded with the peak fruiting times of their major hosts. There was no direct relationship between temperature and rainfall and the variations in population numbers. The host plants of some species do not grow in the Cooloola area and there is evidence that large numbers of flies migrate into the region from other breeding areas up to 100 km away. Pockets of tropical rainforest such as Cooloola could be important adult fruit fly feeding areas even in the absence of larval host plants.

  18. Microsatellite analysis of the Queensland fruit fly Bactrocera tryoni (Diptera: Tephritidae) indicates spatial structuring: implications for population control.

    Science.gov (United States)

    Yu, H; Frommer, M; Robson, M K; Meats, A W; Shearman, D C; Sved, J A

    2001-04-01

    The population structure of a tephritid pest species, the Queensland fruit fly Bactrocera tryoni (Froggatt), has been analysed over a five year period (1994-1998), using six microsatellites. Adult fly samples were collected to cover most regions of eastern and central Australia where the flies are regularly found. Tests for heterogeneity indicated that flies within geographically defined regions were homogeneous. The samples were allocated into five regions, including one very large region, Queensland, which encompasses that portion of the fly's range where breeding can occur year-round. With one exception, the collections from different regions were homogeneous between years, showing a fairly static distribution of the species. However, differences between regions were highly significant. The one case of a change in frequency between years indicated a gradual replacement of flies in a marginal region by flies from the main part of the range. The finding of stability in the distribution of a highly mobile insect is of interest, potentially also for other species which have expanded beyond their native range. It is argued that a contributing reason for this stability may be adaptation to different climatic regimes, and that strategies for control based on this hypothesis afford a reasonable chance of success.

  19. Raspberry Ketone Analogs: Vapour Pressure Measurements and Attractiveness to Queensland Fruit Fly, Bactrocera tryoni (Froggatt (Diptera: Tephritidae.

    Directory of Open Access Journals (Sweden)

    Soo J Park

    Full Text Available The Queensland fruit fly, Bactrocera tryoni (Froggatt (Q-fly, is a major horticultural pest in Eastern Australia. Effective monitoring, male annihilation technique (MAT and mass trapping (MT are all important for control and require strong lures to attract flies to traps or toxicants. Lure strength is thought to be related in part to volatility, but little vapour pressure data are available for most Q-fly lures. Raspberry ketone (4-(4-hydroxyphenyl-2-butanone and analogs that had esters (acetyl, difluoroacetyl, trifluoroacetyl, formyl, propionyl and ethers (methyl ether, trimethylsilyl ether in replacement of the phenolic group, and in one case also had modification of the 2-butanone side chain, were measured for their vapour pressures by differential scanning calorimetry (DSC, and their attractiveness to Q-fly was assessed in small cage environmentally controlled laboratory bioassays. Maximum response of one category of compounds, containing both 2-butanone side chain and ester group was found to be higher than that of the other group of compounds, of which either of 2-butanone or ester functionality was modified. However, linear relationship between vapour pressure and maximum response was not significant. The results of this study indicate that, while volatility may be a factor in lure effectiveness, molecular structure is the dominating factor for the series of molecules investigated.

  20. Efficacy of Chemicals for the Potential Management of the Queensland Fruit Fly Bactrocera tryoni (Froggatt) (Diptera: Tephritidae).

    Science.gov (United States)

    Reynolds, Olivia L; Osborne, Terrence J; Barchia, Idris

    2017-05-09

    This study investigated alternative in-field chemical controls against Bactrocera tryoni (Froggatt). Bioassay 1 tested the mortality of adults exposed to fruit and filter paper dipped in insecticide, and the topical application of insecticide to adults/fruit. Bioassay 2 measured the mortality of adults permitted to oviposit on fruit dipped in insecticide and aged 0, 1, 3, or 5 days, plus the production of offspring. Bioassay 3 tested infested fruit sprayed with insecticide. The field bioassay trialed the mortality of adults exposed to one- and five-day insecticide residues on peaches, and subsequent offspring. Abamectin, alpha-cypermethrin, clothianidin, dimethoate (half-label rate), emamectin benzoate, fenthion (half- and full-label rate), and trichlorfon were the most efficacious in bioassay 1, across 18 tested insecticide treatments. Overall, the LT50 value was lowest for fenthion (full-label rate), clothianidin, and alpha-cypermethrin. Fenthion, emamectin benzoate, and abamectin had the greatest effect on adult mortality and offspring production. Infested fruit treated with acetamiprid, fenthion, and thiacloprid produced no/very few offspring. Alpha-cypermethrin demonstrated good field efficacy against adults (one day post treatment: 97.2% mortality, five day post treatment: 98.8% mortality) and subsequent offspring (100% across one and five day post treatments), comparable to that of fenthion (full-label rate) (100% mortality for offspring and adults across both post treatments). Alpha-cypermethrin is a possible alternative to fenthion against B. tryoni ; as a pyrethroid, it may not be desirable if adjunct biological control is imperative. Thiacloprid and Acetamiprid may be useful as a post-harvest treatment.

  1. Efficacy of Chemicals for the Potential Management of the Queensland Fruit Fly Bactrocera tryoni (Froggatt (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Olivia L. Reynolds

    2017-05-01

    Full Text Available This study investigated alternative in-field chemical controls against Bactrocera tryoni (Froggatt. Bioassay 1 tested the mortality of adults exposed to fruit and filter paper dipped in insecticide, and the topical application of insecticide to adults/fruit. Bioassay 2 measured the mortality of adults permitted to oviposit on fruit dipped in insecticide and aged 0, 1, 3, or 5 days, plus the production of offspring. Bioassay 3 tested infested fruit sprayed with insecticide. The field bioassay trialed the mortality of adults exposed to one- and five-day insecticide residues on peaches, and subsequent offspring. Abamectin, alpha-cypermethrin, clothianidin, dimethoate (half-label rate, emamectin benzoate, fenthion (half- and full-label rate, and trichlorfon were the most efficacious in bioassay 1, across 18 tested insecticide treatments. Overall, the LT50 value was lowest for fenthion (full-label rate, clothianidin, and alpha-cypermethrin. Fenthion, emamectin benzoate, and abamectin had the greatest effect on adult mortality and offspring production. Infested fruit treated with acetamiprid, fenthion, and thiacloprid produced no/very few offspring. Alpha-cypermethrin demonstrated good field efficacy against adults (one day post treatment: 97.2% mortality, five day post treatment: 98.8% mortality and subsequent offspring (100% across one and five day post treatments, comparable to that of fenthion (full-label rate (100% mortality for offspring and adults across both post treatments. Alpha-cypermethrin is a possible alternative to fenthion against B. tryoni; as a pyrethroid, it may not be desirable if adjunct biological control is imperative. Thiacloprid and Acetamiprid may be useful as a post-harvest treatment.

  2. Specialized Pheromone and Lure Application Technology as an Alternative Male Annihilation Technique to Manage Bactrocera tryoni (Diptera: Tephritidae).

    Science.gov (United States)

    Reynolds, O L; Osborne, T; Crisp, P; Barchia, I M

    2016-03-27

    The results of this study suggest that a novel male annihilation technique (specialized pheromone and lure application technology [SPLAT] incorporating cue-lure [CL] plus spinosad) is as effective as industry standard male annihilation controls, and is worth exploring further to manageBactrocera tryoni(Froggatt) populations. Three lures were evaluated in a contact and feeding bioassay and a cage attractancy trial: 1) SPLAT-CL + spinosad; 2) SPLAT-CL without spinosad; and 3) wick-CL + malathion. In a field attraction trial, lures (1) and (3) were evaluated with a third treatment, caneite blocks-CL + malathion. Lures were weathered for 0, 1, 2, 4, or 8 wk, with an additional weathering treatment of 12 wk included in the field trial. In the contact and feeding bioassay, lures with SPLAT-CL + spinosad were >97% effective at 48 h for up to 2 wk weathering; however, wicks-CL + malathion killedB. tryoniwithin 2 h of exposure under all weathering periods. In the cage attractancy trial, SPLAT-CL + spinosad was as effective as, or performed better than, wicks-CL + malathion under all weathering treatments. The field study trap catches were similar for SPLAT-CL + spinosad and blocks-CL + malathion, and both had higher trap catches than wicks-CL + malathion at all weathering periods, except week 12. Overall, SPLAT-CL + spinosad compared favorably with current standard techniques for male annihilation and warrants further research. SPLAT-CL + spinosad may be a reduced-risk alternative for wicks-CL + malathion or blocks-CL + malathion forB. tryoniand other CL-responding fruit flies, such asBactrocera cucurbitaeCoquillett, because it contains a reduced-risk insecticide that poses a lower risk to humans and the environment and does not require labor-intensive handling and placement. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. Ultrastructure of male reproductive accessory glands and ejaculatory duct in the Queensland fruit fly, Bactrocera tryoni (Diptera: Tephritidae).

    Science.gov (United States)

    Radhakrishnan, Preethi; Marchini, Daniela; Taylor, Phillip W

    2009-05-01

    Ultrastructure of male reproductive accessory glands and ejaculatory duct in the Queensland fruit fly (Q-fly), Bactrocera tryoni, were investigated and compared with those of other tephritid flies. Male accessory glands were found to comprise one pair of mesodermic glands and three pairs of ectodermic glands. The mesodermic accessory glands consist of muscle-lined, binucleate epithelial cells, which are highly microvillated and extrude electron-dense secretions by means of macroapocrine transport into a central lumen. The ectodermic accessory glands consist of muscle-lined epithelial cells which have wide subcuticular cavities, lined with microvilli. The electron-transparent secretions from these glands are first extruded into the cavities and then forced out through small pores of the cuticle into the gland lumen. Secretions from the two types of accessory glands then flow into the ejaculatory duct, which is highly muscular, with epithelial cells rich in rough endoplasmic reticulum and lined with a thick, deeply invaginated cuticle. While there are some notable differences, reproductive accessory glands of male Q-flies generally resemble those of the olive fruitfly, Bactrocera oleae, and to a lesser extent the Mediterranean fruit fly, Ceratitis capitata.

  4. Efficacy of Chemicals for the Potential Management of the Queensland Fruit Fly Bactrocera tryoni (Froggatt) (Diptera: Tephritidae)

    OpenAIRE

    Reynolds, Olivia L.; Osborne, Terrence J.; Barchia, Idris

    2017-01-01

    This study investigated alternative in-field chemical controls against Bactrocera tryoni (Froggatt). Bioassay 1 tested the mortality of adults exposed to fruit and filter paper dipped in insecticide, and the topical application of insecticide to adults/fruit. Bioassay 2 measured the mortality of adults permitted to oviposit on fruit dipped in insecticide and aged 0, 1, 3, or 5 days, plus the production of offspring. Bioassay 3 tested infested fruit sprayed with insecticide. The field bioassay...

  5. Raspberry Ketone Analogs: Vapour Pressure Measurements and Attractiveness to Queensland Fruit Fly, Bactrocera tryoni (Froggatt) (Diptera: Tephritidae).

    Science.gov (United States)

    Park, Soo J; Morelli, Renata; Hanssen, Benjamin L; Jamie, Joanne F; Jamie, Ian M; Siderhurst, Matthew S; Taylor, Phillip W

    2016-01-01

    The Queensland fruit fly, Bactrocera tryoni (Froggatt) (Q-fly), is a major horticultural pest in Eastern Australia. Effective monitoring, male annihilation technique (MAT) and mass trapping (MT) are all important for control and require strong lures to attract flies to traps or toxicants. Lure strength is thought to be related in part to volatility, but little vapour pressure data are available for most Q-fly lures. Raspberry ketone (4-(4-hydroxyphenyl)-2-butanone) and analogs that had esters (acetyl, difluoroacetyl, trifluoroacetyl, formyl, propionyl) and ethers (methyl ether, trimethylsilyl ether) in replacement of the phenolic group, and in one case also had modification of the 2-butanone side chain, were measured for their vapour pressures by differential scanning calorimetry (DSC), and their attractiveness to Q-fly was assessed in small cage environmentally controlled laboratory bioassays. Maximum response of one category of compounds, containing both 2-butanone side chain and ester group was found to be higher than that of the other group of compounds, of which either of 2-butanone or ester functionality was modified. However, linear relationship between vapour pressure and maximum response was not significant. The results of this study indicate that, while volatility may be a factor in lure effectiveness, molecular structure is the dominating factor for the series of molecules investigated.

  6. Raspberry Ketone Analogs: Vapour Pressure Measurements and Attractiveness to Queensland Fruit Fly, Bactrocera tryoni (Froggatt) (Diptera: Tephritidae)

    OpenAIRE

    Park, Soo J.; Morelli, Renata; Hanssen, Benjamin L.; Jamie, Joanne F.; Jamie, Ian M.; Siderhurst, Matthew S.; Taylor, Phillip W.

    2016-01-01

    The Queensland fruit fly, Bactrocera tryoni (Froggatt) (Q-fly), is a major horticultural pest in Eastern Australia. Effective monitoring, male annihilation technique (MAT) and mass trapping (MT) are all important for control and require strong lures to attract flies to traps or toxicants. Lure strength is thought to be related in part to volatility, but little vapour pressure data are available for most Q-fly lures. Raspberry ketone (4-(4-hydroxyphenyl)-2-butanone) and analogs that had esters...

  7. Sexual Competitiveness of Anastrepha ludens (Diptera: Tephritidae) Males Exposed to Citrus aurantium and Citrus paradisi Essential Oils.

    Science.gov (United States)

    Morató, Santiago; Shelly, Todd; Rull, Juan; Aluja, Martin

    2015-04-01

    Males of the Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) display increased mating competitiveness following exposure to the odor of certain host and nonhost plants, and this phenomenon has been used in the sterile insect technique to boost the mating success of released, sterile males. Here, we aimed to establish whether males of the Mexican fruit fly (Anastrepha ludens (Loew)) gain a mating advantage when exposed to the aroma of two preferred hosts, grapefruit (Citrus paradisi Macfadyen) and bitter orange (Citrus aurantium L.). Under seminatural conditions, we observed that, in trials using wildish males (from a young laboratory colony started with wild flies) exclusively, exposure to the aroma of bitter orange had no effect on male mating success but exposure to the odor grapefruit oil increased male mating success significantly. In a separate test involving both exposed and nonexposed wildish and mass-reared, sterile males, although wildish males were clearly more competitive than sterile males, exposure to grapefruit oil had no detectable effect on either male type. Exposure to oils had no effect on copulation duration in any of the experiments. We discuss the possibility that the positive effect of grapefruit essential oils on wildish male competitiveness may have been linked to exposure of females to grapefruit as a larval food, which may have imprinted them with grapefruit odors during pupal eclosion and biased their response as adults to odors of their maternal host. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. [Fruit flies (Diptera: Tephritidae) and their parasitoids (Hymenoptera: Braconidae) associated to host plants in the southern region of Bahia State].

    Science.gov (United States)

    Bittencourt, M A L; da Silva, A C M; Silva, V E S; Bomfim, Z V; Guimarães, J A; de Souza Filho, M F; Araujo, E L

    2011-01-01

    The association among Anastrepha species, braconid parasitoids and host fruits in southern Bahia is recorded. Doryctobracon areolatus (Szépligeti) was associated with A. serpentina (Wied.) in Pouteria caimito, A. bahiensis Lima in Helicostylis tomentosa, A. sororcula Zucchi in Eugenia uniflora, and A. obliqua (Macquart) in Spondias purpurea. Anatrepha obliqua was unique in fruits of Averrhoa carambola, but associated with D. areolatus, Asobara anastrephae (Muesebeck) and Utetes anastrephae (Viereck). In Achras sapota, A. serpentina was associated with A. anastrephae and D. areolatus, while in Psidium guajava, A. fraterculus (Wied.) and A. sororcula were associated with D. areolatus and U. anastrephae.

  9. Genetic diversity and population structure of Anastrepha striata (Diptera: Tephritidae) in three natural regions of southwestern Colombia using mitochondrial sequences.

    Science.gov (United States)

    Gallo-Franco, Jenny Johana; Velasco-Cuervo, Sandra Marcela; Aguirre-Ramirez, Elkin; González Obando, Ranulfo; Carrejo, Nancy Soraya; Toro-Perea, Nelson

    2017-02-01

    Anastrepha striata is widely distributed across the Americas and is a pest of economically important crops, especially crops of the Myrtaceae family. Insect population structures can be influenced by the presence of physical barriers or characteristics associated with habitat differences. This study evaluated the effect of the Western Andes on the population structure of A. striata. Individuals were collected from Psidium guajava fruits from three natural regions of southwestern Colombia (Pacific Coast, mountainous region and the inter-Andean valley of the Cauca River). Based on a 1318 bp concatenated of the genes Cytochrome Oxidase subunit I (COI) and NADH dehydrogenase subunit 6 (ND6), 14 haplotypes with few changes among them (between 1 and 3) were found. There was only one dominant haplotype in all three regions. No genetic structure associated with the three eco-geographical regions of the study was found. Moreover, the Western Andes are not an effective barrier for the genetic isolation of the populations from the Pacific Coast compared with the inter-Andean valley populations. This genetic homogeneity could be partially due to anthropogenic intervention, which acts as a dispersal agent of infested fruits. Another hypothesis to explain the lack of structure would be the relatively recent arrival of A. striata to the region, as indicated by an analysis of the demographic history, which reveals a process of population expansion. This study represents the first attempt to understand the population genetics of A. striata in Colombia and could contribute to the integral management of this pest.

  10. Intensity of Attack Caused by Mediterranean Fruit Fly Ceratitis capitata Wiedem. (Diptera, Tephritidae on Mandarin along the Montenegrin Seacoast

    Directory of Open Access Journals (Sweden)

    Sanja Radonjić

    2011-01-01

    Full Text Available Along the Montenegrin seacoast, all cultivated citrus species (mandarin, orange, lemon,grapefruit, fig, loquat and ziziphus were detected as host plants of the Ceratitis capitata Wiedem.Among those found, in economic sense, the most important host plant is mandarinUnšiu.Intensity of the attack were monitored on mandarin in 2003 and 2004 in localities Baošići,Lastva Grbaljska and Bar, and was determined as higher in 2003. The first symptoms ofattack were detected, depending on locality, from middle of September until beginning ofOctober, one to two months earlier then in 2004. The maximum number of larvae per fruitwere detected in October and November (average from 13.44±0.16 to 22.82±0.13. Timeof the first symptoms appearence on mandarin in September and October 2003 and in November2004, indicate on crucial importance of alternative host plants (figs and loquat forreproduction and increasing of C. capitata population, because later during a season its intensityof attack on mandarin, depend largely on their presence.

  11. Antennal responses of West Indian and Caribbean fruit flies (Diptera: Tephritidae) to ammonium bicarbonate and putrescine lures

    Science.gov (United States)

    Efforts to monitor and detect tephritid fruit flies in the genus Anastrepha currently involve MultiLure traps baited with two food-based synthetic attractants; ammonium acetate and putrescine (1,4-diaminobutane). These baits are used in Central America, Florida, Texas, and the Caribbean, each region...

  12. Notes on the frugivorous fruit fly (Diptera: Tephritidae fauna of western Africa, with description of a new Dacus species

    Directory of Open Access Journals (Sweden)

    Kim F.M. Goodger

    2013-07-01

    Full Text Available The species richness of the frugivorous fruit fly fauna of western African (in particular of Ivory Coast, Ghana, Togo, Benin and Nigeria is discussed. The diversity is compared at a national level and between the ecoregions within the national boundaries of the study area. A new species, Dacus goergeni sp. nov. is described and additional taxonomic notes are presented.

  13. Country Checklist of Rhagoletis Loew (Diptera: Tephritidae for Europe, with Focus on R. Batava and Its Recent Range Expansion

    Directory of Open Access Journals (Sweden)

    Stalažs Arturs

    2017-06-01

    Full Text Available This work is intended as a country checklist of fruit flies Rhagoletis Loew, 1862 for Europe (including transcontinental countries - Kazakhstan and Turkey, based on recent records, wherein we recognise 15 Rhagoletis species, including five species occurring in the Asian part of Kazakhstan. During the past 10-15 years, three species, Rhagoletis batava Hering, 1958, R. cingulata (Loew, 1862, and R. completa Cresson, 1929, have rapidly expanded their distribution range in Europe. We traced the potential route of an aggressive R. batava population movement into Europe, and it is postulated that this R. batava race originated from Siberia. R. batava was initially documented outside its natural range in 2001 in the European part of the Russian Federation. Later, this species was recorded in other territories to the west of Russia - Belarus (2010, Latvia (2011, Lithuania (2012, Germany (2013, and Poland (2014. In Germany and Poland, R. batava probably has both native and alien status.

  14. Fitness of Mass-Reared Males of Anastrepha obliqua (Diptera: Tephritidae) Resulting From Mating Competition Tests in Field Cages.

    Science.gov (United States)

    Hernández, Emilio; Liedo, Pablo; Toledo, Jorge; Montoya, Pablo; Perales, Hugo; Ruiz-Montoya, Lorena

    2017-10-11

    The sterile insect technique uses males that have been mass-reared in a controlled environment. The insects, once released in the field, must compete to mate. However, the mass-rearing condition supposes a loss of fitness that will be noticeable by wild females. To compare the fitness of wild males and mass-reared males, three competition settings were established. In setting 1, wild males, mass-reared males and wild females were released in field cages. In setting 2, wild females and wild males were released without competition, and in setting 3, mass-reared males and mass-reared females were also released without competition. Male fitness was based on their mating success, fecundity, weight and longevity. The fitness of the females was measured based on weight and several demographic parameters. The highest percentage of mating was between wild males and wild females between 0800 and 0900 h in the competition condition, while the mass-reared males started one hour later. The successful wild males weighed more and showed longer mating times, greater longevity and a higher number of matings than the mass-reared males. Although the mass-reared males showed the lowest percentage of matings, their fecundity when mating with wild females indicated a high fitness. Since the survival and fecundity of wild females that mated with mass-reared males decreased to become similar to those of mass-reared females that mated with mass-reared males, females seem to be influenced by the type of male (wild or mass-reared). © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  15. Histologia y morfologia del sistema reproductor en hembras de Rhagoletis conversa (Brethes y de Rhagoletis nova (Schimer (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Verónica Flores Rojas

    1987-01-01

    Full Text Available The histology and morphology of the reproductive system of females of Rhagoletis conversa (Brèthes and Rhagoletis nova (Schiner were studied. These species parasitize wild and cultivated Solanaceae respectively. Adult females of both species were collected in natural populations in the Central Zone of Chile. In order to study the development of ovaries the females collected were sacrificed at different ages. Once obtained, ovaries were preparedfor optical microscopy by using histological and squash standard techniques. Results show that within each one of ovarioles it can be observed follicles arranged in line and showing different stages of maduration. It can be described about 6 follicle stages in the ovarioles studied. Ovaries of both species show a very similar structure. However, females of Rhagoletis nova show an ovipositor wider than R. conversa. The number of ovarioles of R. nova is also higher than in R. conversa.

  16. Capture of Anastrepha suspensa and sterile male Ceratitis capitata (Diptera: Tephritidae) in multilure traps versus phase 4 traps

    Science.gov (United States)

    Field trials were conducted in south Florida to compare capture of wild Caribbean fruit flies, Anastrepha suspensa (Loew), and sterile male Mediterranean fruit flies, Ceratitis capitata (Wiedemann), in Multilure traps, which are McPhail-type traps that use an aqueous solution to retain attracted fli...

  17. Attraction and electroantennogram responses of male Mediterranean fruit fly (Diptera: Tephritidae) to volatile chemicals from Persea, Litchi and Ficus wood

    Science.gov (United States)

    Trimedlure is the most effective male-targeted lure for the Mediterranean fruit fly, Ceratitis capitata (Wiedemann). A similar response is elicited by plant substances that contain a-copaene, a naturally-occurring sesquiterpene. a-copaene is a complex, highly-volatile, widely-distributed plant comp...

  18. Effects of different protein concentrations on longevity and feeding behavior of two adult populations of Ceratitis capitata Wiedemann (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Placido-Silva, Maria do Carmo; Silva Neto, Alberto M. da; Joachim-Bravo, Iara S. [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Dept. de Biologia Geral; Zucoloto, Fernando S. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia Ciencias e Letras. Dept. de Biologia

    2006-11-15

    The effects of protein intake on two adult male and female populations of Ceratitis capitata Wiedemann were assessed. One population consisted of flies reared for twenty years in the laboratory (Lab-pop); the other population consisted both of flies reared in the laboratory for approximately fifteen years and of the periodically introduced wild flies (Hybrid-pop). Three diets were tested: a no-yeast diet and two diets containing yeast (protein source) at the concentrations 6.5 g or 1.5 g per 100 ml diet. The parameters analyzed were: adult longevity, diet intake with and without yeast, and discrimination threshold for yeast. Protein intake increased Lab-pop adult longevity and did not affect longevity of the Hybrid-pop. Longevity in each population was similar for males and females fed on the same diet. Food behavior were similar for male and female adults of both populations; all preferred diets containing protein (yeast). Males and females in both populations ingested similar amounts of each diet. The discrimination threshold for yeast was similar for all males (0.5 g yeast/100 ml diet); Lab-pop females were able to detect the presence of smaller quantities of yeast in their diet, thus having a higher discrimination capacity (0.4 g/100 ml diet) as compared to the Hybrid-pop females (0.6 g/ 100 ml diet). (author)

  19. Rhythmicity of Bactrocera cucurbitae (Diptera:Tephritidae) attraction to cuelure: Insights from an interruptable lure and computer vision

    Science.gov (United States)

    We describe and validate an Agent-Based Simulation (ABS) of invasive insects and use it to investigate the time to extirpation of Ceratitis capitata using data from seven outbreaks that occurred in California from 2008-2010. Results are compared with the length of intervention and quarantine imposed...

  20. MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE EM POMARES DA ÁREA URBANA NO NORTE DE MINAS GERAIS

    Directory of Open Access Journals (Sweden)

    CLARICE DINIZ ALVARENGA

    2010-01-01

    Full Text Available The aim this work was know the species of fruit fly and host plants in orchards in the urban area in the north of Minas Gerais. Were selected 10 orchards with wide variety of fruit species, which were distributed in equidistant way in the urban area of Janaúba, MG. Weekly, were collected systematically fruit flies through trap type McPhail and ripe fruit and in ripening one, on those orchards. Were collected 7.016 tephritid obtained from trap (5.226 and fruit (1.790, from which 1.044 belonged to genus Anastrepha and 5.972 were Ceratitis capitata. The specimens number of C. capitata (85.1% was around six times superior to Anastrepha spp. (14.9%, demonstrating the preference of this species for urban orchards. Eight species of Anastrepha occur in urban orchards of Janaúba, MG. Ceratitis capitata was found infesting 10 species of host fruits, being the main S. purpurea and guava. In fruits were collected three species of Anastrepha (A. obliqua, A. sororcula and A. zenildae which were associated with five species of fruit (Malpighia glabra L, Psidium guayava L, S. dulcis, S. purpurea and S. tuberosa. The predominant species of Anastrepha was A. obliqua, and S. tuberosa and S. purpurea being the main hosts of this species in the urban area of Janaúba, MG.

  1. Captures of bactrocera fruit flies (Diptera: Tephritidae) and nontarget insects in biolure and torula yeast traps in Hawaii

    Science.gov (United States)

    BioLure, a synthetic food attractant for Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) that uses a combination of three chemical components (ammonium acetate, trimethylamine hydrochloride and putrescine), was deployed in MultiLure traps in predominantly native forests, non-native forests,...

  2. Influence of protein on feeding behavior of Ceratitis capitata Wiedemann (Diptera: Tephritidae): comparison between immature males and females

    Energy Technology Data Exchange (ETDEWEB)

    Placido-Silva, Maria do C.; Joachim-Bravo, Iara S. [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Inst. de Biologia. Dept. de Biologia Geral; Zucoloto, Fernando S. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Dept. de Biologia

    2005-07-15

    The objective of this work was to compare the influence of dietary protein on performance and feeding behavior of immature males and females of Ceratitis capitata (Wiedemann). The protein source was beer yeast at 6.5 and 1.5 g.100 ml-1. The following parameters were evaluated: percentage of emergence, total life cycle, adult size, diet consumption, feeding preference and discrimination threshold for yeast. Immature adults showed similar protein requirements regardless of sex. Both males and females showed similar feeding behavior, preferring to feed on the diet with higher protein content. The discrimination threshold for levedure in both sexes was 0.4 g.100 ml-1. We concluded that immature males of C. capitata show similar protein requirements as the immature females. (author)

  3. Capacidad dispersiva de Ceratitis capitata (Diptera: Tephritidae entre valles agrícolas en San Juan, Argentina

    Directory of Open Access Journals (Sweden)

    Leonardo M. DÍAZ

    2008-01-01

    Full Text Available Ceratitis capitata (Wiedemann, díptero tefrítido cosmopolita originario del norte de África, es la principal plaga de los frutales en muchos países de América. El objetivo de este trabajo fue conocer las características de la capacidad de dispersión de Ceratitis capitata , mediante la liberación de moscas estériles en condiciones de campo, con el propósito de predecir las posibles invasiones de valles agrícolas vecinos. Se liberaron 54.000 moscas estériles marcadas de ambos sexos, en localidades del valle de Tulum, cercanas a los ingresos de los valles de Ullum y Zonda. Para el monitoreo del vuelo dispersivo se instalaron trampas Jackson y Mc Phail. Se capturaron 1.213 adultos durante el periodo de muestreo. No hubo propagación de los adultos liberados desde el valle de Tulum a los valles de Ullum y Zonda. La presencia de hospederos, posición geográfica de cada Quebrada y la orientación respecto al viento predominante, podrían explicar la diferencia de difusión entre ambas Quebradas. La dispersión duró cinco semanas. La distancia media de los adultos liberados fue de 3.764 m (S= 2.897 m sin encontrar diferencias entre ambos sexos.

  4. Response of Ceratitis capitata, Bactrocera dorsalis, and Bactrocera cucurbitae (Diptera:Tephritidae) to metabolic stress disinfection and disinfestation treatment

    Science.gov (United States)

    Metabolic stress disinfection and disinfestation (MSDD) is a postharvest treatment designed to control pathogens and arthropod pests on commodities that combines short cycles of low pressure/vacuum and high CO2 with ethanol vapor. Experiments were conducted to evaluate the effect of MSDD treatment o...

  5. Treatment post harvest of Citrus sinensis infested with Ceratitis capitata (Wied., 1824) (Diptera: Tephritidae) using gamma radiation

    Energy Technology Data Exchange (ETDEWEB)

    Albergaria, Nuno M.M. Soares de; Bortoli, Sergio A. de, E-mail: nmendes@terra.com.b, E-mail: bortoli@fcav.unesp.b [UNESP, Jaboticabal, SP (Brazil). Faculdade de Ciencias Agrarias e Veterinarias. Depto. de Fitossanidade; Doria, Hayda O.S., E-mail: hosd75@terra.com.b [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Medicina. Dept. de Biologia; Arthur, Valter, E-mail: varthur@cena.usp.b [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil). Lab. de Radiobiologia e Ambiente

    2009-07-01

    This work was carried out to evaluate the effect of irradiation on fruit fly (Ceratitis capitata) eggs and larvae (first, second, third instars), in 'Valencia' oranges; and evaluate the effect of the irradiation on the chemical composition of the fruits. Fruits were artificially infested with the immature stages of the fruit fly and treated with 0, 10, 20, 30, 40, 50, 100, 150 and 200 Gy Cobalt-60 doses. By the results obtained it is possible to conclude that: third instar larvae are more tolerant to irradiation treatments; the dose of 50 Gy causes sterility to the adults emerged from all immature stages irradiated. (author)

  6. Relación entre tiempo de desarrollo larvario y fecundidad de la hembra en Ceratitis capitata (Diptera:Tephritidae

    Directory of Open Access Journals (Sweden)

    Fanny C. MANSO

    2006-01-01

    Full Text Available Se estudió la relación entre tiempo de desarrollo larvario y fecundidad en la hembra de Ceratitis capitata Wiedemann, comparando individuos de una cepa salvaje, con individuos de una cepa portadora de la mutación sw, la cual provoca atrasos en el desarrollo larvario. Se observaron caracteres de la morfología del ovario y su herencia entre los segregantes, para «tiempo de desarrollo» en la progenie del cruzamiento entre mutante y silvestre. El estudio mostró que las hembras sw(- que quedan muy retrasadas en su desarrollo, tienen menos ovariolas y una distribución de tamaños de óvulos menos homogénea que las que se desarrollan antes. Se encontró asimismo que entre las larvas de tipo salvaje, las más retrasadas también producen hembras con menor número de ovariolas y menos huevos totalmente desarrollados, que las que se desarrollan antes. Tanto en las hembras sw(- como en las sw(+, los atrasos del desarrollo obran en desmedro de la postura de huevos de las hembras que se desarrollan más tarde, efecto que se manifiesta en el número menor de ovariolas y en las diferencias del ritmo de maduración del ovario. Bajo condiciones apropiadas de cría, las hembras mutantes para sw son capaces de alcanzar la misma fecundidad que las normales.

  7. Development of a transgenic sexing system based on female-specific embryonic lethality in Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    The Sterile Insect Technique (SIT) is more efficient and cost-effective when only sterile males are released. A female-specific lethality system based on a female-specifically spliced intron was developed for transgenic sexing in Ceratitis capitata (Fu et al., 2007) possibly to overcome the fitness ...

  8. Performance of Psyttalia humilis (Hymenoptera: Braconidae) reared from irradiated host on olive fruit fly (Diptera: Tephritidae) in California

    Science.gov (United States)

    The parasitoid Psytallia humilis (Silvestri) was reared on Mediterranean fruit fly, Ceratitis capitata (Wiedemann), larvae irradiated at different doses from 0-70 Gy at the USDA, APHIS, PPQ, Moscamed biological control laboratory in San Miguel Petapa, Guatemala and shipped to the USDA, ARS, Parlier,...

  9. Description of third instar larvae of Ceratitis fasciventris, C. anonae, C. rosa (FAR complex) and C. capitata (Diptera, Tephritidae)

    Science.gov (United States)

    Steck, Gary J.; Ekesi, Sunday

    2015-01-01

    Abstract Third instar larvae of members of the Ceratitis FAR complex, including Ceratitis fasciventris (Bezzi), Ceratitis anonae Graham, and Ceratitis rosa Karsch are described and compared with those of Ceratitis capitata (Wiedemann). Diagnostic characters, such as presence vs. absence of a secondary tooth on the mandibles, previously used to separate Ceratitis capitata from Ceratitis rosa, are shown to vary in each species. Significant variation in diagnostic morphological characters among populations of Ceratitis rosa from east and south Africa is documented; however, the differences are not simply congruent with the R1 and R2 designations based on other studies. Quantitative measures of numerous morphological characters are consistently smaller in the larvae of Ceratitis fasciventris and distinguish them from other species of the FAR complex. Larvae of Ceratitis capitata can be distinguished from those of the FAR complex by characters such as absence of accessory plates of the oral ridges, the shape of the anterior spiracle, and the pattern of dorsal spinules. Previous studies indicated that absence of accessory lobes separate the genus Ceratitis from Bactrocera, but this is shown to be incorrect, as accessory lobes are in fact present in several species of Ceratitis. PMID:26798272

  10. Dispersion of the Mediterranean Fruit Fly Ceratitis capitata Wiedem. (Diptera: Tephritidae in Mandarin Orchards on Montenegrin Seacoast

    Directory of Open Access Journals (Sweden)

    Sanja Radonjić

    2013-01-01

    Full Text Available The Mediterranean fruit fly Ceratitis capitata Widem. has been an established pest onthe Montenegrin seacoast for more than ten years, although with variable abundance indifferent years and localities.From an economic aspect, its most important host in Montenegro is the mandarinunshiu (Citrus unshiu Marc., particularly its cultivar Owari. Dispersion of C. capitata in citrusorchards (prevailingly mandarin was monitored on Baošići, Lastva Grbaljska and Bar localitiesduring 2003 and 2004.The results of this study showed that, during both years, peripheral-row trees (primarily thefirst row in citrus orchards were more exposed to attacks by C. capitata than middle and lastrows. In 2003, the average number of larvae in mandarin fruits in first rows varied from 11.4±0.59to 40.1±0.67, from 7.04±0.47 to 28.8±0.48 and from 2.9±0.07 to 17.3±0.54 on the localities ofBaošići, Lastva Grbaljska and Bar, respectively. On the same localities, it ranged from 7.4±0.34 to16.9±0.4, from 0.0 to 18.7±0.32 and from 0.0 to 9.93±0.56 in middle rows, and from 3.0±0.28 to16.8±0.77, from 0.0 to 20.9±0.38 and from 0.0 to 13.1±0.39 in last rows. Data collected at Baošići,Lastva Grbaljska and Bar in 2003 also suggest that the average number of larvae per mandarinfruit in first rows was 1.78-2.08 times higher than in middle rows, and 1.25-1.77 times higher thanin last rows. In 2004, the average number of larvae in mandarin fruits in first rows varied from7.3±0.27 to 8.3±0.45, from 7.2±0.23 to 17.6±0.59 and from 3.8±0.1 to 8.8±0.25 on the localitiesof Baošići, Lastva Grbaljska and Bar, respectively. On these localities, it ranged from 1.7 ±0.17 to3.3±0.19, from 1.1±0.12 to 3.5±0.8 and from 0.0 to 0.8±0.14 in middle rows, and from 1.7±0.17 to3.6±0.32, from 0.0 to 4.0±0.26 and from 0.0 to 0.2±0.06 in last rows. Data collected in 2004also showed that the average number of larvae in mandarin fruits in first rows on the samelocalities was 3.12-15.75 times higher than in middle rows, and 2.94 -6.3 times higher than inlast rows.

  11. Comparison of aggregation and feeding responses by normal and irradiated fruit flies, Ceratitis capitata and Anastrepha suspensa (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Galun, R.; Gothilf, S.; Blondheim, S.; Sharp, J.L.; Mazor, M.; Lachman, A.

    1985-12-01

    Olfactory, aggregatory, and feeding responses of normal (untreated) laboratory stocks of Mediterranean fruit fly (medfly), Ceratitis capitata (Wiedemann), and of Caribbean fruit fly (caribfly), Anastrepha suspensa (Loew), were compared to those of flies irradiated (10 krad in air) 2 days before eclosion. Females of both species consumed greater quantities of protein hydrolysate solutions, entered protein hydrolysate-baited olfactory traps, and aggregated on agar plates containing protein hydrolysate in greater numbers than males of the same age and condition. However, male medflies consumed more sucrose than did females of the same age and condition. In the medfly, irradiation resulted in reduced olfactory response, reduced total food intake by flies of both sexes, and a significant reduction in aggregation on and intake of protein hydrolysate by females and of sugar consumption by males. In the irradiated caribfly, there was a significant reduction in olfactory response of females to yeast hydrolysate. In both sexes, aggregation on and consumption of yeast hydrolysate were reduced. Effects of irradiation on feeding behavior are discussed in relation to the biology of the flies and their control by the sterile insect release method.

  12. Seasonal changes in english walnut (Juglans regia L.) (Juglandaceae), fruit properties and host use patterns by Rhagoletis zoqui (Diptera: Tephritidae)

    Science.gov (United States)

    Rhagoletis zoqui Bush is a Neosubtropical, univoltine, frugivorous tephritid fly that exploits both native Juglans spp. and the introduced, Palearctic English walnut, Juglans regia. The seasonal development of commercial J. regia fruit and the pattern of host exploitation by R. zoqui were tracked ov...

  13. A four-component attractant for the mexican fruit fly,Anastrepha ludens (Diptera: Tephritidae), from host fruit.

    Science.gov (United States)

    Robacker, D C; Warfield, W C; Flath, R A

    1992-07-01

    Sixteen chemicals found in fermented chapote fruit odor were evaluated as attractants for hungry adult Mexican fruit flies. Ethyl octanoate, ethyl benzoate, terpinyl acetate, ethyl salicylate, and (-)-α-copaene proved slightly attractive. Several of the chemicals also were tested for their ability to increase the attractiveness of the previously developed chapote-derived attractant (CEH) consisting of 1,8-cineole, ethyl hexanoate, and hexanol. Combinations containing CEH with ethyl octanoate, ethyl benzoate, 4-terpineol, (-)-α-cubebene, orα-terpineol were significantly more attractive than CEH alone. The two most attractive four-component combinations were ethyl octanoate with CEH (CEHO) and ethyl benzoate with CEH. No combinations containing greater numbers of chemicals were significantly more attractive than CEHO. Therefore, CEHO was selected for further study in this paper. Of CEHO component ratios that were tested, the most attractive was 10∶1∶1∶100 for the chemicals 1,8-cineole, ethyl hexanoate, hexanol, and ethyl octanoate, respectively. Formulations of CEHO into rubber septa and polyvinyl chloride (PVC) were aged 0-15 days and tested againstTorula yeast in competing McPhail traps in a flight chamber. Summed over all lure ages, rubber septa and PVC dispensers, respectively, were 1.2 and 1.5 times more attractive thanTorula yeast. PVC dispensers aged 10-15 days were approximately 2.1 times more attractive thanTorula yeast.

  14. Species of Anastrepha (Diptera: Tephritidae) captured in a guava orchard (Psidium guajava L., Myrtaceae) in Boa Vista, Roraima, Brazil.

    Science.gov (United States)

    Marsaro Júnior, A L; Deus, E G; Ronchi-Teles, B; Adaime, R; Silva Júnior, R J

    2013-11-01

    The guava fruit (Psidium guajava) is among the most strongly affected by fruit flies in Brazil. In the Brazilian Amazon, 11 species of Anastrepha have been reported in guava orchards to date. This work aimed to identify the species of Anastrepha present in a guava orchard in the municipality of Boa Vista, determine the species infesting the fruits, and identify any parasitoids present. Two McPhail traps with food bait were installed and weekly collections were made between January and December 2008. Fruits were also collected systematically during this period, with a view to determining the association between host plant and tephritid species. Nine species of Anastrepha were identified, in addition to one specimen belonging to a probable new species. Anastrepha striata Schiner, Anastrepha sororcula Zucchi, Anastrepha obliqua (Macquart), and Anastrepha fraterculus (Wiedemann) were the dominant species in the orchard, accounting for 84.8% of all captured individuals. All females collected directly from fruits were A. striata. Doryctobracon areolatus (Szépligeti) was the only parasitoid species obtained. In this work, Anastrepha ethalea (Walker) is reported for the first time in the state of Roraima.

  15. Short range attraction of Ceratitis capitata (Diptera: Tephritidae) sterile males to six commercially available plant essential oils

    Science.gov (United States)

    Plant essential oils have a number of roles in insect pest management. For male Ceratitis capitata, this includes use of angelica seed oil as long range attractants and ginger root oil as aromatherapy, which is exposure to sterile males to increase mating success. Neither of these plants are hosts f...

  16. Infestation of grape Vitis vinifera by Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) in sub-medium Sao Francisco valley, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Habibe, Tuffi C.; Viana, Rodrigo E.; Damasceno, Itala Cruz; Malavasi, Aldo [Biofabrica Moscamed Brasil, Juazeiro, BA (Brazil). Distrito Industrial do Sao Francisco; Nascimento, Antonio S., E-mail: antnasc@cnpmf.embrapa.b [EMBRAPA Mandioca e Fruticultura Tropical, Cruz das Almas, BA (Brazil); Paranhos, Beatriz A.J.; Haji, Francisca Nemaura P., E-mail: bjodao@cpatsa.embrapa.b [EMBRAPA Semi-Arido, Petrolina, PE (Brazil); Carvalho, Raimundo S. [Agencia de Defesa Agropecuaria da Bahia (ADAB), Salvador, BA (Brazil)

    2006-07-01

    The objective of this study was to assess the infestation level in grapes, Vitis vinifera, by the medfly,Ceratitis capitata in the Sao Francisco River Valley. The adult population was monitored with Jackson trap baited with trimedlure. Samples of grapes for larval infestation assessment were taken along three months, with a total of 116 kg. The average FTD (flies/trap/day) for medfly males was 0.26. The number of pupae obtained from the fruit samples was 471; 287 adults emerged (60.4%), all Ceratitis capitata. The infestation level was 4.0 pupa/kg of fresh fruit. We conclude that grape is a medfly host in SFV, occasionally causing high damage to production. (author)

  17. Complete Mitochondrial Genome of Three Bactrocera Fruit Flies of Subgenus Bactrocera (Diptera: Tephritidae and Their Phylogenetic Implications.

    Directory of Open Access Journals (Sweden)

    Hoi-Sen Yong

    Full Text Available Bactrocera latifrons is a serious pest of solanaceous fruits and Bactrocera umbrosa is a pest of Artocarpus fruits, while Bactrocera melastomatos infests the fruit of Melastomataceae. They are members of the subgenus Bactrocera. We report here the complete mitochondrial genome of these fruit flies determined by next-generation sequencing and their phylogeny with other taxa of the subgenus Bactrocera. The whole mitogenomes of these three species possessed 37 genes namely, 13 protein-coding genes (PCGs, 2 rRNA and 22 tRNA genes. The mitogenome of B. latifrons (15,977 bp was longer than those of B. melastomatos (15,954 bp and B. umbrosa (15,898 bp. This difference can be attributed to the size of the intergenic spacers (283 bp in B. latifrons, 261 bp in B. melastomatos, and 211 bp in B. umbrosa. Most of the PCGs in the three species have an identical start codon, except for atp8 (adenosine triphosphate synthase protein 8, which had an ATG instead of GTG in B. umbrosa, whilst the nad3 (NADH dehydrogenase subunit 3 and nad6 (NADH dehydrogenase subunit 6 genes were characterized by an ATC instead of ATT in B. melastomatos. The three species had identical stop codon for the respective PCGs. In B. latifrons and B. melastomatos, the TΨC (thymidine-pseudouridine-cytidine-loop was absent in trnF (phenylalanine and DHU (dihydrouracil-loop was absent in trnS1 (serine S1. In B. umbrosa, trnN (asparagine, trnC (cysteine and trnF lacked the TψC-loop, while trnS1 lacked the DHU-stem. Molecular phylogeny based on 13 PCGs was in general concordant with 15 mitochondrial genes (13 PCGs and 2 rRNA genes, with B. latifrons and B. umbrosa forming a sister group basal to the other species of the subgenus Bactrocera which was monophyletic. The whole mitogenomes will serve as a useful dataset for studying the genetics, systematics and phylogenetic relationships of the many species of Bactrocera genus in particular, and tephritid fruit flies in general.

  18. Olive Volatiles from Portuguese Cultivars Cobrancosa, Madural and Verdeal Transmontana: Role in Oviposition Preference of Bactrocera oleae (Rossi (Diptera: Tephritidae.

    Directory of Open Access Journals (Sweden)

    Ricardo Malheiro

    Full Text Available The olive fly, Bactrocera oleae (Rossi, a serious threat to the olive crop worldwide, displays ovipositon preference for some olive cultivars but the causes are still unclear. In the present work, three Portuguese olive cultivars with different susceptibilities to olive fly (Cobrançosa, Madural, and Verdeal Transmontana were studied, aiming to determine if the olive volatiles are implicated in this interaction. Olive volatiles were assessed by SPME-GC-MS in the three cultivars during maturation process to observe possible correlations with olive fly infestation levels. Overall, 34 volatiles were identified in the olives, from 7 chemical classes (alcohols, aldehydes, aromatic hydrocarbons, esters, ketones, sesquiterpenes, and terpenes. Generally, total volatile amounts decrease during maturation but toluene, the main compound, increased in all cultivars, particularly in those with higher susceptibility to olive fly. Sesquiterpenes also raised, mainly α-copaene. Toluene and α-copaene, recognized oviposition promoters to olive fly, were correlated with the infestation level of cvs. Madural and Verdeal Trasnmontana (intermediate and highly susceptible cultivars respectively, while no correlations were established with cv. Cobrançosa (less susceptible. No volatiles with inverse correlation were observed. Volatile composition of olives may be a decisive factor in the olive fly choice to oviposit and this could be the basis for the development of new control strategies for this pest.

  19. Competitive Interactions between Immature Stages of Bactrocera cucurbitae (Coquillett) and Bactrocera tau (Walker) (Diptera: Tephritidae) under Laboratory Conditions.

    Science.gov (United States)

    Shen, K; Hu, J; Wu, B; An, K; Zhang, J; Liu, J; Zhang, R

    2014-08-01

    The melon fly, Bactrocera cucurbitae (Coquillett), and the pumpkin fly, Bactrocera tau (Walker), are economically important pests that attack mainly cucurbitacean fruits. The two fruit fly species have similar natural distributions, host ranges, and population growth capacities. This study was designed to assess the asymmetrical competitions through resource exploitation between the larvae of B. cucurbitae and B. tau at different density levels and temperatures, and on different hosts by comparing the relative effects of interspecific and intraspecific interactions on four life history parameters: survival rate, puparial mass, puparial duration, and developmental duration. Our results showed that intraspecific and interspecific competitions occurred under some laboratory conditions, and B. cucurbitae took advantage over B. tau at the high-density level and at low and high temperatures on pumpkin, bitter gourd, and bottle gourd when interspecific competition took place. Intraspecific and interspecific competitions mainly affected the puparial mass and the survival rate of the two fruit fly species but had no marked effect on the puparial duration or development duration.

  20. Response of the pearly eye melon fly Bactrocera cucurbitae (Coquillett)(Diptera:Tephritidae) mutant to host-associated visual cues

    Science.gov (United States)

    We report on a pearly eye mutant (PEM) line generated from a single male Bactrocera cucurbitae collected in Kapoho, Hawaii. Crossing experiments with colony wild-type flies indicate that the locus controlling this trait is autosomal and the mutant allele is recessive. Experiments with females to ass...

  1. De novo Transcriptome Analysis of Chinese Citrus Fly, Bactrocera minax (Diptera: Tephritidae, by High-Throughput Illumina Sequencing.

    Directory of Open Access Journals (Sweden)

    Jia Wang

    Full Text Available The Chinese citrus fly, Bactrocera minax (Enderlein, is one of the most devastating pests of citrus in the temperate areas of Asia. So far, studies involving molecular biology and physiology of B. minax are still scarce, partly because of the lack of genomic information and inability to rear this insect in laboratory. In this study, de novo assembly of a transcriptome was performed using Illumina sequencing technology. A total of 20,928,907 clean reads were obtained and assembled into 33,324 unigenes, with an average length of 908.44 bp. Unigenes were annotated by alignment against NCBI non-redundant protein (Nr, Swiss-Prot, Clusters of Orthologous Groups (COG, Gene Ontology (GO, and Kyoto Encyclopedia of Genes and Genomes Pathway (KEGG database. Genes potentially involved in stress tolerance, including 20 heat shock protein (Hsps genes, 26 glutathione S-transferases (GSTs genes, and 2 ferritin subunit genes, were identified. These genes may play roles in stress tolerance in B. minax diapause stage. It has previously been found that 20E application on B. minax pupae could avert diapause, but the underlying mechanisms remain unknown. Thus, genes encoding enzymes in 20E biosynthesis pathway, including Neverland, Spook, Phantom, Disembodied, Shadow, Shade, and Cyp18a1, and genes encoding 20E receptor proteins, ecdysone receptor (EcR and ultraspiracle (USP, were identified. The expression patterns of 20E-related genes among developmental stages and between 20E-treated and untreated pupae demonstrated their roles in diapause program. In addition, 1,909 simple sequence repeats (SSRs were detected, which will contribute to molecular marker development. The findings in this study greatly improve our genetic understanding of B. minax, and lay the foundation for future studies on this species.

  2. Effect of Body Size, Age, and Premating Experience on Male Mating Success in Bactrocera tryoni (Diptera: Tephritidae).

    Science.gov (United States)

    Ekanayake, E W M T D; Clarke, Anthony R; Schutze, Mark K

    2017-10-01

    Variation in male body size, age, and prior sexual experience may all influence male mating success in tephritid fruit flies. Bactrocera tryoni (Froggatt) is an Australian pest tephritid for which the sterile insect technique (SIT) is being actively pursued, and for which information on what makes males more competitive is urgently needed. Pair-wise competitive mating trials were run using laboratory-reared flies in walk-in field cages, evaluating young, large, and virgin B. tryoni males against old, small, and nonvirgin males, respectively. Analysis of male sexual competitiveness indices revealed that young and large males obtained significantly more copulations compared to old and small males; there was no significant difference between virgin and nonvirgin males in obtaining mates. While SIT programs will always release young males, the results do show that rearing programs which focus on producing larger males, rather than greater numbers of smaller males, will produce more sexually competitive males. After release, virgin SIT males will not be at a competitive disadvantage with sexually experienced males based on prior mating experience. © The Author 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. Cuelure but not zingerone make the sex pheromone of male Bactrocera tryoni (Tephritidae: Diptera) more attractive to females.

    Science.gov (United States)

    Kumaran, Nagalingam; Hayes, R Andrew; Clarke, Anthony R

    2014-09-01

    In tephritid fruit flies of the genus Bactrocera Macquart, a group of plant derived compounds (sensu amplo 'male lures') enhance the mating success of males that have consumed them. For flies responding to the male lure methyl eugenol, this is due to the accumulation of chemicals derived from the male lure in the male rectal gland (site of pheromone synthesis) and the subsequent release of an attractive pheromone. Cuelure, raspberry ketone and zingerone are a second, related group of male lures to which many Bactrocera species respond. Raspberry ketone and cuelure are both known to accumulate in the rectal gland of males as raspberry ketone, but it is not known if the emitted male pheromone is subsequently altered in complexity or is more attractive to females. Using Bactrocera tryoni as our test insect, and cuelure and zingerone as our test chemicals, we assess: (i) lure accumulation in the rectal gland; (ii) if the lures are released exclusively in association with the male pheromone; and (iii) if the pheromone of lure-fed males is more attractive to females than the pheromone of lure-unfed males. As previously documented, we found cuelure was stored in its hydroxyl form of raspberry ketone, while zingerone was stored largely in an unaltered state. Small but consistent amounts of raspberry ketone and β-(4-hydroxy-3-methoxyphenyl)-propionic acid were also detected in zingerone-fed flies. Males released the ingested lures or their analogues, along with endogenous pheromone chemicals, only during the dusk courtship period. More females responded to squashed rectal glands extracted from flies fed on cuelure than to glands from control flies, while more females responded to the pheromone of calling cuelure-fed males than to control males. The response to zingerone treatments in both cases was not different from the control. The results show that male B. tryoni release ingested lures as part of their pheromone blend and, at least for cuelure, this attracts more females. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Natural field infestation of Mangifera casturi and M.lalijiwa by oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae)

    Science.gov (United States)

    Mango, Mangifera indica, is a crop cultivated pantropically. There are, however, many other Mangifera spp. (“mango relatives”) which have much more restricted distributions and are poorly known, but have potential to produce mango-like fruits in areas where mangoes do not grow well or could be tapp...

  5. Host plant records of the Mango Fruit Fly, Bactrocera (Bactrocera) frauenfeldi (Schiner) (Diptera: Tephritidae), version 1.0

    Science.gov (United States)

    Bactrocera (Bactrocera) frauenfeldi (Schiner, 1868), commonly known as the mango fruit fly, is regulated through the Plant Protection Act of 2000 (7 U.S.C. 7701-7772) and relevant Parts and Subparts of the Code of Federal Regulations (7 CFR – Agriculture). Although, to date, the USDA PestID has no i...

  6. Diversity of bacterial communities in the midgut of Bactrocera cucurbitae (Diptera: Tephritidae) populations and their potential use as attractants.

    Science.gov (United States)

    Hadapad, Ashok B; Prabhakar, Chandra S; Chandekar, Snehal C; Tripathi, Jyoti; Hire, Ramesh S

    2016-06-01

    The microbiota plays an important role in insect development and fitness. Understanding the gut microbiota composition is essential for the development of pest management strategies. Midgut bacteria were isolated from nine wild B. cucurbitae populations collected from different agroecological zones of India. These isolates were further studied for attractant potential of fruit fly adults, and the chemical constituents in the supernatants of gut bacteria were analysed. Twenty-six bacterial isolates belonging to the families Enterobacteriaceae, Bacillaceae, Micrococcaceae and Staphylococcaceae were isolated and identified on the basis of 16S rRNA gene sequence analysis. The dominant species in the midgut of melon fly were from the genera Enterobacter (34.6%), Klebsiella (19.2%), Citrobacter (7.7%), Bacillus (15.4%) and Providencia (7.7%), and 3.8% each of Micrococcus, Staphylococcus, Leclercia and Exiguobacterium. Bactrocera cucurbitae and B. dorsalis adults were significantly attracted to bacterial whole cell cultures and their supernatants in the fruit fly attraction bioassays. Bacillus cereus, Enterobacter, Klebsiella, Citrobacter and Providencia species attracted both male and females of Bactrocera species. The supernatants of Klebsiella, Citrobacter and Providencia species attracted a significantly greater number of females than males. The most abundant chemical constituents in supernatants of K. oxytoca and C. freundii were 3-methyl-1-butanol, 2-phenylethanol, butyl isocyanatoacetate, 2-methyl-1-propanol and 3-hydroxy-2-butanone, as identified by gas chromatography-mass spectrometry. The bacterial endosymbionts associated with melon fly exhibited attractant potential which could facilitate eco-friendly insect control strategies. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  7. Phenoloxidase and its zymogen are required for the larval-pupal transition in Bactrocera dorsalis (Diptera: Tephritidae).

    Science.gov (United States)

    Bai, Ping-Ping; Xie, Yi-Fei; Shen, Guang-Mao; Wei, Dan-Dan; Wang, Jin-Jun

    2014-12-01

    Phenoloxidases (POs) play a key role in melanin production, are involved in invertebrate immune mechanisms, and are considered important enzymes in the insect development process. In the present study, we report the developmental stage and tissue-specific expression patterns of BdPPO1 and PO activity from Bactrocera dorsalis. The results showed that the activity of PO and its zymogen expression were closely related to the development of B. dorsalis during the larval-pupal transition, particularly in the integument. Additionally, biochemical characterization showed that PO from different developmental stages and tissues all had maximum activity at pH 7.5 and 37°C. After feeding a metal ion-containing artificial diet, the activity of PO and expression of BdPPO1 were significantly increased, indicating that PO was a metalloprotein and it could be activated by Zn2+, Mg2+, Ca2+, and Cu2+. The functional analysis showed that the expression of BdPPO1 could be regulated by 20-hydroxyecdysone (20E) after injection. Furthermore, injection of the double-stranded RNA of BdPPO1 into the 3rd instar larvae significantly reduced mRNA levels after 24 h and 48 h, and resulted in a lower pupation rate and abnormal phenotype. These results expand the understanding of the important role of PO and its zymogen in the growth of B. dorsalis. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Suitability of a liquid larval diet for rearing the Philippines fruit fly Bactrocera philippinensis (Diptera:Tephritidae)

    Science.gov (United States)

    A liquid larval diet as an artificial rearing medium was successfully tested for the Philippines fruit fly Bactrocera philippinensis Drew & Hancock. The biological parameters studied were pupal weight, adult emergence and fliers, sex ratio, fecundity and fertility. The insects performed most satisfa...

  9. Parasitism, emergence, and development of Spalangia endius (Hymenoptera: Pteromalidae) in pupae of different ages of Bactrocera cucurbitae (Diptera: Tephritidae).

    Science.gov (United States)

    Tang, Liang-De; Ji, Xun-Cong; Han, Yun; Fu, Bu-Li; Liu, Kui

    2015-01-01

    The wasp Spalangia endius Walker (Hymenoptera: Pteromalidae) is a major parasitoid of the pupae of fruit flies, which are a common agricultural pest. An understanding of this intricate host-parasitoid interaction could provide basic information necessary for the sustainable integrated biological control of fruit flies. In this study, we investigated the effect of S. endius on different-aged pupae of the melon fly Bactrocera cucurbitae Coquillett by using choice and nonchoice tests under laboratory conditions. We showed that S. endius females oviposited, and their progeny successfully developed, in different-aged pupae of B. cucurbitae regardless of the method of exposure. There was an oviposition preference for 3-5-d-old pupa. The highest mean percentage parasitism occurred on 4- and 5-d-old hosts, followed by 2- and 3-d-old hosts. The average development time for both males and females was significantly longer in 6-7-d-old hosts than in the younger host stages. Adult females that developed from younger host pupae (2-5-d old) were significantly heavier than those from older host pupae (6-7-d old), and they also lived longer. The sex ratio (proportion of females) of the parasite progeny decreased with an increase in host age. Host mortality also decreased gradually as the pupal age increased. The differences in development time, body weight, and longevity between females and males were significant. These results suggest that S. endius is a good candidate for the biological control of B. cucurbitae. © The Author 2015. Published by Oxford University Press on behalf of the Entomological Society of America.

  10. Germline transformation of the olive fruit fly, Bactrocera oleae (Rossi)(Diptera:Tephritidae) with a piggyBac transposon vector

    Science.gov (United States)

    The olive fruit fly, Bactrocera oleae, is a highly significant pest in olive growing countries whose control may be enhanced by the use of genetically-modified strains, especially for sterile insect technique programs. To improve and expand this technology, piggyBac-mediated germline transformation ...

  11. Genetic structure and colonization history of the fruit fly Bactrocera tau (Diptera: Tephritidae) in China and Southeast Asia.

    Science.gov (United States)

    Shi, W; Kerdelhué, C; Ye, H

    2014-06-01

    Bactrocera tau (Walker), a major invasive pest worldwide, was first described in Fujian (China) in 1849 and has dispersed to tropical and subtropical Asia and the South Pacific region. Few data are available on its colonization history and expansion processes. This pilot study attempted to reconstruct the colonization history and pathways of this pest in China and neighboring Southeast Asian countries based on mitochondrial DNA. Results of the study showed six genetic groups corresponding to geographical characteristics, although the pattern was relatively weak. Homogeneous genetic patterns were observed within southern and central China, and northern Vietnam. Continuous colonization from the coast of southern China to inland regions of China and northern Vietnam was suggested. Strong genetic structure was observed in western China, Thailand, and Laos. The isolation of four of the six groups was most probably attributable to major topographical barriers of western China. Yunnan acted as a contact zone of B. tau in China and neighboring Southeast Asia. The absence of isolation by distance and the overall low phylogeographic structure of B. tau suggested that long distance dispersal events and human activities could play a major role in the colonization and expansion patterns of B. tau. By analyzing the genetic diversity, gene flow, haplotype phylogeny, and demographic history of 23 fly populations, we hypothesized that B. tau could have been introduced long ago in southern China, from which it further expanded or that southern China could correspond to the native range of this species.

  12. Assessment of a liquid larval diet for rearing Dacus and Bactrocera species (Diptera:Tephritidae), in Western Africa

    Science.gov (United States)

    The fruit fly larval diet formulations developed by USDA-ARS were used in this study to compare with other artificial and natural diet to rear two Dacus species. The evaluation was based on the parameters of egg hatch, pupal production, adult emergence, flight ability, and productivity. This study s...

  13. Evaluating irradiation dose for sterility induction and quality control of mass-produced fruit fly Bactrocera tryoni (Diptera: Tephritidae).

    Science.gov (United States)

    Dominiak, B C; Sundaralingam, S; Jiang, L; Fanson, B G; Collins, S R; Banos, C; Davies, J B; Taylor, P W

    2014-06-01

    The sterile insect technique has been routinely used to eradicate fruit fly Bactrocera tryoni (Froggatt) incursions. This study considers whether fly quality in a mass-rearing facility can be improved by reducing irradiation doses, without sacrificing reproductive sterility. Pupae were exposed to one of five target irradiation dose ranges: 0, 40-45, 50-55, 60-65, and 70-75 Gy. Pupae were then assessed using routine quality control measures: flight ability, sex ratio, longevity under nutritional stress, emergence, and reproductive sterility. Irradiation did not have a significant effect on flight ability or sex ratio tests. Longevity under nutritional stress was significantly increased at 70-75 Gy, but no other doses differed from 0 Gy. Emergence was slightly reduced in the 50-55, 60-65, and 70-75 Gy treatments, but 40-45 Gy treatments did not differ from 0 Gy, though confounding temporal factors complicate interpretation. Reproductive sterility remained acceptable (> 99.5%) for all doses--40-45 Gy (99.78%), 50-55 Gy (100%), 60-65 Gy (100%), and 70-75 Gy (99.99%). We recommend that B. tryoni used in sterile insect technique releases be irradiated at a target dose of 50-55 Gy, providing improved quality and undiminished sterility in comparison with the current 70-75 Gy standard while also providing a substantial buffer against risk of under dosing.

  14. Bacterial communities in the gut and reproductive organs of Bactrocera minax (Diptera: Tephritidae based on 454 pyrosequencing.

    Directory of Open Access Journals (Sweden)

    Ailin Wang

    Full Text Available The citrus fruit fly Bactrocera minax is associated with diverse bacterial communities. We used a 454 pyrosequencing technology to study in depth the microbial communities associated with gut and reproductive organs of Bactrocera minax. Our dataset consisted of 100,749 reads with an average length of 400 bp. The saturated rarefaction curves and species richness indices indicate that the sampling was comprehensive. We found highly diverse bacterial communities, with individual sample containing approximately 361 microbial operational taxonomic units (OTUs. A total of 17 bacterial phyla were obtained from the flies. A phylogenetic analysis of 16S rDNA revealed that Proteobacteria was dominant in all samples (75%-95%. Actinobacteria and Firmicutes were also commonly found in the total clones. Klebsiella, Citrobacter, Enterobacter, and Serratia were the major genera. However, bacterial diversity (Chao1, Shannon and Simpson indices and community structure (PCA analysis varied across samples. Female ovary has the most diverse bacteria, followed by male testis, and the bacteria diversity of reproductive organs is richer than that of the gut. The observed variation can be caused by sex and tissue, possibly to meet the host's physiological demands.

  15. De novo Transcriptome Analysis of Chinese Citrus Fly, Bactrocera minax (Diptera: Tephritidae), by High-Throughput Illumina Sequencing.

    Science.gov (United States)

    Wang, Jia; Xiong, Ke-Cai; Liu, Ying-Hong

    2016-01-01

    The Chinese citrus fly, Bactrocera minax (Enderlein), is one of the most devastating pests of citrus in the temperate areas of Asia. So far, studies involving molecular biology and physiology of B. minax are still scarce, partly because of the lack of genomic information and inability to rear this insect in laboratory. In this study, de novo assembly of a transcriptome was performed using Illumina sequencing technology. A total of 20,928,907 clean reads were obtained and assembled into 33,324 unigenes, with an average length of 908.44 bp. Unigenes were annotated by alignment against NCBI non-redundant protein (Nr), Swiss-Prot, Clusters of Orthologous Groups (COG), Gene Ontology (GO), and Kyoto Encyclopedia of Genes and Genomes Pathway (KEGG) database. Genes potentially involved in stress tolerance, including 20 heat shock protein (Hsps) genes, 26 glutathione S-transferases (GSTs) genes, and 2 ferritin subunit genes, were identified. These genes may play roles in stress tolerance in B. minax diapause stage. It has previously been found that 20E application on B. minax pupae could avert diapause, but the underlying mechanisms remain unknown. Thus, genes encoding enzymes in 20E biosynthesis pathway, including Neverland, Spook, Phantom, Disembodied, Shadow, Shade, and Cyp18a1, and genes encoding 20E receptor proteins, ecdysone receptor (EcR) and ultraspiracle (USP), were identified. The expression patterns of 20E-related genes among developmental stages and between 20E-treated and untreated pupae demonstrated their roles in diapause program. In addition, 1,909 simple sequence repeats (SSRs) were detected, which will contribute to molecular marker development. The findings in this study greatly improve our genetic understanding of B. minax, and lay the foundation for future studies on this species.

  16. Phenetic structure of two Bactrocera tau cryptic species (Diptera: Tephritidae) infesting Momordica cochinchinensis (Cucurbitaceae) in Thailand and Laos.

    Science.gov (United States)

    Dujardin, Jean-Pierre; Kitthawee, Sangvorn

    2013-04-01

    Morphometric variation with respect to wing venation patterns was explored for 777 specimens of the Bactrocera tau complex collected in Thailand (nine provinces) and Laos (one locality). Cryptic species B. tau A and C were identified based on their wing shape similarity to published reference images. In Thailand, the B. tau A species was identified in four provinces and the B. tau C species in seven provinces, and both species in one locality of Laos. The objective of the study was to explain the geographic variation of size and shape in two cryptic species collected from the same host (Momordica cochinchinensis). Although collected from the same host, the two species did not show the same morphological variance: it was higher in the B. tau A species, which currently infests a wide range of different fruit species, than in the B. tau C species, which is specific to only one fruit (M. cochinchinensis). Moreover, the two species showed a different population structure. An isolation by distance model was apparent in both sexes of species C, while it was not detected in species A. Thus, the metric differences were in apparent accordance with the known behavior of these species, either as a generalist (species A) or as a specialist (species C), and for each species our data suggested different sources of shape diversity: genetic drift for species C, variety of host plants (and probably also pest-host-relationship) for species A. In addition to these distinctions, the larger species, B. tau C, showed less sexual size and shape dimorphism. The data presented here confirm the previously established wing shape differences between the two cryptic species. Character displacement has been discussed as a possible origin of this interspecific variation. The addition of previously published data on species A from other hosts allowed the testing of the character displacement hypothesis. The hypothesis was rejected for interspecific shape differences, but was maintained for size differences. Copyright © 2012 Elsevier GmbH. All rights reserved.

  17. Bacterial communities in the gut and reproductive organs of Bactrocera minax (Diptera: Tephritidae) based on 454 pyrosequencing.

    Science.gov (United States)

    Wang, Ailin; Yao, Zhichao; Zheng, Weiwei; Zhang, Hongyu

    2014-01-01

    The citrus fruit fly Bactrocera minax is associated with diverse bacterial communities. We used a 454 pyrosequencing technology to study in depth the microbial communities associated with gut and reproductive organs of Bactrocera minax. Our dataset consisted of 100,749 reads with an average length of 400 bp. The saturated rarefaction curves and species richness indices indicate that the sampling was comprehensive. We found highly diverse bacterial communities, with individual sample containing approximately 361 microbial operational taxonomic units (OTUs). A total of 17 bacterial phyla were obtained from the flies. A phylogenetic analysis of 16S rDNA revealed that Proteobacteria was dominant in all samples (75%-95%). Actinobacteria and Firmicutes were also commonly found in the total clones. Klebsiella, Citrobacter, Enterobacter, and Serratia were the major genera. However, bacterial diversity (Chao1, Shannon and Simpson indices) and community structure (PCA analysis) varied across samples. Female ovary has the most diverse bacteria, followed by male testis, and the bacteria diversity of reproductive organs is richer than that of the gut. The observed variation can be caused by sex and tissue, possibly to meet the host's physiological demands.

  18. Functional analysis of five trypsin-like protease genes in the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae).

    Science.gov (United States)

    Li, Ya-Li; Hou, Ming-Zhe; Shen, Guang-Mao; Lu, Xue-Ping; Wang, Zhe; Jia, Fu-Xian; Wang, Jin-Jun; Dou, Wei

    2017-03-01

    Insect midgut proteases catalyze the release of free amino acids from dietary proteins and are essential for insect normal development. To date, digestive proteases as potential candidates have made great progress in pest control. To clarify the function of trypsin-like protease genes in the digestive system of Bactrocera dorsalis, a serious pest of a wide range of tropical and subtropical fruit and vegetable crops, five trypsin genes (BdTry1, BdTry2, BdTry3, BdTry4 and BdTry5) were identified from transcriptome dataset, and the effects of feeding condition on their expression levels were examined subsequently. RNA interference (RNAi) was applied to further explore their function on the growth of B. dorsalis. The results showed that all the BdTrys in starving midgut expressed at a minimal level but up-regulated upon feeding (except BdTry3). Besides, RNAi by feeding dsRNAs to larvae proved to be an effective method to cause gene silencing and the mixed dsRNAs of the five BdTrys slowed larvae growth of B. dorsalis. The current data suggest that trypsin genes are actively involved in digestion process of B. dorsalis larvae and thereafter play crucial roles in their development. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. The Bactrocera oleae genome: localization of nine genes on the polytene chromosomes of the olive fruit fly (Diptera: Tephritidae).

    Science.gov (United States)

    Drosopoulou, Elena; Nakou, Ifigeneia; Mavragani-Tsipidou, Penelope

    2014-10-01

    Four homologous and five heterologous gene-specific sequences have been mapped by in situ hybridization on the salivary gland polytene chromosomes of the olive fruit fly, Bactrocera oleae. The nine genes were dispersed on four of the five autosomal chromosomes, thus enriching the available set of chromosome landmarks for this major agricultural pest. Present data further supports the proposed chromosome homologies among B. oleae, Ceratitis capitata, and Drosophila melanogaster and the idea of the conservation of chromosomal element identity throughout dipteran evolution.

  20. Historical perspective on the synonymization of the four major pest species belonging to the Bactrocera dorsalis species complex (Diptera, Tephritidae).

    Science.gov (United States)

    Hee, Alvin K W; Wee, Suk-Ling; Nishida, Ritsuo; Ono, Hajime; Hendrichs, Jorge; Haymer, David S; Tan, Keng-Hong

    2015-01-01

    An FAO/IAEA-sponsored coordinated research project on integrative taxonomy, involving close to 50 researchers from at least 20 countries, culminated in a significant breakthrough in the recognition that four major pest species, Bactrocera dorsalis, Bactrocera philippinensis, Bactrocera papayae and Bactrocera invadens, belong to the same biological species, Bactrocera dorsalis. The successful conclusion of this initiative is expected to significantly facilitate global agricultural trade, primarily through the lifting of quarantine restrictions that have long affected many countries, especially those in regions such as Asia and Africa that have large potential for fresh fruit and vegetable commodity exports. This work stems from two taxonomic studies: a revision in 1994 that significantly increased the number of described species in the Bactrocera dorsalis species complex; and the description in 2005 of Bactrocera invadens, then newly incursive in Africa. While taxonomically valid species, many biologists considered that these were different names for one biological species. Many disagreements confounded attempts to develop a solution for resolving this taxonomic issue, before the FAO/IAEA project commenced. Crucial to understanding the success of that initiative is an accounting of the historical events and perspectives leading up to the international, multidisciplinary collaborative efforts that successfully achieved the final synonymization. This review highlights the 21 year journey taken to achieve this outcome.

  1. New species, new records and updated subgeneric key of Bactrocera Macquart (Diptera: Tephritidae: Dacinae: Dacini) from India.

    Science.gov (United States)

    David, K J; Hancock, D L; Singh, Shakti Kumar; Ramani, S; Behere, G T; Salini, S

    2017-05-30

    Two new species of genus Bactrocera Macquart, namely B. (Sinodacus) brevipunctata David and Hancock, sp. nov. and B. (Bactrocera) furcata David and Hancock, sp. nov., are described from India. B. (B.) aethriobasis Hardy, B. (B.) rubigina Wang & Zhao, B. (B.) syzygii Tsuruta & White and B. (B.) tuberculata (Bezzi) are recorded for the first time from India. Updated keys to twelve subgenera of Bactrocera and Indian species of Bactrocera (Bactrocera) are also provided.

  2. Complete Mitochondrial Genome of Three Bactrocera Fruit Flies of Subgenus Bactrocera (Diptera: Tephritidae) and Their Phylogenetic Implications.

    Science.gov (United States)

    Yong, Hoi-Sen; Song, Sze-Looi; Lim, Phaik-Eem; Eamsobhana, Praphathip; Suana, I Wayan

    2016-01-01

    Bactrocera latifrons is a serious pest of solanaceous fruits and Bactrocera umbrosa is a pest of Artocarpus fruits, while Bactrocera melastomatos infests the fruit of Melastomataceae. They are members of the subgenus Bactrocera. We report here the complete mitochondrial genome of these fruit flies determined by next-generation sequencing and their phylogeny with other taxa of the subgenus Bactrocera. The whole mitogenomes of these three species possessed 37 genes namely, 13 protein-coding genes (PCGs), 2 rRNA and 22 tRNA genes. The mitogenome of B. latifrons (15,977 bp) was longer than those of B. melastomatos (15,954 bp) and B. umbrosa (15,898 bp). This difference can be attributed to the size of the intergenic spacers (283 bp in B. latifrons, 261 bp in B. melastomatos, and 211 bp in B. umbrosa). Most of the PCGs in the three species have an identical start codon, except for atp8 (adenosine triphosphate synthase protein 8), which had an ATG instead of GTG in B. umbrosa, whilst the nad3 (NADH dehydrogenase subunit 3) and nad6 (NADH dehydrogenase subunit 6) genes were characterized by an ATC instead of ATT in B. melastomatos. The three species had identical stop codon for the respective PCGs. In B. latifrons and B. melastomatos, the TΨC (thymidine-pseudouridine-cytidine)-loop was absent in trnF (phenylalanine) and DHU (dihydrouracil)-loop was absent in trnS1 (serine S1). In B. umbrosa, trnN (asparagine), trnC (cysteine) and trnF lacked the TψC-loop, while trnS1 lacked the DHU-stem. Molecular phylogeny based on 13 PCGs was in general concordant with 15 mitochondrial genes (13 PCGs and 2 rRNA genes), with B. latifrons and B. umbrosa forming a sister group basal to the other species of the subgenus Bactrocera which was monophyletic. The whole mitogenomes will serve as a useful dataset for studying the genetics, systematics and phylogenetic relationships of the many species of Bactrocera genus in particular, and tephritid fruit flies in general.

  3. Sexual selection in true fruit flies (Diptera: Tephritidae): transcriptome and experimental evidences for phytochemicals increasing male competitive ability.

    Science.gov (United States)

    Kumaran, Nagalingam; Prentis, Peter J; Mangalam, Kalimuthu P; Schutze, Mark K; Clarke, Anthony R

    2014-09-01

    In male tephritid fruit flies of the genus Bactrocera, feeding on secondary plant compounds (sensu lato male lures = methyl eugenol, raspberry ketone and zingerone) increases male mating success. Ingested male lures alter the male pheromonal blend, normally making it more attractive to females and this is considered the primary mechanism for the enhanced mating success. However, the male lures raspberry ketone and zingerone are known, across a diverse range of other organisms, to be involved in increasing energy metabolism. If this also occurs in Bactrocera, then this may represent an additional benefit to males as courtship is metabolically expensive and lure feeding may increase a fly's short-term energy. We tested this hypothesis by performing comparative RNA-seq analysis between zingerone-fed and unfed males of Bactrocera tryoni. We also carried out behavioural assays with zingerone- and cuelure-fed males to test whether they became more active. RNA-seq analysis revealed, in zingerone-fed flies, up-regulation of 3183 genes with homologues transcripts to those known to regulate intermale aggression, pheromone synthesis, mating and accessory gland proteins, along with significant enrichment of several energy metabolic pathways and gene ontology terms. Behavioural assays show significant increases in locomotor activity, weight reduction and successful mating after mounting; all direct/indirect measures of increased activity. These results suggest that feeding on lures leads to complex physiological changes, which result in more competitive males. These results do not negate the pheromone effect, but do strongly suggest that the phytochemical-induced sexual selection is governed by both female preference and male competitive mechanisms. © 2014 John Wiley & Sons Ltd.

  4. Opiine parasitoids (Hymenoptera: Braconidae) of tropical fruit flies (Diptera: Tephritidae) of the Australian and South Pacific region.

    Science.gov (United States)

    Carmichael, A E; Wharton, R A; Clarke, A R

    2005-12-01

    Opiine wasps are parasitoids of dacine fruit flies, the primary horticultural pests of Australia and the South Pacific. A taxonomic synopsis and distribution and host records (44% of which are new) for each of the 15 species of dacine-parasitizing opiine braconids found in the South Pacific is presented. Species dealt with are Diachasmimorpha hageni (Fullaway), D. kraussii (Fullaway), D. longicaudata (Ashmead), D. tryoni (Cameron), Fopius arisanus (Sonan), F. deeralensis (Fullaway), F. ferrari Carmichael & Wharton sp. n., F. illusorius (Fischer) comb. n., F. schlingeri Wharton, Opius froggatti Fullaway, Psyttalia fijiensis (Fullaway), P. muesebecki (Fischer), P. novaguineensis (Szépligeti) and Utetes perkinsi (Fullaway). A potentially undescribed species, which may be a colour morph of F. vandenboschi (Fullaway), is diagnosed but not formally described. Fopius vandenboschi sensu stricto, Diachasmimorpha fullawayi Silvestri, Psyttalia concolor Szépligeti and P. incisi Silvestri have been liberated into the region but are not considered to have established: a brief diagnosis of each is included. Biosteres illusorius Fischer is formally transferred to the genus Fopius. A single opiine specimen reared from a species of Bactrocera (Bulladacus) appears to be Utetes albimanus (Szépligeti), but damage to this specimen and to the holotype (the only previously known specimen) means that this species remains unconfirmed as a fruit fly parasite: a diagnosis of U. cf. albimanus is provided. Psyttalia novaguineensis could not be adequately separated from P. fijiensis using previously published characterizations and further work to resolve this complex is recommended. A key is provided to all taxa.

  5. Parasitismo natural em moscas-das-frutas (Diptera: Tephritidae no semiárido do sudoeste da Bahia, Brasil

    Directory of Open Access Journals (Sweden)

    Ricardo Falcão de Sá

    2012-12-01

    Full Text Available Parasitoides são importantes agentes de controle natural de tefritídeos, e os conhecimentos sobre as relações tritróficas podem subsidiar o manejo destas pragas. Este trabalho objetivou estimar índices de parasitismo em moscas-das-frutas, em 21 espécies vegetais, e identificar as espécies de parasitoides associados, nas condições do semiárido do sudoeste da Bahia. Oito hospedeiros apresentaram infestação por Anastrepha spp. e, destes, em quatro, ocorreu parasitismo superior a 20,0%, sendo: 20,8% (Ziziphus joazeiro L.; 21,3% (Spondias tuberosa L.; 32,4% (Spondias purpurea L. e 57,1% (Malpighia emarginata L.. Os parasitoides coletados pertencem à família Braconidae, sendo 89% de Doryctobracon areolatus e 11% de Asobara anastrephae.

  6. Effect of cryopreservation on the pre-hatching behavior in the Mexican fruit fly Anastrepha ludens Loew (Diptera, Tephritidae).

    Science.gov (United States)

    Rajamohan, Arun; Rinehart, Joseph P; Leopold, Roger A

    2017-12-19

    In a sampling of untreated embryos of the economically important fruit pest species, Anastrepha ludens, the cumulative hatch percentage in the lab was noted to be ∼85%. Approximately 70% of the larvae had eclosed through the posterior pole of the egg. This process is effected by the act of Pole Reversal (PR) of the fully developed pre-hatch larva from the wider anterior to the narrower posterior pole of the egg. Investigation of the effects of cryopreservation and various pretreatments prior to cryostorage on the PR behavior was prompted by the observation of significantly lower proportion of cryopreserved embryos exhibiting the PR behavior. Pretreatments (dechorionation and permeabilization) followed by vitrification resulted in delayed hatching, reflecting a slower embryonic development rate of ∼10 h. A smaller proportion of the treated embryos either eclosed from the anterior end of the egg or did not eclose at all despite complete development and prehatch gnawing activity. In the untreated controls, 24.0% of the embryos eclosed from the anterior pole. After permeabilization and cryopreservation, 83% and 55% (adjusted hatch) of the embryos were noted to hatch this way, respectively. An analysis of the hatch count after the treatments shows that factors contributing to the embryos' inability to properly invert polarity is not solely due to cryopreservation but also due to the pretreatment procedures including dechorionation and permeabilization. In fact, the permeabilization pre-treatment contributed the highest to this phenomenon lending support to the view that chemical toxicity rather than physical effects of cryopreservation play a major role in post-cryopreservation effects. Published by Elsevier Inc.

  7. Effect of cryopreservation on the pre-hatching behavior in the Mexican fruit fly Anastrepha ludens Loew (Diptera, Tephritidae)

    Science.gov (United States)

    In a sampling of untreated embryos of Mexican fruit fly, Anastrepha ludens, the cumulative hatch percentage was 84.77±7.8% of which ~70% of the larvae eclosed through the posterior pole of the egg. This is due to an unusual and seemingly energy demanding act of flipping of the fully developed pre-ha...

  8. Fungi that cause rot in bunches of grape identified in adult fruit flies (Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Ruben Machota Jr

    2013-06-01

    Full Text Available Anastrepha fraterculus (Wiedemann is the main species of frugivorous insect that damages berries of table grape (Vitis vinifera L. in Southern Brazil. This study was conducted to isolate and identify the fungi associated with bunch rot present in the body of adults of A. fraterculus collected in a commercial vineyard. From January to February 2011, adults of A. fraterculus were collected from a commercial vineyard of green grapes using adapted McPhail traps. In laboratory, flies bodies were divided into four parts (head, legs, wings, and ovipositor in Petri dishes with PDA medium to evaluate microorganisms associated. Six adult females of A. fraterculus collected in the field were also analyzed in a scanning electron microscope (SEM to identify spores of fungi. Phytopathogenic microorganisms were found in all sectioned parts. Fungal spores were recorded adhered to the body of adult females of A. fraterculus. The main species of fungi found in the body parts of A. fraterculus were Cladosporium spp. (20.2% of the obtained colonies, Botrytis cinerea Pers. (12.9%, Colletotrichum spp. (10.1%, Penicillium spp. (10.1%, Fusarium spp. (7.7%, followed by Rhizopus spp., Trichoderma spp. and Aspergillus spp., suggesting that the insect can serve as a mechanical vector of spores increasing damage in the vineyards.

  9. Incipient speciation revealed in Anastrepha fraterculus (Diptera; Tephritidae) by studies on mating compatibility, sex pheromones, hybridisation and cytology

    Science.gov (United States)

    It is suggested that the nominal species Anastrepha fraterculus is a species complex and previous studies showed high levels of pre-zygotic isolation between two laboratory strains from Argentina and Peru. To further analyze this observation, experiments were carried out on the same populations and...

  10. Precocious sexual signalling and mating in Anastrepha fraterculus (Diptera: Tephritidae) sterile males achieved through juvenile hormone treatment and protein supplements

    Science.gov (United States)

    Sexual maturation of Anastrepha fraterculus is a long process. Methoprene (a mimic of juvenile hormone) considerably reduces the time for sexual maturation in males. However, in other Anastrepha species, this effect depends on protein intake at the adult stage. Here, we evaluated the mating competit...

  11. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    JULIANA GARCÍA

    2011-01-01

    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de huevos/hembra/día con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.

  12. Global population genomics and comparisons of selective signatures from two invasions of melon fly, Zeugodacus cucurbitae (Diptera: Tephritidae)

    Science.gov (United States)

    Population genetics is a powerful tool for invasion biology and pest management, from tracing invasion pathways to informing management decisions with inference of population demographics. Genomics greatly increases the resolution of population-scale analyses, yet outside of model species with exten...

  13. New records of fruit flies (Diptera: Tephritidae), wild hosts and parasitoids (Hymenoptera: Braconidae) in the Brazilian Amazon

    Energy Technology Data Exchange (ETDEWEB)

    Jesus, Cristiane R. de; Oliveira, Manoela N. de; Silva, Ricardo A. da [EMBRAPA Amapa, Macapa, AP (Brazil); Pereira, Julia D.B. [Universidade Federal do Amapa, Macapa, AP (Brazil); Souza Filho, Miguel F. [Instituto Biologico, Campinas, SP (Brazil); Costa Neto, Salustiano V. da [Instituto de Pesquisas Cientificas e Tecnologicas do Amapa, Macapa, AP (Brazil); Marinho, Claudia F.; Zucchi, Roberto A. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Entomologia, Fitopatologia e Zoologia Agricola

    2008-11-15

    Anastrepha anomala Stone was obtained from Parahancornia amapa (Huber) Ducke (Apocynaceae) fruits, and Anastrepha hastata Stone from Cheiloclinium cognatum (Miers.) (Hippocrateaceae) in the State of Amapa, Brazil. Two braconids, Doryctobracon sp. and Opius bellus Gahan, were reared from the latter fruit fl y species. This is the fi rst record of P. amapa as a fruit fl y host. C. cognatum is the fi rst host known to A. hastata. Both braconids are also the fi rst records of parasitoids for this species. (author)

  14. RNAi-Mediated Knock-Down of transformer and transformer 2 to Generate Male-Only Progeny in the Oriental Fruit Fly, Bactrocera dorsalis (Hendel.

    Directory of Open Access Journals (Sweden)

    Guiqing Liu

    Full Text Available The transformer (tra gene appears to act as the genetic switch that promotes female development by interaction with the transformer2 (tra-2 gene in several dipteran species including the Medfly, housefly and Drosophila melanogaster. In this study, we describe the isolation, expression and function of tra and tra-2 in the economically important agricultural pest, the oriental fruit fly, Bactrocera dorsalis (Hendel. Bdtra and Bdtra-2 are similar to their homologs from other tephritid species. Bdtra demonstrated sex-specific transcripts: one transcript in females and two transcripts in males. In contrast, Bdtra-2 only had one transcript that was common to males and females, which was transcribed continuously in different adult tissues and developmental stages. Bdtra-2 and the female form of Bdtra were maternally inherited in eggs, whereas the male form of Bdtra was not detectable until embryos of 1 and 2 h after egg laying. Function analyses of Bdtra and Bdtra-2 indicated that both were indispensable for female development, as nearly 100% males were obtained with embryonic RNAi against either Bdtra or Bdtra-2. The fertility of these RNAi-generated males was subsequently tested. More than 80% of RNAi-generated males could mate and the mated females could lay eggs, but only 40-48.6% males gave rise to progeny. In XX-reversed males and intersex individuals, no clear female gonadal morphology was observed after dissection. These results shed light on the development of a genetic sexing system with male-only release for this agricultural pest.

  15. Fannia flavicincta Stein (Diptera, Fanniidae: a new vector of Dermatobia hominis (Linnaeus Jr. (Diptera, Cuterebridae

    Directory of Open Access Journals (Sweden)

    Cleber Barreto Espindola

    2004-03-01

    Full Text Available Fannia flavicincta Stein, 1904 (Diptera, Fannidae is first recorded as a vector of Dermatobia hominis (Linnaeus Jr., 1781. The material was collected in Paracambi, Rio de Janeiro, Brazil in September, 2002.Fannia flavicincta Stein, 1904 (Diptera, Fannidae é registrada pela primeira vez como vetor de Dermatobia hominis (Linnaeus Jr., 1781. O material foi coletado em Paracambi, Rio de Janeiro, Brazil em setembro de 2002.

  16. MicroRNAs in the oriental fruit fly, Bactrocera dorsalis: extending Drosophilid miRNA clusters to the Tephritidae

    Science.gov (United States)

    The oriental fruit fly, Bactrocera dorsalis, is an important pest species in the family Tephritidae. It is a phytophagous species with broad host range, and while not established in the mainland United States, is a species of great concern for introduction. Despite of the vast amount of informatio...

  17. Landing and Oviposition Responses of Rhagoletis indifferens (Dipt., Tephritidae) on Sweet Cherry Treated with Kaolin- and Limestone-Based Products

    Science.gov (United States)

    Kaolin- and limestone-based products were compared for their effects on landing and oviposition on sweet cherry by Rhagoletis indifferens Curran (Dipt., Tephritidae). Surround (95% calcined kaolin), Cocoon (100% hydrous kaolin), Eclipse (>97% limestone), and Purshade (62.5% limestone) were studied....

  18. Di- and tri-fluorinated analogs of methyl eugenol: attraction to and metabolism in the Oriental fruit fly, Bactrocera dorsalis (Hendel).

    Science.gov (United States)

    Jang, Eric B; Khrimian, Ashot; Siderhurst, Matthew S

    2011-06-01

    Oriental fruit fly, Bactrocera dorsalis (Hendel), males are attracted to the natural phenylpropanoid methyl eugenol (ME). They feed compulsively on ME and metabolize it to ring and side-chain hydroxylated compounds that have both pheromonal and allomonal properties. Previously, we demonstrated that mono-fluorination at the terminal carbon of the ME side-chain significantly reduced metabolic side-chain hydroxylation, while mono-fluorination of ME at position 4 of the aromatic ring blocked ring-hydroxylation but surprisingly enhanced side-chain hydroxylation. Here, we demonstrated that the introduction of fluorine atoms on both the ring and side-chain of ME blocks both positions that undergo enzymatic hydroxylation and, in particular, completely inhibits oxidative biotransformation of the allyl group. In laboratory experiments, B. dorsalis males initially were more attracted to both 1-fluoro-4,5-dimethoxy-2-(3,3-difluoro-2-propenyl)benzene (I) and 1-fluoro-4,5-dimethoxy-2-(3-fluoro-2-propenyl)benzene (II) than to ME. However, both I and II were taken up by flies at rates significantly less than that of ME. Flies fed with difluoroanalog II partially metabolized it to 5-fluoro-4-(3-fluoroprop-2-en-1-yl)-2-methoxyphenol (III), and flies fed with trifluoroanalog I produced 4-(3,3-difluoroprop-2-en-1-yl)-5-fluoro-2-methoxyphenol (V), but the rates of metabolism relative to rates of intakes were much lower compared to those of ME. Flies that consumed either the tri- or difluorinated analog showed higher post-feeding mortality than those that fed on methyl eugenol. In field trials, trifluoroanalog I was ∼90% less attractive to male B. dorsalis than ME, while difluoroanalog II was ∼50% less attractive. These results suggest that increasing fluorination can contribute to fly mortality, but the trade off with attractancy makes it unlikely that either a di or trifluorinated ME would be an improvement over ME for detection and/or eradication of this species.

  19. Molecular characteristics, mRNA expression, and alternative splicing of a ryanodine receptor gene in the oriental fruit fly, Bactrocera dorsalis (Hendel.

    Directory of Open Access Journals (Sweden)

    Guo-Rui Yuan

    Full Text Available Ryanodine receptors (RyRs are a distinct class of ligand-gated channels controlling the release of calcium from intracellular stores. The emergence of diamide insecticides, which selectively target insect RyRs, has promoted the study of insect RyRs. In the present study, the full-length RyR cDNA (BdRyR was cloned and characterized from the oriental fruit fly, Bactrocera dorsalis (Hendel, a serious pest of fruits and vegetables throughout East Asia and the Pacific Rim. The cDNA of BdRyR contains a 15,420-bp open reading frame encoding 5,140 amino acids with a predicted molecular weight of 582.4 kDa and an isoelectric point of 5.38. BdRyR shows a high level of amino acid sequence identity (78 to 97% to other insect RyR isoforms. All common structural features of the RyRs are present in the BdRyR, including a well-conserved C-terminal domain containing consensus calcium-binding EF-hands and six transmembrane domains, and a large N-terminal domain. Quantitative real-time PCR analyses revealed that BdRyR was expressed at the lowest and highest levels in egg and adult, respectively, and that the BdRyR expression levels in the third instar larva, pupa and adult were 166.99-, 157.56- and 808.56-fold higher, respectively, than that in the egg. Among different adult body parts, the highest expression level was observed in the thorax compared with the head and abdomen. In addition, four alternative splice sites were identified in the BdRyR gene, with the first, ASI, being located in the central part of the predicted second spore lysis A/RyR domain. Diagnostic PCR analyses revealed that alternative splice variants were generated not only in a tissue-specific manner but also in a developmentally regulated manner. These results lay the foundation for further understanding the structural and functional properties of BdRyR, and the molecular mechanisms for target site resistance in B. dorsalis.

  20. The Culicoides of Southeast Asia (Diptera: Ceratopogonidae)

    Science.gov (United States)

    1989-01-01

    3-33. Forattini, O.P. 1957. Culicoides da Regido Neotropical (Diptera, Ceratopogonidae). Arq. Fac. Hig. Saude Pub. Univ. Scio Paulo 11: 161-526. Fox...Cullcoides: 239. boormani; 240. gem. flus; 241. gentills ; 242. gymnopterus; 243. hoffmanloldes; 244. kinari; 245. klsangkini; 246. mellipes; 247. nitens

  1. Een nieuwe daas voor Nederland: Hybomitra arpadi (Diptera: Tabanidae)

    NARCIS (Netherlands)

    Zeegers, T.

    2002-01-01

    A new horsefly for the Netherlands: Hybomitra arpadi (Diptera: Tabanidae) The horsefly Hybomitra arpadi (Diptera: Tabanidae) is recorded for the first time from the Netherlands. New features for the recognition of the males and some notes on the biology are given.

  2. Molecular phylogeny of Miltogramminae (Diptera Sarcophagidae)

    DEFF Research Database (Denmark)

    Piwczyński, Marcin; Pape, Thomas; Deja-Sikora, Edyta

    2017-01-01

    Miltogramminae is one of the phylogenetically most poorly studied taxa of the species-rich family Sarcophagidae (Diptera). Most species are kleptoparasites in nests of solitary aculeate wasps and bees, although parasitoids and saprophagous species are also known, and the ancestral miltogrammine...... life habit remains unsettled. Here, we present for the first time a comprehensive phylogenetic tree consisting of 58 representatives of Miltogramminae, reconstructed using sequence data from three mitochondrial (COI, cytB, ND4) and one nuclear (Ef-1α) genes. Our phylogenetic hypothesis suggests that...

  3. Consumption and metabolism of 1,2-dimethoxy-4-(3-fluoro-2-propenyl)benzene, a fluorine analog of methyl eugenol, in the oriental fruit fly Bactrocera dorsalis (Hendel).

    Science.gov (United States)

    Khrimian, Ashot; Jang, Eric B; Nagata, Janice; Carvalho, Lori

    2006-07-01

    Methyl eugenol (ME) is a natural phenylpropanoid highly attractive to oriental fruit fly Bactrocera dorsalis (Hendel) males. The flies eagerly feed on ME and produce hydroxylated metabolites with both pheromonal and allomonal functions. Side-chain metabolic activation of ME has long been recognized as a primary reason for hepatocarcinogenicity of this compound on rodents. In an attempt to develop a safer alternative to ME for fruit fly management, we developed a fluorine analog 1,2-dimethoxy-4-(3-fluoro-2-propenyl)benzene (I), which, in earlier field tests, was as active to the oriental fruit fly as ME. Now we report that B. dorsalis males are not only attracted to, but also eagerly consume (up to approximately 1 mg/insect) compound I, thus recognizing this fluorinated benzene as a close kin of the natural ME. The flies metabolized the fluorine analog I in a similar fashion producing mostly two hydroxylated products, 2-(3-fluoro-2-propenyl)-4,5-dimethoxyphenol (II) and (E)-coniferyl alcohol (III), which they stored in rectal glands. However, the introduction of the fluorine atom at the terminal carbon atom of the double bond favors the ring hydroxylation over a side-chain metabolic oxidation pathway, by which coniferyl alcohol is produced. It also appears that fluorination overall impedes the metabolism: at high feed rate (10 mul per 10 males), the flies consumed in total more fluorine analog I than ME but were unable to metabolize it as efficiently as ME.

  4. Factors affecting decomposition and Diptera colonization.

    Science.gov (United States)

    Campobasso, C P; Di Vella, G; Introna, F

    2001-08-15

    Understanding the process of corpse decomposition is basic to establishing the postmortem interval (PMI) in any death investigation even using insect evidence. The sequence of postmortem changes in soft tissues usually gives an idea of how long an individual has been dead. However, modification of the decomposition process can considerably alter the estimate of the time of death. A body after death is sometimes subject to depredation by various types of animals among which insects can have a predominant role in the breakdown of the corpse thus, accelerating the decomposition rate. The interference of the insect community in the decomposition process has been investigated by several experimental studies using animal models and very few contributions directly on cadavers. Several of the most frequent factors affecting PMI estimates such as temperature, burial depth and access of the body to insects are fully reviewed. On account of their activity and world wide distribution, Diptera are the insects of greatest forensic interest. The knowledge of factors inhibiting or favouring colonization and Diptera development is a necessary pre-requisite for estimating the PMI using entomological data.

  5. Development of immature stages and comparative demography of two cucurbit-attacking fruit flies in Reunion Island: Bactrocera cucurbitae and Dacus ciliatus (Diptera Tephritidae).

    Science.gov (United States)

    Vayssières, J F; Carel, Y; Coubes, M; Duyck, P F

    2008-04-01

    On Reunion Island, two species of Dacini, Bactrocera cucurbitae (Coquillett) and Dacus ciliatus Loew, infest 16 host plant species belonging to the family Cucurbitaceae from sea level to 1,600 m. These two species represent two primary pests of this plant family on the island. Melon fly, Bactrocera cucurbitae, and Ethiopian fruit fly, D. ciliatus, larval development was studied at four different constant temperatures (15, 20, 25, and 30 degrees C) with three host plants (cucumber, pumpkin, and squash). Adult life histories of these two species were studied at 25 degrees C with the three host plants. The results led to the conclusion that B. cucurbitae had a faster egg incubation time. Its preimaginal instars developed significantly faster than those of D. ciliatus independent of temperature. B. cucurbitae and D. ciliatus had similar mean preoviposition duration and egg hatching success. Fecundity was significantly higher for the melon fly on cucumber and pumpkin and lower on squash. Two distinctly different life- history patterns were evident: (1) later onset of reproduction, longer oviposition time, longer life span, and higher fecundity (B. cucurbitae) and (2) early reproduction, lower oviposition time, shorter life span, and lower fecundity (D. ciliatus). These results are useful for improving laboratory-rearing methods and for building simulation models to predict Dacini population dynamics.

  6. Effect of probiotic adult diets on fitness components of sterile male Mediterranean fruit flies (Diptera: Tephritidae) under laboratory and field cage conditions.

    Science.gov (United States)

    Niyazi, Nuri; Lauzon, Carol R; Shelly, Todd E

    2004-10-01

    The aim of the current study was to investigate the effect of probiotic adult diets, i.e., adult diets containing viable symbiotic intestinal bacteria, on the pheromone-calling activity, mating success, life expectancy, and survival of mass-reared male Mediterranean fruit flies, Ceratitis capitata (Wiedemann), as an avenue for improving the field performance of sterile males in release programs to eradicate, suppress, or prevent spread of wild populations. The effect of inoculation of two standard adult diets (sugar-yeast granulate [SY] and sugar agar [s]) and two experimental formulations (yeast-reduced granulate [Sy] and yeast-enhanced sugar agar [sy]) with Enterobacter agglomerans and Klebsiella pneumoniae (typically occurring in the gut of wild flies) on the different fitness components was assessed in the laboratory and on field-caged host trees. We found that, in the laboratory, males reared on the probiotic yeast-enhanced agar, sy, had a significant mating advantage over competitors fed the standard s agar (probiotic and control) or noninoculated sy agar; no effect of probiotic enrichment (or lowering the yeast content) was found with the granular diets. Mating test results obtained in the field were inconsistent with laboratory data in that no differences in the numbers of matings were observed between males reared on any of the probiotic and control agar diets (or the SY granulate), whereas males feeding on the probiotic modified granulate, Sy, scored significantly more matings than their control competitors. The pheromone-calling activity of males maintained on the granular diets was not affected by probiotic enrichment on any of the seven observation days. Agar-fed males, however, "called" more frequently on days 6 and 7 (but not on days 1-5) when their diet contained the probiotic load. Laboratory survival of granulate-fed males was found to be significantly prolonged with probiotic inoculation and lowering the yeast content of the standard SY granulate (but not with probiotic inoculation of sy). Similarly, males reared on the probiotic and control modified agars (sy) survived significantly longer than those feeding on the standard s agars (inoculated and control). Again, the results obtained in the field were inconsistent, because no differences between treated and control males were found for any of the diets. The findings are discussed in the light of other published studies on adult nutrition and behavioral ecology in C. capitata.

  7. Escolha de parceiro para acasalamento em Ceratitis capitata (Wiedemann) (Diptera: Tephritidae): influência do envelhecimento dos machos no sucesso de cópula

    OpenAIRE

    Silva Neto, Alberto M da; Dias, Vanessa S; Joachim-Bravo, Iara S

    2009-01-01

    O objetivo deste estudo foi avaliar o efeito da senescência no sucesso de cópula e na secreção de feromônio sexual por machos de Ceratitis capitata (Wiedemann). O efeito do envelhecimento do macho sobre o acasalamento foi analisado utilizando-se machos com cinco e 21 dias de idade, através do seu sucesso de copula (escolha dos machos pela fêmea para cópula) e pela quantidade de machos que emitiram feromônio sexual. O sucesso de cópula foi avaliado através de várias proporções de machos jovens...

  8. Comportamento Reprodutivo de Ceratitis capitata Wiedemann (Diptera: Tephritidae): Efeito do Tamanho dos Machos Sobre o Seu Sucesso de Cópula.

    OpenAIRE

    Silva Neto, Alberto Moreira; Universidade Estadual de Feira de Santana; Dias, Vanessa Simões; Universidade Federal da Bahia; Joachim-Bravo, Iara Sordi; Universidade Federal da Bahia

    2012-01-01

    Neste trabalho avaliou-se a influência do tamanho de machos de Ceratitis capitata (Wiedemann) no seu sucesso de cópula. Para assegurar a produção de machos adultos de diferentes tamanhos (grandes e pequenos), dois grupos de larvas foram alimentados com diferentes concentrações de proteína. Subsequentemente, machos adultos de ambos os grupos foram comparados em termos de seu sucesso de cópula (estimado pela capacidade de ser escolhido pela...

  9. Evidence for potential of managing some African fruit fly species (Diptera: Tephritidae) using the mango fruit fly host-marking pheromone.

    Science.gov (United States)

    Kachigamba, Donald L; Ekesi, Sunday; Ndungu, Mary W; Gitonga, Linus M; Teal, Peter E A; Torto, Baldwyn

    2012-12-01

    We investigated conspecific and heterospecific oviposition host discrimination among four economically important fruit fly pests of mango in Africa (Ceratitis capitata, Wiedemann; C. fasciventris, Bezzi; C. rosa, Karsch, and C. cosyra, Walker) with regard to host-marking behavior and fecal matter aqueous solutions. The objective of the study was to get insight into the potential of managing these pests using the host-marking technique. Observations were done on mango slices marked by the flies and treated with aqueous solutions of fecal matter of the flies, respectively. In both host-marking and fecal matter experiments, C. cosyra, which is the most destructive species of the four on mango, was exceptional. It only discriminated against hosts treated with its fecal matter but with lower sensitivity while C. capitata and C.fasciventris discriminated against hosts marked by it or treated with its fecal matter and with higher sensitivity. Our results provide evidence for potential of managing some of the major fruit fly species infesting mango in Africa using the host-marking pheromone of the mango fruit fly, C. cosyra.

  10. COMPARISON OF THE VOLATILE COMPONENTS RELEASED BY CALLING MALES OF CERATITIS CAPITATA (DIPTERA: TEPHRITIDAE) WITH THOSE EXTRACTABLE FROM THE SALIVARY GLANDS

    National Research Council Canada - National Science Library

    Gláucia B. Gonçalves; Carlos E. Silva; Jeinny C. G. Dos Santos; Eunice S. Dos Santos; Ruth R. Do Nascimento; Edleide Leite Da Silva; Adriana De Lima Mendonça; Maria Do Rosário Tenório De Freitas; Antônio E. G. Sant’Ana

    2006-01-01

    Abstract The volatile compounds released by calling males of Ceratitis capitata and those that were extracted from the salivary glands with n-hexane were analyzed by gas chromatography-mass spectrometry...

  11. Comportamento Reprodutivo de Ceratitis capitata Wiedemann (Diptera: Tephritidae: Efeito do Tamanho dos Machos Sobre o Seu Sucesso de Cópula.

    Directory of Open Access Journals (Sweden)

    Alberto Silva Neto

    2012-11-01

    Abstract. This work evaluated the influence of size on the copula success in Ceratitis capitata (Wiedemann. To assure the production of different adult sizes (big and small, two groups of larvae had been fed with different protein concentrations. Subsequently, adult males of both groups had been compared in terms of copula success and amount of males who showed the first step of courtship (emission of sexual pheromone. The copula success in laboratory was evaluated with males in some ratios, which the number of big males with five days of life (an unique male in relation to a gradual increase of small males with same age kept constant. The tested ratios had been 1:1, 1:2, 1:3, 1:4, 1:5, and 1:10. In the experiments of copula success in the 1:1 ratio and the ones of pheromone emission, they had been tested small male of different ages (five, nine or 13 days, whereas the age of the big males kept constant (five days. Experiments of copula success in the 1:1 ratio had been also carried through in field cage. It was prove that the big males had taken advantage in all the parameters analyzed in laboratory, emitting pheromone and having a bigger copula success, exactly when the age of the small males was varied. The size effect was so significant, that in the ratio of 1 big male for 10 small males, the females had still chosen the big males. In field cage, the results had been similar to the ones of laboratory.

  12. Comparison of Anastrepha ludens (Diptera: Tephritidae) Bisexual and Genetic Sexing (Tapachula-7) Strains: Effect of Hypoxia, Fly Density, Chilling Period, and Food Type on Fly Quality.

    Science.gov (United States)

    Arredondo, José; Ruiz, Lía; Hernández, Emilio; Montoya, Pablo; Díaz-Fleischer, Francisco

    2016-04-01

    The use of genetic sexing strain (GSS) insects in the sterile insect technique (SIT) makes necessary the revision of quality parameters of some stressful steps used during the packing process for aerial release because of possible differences in tolerance between fly strains. Here, we determined the effect of three periods of hypoxia (12, 24, and 36 h at pupal stage), three cage densities (1.0, 1.3, and 1.5 flies/cm2), two different foods (protein/sugar (1/24) and Mubarqui), and three chilling times (20 min [control], 90, and 180 min) on the quality parameters of flies of two Anastrepha ludens (Loew) strains (bisexual and GSS Tapachula-7). In general, the response to stressful conditions of both fly strains was qualitatively equivalent but quantitatively different, as flies of both strains responded equally to the stressful factors; however, flies of Tapachula-7 exhibited lower quality parameters than the control flies. Thus, hypoxia affected the flying ability but not the emergence or longevity of flies. The food type affected the adult weight; protein/sugar produced heavier flies that also survived longer and had a greater mating propensity. Flies under the lowest density were better fliers that those at the other two densities. Increasing chilling time reduced flight ability but not longevity or mating propensity. The implications of these findings for the use of A. ludens GSS in SIT programs are discussed herein.

  13. Infectivity of Four Entomopathogenic Nematodes in Relation to Environmental Factors and Their Effects on the Biochemistry of the Medfly Ceratitis capitata (Wied.) (Diptera: Tephritidae).

    Science.gov (United States)

    Shaurub, E H; Soliman, N A; Hashem, A G; Abdel-Rahman, A M

    2015-12-01

    Late third instars of the medfly, Ceratitis capitata (Wied.), migrate from the host fruit into the soil and leaf litter beneath host trees, where they may become a target for entomopathogenic nematodes (EPNs). The effects of ultraviolet (UV) light, temperature, soil type (texture), and soil moisture level on infectivity of the four tested EPNs Heterorhabditis bacteriophora AS1, H. bacteriophora HP88, Steinernema carpocapsae ALL, and Steinernema riobrave ML29 to late third instars of C. capitata were evaluated. Biochemical alterations induced by the most virulent nematodes were quantified. The nematode infectivity decreased with increase in exposure time to UV light, whereas it increased with increase in temperature. Infectivity increased in sandy soil, whereas it decreased in silt and clay soils. Soils with high moisture levels decreased infectivity. Based on the 50% lethal concentration (LC50), H. bacteriophora AS1 and S. carpocapsae ALL were the most virulent heterorhabditid and steinernematid nematodes, respectively, with the highest virulence for H. bacteriophora AS1. The nematodes caused significant decline in total protein and cholesterol content of larvae and caused reduced activity of transaminases and phosphatases. In contrast, they significantly enhanced total glucose content. It can be concluded that the most optimum environmental conditions of the tested nematodes to elicit their infectivity against late third instars of C. capitata were sandy soil with 10% moisture level, ambient temperature of 25°C, and no exposure to UV. The EPNs tested can affect late third instars of C. capitata by targeting different biochemical molecules in different metabolic pathways. The interaction between them and the host larvae appears to be primarily nutritional.

  14. Suppression of mediterranean fruit fly(Diptera: Tephritidae) with trimedlure(TML) dispensers and biolure in coffee(Coffea arabica L)

    Science.gov (United States)

    Solid Trimedlure[TML] dispensers and novel solid triple lure dispensers[TMR] without insecticides were tested as “attract and kill” devices alone and in combination with Biolure mass trapping to evaluate suppression of Mediterranean fruit fly, Ceratitis capitata(Wiedemann) in a large coffee plantati...

  15. Estudios de laboratorio para el control de Ceratitis capitata (Wiedmann (Diptera: Tephritidae (Mosca del Mediterráneo con Beauveria bassiana

    Directory of Open Access Journals (Sweden)

    Luis Porras

    2008-01-01

    Full Text Available Con el objetivo de seleccionar cepas promisorias de Beauveria bassiana para el control de Ceratitis capitata, se realizó, en condiciones de laboratorio, una serie de ensayos empleando la mosca adulta como estado vulnerable al parasitismo por el hongo entomopatógeno. Para la selección se utilizó una concentración de 5x109 CV.m-2 del hongo. Se determinó la CL90, la sobrevivencia media (SM, la compatibilidad con insecticidas, además de ensayos de producción con el hongo. Así como la compatibilidad de los insecticidas Mercaptotion 100% CE (Lupara® y Dimetoato 40% CE (Sistémico Icona con las cepas seleccionadas. Se cuantificó la viabilidad de los conidios en platos de Petri pos-tratamiento, a 50, 100 y 200% de la dosis comercial del insecticida. A partir de 7 cepas evaluadas (mortalidad 97-14% fueron seleccionadas la Bb 26, la Bb 259, la Bb 132, y la Bb 238. Los valores de CL90 estuvieron entre 1x109 y 3,8 x1011 CV.m-2 (Bb 238 y Bb 26, respectivamente. La SM de las cepas varió de 7-12 días (Bb 238 y Bb 26, respectivamente. La mayor producción fue de 7x109 UFC.mg-1 y 20,7 g.conidios.kg-1 de arroz (Bb 26. Todas las cepas fueron compatibles con Mercaptotion y la Bb 132 presentó la mayor compatibilidad con el Dimetoato. En conclusión, los ensayos en el laboratorio permitieron seleccionar cepas de B. bassiana con potencial para controlar C. capitata.

  16. Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830 (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    IJ. Bechara

    Full Text Available The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae. We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3' as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

  17. Influence of male nutritional conditions on the performance and alimentary selection of wild females of Anastrepha obliqua (Macquart)(Diptera, Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Cresoni-Pereira, Carla; Zucoloto, Fernando Sergio [Universidade Federal de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Fac. de Filosofia, Ciencias e Letras. Dept. de Biologia], e-mail: cresoni@usp.br, e-mail: zucoloto@ffclrp.usp.br

    2006-04-15

    The behavior of A. obliqua females is regulated by endogenous and exogenous factors and among these the presence of males. Experiments were carried out to investigate whether the presence of males and their nutritional condition may affect the behavior of self-selection feeding and the performance of A. obliqua females. Females were sorted in groups containing yeast-deprived females and males, and non-yeast deprived females and males. The females were maintained apart from the males by a transparent plastic screen. Several yeast and sucrose combinations were offered to the females in a single diet block or in separate blocks. Ingestion, egg production, longevity and diet efficiency were determined. The non-yeast-deprived males positively influenced the females performance when the latter were fed with yeast and sucrose in distinct diet blocks. Performance was better in the groups without males and with yeast-deprived males where the females could not select the nutrient proportions (yeast and sucrose in a single diet block). (author)

  18. Cold Disinfestation of "Hass" Avocado (Persia americana) of Three Species of Fruit Fly (Diptera: Tephritidae)-Ceratitis capitata, Ceratitis rosa, and Ceratitis cosyra.

    Science.gov (United States)

    Ware, A B; du Toit, C L N

    2017-06-01

    The avocado industry is important in South Africa, but access to certain markets is impeded by the presence of phytosanitary pests. One of the ways of securing entry to these markets is to demonstrate that a mitigating treatment will result in there being a negligible chance of accidental importation. In cold treatment comparative studies at 0 °C and 2 °C of immature stages of Ceratitis capitata (Wiedemann), Ceratitis rosa Karsch, and Ceratitis cosyra (Walker) in "Hass" avocado, the third instar of C. cosyra was shown to be the most cold tolerant. This larval life stage was used in a large-scale trial to test treatment efficacy at 2 °C, a temperature known to be the better for fruit quality. There were no survivors from the 49,795 individual fruit fly larvae subjected to the cold treatment at 2 °C for 20 d. It is argued that, although this level of assessment falls short of the Probit 9 level normally required for fruit fly, they are rarely found in avocado fruit and that the level of disinfestation obtained is more than sufficient to achieve quarantine security. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  19. Residual toxicity of insecticides used in Tunisian citrus orchards on the imported parasitoid Diachasmimorpha longicaudata (Hymenoptera: Braconidae: Implications for IPM program of Ceratitis capitata (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Ahlem Harbi

    2017-11-01

    Full Text Available Citrus agro-industry is globally harshened mainly by Ceratitis capitata (Wiedemann, the most worldwide destructive tephritid fruit fly species. Citrus agro-industry is one of the pillars of Tunisia economy, and by hence, harshened by this species. Tunisia has established an Integrated Pest Management (IPM programme against citrus pests, including C. capitata, that rely on the structured use of pesticides, on the application several trapping protocols, along with pilot-scale sterile insect technique program and, since 2013, with pilot-scale releases of the braconid parasitoid Diachasmimorpha longicaudata Ashmed (Hymenoptera: Braconidae. Insecticide side-effects on parasitoids and other natural enemies are being requested for a successful implementation of biological control within any IPM programme. However, these data are almost scarce for the braconid species D. longicaudata. To this end, we have determined the side-effects of malathion, methidathion, acetamiprid, azadiractin, abamectin, deltametrin+thiacloprid and spinosad, as the most popular insecticides used in Tunisia either as fresh residues or at several aged time points, on the parasitoid D. longicaudata according the IOBC pesticide harm-classification. IOBC classification evolution of residues over time had allowed determining the best combination of pesticide applications in a structured fashion with the viable releases of D. longicaudata for the control of C. capitata in Tunisian citrus agro-ecosystems.

  20. Differences in performance and transcriptome-wide gene expression associated with Rhagoletis (Diptera: Tephritidae) larvae feeding in alternate host fruit environments.

    Science.gov (United States)

    Ragland, Gregory J; Almskaar, Kristin; Vertacnik, Kim L; Gough, Harlan M; Feder, Jeffrey L; Hahn, Daniel A; Schwarz, Dietmar

    2015-06-01

    Host race formation, the establishment of new populations using novel resources, is a major hypothesized mechanism of ecological speciation, especially in plant-feeding insects. The initial stages of host race formation will often involve phenotypic plasticity on the novel resource, with subsequent genetically based adaptations enhancing host-associated fitness differences. Several studies have explored the physiology of the plastic responses of insects to novel host environments. However, the mechanisms underlying evolved differences among host races and species remain poorly understood. Here, we demonstrate a reciprocal larval performance difference between two closely related species of Rhagoletis flies, R. pomonella and R. zephyria, specialized for feeding in apple and snowberry fruit, respectively. Microarray analysis of fly larvae feeding in apples versus snowberries revealed patterns of transcriptome-wide differential gene expression consistent with both plastic and evolved responses to the different fruit resources, most notably for detoxification-related genes such as cytochrome p450s. Transcripts exhibiting evolved expression differences between species tended to also demonstrate plastic responses to fruit environment. The observed pattern suggests that Rhagoletis larvae exhibit extensive plasticity in gene expression in response to novel fruit that may potentiate shifts to new hosts. Subsequent selection, particularly selection to suppress initially costly plastic responses, could account for the evolved expression differences observed between R. pomonella and R. zephyria, creating specialized races and new fly species. Thus, genetically based ecological adaptations generating new biodiversity may often evolve from initial plastic responses in gene expression to the challenges posed by novel environments. © 2015 John Wiley & Sons Ltd.

  1. Comparison of brown sugar, hot water, and salt methods for detecting western cherry fruit fly (Diptera: Tephritidae) larvae in sweet cherry

    Science.gov (United States)

    Brown sugar or hot water methods have been developed to detect larvae of tephritid fruit flies in post-harvest fruit in order to maintain quarantine security. It would be useful to determine if variations of these methods can yield better results and if less expensive alternatives exist. This stud...

  2. Evidence for potential of managing some african fruit fly species (Diptera: Tephritidae) using the mango fruit fly host-marking pheromone

    Science.gov (United States)

    We investigated conspecific and heterospecific oviposition host discrimination among four economically important fruit fly pests of mango in Africa (Ceratitis capitata, Wiedemann; C. fasciventris, Bezzi; C. rosa, Karsch, and C. cosyra, Walker) with regard to host-marking behavior and fecal matter aq...

  3. Fruit flies (Diptera: Tephritidae associated to native fruit of Spondias spp. (Anacardiaceae and Ximenia americana L. (Olacaceae and their parasitoids in the State of Piaui, Brazil

    Directory of Open Access Journals (Sweden)

    Almerinda Amélia Rodrigues Araújo

    2014-09-01

    Full Text Available This work aims to identify the species of fruit flies and their parasitoids associated to native fruit of Spondias spp. (caja S. mombin L., umbu-caja Spondias sp., umbu S. tuberosa Arr. Câm. and wild plum Ximenia americana L., in the State of Piaui, Brazil. Samples (63 of fruits were collected from November 2009 to July 2010, totalizing 4,495 fruits and 46,906 kg. It was possible to obtain 10,617 puparia, from which 4,497 tephritids and 1,118 braconid parasitoids emerged. Regarding Spondias spp., the highest occurrence was Anastrepha obliqua (Macquart, with 100% for umbu and umbu-caja. Caja presented an average of 99.52% of A. obliqua, 0.46% of Anastrepha fraterculus (Wied. and 0.97% of Ceratitis capitata (Wied.. Wild plum percentages were 97.83% for A. alveata Stone and 2.17% for A. fraterculus. Infestation rates were 429.2, 178.4, 158.9 and 43.3 puparia/kg in umbu-caja, caja, wild plum and umbu, respectively. Pupal viability was 77.8%, 69.3%, 52.5% and 41.1% to umbu, wild plum, umbu-caja and caja, respectively. By analyzing the sample parasitoids, the percentage was 21.39% for the Doryctobracon areolatus (Szépligeti species and 78.61% for Opius bellus Gahan. For the first time, it was recorded in Brazil X. americana as a host to A. alveata, as well as D. aleolatus and O. bellus as parasitoids of A. obliqua and A. alveata in Piaui.

  4. Diversity and seasonality of fruit flies (Diptera: Tephritidae and Lonchaeidae and their parasitoids (Hymenoptera: Braconidae and Figitidae in orchards of guava, loquat and peach

    Directory of Open Access Journals (Sweden)

    MF. Souza-Filho

    Full Text Available This work was carried out in orchards of guava progenies, and loquat and peach cultivars, in Monte Alegre do Sul, SP, Brazil, in 2002 and 2003. Guavas and loquats were bagged and unbagged bi-weekly and weekly, respectively, for assessment of the infestation period. Peach was only bagged weekly. The assays started when the fruits were at the beginning of development, but still green. Ripe fruits were taken to the laboratory and placed individually into plastic cups. McPhail plastic traps containing torula yeast were hung from January 2002 to January 2004 to assess the fruit fly population in each orchard, but only the Ceratitis capitata population is here discussed. Five tephritid species were reared from the fruits: Anastrepha bistrigata Bezzi, A. fraterculus (Wiedemann, A. obliqua (Macquart, A. sororcula Zucchi, and C. capitata, in addition to six lonchaeid species: Neosilba certa (Walker, N. glaberrima (Wiedemann, N. pendula (Bezzi, N. zadolicha McAlpine and Steyskal, Neosilba sp. 4, and Neosilba sp. 10 (both species are in the process of being described by P. C. Strikis, as well as some unidentified Neosilba species. Ten parasitoid species were obtained from fruit fly puparia, of which five were braconids: Asobara anastrephae (Muesebeck, Doryctobracon areolatus (Szépligeti, D. brasiliensis (Szépligeti, Opius bellus Gahan, and Utetes anastrephae (Viereck, and five figitids: Aganaspis pelleranoi (Brèthes, Dicerataspis grenadensis Ashmead, Lopheucoila anastrephae (Rhower, Leptopilina boulardi (Barbotin, Carlton and Kelner-Pillaut, and Trybliographa infuscata Diaz, Gallardo and Uchôa. Ceratitis capitata showed a seasonal behavior with population density peaking at the second semester of each year. Anastrepha and Neosilba species remained in the orchards throughout both years.

  5. Niche partitioning among two Ceratitis rosa morphotypes and other Ceratitis pest species (Diptera, Tephritidae) along an altitudinal transect in Central Tanzania

    Science.gov (United States)

    Mwatawala, Maulid; Virgilio, Massimiliano; Joseph, Jane; De Meyer, Marc

    2015-01-01

    Abstract Two standard parapheromones, trimedlure (routinely used for monitoring Ceratitis rosa and Ceratitis capitata) and terpinyl acetate (routinely used for monitoring Ceratitis cosyra) were compared with enriched ginger root oil (EGO) lure for detecting and monitoring the presence and relative population abundance of these particular pest species. Standard yellow fruit fly traps were used for the comparison, which was conducted at 10 sites along an altitudinal transect ranging from 540 to 1650 masl on the Uluguru mountains, in Morogoro Region (Central Tanzania). A gradual change of relative occurrence of the two Ceratitis rosa morphotypes was clear from the EGO lure trapping. The morphotype R1 was predominant at lower altitudes while morphotype R2 was predominant at higher altitudes. Further experiments are needed to confirm the consistency of the observed pattern across regions, seasons and years as well as possible differences in the developmental physiology of both morphotypes. The mango fruit fly, Ceratitis cosyra, showed a distinct predominance at altitudes below 800 masl as shown in both the EGO lure and the terpinyl acetate trapping. The catches of all three target species were higher in traps with the EGO lure compared to the conventional lures trimedlure and terpinyl acetate. It is argued that for these species EGO lure can act as a suitable and more effective alternative for trimedlure and terpinyl acetate parapheromones. In addition, EGO lure has the added advantage that it combines the taxon spectrum for the two latter substances, thus requiring the use of only a single attractant. PMID:26798271

  6. Producción masiva y simultánea de machos de Ceratitis capitata (Diptera: Tephritidae y parasitoides Dichasmimorpha longicaudata (Hymenoptera: Braconidae

    Directory of Open Access Journals (Sweden)

    Silvia N. LÓPEZ

    2006-01-01

    Full Text Available En la línea de sexado genético «Cast191» las hembras de Ceratitis capitata son homocigotas para el gen slow , lo que reduce su velocidad de desarrollo; los machos son heterocigotas y muestran una velocidad de desarrollo normal. Esta característica permitió producir, con Cast191, machos estériles por un lado, y parasitoides criados sobre las larvas remanentes por el otro. Nuestro objetivo con este trabajo fue producir ambos insumos simultáneamente y a una escala mayor que hasta ahora. Además, bajo estas condiciones, y en un intento por aumentar la separación entre sexos, se aplicó a las larvas del primer estadío un pulso de 15º C, durante 1 ó 2 días, luego del cual se las mantuvo a 20º C ó 25º C, hasta que entraron al estado de pupa, luego se mantuvo todo el material a 25º C. La mejor separación de sexos, lograda con el tratamiento a 20º C sin pulso de frío, se usó para comparar la calidad del parasitoide Diachasmimorpha longicaudata, criado sobre las larvas obtenidas tras la separación de los machos, con aquellos criados sobre la línea salvaje. Para ello, este tratamiento de separación fue aplicado en la cría de la mosca, y el material remanente de dieta con larvas fue expuesto al parasitoide. La tasa de parasitismo obtenida fue semejante a la hallada sobre la línea salvaje, y la tasa sexual de la F1 del parasitoide presentó un sesgo hacia las hembras aún mayor. Se discute la factibilidad de utilizar la línea Cast191 de C. Capitata, para la producción a mayor escala de machos de mosca y para la cría masiva del parasitoide D. longicaudata.

  7. Flutuação populacional de moscas-das-frutas (Diptera, Tephritidae em pomares de pessegueiro e maracujazeiro em Iraceminha, Santa Catarina

    Directory of Open Access Journals (Sweden)

    Sheila Alberti

    2011-12-01

    Full Text Available http://dx.doi.org/10.5007/2175-7925.2012v25n2p53 O objetivo do estudo foi conhecer a flutuação populacional das moscas-das-frutas em pomares de pessegueiro e maracujazeiro no município de Iraceminha, Santa Catarina. Para o levantamento foram instalados frascos “caça-moscas” do tipo McPhail, contendo glicose invertida a 10%, no período de abril de 2006 a março de 2007. As moscas capturadas foram identificadas no Laboratório de Entomologia da UNOCHAPECÓ. As fêmeas coletadas pertencem a 12 espécies e quatro gêneros. Os adultos de Anatrepha fraterculus ocorreram em todas as estações do ano, com pico populacional em outubro/2006, nos pomares de pessegueiro. Os níveis populacionais de Anastrepha grandis mantiveram-se mais elevados durante os primeiros cinco meses da pesquisa, no pomar de maracujazeiro. Foi constatado baixa infestação dos gêneros Ceratitis capitata, Blepharoneura sp. e Tomoplagia sp. em relação às moscas do gênero Anastrepha. Os resultados mostraram que a presença das moscas está associada a disponibilidade de alimento e não com as condições climáticas.

  8. Parasitoid diversity (Hymenoptera: Braconidae and Figitidae) on frugivorous larvae (Diptera: Tephritidae and Lonchaeidae) at Adolpho Ducke Forest reserve, central amazon region, Manaus, Brazil.

    Science.gov (United States)

    Costa, S G M; Querino, R B; Ronchi-Teles, B; Penteado-Dias, A M M; Zucchi, R A

    2009-05-01

    This study aimed to identify parasitoid species of frugivorous larvae and to describe the tritrophic interactions involving wild fruits, frugivorous insects and their natural enemies at Adolpho Ducke Forest Reserve (RFAD) (Manaus, AM, Brazil). Collections were performed in four 1 km2 quadrants in the corners of the RFAD. The wild fruits were collected inside the forest in access trails leading to each collection area and in trails that surrounded the quadrants, up to five metres from the trail on each side. The fruits were placed in plastic containers covered with thin fabric, with a vermiculite layer on the base to allow the emergence of flies or parasitoids. Seven Braconidae species were collected, distributed among Opiinae: Doryctobracon areolatus (Szépligeti, 1911), Utetes anastrephae (Viereck, 1913), and Opius sp., and Alysiinae: Asobara anastrephae (Muesebeck, 1958), Phaenocarpa pericarpa Wharton and Carrejo, 1999, Idiasta delicata Papp, 1969, and Asobara sp. Parasitism rates by braconids and figitids are presented. Doryctobracon areolatus was the most frequent, parasitizing the highest number of fly species, and showing the highest parasitism percentage in larvae feeding on Micropholis williamii fruits. The collected figitids belong to Aganaspis nordlanderi Wharton, 1998 and A. pelleranoi (Brethes, 1924). All 15 tritrophic associations are new records for the Brazilian Amazon region. The RFAD is an important natural reservoir of frugivorous larvae parasitoids.

  9. First record of the velvet ants (Hymenoptera: Mutillidae) reared from puparia of the ber fruit fly Carpomya vesuviana Costa (Diptera: Tephritidae) in Iran.

    Science.gov (United States)

    Amini, Alieh; Lelej, Arkady S; Sadeghi, Hussein; Karimi, Javad

    2014-09-18

    Two species of mutillids, Smicromyrme (Astomyrme) nikolskajae Lelej, 1985 and S. (Eremotilla) tekensis Skorikov, 1935, reared from puparia of ber fruit fly, Carpomya vesuviana Costa, in South Khorasan, Iran are recorded. Both mutillids are newly recorded from Iran. An overview of eight species of mutillids associated with six species of flies is given in the appendix. 

  10. Cucumber volatile blend, a promising female‐biased lure for Bactrocera cucumis (French 1907) (Diptera: Tephritidae: Dacinae), a pest fruit fly that does not respond to male attractants

    National Research Council Canada - National Science Library

    Royer, Jane E; De Faveri, Stefano G; Lowe, Gail E; Wright, Carole L

    2014-01-01

    Bactrocera cucumis ( F rench 1907), the ‘cucumber fruit fly’, is a horticultural pest in A ustralia that primarily infests cucurbits and has also been recorded from tomatoes, papaw and several other hosts...

  11. Performance of Methyl Eugenol + Matrix + Toxicant combinations under field conditions in Hawaii and California for trapping B. dorsalis (Diptera:Tephritidae).

    Science.gov (United States)

    New solid formulations containing methyl eugenol and either naled or DDVP toxicants were compared to the standard formulations on cotton wicks in large scale field evaluation in Hawaii. Two “reduced risk” toxicants (spinosad and Rynaxypyr®) were also evaluated. In one test the solid lure-toxicant-ma...

  12. Weathering and chemical degradation of methyl eugenol and raspberry ketone solid dispensers for detection, monitoring and male annihilation of Bactrocera dorsalis and Bactrocera cucurbitae (Diptera: Tephritidae) in Hawaii

    Science.gov (United States)

    Solid male lure dispensers containing methyl eugenol (ME) and raspberry ketone (RK), or mixtures of the lures (ME + RK), and dimethyl dichloro-vinyl phosphate (DDVP) were evaluated in AWPM bucket or Jackson traps in commercial papaya (Carica papaya L.) orchards where both oriental fruit fly, Bactroc...

  13. Effect of Resin Ducts and Sap Content on Infestation and Development of Immature Stages of Anastrepha obliqua and Anastrepha ludens (Diptera: Tephritidae) in Four Mango (Sapindales: Anacardiaceae) Cultivars.

    Science.gov (United States)

    Guillén, Larissa; Adaime, Ricardo; Birke, Andrea; Velázquez, Olinda; Angeles, Guillermo; Ortega, Fernando; Ruíz, Eliel; Aluja, Martín

    2017-04-01

    We determined the influence of resin ducts, sap content, and fruit physicochemical features of four mango cultivars (Criollo, Manila, Ataulfo, and Tommy Atkins) on their susceptibility to the attack of the two most pestiferous fruit fly species infesting mangoes in Mexico: Anastrepha ludens (Loew) and Anastrepha obliqua (Macquart). We performed three studies: 1) analysis of resin ducts in mango fruit exocarp to determine the density and area occupied by resin ducts in each mango cultivar, 2) assessment of mango physicochemical features including fruit sap content, and 3) a forced infestation trial under field conditions using enclosed fruit-bearing branches to expose mangoes to gravid A. ludens or A. obliqua females. Infestation rates, development time from egg to prepupae and pupae, pupal weight, and percent of adult emergence, were assessed. 'Ataulfo' and 'Tommy Atkins' cultivars exhibited the highest resin duct density and sap content, the lowest infestation rate, and had a negative effect on immature development and pupal weight. In sharp contrast, 'Manila' and 'Criollo' cultivars, with the lowest resin duct density and sap content, were highly susceptible to A. ludens and A. obliqua attack. We conclude that sap content and the number, size, and distribution of resin ducts as well as firmness in mango fruit exocarp are all involved in the resistance of mango to A. ludens and A. obliqua attack. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  14. Natural Parasitism in Fruit Fly (Diptera: Tephritidae) Populations in Disturbed Areas Adjacent to Commercial Mango Orchards in Chiapas and Veracruz, Mexico.

    Science.gov (United States)

    Montoya, Pablo; Ayala, Amanda; López, Patricia; Cancino, Jorge; Cabrera, Héctor; Cruz, Jassmin; Martinez, Ana Mabel; Figueroa, Isaac; Liedo, Pablo

    2016-04-01

    To determine the natural parasitism in fruit fly populations in disturbed areas adjacent to commercial mango orchards in the states of Chiapas and Veracruz, Mexico, we recorded over one year the fruit fly-host associations, fly infestation, and parasitism rates in backyard orchards and patches of native vegetation. We also investigated the relationship between fruit size, level of larval infestation, and percent of parasitism, and attempted to determine the presence of superparasitism. The most recurrent species in trap catches was Anastrepha obliqua (Macquart), followed by Anastrepha ludens (Loew), in both study zones. The fruit infestation rates were higher in Chiapas than in Veracruz, with A. obliqua again being the most conspicuous species emerging from collected fruits. The diversity of parasitoids species attacking fruit fly larvae was greater in Chiapas, with a predominance of Doryctobracon areolatus (Szépligeti) in both sites, although the exotic Diachasmimorpha longicaudata (Ashmead) was well established in Chiapas. Fruit size was positively correlated with the number of larvae per fruit, but this relationship was not observed in the level of parasitism. The number of oviposition scars was not related to the number of immature parasitoids inside the pupa of D. areolatus emerging from plum fruits. Mass releases of Di. longicaudata seem not to affect the presence or prevalence of the native species. Our findings open new research scenarios on the role and impact of native parasitoid species attacking Anastrepha flies that can contribute to the development of sound strategies for using these species in projects for augmentative biological control. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  15. Faunistic analysis of Anastrepha spp. (Diptera: Tephritidae) on a guava orchard under organic management in the municipality of Una, Bahia, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Dutra, Vivian S.; Santos, Mirian S; Souza Filho, Zilton A.; Silva, Janisete G. [Universidade Estadual de Santa Cruz (UESC), Ilheus, BA (Brazil). Dept. de Ciencias Biologicas; Araujo, Elton L. [Universidade Federal Rural do Semi-Arido, Mossoro, RN (Brazil). Dept. de Ciencias Vegetais

    2009-01-15

    We carried out a study to characterize fruit fly populations on an organic guava orchard (Psidium guajava cv. Paluma) in the municipality of Una, southern region of the state of Bahia, Brazil, using faunistic analysis of the adult fruit f y specimens captured in McPhail traps from January 2004 through March 2007. A total of 22,673 specimens of Anastrepha (15,306 females and 7,367 males) were captured. Thirteen species of Anastrepha were recorded. A. fraterculus and A. obliqua were the more frequent and dominant species, accounting for 90.1% of all females captured in the traps. A. fraterculus was the predominant species (more frequent, constant and dominant). The high value of the Simpson index (0.62) and the low values of Shannon-Wiener (0.83) and equitability (0.49) indices indicated the dominance and high frequency of A. fraterculus and A. obliqua on the guava orchard despite the presence of other fruit species as potential hosts of fruit flies. (author)

  16. RNA interference of a trehalose-6-phosphate synthase gene reveals its roles during larval-pupal metamorphosis in Bactrocera minax (Diptera: Tephritidae).

    Science.gov (United States)

    Xiong, Ke-Cai; Wang, Jia; Li, Jia-Hao; Deng, Yu-Qing; Pu, Po; Fan, Huan; Liu, Ying-Hong

    2016-01-01

    Trehalose is the major blood sugar in insects, which plays a crucial role as an instant source of energy and the starting substrate for chitin biosynthesis. In insects, trehalose is synthesized by catalysis of an important enzyme, trehalose-6-phosphate synthase (TPS). In the present study, a trehalose-6-phosphate synthase gene from Bactrocera minax (BmTPS) was cloned and characterized. BmTPS contained an open reading frame of 2445 nucleotides encoding a protein of 814 amino acids with a predicted molecular weight of 92.05kDa. BmTPS was detectable in all developmental stages of Bactrocera minax and expressed higher in the final- (third-) instar larvae. Tissue-specific expression patterns of BmTPS showed that it was mainly expressed in the fat body. The 20-hydroxyecdysone (20E) induced the expression of BmTPS and three genes in the chitin biosynthesis pathway. Moreover, injection of double-stranded RNA into third-instar larvae successfully silenced the transcription of BmTPS in B. minax, and thereby decreased the activity of TPS and trehalose content. Additionally, silencing of BmTPS inhibited the expression of three key genes in the chitin biosynthesis pathway and exhibited 52% death and abnormal phenotypes. The findings demonstrate that BmTPS is indispensable for larval-pupal metamorphosis. Besides, the establishment of RNAi experimental system in B. minax would lay a solid foundation for further investigation of molecular biology and physiology of this pest. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Molecular Cloning, Characterization and mRNA Expression of a Chitin Synthase 2 Gene from the Oriental Fruit Fly, Bactrocera dorsalis (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Kang-Kang Xu

    2013-08-01

    Full Text Available Chitin synthase (CHS, a potential target for eco-friendly insecticides, plays an essential role in chitin formation in insects. In this study, a full-length cDNA encoding chitin synthase 2 (BdCHS2 was cloned and characterized in the oriental fruit fly, Bactrocera dorsalis. The BdCHS2 cDNA had 4417 nucleotides, containing an open reading frame of 4122 nucleotides, which encoded 1373 amino acid residues with a predicted molecular weight of 158.5 kDa. Phylogenetic analysis with other insect CHSs suggested that BdCHS2 belongs to insect CHS2. The BdCHS2 transcript was predominately found in midgut but was detected at low levels in fat body, Malpighian tubules, integument, and trachea. Moreover, BdCHS2 was expressed in all developmental stages, and highly expressed in the feeding stages. There was a positive relationship between BdCHS2 expression and total chitin content during development. Furthermore, both the gene expression and chitin content in midgut decreased when the insect was fed for 24 h, then starved for 24 h, while they increased dramatically and rapidly under the condition of starvation for 24 h then feeding for 24 h. These results suggest that BdCHS2 may play an important role in regulating chitin content of the midgut, and subsequently affect the growth and development of B. dorsalis.

  18. Comparative rearing parameters for bisexual and genetic sexing strains of Zeugodacus cucurbitae and Bactrocera dorsalis (Diptera: Tephritidae) on an artificial diet

    Science.gov (United States)

    The Sterile Insect Technique (SIT) is an important component of area wide programs to control invading or established populations of pestiferous tephritids. The SIT involves the production, sterilization, and release of large numbers of the target species, with the goal of obtaining sterile male x w...

  19. Co-Infestation and Spatial Distribution of Bactrocera carambolae and Anastrepha spp. (Diptera: Tephritidae) in Common Guava in the Eastern Amazon.

    Science.gov (United States)

    Deus, E G; Godoy, W A C; Sousa, M S M; Lopes, G N; Jesus-Barros, C R; Silva, J G; Adaime, R

    2016-01-01

    Field infestation and spatial distribution of introduced Bactrocera carambolae Drew and Hancock and native species of Anastrepha in common guavas [Psidium guajava (L.)] were investigated in the eastern Amazon. Fruit sampling was carried out in the municipalities of Calçoene and Oiapoque in the state of Amapá, Brazil. The frequency distribution of larvae in fruit was fitted to the negative binomial distribution. Anastrepha striata was more abundant in both sampled areas in comparison to Anastrepha fraterculus (Wiedemann) and B. carambolae The frequency distribution analysis of adults revealed an aggregated pattern for B. carambolae as well as for A. fraterculus and Anastrepha striata Schiner, described by the negative binomial distribution. Although the populations of Anastrepha spp. may have suffered some impact due to the presence of B. carambolae, the results are still not robust enough to indicate effective reduction in the abundance of Anastrepha spp. caused by B. carambolae in a general sense. The high degree of aggregation observed for both species suggests interspecific co-occurrence with the simultaneous presence of both species in the analysed fruit. Moreover, a significant fraction of uninfested guavas also indicated absence of competitive displacement. © The Author 2016. Published by Oxford University Press on behalf of the Entomological Society of America.

  20. Effects of Methyl Eugenol Feeding on Mating Compatibility of Asian Population of Bactrocera dorsalis (Diptera: Tephritidae) with African Population and with B. carambolae.

    Science.gov (United States)

    Haq, Ihsan Ul; Vreysen, Marc J B; Schutze, Mark; Hendrichs, Jorge; Shelly, Todd

    2016-02-01

    Males of some species included in the Bactrocera dorsalis complex are strongly attracted to methyl eugenol (ME) (1,2-dimethoxy-4-(2-propenyl) benzene), a natural compound occurring in a variety of plant species. ME feeding of males of the B. dorsalis complex is known to enhance their mating competitiveness. Within B. dorsalis, recent studies show that Asian and African populations of B. dorsalis are sexually compatible, while populations of B. dorsalis and Bactrocera carambolae are relatively incompatible. The objectives of this study were to examine whether ME feeding by males affects mating compatibility between Asian and African populations of B. dorsalis and ME feeding reduces male mating incompatibility between B. dorsalis (Asian population) and B. carambolae. The data confirmed that Asian and African populations of B. dorsalis are sexually compatible for mating and showed that ME feeding only increased the number of matings. Though ME feeding also increased the number of matings of B. dorsalis (Asian population) and B. carambolae males but the sexual incompatibility between both species was not reduced by treatment with ME. These results conform to the efforts resolving the biological species limits among B. dorsalis complex and have implications for fruit fly control programs in fields and horticultural trade. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America.

  1. Captures of wild Ceratitis capitata Bactrocera dorsalis and Bactrocera cucurbitae (Diptera: Tephritidae) in traps with improved multi-lure TMR-Dispensers weathered in California

    Science.gov (United States)

    During 2012-2013 two “attract and kill” systems were weathered in California as potential detection and male annihilation treatments (MAT). Solid Mallet TMR (trimedlure [TML], methyl eugenol [ME], raspberry ketone [RK]) wafers impregnated with DDVP (2, 2-dichlorovinyl dimethyl phosphate) insecticide...

  2. Population Dynamics of Pre-Imaginal Stages of Olive Fruit Fly Bactrocera oleae Gmel. (Diptera, Tephritidae in the Region of Bar (Montenegro

    Directory of Open Access Journals (Sweden)

    Tatjana Perović

    2013-01-01

    Full Text Available Olive fruit fly is the most harmful pest of olive fruits and important for oil production.Damage involves yield reduction as a consequence of premature fruit drop, but also areduced quality of olive oil and olive products. There is little available data regarding thebiology of Bactrocera oleae in Montenegro. Knowledge of the pest life cycle and developmentwould improve optimization of insecticide application timing and protection offruits, and reduce adverse effects on the environment.Investigation was conducted on the Žutica variety in an olive grove located in Bar duringa three-year period. Population dynamics of the pre-imaginal stages and level of fruitinfestation were monitored from mid-July until the end of October.The results of this three-year investigation showed that the beginning of infestationwas always at the end of July. It was also found that, depending on environmental conditions,the level of infestation was low until the end of August. In September and October itmultiplied, and reached maximum by the end of October.Regarding infestation structure, eggs and first instar larvae were the dominant developmentalstages of the pest until the middle of September. From mid-September until mid-October all developmental stages (eggs, larvae, pupae were equally present in infestedfruits. Pupae, cocoons and abandoned galleries prevailed until the harvest.

  3. Using two-sex life tables to determine fitness parameters of four Bactrocera species (Diptera: Tephritidae) reared on a semi-artificial diet.

    Science.gov (United States)

    Jaleel, W; Yin, J; Wang, D; He, Y; Lu, L; Shi, H

    2017-09-25

    Fruit flies in the genus Bactrocera are global, economically important pests of agricultural food crops. However, basic life history information about these pests, which is vital for designing more effective control methods, is currently lacking. Artificial diets can be used as a suitable replacement for natural host plants for rearing fruit flies under laboratory conditions, and this study reports on the two-sex life-table parameters of four Bactrocera species (Bactrocera correcta, Bactrocera dorsalis, Bactrocera cucurbitae, and Bactrocera tau) reared on a semi-artificial diet comprising corn flour, banana, sodium benzoate, yeast, sucrose, winding paper, hydrochloric acid and water. The results indicated that the larval development period of B. correcta (6.81 ± 0.65 days) was significantly longer than those of the other species. The fecundity of B. dorsalis (593.60 eggs female-1) was highest among the four species. There were no differences in intrinsic rate of increase (r) and finite rate of increase (λ) among the four species. The gross reproductive rate (GRR) and net reproductive rate (R 0) of B. dorsalis were higher than those of the other species, and the mean generation time (T) of B. cucurbitae (42.08 ± 1.21 h) was longer than that of the other species. We conclude that the semi-artificial diet was most suitable for rearing B. dorsalis, due to its shorter development time and higher fecundity. These results will be useful for future studies of fruit fly management.

  4. Population fluctuation of adult males of the fruit fly, Bactrocera tau Walker (Diptera: Tephritidae) in passion fruit orchards in relation to abiotic factors and sanitation

    NARCIS (Netherlands)

    Hasyim, A.; Muryati, M.; Kogel, de W.J.

    2008-01-01

    Fruit fly (Bactrocera tau) is the most destructive pest on some fruits in Indonesia. Monitoring of the pest population is essential as one of the procedures in the IPM concept. The study aimed to investigate the seasonal fluctuation of adult males of B. tau and their damage on passion fruits in

  5. Bdor\\Orco is important for oviposition-deterring behavior induced by both the volatile and non-volatile repellents in Bactrocera dorsalis (Diptera: Tephritidae).

    Science.gov (United States)

    Yi, Xin; Zhao, Haiming; Wang, Peidan; Hu, Meiying; Zhong, Guohua

    2014-06-01

    Several studies have shown that the selections of gravid females to potential oviposition sites from a distance were mediated by volatile signals, however, the means by which the sensory cues from non-volatile chemicals affected the insect behavior were still a controversial subject. Chemosensory in insect is a complex process, which is mediated by multigene families of chemoreceptors, including olfactory receptors, olfactory co-receptors, and odorant-binding proteins. To elucidate the chemoreception mechanism of volatile and non-volatile chemicals, the roles of Orco and OBP in oviposition-deterrent activities induced by citronellal and Rhodojaponin-III were investigated. Our results suggested that RNAi-mediated expression inhibition was successfully achieved by feeding dsRNA in Bactrocera dorsalis. High levels of Bdor\\Orco expression were essential for recognizing two chemicals of different physical properties, whereas the expression of Bdor\\OBP was only imperative in perception of volatile chemical. The results suggested that volatile and non-volatile chemicals may evoke distinct molecular basis for chemosensory in the flies, while Orco was essential in the perception of both chemicals. The study highlighted that the central role of Orco in chemical recognition, which enabled it to be the universally applied target of designing new botanical pesticide. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Attraction of Bactrocera cucurbitae and B.dorsalis(Diptera: Tephritidae) to beer waste and other protein sources laced with ammonium acetate

    Science.gov (United States)

    It is known that adult tephritid fruit fly females require protein sources for adequate egg production and that ammonia and its derivatives serve as volatile cues to locate protein-rich food. The attractiveness of beer waste and the commercially available baits Nulure, Buminal, and Bugs 4 Bugs Fruit...

  7. Genetic analysis of oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae) populations based on mitochondrial cox1 and nad1 gene sequences from India and other Asian countries.

    Science.gov (United States)

    Choudhary, Jaipal S; Naaz, Naiyar; Prabhakar, Chandra S; Lemtur, Moanaro

    2016-10-01

    The study examined the genetic diversity and demographic history of Bactrocera dorsalis, a destructive and polyphagous insect pest of fruit crops in diverse geographic regions of India. 19 widely dispersed populations of the fly from India and other Asian countries were analysed using partial sequences of mitochondrial cytochrome oxidase I (cox1) and NADH dehydrogenase 1 (nad1) genes to investigate genetic diversity, genetic structure, and demographic history in the region. Genetic diversity indices [number of haplotypes (H), haloptype diversity (Hd), nucleotide diversity (π) and average number of nucleotide difference (k)] of populations revealed that B. dorsalis maintains fairly high level of genetic diversity without isolation by distance among the geographic regions. Demographic analysis showed significant (negative) Tajimas' D and Fu's F S with non significant sum of squared deviations (SSD) values, which indicate the possibility of recent sudden expansion of species and is further supported through distinctively star-like distribution structure of haplotypes among populations. Thus, the results indicate that both ongoing and historical factors have played important role in determining the genetic structure and diversity of the species in India. Consequently, sterile insect technique (SIT) could be a possible management strategy of species in the regions.

  8. Transcriptomic and metabolomic profiles of Chinese citrus fly, Bactrocera minax (Diptera: Tephritidae), along with pupal development provide insight into diapause program.

    Science.gov (United States)

    Wang, Jia; Fan, Huan; Xiong, Ke-Cai; Liu, Ying-Hong

    2017-01-01

    The Chinese citrus fly, Bactrocera minax (Enderlein), is a devastating citrus pest in Asia. This univoltine insect enters obligatory pupal diapause in each generation, while little is known about the course and the molecular mechanisms of diapause. In this study, the course of diapause was determined by measuring the respiratory rate throughout the pupal stage. In addition, the variation of transcriptomic and metabolomic profiles of pupae at five developmental stages (pre-, early-, middle-, late-, and post-diapause) were evaluated by next-generation sequencing technology and 1H nuclear magnetic resonance spectroscopy (NMR), respectively. A total of 4,808 genes were significantly altered in ten pairwise comparisons, representing major shifts in metabolism and signal transduction as well as endocrine system and digestive system. Gene expression profiles were validated by qRT-PCR analysis. In addition, 48 metabolites were identified and quantified by 1H NMR. Nine of which significantly contributed to the variation in the metabolomic profiles, especially proline and trehalose. Moreover, the samples collected within diapause maintenance (early-, middle-, and late-diapause) only exhibited marginal transcriptomic and metabolomic variation with each other. These findings greatly improve our understanding of B. minax diapause and lay the foundation for further pertinent studies.

  9. Host plant records of the White Striped Fruit Fly, Bactrocera (Bactrocera) albistrigata(de Meijere,1911)(Diptera: Tephritidae), Version 1.0

    Science.gov (United States)

    Bactrocera (Bactrocera) albistrigata (de Meijere, 1911), commonly known as the white striped fruit fly, is regulated through the Plant Protection Act of 2000 (7 U.S.C. 7701-7772) and relevant Parts and Subparts of the Code of Federal Regulations (7 CFR – Agriculture). While considered an obscure min...

  10. Gene flow and genetic structure of Bactrocera carambolae (Diptera, Tephritidae) among geographical differences and sister species, B. dorsalis, inferred from microsatellite DNA data

    Science.gov (United States)

    Aketarawong, Nidchaya; Isasawin, Siriwan; Sojikul, Punchapat; Thanaphum, Sujinda

    2015-01-01

    Abstract The Carambola fruit fly, Bactrocera carambolae, is an invasive pest in Southeast Asia. It has been introduced into areas in South America such as Suriname and Brazil. Bactrocera carambolae belongs to the Bactrocera dorsalis species complex, and seems to be separated from Bactrocera dorsalis based on morphological and multilocus phylogenetic studies. Even though the Carambola fruit fly is an important quarantine species and has an impact on international trade, knowledge of the molecular ecology of Bactrocera carambolae, concerning species status and pest management aspects, is lacking. Seven populations sampled from the known geographical areas of Bactrocera carambolae including Southeast Asia (i.e., Indonesia, Malaysia, Thailand) and South America (i.e., Suriname), were genotyped using eight microsatellite DNA markers. Genetic variation, genetic structure, and genetic network among populations illustrated that the Suriname samples were genetically differentiated from Southeast Asian populations. The genetic network revealed that samples from West Sumatra (Pekanbaru, PK) and Java (Jakarta, JK) were presumably the source populations of Bactrocera carambolae in Suriname, which was congruent with human migration records between the two continents. Additionally, three populations of Bactrocera dorsalis were included to better understand the species boundary. The genetic structure between the two species was significantly separated and approximately 11% of total individuals were detected as admixed (0.100 ≤ Q ≤ 0.900). The genetic network showed connections between Bactrocera carambolae and Bactrocera dorsalis groups throughout Depok (DP), JK, and Nakhon Sri Thammarat (NT) populations. These data supported the hypothesis that the reproductive isolation between the two species may be leaky. Although the morphology and monophyly of nuclear and mitochondrial DNA sequences in previous studies showed discrete entities, the hypothesis of semipermeable boundaries may not be rejected. Alleles at microsatellite loci could be introgressed rather than other nuclear and mitochondrial DNA. Bactrocera carambolae may be an incipient rather than a distinct species of Bactrocera dorsalis. Regarding the pest management aspect, the genetic sexing Salaya5 strain (SY5) was included for comparison with wild populations. The SY5 strain was genetically assigned to the Bactrocera carambolae cluster. Likewise, the genetic network showed that the strain shared greatest genetic similarity to JK, suggesting that SY5 did not divert away from its original genetic makeup. Under laboratory conditions, at least 12 generations apart, selection did not strongly affect genetic compatibility between the strain and wild populations. This knowledge further confirms the potential utilization of the Salaya5 strain in regional programs of area-wide integrated pest management using SIT. PMID:26798262

  11. Olive Volatiles from Portuguese Cultivars Cobrançosa, Madural and Verdeal Transmontana: Role in Oviposition Preference of Bactrocera oleae (Rossi) (Diptera: Tephritidae).

    Science.gov (United States)

    Malheiro, Ricardo; Casal, Susana; Cunha, Sara C; Baptista, Paula; Pereira, José Alberto

    2015-01-01

    The olive fly, Bactrocera oleae (Rossi), a serious threat to the olive crop worldwide, displays ovipositon preference for some olive cultivars but the causes are still unclear. In the present work, three Portuguese olive cultivars with different susceptibilities to olive fly (Cobrançosa, Madural, and Verdeal Transmontana) were studied, aiming to determine if the olive volatiles are implicated in this interaction. Olive volatiles were assessed by SPME-GC-MS in the three cultivars during maturation process to observe possible correlations with olive fly infestation levels. Overall, 34 volatiles were identified in the olives, from 7 chemical classes (alcohols, aldehydes, aromatic hydrocarbons, esters, ketones, sesquiterpenes, and terpenes). Generally, total volatile amounts decrease during maturation but toluene, the main compound, increased in all cultivars, particularly in those with higher susceptibility to olive fly. Sesquiterpenes also raised, mainly α-copaene. Toluene and α-copaene, recognized oviposition promoters to olive fly, were correlated with the infestation level of cvs. Madural and Verdeal Trasnmontana (intermediate and highly susceptible cultivars respectively), while no correlations were established with cv. Cobrançosa (less susceptible). No volatiles with inverse correlation were observed. Volatile composition of olives may be a decisive factor in the olive fly choice to oviposit and this could be the basis for the development of new control strategies for this pest.

  12. Quarantine cold treatments for Ceratitis capitata and Anastrepha fraterculus (Diptera: Tephritidae) for citrus in Argentina: conclusions after 10 years of research

    Energy Technology Data Exchange (ETDEWEB)

    Willink, Eduardo; Gastaminza, Gerardo; Salvatore, Analia; Gramajo, M. Cecilia; Acenolaza, Mariana; Avila, Rosana; Favre, Paola, E-mail: ewillink@eeaoc.org.a [Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman (Argentina)

    2006-07-01

    Argentina has quarantine restrictions in some markets due to the presence of two quarantine fruit fly pests: Ceratitis capitata and Anastrepha fraterculus. One alternative is the use of cold quarantine treatments during transport of the commodities. Since 1996, the Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman, Argentina, has developed different cold quarantine treatments for citrus. In the present work we present all the data the EEAOC generated in the last ten years in order to facilitate the development of such cold treatments. Fruit flies were obtained from the colonies reared at EEAOC. Four citrus species were analyzed: lemon, grapefruit, orange and tangerines. Different varieties were analyzed for each fruit species. Sensitivity trials aiming at determine the most tolerant stage as well as to asses if there is any influence of varieties on cold tolerance were performed. Finally we compared the tolerance to cold between the two species. Sensitivity trials showed that mature larvae (L3) are the most tolerant stage for both fruit fly species. There was no effect of the varieties and the two fruit fly species were equally sensible to cold. Our results provide strong evidence in favor of concluding that any cold treatment developed for C. capitata is effective for A. fraterculus. (author)

  13. Identification of leaf volatiles from olive (Olea europaea) and their possible role in the ovipositional preferences of olive fly, Bactrocera oleae (Rossi) (Diptera: Tephritidae).

    Science.gov (United States)

    Malheiro, Ricardo; Casal, Susana; Cunha, Sara C; Baptista, Paula; Pereira, José Alberto

    2016-01-01

    The olive fly, Bactrocera oleae (Rossi), is a monophagous pest that displays an oviposition preference among cultivars of olive (Olea europaea L.). To clarify the oviposition preference, the olive leaf volatiles of three olive cultivars (Cobrançosa, Madural and Verdeal Transmontana) were assessed by headspace solid-phase microextraction gas chromatography-mass spectrometry (HS-SPME-GC/MS) at six different periods of olive fruit maturation and degrees of infestation. A total of 39 volatiles were identified, mainly esters and alcohols, with a minor percentage of aldehydes, ketones and terpenic compounds, including sesquiterpenes. At sampling dates with higher degrees of infestation, cv. Cobrançosa had, simultaneously, significantly lower infestation degrees and higher volatile amounts than the other two cultivars, with a probable deterrent effect for oviposition. The green leaf volatiles (GLVs) (Z)-3-hexen-1-ol and (Z)-3-hexen-1-ol acetate) were the main compounds identified in all cultivars, together with toluene. The abundance of GLVs decreased significantly throughout maturation, without significant differences among cultivars, while toluene showed a general increase and positive correlation with olive fly infestation levels. The results obtained could broaden our understanding of the roles of various types and amounts of olive volatiles in the environment, especially in olive fly host selection and cultivar preference. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Laboratory adaptation of Bactrocera tryoni (Diptera: Tephritidae) decreases mating age and increases protein consumption and number of eggs produced per milligram of protein.

    Science.gov (United States)

    Meats, A; Holmes, H M; Kelly, G L

    2004-12-01

    A significant reduction in age of mating occurred during the first four generations (G1-G4) of laboratory adaptation of wild Bactrocera tryoni (Froggatt) and this was associated with the earlier attainment of peak egg load although no significant differences were detected in the peak egg load itself. A long term laboratory (LTL) strain had a significantly earlier mating age and higher peak egg load than flies of wild origin or those from the first four laboratory generations. The amount of protein consumed by females in the first week of adult life was significantly higher in the LTL strain than in flies of wild origin or G1-G4 but there were no significant changes (or only slight changes) with laboratory adaptation in the amounts of protein consumed up to the ages of mating and peak egg load. Laboratory adaptation resulted in no significant changes in egg size, egg dry weight, puparial fresh weight and the dry weight of newly emerged females. The large increase in fecundity with laboratory adaptation is associated with a 4- to 5-fold increase in the rate of conversion of dietary protein to eggs (i.e. eggs produced per mg of protein consumed).

  15. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    Science.gov (United States)

    Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava, Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez, Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca, Jeniffer K.; Zapata, Tito Guevara; Ponce, Patricio

    2015-01-01

    Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and together with published sequences (Paraguay) provided context for interpretation. A total of six ITS1 sequence variants were recognized in the Andean region comprising four groups. Type I predominates in the southernmost range of Anastrepha fraterculus. Type II predominates in its northernmost range. In the central and northern Andes, the geographic distributions overlap and interdigitate with a strong elevational effect. A discussion of relationships between observed ITS1 types and morphometric types is included. PMID:26798259

  16. Transcriptomic and metabolomic profiles of Chinese citrus fly, Bactrocera minax (Diptera: Tephritidae, along with pupal development provide insight into diapause program.

    Directory of Open Access Journals (Sweden)

    Jia Wang

    Full Text Available The Chinese citrus fly, Bactrocera minax (Enderlein, is a devastating citrus pest in Asia. This univoltine insect enters obligatory pupal diapause in each generation, while little is known about the course and the molecular mechanisms of diapause. In this study, the course of diapause was determined by measuring the respiratory rate throughout the pupal stage. In addition, the variation of transcriptomic and metabolomic profiles of pupae at five developmental stages (pre-, early-, middle-, late-, and post-diapause were evaluated by next-generation sequencing technology and 1H nuclear magnetic resonance spectroscopy (NMR, respectively. A total of 4,808 genes were significantly altered in ten pairwise comparisons, representing major shifts in metabolism and signal transduction as well as endocrine system and digestive system. Gene expression profiles were validated by qRT-PCR analysis. In addition, 48 metabolites were identified and quantified by 1H NMR. Nine of which significantly contributed to the variation in the metabolomic profiles, especially proline and trehalose. Moreover, the samples collected within diapause maintenance (early-, middle-, and late-diapause only exhibited marginal transcriptomic and metabolomic variation with each other. These findings greatly improve our understanding of B. minax diapause and lay the foundation for further pertinent studies.

  17. The role of protein in the sexual behaviour of males of Ceratitis capitata (Diptera: Tephritidae: mating success, copula duration and number of copulations

    Directory of Open Access Journals (Sweden)

    Iara Sordi Joachim-Bravo

    2009-09-01

    Full Text Available In this paper, we investigated the influence of protein ingestion during the early adult phase on the sexual behavior of males of Ceratitis capitata (Wiedemann, 1824. The following parameters were evaluated: mating success (ability to be chosen by females, number of copulations, and copula duration. Experiments were carried out using a fifteen-year old laboratory lineage with the occasional introduction of wild flies. Two groups of adult males fed a high-protein diet during their larval phase were given either a high-protein diet (based on Brewer's yeast, concentration = 6.5 g/100 ml or a no-protein diet. Both groups of males were exposed to females fed either a high-protein diet or a no-protein diet and were subsequently evaluated for the parameters listed above. All experiments were conducted at 25ºC, 70% R.H. and with a photoperiod of L12:D12. The number of copulations was the only parameter affected by adult diet. Males fed a high-protein diet and exposed to females fed a no-protein diet had a greater number of copulations compared with males fed a no-protein diet.

  18. Ingestion toxicity of three Lamiaceae essential oils incorporated in protein baits against the olive fruit fly, Bactrocera oleae (Rossi) (Diptera Tephritidae).

    Science.gov (United States)

    Canale, Angelo; Benelli, Giovanni; Conti, Barbara; Lenzi, Gabriele; Flamini, Guido; Francini, Alessandra; Cioni, Pier Luigi

    2013-01-01

    The ingestion toxicity of three Lamiaceae essential oils (EOs) - Hyptis suaveolens, Rosmarinus officinalis and Lavandula angustifolia - incorporated in protein baits was evaluated against Bactrocera oleae, a worldwide pest of olive fruits. In laboratory conditions, all the tested EOs showed dose-dependent toxicity on B. oleae, with mortality rates ranging from 12% (EO concentration: 0.01% w:v) to 100% (EO concentration: 1.75% w:v). Semi-field results highlighted the toxicity of L. angustifolia and H. suaveolens EOs, which exerted more than 60% of flies mortality at a concentration of 1.75% (w:v). Gas Chromatography-Electron Impact Mass Spectrometry analyses of the three EOs showed that H. suaveolens EO was dominated by monoterpene and sesquiterpene hydrocarbons. Oxygenated monoterpenes were the main chemical class in R. officinalis and L. angustifolia EOs. Further research is needed to evaluate the efficacy of these EOs plus food bait against the olive fruit fly in the open field.

  19. Diversity and seasonality of fruit flies (Diptera: Tephritidae and Lonchaeidae) and their parasitoids (Hymenoptera: Braconidae and Figitidae) in orchards of guava, loquat and peach

    Energy Technology Data Exchange (ETDEWEB)

    Souza-Filho, M.F.; Raga, A. [Instituto Biologico, Campinas, SP (Brazil)], e-mail: miguelf@biologico.sp.gov.br; Azevedo-Filho, J.A. [Agencia Paulista de Tecnologia dos Agronegocios (APTA), Monte Alegre do Sul, SP (Brazil). Polo Regional do Leste Paulista; Strikis, P.C. [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Inst. de Biologia. Dept. de Parasitologia; Guimaraes, J.A. [EMBRAPA Agroindustria Tropical, Fortaleza, CE (Brazil); Zucchi, R.A. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Entomologia, Fitopatologia e Zoologia Agricola

    2009-02-15

    This work was carried out in orchards of guava progenies, and loquat and peach cultivars, in Monte Alegre do Sul, SP, Brazil, in 2002 and 2003. Guavas and loquats were bagged and unbagged bi-weekly and weekly, respectively, for assessment of the infestation period. Peach was only bagged weekly. The assays started when the fruits were at the beginning of development, but still green. Ripe fruits were taken to the laboratory and placed individually into plastic cups. McPhail plastic traps containing torula yeast were hung from January 2002 to January 2004 to assess the fruit fly population in each orchard, but only the Ceratitis capitata population is here discussed. Five tephritid species were reared from the fruits: Anastrepha bistrigata Bezzi, A. fraterculus (Wiedemann), A. obliqua (Macquart), A. sororcula Zucchi, and C. capitata, in addition to six lonchaeid species: Neosilba certa (Walker), N. glaberrima (Wiedemann), N. pendula (Bezzi), N. zadolicha McAlpine and Steyskal, Neosilba sp. 4, and Neosilba sp. 10 (both species are in the process of being described by P. C. Strikis), as well as some unidentified Neosilba species. Ten parasitoid species were obtained from fruit fly puparia, of which five were braconids: Asobara anastrephae (Muesebeck), Doryctobracon areolatus (Szepligeti), D. brasiliensis (Szepligeti), Opius bellus Gahan, and Utetes anastrephae (Viereck), and five figitids: Aganaspis pelleranoi (Brethes), Dicerataspis grenadensis Ashmead, Lopheucoila anastrephae (Rhower), Leptopilina boulardi (Barbotin, Carlton and Kelner-Pillaut), and Trybliographa infuscata Diaz, Gallardo and Uchoa. Ceratitis capitata showed a seasonal behavior with population density peaking at the second semester of each year. Anastrepha and Neosilba species remained in the orchards throughout both years. (author)

  20. History of tachinid classification (Diptera, Tachinidae

    Directory of Open Access Journals (Sweden)

    James O Hara

    2013-07-01

    Full Text Available The history of the classification of the Tachinidae (Diptera is traced from Meigen to the present. The contributions of Robineau-Desvoidy, Townsend, Villeneuve, Mesnil, Herting, Wood and many others are discussed within a chronological, taxonomic, and geographic context. The gradual development of the Tachinidae into its modern concept as a family of the Oestroidea and the emergence of the classificatory scheme of tribes and subfamilies in use today are reviewed. Certain taxa that have in the past been difficult to place, or continue to be of uncertain affinity, are considered and some are given in a table to show their varied historical treatments. The more significant systematic works published on the Tachinidae in recent decades are enumerated chronologically.

  1. Diptera, Drosophilidae: historical occurrence in Brazil

    Directory of Open Access Journals (Sweden)

    Valente, V. L. S.

    2008-01-01

    Full Text Available This study presents a literature review of Drosophilidae (Diptera species occurrence in Brazil. The number of speciesrecorded is 304, with Drosophila being the genus with the greatest number of species, followed by Zygothrica,Hirtodrosophila and Diathoneura, which belong to the Drosophilinae subfamily. Drosophila was shown to be the mostinvestigated taxon in the family, with the best resolved species distribution. The low number of records of species fromother genera indicates the paucity of studies specifically designed to investigate these species. Records of species forsome regions of the country like the north and northeast, as well as for some biomes like Caatinga, Pantanal and thePampas, are likewise rare. Apart from the banana bait, different collection methods may be necessary, like thecollection at other oviposition resources, the use of baits other than fermenting fruit, and the adoption of samplingapproaches that do not use baits.

  2. Rehydration of forensically important larval Diptera specimens.

    Science.gov (United States)

    Sanford, Michelle R; Pechal, Jennifer L; Tomberlin, Jeffery K

    2011-01-01

    Established procedures for collecting and preserving evidence are essential for all forensic disciplines to be accepted in court and by the forensic community at large. Entomological evidence, such as Diptera larvae, are primarily preserved in ethanol, which can evaporate over time, resulting in the dehydration of specimens. In this study, methods used for rehydrating specimens were compared. The changes in larval specimens with respect to larval length and weight for three forensically important blow fly (Diptera: Calliphoridae) species in North America were quantified. Phormia regina (Meigen), Cochliomyia macellaria (F.), and Chrysomya rufifacies (Macquart) third-instar larvae were collected from various decomposing animals and preserved with three preservation methods (80% ethanol, 70% isopropyl alcohol, and hot-water kill then 80% ethanol). Preservative solutions were allowed to evaporate. Rehydration was attempted with either of the following: 80% ethanol, commercial trisodium phosphate substitute solution, or 0.5% trisodium phosphate solution. All three methods partially restored weight and length of specimens recorded before preservation. Analysis of variance results indicated that effects of preservation, rehydration treatment, and collection animal were different in each species. The interaction between preservative method and rehydration treatment had a significant effect on both P. regina and C. macellaria larval length and weight. In addition, there was a significant interaction effect of collection animal on larval C. macellaria measurements. No significant effect was observed in C. rufifacies larval length or weight among the preservatives or treatments. These methods could be used to establish a standard operating procedure for dealing with dehydrated larval specimens in forensic investigations.

  3. The drosophilid fauna (Diptera, Drosophilidae of the transition between the Pampa and Atlantic Forest Biomes in the state of Rio Grande do Sul, southern Brazil: first records

    Directory of Open Access Journals (Sweden)

    Cleverton J.C. Hochmüller

    2010-01-01

    Full Text Available Although studies on drosophilid (Diptera, Drosophilidae assemblages have become relatively abundant in the past decades, many environments remain to be searched. The present study investigates the composition, the species abundances and the richness of the drosophilid assemblages in two localities of the municipality of Cruz Alta, northwestern region of the state of Rio Grande do Sul, a point of contact between the biomes Atlantic Forest and Pampa: (i an urban area (2007, constituted by a domestic orchard with Citrus trees, and (ii a forested area, in Centro de Educação, Pesquisa e Proteção Ambiental - CEPPA (2008/2009, of Universidade de Cruz Alta, located in a fragment of riparian forest. Collections were conducted using fermented banana-baited traps and repeated periodically. A total of 7,428 individuals were caught, belonging to two subfamilies, six genera and 53 species. In the urban area, 22 species were found, from two genera (N = 2,421, while in the forested area 46 species were found, from six genera (N = 5,007. Six exotic species were found, markedly more abundant in the urban area, where they corresponded to 95% of the specimens, in comparison to 50% in the forest. Between the Neotropical species, the most common were Drosophila maculifrons Duda and D. polymorpha Dobzhansky & Pavan. Only D. simulans Sturtevant was captured in all samples in both localities. The present survey represents the first records for the state of Rio Grande do Sul of the D. canalinea and D. virilis species groups and the species D. arassari Cunha & Frota-Pessoa, D. fuscolineata Duda, D. nigricruria Patterson & Mainland, D. papei Bächli & Vilela, D. senei Vilela, D. trifilum Frota-Pessoa, D. virilis Sturtevant, Leucophenga maculosa (Coquillett and Rhinoleucophenga obesa (Loew. Furthermore, it also represents the first record for the state of the genera Amiota Loew, Leucophenga Mik and Rhinoleucophenga Hendel and of the subfamily Steganinae. So, the present

  4. Notes and illustrations on Amicitia Emden species (Diptera, Muscidae, Coenosiinae

    Directory of Open Access Journals (Sweden)

    Couri Márcia S.

    2003-01-01

    Full Text Available Amicitia Emden, 1940 is an Afrotropical genus of Coenosiinae (Diptera, Muscidae, with four known species described by Emden (1940: A. insignis, A. lucens, A. modesta and A. seclusa. All examined holotypes are deposited at "The Natural History Museum" (London, UK. Notes on the species and illustrations, especially of the terminalia are presented.

  5. Invloed van inundatie van graslanden op terrestrische dansmuggen (Diptera: Chironomidae)

    NARCIS (Netherlands)

    Moller Pilot, H.

    2005-01-01

    Influence of flooding on terrestrial chironomids in grassland (Diptera: Chironomidae) Although flooding is an important factor for the invertebrate fauna of grassland, not much is published on this topic. As in other groups the different species of terrestrial Chironomidae display different

  6. Mouthpart deformities in Chironomidae (Diptera) as indicators of ...

    African Journals Online (AJOL)

    Due to the absence of appropriate and sensitive tools for monitoring heavy metal pollution in northern Lake Victoria (Uganda), this study investigated mouthpart deformities in chironomid larvae (Diptera) in relation to concentrations of lead, copper, cadmium and zinc in lake sediments, and to dissolved oxygen, pH and ...

  7. Nieuwe en zeldzame zweefvliegen voor de Nederlandse fauna (Diptera: Syrphidae)

    NARCIS (Netherlands)

    Aartsen, van B.

    1993-01-01

    New and rare hoverflies for the Dutch fauna (Diptera: Syrphidae). Paragus albifrons (Fallén), P. bicolor (Fabricius), Sphegina verecunda Collin, Neoascia annexa (O.F. Müller), Callicera aenea (Fabricius), Cheilosia caerulescens (Meigen), C. chloris (Meigen), C. flavipes (Panzer), Chamaesyrphus

  8. Checklist of the family Simuliidae (Diptera of Finland

    Directory of Open Access Journals (Sweden)

    Jari Ilmonen

    2014-09-01

    Full Text Available A checklist of the family Simuliidae (Diptera is provided for Finland and recognizes 56 species. One new record has been added (Simulium latipes and one name sunken in synonymy (Simulium carpathicum. Furthermore, Simulium tsheburovae is treated as a doubtful record.

  9. Molecular identification of tsetse fly (Diptera: Glossinidae) species ...

    African Journals Online (AJOL)

    Christopher

    2015-05-13

    May 13, 2015 ... Tsetse fly (Diptera: Glossinidae) anti-vector measures are reliant upon accurate identification of species and their subpopulations. Two species were studied, Glossina palpalis palpalis and Glossina morsitans submorsitans using two mitochondrial DNA: cytochrome oxidase subunit II (COII) and cytochrome ...

  10. A new species of Culcua Walker (Diptera: Stratiomyidae) from Vietnam

    Science.gov (United States)

    A new species of Culcua Walker (Diptera: Stratiomyidae), C. lingafelteri Woodley, new species, is described from northern Vietnam. It is diagnosed relative to other species using the recent revision of the genus by Rozkošný and Kozánek (2007). This is the first species of Culcua reported from Viet...

  11. Ethology of Omniablautus nigronotum (Wilcox) (Diptera: Asilidae) in Wyoming

    Science.gov (United States)

    In southwest Wyoming, Omniablautus nigronotum (Wilcox), hunted primarily from the surface of the sandy substrate in a greasewood community. Prey, captured in flight, represented four insect orders with Diptera and Hymenoptera predominating. Courtship consisted of the male approaching the female from...

  12. Defence behaviour of reindeer in response to flying parasitic Diptera

    Directory of Open Access Journals (Sweden)

    Andrew J. Karter

    1989-06-01

    Full Text Available Similar defence behaviours were exhibited by a reindeer when experimentally exposed to three different species of tethered, flying parasitic Diptera, Cephenemyia trompe (Modeer, Hypoderma tarandi (L and Tabanid. Defencive behavioural responses appeared to be related to attack angle, and were not elicited by auditory stimuli. These observations raise questions about the validity of parasite species-specific defence responses in reindeer.Forsvars-adferd hos rein angrepet av flyvende, parasittiske diptera.Abstract in Norwegian / Sammendrag: Likeartet forsvars-adferd ble utvist av en rein som ble eksperimentelt utsatt for tre forskjellige arter av bundne, flyvende parasittiske diptera, Cephenemyia trompe (Modeer, Hypoderma tarandi (L og Tabanid. Den forsvarsmessige adferd syntes å ha sammenheng med parasittenes angreps-vinkel og ble ikke utløst av lydstimuli. Disse observasjoner reiser spørsmål om gyldigheten av parasittære artsspesifikke forsvarsreaksjoner hos rein.Poron puolustuskàyttàytyminen lentàvià kaksisiipisià (Diptera hyônteisià vastaan.Abstract in Finnish / Yhteenveto: Poro kàyttàytyi samalla tavalla kun se joutui tekemisiin kolmen kiinniolevan lentàvân kaksisiipisen hyônteisen: saulakan {Cephenemyia trompe Modeer, kurumupaarman {Hypoderma tarandi L ja parman kanssa. Puolustuskàyttàytyminen riippui hyônteisen làhestymiskulvàt kysymyksià lajispesifisen puolustuskàyttàytymisen esiintymisestà proolla hyônteisià vastaan.

  13. Estimation of larval density of Liriomyza sativae Blanchard (Diptera ...

    African Journals Online (AJOL)

    This study was conducted to develop sequential sampling plans to estimate larval density of Liriomyza sativae Blanchard (Diptera: Agromyzidae) at three precision levels in cucumber greenhouse. The within- greenhouse spatial patterns of larvae were aggregated. The slopes and intercepts of both Iwao's patchiness ...

  14. Initial survey of predacious diptera on hemlocks in Japan

    Science.gov (United States)

    Hisashi Ohishi; Shigehiko Shiyake; Yorio Miyatake; Ashley Lamb; Michael E. Montgomery

    2011-01-01

    Some species of Coleoptera and Diptera are specialist predators of adelgids. Previously, we reported our survey of predacious Coleoptera on hemlocks in Japan (Shiyake et al. 2008). Two of these beetles, Sasajiscymnus tsugae and Laricobius sp. nov., have been exported to the U.S. for biological control. Here, we provide the first...

  15. Crowdsourcing for large-scale mosquito (Diptera: Culicidae) sampling

    Science.gov (United States)

    Sampling a cosmopolitan mosquito (Diptera: Culicidae) species throughout its range is logistically challenging and extremely resource intensive. Mosquito control programmes and regional networks operate at the local level and often conduct sampling activities across much of North America. A method f...

  16. Surface ultrastructure of third-instar Megaselia scalaris (Diptera: Phoridae

    Directory of Open Access Journals (Sweden)

    Kabkaew L Sukontason

    2002-07-01

    Full Text Available We describe some ultrastructure of the third-instar Megaselia scalaris (Diptera: Phoridae using scanning electron microscopy, with the cephalic segment, anterior spiracle and posterior spiracle being emphasized. This study provides the taxonomic information of this larval species, which may be useful to differentiate from other closely-related species.

  17. Surface ultrastructure of third-instar Megaselia scalaris (Diptera: Phoridae).

    Science.gov (United States)

    Sukontason, Kabkaew L; Sukontason, Kom; Lertthamnongtham, Sirisuda; Boonchu, Noppawan

    2002-07-01

    We describe some ultrastructure of the third-instar Megaselia scalaris (Diptera: Phoridae) using scanning electron microscopy, with the cephalic segment, anterior spiracle and posterior spiracle being emphasized. This study provides the taxonomic information of this larval species, which may be useful to differentiate from other closely-related species.

  18. Zoogeography and biodiversity of syrphidae (Diptera) in East Africa ...

    African Journals Online (AJOL)

    Zoogeography and biodiversity of syrphidae (Diptera) in East Africa. Marc De Meyer, Edward Vanden Berghe, Andy E Whittington. Abstract. This paper reports on the occurrence of Syrphidae in East Africa (Kenya, Tanzania, Uganda), based on 5,600 specimen records incorporated in the biodiversity database of the ...

  19. Existence of species complex largely reduced barcoding success for invasive species of Tephritidae: a case study in Bactrocera spp.

    Science.gov (United States)

    Jiang, F; Jin, Q; Liang, L; Zhang, A B; Li, Z H

    2014-11-01

    Fruit flies in the family Tephritidae are the economically important pests that have many species complexes. DNA barcoding has gradually been verified as an effective tool for identifying species in a wide range of taxonomic groups, and there are several publications on rapid and accurate identification of fruit flies based on this technique; however, comprehensive analyses of large and new taxa for the effectiveness of DNA barcoding for fruit flies identification have been rare. In this study, we evaluated the COI barcode sequences for the diagnosis of fruit flies using 1426 sequences for 73 species of Bactrocera distributed worldwide. Tree-based [neighbour-joining (NJ)]; distance-based, such as Best Match (BM), Best Close Match (BCM) and Minimum Distance (MD); and character-based methods were used to evaluate the barcoding success rates obtained with maintaining the species complex in the data set, treating a species complex as a single taxon unit, and removing the species complex. Our results indicate that the average divergence between species was 14.04% (0.00-25.16%), whereas within a species this was 0.81% (0.00-9.71%); the existence of species complexes largely reduced the barcoding success for Tephritidae, for example relatively low success rates (74.4% based on BM and BCM and 84.8% based on MD) were obtained when the sequences from species complexes were included in the analysis, whereas significantly higher success rates were achieved if the species complexes were treated as a single taxon or removed from the data set - BM (98.9%), BCM (98.5%) and MD (97.5%), or BM (98.1%), BCM (97.4%) and MD (98.2%). © 2014 John Wiley & Sons Ltd.

  20. Nomenclatural studies toward a world list of Diptera genus-group names. Part V

    DEFF Research Database (Denmark)

    Evenhuis, Neal L.; Pape, Thomas; Pont, Adrian C.

    The Diptera genus-group names of Pierre-Justin-Marie Macquart are reviewed and annotated. A total of 399 available genus-group names in 69 families of Diptera are listed alphabetically, for each name giving author, year and page of original publication, originally included species, type species...

  1. Diptera Community In The Littoral Zone Of A North East Arid Zone ...

    African Journals Online (AJOL)

    Maiduguri, Nigeria, were studied between January and June 2002. Dipteran samples were collected every 2 weeks from five different stations. Five groups of diptera organisms simulidae, chironomidae, centrapogo nidae, culicidae and chaoboridae were found in analyzable numbers. The diptera assemblage was ...

  2. The forgotten flies: the importance of non-syrphid Diptera as pollinators

    Science.gov (United States)

    Orford, Katherine A.; Vaughan, Ian P.; Memmott, Jane

    2015-01-01

    Bees, hoverflies and butterflies are taxa frequently studied as pollinators in agricultural and conservation contexts. Although there are many records of non-syrphid Diptera visiting flowers, they are generally not regarded as important pollinators. We use data from 30 pollen-transport networks and 71 pollinator-visitation networks to compare the importance of various flower-visiting taxa as pollen-vectors. We specifically compare non-syrphid Diptera and Syrphidae to determine whether neglect of the former in the literature is justified. We found no significant difference in pollen-loads between the syrphid and non-syrphid Diptera. Moreover, there was no significant difference in the level of specialization between the two groups in the pollen-transport networks, though the Syrphidae had significantly greater visitation evenness. Flower visitation data from 33 farms showed that non-syrphid Diptera made up the majority of the flower-visiting Diptera in the agricultural studies (on average 82% abundance and 73% species richness), and we estimate that non-syrphid Diptera carry 84% of total pollen carried by farmland Diptera. As important pollinators, such as bees, have suffered serious declines, it would be prudent to improve our understanding of the role of non-syrphid Diptera as pollinators. PMID:25808886

  3. Selección de Cepas de Hongos Entomopatógenos para el Manejo de Anastrepha obliqua (Macquart, 1835 (Diptera: Tephritidae en Colombia Selection of Strains of Entomopathogenic Fungi for Management of Anastrepha obliqua (Macquart, 1835 (Diptera: Tephritidae in Colombia

    Directory of Open Access Journals (Sweden)

    Armando Osorio-Fajardo

    2011-12-01

    Full Text Available Se evaluaron 15 cepas de los hongos entomopatógenos Beauveria bassiana y Metarhizium anisopliae sobre adultos de un día de edad de la mosca de la fruta Anastrepha obliqua. El trabajo se realizó con el fin de seleccionar las cepas más virulentas al insecto y estudiar el efecto sobre los adultos jóvenes cuando el hongo era aplicado antes de la emergencia. Mediante un screening con una concentración de 1x10(7 conidias/mL se seleccionaron las tres cepas más virulentas, siendo dos de ellas de Beauveria y una de Metarhizium, las cuales causaron mortalidades del 77%, 71% y 66%. Valores de CL50 de 2,38x10(6, 1,81x10(6 y 9,94x10(6 conidias/mL, respectivamente, fueron determinados para cada una de estas cepas y un TL50 respectivo de 48,12; 56 y 42,75 horas. No se encontraron diferencias significativas en la mortalidad entre hembras y machos. La aspersión de la CL90 de las cepas seleccionadas sobre el medio de pupación de la mosca de la fruta produjo 34-48% de mortalidad durante las 120 horas de evaluación. Los hongos entomopatógenos pueden ser utilizados fácilmente para el control biológico de A. obliqua aplicándolos de manera dirigida a los adultos jóvenes bajo la copa de los árboles, en programas de manejo integrado de plagas.Fifteen strains from entomopathogenic Beauveria bassiana and Metarhizium anisopliae fungi were evaluated on one day-old adults of Anastrepha obliqua fruit fly. Tested were carried out for selecting the most virulent strains and the effectiveness of their use on young adult when the entomopathogen were applied before emergence were studied too. A screening with a 1x10(7 conidia/mL concentration was used for selecting the three most pathogenic isolates, two from Beauveria and one from Metarhizium, having 77, 71 and 66% mortality. The LC50 for these isolates were 2.38x10(6, 1.81x10(6 and 9.94x10(6 conidia/mL, respectively, and a respective LT50 were 48.12, 56 and 42.75 hours. No significant differences were found between females and males mortality. LC90 spraying of selected strains on fly pupation medium led to 34-48% mortality at 120 hours. Entomopathogenic fungi could be used for A. obliqua biological control and also it can be used easily spraying towards young adults under tree canopies in the integrated pest management programs.

  4. Effects of gamma radiation on the sterility and behavioral quality of the caribbean fruit fly, Anastrepha suspensa (Loew (Diptera:Tephritidae Efeitos da radiação gama na esterilização e comportamento da mosca-do-caribe, Anastrepha suspensa (Low (Diptera:Tephritidae

    Directory of Open Access Journals (Sweden)

    J.M.M. Walder

    1993-09-01

    Full Text Available Pupae of Anastrepha suspensa (Loew were irradiated 2 days before adult eclosión in an air atmosphere with 15, 20, 25, 30, 50 and 70 Gy of gamma radiation (Co-60. The radiation effects on sterility and other parameters of quality and behavior of males and females of caribfly were established. Males became fully sterile with a dose of 50 Gy and females laid no eggs when exposed to 25 Gy. Radiation had no significant effect on adult eclosion, sex ratio, flight ability and irritability, but female mortality was affected significantly by radiation, showing higher survival rates in low dosage treatments. The mating behavior of the males was reduced significantly by increasing the radiation doses.Pupas de Anastrepha suspensa (Loew foram irradiadas dois dias antes da emergência dos adultos em atmosfera de ar com as doses de 15, 20, 25, 30, 50 e 70 Gy de radiação gama (Co-60. Foram avaliados os efeitos da radiação sobre a esterilidade e outros parâmetros de qualidade e comportamento de machos e fêmeas de mosca-do-caribe. Machos tornaram-se totalmente estéreis com uma dose de 50 Gy e as fêmeas não ovipositaram quando expostas a 25 Gy. A radiação não teve efeito significativo sobre a taxa de emergência de adultos, na razão sexual, na habilidade de vôo e na irritabilidade desses insetos. Somente a mortalidade das fêmeas foi afetada significativamente pela radiação, causando unia maior sobrevivência nas dosagens mais baixas. A atividade de acasalamento dos machos foi reduzida significativamente com o incremento da dosagem de radiação.

  5. Biological and morphological aspects of Diachasmimorpha longicaudata (Ashmead, 1905) (Hymenoptera: Braconidae) on irradiated larva of Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae);Aspectos biologicos e morfologicos de Diachasmimorpha longicaudata (Ashmead, 1905) (Hymenoptera: Braconidae) criado em larvas irradiadas de Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Valle, Giuliana Etore do

    2006-07-01

    The objective of this work was evaluate some biological and morphological aspects of Diachasmimorpha longicaudata on irradiated and not irradiated larva of bisexual and tsl strains of Ceratitis capitata. The experiments were developed at the Laboratorio de Irradiacao de Alimentos e Radioentomologia (LIARE) of CENA/USP. For gamma radiation treatment it was used a Cobalt-60 source, model Gamma beam-650. Larva of bisexual strain were irradiated with 65 Gy and the tsl strain with 45 Gy. Experiments were carried out at room temperature of 25 +- 2 deg C, 75 +- 5 % RH and 14 hours of photo phase. After irradiation, the bisexual strain larva were exposed to adults of D. longicaudata for parasitization and parameters of percentage adult emergency and rate of male and female of D. longicaudata were observed. For tsl strain, were used larva from the first and the fourth collection only, and the following parameters were observed: percentage of adult emergency, rate of male and female, and the average unitary volume and weight of pupae at the 8{sup th} and 16 days after the parasitism date. Other parameters evaluated for tsl strain related to the parasitoid morphology such as, the length of the body, antenna, tibia and ovipositor. As result, both of the first and second experiments, the rate of parasitism was satisfactory, as well as showed larger incidence of females than males in parasitized larva, discarding the possibility that gamma radiation interfere in the sexual rate. No significant differences were observed on pupae volume. Some differences on pupae weight were observed at 8th and 16th day after the parasitism date, which should be associated to pre-emerging flies (8th day) and empty pupa (16th day). None significant difference was observed on morphological parameters, so one can conclude that gamma radiation treatment did not interfere in these quality parameters of the parasitoid. (author)

  6. Determination of the dose of gamma radiation sterilization for assessment of biological parameters of male Ceratitis capitada (Diptera: Tephritidae), tsl - Vienna 8 strain; Determinacao da dose de radiacao gama esterilizante pela avaliacao dos parametros biologicos de machos de Ceratitis capitata (Diptera: Tephritidae), linhagem tsl - Vienna 8

    Energy Technology Data Exchange (ETDEWEB)

    Rocha, Aline Cristina Pereira da

    2011-07-01

    The Vienna-8, tsl (temperature sensitive lethal) strain of Ceratitis capitata, by presenting mutations that facilitate the mass rearing and release only of sterile males in the field, has been used in (Sterile Insect Technique) programmes. The objective of this study was to determine the radiation dose that provides the highest level of sterility for Vienna-8, tsl males assessing their biological parameters that indicate the quality of sterile males to be released. Brown pupae (males) of the tsl strain were obtained from the mass rearing of the Food Irradiation and Radio entomology laboratory of CENA/USP, and they were irradiated (with gamma radiation - {sup 60}Co) 24 hours before the emergence at rates of 0, 30, 60, 90 and 120 Gy. The determination of the sterilizing dose was based on fertility of sexually mature females of the bisexual strain and not irradiated, mated with males of different treatments. Eggs were collected daily during 6 days, were counted and it was possible to estimate fecundity, and assess the hatching rate. The emergence and flight ability were determined by following the protocol of quality control manual for FAO/IAEA/USDA (2003). To assess the longevity under nutritional stress, the insects were kept a period of 48 h after emergence in the absence of water and food, and after this period, mortality was recorded. The size of the testes (left and right) was obtained by dissecting irradiated and non-irradiated males at the eighth day of life, and measure the testes in an ocular micrometer, considering the maximum length and width of each sample. To determine the sperm number was necessary to dissect the males and break their testicles. No difference was observed in emergence rate, flight ability and longevity of irradiated and non-irradiated males, nor in the fecundity of females mated with males of different treatments. The sterilizing dose that resulted in lower fertility of females was 120 Gy, with 1.5% hatching. Considering the parameters of emergence, flight ability, longevity under stress and sterility recommended for the sterile insect technique which consists of approximately 99%, the sterilizing dose to be used is 120 Gy. The size of the testes and the sperm number were affected by radiation. Males irradiated with 120 Gy presented a reduction about 25% in size of the testes, compared with the control (0 Gy). The testes of normal males contained an average of 41.910 sperm, and this value was decreased by increasing the dose of radiation, so that males irradiated with 120 Gy had a median of 27.921 sperm, and this allowed to recommend the use of GM male to control C. capitata. (author)

  7. Demographic analysis of mass-reared Anastrepha fraterculus (Diptera: Tephritidae in Tucumán, Argentina Análisis demográfico de la cría masiva de Anastrepha fraterculus (Diptera: Tephritidae en Tucumán, Argentina

    Directory of Open Access Journals (Sweden)

    Héctor E. Jaldo

    2007-06-01

    Full Text Available The life cycle of a lab-adapted mass reared strain of Anastrepha fraterculus at 24°C constant temperature was 41 days, including the preoviposition period. Mortality rates of 8%, 22%, 22%, 5%, and 43% were recorded for eggs, larvae, pupae, adults (preoviposition stage and adults (reproductive stage, respectively. The intrinsic rate of increase was 0.065, the net fecundity rate was 120.4, and the gross fecundity rate was 328.4. In a stable population, 22% would be eggs, 53% larvae, 18% pupae, 4% preoviposition adults, and 3% reproductive adults.El ciclo de vida de Anastrepha fraterculus en cría masiva a temperatura constante de 24°C fue de 41 días, incluyendo el período de preoviposición. Las mortalidades para huevo, larva, pupa, adultos en preoviposición y adultos reproductivos fueron de 8%, 22%, 22%, 5% y 43%, respectivamente. La tasa intrínseca de incremento natural fue de 0,065, la tasa de fertilidad neta fue de 120,4, y la tasa de fertilidad bruta fue de 328,4. En una población estable 22% debería ser huevos, 53% larvas, 18% pupas, 4% adultos en preoviposición y 3% adultos en etapa reproductiva.

  8. Análise faunêstica de moscas-das-frutas (diptera, tephritidae em pomares de pessegueiro em Porto Alegre, Rio Grande do Sul Faunal study of fruit flies (Diptera, Tephritidae in peach or-chards in Porto Alegre, Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    1998-12-01

    Full Text Available In order to characterizc the peach trees ecosystem in Porto Alegre related to tephrilidea species, a faunal study was developed over the data of the collects of these insects with traps in tvvelve months. For the characterization of the communities, constancy, abundance and frequency index were determined. Relation between sex were obtained by correlation matrix, sexual proportion and sexual rates. Anastrepha fratercalus (Wiedemann, 1830 was abundant, constant and frequent, Ceratitis capitata (Wiedemann, 1824 was accessory and Anastrepha grandis (Macquart, 1845 accidental. A greatcr number of females than males was observed.

  9. Flutuação populacional de Anastrepha fraterculus (Wiedemann e Ceratitis capitata (Wiedemann (Diptera, Tephritidae em pomares de pessegueiro em Porto Alegre, Rio Grande do Sul Population fluctuation of Anastrepha fraterculus (Wiedemann and Ceratitis capitata (Wiedemann (Diptera, Tephritidae in peach orchards in Porto Alegre, Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    1998-01-01

    Full Text Available This paper presents the study of population fluctuation of Anastrepha fraterculus (Wiedemann, 1824 and Ceratitis capitata (Wiedemann, 1830 in peach orchards in Porto Alegre city. The peak for A. fraterculus was in November and December and for C. capitata in December and January. There was no significant difference among the population levels in the cultivars Fla 13-72, Premier and Marli.

  10. First register of fruit flies (Diptera: Tephritidae in star fruit in Teresina, Altos and Parnaiba, state of Piaui, Brazil/ Primeiro registro de moscas-das-frutas (Diptera: Tephritidae em carambola nos municípios de Teresina, Altos e Parnaíba no estado do Piauí

    Directory of Open Access Journals (Sweden)

    Almerinda Amélia Rodrigues Araújo Soares

    2007-08-01

    Full Text Available The present work aims to register the occurrence of the fruit flies associated to star fruit (Averrhoa carambola L. in three counties of the state of Piaui, as well as to determine the frequency and the index of infestation of these insects. The fruits had been collected during the months of August and September 2005, and had been placed in plastic trays with sterilized soil, stored in metal cages, and left in environmental temperature at the laboratory. Until emergency, the adults had been kept in bottles with alcohol 70% and later identified in the species level. The biggest index of infestation (flies/fruit of C. capitata has occurred in the county of Altos (3.66, followed by Teresina and Parnaiba that had presented index of infestation of 2.18 and 0.016, respectively. C. capitata was the most frequent species in all the counties, presenting frequencies of 100%, 96.5%, and 100% in Teresina, Altos and Parnaiba, respectively. Ceratitis capitata is registered for the first time in star fruit in Teresina, Altos and Parnaiba, state of the Piaui. Anastrepha fraterculus is registered for the first time in the county of Altos. A. fraterculus and C. capitata occur simultaneously in star fruits.O presente trabalho visou conhecer as espécies de moscas-das-frutas associadas à carambola (Averrhoa carambola L. em três municípios do Estado do Piauí, bem como determinar a freqüência e o índice de infestação desses insetos. Os frutos foram coletados durante os meses de agosto e setembro de 2005, colocados em bandejas plásticas com solo esterilizado, armazenados em gaiolas metálicas e deixados em temperatura ambiente no laboratório. Até a emergência dos adultos, estes foram acondicionados em frascos contendo álcool 70% e posteriormente identificados em nível de espécie. O maior índice de infestação (moscas/fruto de C. capitata ocorreu no município de Altos (3,66, seguido pelos municípios de Teresina e Parnaíba que apresentaram índice de infestação de 2,18 e 0,016, respectivamente. C. capitata foi a espécie mais freqüente em todos os municípios, apresentando freqüências de 100%, 96,5%, 100% em Teresina, Altos e Parnaíba, respectivamente. Ceratitis capitata é registrada pela primeira vez em frutos de carambola nos municípios piauienses de Teresina, Altos e Parnaíba. Anastrepha fraterculus é registrada pela primeira vez no município de Altos. A. fraterculus e C. capitata ocorrem simultaneamente em frutos de carambola.

  11. Tratamento hidrotérmico na mortalidade de larvas de Ceratitis capitata (Weidmann, 1824 (Diptera: Tephritidae em tangerina (Citrus reticulata Blanco = Effect of hydrothermal treatment on the mortality of fruit fly (Ceratitis capitata Weidmann, 1824 (Diptera: Tephritidae larvae in tangerine fruit (Citrus reticulata Blanco

    Directory of Open Access Journals (Sweden)

    Edson Batista Lopes

    2008-12-01

    Full Text Available O objetivo dessa pesquisa foi avaliar a eficiência do tratamento hidrotérmico no controle de larvas de C. capitata em frutos de tangerina para fins quarentenários. Tangerinas da variedade ‘Dancy’ infestadas por larvas de Ceratitis capitata foram submetidas aostratamentos hidrotérmicos de 46±1°C e 50±1°C, em diferentes tempos de exposição. Para a temperatura de 46±1°C foram utilizados nove períodos de exposição: 0, 5, 10, 15, 20, 25, 30, 35 e 40 min. Na temperatura de 50±1°C, utilizaram-se sete tempos de exposição: 0, 5,10, 15, 20, 25 e 30 min., sendo o tempo (0 infestado e sem tratamento para as duas temperaturas. Cada tratamento foi composto de cinco repetições com dois frutos. Frutos maduros e semi-maduros infestados foram imersos em água quente, visando quantificar ototal de larvas vivas e mortas, sendo que, um grupo de frutos foi mantido sem imersão como controle. Os índices quarentenários, na temperatura de 46±1°C foram atingidos aos 32,0 e 35,3 min. para frutos maduros e semi-maduros, respectivamente. Na temperatura de50±1°C, os índices quarentenários foram atingidos aos 20,8 e 21,7 minutos para os frutos maduros e semi-maduros, respectivamente. A mortalidade das larvas de C. capitata foi crescente com o aumento da temperatura e o tempo de exposição.This research aimed to evaluate the efficiency of hydrothermaltreatment in the control of C. capitata larvae in tangerine fruit for quarantine safety. Tangerines fruits infested by larvae of Mediterranean fruit fly Ceratitis capitata were submitted to hydrothermal treatment at 46±1°C and 50±1°C for different exposure times. The fruits were selected in two maturity stages (ripe and semi-ripe and immersed in hot water. For temperature at 46±1°C, nine exposure times were used: 0, 5, 10, 15, 20, 25, 30, 35 and 40 minutes. The same procedure was used for temperature at 50±1°C, where the exposure times were: 0, 5, 10, 15, 20, 25 and 30 minutes. Infested fruits immersed in hot water were evaluated aiming to quantify the total of live and dead larvae, with one groupwas kept as control and not immersed. Quarantine safety using treatment with hot water at 46±1°C was reached at 32.0 and 35.3 minutes for ripe and semi-ripe fruits, respectively. At 50±1°C, quarantine safety was reached at 20.8 and 21.7 minutes for ripe and semi-ripe fruits, respectively. C. capitata mortality increased with the rise in temperature and exposure time.

  12. Introducción y producción en laboratorio de Diachasmimorpha tryon i y Diachasmimorpha longicaudata (Hymenoptera: Braconidae para el control biológico de Ceratitis capitata (Diptera: Tephritidae en la Argentina Introduction and laboratory production of Diachasmimorpha tryoni and Diachasmimorpha longicaudata (Hymenoptera: Braconidae for the biological control of Ceratitis capitata (Diptera: Tephritidae in Argentina

    Directory of Open Access Journals (Sweden)

    Sergio M. Ovruski

    2003-12-01

    Full Text Available Con el propósito de reanudar la utilización de enemigos naturales contra la especie exótica Ceratitis capitata (Wiedemann, fueron introducidos a la Argentina en 1999 los agentes de control biológico Diachasmimorpha tryoni (Cameron y Diachasmimorpha longicaudata (Ashmead, dos endoparasitoides de larvas de tefrítidos. Por este motivo, en este trabajo se describen los procedimientos de cría en laboratorio del huésped y de ambas especies de parasitoides y, se presentan y discuten los resultados de un año de producción de D. tryoni y D. longicaudata a mediana escala (enero-diciembre/2000. Se realizó un análisis comparativo de los datos obtenidos sobre la producción de descendientes, proporción sexual, porcentaje de parasitismo y viabilidad de puparios por jaula de cría durante 15 generaciones entre ambas especies de parasitoides exóticos, utilizando como huésped larvas de C. capitata del tercer estadio de siete días de edad. Además, se discuten las posibilidades para implementar el control biológico aumentativo contra C. capitata y Anastrepha fraterculus (Wiedemann en el país.The biocontrol agents Diachasmimorpha tryoni (Cameron and Diachasmimorpha longicaudata (Ashmead, two endoparasitoids of fruit fly larvae, were introduced to Argentina in 1999 with the purpose of renewing the employment of natural enemies against Ceratitis capitata (Wiedemann. For this reason, the general procedure and maintenance of the host and parasitoids rearing in the laboratory are described, and the results of one year insectary production (January-December/2000 of both D. tryoni and D. longicaudata are discussed. Data are presented of the progeny production, offpring sex ratio, host parasitism percentage, and pupal viability per parasitoid rearing cage during 15 generations of D. longicaudata and D. tryoni reared using late third instar larvae of C. capitata. New perspectives are discussed on the establishment of a biological control program for C. capitata and Anastrepha fraterculus (Wiedemann in Argentina by using parasitoid augmentative releases.

  13. Flutuação populacional de Anastrepha fraterculus (Wiedemann, 1830 (Diptera, Tephritidae na Região Oeste de Santa Catarina, Brasil Population fluctuation of Anastrepha fraterculus (Wiedemann, 1830 (Diptera, Tephritidae in the Western Region of Santa Catarina State, Brazil

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    2003-01-01

    Full Text Available Fruit flies are the major pests in fruit orchards and require a frequent insecticide aplication control, which increases production cost and chemical residues in fruits. Adults of Anastrepha fraterculus were sampled from twelve peach, plum, orange, tangerine and acid lime orchards in four counties in the Western Region of Santa Catarina. Modified McPhail plastic traps, baited with glucose 10%, were used to collect the flies from October 1998 to September 2000. Trap monitoring, bait replacement and fruit flies sorting by species and sex were done weekly. A total of 4,164 specimens of A. fraterculus was collected and highest population was registered in the county of Chapecó (64,8% of all sampled flies. Adults were collected all year long, with the highest population peaks occurring from December and January, although the fluctuation was different for each fruit species due to their particular phenology and in different years. Positive correlation among temperature, atmospheric humidity and population levels of adults of A. fraterculus was observed. According to the degree days obtained for each year, 4851.9, 4632.9 and 4983.7, respectively in 1998, 1999 and 2000, it was established that A. fraterculus could present an average of 11.2 generations a year.

  14. Mass production in liquid diet and radiosterilization of South American fruit fly Anastrepha sp.1 aff. fraterculus (Wied., 1830) (Diptera: Tephritidae); Criacao massal em dieta liquida e radioesterilizacao da mosca-sulamericana Anastrepha sp.1 aff. fraterculus (Wied., 1830) (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Kamiya, Aline Cristiane

    2010-07-01

    Both the biological control techniques as the Sterile Insect Technique (SIT), are used in many countries to control, suppress and even eradicate fruit flies and other pests in agriculture and public health. The use of such techniques minimizes the continuous employment of insecticides, protects the environment and conforms to standards for food safety. However, it is necessary to implement such programs, technology to produce millions of parasitoids and the pest in its own laboratory with biological quality similar to the insects found in nature and cost competitive with chemical control. The objectives of this study was to establish protocols for artificial rearing of A. sp. 1 aff. fraterculus in liquid larval diet that will achieve levels of mass production for a possible reduction in the cost of establishing and determining the dose of radiation sterilization of adult A. sp. 1 aff. fraterculus meeting the quality parameters required by the Sterile Insect Technique with insects from the creation of Radioentomology Laboratory of CENA/USP. Seven experimental diets compared to the conventional diet used in Radioentomology Lab. of CENA/USP, which was used as control. All seven diets have in common the exclusion of agar in its formulation. Only two of the diets tested were suitable for larval development of the fly, they compared with the standard diet, showed inferior results with respect to the volume of recovered larvae, pupae and weight of emergency, however, no significant differences regarding the periods of development , pupal recovery, sex ratio and longevity under stress. It is possible to replace the diet with agar for liquid diets for artificial creation of A. sp. 1 aff. fraterculus, reduced cost and greater convenience of handling, but due to their quality standards lower than the standard diet, more tests are needed especially regarding the adaptability of the insect to the new environment. To determine the sterilizing dose this study examined the fertility, fecundity, emergence, flight ability and longevity under stress in A. fraterculus irradiated with 40, 50, 60, 70 and 80 Gy. The radiation source was a gamma irradiator with a Co-60 (Gamma beam-650) located in the same laboratory. The tests were performed under the following environmental conditions: 26 +- 1 deg C, 70 +- 5% RH and photoperiod of 12:12. The dose of gamma radiation sterilization for male A. sp. 1 aff. fraterculus was determined with 70 Gy. Irradiates females, even with the lower dose of 40 Gy, laid no eggs, possibly due to atrophy of the ovaries caused by radiation. The radiation did not affect the other quality parameters such as insect emergence, longevity and ability to fly. (author)

  15. Release and establishment of the parasitoid Diachasmimorpha kraussii against the tephritid fruit fly Bactrocera latifrons in Hawaii.

    Science.gov (United States)

    Bokonon-Ganta, Aimé H; McQuate, Grant T; Messing, Russell H; B Jang, Eric

    2013-01-01

    Diachasmimorpha kraussii (Fullaway) (Hymenoptera: Braconidae) was first released against Bactrocera latifrons (Hendel) (Diptera: Tephritidae) in Hawaii in March 2003. Over a three month period, eight releases, totaling 7,696 females and 3,968 males, were made in a turkeyberry, Solanum torvum Swartz (Solanales: Solanaceae) patch known to have a well established B. latifrons population. The establishment of D. kraussii was assessed through fruit collections conducted over a three-year period beyond the last release. D. kraussii was recovered 2 weeks, 31 months, and 39 months after the last parasitoid release, with collections not only from the release site, but also from a control site about 5.0 km distance from the release site. Recovery from fruit collections three years after the last parasitoid release confirmed that D. kraussii had become established in Hawaii. Parasitism rates were low, only 1.0-1.4%, compared to rates of 2.8-8.7% for the earlier established egg-larval parasitoid, Fopius arisanus (Sonan).

  16. Field infestation of rambutan fruits by internal-feeding pests in Hawaii.

    Science.gov (United States)

    McQuate, G T; Follett, P A; Yoshimoto, J M

    2000-06-01

    More than 47,000 mature fruits of nine different varieties of rambutan (Nephelium lappaceum L.) were harvested from orchards in Hawaii to assess natural levels of infestation by tephritid fruit flies and other internal feeding pests. Additionally, harvested, mature fruits of seven different rambutan varieties were artificially infested with eggs or first-instars of Mediterranean fruit fly, Ceratitis capitata (Wiedemann), or oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae) to assess host suitability. When all varieties were combined over two field seasons of sampling, fruit infestation rates were 0.021% for oriental fruit fly, 0.097% for Cryptophlebia spp. (Lepidoptera: Tortricidae), and 0.85% for pyralids (Lepidoptera). Species of Cryptophlebia included both C. illepida (Butler), the native Hawaiian species, and C. ombrodelta (Lower), an introduced species from Australia. Cryptophlebia spp. had not previously been known to attack rambutan. The pyralid infestation was mainly attributable to Cryptoblabes gnidiella (Milliere), a species also not previously recorded on rambutan in Hawaii. Overall infestation rate for other moths in the families Blastobasidae, Gracillariidae, Tineidae, and Tortricidae was 0.061%. In artificially infested fruits, both species of fruit fly showed moderately high survivorship for all varieties tested. Because rambutan has such low rates of infestation by oriental fruit fly and Cryptophlebia spp., the two primary internal-feeding regulatory pests of rambutan in Hawaii, it may be amenable to the alternative treatment efficacy approach to postharvest quarantine treatment.

  17. Release and Establishment of the Parasitoid Diachasmimorpha kraussii Against the Tephritid Fruit Fly Bactrocera latifrons in Hawaii

    Science.gov (United States)

    Bokonon-Ganta, Aimé H.; McQuate, Grant T.; Messing, Russell H.; B. Jang, Eric

    2013-01-01

    Diachasmimorpha kraussii (Fullaway) (Hymenoptera: Braconidae) was first released against Bactrocera latifrons (Hendel) (Diptera: Tephritidae) in Hawaii in March 2003. Over a three month period, eight releases, totaling 7,696 females and 3,968 males, were made in a turkeyberry, Solanum torvum Swartz (Solanales: Solanaceae) patch known to have a well established B. latifrons population. The establishment of D. kraussii was assessed through fruit collections conducted over a three-year period beyond the last release. D. kraussii was recovered 2 weeks, 31 months, and 39 months after the last parasitoid release, with collections not only from the release site, but also from a control site about 5.0 km distance from the release site. Recovery from fruit collections three years after the last parasitoid release confirmed that D. kraussii had become established in Hawaii. Parasitism rates were low, only 1.0–1.4%, compared to rates of 2.8–8.7% for the earlier established egg-larval parasitoid, Fopius arisanus (Sonan). PMID:23879328

  18. Defence behaviour of reindeer in response to flying parasitic Diptera

    OpenAIRE

    Karter, Andrew J.; Ivar Folstad

    1989-01-01

    Similar defence behaviours were exhibited by a reindeer when experimentally exposed to three different species of tethered, flying parasitic Diptera, Cephenemyia trompe (Modeer), Hypoderma tarandi (L) and Tabanid. Defencive behavioural responses appeared to be related to attack angle, and were not elicited by auditory stimuli. These observations raise questions about the validity of parasite species-specific defence responses in reindeer.Forsvars-adferd hos rein angrepet av flyvende, parasitt...

  19. Contraintes a l'adoption de la methode de l'hygiene sanitaire des ...

    African Journals Online (AJOL)

    Contraintes a l'adoption de la methode de l'hygiene sanitaire des vergers pour la lutte contre les mouches nuisibles aux fruits ( Diptera, Tephritidae ) par les producteurs de mangues et d'agrumes au Benin.

  20. Effect of continuous rearing on courtship acoustics of five braconid parasitoids, candidates for augmentative biological control of Anastrepha species

    Science.gov (United States)

    The courtship acoustics of five species of parasitoid wasps (Hymenoptera: Braconidae), potential candidates for augmentative biological control of Anastrepha species (Diptera: Tephritidae), were compared between recently colonized individuals and those continuously reared 70-148 generations. During...