WorldWideScience

Sample records for hemoglobinopathies

  1. Gene Therapy in Thalassemia and Hemoglobinopathies

    OpenAIRE

    Breda, Laura; Gambari, Roberto; Rivella, Stefano

    2009-01-01

    Sickle cell disease (SCD) and ß-thalassemia represent the most common hemoglobinopathies caused, respectively, by the alteration of structural features or deficient production of the ß-chain of the Hb molecule. Other hemoglobinopathies are characterized by different mutations in the α- or ß-globin genes and are associated with anemia and might require periodic or chronic blood transfusions. Therefore, ß-thalassemia, SCD and other hemoglobinopathies are excellent candidates for genetic approac...

  2. Thalassemias and hemoglobinopathies in Turkey.

    Science.gov (United States)

    Canatan, Duran

    2014-01-01

    Thalassemias and hemoglobinopathies are a serious health problem in Turkey. There is a 70-year history of thalassemia in Turkey. The first patient with β-thalassemia major (β-TM) was reported in 1941. The first clinical and hematological studies were published by Aksoy in 1958. The overall incidence of β-thalassemia (β-thal) was reported by Çavdar and Arcasoy to be 2.1% in 1971. Important steps such as written regulations, education and prevention campaigns, have been taken to prevent thalassemia in Turkey by the Ministry of Health (MOH), the Turkish National Hemoglobinopathy Council (TNHC) and the Thalassemia Federation of Turkey (TFT) since 2000. A national hemoglobinopathy prevention program was started in provinces with a high prevalence by the MOH in 2003. While the percentage of premarital screening test was 30.0% of all couples in 2003, it reached 86.0% in 2013. While the number of newborn with thalassemias and hemoglobinopathies was 272 in 2002, it had dropped to 25 in 2010. There has been a 90.0% reduction of affected births in the last 10 years.

  3. [Hemoglobin variants in Colombian patients referred to discard hemoglobinopathies].

    Science.gov (United States)

    Romero-Sánchez, Consuelo; Gómez Gutiérrez, Alberto; Duarte, Yurani; Amazo, Constanza; Manosalva, Clara; Chila M, Lorena; Casas-Gómez, María Consuelo; Briceño Balcázar, Ignacio

    2015-10-01

    Oxygen transport is altered in hemoglobinopathies. To study the distribution of hemoglobinopathies in Andean subjects without African ancestry. We analyzed blood samples of 1,407 subjects aged 18 to 59 years (58% females), living in the central Andean region of Colombia, referred to discard hemoglobinopathies. The frequency and type of hemoglobinopathy was established by capillary and agarose gel electrophoresis. The frequency of hemoglobinopathies was 34.5% and higher among females. The structural variants found were: AS-heterozygous hemoglobin (8.1%), homozygous SS (3.7%), heterozygous SC (2.2%), AC heterozygotes (0.5%) and heterozygous AE (0.3%). Quantitative variants found were Hb A-Beta thalassemia (13.91%) and Hb H (0.06%), Beta-thalassemia heterozygotes C (0.88%), S-Beta thalassemia heterozygotes (6.07%) and compound heterozygous SC/Beta thalassemia (0.25%), with a persistence of fetal hemoglobin 0. Composite thalassemia was also found in 31%. All techniques showed good correlation and capillary electrophoresis demonstrated a greater detection of hemoglobin variants. The frequency of hemoglobin variants in the analyzed population was high, which is an important public health indicator. The most common hemoglobin variant was HbA/Increased structural Hb A2 and the mos frequent structural hemoglobinopathy was sickle cell trait. Capillary electrophoresis can discern any Hb variants present in the population.

  4. Newborn screening for hemoglobinopathies at Muhimbili National ...

    African Journals Online (AJOL)

    Results: Out of 2,053 samples analyzed, the prevalence of hemoglobinopathies was 18.2% (n=374). The percentages of children with defined hemoglobinopathies included 12.6% (n=258) with sickle cell trait (Hb FAS); 0.9% (n=19) as sickle cell carrier or Hb S Beta+ -thalassemia (Hb FSA); 0.54% (n=11) had SCA or Hb S ...

  5. Thalassemia and related hemoglobinopathies.

    Science.gov (United States)

    Sarnaik, Sharada A

    2005-04-01

    Hemoglobinopathies are the most common single gene disorders in man. There are several hundred of these disorders though the thalassemias -- alpha and beta and the sickling disorders make up the vast majority. Recent advances in the understanding of the hemoglobin structure and the genetics of its synthesis has contributed significantly to the understanding of these diseases. Disorders include those with reduced globin synthesis, abnormal globin chains and failure to switch globin chain synthesis at the appropriate age. This review focuses on the clinical features, diagnosis and management strategies of the alpha and beta thalassemias, the sickling disorders and touches on a few rarer hemoglobinopathies. It also emphasizes prevention strategies and chronic transfusion safety in countries like India where there are limited resources.

  6. Hemoglobinopathies: clinical manifestations, diagnosis, and treatment.

    Science.gov (United States)

    Kohne, Elisabeth

    2011-08-01

    Hemoglobinopathies are among the most common inherited diseases around the world. They have become much more common recently in northern and central Europe, including Germany, due to immigration. Selective review of the literature with consideration of national guidelines. The hemoglobinopathies encompass all genetic diseases of hemoglobin. They fall into two main groups: thalassemia syndromes and structural hemoglobin variants (abnormal hemoglobins). α- and β-thalassemia are the main types of thalassemia; the main structural hemoglobin variants are HbS, HbE and HbC. There are many subtypes and combined types in each group. The highly variable clinical manifestations of the hemoglobinopathies range from mild hypochromic anemia to moderate hematological disease to severe, lifelong, transfusion-dependent anemia with multiorgan involvement. Stem-cell transplantation is the preferred treatment for the severe forms of thalassemia. Supportive, rather than curative, treatment consists of periodic blood transfusions for life, combined with iron chelation. Drugs to treat the symptoms of sickle-cell disease include analgesics, antibiotics, ACE inhibitors and hydroxyurea. Blood transfusions should be given only when strictly indicated. More than 90% of patients currently survive into adulthood. Optimally treated patients have a projected life span of 50 to 60 years. Hemoglobinopathies are a public health issue in today's multiethnic German population. Adequate care of the affected patients requires a wide variety of diagnostic and therapeutic measures.

  7. Gene Therapy Approaches to Hemoglobinopathies.

    Science.gov (United States)

    Ferrari, Giuliana; Cavazzana, Marina; Mavilio, Fulvio

    2017-10-01

    Gene therapy for hemoglobinopathies is currently based on transplantation of autologous hematopoietic stem cells genetically modified with a lentiviral vector expressing a globin gene under the control of globin transcriptional regulatory elements. Preclinical and early clinical studies showed the safety and potential efficacy of this therapeutic approach as well as the hurdles still limiting its general application. In addition, for both beta-thalassemia and sickle cell disease, an altered bone marrow microenvironment reduces the efficiency of stem cell harvesting as well as engraftment. These hurdles need be addressed for gene therapy for hemoglobinopathies to become a clinical reality. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. [Prevalence of hemoglobinopathies in pregnant women in the Lanzarote health sanitary area].

    Science.gov (United States)

    Calvo-Villas, J M; Zapata Ramos, M F; Cuesta Tovar, J; de la Iglesia Iñigo, S; Ropero Gradilla, P; Carreter de Granda, E; Sicilia Guillén, F

    2006-05-01

    The aim of this study is to analyze the global prevalence of carriers of heterozygous hemoglobinopathies among pregnant women settled in Lanzarote. A epidemiologic cross-sectional observational investigation was undertaken to study the prevalence of hemoglobinopathies in 2,436 pregnant women in Lanzarote. The techniques of primary screening were hemoglobin electrophoresis on cellulose acetate at alkaline pH for the detection of hemoglobin variants, and the quantification of HbA2 and HbF for the diagnosis of b thalassemia trait. The study to confirm the diagnosis of structural hemoglobinopathies was based on hemoglobin electrophoresis on citrate agar at acid pH, isolectric focusing and high-performance liquid chromatography (HPLC). The molecular characterization of b thalassemia trait (HbA2 >3.5%) was carried out by techniques using a real time PCR procedure with specific fluorescently labelled hybridization probes and allele-specific amplification (PCR-ARMS). The global prevalence of hemoglobinopathies was 11.90 corresponding to 9.44 for structural hemoglobinopathies and 2.46 for heterozygous b thalassemias. A variant hemoglobin was detected on 23 women and the distribution was as follows: thirteen carriers of hemoglobin S, seven HbC trait, two HbD trait and one "unstable" hemoglobin. 82.6% of the variant hemoglobins found were from migrant population from Africa and America. The high prevalence of carriers of structural hemoglobinopathies in Lanzarote justifies the initiation of programs for screening for hemoglobinopathies to prevent the emergence of severe states causing disease.

  9. A Novel Double Heterozygous Hb D-Punjab/Hb J-Meerut Hemoglobinopathy.

    Science.gov (United States)

    Chandra, Dinesh; Tyagi, Seema; Deka, Roopam; Chauhan, Richa; Seth, Tulika; Saxena, Renu; Pati, H P

    2017-12-01

    A comprehensive laboratory diagnosis of hemoglobinopathies forms an integral part in workup of disorders of globin chain synthesis. Clinical findings, complete blood counts, peripheral smear examination along with hemoglobin (Hb) electrophoresis and/or cation exchange high performance liquid chromatography findings and parental study helps to clinch a final diagnosis. Compound heterozygous hemoglobinopathy presents with variable clinical findings and some of them are picked up on screening tests done as part of routine antenatal workup. Here we report a rare double heterozygous hemoglobinopathy of Hb D-Punjab and Hb J-Meerut in a 35 year antenatal female.

  10. Present scenario of hemoglobinopathies in West Bengal, India: An analysis of a large population

    OpenAIRE

    Prakas Kumar Mandal; Suman Kumar Maji; Tuphan Kanti Dolai

    2014-01-01

    Background: To find out the prevalence of hemoglobinopathies by screening large population in West Bengal from Eastern India. Materials and Methods: A total of 50,487 subjects are screened for hemoglobinopathies from June 2010 to August 2013. A 2.5 ml of venous blood samples were collected in the tri-potassium EDTA vacuum container from each subject and tested with automated blood cell counter (Sysmex KX21) for red cell indices. Diagnosis of hemoglobinopathies was done by VARIANT TM (Bio-Rad ...

  11. Toward prevention of Hemoglobinopathies in Oman

    NARCIS (Netherlands)

    Hassan, Suha Mustafa

    2015-01-01

    Hemoglobinopathies (HBP) are the most common autosomal recessive genetic disorder in Oman. Carriers are usually asymptomatic but carrier couples are at 25% risk of getting a severely affected child. Public health authorities have focused not only on state of the art management and patient care but

  12. A novel double heterozygous Hb Fontainebleau/HbD Punjab hemoglobinopathy.

    Science.gov (United States)

    Rodríguez-Capote, Karina; Estey, Mathew P; Barakauskas, Vilte; Bordeleau, Pierre; Christensen, Cathie-Lou; Zuberbuhler, Peter; Higgins, Trefor N

    2015-09-01

    To report the finding of a novel double heterozygous hemoglobinopathy, the coinheritance of Hb Fontainebleau (α-chain variant) with HbD-Punjab (β-chain variant) discovered upon investigation of unexplained microcytosis in an infant. Hemoglobinopathy investigation was performed by high performance liquid chromatography (HPLC) using the β-thalassemia Short Program on the Bio-Rad Variant II(TM) followed by gel electrophoresis at alkaline and acid pH (Sebia Hydrasys 2 Electrophoresis System) and molecular diagnostic testing. This study complied with our institutional board ethics requirements. HPLC and electrophoresis suggested a complex α- and β-chain hemoglobinopathy with presumptive identification of the beta Hb variant as Hb D-Punjab. DNA sequencing analysis revealed the presence of a double heterozygous status for Hb Fontainebleau/Hb D-Punjab. In this paper we report the coinheritance of Hb Fontainebleau with Hb D-Punjab. Copyright © 2015 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  13. Screening for thalassemia and other hemoglobinopathies in a tertiary care hospital of West Bengal: implications for population screening.

    Science.gov (United States)

    Jain, Bhawna Bhutoria; Roy, Rabindra Nath; Ghosh, Sulekha; Ghosh, Tapan; Banerjee, Uma; Bhattacharya, Subodh Kumar

    2012-01-01

    Hemoglobinopathies are common genetic disorders of hemoglobin, which can be prevented by population screening and offering genetic counseling. In absence of population-based screening for hemoglobinopathies, the hospital-based diagnosis register provide idea about the extent of problem in the community. The present study was undertaken to find out the burden of hemoglobinopathies and spectrum of this disorders among the population who were screened in the hospital-based screening program. A record-basedanalysis of subjects who underwent screening for hemoglobinopathies in Burdwan Medical College and Hospital over a period of 3 years and 4 months revealed that overall 29.3% of subjects were positive for hemoglobinopathies. Beta thalassemia heterozygous was the most commonhemoglobinopathy in this region closely followed by hemoglobin E heterozygous. In view of high prevalence of hemoglobinopathies in this region, a routine premarital screening program is needed for identification and prevention of high-risk marriages.

  14. Bilateral orbital infarction and retinal detachment in a previously undiagnosed sickle cell hemoglobinopathy African child

    Science.gov (United States)

    Helen, Onakpoya Oluwatoyin; Ajite, K. O.; Oyelami, O. A.; Asaleye, C. M.; Adeoye, A. O.

    2013-01-01

    Bone infarction involving the orbit in sickle cell disease is not common. Bilateral orbital infarction in a previously undiagnosed sickle cell hemoglobinopathy has not been previously reported. In this report, we present a case of an 11-year-old previously undiagnosed sickle cell disease Nigerian girl with severe acute bilateral orbital infarction and retinal detachment to highlight that hemoglobinopathy induced orbital infarction should be considered in African children with acute onset proptosis with or without previous history of sickle cell hemoglobinopathy. PMID:23901183

  15. Usage of Capillary Electrophoresis for screening common Hemoglobinopathies

    Directory of Open Access Journals (Sweden)

    2016-06-01

    Full Text Available Hemoglobinopathies are most common inherited disorders in the world approximately 7 percent of the worldwide population and 5-6 percent of population of Iran are carriers. For control of this inherited hemoglobin disorders need to accurate screening by more advanced and more accurate methods. This study explains features of current Iran hemoglobin disorders, nominates the accessible methods for screening them and introduces the capillary zone electrophoresis as a rapid & more accurate method. The required data were extracted of various articles and then for good explanation, current Iran hemoglobinopathies properties were showed in the tables and electropherograms of important hemoglobin disorders in Iran population were provided for help to interpretation results of blood tests by capillary zone electrophoresis method. Hemoglobin disorders are including thalassemias & hemoglobin variants Disruption in the production and malfunction of globin chains cause types of hemoglobin disorders. We cannot introduce one of clinical laboratory tests as critical and basic method for screening and distinguishing types of inherited hemoglobin disorders as alone. For distinguishing the types of them must be prepared enough information and data of the hemoglobin disorders and for more accurate analysis must be used simultaneously different methods as Gel electrophoresis, High performance liquid chromatography, Isoelectric focusing, Capillary zone electrophoresis or molecular tests. The capillary electrophoresis is an accurate and rapid method for screening types of the hemoglobin disorders. Other side this method cannot analyze all of them, so must be used biochemical, biophysical and molecular methods for confirmation the results. This review showed we can use the capillary electrophoresis and HPLC as two complementary methods for hemoglobinopathies screening. We can analyze by the methods more hemoglobin disorders and decrease more laboratory errors. Moreover

  16. Prevalence of Co-Inheritance of Alpha-Thalassemia with Beta-Thalassemia and Beta-Hemoglobinopathy in Ahvaz City

    Directory of Open Access Journals (Sweden)

    Najmaddin Saki

    2013-09-01

    Full Text Available Background: Co-inheritance of hemoglobin gene defects is a rare important status that can lead to double heterozygote or homozygote with significant clinical manifestations. Such conditions can be observed in co-inheritance of alpha-thalassemia with beta-thalassemia or hemoglobinopathy. The aim of this study was to evaluate the prevalence of alpha-thalassemia with beta-thalassemia and hemoglobinopathy co-inheritance in a considerable number of Iranian.   Methods: This descriptive study was performed on patients with abnormal hematological findings in favor of alpha-thalassemia, beta-thalassemia or beta-hemoglobinopathies. Patients with low MCV and MCH levels and high HbA2 (>3.5 and those with low MCV and MCH and normal or low HbA2 were candidate for molecular analysis for beta and alpha thalassemia respectively. Abnormal Hb electrophoresis was diagnostic criteria for molecular analysis of beta-hemoglobinopathies.   Results: Study revealed that more than half of the patients with alpha-thalassemia affected simultaneously by beta-thalassemia and about thirty percent inherited beta-hemoglobinopathies. Among patients with beta-thalassemia, HbSCd6 (A-T was the most common mutation and in alpha-thalassemic patients α 3.7 was the commonest mutation.   Conclusion: Relatively high prevalence of co-inheritance of alfa-thalassemia with beta-thalassemia and hemoglobinopathies reflect the necessity of genetic consulting and molecular analysis in diagnosis of such conditions.

  17. Development of new technological applications for post- and prenatal diagnosis of the hemoglobinopathies

    OpenAIRE

    Phylipsen, Marion

    2013-01-01

    Hemoglobinopathies (HbP) are recessive hereditary disorders of hemoglobin, characterized by microcytic hypochromic anemia. HbP diagnostics encompasses three specialties: hematological, biochemical and molecular testing. Results of all tests together form the complete diagnosis. The main objective of this thesis was to improve post- and prenatal diagnostics of the hemoglobinopathies. Several molecular assays have been designed, tested and validated. In addition, a number of informative hemoglo...

  18. Prevalence of hemoglobinopathy, ABO and rhesus blood groups in rural areas of West Bengal, India.

    Science.gov (United States)

    Mondal, Bikash; Maiti, Soumyajit; Biswas, Biplab Kumar; Ghosh, Debidas; Paul, Shyamapada

    2012-08-01

    Hemoglobinopathies are a group of inherited disorders of hemoglobin synthesis. It could be formed a fatal scenario in concern of lacking of actual information. Beside this, ABO and Rh blood grouping are also important matter in transfusion and forensic medicine and to reduce new born hemolytic disease (NHD). The spectrum and prevalence of various hemoglobinopathies, ABO and rhesus (Rh) blood groups was screened among patients who visited B.S. Medical College and Hospital, Bankura, West Bengal, India. This study was carried out on 958 patients of different ages ranging from child to adults from January to June 2011. High-performance liquid chromatography (HPLC), complete blood count (CBC) and hemagglutination technique were performed for the assessment of abnormal hemoglobin variants, ABO and Rh blood groups, respectively. Results from this study had been shown that there was high prevalence of hemoglobinpathies (27.35%) where β-thalassemia in heterozygous state occurred more frequent than other hemoglobinopathies. Out of 958 patients, 72.65% were HbAA and 27.35% were hemoglobinopathies individuals where 17.64% β-thalassemia heterozygous, 2.92% β-thalassemia homozygous, 3.86% HbAE, 1.15% HbAS trait, 1.25% HbE-β thalassemia trait and 0.52% HbS-β thalassemia trait were found. No incidence of HbSS, HbSC, HbCC, HbD and other variants of hemoglobinpathies were observed. The gene frequencies with respect to ABO systems had been shown as O > B > A > AB. Blood group O was the highest (35.8%) and the least percentage distribution was blood group AB (6.68%). Rhesus positive (Rh+) were 97.7%, while the remaining was 2.3% Rhesus negative (Rh-). The frequencies of A(+), B(+), AB(+,) and O(+) blood groups were 22.44%, 33.61%, 6.58%, and 35.07%, respectively. Remarkable percentages of hemoglobinopathies were prevalent from the present study. An extensive screening of the population is needed to assess the prevalence of hemoglobinopathies, which will help in identification of

  19. The Results of Hemoglobinopathy Screening in Hatay, the Southern Part of Turkey

    Directory of Open Access Journals (Sweden)

    Gonul Oktay

    2014-12-01

    Full Text Available Aim: %u03B2-Thalassemia and hemoglobinopathies are common genetic disorders in Turkey. Because of this reason, either anemic people or couples before marriage are investigated for hemoglobinopathies routinly. In this retrospective study, our aim was to determine the frequency of %u03B2-thalassemia and hemoglobinopathies in Hatay, which is located in the southern part of Turkey. Material and Method: In this study, data from 70226 individuals, admitted to Antakya State Hospital Hemoglobinopathy Center in Hatay, both for the reason of anemia and before marriage investigations, were evaluated between January 2006 and October 2012. The blood samples were collected into EDTA-containing tubes and hematological parameters were analyzed using a Sysmex XT-2000i Hematology Analyzer. High performance liquid chromatography technique was used to determine the type of hemoglobin. Results: The frequency of hemoglobinopaties were 6% %u03B2-Thalassemia trait, 6.3% sickle cell trait, 12.9% %u03B1-thalassaemia trait? and 4.2 % other abnormal hemoglobinopaties variants. We detected 49 cases with homozygot %u03B2-thalassaemia, 60 cases with homozygot haemoglobin S, 33 cases with HbH disease (thalassaemia intermedia among all. Discussion: The frequency of %u03B2-thalassemia trait and other haemoglobinopathies in Hatay is found to be quite high as compared with other provinces in Turkey.

  20. Usage of capillary electrophoresis for common hemoglobinopathies screening

    Directory of Open Access Journals (Sweden)

    Alireza Ebrahimi

    2016-06-01

    Full Text Available Hemoglobinopathies are most common inherited disorders in the world; approximately 7 percent of the worldwide population and 5-6 percent of population of Iran are carriers. The hemoglobin disorders inherit as autosomal recessive and are very common in the Mediterranean area and much of the Asia and Africa. The control of this inherited disorders need to genetic counseling and accurate screening by more advanced and more accurate methods. This study explains features of current Iran hemoglobin disorders, nominates the accessible methods for screening them and introduces the capillary zone electrophoresis as a rapid and more accurate method. The required data were extracted of various articles and then for good explanation, current Iran hemoglobinopathies properties were showed in the tables and electropherograms of important hemoglobin disorders in Iran population were provided for help to interpretation results of blood tests by capillary zone electrophoresis method. Hemoglobin disorders are including thalassemias and hemoglobin variants; Disruption in the production and malfunction of globin chains cause types of hemoglobin disorders. We cannot introduce one of clinical laboratory tests as critical and basic method for screening and distinguishing types of inherited hemoglobin disorders as alone. For distinguishing the types of them must be prepared enough information and data of the hemoglobin disorders and for more accurate analysis must be used simultaneously different methods as gel electrophoresis, high performance liquid chromatography, isoelectric focusing, capillary zone electrophoresis or molecular tests. The capillary electrophoresis is an accurate and rapid method for screening types of the hemoglobin disorders. Other side this method cannot analyze all of them, so must be used biochemical, biophysical and molecular methods for confirmation the results. This review showed we can use the capillary electrophoresis and HPLC as two

  1. The epidemiologic transition of thalassemia and associated hemoglobinopathies in southern Taiwan.

    Science.gov (United States)

    Wang, Hui-Ching; Hsieh, Li-Ling; Liu, Yi-Chang; Hsiao, Hui-Hua; Lin, Shu-Kai; Tsai, Wen-Chan; Liu, Ta-Chih

    2017-02-01

    Since 1993, following the National Thalassemia Major Prevention Program and an increase in immigration and interracial marriages, especially in southern Taiwan, the distribution of hemoglobinopathies may have changed. This study investigates the epidemiologic transition of hemoglobinopathies. We analyzed 1870 specimens collected between 2003 and 2012 in southern Taiwan, used gap-polymerase chain reaction and PCR-restriction fragment length polymorphism-based methods, and confirmed genotypes of hemoglobinopathies by DNA sequencing. We found a 91% reduction in the incidence of thalassemia major compared with samples from between 1986 and 1995. The most common genotypes of α-thalassemia and α Hb variants were the SEA type (69.4%) and Hb Quong Sze (1.54%). The most common genotypes of β-thalassemia and β Hb variants were IVS-II-654 (46.2%) and Hb E (2.2%), respectively. Compared with studies performed in different areas of and time intervals in Taiwan, a higher prevalence of -α 3.7 , Hb Quong Sze, and Hb E and a lower prevalence of the SEA type were found in this study. However, the SEA type remained the most common genotype observed. In addition, an increasing number of cases with an -α 3.7 type carrier, Hb Quong Sze carrier, and G γ (A γ δβ)° were identified following a peak of interracial marriages between 2003 and 2005, reflecting a regional difference and the impact of interracial marriage. In conclusion, global migration and international marriage have changed the distribution of hemoglobinopathies in Taiwan. A more comprehensive prenatal screening for new immigrants with a longer follow-up is warranted.

  2. National registry of hemoglobinopathies in Spain (REPHem).

    Science.gov (United States)

    Cela, Elena; Bellón, José M; de la Cruz, María; Beléndez, Cristina; Berrueco, Rubén; Ruiz, Anna; Elorza, Izaskun; Díaz de Heredia, Cristina; Cervera, Aurea; Vallés, Griselda; Salinas, J Antonio; Coll, M Teresa; Bermúdez, Mar; Prudencio, Marta; Argilés, Bienvenida; Vecilla, Cruz

    2017-07-01

    Although highly prevalent throughout the world, the accurate prevalence of hemoglobinopathies in Spain is unknown. This study presents data on the national registry of hemoglobinopathies of patients with thalassemia major (TM), thalassemia intermedia (TI), and sickle cell disease (SCD) in Spain created in 2014. Fifty centers reported cases retrospectively. Data were registered from neonatal screening or from the first contact at diagnosis until last follow-up or death. Data of the 715 eligible patients were collected: 615 SCD (497 SS, 64 SC, 54 SBeta phenotypes), 73 thalassemia, 9 CC phenotype, and 18 other variants. Most of the SCD patients were born in Spain (65%), and 51% of these were diagnosed at newborn screening. Median age at the first diagnosis was 0.4 years for thalassemia and 1.0 years for SCD. The estimated incidence was 0.002 thalassemia cases and 0.03 SCD cases/1,000 live births. Median age was 8.9 years (0.2-33.7) for thalassemia and 8.1 years (0.2-32.8) for SCD patients. Stroke was registered in 16 SCD cases. Transplantation was performed in 43 TM and 23 SCD patients at a median age of 5.2 and 7.8 years, respectively. Twenty-one patients died (3 TM, 17 SCD, 1 CC) and 200 were lost to follow-up. Causes of death were related to transplantation in three patients with TM and three patients with SCD. Death did not seem to be associated with SCD in six patients, but nine patients died secondary to disease complications. Overall survival was 95% at 15 years of age. The registry provides data about the prevalence of hemoglobinopathies in Spain and will permit future cohort studies and the possibility of comparison with other registries. © 2016 Wiley Periodicals, Inc.

  3. Is high pressure liquid chromatography an effective screening tool for characterization of molecular defects in hemoglobinopathies?

    Directory of Open Access Journals (Sweden)

    Nikhil Moorchung

    2013-01-01

    Full Text Available Introduction: Hemoglobinopathies constitute entities that are generated by either abnormal hemoglobin or thalassemias. high pressure liquid chromatography (HPLC is one of the best methods for screening and detection of various hemoglobinopathies but it has intrinsic interpretive problems. The study was designed to evaluate the different mutations seen in cases of hemoglobinopathies and compare the same with screening tests. Materials and Methods: 68 patients of hemoglobinopathies were screened by HPLC. Mutation studies in the beta globin gene was performed using the polymerase chain reaction (PCR-based allele-specific Amplification Refractory Mutation System (ARMS. Molecular analysis for the sickle cell mutation was done by standard methods. Results: The IVS 1/5 mutation was the commonest mutation seen and it was seen in 26 (38.23% of the cases. This was followed by the IVS 1/1, codon 41/42, codon 8/9, del 22 mutation, codon 15 mutation and the -619 bp deletion. No mutation was seen in eight cases. There was a 100% concordance between the sickle cell trait as diagnosed by HPLC and genetic testing. Discussion and Conclusion: Our study underlies the importance of molecular testing in all cases of hemoglobinopathies. Although HPLC is a useful screening tool, molecular testing is very useful in accurately diagnosing the mutations. Molecular testing is especially applicable in cases with an abnormal hemoglobin (HbD, HbE and HbS because there may be a concomitant inheritance of a beta thalassemia mutation. Molecular testing is the gold standard when it comes to the diagnosis of hemoglobinopathies.

  4. Screening for thalassemia and other hemoglobinopathies in a tertiary care hospital of West Bengal: Implications for population screening

    OpenAIRE

    Bhawna Bhutoria Jain; Rabindra Nath Roy; Sulekha Ghosh; Tapan Ghosh; Uma Banerjee; Subodh Kumar Bhattacharya

    2012-01-01

    Hemoglobinopathies are common genetic disorders of hemoglobin, which can be prevented by population screening and offering genetic counseling. In absence of population-based screening for hemoglobinopathies, the hospital-based diagnosis register provide idea about the extent of problem in the community. The present study was undertaken to find out the burden of hemoglobinopathies and spectrum of this disorders among the population who were screened in the hospital-based screening program. A r...

  5. Hemoglobinopatias em trabalhadores expostos à riscos ocupacionais Hemoglobinopathies in workers exposed to occupational hazards

    Directory of Open Access Journals (Sweden)

    Isaac L. Silva Filho

    2002-12-01

    Full Text Available Hemoglobinopathies have been considered the most frequent hereditary disease in Brazilian population, constituting a Public Health problem. This paper reports on screening in workers at FIOCRUZ-RJ., exposed to some hazards factors such as, chemical substances, radiation, excessive cold and heat etc., with the objective of evaluating the impact of these factors in carriers of hemoglobinopathies, mainly in sickle cell trait (AS.

  6. Prevalence of hemoglobinopathy, ABO and rhesus blood groups in rural areas of West Bengal, India

    Directory of Open Access Journals (Sweden)

    Bikash Mondal

    2012-01-01

    Full Text Available Background: Hemoglobinopathies are a group of inherited disorders of hemoglobin synthesis. It could be formed a fatal scenario in concern of lacking of actual information. Beside this, ABO and Rh blood grouping are also important matter in transfusion and forensic medicine and to reduce new born hemolytic disease (NHD. Materials and Methods: The spectrum and prevalence of various hemoglobinopathies, ABO and rhesus (Rh blood groups was screened among patients who visited B.S. Medical College and Hospital, Bankura, West Bengal, India. This study was carried out on 958 patients of different ages ranging from child to adults from January to June 2011. High-performance liquid chromatography (HPLC, complete blood count (CBC and hemagglutination technique were performed for the assessment of abnormal hemoglobin variants, ABO and Rh blood groups, respectively. Results: Results from this study had been shown that there was high prevalence of hemoglobinpathies (27.35% where β-thalassemia in heterozygous state occurred more frequent than other hemoglobinopathies. Out of 958 patients, 72.65% were HbAA and 27.35% were hemoglobinopathies individuals where 17.64% β-thalassemia heterozygous, 2.92% β-thalassemia homozygous, 3.86% HbAE, 1.15% HbAS trait, 1.25% HbE-β thalassemia trait and 0.52% HbS-β thalassemia trait were found. No incidence of HbSS, HbSC, HbCC, HbD and other variants of hemoglobinpathies were observed. The gene frequencies with respect to ABO systems had been shown as O > B > A > AB. Blood group O was the highest (35.8% and the least percentage distribution was blood group AB (6.68%. Rhesus positive (Rh+ were 97.7%, while the remaining was 2.3% Rhesus negative (Rh-. The frequencies of A + , B + , AB +, and O + blood groups were 22.44%, 33.61%, 6.58%, and 35.07%, respectively. Conclusions: Remarkable percentages of hemoglobinopathies were prevalent from the present study. An extensive screening of the population is needed to assess the

  7. Epidemiology of Hemoglobinopathies in the Huzhou Region, Zhejiang Province, Southeast China.

    Science.gov (United States)

    Ding, Zhong-Ying; Shen, Guo-Song; Zhang, Su; He, Ping-Ya

    2016-09-01

    The aim of the present study was to report the frequency of thalassemia traits and other hemoglobinopathies in Huzhou City, Zhejiang Province, People's Republic of China (PRC), and for the future management of hemoglobinopathies. A total of 8578 pregnant women in the Huzhou region was analyzed for thalassemia traits and other hemoglobinopathies from July 1 2012 to November 30 2015. Complete blood count (CBC), and hemoglobin (Hb) variant analyses were performed with automatic counters and capillary electrophoresis (CE). High resolution melting (HRM) analysis was applied for genetic diagnosis of thalassemia. The prevalence of patients with the α-thalassemia (α-thal) trait was 1.01% (87/8578). β-Thalassemia (β-thal) was carried by 112 women with a frequency of 1.3%. The carrier rate of thalassemia genes in the studied samples was nearly 2.32%. We excluded those without iron studies, with 159 cases as our sample, a total of 63/159 cases (39.6%) also had iron deficiencies. Moreover, Hb E (HBB: c.79G > A), and Hb D-Punjab (HBB: c.364G > C) were the most common Hb variants after thalassemia trait with frequencies of 0.16 and 0.06%, respectively. Only two Hb S (HBB: c.20A > T) carriers were detected in 20 months of screening time. Hb A 1c results could be confidently reported on all cases except the Hb D-Punjab and Hb E variants. This study provided a detailed prevalence and molecular characterization of thalassemia in the Huzhou region, and will contribute toward the development of prevention strategies and reducing excessive health care costs in this area, allowing better management of hemoglobinopathies.

  8. Prevention of hemoglobinopathies in Turkey

    Directory of Open Access Journals (Sweden)

    Mehmet Akif Çürük

    2013-08-01

    Full Text Available Hemoglobinopathies are the most common genetic disorders in Turkey. The incidence of beta thalassemia and sickle cell trait (HbAS is 2.0% and 0.3% respectively. In addition to HbS, 51 abnormal hemoglobins and 42 different beta thalassemia mutations have been detected by DNA analysis. In Turkey, beta thalassemia and sickle cell anemia cause major health problems. For thirty years, screening programs for carriers, genetic counseling and prenatal diagnosis have sought to prevent hemoglobinopathies. In 1983, the first prenatal diagnosis center was established for sickle cell anemia and beta thalassemia at Hacettepe University, Ankara. After many populationscreening studies, a law was passed in 1993 by the Turkish Parliament for the eradication of hemoglobinopathies. Forty-one premarital screening centers were set up by the Ministry of Health in the 33 provinces where most of the transfusion-dependent thalassemic patients live. The mothers at risk for hemoglobinopathies were given genetic counseling and directed to prenatal diagnosis centers. Since 1990, four prenatal diagnosis centers have been established at university hospitals in Adana, Antalya, Istanbul and Izmir. A total of 5255 prenatal diagnoses have been made for sickle cell anemia and beta thalassemia in 5 centers; 1338 fetuses have been diagnosed as homozygous or compound heterozygotes for hemoglobinopathies. Prenatal diagnosis was performed on families who had decided to terminate the pregnancy if it were to be found that the fetus was affected. 血红蛋白病是土耳其最为常见的遗传性疾病。乙型地中海贫血和镰状细胞性状(HbAS)的发病率分别为2.0%和0.3%。除HbS外,已通过NDA分析检测出51种异常血红蛋白和42种乙型地中海贫血突变基因。在土耳其,乙型地中海贫血和镰状细胞性贫血会导致严重的健康问题。30

  9. Incidence of hemoglobinopathies and thalassemias in Northern Alberta. Establishment of reference intervals for HbF and HbA2.

    Science.gov (United States)

    Rodriguez-Capote, Karina; Higgins, Trefor N

    2015-07-01

    The aims of this study were to identify the incidence of hemoglobinopathies and thalassemias in Northern Alberta and calculate the reference intervals (RI) for hemoglobin (Hb) HbF and HbA2. A retrospective ad-hoc analysis of the structural Hb variants and thalassemias identified on patients who had a hemoglobinopathy/thalassemia investigation performed between February 1 to December 31, 2013. Results were extracted from the Laboratory Information System. Statistical analysis was performed using MedCalc® version 11.4.2.0 for Windows software. 6616 hemoglobinopathy/thalassemia investigations and HbS screens were physician requested and 602 Hb variants were fortuitously found during HbA1c analysis. 3438 were interpreted as "normal" and 532 were classified as iron deficient. 3306 individuals, with age ranging from 3 to 92 years were included in the RI calculation. HbA2 RI was 2.3% to 3.4% and HbF 0.0% to 1.8%. 524 and 423 α and β thalassemia traits respectively were identified. Additionally ten δβ thalassemia traits and twelve cases of HbH disease were identified. Regarding hemoglobinopathies, 7% were classified as α-chain variants and 93% as β-chain variants with HbS (46%), HbE (16%), HbD Punjab (8%) and HbC (7%) traits being the most prevalent. We also documented 20 homozygous hemoglobinopathies and 36 compound/double heterozygous hemoglobinopathies. A wide diversity of hemoglobinopathies is found in the Northern Alberta population, 80% of the hemoglobinopathies were found as a reflex to HbA1c testing. Reference intervals for HbF and HbA2 were established. Copyright © 2015 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  10. β-Thalassemia mutations and hemoglobinopathies in Adana, Turkey: results from a single center study

    OpenAIRE

    Guvenc, Birol; Canataroglu, Abdullah; Unsal, Cagatay; Yildiz, Sule Menziletoglu; Turhan, Ferda Tekin; Bozdogan, Sevcan Tug; Dincer, Suleyman; Erkman, Hakan

    2012-01-01

    Introduction β-Thalassemia and hemoglobinopathies are common genetic disorders in Turkey and in this retrospective study our aim was to determine the frequency of β-thalassemia and hemoglobinopathies in Adana, which is one of the biggest cities located in the southern part of Turkey. Material and methods Data from 3000 individuals admitted to Seyhan Hereditary Blood Disorders Center in Adana were evaluated. The blood samples were collected into EDTA-containing tubes and hematological paramete...

  11. Thalassemia and hemoglobinopathies in Thua Thien Hue Province, Central Vietnam.

    Science.gov (United States)

    Nguyen, Hoa Van; Sanchaisuriya, Kanokwan; Nguyen, Dung; Phan, Hoa Thi Thuy; Siridamrongvattana, Sirivara; Sanchaisuriya, Pattara; Fucharoen, Supan; Fucharoen, Goonnapa; Schelp, Frank P

    2013-01-01

    A community-based assessment of thalassemias and hemoglobinopathies was conducted at the Thua Thien Hue Province, Central Vietnam. By cluster sampling, a total of 410 pregnant women attending the antenatal care service at 30 commune health centers were recruited consecutively from September 2011 to June 2012. Hemoglobin (Hb) analysis was performed using an automated Hb analyzer. α-Thalassemia (α-thal) genes were identified by polymerase chain reaction (PCR)-based techniques. Out of the 410 pregnant women, 2.7% carried α(0)-thal and 1.2% were β-thal carriers. One woman with the - -(THAI) deletion was also found. Among the females under survey, structural Hb variants with 3.2% Hb E [β26(B8)Glu→Lys, GAG>AAG; HBB: c.78G>C] and 3.7% Hb Constant Spring [Hb CS; α142, Term→Gln, TAA>CAA (α2); HBA2: c.427T>C] were found. Assessing the frequency of thalassemias and hemoglobinopathies by ethnicity, Kinh (Vietnamese) and ethnic minority groups, Hb CS with a high frequency of 24.0% was observed in the ethnic minority groups. These results provide basic population-based information, are useful not only for implementing measures for prevention and control of thalassemias in the region but also for studying the importance of thalassemias and hemoglobinopathies in ethnic minorities within Southeast Asia.

  12. Distribution of hemoglobinopathies in patients presenting for electrophoresis and comparison of result with High performance liquid chromatography

    Directory of Open Access Journals (Sweden)

    R Jha

    2015-09-01

    Full Text Available Background: Nearly 226 million carriers of thalassemias and abnormal hemoglobin are present worldwide according to the World Health Organization (WHO. The laboratory plays an important role in the investigation of the thalassemias and hemoglobinopathies. Cellulose acetate electrophoresis at alkaline pH and diagnosis based mainly on visual impression of thickness of band may miss the thalassemic trait patients. The aim of this study was to find out different hemoglobinopathies and thalassemia presenting in our hospital and to compare electrophoresis results with HPLC.Materials and Methods: This study was performed in the hematopathology section of Department of Pathology of Tribhuvan University Teaching Hospital on cases sent for electrophoresis during 18 months period from October 2013 to March 2015 and included hemoglobinopathies and thalassemias identified by either electrophoresis or HPLC. 97 cases fulfilled the inclusion criteria and thus were included in the study. Electrophoresis at alkaline pH was done in all whereas HPLC was performed in 27 cases.Results: A sharp peak of hemoglobinopathies and thalassemias was seen in Tharu community though other communities are also affected. Thalassemia trait was the most common diagnosis (26.8% followed by sickle cell anemia (21.6%.  Electrophoresis was efficient in detecting some alpha thalassemia variants but missed many cases of beta thalassemia trait.Conclusion: Beta Thalassemia trait and sickle cell anemia both are common in Nepal , along with some other hemoglobinopathies  A sharp peak of hemoglobinopathies and thalassemias are seen in Tharu community. These abnormal hemoglobins and thalassemias are mainly seen in Terai region. Electrophoresis fails to quantify hemoglobin percentage and thus is not appropriate test in beta thalassemia screening. 

  13. Diabetes in Patients with ß-thalassemia or other Hemoglobinopathies - Analysis from the DPV Database.

    Science.gov (United States)

    Warncke, K; Konrad, K; Kohne, E; Hammer, E; Ohlenschläger, U; Herrlinger, S; Jäger, A; Holl, R W

    2016-11-01

    Background: Diabetes mellitus is a common endocrinopathy in patients with thalassemia major, but the occurrence of hemoglobinopathies is rare in Germany and Western Europe. The longitudinal German-Austrian DPV (Diabetes Patienten Verlaufsdokumentation) registry allows a comprehensive characterization of this group of patients. Patients/methods: Patients from the DPV-registry agedthalassemia major or other hemoglobinopathies were compared to patients with type 1 diabetes (T1D) and type 2 diabetes (T2D) using the statistical software SAS 9.4. Results: 94 patients (0.13% of patients) with hemoglobinopathies are registered in DPV. 82.4% of 17 patients with thalassemia major, 100% of 12 patients with sickle cell disease (SCD) and >90% of 65 patients with other hemoglobinopathies receive insulin treatment. In the majority of patients with thalassemia major, hemosiderosis is documented. Patients with thalassemia major developed diabetes at a median age of 14.6 [IQR 8.4-18.0] years (9.0 years [5.3-12.5] in T1D; 18.7 years [14.2-25.6] in TD2; both pthalassemia major is probably caused by hemosiderosis due to polytransfusion, while patients with SCD/thalassemia minor are most likely affected by T1D. The high rate of hypoglycemia in patients with ß-thalassemia major may be caused by liver fibrosis and a lack of hepatic glycogen stores. © Georg Thieme Verlag KG Stuttgart · New York.

  14. Prevalence of hemoglobinopathy, ABO and rhesus blood groups in rural areas of West Bengal, India

    OpenAIRE

    Bikash Mondal; Soumyajit Maiti; Biplab Kumar Biswas; Debidas Ghosh; Shyamapada Paul

    2012-01-01

    Background: Hemoglobinopathies are a group of inherited disorders of hemoglobin synthesis. It could be formed a fatal scenario in concern of lacking of actual information. Beside this, ABO and Rh blood grouping are also important matter in transfusion and forensic medicine and to reduce new born hemolytic disease (NHD). Materials and Methods: The spectrum and prevalence of various hemoglobinopathies, ABO and rhesus (Rh) blood groups was screened among patients who visited B.S. Medical College...

  15. Prevention of the hemoglobinopathies

    Directory of Open Access Journals (Sweden)

    Dimitris Loukopoulos

    2013-03-01

    Full Text Available The inherited hemoglobin disorders not only cause suffering and unhappiness to the patients but they also absorb a large part of resources and human effort in several countries which harbor the deleterious genes. Numbers are frightening! Africa, with several millions patients with sickle cell anemia; India with millions of patients with sickle cell disease and thalassemia, South East Asia with more millions of patients with hemoglobin E and a- or b-thalassemia. The offered treatment is suboptimal or nil and, and, in several places, patients are dying at infancy not only because of their hemoglobinopathy but mainly because of infections and malaria; in this way, nature took care of her own faults and eliminated them before they enter productive life...

  16. Carrier screening for thalassemia and hemoglobinopathies in Canada.

    Science.gov (United States)

    Langlois, Sylvie; Ford, Jason C; Chitayat, David

    2008-10-01

    To provide recommendations to physicians, midwives, genetic counsellors, and clinical laboratory scientists involved in pre-conceptional or prenatal care regarding carrier screening for thalassemia and hemoglobinopathies (e.g., sickle cell anemia and other qualitative hemoglobin disorders). To determine the populations to be screened and the appropriate tests to offer to minimize practice variations across Canada. The Medline database was searched for relevant articles published between 1986 and 2007 on carrier screening for thalassemia and hemoglobinopathies. Key textbooks were also reviewed. Recommendations were quantified using the Evaluation of Evidence guidelines developed by the Canadian Task Force on Preventive Health Care. The evidence collected from the Medline search was reviewed by the Prenatal Diagnosis Committee of the Canadian College of Medical Geneticists (CCMG) and the Genetics Committee of the Society of Obstetricians and Gynaecologists of Canada (SOGC). Screening of individuals at increased risk of being carriers for thalassemia and hemoglobinopathies can identify couples with a 25% risk of having a pregnancy with a significant genetic disorder for which prenatal diagnosis is possible. Ideally, screening should be done pre-conceptionally. However, for a significant proportion of patients, the screening will occur during the pregnancy, and the time constraint for obtaining screening results may result in psychological distress. This guideline does not include a cost analysis. 1. Carrier screening for thalassemia and hemoglobinopathies should be offered to a woman if she and/or her partner are identified as belonging to an ethnic population whose members are at higher risk of being carriers. Ideally, this screening should be done pre-conceptionally or as early as possible in the pregnancy. (II-2A) 2. Screening should consist of a complete blood count, as well as hemoglobin electrophoresis or hemoglobin high performance liquid chromatography. This

  17. Frequency and spectrum of hemoglobinopathy mutations in a Uruguayan pediatric population

    Directory of Open Access Journals (Sweden)

    Julio Da Luz

    2013-01-01

    Full Text Available Hemoglobinopathies are the most common recessive diseases worldwide but their prevalence in Uruguay has not been investigated. In this study, 397 unrelated outpatient children from the Pereira Rosell Hospital Center (CHPR, as well as 31 selected patients with microcytic anemia and 28 β-thalassemia carriers were analyzed for hemoglobinopathies by using biochemical and molecular biology methods. Parametric and non-parametric methods were used to compare the hematological indices between groups of genotypes. Of the 397 patients in the first group, approximately 1% (0.76% HbS and 0.25% β-thalassemia had a mutation in the HBB gene and 3.3% had α-thalassemia. These mutations had a heterogeneous distribution that varied according to individual ancestry. HbS was found exclusively in individuals with declared African ancestry and had a carrier frequency of 2.2%. The frequency of α-thalassemia carriers in outpatients of European and African ancestry was 1.2% and 6.5%, respectively. In contrast, the frequency of α-thalassemia carriers in patients with microcytic anemia was 25.8%, significantly higher (p < 0.01 than that observed in the sample as a whole and in Afro-descendants and Euro-descendants. Significant differences were observed in the hematological parameters between individuals with thalassemia genotypes and those with a normal genotype. These results indicate that hemoglobinopathies are a relevant health problem in Uruguay.

  18. β-Thalassemia mutations in Western India: outcome of prenatal diagnosis in a hemoglobinopathies project.

    Science.gov (United States)

    Patel, Ashwin P; Patel, Rupesh B; Patel, Saumyaa A; Vaniawala, Salil N; Patel, Dipika S; Shrivastava, Naina S; Sharma, Narmadeshwar P; Zala, Jayendrasinh V; Parmar, Prakash H; Naik, Madhuben R

    2014-01-01

    Prenatal diagnosis (PND) is one of the most cost effective preventive methods, but it is available only in the large cities of India. Therefore, we initiated a program that offers PND and allows us to determine the prevalence of various mutations. Pregnant females (n = 111,426) were screened for hemoglobinopathies using complete blood count (CBC) and high performance liquid chromatography (HPLC). If the female had a hemoglobinopathy, her husband was then tested. If hemoglobinopathies were seen in both partners, a genetic mutation study was performed on the couple. Fetal samples were obtained by either chorionic villus sampling (CVS) in 70.6% or amniocentesis in 29.4%. The study included 282 couples. IVS-I-5 (G > C) was the most common mutation in all castes except in the Sindhis and Lohanas, where the 619 bp deletion was the most common. Prenatal testing was informative in 97.9% of the couples. A significant number of couples (41.0%) underwent PND during their first pregnancy. Seven patients with β-thalassemia (β-thal) trait had normal Hb A2 levels. The Hb A2 and Hb F values varied significantly (p  T or G > A), were present in 81.0% of the couples tested. β-Thalassemia mutation frequency varied among the different castes, underlining the need for evolving a testing strategy that considers the caste system. Targeting antenatal clinics could also prove to be a most cost effective way of preventing hemoglobinopathies.

  19. Hemoglobinopathies in newborns from Salvador, Bahia, Northeast Brazil

    Directory of Open Access Journals (Sweden)

    Adorno Elisângela Vitória

    2005-01-01

    Full Text Available Hemoglobinopathies are hereditary disorders of the hemoglobin molecule with a high prevalence worldwide. Brazil has a prevalence of 0.1 to 0.3% of newborns with sickle cell anemia and 20.0 to 25.0% of heterozygous alpha2 thalassemia among African Brazilians. In the present study, we investigated the presence of variant hemoglobins and alpha2(3.7 Kb and alpha2(4.2 Kb thalassemia in newborns from Salvador, Bahia, Brazil. Samples of umbilical cord blood from a total of 590 newborns were analyzed, of which 57 (9.8% were FAS; 36 (6.5% FAC; one (0.2% SF; and five (0.9% FSC. One hundred fourteen (22.2% newborns had alpha2(3.7 Kb thalassemia, of whom 101 (19.7% were heterozygous and 13 (2.5% homozygous, showing statistical significance for hematological data between newborns with normal alpha genes and alpha2(3.7 Kb thalassemia carriers. The alpha2(4.2 Kb thalassemia was not found. Frequencies found in the present study confirm that hemoglobinopathies are a public health problem in Brazil, emphasizing the need for neonatal screening and genetic counseling programs.

  20. Prevalence of Co-Inheritance of Alpha-Thalassemia with Beta-Thalassemia and Beta-Hemoglobinopathy in Ahvaz City

    OpenAIRE

    Najmaddin Saki; Akbar Dorgalaleh; Zahra Kashani Khatib; Shaban Alizadeh; Fakher Rahim; Hamid Galehdari; Bijan Kaikhaei; Mohammad Pedram; Ali Dehghani Fard

    2013-01-01

    Background: Co-inheritance of hemoglobin gene defects is a rare important status that can lead to double heterozygote or homozygote with significant clinical manifestations. Such conditions can be observed in co-inheritance of alpha-thalassemia with beta-thalassemia or hemoglobinopathy. The aim of this study was to evaluate the prevalence of alpha-thalassemia with beta-thalassemia and hemoglobinopathy co-inheritance in a considerable number of Iranian.   Methods: This descriptive study was pe...

  1. Indian National Conference on Hemoglobinopathies, 17-18 May 2013, Bangalore - India

    Directory of Open Access Journals (Sweden)

    Editors: Karuna Rameshkumar

    2013-08-01

    Full Text Available This abstract book contains some abstracts presented at the Indian National Conference on Hemoglobinopathies, 17-18 May 2013, Bangalore - IndiaOrganized by Departments of Clinical Pathology, Paediatrics & Haematology St. John’s National Academy of Health Sciences Bangalore - India

  2. Preconception carrier screening and prenatal diagnosis in thalassemia and hemoglobinopathies: challenges and future perspectives.

    Science.gov (United States)

    Traeger-Synodinos, Joanne; Harteveld, Cornelis L

    2017-03-01

    Hemoglobinopathies constitute the most common severe monogenic disorders worldwide, with an increasing global burden each year. The benefit of applying programmes for preconception carrier screening, with the option of prenatal diagnosis, to minimize the incidence of new cases is recognized in many countries. Areas covered: The challenges associated with identifying carrier couples using hematology-based screening, along with DNA diagnosis and prenatal diagnosis were addressed, based on a literature search and the authors expertise. Expert commentary: The hemoglobinopathies are extremely heterogeneous at the haematological, molecular and clinical level, requiring appropriately equipped and staffed laboratories with experience to support comprehensive screening and diagnosis. However complete services with adequate infrastructure to address the associated technical challenges do not exist widely, especially in low-income countries that, coincidentally, are often those with the highest frequency of hemoglobinopathies in their population. Additionally, overcoming limited public awareness, education and absence of systematic dissemination of information also constitutes a challenge. This article aims to highlight these challenges and to evaluate potential future developments that may address at least some of them, focusing mainly on the technical challenges related to molecular diagnostics.

  3. Premarital hemoglobinopathy screening in Kocaeli, Turkey: a crowded industrial center on the north coast of Marmara Sea

    Directory of Open Access Journals (Sweden)

    Nazan Sarper

    2009-06-01

    Full Text Available Objective: Premarital hemoglobinopathy screening is one of the important procedures of hemoglobinopathy control programs. This is the first report about the prevalence of hemoglobinopathies in Kocaeli. Materials and Methods: The study covered screening from July 2005 to the end of December 2008. Under the auspices of the Ministry of Health and regional health authorities, blood samples of the couples were obtained during admission to the marriage office. Complete blood counts and hemoglobin variant analysis were performed with automatic counter and high pressure liquid chromatography technique. Genetic counseling was given to carriers of thalassemia and abnormal hemoglobins. Results: A total of 88,888 people were screened. The frequencies of β-thalassemia trait and sickle cell anemia trait were 0.89% and 0.05%, respectively. The frequency of couples with high-risk of having a sibling with homozygous hemoglobinopathy was 0.01%. Conclusion: The prevalence of β-thalassemia trait and sickle cell anemia trait was quite low and reflects the frequency in eastern and northern Anatolia and migration to Kocaeli from these geographic regions. Although frequency is low, the chronic transfusion requirement, high cost of chelating, organ damage, painful crisis and other crisis, and availability of stem cell transplantation only for a limited number of patients with compatible sibling donors justify premarital screening studies even in regions with lower prevalence such as Kocaeli.

  4. Premarital screening for hemoglobinopathies: experience of a single center in Kurdistan, Iraq.

    Science.gov (United States)

    Al-Allawi, Nasir A S; Al-Doski, Adnan A S; Markous, Raji S D; Mohamad Amin, Khyria A K; Eissa, Adil A Z; Badi, Ameer I A; Asmaro, Rafal R H; Hamamy, Hanan

    2015-01-01

    A program for the prevention of major hemoglobinopathies was initiated in 2008 in the Kurdistan region of Iraq. This study reports on the achievements and challenges of the program. A total of 102,554 individuals (51,277 couples) visiting a premarital center between 2008 and 2012 were screened for carrier status of hemoglobinopathies, and at-risk couples were counseled. A total of 223 (4.3/1,000) couples were identified and counseled as high-risk couples. Available data on 198 high-risk couples indicated that 90.4% proceeded with their marriage plans, and 15% of these married couples decided to have prenatal diagnosis (PND) in subsequent pregnancies with the identification of 8 affected fetuses; all were terminated as chosen by the parents. Thirty affected births were recorded among the high-risk couples. The premarital program managed to reduce the affected birth rate of major hemoglobinopathies by 21.1%. Of the 136 affected babies born during the study period, 77.9% were born to couples married prior to the start of the program, while 22.1% were born to couples identified as having a high risk. The main reason for not taking the option of PND was unaffordable costs. Financial support would have increased opting for PND by high-risk couples. Further reduction in affected birth rates could be achieved by including parallel antenatal screening programs to cover those married before the initiation of the premarital program and improving the public health education and counseling programs. © 2015 S. Karger AG, Basel.

  5. Development of new technological applications for post- and prenatal diagnosis of the hemoglobinopathies

    NARCIS (Netherlands)

    Phylipsen, Marion

    2013-01-01

    Hemoglobinopathies (HbP) are recessive hereditary disorders of hemoglobin, characterized by microcytic hypochromic anemia. HbP diagnostics encompasses three specialties: hematological, biochemical and molecular testing. Results of all tests together form the complete diagnosis. The main objective of

  6. Systematic documentation and analysis of human genetic variation in hemoglobinopathies using the microattribution approach

    NARCIS (Netherlands)

    B. Giardine (Belinda); J. Borg (Joseph); D.R. Higgs (Douglas); K.R. Peterson (Kenneth R.); J.N.J. Philipsen (Sjaak); D. Maglott (Donna); B.K. Singleton (Belinda K.); D.J. Anstee (David J.); A.N. Basak (Nazli); B.H. Clark (Bruce); F.C. Costa (Flavia C.); P. Faustino (Paula); H. Fedosyuk (Halyna); A.E. Felice (Alex); A. Francina (Alain); R. Galanello (Renzo); M.V.E. Gallivan (Monica V. E.); M. Georgitsi (Marianthi); R.J. Gibbons (Richard J.); P.C. Giordano (Piero Carlo); C.L. Harteveld (Cornelis); J.D. Hoyer (James D.); M. Jarvis (Martin); P. Joly (Philippe); E. Kanavakis (Emmanuel); P. Kollia (Panagoula); S. Menzel (Stephan); W.G. Miller (William); K. Moradkhani (Kamran); J. Old (John); A. Papachatzpoulou (Adamantia); M.N. Papadakis (Manoussos); P. Papadopoulos (Petros); S. Pavlovic (Sonja); L. Perseu (Lucia); M. Radmilovic (Milena); C. Riemer (Cathy); S. Satta (Stefania); I.A. Schrijver (Ingrid); M. Stojiljkovic (Maja); S.L. Thein; J. Traeger-Synodinos (Joanne); R. Tully (Ray); T. Wada (Takahito); J.S. Waye (John); C. Wiemann (Claudia); B. Zukic (Branka); D.H.K. Chui (David H. K.); H. Wajcman (Henri); R. Hardison (Ross); G.P. Patrinos (George)

    2011-01-01

    textabstractWe developed a series of interrelated locus-specific databases to store all published and unpublished genetic variation related to hemoglobinopathies and thalassemia and implemented microattribution to encourage submission of unpublished observations of genetic variation to these public

  7. Genetic Epidemiology, Hematological and Clinical Features of Hemoglobinopathies in Iran

    OpenAIRE

    Rahimi, Zohreh

    2013-01-01

    There is large variation in the molecular genetics and clinical features of hemoglobinopathies in Iran. Studying structural variants of hemoglobin demonstrated that the ?-chain variants of hemoglobin S and D-Punjab are more prevalent in the Fars (southwestern Iran) and Kermanshah (western Iran) provinces, respectively. Also, ? -chain variants of Hb Q-Iran and Hb Setif are prevalent in western Iran. The molecular basis and clinical severity of thalassemias are extremely heterogenous among Iran...

  8. Genetic epidemiology, hematological and clinical features of hemoglobinopathies in Iran.

    Science.gov (United States)

    Rahimi, Zohreh

    2013-01-01

    There is large variation in the molecular genetics and clinical features of hemoglobinopathies in Iran. Studying structural variants of hemoglobin demonstrated that the β-chain variants of hemoglobin S and D-Punjab are more prevalent in the Fars (southwestern Iran) and Kermanshah (western Iran) provinces, respectively. Also, α-chain variants of Hb Q-Iran and Hb Setif are prevalent in western Iran. The molecular basis and clinical severity of thalassemias are extremely heterogenous among Iranians due to the presence of multiethnic groups in the country. β-Thalassemia is more prevalent in northern and southern Iran. Among 52 different β-thalassemia mutations that have been identified among Iranian populations, IVSII-1 G:A is the most frequent mutation in most parts of the country. The presence of IVS I-5 G:C mutation with high frequency in southeastern Iran might reflect gene flow from neighboring countries. A wide spectrum of α-thalassemia alleles has been detected among Iranians with -α(3.7 kb) as the most prevalent α-thalassemia mutation. The prevention program of thalassemia birth in Iran has reduced the birth rate of homozygous β-thalassemia since the implementation of the program in 1997. In this review genetic epidemiology, clinical and hematological aspects of hemoglobinopathies, and the prevention programs of β-thalassemia in Iran will be discussed.

  9. Genetic Epidemiology, Hematological and Clinical Features of Hemoglobinopathies in Iran

    Directory of Open Access Journals (Sweden)

    Zohreh Rahimi

    2013-01-01

    Full Text Available There is large variation in the molecular genetics and clinical features of hemoglobinopathies in Iran. Studying structural variants of hemoglobin demonstrated that the β-chain variants of hemoglobin S and D-Punjab are more prevalent in the Fars (southwestern Iran and Kermanshah (western Iran provinces, respectively. Also, α-chain variants of Hb Q-Iran and Hb Setif are prevalent in western Iran. The molecular basis and clinical severity of thalassemias are extremely heterogenous among Iranians due to the presence of multiethnic groups in the country. β-Thalassemia is more prevalent in northern and southern Iran. Among 52 different β-thalassemia mutations that have been identified among Iranian populations, IVSII-1 G:A is the most frequent mutation in most parts of the country. The presence of IVS I-5 G:C mutation with high frequency in southeastern Iran might reflect gene flow from neighboring countries. A wide spectrum of α-thalassemia alleles has been detected among Iranians with as the most prevalent α-thalassemia mutation. The prevention program of thalassemia birth in Iran has reduced the birth rate of homozygous β-thalassemia since the implementation of the program in 1997. In this review genetic epidemiology, clinical and hematological aspects of hemoglobinopathies, and the prevention programs of β-thalassemia in Iran will be discussed.

  10. MR imaging of marrow heterotopia in the hemoglobinopathies

    International Nuclear Information System (INIS)

    Trakadas, S.; Papavasiliou, C.; Gouliamos, A.D.; Vlahos, L.

    1987-01-01

    The MR imaging findings of marrow heterotopia in the costovertebral angles in patients with various hemoglobinopathies are presented. There was good correlation between the MR imaging findings and the appearance of the masses on conventional radiography or CT. The masses were of low signal intensity, similar to the signal intensity of the adjacent marrow of the thoracic spine, and surrounded by a high-intensity rim attributed to a layer of fat surrounding the masses. The latter finding is thought to be characteristic of marrow heterotopia masses. MR imaging may also reveal potential intrusion of marrow heterotopia into the spinal canal, thus eliminating the need for myelography

  11. Hemoglobinopathies and thalassemia screening among Senoi Orang Asli in Peninsular Malaysia

    Science.gov (United States)

    Rong, Danny Koh Xuan; Ismail, Endom; Sabudin, Raja Zahratul Azma Raja; Hussin, Noor Hamidah; Othman, Ainoon

    2015-09-01

    Orang Asli are the minority indigenous people in Peninsular Malaysia and can be divided into 3 main groups (Negrito, Senoi and Proto Malay) with different six sub-ethnics under each group. Within the Senoi group, the six sub-ethnics are sub-ethnic Mah Meri, Semoq Beri, Che Wong, Jah Hut, Semai and Temiar. This study was aimed to investigate the current prevalence of α- and β-thalassemia and hemoglobinopathies and their mutation types among all six sub-ethnics of Senoi Orang Asli. Blood samples from 685 Senoi participants were collected and sent immediately for routine full blood count analysis and hemoglobin sub-typing. Of 378 subjects screened, 7 subjects were found to be Hemoglobin E (HbE) beta thalassemia carriers, 13 beta thalassaemic, 35 Hemoglobin Constant Spring (HbCS) carriers, 6 compound HbE and HbCS carriers, 32 with HbE disease and 163 HbE heterozygote carriers. The findings of high HbE among Temiars and Jah Huts and high HbCS exclusively in Jah Huts in this study suggest distinct differences across sub-ethnics under Senoi group. Understanding of prevalence and wide spectrum of thalassemia and hemoglobinopathies among Senoi and Orang Asli is essential for national thalassaemia awareness and prevention program, especially in Orang Asli communities.

  12. Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies

    NARCIS (Netherlands)

    Loucari, C.C. (Constantinos C.); Patsali, P. (Petros); T.B. van Dijk (Thamar); Stephanou, C. (Coralea); Papasavva, P. (Panayiota); Zanti, M. (Maria); Kurita, R. (Ryo); Nakamura, Y. (Yukio); S. Christou (Soteroula); Sitarou, M. (Maria); J.N.J. Philipsen (Sjaak); C.W. Lederer (Carsten); M. Kleanthous (Marina)

    2018-01-01

    textabstractThe β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of

  13. Development of hemoglobin typing control materials for laboratory investigation of thalassemia and hemoglobinopathies.

    Science.gov (United States)

    Pornprasert, Sakorn; Tookjai, Monthathip; Punyamung, Manoo; Pongpunyayuen, Panida; Jaiping, Kanokwan

    2016-01-01

    To date, the hemoglobin (Hb) typing control materials for laboratory investigation of thalassemia with low (1.8%-3.2%) and high (4%-6%) levels of HbA2 are available but there are no Hb typing quality control materials for analysis of thalassemia and hemoglobinopathies which are highly prevalent in South-East Asian countries. The main aim of the present study was to develop the lyophilized Hb typing control materials for laboratory investigation of thalassemia and hemoglobinopathies that are commonly found in South-East Asia. Erythrocytes of blood samples containing Hb Bart's, HbH, HbE, HbF, Hb Constant Spring (CS), Hb Hope, and Hb Q-Thailand were washed and dialysed with 0.85% saline solution. The erythrocytes were then lysed in 5% sucrose solution. The lyophilized Hb typing control materials were prepared by using a freeze drying (lyophilization) method. The high performance liquid chromatography (HPLC) analysis of lyophilized Hb was performed after the storage at -20 °C for 1 year and also after reconstitution and storage at 4 or -20 °C for 30 days. In addition, the Hb analysis was compared between the three different methods of HPLC, low pressure liquid chromatography (LPLC) and capillary electrophoresis (CE). Following a year of storage at -20 °C, the HPLC chromatograms of lyophilized Hb typing control materials showed similar patterns to the equivalent fresh whole blood. The stability of reconstituted Hb typing control materials was also observed through 30 days after reconstitution and storage at -20 °C. Moreover, the Hb typing control materials could be analyzed by three methods, HPLC, LPLC and CE. Even a degraded peak of HbCS was found on CE electropherogram. The lyophilized Hb typing control materials could be developed and used as control materials for investigation of thalassemia and hemoglobinopathies.

  14. Differentiation of osteomyelitis and infarction in sickle-cell hemoglobinopathies using combined bone-marrow and gallium scanning

    International Nuclear Information System (INIS)

    Hatfield, M.K.; Kahn, C.E.; Ryan, J.W.; Martin, W.B.

    1986-01-01

    The clinical records and scintigrams of patients with sickle cell hemoglobinopathies in whom acute symptoms developed suggestive of possible osteomyelitis and who had undergone sequential Tc-99m bone marrow scans and gallium scintigraphy of the affected sites were reviewed. Osteomyelitis was correctly diagnosed in six of 18 cases when gallium was focally increased relative to a site of decreased or absent bone marrow activity. Of 12 episodes of infarction, both studies showed focally decreased activity in a concordant manner in 11. The remaining, false-positive study indicated slightly increased gallium in 11. The remaining, false-positive indicated slightly increased gallium concentration at a site of decreased bone marrow activity. Overall, a protocol of sequential Tc-99m bone marrow scans and gallium scintigraphy is an effective means of distinguishing osteomyelitis from infarction in patients with sickle cell hemoglobinopathies

  15. The Prevalence of Hemoglobinopathies in Young Adolescents in the Province of Muğla in Turkey: Results of a Screening Program.

    Science.gov (United States)

    Topal, Yaşar; Topal, Hatice; Ceyhan, Mustafa Nuri; Azik, Fatih; Çapanoğlu, Murat; Kocabaş, Can Naci

    2015-01-01

    Thalassemia is an autosomal recessive inherited blood disorder. It is prevalent in Mediterranean countries such as Sardinia, Greece, Cyprus, Turkey, Lebanon and also Southeast Asia. Our aim was to investigate the carrier prevalence of thalassemia and other hemoglobinopathies in adolescents who live in Muğla Province, Turkey. We analyzed retrospectively the surveys conducted at primary schools between 1997 and 2013. Complete blood count (CBC) and high performance liquid chromatography (HPLC) were used to screen for thalassemia and hemoglobinopathies. Patients were diagnosed as having thalassemia trait if the mean corpuscular volume (MCV) was ≤ 80.0 fL, mean corpuscular hemoglobin (Hb) was ≤ 27.0 pg and Hb A2 levels were ≥ 3.5%. A total of 164,814 students were analyzed. The median age of the students was 13.5 years (minimum 13.0, maximum 14.0). The total number of students with abnormal HPLC results was 5861 (3.8%). There was a significant decrease in the newborn of new thalassemia patients found with screening programs for hemoglobinopathies in Muğla Province from 1997 to 2013. The number of students with abnormal HPLC results for thalassemia, sickle cell disease and other Hb traits were 3.2, 0.15 and 0.4%, respectively. It is important to recognize that including Hb, MCV, red blood cell (RBC) count and HPLC tests for carrier screening are necessary to find hemoglobinopathies. Our study supported that the number of new patients significantly decreased using these screening programs from 1997 to 2013.

  16. Hemoglobin Q-Thailand and its combinations with other forms of thalassemia or hemoglobinopathies in northern Thailand.

    Science.gov (United States)

    Panyasai, Sitthichai; Pornprasert, Sakorn

    2014-01-01

    There have been no reports for the frequency of Hb Q-Thailand [alpha 74(EF3)Asp --> His, GAC > CAC] and its combinations either with other forms of thalassemia or hemoglobinopathies in Northern Thailand. The aims of this study were to search for Hb Q-Thailand and its combinations in Northern Thai population and to analyze fractions of hemoglobin in Hb Q-Thailand and its combinations on high performance liquid chromatography (HPLC) chromatograms and/or capillary electrophoresis (CE) electrophoregrams. Blood samples from public and private hospitals in 7 northern provinces of Thailand were analyzed for thalassemia and hemoglobinopathy diagnoses using HPLC and/or CE and DNA analysis techniques at the Thalassemia Laboratory, Associated Medical Sciences Clinical Service Center, Chiang Mai, Thailand. Hb Q-Thailand was found in 13 of 13,596 (0.10%) samples; 6 were heterozygous Hb Q-Thailand, 4 were compound Hb Q-Thailand/alpha-thalassemia-1 Southeast Asian (SEA) type deletion and 3 with combinations of Hb Q-Thailand/beta(0)-thalassemia, Hb Q-Thailand/Hb E and Hb Q-Thailand/Hb E/alpha-thalassemia-1 SEA type deletion. The fractions of hemoglobin on HPLC chromatograms and CE electrophoregrams were observed based on types of combinations. Hb Q-Thailand and its combinations could be found in northern Thai population with the frequency of 0.10%. Thus, the better understanding of HPLC chromatogram and/or CE electrophoregram patterns of Hb Q-Thailand and its combination is essential for diagnosis and genetic counseling of thalassemia and hemoglobinopathies in this area.

  17. [Molecular epidemiological survey of hemoglobinopathies in Yongzhou area of Hunan province].

    Science.gov (United States)

    Tian, Jie; Tang, Deguo; Yang, Shaohui; Wang, Ju; Ai, Yanmin; Zhang, Miao

    2017-10-10

    To summarize the molecular epidemiology of hemoglobinopathies in Yongzhou area of Hunan province in order to provide a basis for making the guidelines of local thalassemia prevention program. Two thousand and two samples (1001 couples) were randomly recruited based on demographic data and distribution of ethnic groups. All samples were subjected to full blood count and analysis of hemoglobin and 6 common alpha-thalassemia mutations. Known beta-thalassemia mutations were screened in samples with beta-thalassemia trait. The remaining samples with positive phenotype and unknown mutations were subjected to DNA sequence analysis. Two hundred and forty individuals were found to be carriers of hemoglobinopathic mutations, which included 6 common alpha-thalassemia deletions, 9 common beta-thalassemia mutations and 3 common structural hemoglobin variants. One hundred and seventy-four mutant alleles for alpha-thalassemia were detected, which gave a carrier rate of 8.69%, of which 0.1% was due to HbH disease. Seventy mutant alleles for beta-thalassemia were detected, which gave a carrier rate of 3.50%. Seven subjects (0.35%) were identified as carriers of hemoglobin variants. The overall carrier rate for hemoglobinopathic mutations was 12.54% based on detection of 251 hemoglobinopathy mutant alleles. The overall carrier rate for alpha- and beta-thalassemia among ethnic Yaos was 25.00%, which was significantly higher than that of ethnic Han Chinese (11.14%, Phemoglobinopathies in Yongzhou area has been delineated for the first time.

  18. Burden of Hemoglobinopathies (Thalassemia, Sickle Cell Disorders and G6PD Deficiency) in Iran, 1990-2010: findings from the Global Burden of Disease Study 2010.

    Science.gov (United States)

    Rezaei, Nazila; Naderimagham, Shohreh; Ghasemian, Anoosheh; Saeedi Moghaddam, Sahar; Gohari, Kimia; Zareiy, Saeid; Sobhani, Sahar; Modirian, Mitra; Kompani, Farzad

    2015-08-01

    Hemoglobinopathies are known as the most common genetic disorders in Iran. The paper aims to provide global estimates of deaths and disability adjusted life years (DALYs) due to hemoglobinopathies in Iran by sex and age during 1990 to 2010 and describe the challenges due to limitations of the Global Burden of Disease Study 2010 (GBD 2010). GBD 2010 estimates of the numbers of deaths and years of life lost (YLLs) due to premature mortality were calculated using the Cause of Death Ensemble model (CODEm). Years of life lost due to disability (YLDs) were computed by multiplication of prevalence, the disability weight for occurrence of sequelae, and the duration of symptoms. Prevalence was estimated through a systematic search of published and available unpublished data sources, with a Bayesian meta-regression model developed for GBD 2010. Disability weights were produced using collected data from population-based surveys. Uncertainty from all inputs was incorporated into the computations of DALYs using simulation methods. We aim to prepare and criticize the results of GBD 2010 and provide some recommendations for reaching better conclusions about the burden of hemoglobinopathies in Iran. Between 1990 and 2010, the overall deaths attributed to hemoglobinopathies decreased from 0.51% to 0.36% of total deaths, with the corresponding burden declining from 1% to 0.82% of total DALYs. There was a reduction in deaths and DALYs rates for all ages and the rates attributed to all ages followed the same pattern in Iranian men and women. The highest DALYs for hemoglobinopathies, thalassemia, sickle cell disorder, and glucose-6-phosphate dehydrogenase deficiency (G6PD-D) were found in those aged less than 5 years. The collective burden of all of these hemoglobin disorder was lower in 2010 than in 1990. Although the screening programs in Iran have been very successful in reducing the number of thalassemia patients between 1990 to 2010, in order to provide a better estimation of the

  19. Asthma and hemoglobinopathy: when is supplemental oxygen required?

    Science.gov (United States)

    Joseph, Leon; Brickner-Braun, Inbal; Pinshow, Berry; Goldberg, Shmuel; Miskin, Hagit; Picard, Elie

    2013-10-01

    Asthma is the most common reason for referral to the emergency department in childhood. In severe attacks, supplemental O2 is given when oxygen saturation level is asthma attack. Simultaneously, P(a)O2 was normal. A diagnosis of abnormal hemoglobin with decreased oxygen affinity (hemoglobin Seattle) was made on hemoglobin electrophoresis and genetic analysis. To ascertain when supplemental oxygen was needed, an oxygen dissociation curve was plotted using the tonometer technique, and it was found that an S(p)O2 of 70% is parallel to a P(a)O2 of 60 mmHg. Plotting an oxygen dissociation curve is a simple reproducible method to determine when supplemental oxygen is required for a child with a hemoglobinopathy. © 2013 The Authors. Pediatrics International © 2013 Japan Pediatric Society.

  20. The use of prophylactic partial exchange tranfusion in pregnancies associated with sickle cell hemoglobinopathies.

    Science.gov (United States)

    Morrison, J C; Wiser, W L

    1976-11-01

    Sickle cell anemia is associated with an alarming attrition rate during pregnancy. The maternal morbidity rate, perinatal wastage rate, and the incidence of severe morbidity in both mother and child are elevated above acceptable limits. In most cases, these statistics have been compiled using conservative therapeutic modalities. In contrast, this report utilizes prophylactic partial exchange transfusion therapy in patients with severe sickle cell hemoglobinopathies. The protocol involves the introduction of 750-1000 cc of buffy coat, poor washed red cells exchanged with 1000-1500 cc whole blood during phlebotomy at 28 weeks' gestation and again prior to term. Thirty-six consecutive pregnant patients with sickle cell anemia have been managed in this fashion. The one maternal mortality occurred in a patient who did not complete the protocol. Major maternal morbidity and perinatal wastage rates were significantly decreased. Two cases of serum hepatitis occurred. It appears from these data that the use of prophylactic partial exchange transfusion in pregnant patients with severe sickle cell hemoglobinopathies can be of benefit. Further trials of this method seem justified by these results to assess completely the benefit-risk ratio of this procedure.

  1. Micromapping of thalassemia and hemoglobinopathies in diferent regions of northeast Thailand and Vientiane, Laos People's Democratic Republic.

    Science.gov (United States)

    Tritipsombut, Jaruwan; Sanchaisuriya, Kanokwan; Phollarp, Prachatip; Bouakhasith, Dalouny; Sanchaisuriya, Pattara; Fucharoen, Goonnapa; Fucharoen, Supan; Schelp, Frank P

    2012-01-01

    In order to determine the prevalence of thalassemia and hemoglobinopathies in different regions of northeast (NE) Thailand and Vientiane, Laos People's Democratic Republic (PDR), a total of 1,809 blood samples were collected consecutively from individuals attending antenatal care services at 11 community hospitals in different regions of NE Thailand and three hospitals in Vientiane, Laos PDR, from May 2009 to April 2010. All individuals were investigated for thalassemia and hemoglobinopathies using standard methods. For individuals from NE Thailand, the carrier frequencies were 41.7% for Hb E [β26(B8)Glu→Lys, GAG>AAG], 5.8% for α(0)-thalassemia (α(0)-thal), and 0.9% for β-thal. The THAI deletion type of α(0)-thal was found in one individual from an ethnic minority. From a group of pregnant Laotian women, 30.1% were Hb E carriers. The prevalence of α(0)-thal of 8.6% for the Laotian women was similar to that found in the upper northeastern part of Thailand. The frequency of β-thal was 2.3 %. The proportion of carriers of α(+)-thal and Hb Constant Spring (Hb CS, α142, Term→Gln (TAA>CAA in α2)] ) from Thailand and Laos was significantly different. The frequency of Hb Paksé [α142, Term→Tyr (TAA>TAT in α2)] was relatively low for Thailand as well as for Laos. The results indicate that thalassemia and hemoglobinopathies are a significant health burden in the region and that a prevention and control program for severe thalassemia diseases should be established in Laos.

  2. Characterizing a cohort of α-thalassemia couples collected during screening for hemoglobinopathies: 14 years of an Iranian experience.

    Science.gov (United States)

    Hafezi-Nejad, Nima; Khosravi, Mohsen; Bayat, Nooshin; Kariminejad, Ariana; Hadavi, Valeh; Oberkanins, Christian; Azarkeivan, Azita; Najmabadi, Hossein

    2014-01-01

    Our study aimed to determine the number of couples with normal hemoglobin (Hb) electrophoresis and low-borderline hematological values, which may come up with a clinically critical status in their offspring. The number of couples at risk for severe α-thalassemia (α-thal) needed to be estimated before recommending genetic counseling and prenatal diagnosis (PND). During the past 14 years, from at least 7000 referrals, 754 couples were investigated for α-thal by direct mutation detection methods followed by reverse strip assay and α-globin gene sequencing for inconclusive cases. Detection of silent β-thalassemia (β-thal) mutations was done in suspected cases by complete β-globin gene sequencing. We were able to provide a molecular diagnosis in 87.3% (658/754) of couples. A total of 9.1% (60/658) may have a clinically significant hemoglobinopathy in their offspring. Significant conditions included hydrops fetalis (20.0%; 12/60), certain Hb H (β4) genotypes (78.3%; 47/60) and β-thal intermedia (β-TI) (1.7%; 1/60). The diagnostic flowchart for couples with microcytic hypochromic anemia in countries with a high prevalence of hemoglobinopathies should include α and β gene sequencing. As our results indicate, every nine out of 100 of these couples will face significant hemoglobinopathies and every two out of 100 can carry Hb Bart's (γ4) hydrops fetalis in their pregnancies. For such cases, PND should be utilized to allow the carrier couples to decide whether or not to abort the fetus.

  3. Turkish female immigrants' intentions to participate in preconception carrier screening for hemoglobinopathies in the Netherlands: An empirical study

    NARCIS (Netherlands)

    T. van Elderen (Thérèse); D. Mutlu; J. Karstanje; J. Passchier (Jan); A. Tibben (Arend); H.J. Duivenvoorden (Hugo)

    2010-01-01

    textabstractBackground: Preconception carrier screening for hemoglobinopathies (HbPs) is debated in the Netherlands. Objectives: Intentions to participate in preconception carrier screening for HbPs as well as informed reproductive options were assessed in 109 Turkish female immigrants. Method:

  4. Diagnostic utility of isoelectric focusing and high performance liquid chromatography in neonatal cord blood screening for thalassemia and non-sickling hemoglobinopathies.

    Science.gov (United States)

    Uaprasert, Noppacharn; Settapiboon, Rung; Amornsiriwat, Supaporn; Sarnthammakul, Patsita; Thanapat, Tassanee; Rojnuckarin, Ponlapat; Sutcharitchan, Pranee

    2014-01-01

    Thalassemia syndromes are highly prevalent in Southeast Asia. In Thailand, high performance liquid chromatography (HPLC) is the most common technique routinely performed in diagnosis of thalassemia and hemoglobinopathies, while isoelectric focusing (IEF) is rarely employed. We compared the diagnostic utility of IEF and HPLC in neonatal screening for thalassemia and non-sickling hemoglobinopathies. Two-hundred and forty-one cord blood samples were analyzed using IEF and HPLC, β-thalassemia short program. The results were correlated with red cell indices and molecular analyses. Hemoglobin (Hb) Bart's was quantified only on IEF. Of 241 newborns, IEF and HPLC yielded 85.4% and 76.4% sensitivity to identify α-thalassemia syndrome, respectively. HbBart's≥2% yielded 100% sensitivity to identify 2 α-globin gene deletions and/or mutations, while MCV≤95fl and MCH≤30pg yielded 100% sensitivity to identify 2 α-globin gene deletions. DNA analysis revealed HbE mutation in all 61 subjects with HbA2>1% on both IEF and HPLC. IEF is an effective method in neonatal screening for thalassemia and non-sickling hemoglobinopathies. The HbBart's level, MCV and MCH are helpful for identifying α-thalassemia. The presence of HbA2 higher than 1% in cord blood indicates HbE carriers in Southeast Asian newborns. © 2013.

  5. Diagnosis of a rare double heterozygous Hb D Punjab/Hb Q India hemoglobinopathy using Sebia capillary zone electrophoresis

    Directory of Open Access Journals (Sweden)

    Sushama Parab

    2014-01-01

    Full Text Available In India, hemoglobinopathies constitute a major genetic disorder and hemoglobin variants such as Hb S, Hb D Punjab, and Hb E are the most common ones. Other variants include Hb Q India, Hb Lepore, Hb J Meerut, Hb D Iran, etc. These variants show heterozygous state along with beta thalassemia. However, compound heterozygosities among these variants are very rare. Ethylenediaminetetraacetic acid whole blood sample received for routine thalassemia screening was subjected to alkaline electrophoresis using automated capillary zone electrophoresis. Suspecting the presence of rare variants, further analysis was carried out using Bio-Rad D10 and Tosoh G8 high-performance liquid chromatography (HPLC systems. Capillary zone electrophoretograms showed the presence of peaks in zone Hb A, Hb D, a fused peak in Hb A2, and a small peak in Z1 zone. Bio-Rad and Tosoh chromatograms also indicated the presence of four peaks which are identified as Hb A, Hb D Punjab, Hb Q India, and hybrid of Hb D Punjab/Hb Q India. A peak in Hb D zone of capillary was due to co-migration of Hb D Punjab and Hb Q India variants. Small peak in Z1 zone indicated the presence of alpha chain variant Hb Q India. The findings were further confirmed by HPLC results and molecular genetic studies. The present study reports for the 1 st time a rare hemoglobinopathy of double heterozygosity for Hb D Punjab, Hb Q India on Capillarys 2 Flex Piercing analyzer and is forth reported case for this rare hemoglobinopathy.

  6. Chelation Therapy with Oral Solution of Deferiprone in Transfusional Iron-Overloaded Children with Hemoglobinopathies

    Directory of Open Access Journals (Sweden)

    Alexandros Makis

    2013-01-01

    Full Text Available Iron overload in hemoglobinopathies is secondary to blood transfusions, chronic hemolysis, and increased iron absorption and leads to tissue injury requiring the early use of chelating agents. The available agents are parenteral deferoxamine and oral deferiprone and deferasirox. There are limited data on the safety and efficacy of deferiprone at a very young age. The aim of our study was the presentation of data regarding the use of oral solution of deferiprone in 9 children (mean age 6.5, range 2–10 with transfusion dependent hemoglobinopathies (6 beta thalassemia major, 1 thalassemia intermedia, and 2 sickle cell beta thalassemia. The mean duration of treatment was 21.5 months (range 15–31. All children received the oral solution without any problems of compliance. Adverse reactions were temporary abdominal discomfort and diarrhea (1 child, mild neutropenia (1 child that resolved with no need of discontinuation of treatment, and transient arthralgia (1 child that resolved spontaneously. The mean ferritin levels were significantly reduced at the end of 12 months (initial 2440 versus final 1420 μg/L, . This small study shows that oral solution of deferiprone was well tolerated by young children and its use was not associated with major safety concerns. Furthermore, it was effective in decreasing serum ferritin.

  7. Prenatal diagnosis of hemoglobinopathies: from fetoscopy to coelocentesis

    Directory of Open Access Journals (Sweden)

    Gianfranca Damiani

    2014-09-01

    Full Text Available Prenatal diagnosis of hemoglobinopathies involves the study of fetal material from blood, amniocytes, trophoblast coelomatic cells and fetal DNA in maternal circulation. Its first application dates back to the 70s and it involves globin chain synthesis analysis on fetal blood. In the 1980s molecular analysis was introduced as well as amniocentesis and chorionic villi sampling under high-resolution ultrasound imaging. The application of direct sequencing and polymerase chain reactionbased methodologies improved the DNA analysis procedures and reduced the sampling age for invasive prenatal diagnosis from 18 to 16- 11 weeks allowing fetal genotyping within the first trimester of pregnancy. In the last years, fetal material obtained at 7-8 weeks of gestation by coelocentesis and isolation of fetal cells has provided new platforms on which to develop diagnostic capabilities while non-invasive technologies using fetal DNA in maternal circulation are starting to develop.

  8. After the Introduction into the National Newborn Screening Program : Who Is Receiving Genetic Counseling for Hemoglobinopathies in The Netherlands?

    NARCIS (Netherlands)

    Kaufmann, J. O.; Krapels, I. P. C.; Van Brussel, B. T. J.; Zekveld-Vroon, R. C.; Oosterwijk, J. C.; van Erp, F.; van Echtelt, J.; Zwijnenburg, P. J. G.; Petrij, F.; Bakker, E.; Giordano, P. C.

    2014-01-01

    OBJECTIVE: Universal newborn screening for hemoglobinopathies started in The Netherlands in 2007. Herewith severe conditions, such as sickle cell disease, β-thalassemia major and hemoglobin H disease are putatively identified. Additionally, at least 1,800 carriers of hemoglobin variants associated

  9. Prevalence of Hemoglobinopathies and their associations with different types of hemoglobin and mean cell volume in the preuniversity students of Bushehr, 2007

    Directory of Open Access Journals (Sweden)

    Ali Movahed

    2009-09-01

    Full Text Available Background: Hemoglobinopathies such as thalassemia and sickle cell disease are common genetic disorders. The aim of this study was to determine the prevalence of hemoglobinopathies and their associations with HbA, HbA2, HbS and HbF in the preuniversity students of Bushehr. Methods: Overall, 498 blood samples was collected in EDTA tubes. Hematological parameters including RBCs, Hb, MCV and MCH were determined by automatic analyzer. Measurement of HbA1, HbF, HbA2 and S band were done using Cellulose acetate electrophoresis. Samples with MCV 3.5% or HbF> 2% were diagnosed as Beta-thalassemia. Samples with positive sickle cell prep and had S band were diagnosed as SCA trait. Samples with HbA2 normal and low MCV or MCH were diagnosed as Iron deficiency or alpha thalassemia. Results: In our study, 74 samples had MCV< 80 fl and also 14.9% of female and 12% male had MCH 0.05. There was significant relationship between RBCs and HbA2 (p< 0.05. Conclusion: Our study showed that the prevalence of hemoglobinopathies is 28.2% and therefore it suggests that health care authorities must take steps to reduce the complications.

  10. Experiences of a High-Risk Population with Prenatal Hemoglobinopathy Carrier Screening in a Primary Care Setting: a Qualitative Study

    NARCIS (Netherlands)

    Holtkamp, Kim C. A.; Lakeman, Phillis; Hader, Hind; Jans, Suze M. J. P.; Hoenderdos, Maria; Playfair, Henna A. M.; Cornel, Martina C.; Peters, Marjolein; Henneman, Lidewij

    2017-01-01

    Carrier screening for hemoglobinopathies (HbPs; sickle cell disease and thalassemia) aims to facilitate autonomous reproductive decision-making. In the absence of a Dutch national HbP carrier screening program, some primary care midwives offer screening on an ad hoc basis. This qualitative

  11. Hemoglobinopathy: molecular epidemiological characteristics and health effects on Hakka people in the Meizhou region, southern China.

    Directory of Open Access Journals (Sweden)

    Min Lin

    Full Text Available BACKGROUND: Hemoglobinopathies are the most common inherited diseases in southern China. However, there have been only a few epidemiological studies of hemoglobinopathies in Guangdong province. MATERIALS AND METHODS: Peripheral blood samples were collected from 15299 "healthy" unrelated subjects of dominantly ethnic Hakka in the Meizhou region, on which hemoglobin electrophoresis and routine blood tests were performed. Suspected cases with hemoglobin variants and hereditary persistence of fetal hemoglobin (HPFH were further characterized by PCR, DNA sequencing, reverse dot blot (RDB or multiplex ligation-dependent probe amplification (MLPA. In addition, 1743 samples were randomly selected from the 15299 subjects for thalassemia screening, and suspected thalassemia carriers were identified by PCR and RDB. RESULTS: The gene frequency of hemoglobin variants was 0.477% (73/15299. The five main subgroups of the ten hemoglobin variants were Hb E, Hb G-Chinese, Hb Q-Tahiland, Hb New York and Hb J-Bangkok. 277 cases (15.89%, 277/1743 of suspected thalassemia carriers with microcytosis (MCV<82 fl were found by thalassemia screening, and were tested by a RDB gene chip to reveal a total of 196 mutant chromosomes: including 124 α-thalassemia mutant chromosomes and 72 β-thalassemia mutant chromosomes. These results give a heterozygote frequency of 11.24% for common α and β thalassemia in the Hakka population in the Meizhou region. 3 cases of HPFH/δβ-thalassemia were found, including 2 cases of Vietnamese HPFH (FPFH-7 and a rare Belgian( Gγ((Aγδβ⁰-thalassemia identified in Chinese. CONCLUSIONS: Our results provide a detailed prevalence and molecular characterization of hemoglobinopathies in Hakka people of the Meizhou region. The estimated numbers of pregnancies each year in the Meizhou region, in which the fetus would be at risk for β thalassemia major or intermedia, Bart's hydrops fetalis, and Hb H disease, are 25 (95% CI, 15 to 38, 40 (95% CI

  12. Hemoglobinopathy: Molecular Epidemiological Characteristics and Health Effects on Hakka People in the Meizhou Region, Southern China

    Science.gov (United States)

    Lin, Min; Wen, Ying-Fang; Wu, Jiao-Ren; Wang, Qian; Zheng, Lei; Liu, Gui-Rong; Huang, Yue; Yang, Hui; Lin, Fen; Zhan, Xiao-Fen; Lin, Chun-Ping; Yang, Hui-Tian; Weng, Qiu-Qing; Huang, Fen-Ting; Wang, Yuan; Yao, Mei-Qiong; Chen, Hui-Zhou; Wu, Di-Hong; Zeng, Jing-Bo; Zeng, Ri-Xin; Yang, Hua; Li, Gui-Cai; Lu, Min; Zhu, Juan-Juan; Xie, Long-Xu; Wang, Jun-Li; Yang, Li-Ye

    2013-01-01

    Background Hemoglobinopathies are the most common inherited diseases in southern China. However, there have been only a few epidemiological studies of hemoglobinopathies in Guangdong province. Materials and Methods Peripheral blood samples were collected from 15299 “healthy” unrelated subjects of dominantly ethnic Hakka in the Meizhou region, on which hemoglobin electrophoresis and routine blood tests were performed. Suspected cases with hemoglobin variants and hereditary persistence of fetal hemoglobin (HPFH) were further characterized by PCR, DNA sequencing, reverse dot blot (RDB) or multiplex ligation-dependent probe amplification (MLPA). In addition, 1743 samples were randomly selected from the 15299 subjects for thalassemia screening, and suspected thalassemia carriers were identified by PCR and RDB. Results The gene frequency of hemoglobin variants was 0.477% (73/15299). The five main subgroups of the ten hemoglobin variants were Hb E, Hb G-Chinese, Hb Q-Tahiland, Hb New York and Hb J-Bangkok. 277 cases (15.89%, 277/1743) of suspected thalassemia carriers with microcytosis (MCVthalassemia screening, and were tested by a RDB gene chip to reveal a total of 196 mutant chromosomes: including 124 α-thalassemia mutant chromosomes and 72 β-thalassemia mutant chromosomes. These results give a heterozygote frequency of 11.24% for common α and β thalassemia in the Hakka population in the Meizhou region. 3 cases of HPFH/δβ-thalassemia were found, including 2 cases of Vietnamese HPFH (FPFH-7) and a rare Belgian Gγ(Aγδβ)0–thalassemia identified in Chinese. Conclusions Our results provide a detailed prevalence and molecular characterization of hemoglobinopathies in Hakka people of the Meizhou region. The estimated numbers of pregnancies each year in the Meizhou region, in which the fetus would be at risk for β thalassemia major or intermedia, Bart’s hydrops fetalis, and Hb H disease, are 25 (95% CI, 15 to 38), 40 (95% CI, 26 to 57), and 15 (95% CI, 8 to

  13. Evaluation of the URIT-2900 automated hematology analyzer for screening of thalassemia and hemoglobinopathies in Southeast Asian populations.

    Science.gov (United States)

    Karnpean, Rossarin; Pansuwan, Anupong; Fucharoen, Goonnapa; Fucharoen, Supan

    2011-07-01

    The effectiveness of the URIT-2900 Hematology Analyzer for screening of hemoglobinopathies commonly found in Southeast Asian populations was examined. Appropriate cut-off values of MCV and MCH for screening of α(0) and β thalassemias were derived from the receiver operator characteristic curve conducted initially on 279 subjects with various thalassemia genotypes. Validation was performed additionally in a cohort of another unrelated 313 subjects. The best cut off values of MCV and MCH were found to be 78fL and 27pg, respectively. Using these cut off values in combination with the dichlorophenolindophenol test in screening of α(0) thalassemia, β thalassemia and Hb E in a cohort study revealed 100% sensitivity, 79.6% specificity, 80.0% positive predictive value and 100% negative predictive value. The combined blood cell counting using the URIT-2900 Automated Hematology Analyzer and dichlorophenolindophenol test is suitable for population screening of thalassemia and hemoglobinopathies in Southeast Asia. Copyright © 2011 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  14. Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

    Science.gov (United States)

    Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

    2015-01-01

    Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

  15. The Evaluation of Results of the Premarital Screening of Hemoglobinopathies Trait in Kahramanmaras

    Directory of Open Access Journals (Sweden)

    Ekrem Guler

    2008-06-01

    Full Text Available BACKGROUND: This study was performed in order to determine hemoglobipathy trait in Kahramanmaras. METHOD: In this study premarital screening of hemoglobinopathies was performed in 11040 subjects between March 2006 and February 2007 who were planning to get married. RESULTS: Thalassemia trait was detected in 261 subjects; hence the rate was determined to be 2.35 %. Sickle cell anemia trait was detected in 59 subjects; hence the rate was determined to be 0.54%. CONCLUSION: These rates are similar to the overall rates of Turkey. [TAF Prev Med Bull 2008; 7(3.000: 243-244

  16. The attitudes and intention to participate in hemoglobinopathy carrier screening in the Netherlands among individuals from turkish, moroccan, and surinamese descent

    NARCIS (Netherlands)

    Pal, S.M. van der; Kesteren, N.M.C. van; Wouwe, J.P. van; Dommelen, P. van; Detmar, S.B.

    2013-01-01

    Objective. To explore factors that influence intention to participate in hemoglobinopathy (HbP) carrier screening under Dutch subjects at risk, since HbP became more common in The Netherlands. Method. Structured interviews with 301 subjects from Turkish, Moroccan, or Surinamese ethnicity. Results.

  17. Pluripotent Stem Cells in Research and Treatment of Hemoglobinopathies

    Science.gov (United States)

    Arora, Natasha; Daley, George Q.

    2012-01-01

    Pluripotent stem cells (PSCs) hold great promise for research and treatment of hemoglobinopathies. In principle, patient-specific induced pluripotent stem cells could be derived from a blood sample, genetically corrected to repair the disease-causing mutation, differentiated into hematopoietic stem cells (HSCs), and returned to the patient to provide a cure through autologous gene and cell therapy. However, there are many challenges at each step of this complex treatment paradigm. Gene repair is currently inefficient in stem cells, but use of zinc finger nucleases and transcription activator-like effector nucleases appear to be a major advance. To date, no successful protocol exists for differentiating PSCs into definitive HSCs. PSCs can be directly differentiated into primitive red blood cells, but not yet in sufficient numbers to enable treating patients, and the cost of clinical scale differentiation is prohibitively expensive with current differentiation methods and efficiencies. Here we review the progress, promise, and remaining hurdles in realizing the potential of PSCs for cell therapy. PMID:22474618

  18. Epidemiology of hemoglobinopathies and thalassemias in individuals referred to the haematology research centre, Shiraz University of Medical Sciences, Shiraz, Iran from 2006 to 2011.

    Science.gov (United States)

    Haghpanah, Sezaneh; Ramzi, Mani; Zakerinia, Maryam; Nourani Khojasteh, Habib; Haghshenas, Mansour; Rezaei, Narges; Moayed, Vida; Rezaei, Alireza; Karimi, Mehran

    2014-01-01

    Hemoglobinopathies and thalassemias are the most frequent genetic hereditary disorders with an increasing global health burden, especially in low- and middle-income countries. We aimed to determine the epidemiologic pattern of hemoglobinopathies and thalassemias in individuals referred to the Haematology Research Centre, Shiraz University of Medical Sciences, Shiraz, Iran, which is the most important referral center in Southern Iran during 2006 to 2011. The most frequent abnormality was β-thalassemia (β-thal) minor (24.0%), followed by α-thalassemia (α-thal) trait (10.0%), hemoglobin (Hb) S trait (4.0%) and Hb D-Punjab trait (4.0%). Because this center is a referral center, we detected a higher prevalence compared to the normal population; however, these data could help policymakers and health service providers to better programming for prevention of births affected with Hb disorders.

  19. Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies

    Science.gov (United States)

    Loucari, Constantinos C.; Patsali, Petros; van Dijk, Thamar B.; Stephanou, Coralea; Papasavva, Panayiota; Zanti, Maria; Kurita, Ryo; Nakamura, Yukio; Christou, Soteroulla; Sitarou, Maria; Philipsen, Sjaak; Lederer, Carsten W.; Kleanthous, Marina

    2018-01-01

    The β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of induced or exogenous β-like globins. Reversed-phase high-performance liquid chromatography (HPLC) allows versatile and inexpensive globin quantification, but commonly applied protocols suffer from long run times, high sample requirements, or inability to separate murine from human β-globin chains. The latter point is problematic for in vivo studies with gene-addition vectors in murine disease models and mouse/human chimeras. This study demonstrates HPLC-based measurements of globin expression (1) after differentiation of the commonly applied human umbilical cord blood–derived erythroid progenitor-2 cell line, (2) in erythroid progeny of CD34+ cells for the analysis of clustered regularly interspaced short palindromic repeats/Cas9-mediated disruption of the globin regulator BCL11A, and (3) of transgenic mice holding the human β-globin locus. At run times of 8 min for separation of murine and human β-globin chains as well as of human γ-globin chains, and with routine measurement of globin-chain ratios for 12 nL of blood (tested for down to 0.75 nL) or of 300,000 in vitro differentiated cells, the methods presented here and any variant-specific adaptations thereof will greatly facilitate evaluation of novel therapy applications for β-hemoglobinopathies. PMID:29325430

  20. A Nonhuman Primate Transplantation Model to Evaluate Hematopoietic Stem Cell Gene Editing Strategies for β-Hemoglobinopathies

    Directory of Open Access Journals (Sweden)

    Olivier Humbert

    2018-03-01

    Full Text Available Reactivation of fetal hemoglobin (HbF is a promising approach for the treatment of β-hemoglobinopathies and the targeting of genes involved in HbF regulation is under intensive investigation. Here, we established a nonhuman primate (NHP transplantation model to evaluate hematopoietic stem cell (HSC-based gene editing strategies aimed at reactivating HbF. We first characterized the transient HbF induction to autologous HSC transplantation in pigtailed macaques, which was comparable in duration and amplitude to that of human patients. After validating function of the HbF repressor BCL11A in NHPs, we transplanted a pigtailed macaque with CD34+ cells electroporated with TALE nuclease mRNA targeting the BCL11A coding sequence. In vivo gene editing levels were low, but some BCL11A deletions were detected as late as 200 days post-transplantation. HbF production, as determined by F-cell staining and γ-globin expression, was slightly increased in this animal as compared to transplant controls. We also provided proof-of-concept results for the selection of edited NHP CD34+ cells in culture following integration of the P140K/MGMT cassette at the BCL11A locus. In summary, the NHP model described here will allow the testing of novel therapeutic approaches for hemoglobinopathies and should facilitate clinical translation.

  1. Frequency of β-thalassemia trait and other hemoglobinopathies in northern and western India

    Science.gov (United States)

    Madan, Nishi; Sharma, Satendra; Sood, S. K.; Colah, Roshan; Bhatia, (Late) H. M.

    2010-01-01

    INTRODUCTION: India is an ethnically diverse country with an approximate population of 1.2 billion. The frequency of beta-thalassemia trait (βTT) has variously been reported from hemoglobinopathies in different regions and population groups in the country. A high frequency of Hb D has been reported from the North in the Punjabi population, Hb E in the eastern region of India and Hb S is mainly reported from populations of tribal origin from different parts of the country. OBJECTIVES: To study the gene frequency of βTT and other hemoglobinopathies in three regions East (Kolkata), West (Mumbai) and North (Delhi) in larghe population group (schoolchildren) for a more accurate assessment of gene frequency for planning of control programmes for haemoglobinopathies. MATERIALS AND METHODS: This study included 5408 children from 11 schools in Delhi, 5682 from 75 schools in Mumbai and 957 schoolchildren from Kolkata who were screened for βTT and haemoglobinopathies. These included 5684 children from 75 schools in Mumbai and 5408 children from 11 schools in Delhi. Children were 11-18 years of age of both sexes. The final report is, however, only on 11090 schoolchildren from Mumbai and Delhi as data from Kolkata was restricted both in numbers and objectives and could not be included for comparison. RESULTS: The overall gene frequency of βTT in Mumbai and Delhi was 4.05% being 2.68% and 5.47% in children of the two cities respectively. In Mumbai, the gene frequency was evenly distributed. Majority of the children with βTT from Mumbai were from Marathi (38.9%) and Gujarati (25%) speaking groups. Gene frequency was >5% in Bhatias, Khatris, Lohanas and Schedule Castes. In Delhi, a higher incidence was observed in schoolchildren of North and West Delhi (5.8-9.2%). The schoolchildren of North and West Delhi comprised predominantly of Punjabi origin compared to children in the South of the city (2.2%, 2.3%). When analyzed state-wise, the highest incidence was observed in

  2. INFECTIONS IN THALASSEMIA AND HEMOGLOBINOPATHIES

    Directory of Open Access Journals (Sweden)

    Deborah Rund

    2009-06-01

    Full Text Available

     

    The clinical approach to thalassemia and hemoglobinopathies, specifically Sickle Cell Disease (SCD, based on transfusions, iron chelation and bone marrow transplantation has ameliorated their prognosis. Nevertheless, infections still may cause serious complications in these patients. The susceptibility to infections in thalassemia and SCD arises both from a large spectrum of immunological abnormalities and from exposure to specific infectious agents. Four fundamental issues will be focused upon as central causes of immune dysfunction: the diseases themselves; iron overload, transfusion therapy and the role of the spleen. Thalassemia and SCD differ in their pathogenesis and clinical course. It will be outlined how these differences affect immune dysfunction, the risk of infections and the types of most frequent infections in each disease. Moreover, since transfusions are a fundamental tool for treating these patients, their safety is paramount in reducing the risks of infections. In recent years, careful surveillance worldwide and improvements in laboratory tests reduced greatly transfusion transmitted infections, but the problem is not completely resolved. Finally, selected topics will be discussed regarding Parvovirus B19 and transfusion transmitted infections as well as the prevention of infectious risk postsplenectomy or in presence of functional asplenia.

  3. Long-term follow-up of kidney allografts in patients with sickle cell hemoglobinopathy Transplante renal na anemia falciforme

    Directory of Open Access Journals (Sweden)

    João R. Friedrisch

    2003-06-01

    Full Text Available Although sickle cell anemia and sickle cell disease produce a variety of functional renal abnormalities they uncommonly cause end stage renal failure. Renal transplantation has been a successful alternative for the treatment of the rare terminal chronic renal failure with outcomes comparable with non-sickle recipients. This approach, however, has not been often described on patients with renal failure associated with SC hemoglobinopathy. Here we report the outcomes of two patients with chronic renal failure due to SC hemoglobinopathies who underwent renal transplantation. At the time of the transplantation they were both severely anemic and had frequent vasoocclosive pain crises. Both patients evolved with good allograft function, near normal hematological parameters, and very rare pain crisis, thirteen and eight years after transplant. These cases illustrate that terminal renal failure due to SC hemoglobinopathy can be successfully managed by renal transplantation and satisfactory long-term results are achievable not only in terms of renal allograft function but also of their hematological condition.Embora a anemia falciforme e as síndromes falciformes freqüentemente causem várias alterações funcionais renais, não é comum a insuficiência renal terminal. Nestes casos, o transplante renal é uma alternativa que se acompanha de resultados comparáveis aos obtidos em receptores sem hemoglobinopatias. Esta estratégia terapêutica tem sido, no entanto, pouco relatada para portadores de hemoglobinopatia SC. Este relato descreve a evolução de dois pacientes portadores de hemoglobinopatia SC que foram submetidos ao transplante renal. No momento do transplante ambos apresentavam severa anemia e crises dolorosas freqüentes. Os pacientes evoluíram com boa função do enxerto, parâmetros hematológicos quase normais e praticamente assintomáticos do ponto de vista da hemoglobinopatia, treze e oito anos após o transplante. Estes casos ilustram

  4. Screening and genetic diagnosis of Hemoglobinopathies in Southern and Northern Europe: Two examples

    Directory of Open Access Journals (Sweden)

    Antonio Amato

    2009-08-01

    Full Text Available Prevention of Hemoglobinopathies has developed around the world based upon the experience done in pioneering endemic countries and is now facing a new phase in non-endemic areas with a recent immigration history. We describe two situations, taking Latium (central Italy and The Netherlands as two models for endemic and non-endemic countries both confronted with a large multi-ethnic immigrant society. We present prevention results and discuss aspects such as local knowledge and organization. We illustrate the importance of issues like information, carrier diagnostics, screening, counseling and prenatal diagnosis in particular situation of contrasting interest an different ethical opinions. We conclude by underlining the importance of implementing primary prevention at the European level, based upon better information, diagnostics and counseling.

  5. Osteomyelitis and infarction in sickle cell hemoglobinopathies: differentiation by combined technetium and gallium scintigraphy

    International Nuclear Information System (INIS)

    Amundsen, T.R.; Siegel, M.J.; Siegel, B.A.

    1984-01-01

    Clinical records and scintigrams were reviewed of 18 patients with sickle cell hemoglobinophaties who had undergone combined technetium and gallium scintigraphy during 22 separate episodes of suspected osseous infection. The combined scintigrams were correctly interpreted as indicating osteomyelitis in four studies. Of 18 studies in patients with infarction, the combined scintigrams were correctly interpreted in 16 and showed either no local accumulation of Ga-67 or less accumulation than that of Tc-99m MDP at symptomatic sites. In the other two studies, the scintigrams were falsely interpreted as indicating osteomyelitis and showed congruent, increased accumulation of both Tc-99, MDP and Ga-67. This pattern must be considered indeterminate. Overall, the results indicate that the combination of technetium and gallium scintigraphy is an effective means to distinguish osteomyelitis from infarction in patients with sickle cell hemoglobinopathies

  6. Molecular Diagnosis of Thalassemias and Hemoglobinopathies: An ACLPS Critical Review.

    Science.gov (United States)

    Sabath, Daniel E

    2017-07-01

    To describe the use of molecular diagnostic techniques for patients with hemoglobin disorders. A clinical scenario is presented in which molecular diagnosis is important for genetic counseling. Globin disorders, techniques for their diagnosis, and the role of molecular genetic testing in managing patients with these disorders are described in detail. Hemoglobin disorders, including thalassemias and hemoglobinopathies, are among the commonest genetic diseases, and the clinical laboratory is essential for the diagnosis of patients with these abnormalities. Most disorders can be diagnosed with protein-based techniques such as electrophoresis and chromatography. Since severe syndromes can result due to inheritance of combinations of globin genetic disorders, genetic counseling is important to prevent adverse outcomes. Protein-based methods cannot always detect potentially serious thalassemia disorders; in particular, α-thalassemia may be masked in the presence of β-thalassemia. Deletional forms of β-thalassemia are also sometimes difficult to diagnose definitively with standard methods. Molecular genetic testing serves an important role in identifying individuals carrying thalassemia traits that can cause adverse outcomes in offspring. Furthermore, prenatal genetic testing can identify fetuses with severe globin phenotypes. © American Society for Clinical Pathology, 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  7. Heterozigose para hemoglobinopatias em doadores de sangue do Centro de Hemoterapia de Sergipe Heterozigosity to hemoglobinopathies in blood donors from the Hemotherapy Center in Sergipe, NE-Brazil

    Directory of Open Access Journals (Sweden)

    Wanessa L. P. Vivas

    2006-12-01

    Full Text Available As hemoglobinopatias, distúrbios geneticamente determinados da hemoglobina (Hb humana, estão presentes com freqüência elevada em várias partes do mundo, sendo que no Brasil as Hb anormais S e C são as mais prevalentes. Com o objetivo de identificar a presença de portadores saudáveis de genes para hemoglobinopatias entre doadores de sangue do Centro de Hemoterapia do Estado de Sergipe (Hemose, foram analisadas 1.345 amostras de doadores de sangue. Em todas as amostras foram realizados eritrograma automatizado e eletroforese de hemoglobina em acetato de celulose utilizando-se tampão Tris-EDTA-Borato pH 8,6. As amostras que apresentaram hemoglobinas anormais foram submetidas a teste de falcização, teste de solubilidade e Cromatografia Líquida de Alta Performance (HPLC. Foram identificadas 76 amostras com hemoglobinas anormais (5,6%, das quais 55 (4,1% com traço falciforme (Hb AS, 19 (1,4% com Hb AC, uma com Hb AD e outra sugestiva de beta-talassemia. Os resultados encontrados demonstram a necessidade de implantação da triagem para hemoglobinopatias entre doadores de sangue, pois desta maneira o receptor de sangue é beneficiado com produto de melhor qualidade, e o doador com a identificação de uma alteração genética que pode vir a se manifestar em seus descendentes.Hemoglobinopathies are genetically determined disorders that present in significant high frequencies in certain parts of the world. Despite of the existence of hundreds of known hereditary hemoglobinopathies, Brazilian studies have demonstrated that abnormal hemoglobins S and C are the most prevalent. With the objective of identifying the profile of hemoglobinopathies of blood donors at the Hemotherapy Center in the State of Sergipe (Hemose, 1345 samples of blood were analyzed. Initially automatic blood testing and electrophoreses in cellulose acetate using a Tris-EDTA-Borate buffer at pH 8.6 were carried out for all samples. Samples that presented with abnormal

  8. Population Screening and Prevention Strategies for Thalassemias and other Hemoglobinopathies of Eastern India: Experience of 18,166 cases.

    Science.gov (United States)

    Chatterjee, Tridip; Chakravarty, Amit; Chakravarty, Sudipa

    2015-01-01

    We evaluated population screening programs (1999-2011), conducted by the Thalassaemia Foundation, Kolkata, India, for the first time in Eastern India in different districts of West Bengal, for prevention of thalassemia comprising screening of heterozygotes and β-thalassemia intermedia (β-TI) cases [β(+), β(++), β(0)/β(+), β(E)/β(E) (codon 26 or HBB: c.79G > A), Hb-E-β-thalassemia (Hb E-β-thal)]. Among 18,166 cases, we found 2092 heterozygotes and 2245 β-TI individuals (who had no information about their disorders). Results were evaluated with standard hematological analyses including erythrocyte indices, hemoglobin (Hb) typing and quantification. Participants were divided into five groups (children, pre-marriage cases, pre-pregnancy cases, affected family members, pregnant women). The objectives of this evaluation were to fix cut-off values of red blood cells (RBCs), mean corpuscular volume (MCV), mean corpuscular Hb (MCH), red blood cell distribution width (RDW) and Hb A2, as the standard World Health Organization (WHO) guidelines were not strictly followed in mass-scale screening programs. We have observed many dilemmas in considering the status of the thalassemia subject, due to presence of some other clinical conditions such as iron deficiency anemia, α-thalassemia (α-thal), δ-thalassemia (δ-thal), clinically silent Hb variants, and some cases of non hemoglobinopathies (such as pregnancy) along with thalassemia. The MCV values varied greatly in different conditions of hemoglobinopathies, whereas MCH provided a more stable measurement. We found an MCH value of <27.0 pg is a suitable cut-off point for screening in this population. Participants with an MCH of <27.0 pg should be investigated further to confirm or exclude a diagnosis of β-thal trait.

  9. Thalassemia and hemoglobinopathies in Southeast Asian newborns: diagnostic assessment using capillary electrophoresis system.

    Science.gov (United States)

    Srivorakun, Hataichanok; Fucharoen, Goonnapa; Changtrakul, Yossombat; Komwilaisak, Patcharee; Fucharoen, Supan

    2011-04-01

    We have investigated the Capillarys 2 Hemoglobin testing system to assist in presumptive diagnosis of thalassemia and hemoglobinopathies commonly found in Southeast Asia. Study was conducted on 226 newborns. Hematological parameters were recorded and Hb profiles were examined on the Capillarys 2 Hemoglobin analyzer (SEBIA). DNA analyses were used to establish the final diagnoses. Among 226 newborns examined, 122 had thalassemias with 17 different genotypes. The capillary electrophoresis system could provide useful data for presumptive diagnoses of cases, especially those with Hb E and α-thalassemia. Hb E was found to be 2.6-6.2% in heterozygote whereas Hb Bart's were clearly observed in cases with compound heterozygous or homozygous α(+)-thalassemia and heterozygous α(0)-thalassemia. Hb H disease and other forms of α-thalassemia could be differentiated based on the presence of Hb Bart's and its percentage. The capillary electrophoresis system is applicable to newborn screening for common forms of thalassemia in Southeast Asia. Copyright © 2011 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  10. Laboratory investigation of hemoglobinopathies and thalassemias: review and update.

    Science.gov (United States)

    Clarke, G M; Higgins, T N

    2000-08-01

    Structural hemoglobin (Hb) variants typically are based on a point mutation in a globin gene that produce a single amino acid substitution in a globin chain. Although most are of limited clinical significance, a few important subtypes have been identified with some frequency. Homozygous Hb C and Hb S (sickle cell disease) produce significant clinical manifestations, whereas Hb E and Hb D homozygotes may be mildly symptomatic. Although heterozygotes for these variants are typically asymptomatic, diagnosis may be important for genetic counseling. Thalassemia, in contrast, results from quantitative reductions in globin chain synthesis. Those with diminished beta-globin chains are termed beta-thalassemias, whereas those with decreased alpha-chain production are called alpha-thalassemias. Severity of clinical manifestations in these disorders relates to the amount of globin chain produced and the stability of residual chains present in excess. The thalassemia minor syndromes are characterized clinically by mild anemia with persistent microcytosis. Thalassemia intermedia (i.e., Hb H disease) is typified by a moderate, variably compensated hemolytic anemia that may present with clinical symptoms during a period of physiologic stress such as infection, pregnancy, or surgery. The thalassemia major syndromes produce severe, life-threatening anemia. alpha-Thalassemia major usually is incompatible with extrauterine life; beta-thalassemia major presents in infancy and requires life-long transfusion therapy and/or bone marrow transplantation for successful control of the disease. Double heterozygosity for certain structural variants and/or thalassemia syndromes may also lead to severe clinical disease. Several guidelines have been published that outline the required steps for hemoglobinopathy and thalassemia investigation. The availability of HPLC has streamlined many of these requirements, allowing an efficient stepwise diagnostic strategy for these complex disorders.

  11. Hepatitis C virus genotypes among multiply transfused hemoglobinopathy patients from Northern Iraq

    Directory of Open Access Journals (Sweden)

    Adil A Othman

    2014-01-01

    Full Text Available Background and Aim: Owing to the scarcity of data on hepatitis C virus (HCV genotypes in Iraq and due to their epidemiological as well as therapy implications, this study was initiated aiming at determining these genotypes in Northern Iraq. Materials and Methods: A total of 70 HCV antibody positive multi transfused patients with hemoglobinopathies, who had detectable HCV ribonucleic acid, were recruited for genotyping using genotype-specific nested polymerase chain reaction. Results: The most frequent genotype detected was genotype 4 (52.9% followed by 3a (17.1%, 1b (12.9% and 1a (1.4%, while mixed genotypes (4 with either 3a or 1b were detected in 7.1%. Conclusion: The predominance of genotype 4 is similar to other studies from surrounding Eastern Mediterranean Arab countries and to the only earlier study from central Iraq, however the significant high proportion of 3a and scarcity of 1a, are in contrast to the latter study and may be explainable by the differing population interactions in this part of Iraq. This study complements previous studies from Eastern Mediterranean region and demonstrates relative heterogeneity of HCV genotype distribution within Iraq and should trigger further studies in other parts of the country.

  12. Reticulocyte parameters in hemoglobinopathies and iron deficiency anemia

    Directory of Open Access Journals (Sweden)

    Cortellazzi Laura C.

    2003-01-01

    Full Text Available Flow cytometric reticulocyte analysis allows the evaluation of reticulocyte maturity. New reticulocyte parameters have been used in the diagnosis and management of anemias, in the bone marrow transplant setting and in the monitoring of iron replacement or erythropoiet in therapy. Reticulocyte numbers and maturation levels have been studied in different hemoglobinopathies and the results have been correlated with the degree of ineffective erythropoiesis. In order to verify differences in reticulocyte parameters in various types of anemias and to test the absolute number of immature reticulocytes as a possible discriminating factor among various types of anemias, reticulocyte counts were performed on 219 samples from patients with sickle cell anemia (SS (n= 62, hemoglobin S trait (n=9, Sbeta thalassemia (n=7, hemoglobin SC disease (n=11, beta thalassemia trait (n=33 and iron deficiency anemia (n= 47, and non-anemic individuals (n= 50. Mean fluorescence index (MFI was defined as representative of the degree of reticulocyte immaturity and it was evaluated as a percentage and in absolute values. Reticulocyte counts and MFI values were significantly higher in SS, Sbeta thalassemic and SC groups when compared to controls, but not different among the three anemia groups. Patients with hemoglobin S trait, iron deficiency anemia and beta thalassemia trait showed reticulocyte parameters similar to the non-anemic group. There was no difference between the b thalassemic trait and iron deficiency anemia in relation to any parameters. MFI in absolute numbers were significantly higher in anemias that develop with the hemolytic process, although this was not evident in MFI percentage values. Our results showed that the erythoid expansion in sickle cell diseases (SS, SC and Sb thalassemia leads to an enhanced immature reticulocyte release from bone marrow and that the phenomena is more evident by the MFI counting in absolute figures than in percentages. We

  13. Allogeneic Stem Cell Transplantation in Congenital Hemoglobinopathies Using a Tailored Busulfan-Based Conditioning Regimen: Single-Center Experience.

    Science.gov (United States)

    Zaidman, Irina; Rowe, Jacob M; Khalil, Abdalla; Ben-Arush, Myriam; Elhasid, Ronit

    2016-06-01

    Hematopoietic stem cell transplantation (HSCT) is the only proven curative option for patients with hemoglobinopathies, both thalassemia and sickle cell anemia (SCA). A busulfan-based myeloablative conditioning regimen is the standard of care for HSCT in these patients, although increased treatment-related morbidity, including veno-occlusive disease (VOD), has been demonstrated. Thirty-eight pediatric patients, median age 8 years (range, 6 months to 22 years), suffering from hemoglobinopathy were treated at Rambam Medical Center in Haifa, Israel, between 1998 and 2011. Thirty-four patients had thalassemia major and 4 had SCA. The 38 patients underwent 40 HSCTs, 34 of which were first transplants and 6 second transplants. Most transplants (32/40) were from matched sibling donors. Sources of stem cells were peripheral blood in 30 transplants, bone marrow in 7 transplants, and cord blood in 3 transplants. All received different customized busulfan-based conditioning regimens tailored by pharmacokinetic analysis of busulfan levels. Primary engraftment occurred in 37 of 40 transplants. Neutrophil engraftment (>.5 × 10(9)/L) occurred at a median of 15.3 days post-transplantation (range, 10 to 45). Platelet transfusion independence (>20 × 10(9)/L) occurred at a median of 22.3 days (range, 11 to 60). The rate of 5-year overall survival for thalassemia patients after first transplantation was 90.5% ± 5.3%. The rate of 5-year thalassemia-free survival was 81.7% ± 6.8%. Cumulative incidence of acute graft-versus-host disease (GVHD) was 17.6%. Rate of grades III to IV GVHD was 8.8%. Cumulative incidence of chronic GVHD was 23.5%, with 11.8% incidence of extensive chronic GVHD. One patient developed VOD. Full donor chimerism occurred in 36.4% of patients with class 1 + 2 thalassemia, compared with 78.6% in class 3 thalassemia (P = .049). Overall survival above 90% in patients undergoing their first transplant was demonstrated using busulfan

  14. Detection of complex hemoglobinopathies: recommendations on screening and DNA testing

    Directory of Open Access Journals (Sweden)

    E. Baysal

    2011-12-01

    Full Text Available The following recommendations should be taken into account during the evaluation and elucidation of the complex hemoglobinopathies: a in complex hemoglobinopathies performing DNA studies on all family members might be essential; b complex gene-gene interactions offer major diagnostic challenges both at the technical and clinical level; c hematological & DNA analyses must be run in parallel. Some cases may be straight forward but others may require indepth DNA work-up; d co-inheritance of a-thalassemia offers added challenge as it may affect phenotype significantly; e sickle cell anemia (SS, co-inherited with a-thal, can be a phenocopy of Sβ0-thal. The HbA2 increase can be mistaken for Sβ-thal. DNA Sequencing is imperative; f only a selected number of normal MCV, MCH, borderline HbA2 cases must be referred for DNA analysis. However, in certain cases, following hematological and family evaluation, the β and d genes may need to be sequenced; g DNA Sequencing will increasingly become the method of choice for screening and DNA mutation analysis. However, new methods like MLPA-which analyzes gene dosage- must be used more commonly to rule out deletion mutants to avoid false negative sequencing results; h these recommendations should be reviewed every 2-3 years reflecting new methods, new findings and new findings from ethnic groups. 诊断和说明复杂血红蛋白病时,建议考虑以下几点: a)针对复杂的血红蛋白病,有必要对所有家庭成员开展DNA研究;b 复杂的基因-基因交互作用可能使诊断在技术和临床层面上颇受挑战;c 血液和DNA分析须同时进行。 有些病例简单,但另外一些病例可能需要开展深层次的DNA检查;d 由于α型地中海贫血可能严重影响表型,α型地中海贫血的共同继承特征更具挑战;e 共同继承α型地中海贫血的镰状细胞贫血(SS),可以作为Sβ0型地中海贫血的显型。 HbA2

  15. Genética das doenças hematológicas: as hemoglobinopatias hereditárias The genetics of blood disorders: hereditary hemoglobinopathies

    Directory of Open Access Journals (Sweden)

    Maria de Fátima Sonati

    2008-08-01

    Full Text Available OBJETIVO: Sumarizar os dados disponíveis na literatura recente sobre os aspectos fisiopatológicos, de diagnóstico e tratamento das doenças falciformes e da talassemia β, hemoglobinopatias hereditárias de maior relevância nas populações. FONTES DOS DADOS: MEDLINE e SciELO, utilizando os termos hemoglobinopatias hereditárias, doenças falciformes e talassemia beta, no período de 2003 a maio de 2008. Dois livros e dois capítulos de livro foram também incluídos. SÍNTESE DOS DADOS: Foram encontrados mais de 2.000 artigos, sendo selecionados aqueles de maior pertinência e amplitude. CONCLUSÕES: As taxas de morbidade e a mortalidade das doenças falciformes e da talassemia β são ainda bastante expressivas e constituem importante desafio. Um maior conhecimento dos mecanismos fisiopatológicos tem permitido avanços significativos nas formas de tratamento e prevenção dessas doenças.OBJECTIVE: To summarize recently published data on the pathophysiology, diagnosis and treatment of sickle cell diseases and β-Thalassemias, the most relevant hereditary hemoglobinopathies in the global population. SOURCES: Searches were run on the MEDLINE and SCIELO databases, limited to the period from 2003 to May 2008, using the terms hereditary hemoglobinopathies, sickle cell diseases and β-thalassemia. Two books and two chapters were also included. SUMMARY OF THE FINDINGS: More than 2,000 articles were identified; those providing the most important information and broadest views were selected. CONCLUSIONS: Morbidity and mortality rates from sickle cell diseases and β-thalassemia are still very high and represent an important challenge. Increased understanding of pathophysiological aspects has lead to significant improvements in treatment and prevention of these diseases.

  16. A brief review on newborn screening methods for hemoglobinopathies and preliminary results selecting beta thalassemia carriers at birth by quantitative estimation of the HbA fraction.

    Science.gov (United States)

    Mantikou, Eleni; Arkesteijn, Sandra G; Beckhoven van, Jaqueline M; Kerkhoffs, Jean-Louis; Harteveld, Cornelis L; Giordano, Piero Carlo

    2009-12-01

    We present in a brief summary the basic aspects of the most rational technologies used for new born screening (NBS) of the hemoglobinopathies and we report the preliminary results for the identification of beta-thalassemia carriers at birth by measuring the expression of the HbA fraction. Separation and measurement of the Hb fractions in 1.500 cord blood samples collected among the multi-ethnic Dutch population using different methods. By using a cut of thalassemia can be preselected at birth with a reasonable degree of sensitivity and be confirmed by parent analysis.

  17. Proxy indicators for identifying iron deficiency among anemic vegetarians in an area prevalent for thalassemia and hemoglobinopathies.

    Science.gov (United States)

    Wongprachum, Kasama; Sanchaisuriya, Kanokwan; Sanchaisuriya, Pattara; Siridamrongvattana, Sirivara; Manpeun, Suwanna; Schlep, Frank P

    2012-01-01

    The study aimed to determine the proportion of iron deficiency (ID) anemia (IDA) among vegans in northeast Thailand and to explore whether mathematical formulas derived from red blood cell (RBC) indices are applicable for IDA screening in the study population. Blood samples from 234 individuals (age 6-45 years) living in a vegan community were taken. Complete blood cell count, serum ferritin, hemoglobin profiles and DNA analysis for α-thalassemia were determined. Anemia was defined using the WHO criteria adjusted for age and sex. Serum ferritin thalassemia and hemoglobinopathies was 56.4% (95% CI = 49.8-62.9%). Of the anemic participants, 45.4% had ID. Based on the receiver-operating characteristic curve analysis, 4 formulas were applicable for predicting ID among anemic individuals (highest sensitivity of 86.4%). The proposed formulas might be used as proxy indicators for the identification of ID among anemic children and adult vegans if more sophisticated laboratory determinations are not available due to limited financial resources. Copyright © 2012 S. Karger AG, Basel.

  18. Consenso brasileiro em transplante de células-tronco hematopoéticas: comitê de hemoglobinopatias Brazilian consensus meeting on stem cell transplantation: hemoglobinopathies comittee

    Directory of Open Access Journals (Sweden)

    Belinda P. Simões

    2010-05-01

    Full Text Available Os distúrbios hereditários das hemoglobinas são as doenças genéticas mais frequentes do homem e mais difundidas no mundo, abrangendo sobretudo continentes como África, Américas, Europa e extensas regiões da Ásia. Estima-se que haja 270 milhões de portadores de hemoglobinopatias no mundo, dos quais 80 milhões são portadores de talassemia. Aproximadamente 60 mil crianças nascem anualmente no mundo com talassemia e 250 mil com anemia falciforme, dando uma frequência de 2,4 crianças afetadas para cada 1.000 nascimentos. No Brasil, a doenca falciforme é a doença hereditária monogênica mais comum, estimando-se que haja entre 20 a 30 mil pacientes portadores desta doenca. O transplante de células-tronco hematopoéticas alogênico (TCTH alo é atualmente a única modalidade terapêutica capaz de curar pacientes com hemoglobinopatias. Neste artigo discutiremos os dados disponíveis na literatura e sugerimos os critérios para a indicação do TCTH nas hemoglobinopatias.Hemoglobinopathies are the most prevalent genetic diseases in man. Most cases are described in Europe, Africa and in the Americas. About 270 million hemoglobinopathy carriers are alive today with 80 million being carriers of thalassemia. We estimate that, throughout the world, about 60,000 children are born annually with thalassemia and 250,000 with sickle cell disease with an estimated frequency of 2.4 children in every 1000 births. Sickle cell disease is the most common monogenic hereditary disease in Brazil with a total of from 20,000 to 30,000 patients. Allogeneic stem cell transplantation is the only curative approach. Here we describe published data and propose criteria to indicate stem cell transplantation in thalassemia and sickle cell disease patients.

  19. Diagnosis of common hemoglobinopathies among South East Asian population using capillary isoelectric focusing system.

    Science.gov (United States)

    Srivorakun, H; Fucharoen, G; Sanchaisuriya, K; Fucharoen, S

    2017-02-01

    We have evaluated an automated capillary isoelectric focusing (cIEF)-based Hb analyzer in diagnosis of hemoglobinopathies commonly found among South East Asian population. Study was performed on a cohort of 665 adult Thai subjects and 13 fetal blood specimens obtained at routine thalassemia diagnostic laboratory. Hb analysis was performed using the cIEF system. Thalassemia genotypes were defined by DNA analysis. The system revealed satisfactorily within-run and between-run precision for quantitation of Hb A 2 and Hb E (CV: 0.02-0.09%). The reference ranges of Hb A 2 and Hb E were 2.6-4.0% and 25.7-33.1%, respectively. The system identified the cases of β-thalassemia and Hb E disorders correctly. Several thalassemia genotypes and Hb variants were identifiable. However, Hb Constant Spring was separated closely to Hb A 2 and Hbs Bart's and H were relatively difficult to be reported due to interfering peaks separating at the same regions. Prenatal diagnosis by fetal blood analysis was found to be accurate for Hb Bart's hydrops fetalis and Hb E-β 0 -thalassemia disease. The cIEF system could accurately diagnose β-thalassemia and Hb E carriers and demonstrate many Hb variants found in the region. The system cannot report Hb A 2 in the presence of Hb E whereas Hbs Lepore and F are comigrated. Diagnosis of α-thalassemia disease based on Hb H and Hb Bart's might be difficult. © 2016 John Wiley & Sons Ltd.

  20. [Neonatal screening of hemoglobinopathies and G6PD deficiency in Catalonia (Spain). Molecular study of sickle cell disease associated with alpha thalassemia and G6PD deficiency].

    Science.gov (United States)

    Mañú Pereira, María Del Mar; Cabot, Anna; Martínez González, Ana; Sitjà Navarro, Eulalia; Cararach, Vicent; Sabrià, Josep; Boixaderas, Jordi; Teixidor, Roser; Bosch, Albert; López Vílchez, M Angeles; Martín Ibáñez, Itziar; Carrión, Teresa; Plaja, Pere; Sánchez, Mario; Vives Corrons, José Luis

    2007-06-30

    The prevalence of hemoglobinopathies and glucose-6-phosphate dehidrogenase (G6PD) deficiency in the Catalan neonatal population is increasing due to immigration. Coinheritance of more than a single RBC genetic defect is becoming more frequent and diagnostic pitfalls are also increasing. We intended to demonstrate the need to perform an early diagnosis of sickle cell disease (SCD) by means of neonatal screening, to establish the prevalence of SCD associated with alpha thalassemia and G6PD deficiency and to identify genotypes associated with sickle cell disease and G6PD deficiency. 4,020 blood samples from newborns were screened. For the screening of hemoglobinopathies the high performance liquid chromatography method was used and for G6PD deficiency the fluorescent spot test was employed. We studied the association between betaS gene and alpha thalassaemia del-3.7 Kb. SCD and G6PD deficiency genotypes were established. Prevalence of SCD in population at risk was 1/475 newborns. Prevalence of G6PD deficiency in population at risk was 1/43, and in autochthonous population was 1/527 newborns. In all the cases, sickle hemoglobin was confirmed by ARMS (amplification refractory mutation system). Association between betaS gene and alpha thalassaemia del-3.7 Kb was found in 32.2% of the samples, and an association between betaS gene and G6PD deficiency was observed in 7% of the samples. This study confirms the high prevalence of SCD and G6PD deficiency in population at risk as well as their genetic and clinical heterogeneity. The study of genotype/phenotype relationships allows a better knowledge of molecular mechanism and is useful to establish suitable criteria of diagnosis.

  1. A Qualitative Secondary Evaluation of Statewide Follow-Up Interviews for Abnormal Newborn Screening Results for Cystic Fibrosis and Sickle Cell Hemoglobinopathy

    Science.gov (United States)

    La Pean, Alison; Collins, Jenelle L.; Christopher, Stephanie A.; Eskra, Kerry L.; Roedl, Sara; Tluczek, Audrey; Farrell, Michael H.

    2011-01-01

    Purpose The purpose of this qualitative analysis was to assess parental acceptability of large-scale, telephone follow-up regarding their infants' newborn screening (NBS) results indicating carrier status for sickle cell hemoglobinopathy (SCH) and cystic fibrosis (CF). Methods Analysis of 195 interview transcripts focused on parents' responses to two open-ended questions “What was your reaction to being called by me?” and “What do you think of the state newborn screening program having follow-up people calling parents like you?” Responses were coded using conventional content analysis procedures and non-parametric tests were performed to analyze quantitative data. Results Most parents reported favorable opinions about the follow-up. Favorable opinions were associated with several emotional reactions to receiving follow-up (pinterview beneficial (pinterview. Conclusion Parents of CF and SCH carrier infants had favorable opinions and identified specific benefits to receiving follow-up contact. This analysis demonstrates an information deficit among carrier parents and illustrates the importance of NBS follow-up and need for comprehensive communication and counseling. PMID:22261754

  2. Distribution of thalassemias and associated hemoglobinopathies identified by prenatal diagnosis in Taiwan.

    Science.gov (United States)

    Peng, Ching-Tien; Liu, Su-Ching; Peng, Yi-Chin; Lin, Tsai-Hsiu; Wang, Shiow-Jain; Le, Ching-Yi; Shih, Mu-Chin; Tien, Ni; Lu, Jang-Jih; Lin, Chien-Yu

    2013-10-01

    Hemoglobin (Hb) gene disorders are common hereditary disorders in Taiwan, and α- and β-thalassemias are among the well-known Hb disorders here. Our study provides a primary reference for designing a locally relevant antenatal diagnostic test to control the spread of thalassemia. Between 1998 and 2011, prenatal diagnoses for identifying thalassemia and hemoglobinopathies were performed on 1240 fetuses at risk for α-hydrops and β-thalassemia major. Of 1240 specimens analyzed, 1082 (87%) were obtained by amniocentesis; 125 (10%), by chorionic villus sampling; and 33 (3%), by cordocentesis. Prenatal diagnoses revealed that 21.5% of these fetuses as thalassemia major (including α-thalassemia hydrops, β-thalassemia major, and Hb E/β-thalassemia); 50.2%, for thalassemia minor (include α-thalassemia carrier, β-thalassemia carrier, and α-thalassemia combined β-thalassemia carrier); and 28.3% for normal type (include non-α, β-thalassemia). The most common α-hydrops were SEA (Southeast Asian) and Philippine type (frequencies of 74.91 and 5.24%, respectively). The frequency of the IVS-II-654 combined codons 41/42 mutation, the most common β-thalassemia major mutation in this region, was 5.24%. Two fetuses were found with E/β-thalassemia (HbE/IVS-II-654 and HbE/codons 41/42, respectively). Since 1993, Taiwan's Department of Health adopted a national program for screening pregnancies to control spread of thalassemia. In the last 10years, less than 3 such cases have occurred per year. After 2003, this number was 0 for a total of 4years (2003, 2004, 2007, and 2008). In Taiwan, incidence and frequency of thalassemia genotypes were similar to those previously reported. The national program for screening pregnancies to control spread of thalassemia that resulted in a marked decline in the number of newborns with thalassemia major. Interestingly, prenatal diagnoses revealed 21.5% for thalassemia major, 50.2% for thalassemia minor, 28.3% normal comparison of thalassemia

  3. Anti-Toxoplasma gondii antibodies in patients with beta-hemoglobinopathies: the first report in the Americas.

    Science.gov (United States)

    Ferreira, Marina Neves; Bonini-Domingos, Claudia Regina; Fonseca Estevão, Isabeth; de Castro Lobo, Clarice Lopes; Souza Carrocini, Gisele Cristina; Silveira-Carvalho, Aparecida Perpétuo; Ricci, Octávio; de Mattos, Luiz Carlos; Brandão de Mattos, Cinara Cássia

    2017-06-14

    In Brazil, there have been no previous studies of Toxoplasma gondii infection in sickle cell anemia patients and carriers of severe forms of beta-thalassemia. This study evaluated T. gondii infection in patients with beta-hemoglobinopathies. A total of 158 samples, 77 (48.7%) men and 81 (51.3%) women, were evaluated. Three groups were formed: G1 (85 patients with sickle cell disease); G2 (11 patients with homozygous beta-thalassemia; G3 (62 patients with heterozygous beta-thalassemia). ELISA was employed to identify anti-T. gondii IgM and IgG antibodies, and molecular analysis was performed to determine beta-hemoglobin mutations. Fisher's exact test was used to compare frequencies of anti-T. gondii IgM and IgG antibodies in respect to gender and age. Anti-T. gondii IgG antibodies were found in 43.5% of individuals in G1, 18.1% in G2 and 50% in G3. All samples from G1 and G2 were seronegative for anti-T. gondii IgM antibodies, but 3.2% from G3 were seropositive. Considering anti-T. gondii IgG antibodies, no statistical significant differences were found between these groups nor in seroprevalence between genders within each group. Despite this, comparisons of the mean ages between G1, G2 and G3 were statistically significant (G2 vs. G1: p value = 0.0001; G3 vs. G1: p-value <0.0001; G3 vs. G2: p-value = 0.0001). A comparison by age of patients with sickle cell anemia showed a trend of lower risk of infection among younger individuals. Therefore, this study demonstrates that T. gondii infection occurs in patients with beta-thalassemia and sickle cell anemia in Brazil as seen by the presence of anti-T. gondii IgM and IgG antibodies.

  4. MALDI-ISD Mass Spectrometry Analysis of Hemoglobin Variants: a Top-Down Approach to the Characterization of Hemoglobinopathies

    Science.gov (United States)

    Théberge, Roger; Dikler, Sergei; Heckendorf, Christian; Chui, David H. K.; Costello, Catherine E.; McComb, Mark E.

    2015-08-01

    Hemoglobinopathies are the most common inherited disorders in humans and are thus the target of screening programs worldwide. Over the past decade, mass spectrometry (MS) has gained a more important role as a clinical means to diagnose variants, and a number of approaches have been proposed for characterization. Here we investigate the use of matrix-assisted laser desorption/ionization time-of-flight MS (MALDI-TOF MS) with sequencing using in-source decay (MALDI-ISD) for the characterization of Hb variants. We explored the effect of matrix selection using super DHB or 1,5-diaminonaphthalene on ISD fragment ion yield and distribution. MALDI-ISD MS of whole blood using super DHB simultaneously provided molecular weights for the alpha and beta chains, as well as extensive fragmentation in the form of sequence defining c-, (z + 2)-, and y-ion series. We observed sequence coverage on the first 70 amino acids positions from the N- and C-termini of the alpha and beta chains in a single experiment. An abundant beta chain N-terminal fragment ion corresponding to βc34 was determined to be a diagnostic marker ion for Hb S (β6 Glu→Val, sickle cell), Hb C (β6 Glu→Lys), and potentially for Hb E (β26 Glu→Lys). The MALDI-ISD analysis of Hb S and HbSC yielded mass shifts corresponding to the variants, demonstrating the potential for high-throughput screening. Characterization of an alpha chain variant, Hb Westmead (α122 His→Gln), generated fragments that established the location of the variant. This study is the first clinical application of MALDI-ISD MS for the determination and characterization of hemoglobin variants.

  5. Molecular epidemiological survey of hemoglobinopathies in the Wuxi region of Jiangsu Province, eastern China.

    Science.gov (United States)

    Lin, Min; Han, Zhi-Jun; Wang, Qian; Zheng, Lei; Wang, Yan; Yang, Hui; Huang, Yue; Lin, Fen; Zhan, Xiao-Fen; Lin, Chun-Ping; Wu, Jiao-Ren; Luo, Zhao-Yun; Liu, Jing-Bo; Yan, Zhi-He; Zheng, Shu-Yan; Zheng, Jia-Kun; Lu, Min; Zhu, Juan-Juan; Xie, Long-Xu; Yang, Li-Ye

    2013-01-01

    In order to determine the prevalence and molecular characterization of hemoglobinopathies in the Wuxi region of Jiangsu Province in the People's Republic of China (PRC), a total of 10,297 healthy people selected from a regional hospital were screened. Hemoglobin (Hb) electrophoresis, complete blood cell (CBC) count, polymerase chain reaction (PCR), DNA sequencing, reverse dot-blot and multiplex ligation-dependent probe amplification (MLPA) were used to detect Hb variants, thalassemias and hereditary persistence of fetal Hb (HPFH). Two thousand and twenty-one adult subjects were screened for thalassemia, five cases were identified as α-thalassemia (α-thal) carriers including three cases of the -α(3.7) (rightward) deletion, one case of the - -(SEA) deletion and one case of β-thal [IVS-II-654 (C>T), (HBB: c.316-197C>T)]. The incidence of Hb variants, thalassemia and HPFH/δβ-thal were 0.136% (14/10,297), 0.25% (5/2021) and 0.0001% (1/10,297), respectively. Eight genotypes of Hb variants were found, including Hb E [β26(B8)Glu→Lys, GAG>AAG; HBB: c.79G>A], Hb J-Bangkok [β56(D7)Gly→Asp (GGC>GAC); HBB; c.170G>A], Hb G-Coushatta [β22(4)Glu→Ala (GAA>GCA); HBB: c.68A>C], Hb Queens [α34(B15)Leu→Arg (CTG>CGG) (α2 or α1); HBA2: c.104T>G (or HBA1)], Hb I [α16(A14)Lys→Glu, AAG>GAG (α1); HBA1: c.49A>G], Hb Beijing [α16(A14)Lys→Asn (AAG>AAC or AAT) (α2 or α1); HBA2: c.51G>C (or HBA1) or 51G>T (or HBA1)], Hb Ube-2 [α68(E17)Asn→Asp (AAC>GAC) (α2 or α1); HBA2: c.205A>G (or HBA1)] and Hb G-Taipei [β22(B4)Glu→Gly (GAA>GGA); HBB: c.68A>G]. A Sicilian δβ(0)-thal, identified for the first time in Asia, was also found in this survey.

  6. [Results of hematopoietic stem cell transplantation in hemoglobinopathies: thalassemia major and sickle cell disease].

    Science.gov (United States)

    Hladun, R; Elorza, I; Olivé, T; Dapena, J L; Llort, A; Sánchez de Toledo, J; Díaz de Heredia, C

    2013-08-01

    The prevalence of hemoglobinopathies in Spain is increasing as a result of immigration. Thalassemia major presents with chronic hemolytic anemia that requires regular red blood cell transfusions within the first year of life. Patients with sickle cell disease suffer from chronic anemia, vasculopathy and progressive damage in almost any organ. There is decreased life expectancy in both conditions. Allogeneic hematopoietic stem cell transplantation represents the only potentially curative option. Seventeen patients (fourteen thalassemia major, and three sickle cell disease) underwent allogeneic hematopoietic stem cell transplantations. In the thalassemia group, nine donors were HLA-geno-identical siblings, two were partially matched related donors (one HLA allele mismatch), and three unrelated donors. All three patients with sickle cell disease were transplanted from HLA-geno-identical siblings. The source of stem cells was bone marrow in sixteen cases. Median patient age at transplant was six years (range: 1-16) in the thalassemia group, and twelve years (range: 8-15) in the sickle cell disease group. The graft was successful in all patients. Secondary graft rejection was observed in two thalassemia patients rendering them dependent on blood transfusions. Complete chimerism was observed in thirteen patients and, although mixed chimerism occurred in two, with all of them showing normal hemoglobin levels after transplantation and not requiring further transfusion support. Patients affected by sickle cell disease did not present with new vaso-occlusive crises, and stabilization of pulmonary and neurological function was observed. Chronic graft-versus-host disease was detected in three patients affected by thalassemia, and hypogonadotrophic hypogonadism in five patients. We conclude that for thalassemia major and sickle cell disease, allogenic hematopoietic stem cell transplantation from HLA-geno-identical siblings offers a high probability of complication-free survival

  7. ARKRAY ADAMS A1c HA-8180T Analyzer for Diagnosis of Thalassemia and Hemoglobinopathies Common in Southeast Asia.

    Science.gov (United States)

    Kunwandee, Jatuphol; Srivorakun, Hataichanok; Fucharoen, Goonnapa; Sanchaisuriya, Kanokwan; Fucharoen, Supan

    2014-01-01

    To evaluate the ARKRAY ADAMS A1c HA-8180T analyzer for diagnosis of thalassemias and hemoglobinopathies commonly found in the Southeast Asian population. Our cohort consisted of 557 specimens from adults referred for thalassemia diagnosis. From these, we selected 457 specimens and subjected them to DNA analysis to determine various thalassemia genotypes. Also, to confirm the reference range for HbA2, we obtained an additional 48 specimens from healthy individuals. We estimated the diagnostic range for Hb E from specimens from another 52 subject individuals previously diagnosed with heterozygous HbE. All of these individuals had negative results in DNA testing for all common α-thalassemia alleles found in Thailand. We performed hemoglobin (Hb) analysis and compared the results with those we derived from testing the CAPILLARYS 2 Flex Piercing device. We defined genotypes via by DNA analysis. Performance evaluation revealed the within- and between-run precision for analysis of HbA2 and HbE, with coefficients of variation (CVs) ranging from 0.6% to 2.5%. We determined the reference ranges of HbA2 and HbE in the HbE heterozygote to be 2.2% to 3.4 % and 25.7% to 31.0%, respectively. We were able to identify all cases of β-thalassemia and HbE disorders. We coeluted HbH and Hb Bart and interfered with acetylated HbF. The ARKRAY ADAMS A1c HA-8180T analyzer could accurately identify which individuals had β-thalassemia and HbE disorders. However, compared with other high-performance liquid chromatography instruments in diagnosing α-thalassemia disease with HbH and Hb Bart, this analyzer is relatively difficult to use. Copyright© by the American Society for Clinical Pathology (ASCP).

  8. Triagem neonatal para hemoglobinopatias: um estudo piloto em Porto Alegre, Rio Grande do Sul, Brasil Neonatal screening for hemoglobinopathies: a pilot study in Porto Alegre, Rio Grande do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Liane Esteves Daudt

    2002-06-01

    Full Text Available Este estudo, tem como o objetivo determinar a freqüência das hemoglobinopatias em neonatos, que realizaram a coleta para o Teste de Triagem Neonatal para Distúrbios Metabólicos no Hospital de Clínicas de Porto Alegre. O método utilizado para a determinação das variantes da hemoglobina, foi eletroforese por focalização isoelétrica em amostra de sangue total, coletadas em papel filtro por punção do calcanhar. Para confirmação diagnóstica dos casos alterados, foram realizadas eletroforeses das hemoglobinas em acetato de celulose com pH 8,6 e em citrato de ágar com pH 6,2, em amostra de sangue total dos neonatos e dos seus progenitores. Foram analisados, 1.615 indivíduos, e identificada a presença da hemoglobina S em 20 amostras e da hemoglobina C em seis amostras. Esses valores, correspondem a uma freqüência de 1,2% para o gene da anemia falciforme e 0,4% para o gene da doença de hemoglobina C, independente da raça ou ascendência. Esses dados, sugerem que a inclusão da triagem neonatal universal para hemoglobinopatias nos projetos já implementados para fenilcetonúria e hipotireoidismo congênito, apresenta vantagens e deve ser considerada pelos programas de saúde.This study was conducted to establish the frequency of hemoglobinopathies among newborns undergoing screening tests for metabolic diseases at the University Hospital (Hospital de Clínicas in Porto Alegre, Rio Grande do Sul, Brazil. Testing for abnormal hemoglobins was performed by isoelectric focusing electrophoresis on agarose gel with blood obtained by heel stick and applied to filter paper. For confirmatory testing of abnormal neonatal screening, a venopuncture blood sample was obtained from the infant and parents and then submitted to hemoglobin electrophoresis on cellulose acetate at pH 8.6 and citrate agar at pH 6.2. A total of 1,615 subjects were studied: 20 samples showed the Hb S pattern and six samples showed Hb C. Thus, frequency of the sickle cell

  9. Thalassemia and hemoglobinopathies in an ethnic minority group in Central Vietnam: implications to health burden and relationship between two ethnic minority groups.

    Science.gov (United States)

    Nguyen, Nga Thi; Sanchaisuriya, Kanokwan; Sanchaisuriya, Pattara; Van Nguyen, Hoa; Phan, Hoa Thi Thuy; Fucharoen, Goonnapa; Fucharoen, Supan

    2017-07-01

    Thalassemia is a genetic condition that can result in long and expensive treatments, and severe thalassemia may lead to death if left untreated. Couples contributing two genes for thalassemia place their children at particular risk for severe thalassemia. Gene frequency of thalassemia varies in Vietnam, but presents remarkably high levels among some ethnic minority groups. Limited information about thalassemia frequency makes prevention and control of thalassemia difficult. This study aimed to determine gene frequency of certain types of thalassemia among 390 women of reproductive age of the Ta-Oi ethnic minority. Hemoglobin and DNA analyses were carried out to diagnose thalassemia and hemoglobinopathies. Of the total participants, 56.1% (95% CI = 51.1-61.1) carried thalassemia genes. A remarkably high frequency of hemoglobin Constant Spring (Hb CS) of 23.8% (95% CI = 19.7-28.4) was noted. The frequency of α + -thalassemia (-3.7 kb deletion) was 26.4% (95% CI = 22.1-31.1), while hemoglobin E (Hb E) and hemoglobin Paksé (Hb Ps) were identified at frequencies of 14.6 (95% CI = 11.2-18.5) and 2.6% (95% CI = 1.4-5.0), respectively. Further analysis of α-globin gene haplotype revealed the same Hb CS haplotype (+ - M + + -) as of the Co-Tu minority, a neighboring minority of the Ta-Oi, indicating that these two minorities may share the same ancestors. This information will be helpful for further studies in population genetics, as well as the development prevention and control program in the region.

  10. Routine hemoglobin electrophoresis for pediatric surgery day case ...

    African Journals Online (AJOL)

    Background: Hemoglobin electrophoresis (HBE) is a part of the preoperative routine requested by anesthetists. However, the prevalence of hemoglobinopathy in the population is low. This study aims to determine the clinical risk factors for hemoglobinopathies and propose clinical guidelines for preoperative screening of ...

  11. Profil épidémiologique des hémoglobinopathies: étude transversale ...

    African Journals Online (AJOL)

    In 2008, the World Health Organization (WHO) has published data on hemoglobinopathies epidemiology: more than 330.000 cases of hemoglobinopathy occur each year (83% of cases of sickle cell anemia, 17 % of cases of thalassemia). Hemoglobin disorders are responsible for approximately 3.4% of deaths among ...

  12. Hemoglobinopathy Evaluation

    Science.gov (United States)

    ... in Previous Reviews Harmening D. Clinical Hematology and Fundamentals of Hemostasis , Fifth Edition. F.A. Davis Company, Philadelphia, 2009, Chapters 11 and 12. Henry's Clinical Diagnosis and Management by Laboratory Methods . 21st ed. McPherson R, Pincus ...

  13. Spectrum of hemoglobin variants in the population of northern region of West Bengal: An ethnogenetic proposition

    Directory of Open Access Journals (Sweden)

    Bidyut Krishna Goswami

    2014-01-01

    Full Text Available Context: The birth of transfusion-dependent states of hemoglobinopathies including thalassemias is preventable by population screening and genetic counseling. Magnitude is not addressed in the Northern Region of West Bengal where many ethnic variants inhabit. Aims and Objectives: The aim of the following study is to find out the burden of different entities of hemoglobinopathies, their correlation with ethnicity and the "at risk" groups. Subjects and Methods: A descriptive study was conducted from the Hematology Unit of North Bengal Medical College over 1 year on the subjects underwent screening for hemoglobinopathies for detection of abnormal hemoglobin (Hb variants by "cation-exchange high-performance liquid chromatography" principle along with other relevant tests. Statistical Analysis: Data was analyzed by frequency distribution and Chi-square test assuming P value as 95% of the level of significance using the SPSS version 16 (SPSS Inc., Chicago, Illinois, U.S.A. Result: Abnormal Hb variant was 47.5% among 1872. Hb E trait (34.4% was most common followed by Hb E disease (25.3% and others. Hb E disorders (92.7% were observed mostly among Rajbangsi population while E-β-thalassemias (40% in the Muslims and a heterogeneous pattern noted among tribal and mongoloid. Conclusion: Hb E hemoglobinopathies was high among Rajbangsi and Muslims with identification of some other hemoglobinopathies involving tribal and mongoloid.

  14. Erroneous HbA1c results in a patient with elevated HbC and HbF.

    Science.gov (United States)

    Adekanmbi, Joy; Higgins, Trefor; Rodriguez-Capote, Karina; Thomas, Dylan; Winterstein, Jeffrey; Dixon, Tara; Gifford, Jessica L; Krause, Richard; Venner, Allison A; Clarke, Gwen; Estey, Mathew P

    2016-11-01

    HbA1c is used in the diagnosis and monitoring of diabetes mellitus (DM). Interference from hemoglobin variants is a well-described phenomenon, particularly with HPLC-based methods. While immunoassays may generate more reliable HbA1c results in the presence of some variants, these methods are susceptible to negative interference from high concentrations of HbF. We report a case where an accurate HbA1c result could not be obtained by any available method due to the presence of a compound hemoglobinopathy. HbA1c was measured by HPLC, immunoassay, and capillary electrophoresis. Hemoglobinopathy investigation consisted of a CBC, hemoglobin fractionation by HPLC and electrophoresis, and molecular analysis. HbA1c analysis by HPLC and capillary electrophoresis gave no result. Analysis by immunoassay yielded HbA1c results of 5.9% (Siemens DCA 2000+) and 5.1% (Roche Integra), which were inconsistent with other markers of glycemic control. Hemoglobinopathy investigation showed HbC with the hereditary persistence of fetal hemoglobin-2 Ghana deletion. Reliable HbA1c results may be unobtainable in the presence of some hemoglobinopathies. HPLC and capillary electrophoresis alerted the laboratory to the presence of an unusual hemoglobinopathy. Immunoassays generated falsely low results without warning, which could lead to missed diagnoses and under treatment of patients with DM. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Primary prevention of hemoglobinopathies by prenatal diagnosis and selective pregnancy termination in a Muslim country: Oman

    Directory of Open Access Journals (Sweden)

    Suha Mustafa Hassan

    2014-11-01

    Full Text Available Hemoglobinopathies (HBP are the most common genetic disorder in Oman and are in need of prevention programs due to the high incidence of β-thalassemia major and sickle cell disease. Prenatal diagnosis (PD and selective pregnancy termination is shown to be the most effective prevention tool for the control of HBP. However, PD is not available in Oman thus far because abortion is subject to religious, cultural and ethical issues. We have examined the attitude of a number of Omani HBP carrier couples towards prenatal diagnosis and selective abortion. We have interviewed 35 couples at risk visiting the main premarital clinic in Muscat between Jan 2011 and Jan 2012. Couples were interviewed using a pre-structured questionnaire. The majority would have accepted prenatal diagnosis (94% if the service would be available in the country but pregnancy termination was greatly influenced by religious values. 血红蛋白病(HBP)是一种在阿曼最常见的遗传性疾病,由于其高发的B型地中海贫血症及镰状细胞症,相关的预防措施对于这一国家来说,相当重要。产前诊断(PD)和选择性终止妊娠被证实是针对管控血红蛋白病(HBP)的最有效方法。然而,由于受到宗教、文化和伦理抵制堕胎的影响,产前诊断(PD)并不能在该国得以应用。我们对该国一部分血红蛋白病患夫妇做了一项关于产前诊断的意向调查。2011年一月至2012年一月,我们在马斯喀特(阿曼首都)的一家婚前诊所对35对夫妇做了相关的采访调查。调查的问卷是事先设置好的。大部分(94%)夫妇表示接受产前诊断如果相应的措施能得到广泛的普及,但是他们对于选择性终止妊娠的态度受到了其宗教价值观的极大影响。

  16. Mutation Screening of the Krüppel-like Factor 1 Gene in Individuals With Increased Fetal Hemoglobin Referred for Hemoglobinopathy Investigation in South of Iran.

    Science.gov (United States)

    Hamid, Mohammad; Ershadi Oskouei, Sanaz; Shariati, Gholamreza; Babaei, Esmaeil; Galehdari, Hamid; Saberi, Alihossein; Sedaghat, Alireza

    2018-04-01

    Any mutation in the Krüppel-like factor 1 (KLF1) gene may interfere with its proper related function in the erythropoiesis process and lead to alterations in proper activation of its downstream protein through globin switching, which results in an increase in fetal hemoglobin (HbF). This study aimed to investigate whether KLF1 mutation can associate with high level of HbF in individuals with increased fetal hemoglobin referred for screening of hemoglobinopathies in south of Iran. The human KLF1 gene was amplified via the polymerase chain reaction procedure, and sequencing was used to determine any mutation in these patients. Moreover, XmnI polymorphisms in the position of -158 of γ-globin gene promoter were analyzed in all patients by polymerase chain reaction restriction fragment length polymorphism. Analysis of sequencing revealed a missense mutation in the KLF1 gene, p.Ser102Pro (c.304T>C), which was detectable in 10 of 23 cases with elevated HbF level. This mutation was only detected in individuals who had a HbF level between 3.1% and 25.6%. Statistical analysis showed that the frequency of C allele is significantly correlated with a high level of HbF (PC) in the KLF1 gene in β-thalassemia patients with increased level of fetal hemoglobin. According to statistical results of p.Ser102Pro mutation and XmnI polymorphism, it has been strongly suggested that both polymorphisms have an association with increased HbF samples. These nucleotide changes alone may not be the only elements raising the level of HbF, and other regulatory and modifying factors also play a role in HbF production.

  17. Evaluation of low red blood cell mean corpuscular volume in an apheresis donor population.

    Science.gov (United States)

    Bryant, Barbara J; Hopkins, Julie A; Arceo, Sarah M; Leitman, Susan F

    2009-09-01

    Apheresis donors are routinely evaluated with a complete blood count (CBC). Low red blood cell mean corpuscular volume (MCV) values (or=12.5 g/dL) could be due to iron deficiency or hemoglobinopathy. The etiology of a low MCV in a healthy apheresis donor population was assessed. Predonation samples for CBC were obtained from 1162 consecutive apheresis donors. Donors with a MCV of less than 80 fL were evaluated by CBC, iron studies (ferritin, serum iron, transferrin, percentage of transferrin saturation), and hemoglobin (Hb) electrophoresis. Iron deficiency was defined as a ferritin value below the reference range. Beta chain Hb variants were determined by Hb electrophoresis. Alpha thalassemia trait was presumed if the red blood cell (RBC) count was elevated, no variant Hbs were detected, and the iron studies were within normal ranges. In a 19-month period, 33 of 1162 apheresis donors had low MCV values. Iron deficiency was present in 64%; 49% had isolated iron deficiency and 15% had iron deficiency plus hemoglobinopathy. Hemoglobinopathy without concomitant iron deficiency was found in the remaining 36%. Iron deficiency is present in the majority of apheresis donors with repeatedly low MCV values and Hb levels of 12.5 g/dL or more. Hemoglobinopathy is also commonly present but may not be easily recognized in the setting of iron deficiency. The MCV is a useful screening tool to detect iron deficiency and hemoglobinopathy. Low MCV values should be investigated to determine if iron replacement therapy is indicated.

  18. Incidence of Inborn Errors of Metabolism by Expanded Newborn Screening in a Mexican Hospital

    Directory of Open Access Journals (Sweden)

    Consuelo Cantú-Reyna MD

    2016-09-01

    Full Text Available Newborn screening for the detection of inborn errors of metabolism (IEM, endocrinopathies, hemoglobinopathies, and other disorders is a public health initiative aimed at identifying specific diseases in a timely manner. Mexico initiated newborn screening in 1973, but the national incidence of this group of diseases is unknown or uncertain due to the lack of large sample sizes of expanded newborn screening (ENS programs and lack of related publications. The incidence of a specific group of IEM, endocrinopathies, hemoglobinopathies, and other disorders in newborns was obtained from a Mexican hospital. These newborns were part of a comprehensive ENS program at Ginequito (a private hospital in Mexico, from January 2012 to August 2014. The retrospective study included the examination of 10 000 newborns’ results obtained from the ENS program (comprising the possible detection of more than 50 screened disorders. The findings were the following: 34 newborns were confirmed with an IEM, endocrinopathies, hemoglobinopathies, or other disorders and 68 were identified as carriers. Consequently, the estimated global incidence for those disorders was 3.4 in 1000 newborns; and the carrier prevalence was 6.8 in 1000. Moreover, a 0.04% false-positive rate was unveiled as soon as diagnostic testing revealed negative results. The most frequent diagnosis was glucose-6-phosphate dehydrogenase deficiency; and in the case of carriers, it was hemoglobinopathies. The benefit of the ENS is clear as it offers prompt treatment on the basis of an early diagnosis including proper genetic counseling. Furthermore, these results provide a good estimation of the frequencies of different forms of newborn IEM, endocrinopathies, hemoglobinopathies, and other disorders at Ginequito.

  19. Spectrum of types of thalassemias and hemoglobinopathies: study in a tertiary level children hospital in Bangladesh

    Directory of Open Access Journals (Sweden)

    Waqar A. Khan

    2017-05-01

    Full Text Available Thalassemias and hemoglobinopathies are the most common hemolytic congenital disorders in Bangladesh as in many parts of the world. This study was done to find the common types of thalassemias and abnormal hemoglobin variants seen in Bangladeshi populations. A total of 4813 samples were analyzed for hemoglobin disorders out of which 2308 (49.95% showed abnormalities. The samples were analyzed by Bio Rad D 10 Analyzer in 3914 (81.32% cases, BIORAD VARIANTβ thalassemia short program using the principle of high performance liquid chromatography in 474 (9.85% cases and by CAPILLARYS 2 FLEX PIERCING utilizing capillary electrophoresis in 425 (8.83% cases. The samples were analyzed in the Department of Biochemistry and Molecular Biology of Dhaka Shishu (Children Hospital, Dhaka, Bangladesh. The common hemoglobin disorders seen were β trait 863 (17.94%, Hb E trait 601 (12.50%, Hb E β thalassemia 524 (10.87%, β thalassemia major 192(4.00 %, Hb E disease 99 (2.05%. Other Hb abnormalities detected were Hb D trait 17 (0.35%, Sickle cell trait 4 (0.08%, hereditary persistence of fetal hemoglobin (HPFH 2 (0.04%, and Hb Lepore, δ β thalassemia, sickle cell β thalassemia, Sickle cell disease, compound heterozygote for HbE+D and Hb Q band one case each (0.02%.   与世界许多地方一样,地中海和血红蛋白病是孟加拉国最常见的溶血性先天性疾病。本研究的目的是找到孟加拉国人群的常见地中海贫血类型和异常血红蛋白变体。总共对4813例样本进行了血红蛋白疾病分析,其中2308例(49.95%)显示异常。3914例(81.32%)样本使用Bio Rad D 10分析仪分析,由BIORAD VARIANTβ地中海贫血症短期计划使用高效液相色谱法分析了474例(9.85%),由CAPILLARYS 2 FLEX PIERCING使用毛细管电泳分析了425例(8.83%)。样本在孟加拉达卡的达卡生化与分子生物学教研室进行分析。观察到的常见血红蛋白疾病是863例(17.94%

  20. Application of diagnostic methods and molecular diagnosis of hemoglobin disorders in Khuzestan province of Iran

    Science.gov (United States)

    Fakher, Rahim; Bijan, Kaeikhaei; Taghi, Akbari Mohammad

    2007-01-01

    BACKGROUND: The hemoglobinopathies refer to a diverse group of inherited disorders characterized by a reduced synthesis of one or more globin chains (thalassemias) or the synthesis of structurally abnormal hemoglobin (Hb). The thalassemias often coexist with a variety of structural Hb variants giving rise to complex genotypes and an extremely wide spectrum of clinical and hematological phenotypes. Hematological and biochemical investigations and family studies provide essential clues to the different interactions and are fundamental to DNA diagnostics of the Hb disorders. Although DNA diagnostics have made a major impact on our understanding and detection of the hemoglobinopathies, DNA mutation testing should never be considered a shortcut or the test of first choice in the workup of a hemoglobinopathy. MATERIALS AND METHODS: A careful three-tier approach involving: (1) Full blood count (2) Special hematological tests, followed by (3) DNA mutation analysis, provides the most effective way in which to detect primary gene mutations as well as gene-gene interactions that can influence the overall phenotype. With the exception of a few rare deletions and rearrangements, the molecular lesions causing hemoglobinopathies are all identifiable by PCR-based techniques. Furthermore, each at-risk ethnic group has its own combination of common Hb variants and thalassemia mutations. In Iran, there are many different forms of α and β thalassemia. Increasingly, different Hb variants are being detected and their effects per se or in combination with the thalassemias, provide additional diagnostic challenges. RESULTS: We did step-by-step diagnosis workup in 800 patients with hemoglobinopathies who referred to Research center of Thalassemia and Hemoglobinopathies in Shafa Hospital of Ahwaz Joundishapour University of medical sciences, respectively. We detected 173 patients as iron deficiency anemia (IDA) and 627 individuals as thalassemic patients by use of different indices. We

  1. Incidence of sickle cell disease and other hemoglobin variants in 10,095 Lebanese neonates.

    Directory of Open Access Journals (Sweden)

    Evelyne Khoriaty

    Full Text Available Hemoglobinopathies are highly prevalent diseases and impose a public health burden. Early diagnosis and treatment can ameliorate the course of these diseases and improve survival. Despite purported high incidence of hemoglobinopathies in Lebanon, there are no nationwide screening programs. In this study, newborn screening utilizing high pressure liquid chromatography was executed in all public hospitals across Lebanon between 2010 and 2013. All newborns with an abnormal hemoglobin (Hb were offered genetic counseling and all those with disease were enrolled in comprehensive hemoglobinopathy clinics. Among newborns, 2.1% were found to have an abnormal Hb variant with sickle Hb being the most common while 0.1% were found to have sickle cell disease (SCD. The majority of those with SCD had non-Lebanese origins. The most common causes of hospitalizations in infants with SCD were acute splenic sequestration and pain crises. No bacteremia or other life threatening infections were noted. At a median follow up 14 months (follow up range 7 to 34 months, all children with disease are alive and compliant with treatment. Systematic screening for SCD and other Hb variants was shown to be feasible, cost effective, and of accurate predictive value. This program was also clinically effective because it led to the identification of babies with disease and to providing them with free early multidisciplinary care. Conclusively, a newborn screening program should be implemented across Lebanon to detect hemoglobinopathies and initiate early therapeutic and preventive strategies and genetic counseling.

  2. Avaliação da cobertura do programa de triagem neonatal de hemoglobinopatias em populações do Recôncavo Baiano, Brasil Evaluation of coverage by a neonatal screening program for hemoglobinopathies in the Recôncavo region of Bahia, Brazil

    Directory of Open Access Journals (Sweden)

    Wellington dos Santos Silva

    2006-12-01

    Full Text Available Em 2001, a Portaria n. 822/2001 do Ministério da Saúde tornou obrigatória a triagem neonatal para as hemoglobinopatias, especialmente a anemia falciforme, a doença genética mais comum no Brasil. A Bahia, em decorrência de sua história de povoamento, é o Estado com maior prevalência dessa doença no país. No presente trabalho, apresentamos a cobertura da triagem neonatal (número de recém-nascidos/número de triagens realizadas no período de 2001 a 2003 nos municípios de Cachoeira, São Félix e Maragogipe, localizados na região do Recôncavo Baiano, e a freqüência das hemoglobinas variantes HbS e HbC na população dos mesmos municípios, com exceção de São Félix. A freqüência total estimada de portadores para as duas hemoglobinas nessas populações foi de 13,0% e nos recém-nascidos de 8,5% em 2001, 6,5% em 2002 e 11,6% em 2003. A cobertura da triagem neonatal, quando se considera o período de 2001 a 2003, caiu de 82,6% para 46,4% no Município de Cachoeira, aumentou de 23,7% para 56,2% em Maragogipe e em São Félix atingiu 100%. Os dados aqui apresentados apontam para a necessidade de um melhor preparo dos serviços de saúde pública na maioria dos municípios analisados do Recôncavo Baiano para a cobertura da triagem neonatal.In 2001, government ruling n. MS 822/01 by the Brazilian Ministry of Health made neonatal screening mandatory for hemoglobinopathies, with special focus on sickle cell disease, the most common hemoglobinopathy in Brazil. Bahia is the State of Brazil with the highest prevalence of this disease. The current paper reports on the prevalence of hemoglobin variants HbS and HbC, which cause sickle cell disease, in the cities of Cachoeira, Maragogipe, and São Félix, Bahia State. The overall proportion of carriers for the two forms of hemoglobin was 13%. From 2001 to 2003, the neonatal screening rate decreased from 82.6% to 46.4% in Cachoeira and increased from 37.0% to 56.2% in Maragogipe. Thus, only

  3. New updating into hemoglobinopathies.

    Science.gov (United States)

    Fucharoen, S; Winichagoon, P

    2012-12-01

    Thalassemia and abnormal hemoglobin are the most common genetic disorders and are considered health problems in many developing countries. In the last few years, there has been much progress in laboratory diagnosis, treatment and control of thalassemia. The variation in the clinical severity in both α- and β-thalassemia reflects a genotype-phenotype interaction. This is important for future therapeutic intervention and should be well characterized in each population. The quality of life of the patients is much improved with regular blood transfusion and novel iron chelators. The cure for thalassemia is possible by stem cell transplantation and future gene therapy. It is expected that under multinational collaboration the prevention of thalassemia will happen worldwide. © 2012 Blackwell Publishing Ltd.

  4. Investigating alpha-globin structural variants: a retrospective review of 135,000 Brazilian individuals

    Directory of Open Access Journals (Sweden)

    Elza Miyuki Kimura

    2015-04-01

    Full Text Available Background: Brazil has a multiethnic population with a high diversity of hemoglobinopathies. While screenings for beta-globin mutations are far more common, alterations affecting alpha-globin genes are usually more silent and less well known. The aim of this study was to describe the results of a screening program for alpha-globin gene mutations in a representative sample of the Southeastern Brazilian population. Methods: A total of 135,000 individuals, including patients with clinical suspicion of hemoglobinopathies and their family members, randomly chosen individuals submitted to blood tests and blood donors who were abnormal hemoglobin carriers were analyzed. The variants were screened by alkaline and acid electrophoreses, isoelectric focusing and cation-exchange high performance liquid chromatography (HPLC and the abnormal chains were investigated by reverse-phase high performance liquid chromatography (RP-HPLC. Mutations were identified by molecular analyses, and the oxygen affinity, heme-heme cooperativity and Bohr effect of the variants were evaluated by functional tests. Results: Four new and 22 rare variants were detected in 98 families. Some of these variants were found in co-inheritance with other hemoglobinopathies. Of the rare hemoglobins, Hasharon, Stanleyville II and J-Rovigo were the most common, the first two being S-like and associated with alpha-thalassemia. Conclusion: The variability of alpha-globin alterations reflects the high degree of racial miscegenation and an intense internal migratory flow between different Brazilian regions. This diversity highlights the importance of programs for diagnosing hemoglobinopathies and preventing combinations that may lead to important clinical manifestations in multiethnic populations.

  5. [Breastfeeding and the anthropometric profile of children with sickle cell anemia receiving follow-up in a newborn screening reference service].

    Science.gov (United States)

    Nogueira, Zeni Drubi; Boa-Sorte, Ney; Leite, Maria Efigênia de Queiroz; Kiya, Márcia Miyuki; Amorim, Tatiana; Fonseca, Silvana Fahel da

    2015-01-01

    To study breastfeeding history (BF) and the anthropometric status of children with Sickle Cell Disease (SCD). A cross-sectional study of 357 children with SS and SC hemoglobinopathies aged between 2 and 6 years old receiving regular follow-up at a Newborn Screening Reference Service (NSRS) between November 2007 and January 2009. The outcome was anthropometric status and the exposures were: BF pattern, type of hemoglobinopathy and child's age and sex. The average (SD) age was 3.7 (1.1) years, 52.9% were boys and 53.5% had SS hemoglobinopathy. The prevalence of exclusive breastfeeding (EBR) up to six months of age was 31.5%, the median EBR times (p25-p75) was 90.0 (24.0-180.0) days and the median weaning ages (p25-p75) was 360.0 (90.0-20.0) days respectively. Normal W/H children experienced EBR for an average duration almost four times longer than malnourished children (p=0.01), and were weaned later (p<0.05). Height deficit was found in 5.0% of children, while all the children with severe short stature had SS hemoglobinopathy and were over 4 years of age. EBR time and weaning age were greater than found in the literature, which is a possible effect of the multidisciplinary follow-up. Duration of EBR and later weaning were associated with improved anthropometric indicators. Copyright © 2014 Associação de Pediatria de São Paulo. Publicado por Elsevier Editora Ltda. All rights reserved.

  6. Microcytic hypochromic anemia: Should high performance liquid chromatography be used routinely for screening anemic and antenatal patients?

    Directory of Open Access Journals (Sweden)

    Joseph Philip

    2013-01-01

    Full Text Available Background: Hemoglobinopathies are the most common inherited red cell disorders worldwide. Identification of these disorders is immensely important epidemiologically and for improved management protocols. Aim and Objectives: Our aim was to determine the prevalence of hemoglobinopathies in patients with microcytic hypochromic anemia and to assess the suitability of using high performance liquid chromatography (HPLC routinely for screening antenatal cases and patients with anemia. Materials and Methods: A total of 4335 cases received from Mar 2007 to Nov 2011 were studied for various hemoglobinopathies and variants on BIO RAD ′VARIANT′ analyzer. Results: Of the 4335 cases studied, 2119 were antenatal cases, 1710 patients with other disorders and 506 family studies. Of these, 688 cases displayed abnormal hemoglobin fractions on HPLC of which 140 were antenatal women. There were 455 cases of β thalassemia trait, 24 β thalassemia major, 20 thalassemia inter-media, 54 sickle cell trait, fivesickle cell disease, 21 double heterozygous β thalassemia-sickle cell trait, nineand 4 Hb D- Punjab heterozygous and homozygous respectively, three Hb D β Thalassemia trait, 20 and 37 Hb E homozygous and heterozygous respectively, three Hb E β Thalassemia trait and four cases of Hb Q India. Twenty nine adults had isolated HbF elevation. Conclusion: Our study found a high prevalence (15.8% of hemoglobinopathies amongst microcytic hypochromic anemia and antenatal cases. An accurate diagnosis helps in preventing unnecessary iron loading. Screening all antenatal cases with anemia helps in timely antenatal counseling, thus preventing the psychological trauma of bearing a transfusion dependent child for life.

  7. Morbiletalidad en pacientes adultos con drepanocitosis Morbimortality rates in adult patients with sickle cell disease

    Directory of Open Access Journals (Sweden)

    Sergio Machín García

    2004-08-01

    Full Text Available Se estudiaron 397 pacientes adultos con drepanocitosis, seguidos entre enero de 1973 y diciembre de 1997; 200 del sexo femenino y 197 del masculino. De estos, 305 con anemia drepanocítica, 63 con hemoglobinopatía SC y 29 con Sb talasemia. La mediana de seguimiento fue de 14,3 años. La media anual de ingresos y transfusiones fue menor en la hemoglobinopatía SC (pA study was performed on 397 adult patients with sickle cell anemia, who had been followed up from January 1973 to December 1997. Two hundred were females and 197 males; 305 of these patients presented with sickle cell anemia, 63 with SC hemoglobinopathy and 29 with Sb thalassemia. The mean follow-up period was 14,3 years. The yearly admission and blood transfusion mean was lower in SC hemoglobinopathy(p<0,001. Painful vasoocclusive crisis was more frequent in Sb thalassemia whereas infections often occurred in sickle cell anemia (p<0,001. One hundred four pregnancies were developed from 87 females. There were 4 maternal deaths and 10 perinatal deaths. Differences were found in hemoglobin and reticulocyte values among hemoglobinopathies (p<0,001 but no difference was seen between sexes or among age groups (18-29 y, 30-40 y and over 40 y. Fetal hemoglobin values did not show significant difference between sexes, although they were higher in sickle cell anemia. Global survival estimates were 53 years in sickle cell anemia, 59 years in SC hemoglobinopathy and 48 in Sb thalassemia (p< 0,05. The most frequent cases of death were hepatic complications, encephalic vascular attacks and infections

  8. Hematological and Molecular Characterization of Hb J-Buda [α61(E10)Lys → Asn, AAG > AAT].

    Science.gov (United States)

    Panyasai, Sitthichai; Permsripong, Nopphadol; Jaiping, Kanokwan; Khantarag, Pisuttinee; Pornprasert, Sakorn

    2016-06-01

    Hemoglobin (Hb) J-Buda [α61(E10)Lys → Asn, AAG > AAT] is a very rare α-chain variant found in South-East Asia. We analyzed hematological parameters and provided a rapid molecular analysis method for detection of this hemoglobinopathy in two Thai women who had severe microcytic anemia with Hb and MCV AAG → AAT mutation at codon 61 for Hb J-Buda on one allele of the α1-globin gene. The developed Allele-specific PCR (ASPCR) showed the 455 bp amplified fragment from Hb J-Buda allele. Thus, understanding of hematological characterizations and the developed ASPCR for diagnosis of Hb J-Buda are essential for genetic counseling of this hemoglobinopathy.

  9. Expanded Access Protocol (EAP) Using the CliniMACS® Device for Pediatric Haplocompatible Donor Stem Cell Transplant

    Science.gov (United States)

    2017-11-22

    Acute Lymphoblastic Leukemia; Acute Myeloid Leukemia; Chronic Myeloid Leukemia; Myelodysplastic Syndrome; Lymphomas; Bone Marrow Failure; Hemoglobinopathy; Immune Deficiency; Osteopetrosis; Cytopenias; Leukocyte Disorders; Anemia Due to Intrinsic Red Cell Abnormality

  10. Diagnóstico de hemoglobinopatias em recém-nascidos do Hospital de Base de São José do Rio Preto-SP Diagnosis of hemoglobinopathies in newborn babies in Hospital de Base, São José do Rio Preto, SP, Brazil

    Directory of Open Access Journals (Sweden)

    Fatima A. M. Siqueira

    2002-12-01

    Full Text Available The neonatal period is considered the most effective for the screening of hemoglobinopathies. This allows prophylaxis and prevention, improving the patient's survival and guidance of parents and heterozygote carriers. The present work aims at the early detection of abnormal hemoglobins, the establishment of standard analysis and to examine the viability of the prevention program. Blood samples were collected by heel stick and from blood cord of children born in the Hospital de Base São José do Rio Preto, from April 1998 to November 1999. Electrophoresis and cytological, biochemical, cromatographic analyses were made for abnormal hemoglobin characterization. A total of 1,478 neonatal blood samples were analyzed in which 14.62% presented with hemoglobins alterations: 3.32% had Hb S; 0.61% had Hb C; 7.44% were suggestive of alpha thalassemia; 1.55% were suggestive of beta thalassemia, and 1.70% had alpha/beta thalassemia interactions. The samples collected from the blood cord showed better results in all analyses while the blood samples collected by heel stick on filter paper, were applicable to only specific methodologies. The routine laboratory methods allowed identification of the thalassemic and variant forms, and isoelectric focusing presented sensitivity only for variant identification in this age range. The suspected cases were reassessed after six months, which permitted genetic counseling of their family members and clinic attendance. A multidisciplinary approach in programs of this kind is fundamental for its success.

  11. Induction of HBF

    Directory of Open Access Journals (Sweden)

    Mehran Karimi

    2013-03-01

    Full Text Available The role of HbF inducers in ameliorating the pathophysiology and severity associated with hemoglobinopathies like sickle cell disease and thalassemia is well demonstrated. So many studies have focused on explain the pathways that involved in the re-activation of γ-globin gene expression. The HbF inducers are mainly includes chemotherapeutic agents (e.g. 5-Azacytidine and hydroxyurea, short-chain fatty acid derivatives (e.g. butyrates, valporate, sodium phenylbutyrate and other HbF inducers like stem cell factor and synthetic gene-targeted transcription factors. These HbF inducers have significant effects on improve clinical manifestations of hemoglobinopathies and decreasing transfusion dependency. But regarding some limitations of these agents, more studies for the investigation of new agents with more safety and effectiveness is needed.

  12. Genomic variants in the ASS1 gene, involved in the nitric oxide biosynthesis and signaling pathway, predict hydroxyurea treatment efficacy in compound sickle cell disease/β-thalassemia patients.

    Science.gov (United States)

    Chalikiopoulou, Constantina; Tavianatou, Anastasia-Gerasimoula; Sgourou, Argyro; Kourakli, Alexandra; Kelepouri, Dimitra; Chrysanthakopoulou, Maria; Kanelaki, Vasiliki-Kaliopi; Mourdoukoutas, Evangelos; Siamoglou, Stavroula; John, Anne; Symeonidis, Argyris; Ali, Bassam R; Katsila, Theodora; Papachatzopoulou, Adamantia; Patrinos, George P

    2016-03-01

    Hemoglobinopathies exhibit a remarkable phenotypic diversity that restricts any safe association between molecular pathology and clinical outcomes. Herein, we explored the role of genes involved in the nitric oxide biosynthesis and signaling pathway, implicated in the increase of fetal hemoglobin levels and response to hydroxyurea treatment, in 119 Hellenic patients with β-type hemoglobinopathies. We show that two ASS1 genomic variants (namely, rs10901080 and rs10793902) can serve as pharmacogenomic biomarkers to predict hydroxyurea treatment efficacy in sickle cell disease/β-thalassemia compound heterozygous patients. These markers may exert their effect by inducing nitric oxide biosynthesis, either via altering splicing and/or miRNA binding, as predicted by in silico analysis, and ultimately, increase γ-globin levels, via guanylyl cyclase targeting.

  13. Current status and developments in gene therapy for thalassemia and sickle cell disease

    Directory of Open Access Journals (Sweden)

    Evangelia Yannaki

    2014-12-01

    Full Text Available β-thalassemias and sickle cell anemia (SCA are the most common monogenic diseases worldwide for which curative treatments remain a desired goal. Allogeneic hematopoietic stem cell transplantation (allo-HCT, - the only curative treatment currently available for hemoglobinopaties-, has a narrow application window whereas it incurs several immunological risks. Gene therapy (GT, that is the autologous transplantation of genetically modified hematopoietic stem cells (CD34+, represents a promising new therapeutic strategy which is anticipated to reestablish effective hemoglobin production and render patients transfusion- and drug- independent without the immunological complications that normally accompany allo-HCT. Prior to the application of GT for hemoglobinopathies in the clinic, many years of extensive preclinical research were spent for the optimization of the gene transfer tools and conditions. To date, three GT clinical trials for β-thalassemia and sickle cell disease (SCD have been conducted or are in progress and 3 cases of transfusion independence in thalassemic β0/βΕ patients have been reported. In the present review, the prerequisites for successful implementation of GT, the tough pathway of GT for hemoglobinopathies towards the clinic and the knowledge gained from the first clinical trials as well as the remaining questions and challenges, will be discussed. Overall, after decades of research including achievements but pitfalls as well, the path to GT of human patients with hemoglobinopathies is currently open and highly promising...

  14. In silico analysis of single nucleotide polymorphism (SNPs in human β-globin gene.

    Directory of Open Access Journals (Sweden)

    Mohammed Alanazi

    Full Text Available Single amino acid substitutions in the globin chain are the most common forms of genetic variations that produce hemoglobinopathies--the most widespread inherited disorders worldwide. Several hemoglobinopathies result from homozygosity or compound heterozygosity to beta-globin (HBB gene mutations, such as that producing sickle cell hemoglobin (HbS, HbC, HbD and HbE. Several of these mutations are deleterious and result in moderate to severe hemolytic anemia, with associated complications, requiring lifelong care and management. Even though many hemoglobinopathies result from single amino acid changes producing similar structural abnormalities, there are functional differences in the generated variants. Using in silico methods, we examined the genetic variations that can alter the expression and function of the HBB gene. Using a sequence homology-based Sorting Intolerant from Tolerant (SIFT server we have searched for the SNPs, which showed that 200 (80% non-synonymous polymorphism were found to be deleterious. The structure-based method via PolyPhen server indicated that 135 (40% non-synonymous polymorphism may modify protein function and structure. The Pupa Suite software showed that the SNPs will have a phenotypic consequence on the structure and function of the altered protein. Structure analysis was performed on the key mutations that occur in the native protein coded by the HBB gene that causes hemoglobinopathies such as: HbC (E→K, HbD (E→Q, HbE (E→K and HbS (E→V. Atomic Non-Local Environment Assessment (ANOLEA, Yet Another Scientific Artificial Reality Application (YASARA, CHARMM-GUI webserver for macromolecular dynamics and mechanics, and Normal Mode Analysis, Deformation and Refinement (NOMAD-Ref of Gromacs server were used to perform molecular dynamics simulations and energy minimization calculations on β-Chain residue of the HBB gene before and after mutation. Furthermore, in the native and altered protein models, amino acid

  15. Laparoscopic versus open splenectomy in children with benign ...

    African Journals Online (AJOL)

    2017-06-28

    Jun 28, 2017 ... Thalassemia was present in 36 cases, idiopathic thrombocytopenic purpura ... hemoglobinopathies) and extracellular defects particu- larly autoimmune .... Thalassemia. 2. 2. Spherocytosis. 1. 0. ITP, idiopathic thrombocytopenic purpura; LS, laparoscopic splenectomy;. OS, open splenectomy. Laparoscopic ...

  16. Anemia among hospitalized children at a multispecialty hospital, Bangalore (Karnataka, India

    Directory of Open Access Journals (Sweden)

    Firdos Saba

    2014-01-01

    Full Text Available Background: Due to the limited availability of data related to anemia in hospitalized children, this research was conducted to study the occurrence, morphological patterns, distribution in different age groups, sex, and severity of anemia among children aged 6 months-12 years. Setting: Inpatients in department of pediatrics at a multispecialty hospital, Bangalore. Study Design: Descriptive cross sectional study from Oct, 2011 to Sep, 2012. Materials and Methods: Ethical clearance was obtained from the ethical committee of the hospital as per 1964 Declaration of Helsinki. Unrestricted random sampling method was used to select the study group consisting of 882 children between the age of 6 months and 12 years. After obtaining the consent, data were obtained and statistically analyzed using statistical tools like mean, median, standard deviation, and Chi-square test. Results: Out of 882 children selected, 642 (72.79% were anemic, out of which a majority of 629 (98% children suffered from nonhemoglobinopathies and a meagre 13 (2% suffered from hemoglobinopathies. Children in the age group of 6 months-1 year were most affected with nonhemoglobinopathies (33%. Moderate degree of anemia (hemoglobin = 7-9.9 g/dL was the commonest grade of anemia (80%, while microcytic hypochromic anemia was commonest morphological type of anemia (48%. Among hemoglobinopathies, thalassemia major was the most common (69%, that is 9 out of 13 patients. Conclusion: The occurrence of anemia among children aged between 6 months and 12 years is high and nonhemoglobinopathies predominate over the hemoglobinopathies.

  17. Hemoglobin Wayne Trait with Incidental Polycythemia.

    Science.gov (United States)

    Ambelil, Manju; Nguyen, Nghia; Dasgupta, Amitava; Risin, Semyon; Wahed, Amer

    2017-01-01

    Hemoglobinopathies, caused by mutations in the globin genes, are one of the most common inherited disorders. Many of the hemoglobin variants can be identified by hemoglobin analysis using conventional electrophoresis and high performance liquid chromatography; however hemoglobin DNA analysis may be necessary in other cases for confirmation. Here, we report a case of a rare alpha chain hemoglobin variant, hemoglobin Wayne, in a 47-year-old man who presented with secondary polycythemia. Capillary zone electrophoresis and high performance liquid chromatography revealed a significant amount of a hemoglobin variant, which was further confirmed by hemoglobin DNA sequencing as hemoglobin Wayne. Since the patient was not homozygous for hemoglobin Wayne, which is associated with secondary polycythemia, the laboratory diagnosis in this case was critical in ruling out hemoglobinopathy as the etiology of his polycythemia. © 2017 by the Association of Clinical Scientists, Inc.

  18. [Hemoglobinopathies and patients with foreign names].

    Science.gov (United States)

    Lilleholt, Kristin; Hallberg, Marit H; Hagve, Tor-Arne

    2005-05-04

    The diagnosis of haemoglobinopathies is of growing importance in Norway because of increasing immigration from countries where haemoglobinopathies are prevalent conditions. The aim of this study was to investigate the relationship between mean corpuscular volume (MCV) and the various haemoglobinopathies diagnosed in Norway. For a period of three years, all samples with MCV lower than 70 fl were also examined for beta-thalassaemia and haemoglobin variants HbS, HbC, HbE and HbD. A total of 263 samples with low MCV were analysed by high-pressure liquid chromatography. In 18% of the samples, a variant of haemoglobinopathy was found, mainly beta-thalassemia minor. 119 of the samples were from persons with an ethnic background from a country in which these diseases are common; all observed haemoglobinopathies were found in this group. 35% of persons with low MCV and a mainly African or Asian ethnic origin had a heterozygous haeomglobinopathy. Low MCV in patients with a foreign ethnic origin is a useful first step in the diagnosis of haemoglobinopathies.

  19. Future prospects for treatment of hemoglobinopathies.

    OpenAIRE

    Stamatoyannopoulos, J A

    1992-01-01

    Strategies for the treatment of sickle cell anemia and beta-thalassemia are founded on the knowledge that these disorders result from structural or functional defects in an adult gene for which an intact fetal counterpart exists. During the past decade, several pharmacologic agents have been investigated for their potential to ameliorate sickle cell anemia and beta-thalassemia by increasing the synthesis of fetal hemoglobin in adults. Progress in understanding globin gene regulation is now be...

  20. Molecular Epidemiology of Hemoglobinopathies in Cambodia.

    Science.gov (United States)

    Munkongdee, Thongperm; Tanakulmas, Jatuporn; Butthep, Punnee; Winichagoon, Pranee; Main, Barbara; Yiannakis, Miriam; George, Joby; Devenish, Robyn; Fucharoen, Suthat; Svasti, Saovaros

    2016-06-01

    Determining the magnitude of the thalassemia problem in a country is important for implementing a national prevention and control program. In order to acquire accurate thalassemia prevalence data, the gene frequency of α- and β-thalassemia (α- and β-thal) in different regions of a country should be determined. The molecular basis of thalassemia in Cambodia was performed by polymerase chain reaction (PCR)-based techniques in a community-based cross-sectional survey of 1631 unrelated individuals from three regions, Battambang, Preah Vihear and Phnom Penh. Thalassemia mutations were detected in 62.7% of the three studied population of Cambodia. Hb E (HBB: c.79G > A) was the most common β-globin gene mutation with a frequency ranging from 0.139 to 0.331, while the most frequent α-globin gene mutation was the -α(3.7) (rightward) deletion (0.098-0.255). The other frequencies were 0.001-0.003 for β-thal, 0.008-0.011 for α-thal-1 (- -(SEA)), 0.003-0.008 for α-thal-2 [-α(4.2) (leftward deletion)], 0.021-0.044 for Hb Constant Spring (Hb CS, HBA2: c.427T > C) and 0.009-0.036 for Hb Paksé (HBA2: c.429A > T). A regional specific thalassemia gene frequency was observed. Preah Vihear had the highest prevalence of Hb E (55.9%), α-thal-2 (24.0%) and nondeletional α-thal (15.1%), whereas Phnom Penh had the lowest frequency of thalassemia genes. Interestingly, in Preah Vihear, the frequency of Hb Paksé was extremely high (0.036), almost equivalent to that of Hb CS (0.044). Our results indicate the importance of micromapping and epidemiology studies of thalassemia, which will assist in establishing the national prevention and control program in Cambodia.

  1. 77 FR 32127 - Agency Information Collection Activities: Proposed Collection: Comment Request

    Science.gov (United States)

    2012-05-31

    ... technology. Proposed Project: Sickle Cell Disease Treatment Demonstration Program-- Quality Improvement Data Collection for the Hemoglobinopathy Learning Collaborative (OMB No. 0915-xxxx)--[New] Background: In response... is designed to improve access to services for individuals with sickle cell disease, improve and...

  2. Screening of Hemoglobin disorder in non-endemic region

    Directory of Open Access Journals (Sweden)

    Shiva Raj K.C.

    2017-09-01

    Full Text Available Hemoglobinopathies are group of inherited disorders which can broadly be classified into qualitative and quantitative defects. Qualitative defects include Sickle cell anemia whereas quantitative defect includes Thalassemia.  Sickle cell anemia is characterised by abnormality in the structure of haemoglobin in particular substitution of adenine in sixth codon of β gene (GAG-GTG, thereby encoding valine instead of glutamic acid in sixth position of β chain.1 In thalassemia there is reduced production of one or more globin chains. Thalassemia is generally classified into two broad categories: α-thalassemia and β-thalassemia usually caused by deletions of one or all four alleles of α- genes and point mutation β gene respectively. This results in reduction or absence in globin chain synthesis.Hemoglobinopathies can be either in trait or disease condition. People with traits do not require medical or follow-up care after the initial diagnosis is made. People with β-thalassemia trait should be warned that their condition can be misdiagnosed as the more common iron deficiency anemia and should avoid routine use of iron supplements. Counselling is indicated in all persons with genetic disorders, especially when the family is at risk of a severe form of disease that may be prevented.In Nepal, though actual data is not available, increased incidence of hemoglobinopathies is observed among the ethnic community of Terai region. As we know, inherited haemoglobin disorders (sickle-cell disorders and thalassaemias were originally characteristic of the tropics and subtropics. However, due to migration it has become common worldwide.2-5 In Nepal; hemoglobinopathies are seen in other population than from Terai. Hemoglobinopathies can be controlled cost-effectively by programmes that integrate treatment with carrier detection and genetic counselling, WHO has recommended global development of these services.5 A policy of detecting carriers and informing

  3. Thalassemia in Western Australia: 11 novel deletions characterized by Multiplex Ligation-dependent Probe Amplification.

    NARCIS (Netherlands)

    Phylipsen, M.; Prior, J.F.; Lim, E.; Lingam, N.; Vogelaar, I.P.; Giordano, P.C.; Finlayson, J.; Harteveld, C.L.

    2010-01-01

    The number of immigrants in Western Australia from many different areas where hemoglobinopathies are endemic has increased dramatically since the 1970s. Therefore, many different thalassemia mutations have been introduced in the country, which add a technological diagnostic problem to the serious

  4. Erythropoiesis and Hemoglobin Regulation: A journey from laboratory to disorders

    NARCIS (Netherlands)

    F. Esteghamat (Sahar)

    2011-01-01

    textabstractThe hematopoietic system provides one of the most attractive systems for studies on development at both levels of molecular characterization and systems biology. Among the single-gene related disorders, hemoglobinopathies ranked on top with the prevalence of 4.83% in the world

  5. CD34+ (Non-Malignant) Stem Cell Selection for Patients Receiving Allogeneic Stem Cell Transplantation

    Science.gov (United States)

    2017-07-13

    Bone Marrow Failure Syndrome; Severe Aplastic Anemia; Severe Congenital Neutropenia; Amegakaryocytic Thrombocytopenia; Diamond-Blackfan Anemia; Schwachman Diamond Syndrome; Primary Immunodeficiency Syndromes; Acquired Immunodeficiency Syndromes; Histiocytic Syndrome; Familial Hemophagocytic Lymphocytosis; Lymphohistiocytosis; Macrophage Activation Syndrome; Langerhans Cell Histiocytosis (LCH); Hemoglobinopathies; Sickle Cell Disease; Sickle Cell-beta-thalassemia

  6. 75 FR 52533 - Agency Information Collection Activities: Proposed Collection: Comment Request

    Science.gov (United States)

    2010-08-26

    ... Minimum Database Project Sickle Cell Trait/Carrier (MDP SCT) Questionnaire, and (3) the MDP Hemoglobinopathies Emerging Populations Questionnaire. Respondents: The MDP SCD and the MDP SCT Questionnaires will... participate in either the SCD questionnaire or the SCT questionnaire depending on their disease or carrier...

  7. Bilateral Simultaneous Macular Infarction with Spontaneous Visual ...

    African Journals Online (AJOL)

    To report the rare and dramatic event of bilateral macular infarction in a sickle cell hemoglobinopathy (SS genotype) patient, resulting in bilateral severe reduction in visual acuity. Without any intervention, the patient's vision gradually improved over the follow‑up period. Central visual field defects however persisted.

  8. Synthetic review on the different anthropological aspects of ...

    African Journals Online (AJOL)

    Hemoglobinopathies are a group of hereditary hemolytic anemia characterized by qualitative (sickle cell disease) or quantitative (thalassemia) defects in the alpha or beta-globin chain synthesis. Homozygotes or compound heterozygotes for the mutated alpha or beta-globin genes can cause severe anemia at an early age.

  9. Hb Agenogi [β90(F6)Glu→Lys (GAG>AAG) HBB: c.271G>A)] in a Pregnant Thai Woman.

    Science.gov (United States)

    Panyasai, Sitthichai; Thongsuk, Pollawat; Pornprasert, Sakorn

    2016-01-01

    Hb Agenogi [β90(F6)Glu→Lys (GAG>AAG) HBB: c.271G>A)] is a very rare β-globin chain variant. We report for the first time this hemoglobinopathy in a pregnant 20-year-old Thai woman. She was seen by an obstetrician at her 14th week of gestation. She was pale and had an inflammatory lesion of her lower left leg. The hemoglobin (Hb) analysis by high performance liquid chromatography (HPLC) and low pressure liquid chromatography (LPLC) showed a peak of abnormal Hb at the C window. On capillary electrophoresis (CE), the abnormal Hb peak was observed at electrophoretic zone 4 that corresponded to the Hb E (HBB: c.79G>A) peak. Direct DNA sequencing revealed a GAG>AAG mutation at codon 90 of the β-globin gene. Thus, even though Hb Agenogi is very rare, it can be found in Thai people. The knowledge and understanding of this hemoglobinopathy will be used to assist in diagnosis, management and counseling for patients.

  10. Aconselhamento genético do paciente com doença falciforme Genetic counseling in the sickle cell disease

    Directory of Open Access Journals (Sweden)

    Antonio Sérgio Ramalho

    2007-09-01

    Full Text Available O aconselhamento genético é um componente importante da conduta médica na doença falciforme, apresentando relevantes implicações médicas, psicológicas, sociais, éticas e jurídicas. No presente trabalho são apresentadas as considerações sobre esse processo, elaboradas pelo Serviço de Aconselhamento Genético em Hemoglobinopatias da Unicamp, mediante solicitação do Programa Nacional de Atenção Integral às Pessoas com Doença Falciforme e outras Hemoglobinopatias do Ministério da Saúde.Genetic counseling is a major component of medical conduct in sickle cell disease with relevant medical, psychological, social, ethical and judicial implications. In the current work considerations of this process elaborated by the Genetic Counseling Service on Hemoglobinopathies of Unicamp at the request of the National Program of Comprehensive Care to Sufferers of Sickle Cell Disease and other Hemoglobinopathies, of the Brazilian Ministry of Health, are presentedl.

  11. Orbital Infarction due to Sickle Cell Disease without Orbital Pain

    Directory of Open Access Journals (Sweden)

    Cameron L. McBride

    2016-01-01

    Full Text Available Sickle cell disease is a hemoglobinopathy that results in paroxysmal arteriolar occlusion and tissue infarction that can manifest in a plurality of tissues. Rarely, these infarcted crises manifest in the bony orbit. Orbital infarction usually presents with acute onset of periorbital tenderness, swelling, erythema, and pain. Soft tissue swelling can result in proptosis and attenuation of extraocular movements. Expedient diagnosis of sickle cell orbital infarction is crucial because this is a potentially sight-threatening entity. Diagnosis can be delayed since the presentation has physical and radiographic findings mimicking various infectious and traumatic processes. We describe a patient who presented with sickle cell orbital crisis without pain. This case highlights the importance of maintaining a high index of suspicion in patients with known sickle cell disease or of African descent born outside the United States in a region where screening for hemoglobinopathy is not routine, even when the presentation is not classic.

  12. Pulmonary Extramedullary Hematopoiesis in a Patient with Chronic Asthma Resembling Lung Cancer: A Case Report

    Directory of Open Access Journals (Sweden)

    Massood Hosseinzadeh

    2012-01-01

    Full Text Available Background. Extramedullary hematopoiesis is most often seen in reticuloendothelial organs specially spleen, liver, or lymph nodes, and it is rarely seen in lung parenchyma. Almost all reported cases of pulmonary extramedullary hematopoiesis occurred following myeloproliferative disorders specially myelofibrosis. Other less common underlying causes are thalassemia syndromes and other hemoglobinopathies. There was not any reported case of pulmonary extramedullary hematopoiesis in asthmatic patients in the medical literature. Case. Here we reported a 65-year-old lady who was a known case of bronchial asthma with recent developed right lower lobe lung mass. Chest X-ray and CT studies showed an infiltrating mass resembling malignancy. Fine needle aspiration cytology of mass revealed pulmonary extramedullary hematopoiesis. The patient followed for 10 months with serial physical examination and laboratory evaluations which were unremarkable. Conclusion. Extramedullary hematopoiesis of lung parenchyma can be mistaken for lung cancer radiologically. Although previous reported cases occurred with myelofibrosis or hemoglobinopathies, we are reporting the first case of asthma-associated extramedullary hematopoiesis.

  13. Identificação de variantes de hemoglobina em doadores de sangue Identification of hemoglobin variants in blood donor

    Directory of Open Access Journals (Sweden)

    Ana C. Bonini-Domingos

    2004-03-01

    Full Text Available Hemoglobinopathies are the most common genetic diseases and affect a great number of individuals in the world, with diverse clinical complications ranging from the almost unnoticeable to lethal consequences. In Brazil the occurrence of hemoglobinopathies is very frequent and influenced by the ethnical groups that are the basis of populations in different regions. The phenotype may be influenced by environmental and genetic factors and by migration. An understanding of these genetic diseases is important for the health and quality of life of the population. In this work we assessed the presence of Hb variants in blood donors from São José do Rio Preto and region, and we observed the occurrence of variants including Hb S and Hb C but in particular the so-called "S-Like" variants. Good determination of the forms of variant hemoglobins is very important to give better guidance to blood donors and their families, and to improve the quality of blood transfusion.

  14. AB027. Developing capacity for variant data sharing in low and middle income countries: HVP’s Global Globin 2020 Challenge

    Science.gov (United States)

    Robinson, Helen M.

    2015-01-01

    The hemoglobinopathies, collectively, are cause for significant morbidity and mortality. Children are the most severely affected. Despite much of the genetics and biology of hemoglobinopathies being known for a long time, and being used successfully in some countries to systematically reduce burden of disease, many low and medium income countries remain practically untouched by recent developments in human genomics involving the systematic collection and sharing of variation data to fighting hemoglobinopathies (notably thalassaemias and sickle cell disease, but also G6PD). Commitment to systematic variant data collection is increasing, but this is occurring mostly in high-income countries where much of the diagnosis and testing takes place. There is a risk that countries with the highest burden of these diseases are being left behind in a form of “genomic divide”. Capacity to generate quality data on variants, to store this information so that it can be shared internationally, needs to be built in these countries. Tackling hemoglobinopathies is an ideal entry point for these countries to develop the necessary infrastructure and expertise that can expand into other areas of health. This genomic capacity will enable building: (I) the genetic evidence base for better management of delivery of local treatment, care and eventually even cure; (II) a foundation for genomic medicine by working with national, regional and local health care professionals to raise public awareness of the genetic basis of hemoglobinopathies. Global Globin 2020 Challenge has been initiated with two goals: (I) to see growth in the quality and quantity of curated inputs into internationally recognized genetic databases from low- and middle-income countries participating in the project, and to harmonize the sharing of all relevant variant data between countries in accordance with international best practice that integrates all the relevant ethical and regulatory frameworks and policies

  15. Bone Marrow Transplantation (BMT) and Gene Replacement ...

    African Journals Online (AJOL)

    Abstract. Background: Sickle cell anemia (SCA) forms one of the neglected tropical disease of genetic aetiology. Unlike many complex genetic diseases inherited on a multiallelic pattern, SCA is a hemoglobinopathy of Mendelian type genetic inheritance. The SCA trait is inherited through a recessive autosomal link, with the ...

  16. PRENATAL DIAGNOSIS OF β-THALASSEMIAS AND HEMOGLOBINOPATHIES

    Directory of Open Access Journals (Sweden)

    Luisella Saba

    2009-06-01

    Full Text Available

     

    Prenatal diagnosis of β-thalassemia was accomplished for the first time in the 1970s by globin chain synthesis analysis on fetal blood obtained by placental aspiration at 18-22 weeks gestation. Since then, the molecular definition of the β- globin gene pathology, the development of procedures of DNA analysis, and the introduction of chorionic villous sampling have dramatically improved prenatal diagnosis of this  disease and of related disorders.  Much information is now available about the molecular mechanisms of the diseases and the molecular testing is widespread.

    As prenatal diagnosis has to provide an accurate, safe and early result, an efficient screening of the population and a rapid molecular characterization of the couple at risk, are necessary prerequisites. In the last decades  earlier and less invasive approaches for prenatal diagnosis were developed . A overview of the most promising procedure will be done.

    Moreover, in order to reduce the choice of   interrupting  the pregnancy in case of affected fetus, Preimplantation or Preconceptional Genetic Diagnosis (PGD has been setting up for several diseases including thalassemias.

     

  17. PRENATAL DIAGNOSIS OF β-THALASSEMIAS AND HEMOGLOBINOPATHIES

    Directory of Open Access Journals (Sweden)

    Maria Cristina Rosatelli

    2009-11-01

    Moreover, in order to reduce the choice of   interrupting  the pregnancy in case of affected fetus, Preimplantation or Preconceptional Genetic Diagnosis (PGD has been setting up for several diseases including thalassemias.

  18. In Utero Hematopoietic Cell Transplantation for Hemoglobinopathies

    Directory of Open Access Journals (Sweden)

    Tippi C. Mackenzie

    2015-01-01

    Full Text Available In utero hematopoietic cell transplantation (IUHCTx is a promising strategy to circumvent the challenges of postnatal hematopoietic stem cell (HSC transplantation. The goal of IUHCTx is to introduce donor cells into a naïve host prior to immune maturation, thereby inducing donor–specific tolerance. Thus, this technique has the potential of avoiding host myeloablative conditioning with cytotoxic agents. Over the past two decades, several attempts at IUHCTx have been made to cure numerous underlying congenital anomalies with limited success. In this review, we will briefly review the history of IUHCTx and give a perspective on alpha thalassemia major, one target disease for its clinical application.

  19. Intracardiac tumor: A risk factor for stroke in the young –A case report

    African Journals Online (AJOL)

    Intracardiac mass should be considered a possible risk factor for ischemic stroke in young adult, especially in the absence of other risk factors such as connective tissue disorders, HIV/AIDS, hemoglobinopathy or use of recreational drugs. High index of suspicion is required in order not to overlook such source of emboli.

  20. 77 FR 59935 - National Heart, Lung, And Blood Institute; Notice of Closed Meetings

    Science.gov (United States)

    2012-10-01

    ... Institute Special Emphasis Panel; NHLBI Resource-Related Research Project for Stem Cells and Cardiomyopathy...; Excellence in Hemoglobinopathies Research. Date: October 22-23, 2012. Time: 8:00 a.m. to 5:00 p.m. Agenda: To.... 93.233, National Center for Sleep Disorders Research; 93.837, Heart and Vascular Diseases Research...

  1. Author Details

    African Journals Online (AJOL)

    Chibani, JB. Vol 1, No 5 (2012) - Articles Origins and spreads of Alpha 1 antitrypsin variants in world human populations: a synthetic review. Abstract PDF · Vol 1, No 5 (2012) - Articles Synthetic review on the different anthropological aspects of hemoglobinopathies in Tunisia Abstract PDF. ISSN: 1737-8176. AJOL African ...

  2. Triagem de hemoglobinopatias em doadores de sangue de Caxias do Sul, Rio Grande do Sul, Brasil: prevalência em área de colonização italiana Screening for hemoglobinopathies in blood donors from Caxias do Sul, Rio Grande do Sul, Brazil: prevalence in an Italian colony

    Directory of Open Access Journals (Sweden)

    Cristina Lucia Alberti Lisot

    2004-12-01

    Full Text Available A alta prevalência de beta-talassemia em italianos e a participação dos mesmos na formação étnica da cidade de Caxias do Sul e arredores, Rio Grande do Sul, Brasil, conduziram-nos à investigação de hemoglobinopatias em uma amostra de 608 doadores de sangue do Hemocentro Regional de Caxias do Sul. Apesar da influência étnica, encontramos 1,81% de hemoglobinas anormais (0,16% Hb AC, 0,99%, Hb AS e 0,66% Hb AH, um padrão similar com o estudo do interior do Estado do Rio Grande do Sul para alterações qualitativas. Para as talassemias, as técnicas mais comuns, cruzadas com seqüenciamento de DNA, em nossas mãos, não foram capazes de esclarecer anormalidades quantitativas da hemoglobina. Esse resultado pode ser atribuído a alterações genéticas ainda não conhecidas, a limitações técnicas ou, mais simplesmente, à miscigenação.The high prevalence of beta thalassemia among Italians and their participation in the ethnic formation of Caxias do Sul, Rio Grande do Sul State, Brazil, and neighboring cities prompted us to investigate hemoglobinopathies in 608 blood donors at the Caxias do Sul Regional Blood Center. Despite the ethnic influence, abnormal hemoglobin levels were found in only 1.81% of the donors (0.16% Hb AC, 0.99% Hb AS, and 0.66% Hb AH, similar to the levels observed in a study on qualitative disorders conducted in the rural area of Rio Grande do Sul. In our setting, the most commonly used screening tests for thalassemia, combined with DNA sequencing, were unable to detect quantitative hemoglobin synthesis disorders. This may be attributable to still-unknown genetic disorders, technical limitations, or simply to miscegenation.

  3. HB Puerta del Sol [HBA1:c.148A>C], HB Valdecilla [HBA2:c.3G>T], HB Gran Vía [HBA2:c.98T>G], HB Macarena [HBA2:c.358C>T] and HB El Retiro [HBA2:c.364_366dupGTG]: description of five new hemoglobinopathies.

    Science.gov (United States)

    de la Fuente-Gonzalo, Félix; Nieto, Jorge M; Velasco, Diego; Cela, Elena; Pérez, Germán; Fernández-Teijeiro, Ana; Escudero, Antonio; Villegas, Ana; González-Fernández, Fernando A; Ropero, Paloma

    2016-04-01

    Structural hemoglobinopathies do not usually have a clinical impact, but they can interfere with the analytical determination of some parameters, such as the glycated hemoglobin in diabetic patients. Thalassemias represent a serious health problem in areas where their incidence is high. The defects in the post-translational modifications produce hyper-unstable hemoglobin that is not detected by most of electrophoretic or chromatographic methods that are available so far. We studied seven patients who belong to six unrelated families. The first two families were studied because they had peak abnormal hemoglobin (Hb) during routine analytical assays. The other four families were studied because they had microcytosis and hypochromia with normal HbA2 and HbF without iron deficiency. HbA2 and F quantification and abnormal Hb separation were performed by chromatographic and electrophoretic methods. The molecular characterization was performed using specific sequencing. The Hb Puerta del Sol presents electrophoretic mobility and elution in HPLC that is different from HbA and similar to HbS. The electrophoretic and chromatographic profiles of the four other variants are normal and do not show any anomalies, and their identification was only possible with sequencing. Some variants, such as Hb Valdecilla, Hb Gran Vía, Hb Macarena and Hb El Retiro, have significant clinical impact when they are associated with other forms of α-thalassemia, which could lead to more serious forms of this group of pathologies as for HbH disease. Therefore, it is important to maintain an adequate program for screening these diseases in countries where the prevalence is high to prevent the occurrence of severe forms.

  4. Hematopoietic Stem Cell Transplant for High Risk Hemoglobinopathies

    Science.gov (United States)

    2017-12-03

    Sickle Cell Disease; Transfusion Dependent Alpha- or Beta- Thalassemia; Diamond Blackfan Anemia; Paroxysmal Nocturnal Hemoglobinuria; Glanzmann Thrombasthenia; Severe Congenital Neutropenia; Shwachman-Diamond Syndrome; Non-Malignant Hematologic Disorders

  5. AB034. Hemoglobinopathies in China and SEA: rapid targeted deep sequencing for molecular screening and clinical genotyping in subjects with hemoglobinopathies

    OpenAIRE

    Qi, Ming

    2015-01-01

    Hemoglobin disorder is one of the most common birth defects in the world. α and β thalassemia are prevalent in tropical and subtropical regions. The imbalance of α and β hemoglobin is the pathological mechanism and the base of clinical classification of α and β thalassemia. In Southern China, 17 gross deletions account for 70-80%, and 13 point mutations, for 20-30% of α-thalassemia. Fifty-two point mutations account for 97% for β-thalassemia. Six deletions cause δβ-thalassemia or HPFH. Fetal ...

  6. Iron deficiency anemia interfering the diagnosis of compound heterozygosity for Hb constant spring and Hb Paksé: The first case report.

    Science.gov (United States)

    Chiasakul, Thita; Uaprasert, Noppacharn

    2018-01-01

    Diagnosis of thalassemia or hemoglobinopathy concomitant with iron deficiency anemia (IDA) is challenging. We report a case of 43-year-old female whose diagnosis of compound heterozygosity for hemoglobin Constant Spring (HbCS) and Hb Paksé became apparent after the treatment of IDA. Prior to treatment, Hb analysis using isoelectric focusing (IEF) showed HbA 95.6%, HbA 2 2.7%, and HbCS 1.7% compatible with heterozygous HbCS. After 4 months of oral iron therapy resulting in an improved Hb level, her HbCS level was substantially increased to 8.7% on IEF suggesting homozygous HbCS. Subsequent DNA analysis using multiplex amplification refractory mutation system analysis revealed compound heterozygosity for HbCS and Hb Paksé. This case demonstrated that IDA can significantly reduce HbCS/Hb Paksé levels and probably mask the diagnosis of homozygous HbCS, homozygous Hb Paksé or the compound heterozygosity for both hemoglobinopathies by hemoblogin analysis. The test should be repeated after resolution of IDA, or molecular testing should be performed to confirm the diagnosis. © 2017 Wiley Periodicals, Inc.

  7. Guidelines for the Standard Monitoring of Patients With Thalassemia: Report of the Thalassemia Longitudinal Cohort.

    Science.gov (United States)

    Tubman, Venée N; Fung, Ellen B; Vogiatzi, Maria; Thompson, Alexis A; Rogers, Zora R; Neufeld, Ellis J; Kwiatkowski, Janet L

    2015-04-01

    Chronic transfusion therapy has played a central role in extending life expectancy for patients with hemoglobinopathies such as thalassemia. However, this life-saving therapy is associated with numerous complications that now comprise the bulk of management considerations for patients with thalassemia. This review reports on the experience of the Thalassemia Longitudinal Cohort and reviews available literature to establish guidelines for the management of patients with thalassemia.

  8. Molecular Diagnostics of ?-Thalassemia

    OpenAIRE

    Atanasovska, B; Bozhinovski, G; Chakalova, L; Kocheva, S; Karanfilski, O; Plaseska-Karanfiska, D

    2012-01-01

    A high-quality hemoglobinopathy diagnosis is based on the results of a number of tests including assays for molecular identification of causative mutations. We describe the current diagnostic strategy for the identification of ?-thalassemias and hemoglobin (Hb) variants at the International Reference Laboratory for Haemoglobinopathies, Research Centre for Genetic Engineering and Biotechnology (RCGEB) ?Georgi D. Efremov,? Skopje, Republic of Macedonia. Our overall approach and most of the meth...

  9. The human ankyrin 1 promoter insulator sustains gene expression in a β-globin lentiviral vector in hematopoietic stem cells

    Directory of Open Access Journals (Sweden)

    Zulema Romero

    Full Text Available Lentiviral vectors designed for the treatment of the hemoglobinopathies require the inclusion of regulatory and strong enhancer elements to achieve sufficient expression of the β-globin transgene. Despite the inclusion of these elements, the efficacy of these vectors may be limited by transgene silencing due to the genomic environment surrounding the integration site. Barrier insulators can be used to give more consistent expression and resist silencing even with lower vector copies. Here, the barrier activity of an insulator element from the human ankyrin-1 gene was analyzed in a lentiviral vector carrying an antisickling human β-globin gene. Inclusion of a single copy of the Ankyrin insulator did not affect viral titer, and improved the consistency of expression from the vector in murine erythroleukemia cells. The presence of the Ankyrin insulator element did not change transgene expression in human hematopoietic cells in short-term erythroid culture or in vivo in primary murine transplants. However, analysis in secondary recipients showed that the lentiviral vector with the Ankyrin element preserved transgene expression, whereas expression from the vector lacking the Ankyrin insulator decreased in secondary recipients. These studies demonstrate that the Ankyrin insulator may improve long-term β-globin expression in hematopoietic stem cells for gene therapy of hemoglobinopathies.

  10. An Atypical Case of Methemoglobinemia due to Self-Administered Benzocaine

    Directory of Open Access Journals (Sweden)

    Thomas M. Nappe

    2015-01-01

    Full Text Available Acquired methemoglobinemia is an uncommon hemoglobinopathy that results from exposure to oxidizing agents, such as chemicals or medications. Although, as reported in the adult population, it happens most often due to prescribed medication or procedural anesthesia and not due to easily accessed over-the-counter medications, the authors will describe an otherwise healthy male adult with no known medical history and no prescribed medications, who presented to the emergency department reporting generalized weakness, shortness of breath, headache, dizziness, and pale gray skin. In addition, the patient reported that he also had a severe toothache for several days, which he had been self-treating with an over-the-counter oral benzocaine gel. Ultimately, the diagnosis of methemoglobinemia was made by clinical history, physical examination, and the appearance of chocolate-colored blood and arterial blood gas (ABG with cooximetry. After 2 mg/kg of intravenous methylene blue was administered, the patient had complete resolution of all signs and symptoms. This case illustrates that emergency physicians should be keenly aware of the potential of toxic hemoglobinopathy secondary to over-the-counter, nonprescribed medications. Discussion with patients regarding the dangers of inappropriate use of these medicines is imperative, as such warnings are typically not evident on product labels.

  11. Management of immigration and pregnancy screening in northeastern Italy

    Directory of Open Access Journals (Sweden)

    Giorgio Tamaro

    2011-01-01

    Full Text Available Giorgio Tamaro, Sergio ParcoDepartment of Laboratory Medicine, Children's Hospital, Burlo Garofolo, Trieste, ItalyAbstract: This study assesses the impact of immigration in Friuli Venezia Giulia, a region of northeastern Italy, on the epidemiological features of hemoglobin patterns and on prothrombotic and trisomy risk in pregnancy for patients of non-Italian origin. This study follows a series of studies on the incidence of thalassemia and other hemoglobinopathies with reduced globin chain synthesis, that were performed during the postwar (1939–45 period in Friuli Venezia Giulia following immigration into the region from Istria and Sardinia (regions of northern and central Italy. Current data show that today’s constantly growing immigration into the region differs from previous decades, in terms of origin and quantity of migrants, who mainly come from third world countries. This has a significant impact on health care issues, and more specifically on prospective health screening for foreigners. The authors conclude that scholastic education and hospital services, either public or private, and voluntary associations, may contribute to solving the problem, but only in terms of training and organization, for non-European Union citizens arriving in northern Italy and neighboring areas, especially those from Africa, Asia, Latin America, and eastern Europe.Keywords: immigration, hemoglobinopathy, pregnancy, trisomy, thalassemia trait, Italy

  12. An Atypical Case of Methemoglobinemia due to Self-Administered Benzocaine.

    Science.gov (United States)

    Nappe, Thomas M; Pacelli, Anthony M; Katz, Kenneth

    2015-01-01

    Acquired methemoglobinemia is an uncommon hemoglobinopathy that results from exposure to oxidizing agents, such as chemicals or medications. Although, as reported in the adult population, it happens most often due to prescribed medication or procedural anesthesia and not due to easily accessed over-the-counter medications, the authors will describe an otherwise healthy male adult with no known medical history and no prescribed medications, who presented to the emergency department reporting generalized weakness, shortness of breath, headache, dizziness, and pale gray skin. In addition, the patient reported that he also had a severe toothache for several days, which he had been self-treating with an over-the-counter oral benzocaine gel. Ultimately, the diagnosis of methemoglobinemia was made by clinical history, physical examination, and the appearance of chocolate-colored blood and arterial blood gas (ABG) with cooximetry. After 2 mg/kg of intravenous methylene blue was administered, the patient had complete resolution of all signs and symptoms. This case illustrates that emergency physicians should be keenly aware of the potential of toxic hemoglobinopathy secondary to over-the-counter, nonprescribed medications. Discussion with patients regarding the dangers of inappropriate use of these medicines is imperative, as such warnings are typically not evident on product labels.

  13. [Coexisting systemic lupus erythematosus and sickle cell disease: case report and literature review].

    Science.gov (United States)

    Robazzi, Teresa Cristina M V; Alves, Crésio; Abreu, Laís; Lemos, Gabriela

    2015-01-01

    To report a case of coexisting systemic lupus erythematosus (SLE) and sickle cell disease (SCD) with a review of the literature on the topic. Report of case and research of the association between SLE and SCD in literature through scientific articles in health sciences databases, such as LILACS, MEDLINE/Pubmed and Scielo, until May 2012. Descriptors used: 1. Sickle cell anemia; 2. Sickle cell disease; 3. Systemic lupus erythematosus; 4. Hemoglobinopathies. The authors describe an association between SLE and SS hemoglobinopathy in an eight-year-old female patient displaying articular, hematologic and neuropsychiatric manifestations during clinical evolution. Forty-five cases of association between SLE and SCD are described in literature, mostly adult (62.2%), women (78%) and with the SS phenotype in 78% of the cases, and different clinical manifestations. Compared with our patient, articular, hematologic and neuropsychiatric manifestations were present in 76%, 36% and 27% of the cases, respectively. SLE and SCD are chronic diseases that have several clinical and laboratory findings in common, meaning difficult diagnosis and difficulty in finding the correct treatment. Although the association between these diseases is not common, it is described in literature, so it is imperative that physicians who treat such diseases be alert to this possibility. Copyright © 2012 Elsevier Editora Ltda. All rights reserved.

  14. SCREENING CORD BLOOD FOR HEMOGLOBINOPATHIES AND THALASSEMIA BY HPLC

    NARCIS (Netherlands)

    VANDERDIJS, FPL; VANDENBERG, GA; SCHERMER, JG; MUSKIET, FD; LANDMAN, H; MUSKIET, FAJ

    We evaluated the use of an HPLC method for screening hemoglobins in cord blood. We studied the genotype frequencies of the structural hemoglobin variants HbS and HbC and the synthesis variants alpha- and beta+-thalassemia in babies born on Curacao. During three months, 67.2% of all (748) newborns

  15. Fetal red blood cell parameters in thalassemia and hemoglobinopathies.

    Science.gov (United States)

    Karnpean, Rossarin; Fucharoen, Goonnapa; Fucharoen, Supan; Ratanasiri, Thawalwong

    2013-01-01

    With the lack of fetal blood specimens in routine practice, little is known about red blood cell (RBC) parameters of fetuses with various thalassemia syndromes. This study aimed to describe these in various forms of thalassemia. The study was performed on 93 fetal blood specimens obtained from pregnant women by cordocentesis during 18-24 weeks of gestation. RBC parameters were recorded on automated analyzer. Hemoglobin (Hb) and DNA analyses were performed for definite genotyping. No significant difference in RBC parameters was observed between non-thalassemic fetuses and those with β-thalassemia trait, Hb E trait, homozygous Hb E and β-thalassemia/Hb E disease. However, in those with α(0)-thalassemia trait and double heterozygous α(0)-thalassemia/Hb E, slight reduction in mean corpuscular volume (MCV) was noted. Fetuses with the Hb H disease showed significant reductions in Hb, MCV and mean corpuscular Hb (MCH). Marked reductions in Hb, hematocrit, MCH and mean cell Hb concentration and increased RBC distribution width with numerous nucleated RBC were clearly observed in Hb Bart's hydrops fetalis. Simple analysis of fetal RBC parameters is useful for making presumptive prenatal diagnosis of α-thalassemia syndromes including Hb H disease and Hb Bart's hydrops fetalis which can then be confirmed by Hb and DNA analyses. Copyright © 2013 S. Karger AG, Basel.

  16. Hemoglobinopathies in the Çukurova Region and Neighboring Provinces.

    Science.gov (United States)

    Yuzbasioglu Ariyurek, Sedefgul; Yildiz, Sule Menziletoglu; Yalin, Ali Erdinc; Guzelgul, Figen; Aksoy, Kiymet

    2016-06-01

    To contribute to the creation of a mutation map of the region, we aimed to determine the mutation spectrum of thalassemias and abnormal hemoglobins (Hbs) in the Çukurova region and surrounding provinces. In this study, a total of 8135 samples from Adana, Hatay, Mersin, Konya and Kayseri provinces between 1993 and 2014 were analyzed. Complete blood cell (CBC) counts and Hb typing were carried out using automatic cell counters, cellulose acetate membrane electrophoresis and high performance liquid chromatography (HPLC), respectively. For the molecular analyses, genomic DNA was extracted using both manual and automated DNA extraction devices. Determination of Hb mutations were done by microarray, restriction fragment length polymorphism (RFLP), amplification refractory mutation system (ARMS) and gap-polymerase chain reaction (gap-PCR) methodologies. Samples were analyzed for abnormal Hb and thalassemia mutations. Out of 8135 samples, 1382 were observed to be carrying Hb mutations. It was identified that 826 mutation carriers included abnormal Hbs with a frequency of 59.7%, 416 carriers included β-thalassemia (β-thal) mutations with a frequency of 30.7% and 136 carriers included α-thalassemia (α-thal) mutations with a frequency of 9.9%. In this study, the most frequently observed abnormal Hb in the region was Hb S [β6(A3)Glu→Val (GTG > GAG), HBB: c.20T > A], whereas the most commonly observed mutations were the IVS-I-110 (G > A) (HBB: c.93-21G > A) point mutation in β-thal and the 3.7 kb deletion in α-thal.

  17. Are we united enough to come down with common charter of demands: the health professionals’ perspective

    Directory of Open Access Journals (Sweden)

    Antonis Kattamis

    2014-12-01

    Full Text Available Providing optimal care for patients with hemoglobinopathies is common goal for all the health professionals working on the field. The medical community has adopted best practices guidelines to provide similar therapeutic plans. The pre-requisites for an effective health system cover all aspects from infrastructure to organization flow, staffing and public interventions. If economic resources are limited, best available option, which will not differ from ‘optimal care’, need to be found.

  18. Prevalência de hemoglobinas anormais em recém-nascidos da cidade de Natal, Rio Grande do Norte, Brasil Prevalence of abnormal hemoglobins in newborns in Natal, Rio Grande do Norte, Brazil

    Directory of Open Access Journals (Sweden)

    Maria Cristina Pignataro Emerenciano de Araújo

    2004-02-01

    Full Text Available As hemoglobinopatias estão incluídas dentre as doenças hereditárias mais freqüentes nas populações humanas. Estudos realizados em diferentes regiões do Brasil têm demonstrado que as hemoglobinas anormais S e C são as mais prevalentes. Com o objetivo de investigar a prevalência de hemoglobinas anormais no período neonatal, foram analisadas 1.940 amostras de sangue de cordão umbilical provenientes de recém-nascidos de três maternidades da cidade de Natal, Rio Grande do Norte. Todas as amostras foram submetidas à eletroforese de hemoglobina em acetato de celulose utilizando tampão Tris-EDTA-Borato pH 8,5. As amostras que apresentaram hemoglobinas anormais foram submetidas à eletroforese em gel de ágar pH 6,2 para confirmação. Foram identificadas 37 (1,91% amostras com hemoglobinas anormais, das quais 29 (1,50% com traço falciforme (Hb FAS, 06 (0,31 % com Hb C, uma (0,05 % com anemia falciforme (Hb FS e uma (0,05 % apresentou Hb Bart's, sugerindo alfa talassemia. Os resultados encontrados evidenciam a necessidade de implantação da triagem de hemoglobinopatias em recém-nascidos na nossa população.Hemoglobinopathies are among the most prevalent hereditary diseases in humans. Studies in different areas of Brazil have identified the prevalence of S and C abnormal hemoglobins. The study analyzed 1,940 cord blood samples of newborns from maternity hospitals in Natal, Rio Grande do Norte State, to investigate the prevalence of abnormal hemoglobins. All samples were submitted to cellulose acetate electrophoresis using a Tris-EDTA-borate buffer at pH 8.5. Electrophoresis in agar gel pH 6.2 was performed on samples presenting abnormal hemoglobin. Some 37 (1.91% of the newborns presented hemoglobinopathies, as follows: 29 (1.50% sickle cell trait (Hb FAS, 6 (0.31% heterozygous Hb C (Hb FAC, one (0.05% homozygous Hb S (Hb FS, and one (0.05% Hb Barts suggestive of alpha thalassemia. The results show the need to implement screening for

  19. Intra-operative cell salvage and sickle cell trait in liver transplantation: time to re-consider?

    Science.gov (United States)

    Loh, P S; Gilder, F; Klinck, J

    2018-04-19

    Sickle cell trait (SCT), characterized by the sickle hemoglobin (HbS) gene in a heterozygous state is the most common hemoglobinopathy worldwide that is typically asymptomatic in affected individuals [1]. In Europe, migration has increased the prevalence, raising concerns about its clinical impact [1]. For example, the use of intraoperative cell salvage may induce sickling because of hypoxia during processing [2]. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  20. Thalassemia and malaria: new insights into an old problem.

    Science.gov (United States)

    Clegg, J B; Weatherall, D J

    1999-01-01

    The hemoglobinopathies are probably the world's most common genetic diseases: The World Health Organization has estimated that at least 5% of the population are carriers for one or other of the most serious forms, the alpha- and beta-thalassemias and the structural variant hemoglobins S, C, and E, which are found at polymorphic frequencies in many countries. All these hemoglobinopathies are believed to provide protection against malaria, and it is thought that, in malarial regions of the world, natural selection has been responsible for elevating and maintaining their gene frequencies, an idea first proposed 50 years ago by J.B.S. Haldane. Epidemiological studies undertaken in the 1950s on hemoglobin S in Africa provided support for the "malaria hypothesis," but until recently it has proved extremely difficult to verify it for the thalassemias. The application of molecular methods has, however, provided new opportunities to address this old question. Population and molecular genetic analysis of thalassemia variants, and microepidemiological studies of the relationship between alpha-thalassemia and malaria in the southwest Pacific, have provided unequivocal evidence for protection. Surprisingly, some of this protection appears to derive from enhanced susceptibility in very young thalassemic children to both Plasmodium falciparum and, especially, P. vivax, and this early exposure appears to provide the basis for better protection in later life.

  1. International cooperation for the cure and prevention of severe hemoglobinopathies.

    Science.gov (United States)

    Faulkner, Lawrence B; Uderzo, Cornelio; Masera, Giuseppe

    2013-08-01

    Thalassemia major (TM) is the most frequent life-threatening noninfectious disease of childhood in the Middle East, South Asia, and Pacific Islands where it accounts for a significant proportion of childhood mortality, morbidity, and related health care expenses. In spite of major advances in supportive care during the last decade, many patients in low-income and middle-income countries still fare poorly because of high treatment costs and lack of accessible multidisciplinary teams, not to consider the risk of blood-borne infections, primarily hepatitis C. In selected low-risk patients with a compatible sibling, TM is highly curable by bone marrow transplantation (BMT), which also improves the quality of life and is cost-effective. Starting in 2008, the Cure2Children Foundation (C2C), an Italian Non-Governmental Organization, has supported a BMT network in Pakistan, which during 2012 was extended to India. The primary aim of this project was to assess feasibility, outcomes, and costs of matched-related BMT for thalassemia in young low-risk children using a well-established and tolerable strategy. A total of 100 matched-related BMTs have been performed to date by partner institutions within this C2C-supported network; in the 50 low-risk cases with TM, over 90% disease-free survival was obtained with procedure expenses within 10,000 USD/BMT, that is, an outcome comparable to that obtained in affluent countries but with a fraction of the expenses. This cure rate was also obtained in start-up BMT centers (1 in Pakistan and 1 in India) within a structured and intensive cooperation program. Twinning and other international cooperation strategies based on shared principles and a common vision may substantially facilitate access to BMT.

  2. Preimplantation HLA typing for stem cell transplantation treatment of hemoglobinopathies

    Directory of Open Access Journals (Sweden)

    Anver Kuliev

    2014-09-01

    Full Text Available Preimplantation genetic diagnosis (PGD for HLA typing is steadily becoming an option for at risk couples with thalassemic children, requiring HLA matched bone marrow transplantation treatment. The paper presents the world’s largest PGD experience of 475 cases for over 2 dozens thalassemia mutations, resulting in birth of 132 unaffected children. A total of 146 cases were performed together with preimplantation HLA typing, resulting in detection and transfer of HLA matched unaffected embryos in 83 of them, yielding the birth of 16 HLA matched children, potential donors for their affected siblings. The presented experience of HLA matched stem cell transplantation for thalassemia, following PGD demonstrated a successful hematopoietic reconstitution both for younger and older patients. The data show that PGD is an efficient approach for HLA matched stem cell transplantation treatment for thalassemia.

  3. [Hemoglobinopathies--clinical symptoms and diagnosis of thalassemia and abnormal hemoglobins].

    Science.gov (United States)

    Herklotz, R; Risch, L; Huber, A R

    2006-01-01

    Haemoglobinopathies constitute entities that are generated by either an abnormal haemoglobin or thalassaemias. While abnormal haemoglobins are caused by a qualitative structural abnormality of the haemoglobin molecule, thalassaemias result by diminished synthesis of the globin chain. Due to increased immigration from Asia, Africa and the Mediterranean to Northern Europe, haemoglobin S, haemoglobin C, haemoglobin E are also encountered commonly in Switzerland, while other abnormal haemoglobins are rare, yet can cause clinically relevant symptoms. This include haemolysis, polyglobulia, cyanosis or a combination thereof Thalassaemia-syndroms constitute with two million affected individuals to the most prelevant monogenetic diseases worldwide. Due to migration into Switzerland, they are also found quite commonly among our patients with 10-15 per cent of all hypochromic, microcytic, anemia second only to iron deficiency. Importantly, thalassaemias and haemoglobinopathies can occur concomitantly sometimes even with a normal haemoglobin variant. This results in wide-spread presentations, making diagnosis and clinical judgement difficult. We describe in this article not only physiological mechanisms and clinical presentation but also propose a step-wise diagnostic algorithm including selective use of molecular biology methods.

  4. Moderate dose of hydroxyurea in children with sickle cell disease and stroke. Preliminary results

    OpenAIRE

    Machín-García, Sergio; Menéndez-Veitía, Andrea; Scherle-Matamoros, Claudio; Svarch, Eva; González-Otero, Alejandro; Arencibia-Núñez, Alberto; Gutiérrez-Díaz, Adys; Lam-Díaz, Rosa M

    2014-01-01

    Twenty children with sickle cell anemia, two with SC hemoglobinopathy and one with S/â0 thalassemia were treated, with a previous stroke or abnormal ultrasound transcranial Doppler (TCD) flow velocities more than 170 cm/s. The mean follow-up was of 41 ± 19 months. Hydroxyurea (HU) at a dose of 25 mg/kg/day associated with chronic transfusion therapy, was administrated during one year to patients with stroke. Patients with abnormal TCD received only HU at the same dose. There was a significant...

  5. Extracellular Vesicles in Hematological Disorders

    Directory of Open Access Journals (Sweden)

    Anat Aharon

    2014-10-01

    Full Text Available Extracellular vesicles (EVs, comprised of exosomes, microparticles, apoptotic bodies, and other microvesicles, are shed from a variety of cells upon cell activation or apoptosis. EVs promote clot formation, mediate pro-inflammatory processes, transfer proteins and miRNA to cells, and induce cell signaling that regulates cell differentiation, proliferation, migration, invasion, and apoptosis. This paper will review the contribution of EVs in hematological disorders, including hemoglobinopathies (sickle cell disease, thalassemia, paroxysmal nocturnal hemoglobinuria, and hematological malignancies (lymphomas, myelomas, and acute and chronic leukemias.

  6. Therapeutic strategies in Sickle Cell Anemia: The past present and future.

    Science.gov (United States)

    Fernandes, Queenie

    2017-06-01

    Sickle Cell Anemia (SCA) was one of the first hemoglobinopathies to be discovered. It is distinguished by the mutation-induced expression of a sickle cell variant of hemoglobin (HbS) that triggers erythrocytes to take a characteristic sickled conformation. The complex physiopathology of the disease and its associated clinical complications has initiated multi-disciplinary research within its field. This review attempts to lay emphasis on the evolution, current standpoint and future scope of therapeutic strategies in SCA. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. The effect of histone deacetylase inhibitors on AHSP expression

    Science.gov (United States)

    Ziari, Katayoun; Ranjbaran, Reza; Nikouyan, Negin

    2018-01-01

    Alpha-hemoglobin stabilizing protein (AHSP) is a molecular chaperone that can reduce the damage caused by excess free α-globin to erythroid cells in patients with impaired β-globin chain synthesis. We assessed the effect of sodium phenylbutyrate and sodium valproate, two histone deacetylase inhibitors (HDIs) that are being studied for the treatment of hemoglobinopathies, on the expression of AHSP, BCL11A (all isoforms), γ-globin genes (HBG1/2), and some related transcription factors including GATA1, NFE2, EKLF, KLF4, and STAT3. For this purpose, the K562 cell line was cultured for 2, 4, and 6 days in the presence and absence of sodium phenylbutyrate and sodium valproate. Relative real-time qRT-PCR analysis of mRNA levels was performed to determine the effects of the two compounds on gene expression. Expression of all target mRNAs increased significantly (p sodium valproate had a more considerable effect than sodium phenylbutyrate (p sodium valproate after 6 days. Both compounds repressed the expression of BCL11A (-XL, -L, -S) and up-regulated GATA1, NFE2, EKLF, KLF4, STAT3, AHSP, and γ-globin genes expression. Moreover, sodium valproate showed a stronger effect on repressing BCL11A and escalating the expression of other target genes. The findings of this in vitro experiment could be considered in selecting drugs for clinical use in patients with β-hemoglobinopathies. PMID:29389946

  8. Prevalence of Beta-Thalassemia in premarital screening in Al-Hassa, Saudi Arabia

    International Nuclear Information System (INIS)

    Al-Suliman, A.

    2006-01-01

    The Al-Hassa area is one of the regions in Saudi Arabia where hemoglobinopathies are prevalent. The Saudi Ministry of Health designed a protocol for premarital testing after the royal decree in December 2003. The protocol was implemented in a February 2004 order. The aim of this study was to determine the prevalence of beta-thalassemia trait among subjects coming for premarital screening in the Al-Hassa area. From February 2004 to November 2004, healthy subjects coming to six marriages consultation centers in the Al-Hassa area underwent routine mandatory tests. Subjects were considered to have beta-thalassemia trait if they had a mean corpuscular volume (MCV), 80 fL and/or a mean corpuscular hemoglobin (MCH) 3.2%. Venous blood was taken into ETDA tube and the complete blood count and red blood cell indices were measured by a Coulter automated cell counter on the same day of hemoglobin collection. Electrophoresis was done on cellulose acetate. All Saudi participants (n=8918), including 4218 (47.3%) males and 4700 (52.7%) females were screened. The prevalence of beta-thalassemia trait with high hemoglobin A2 and microcytic hypochromic anemia was 3.4% (307/8918). In countries with a high prelevance of hemoglobinopathies, a premarital screening program is helpful for identification and prevention of high-risk marriages. With a 3.4% prevalence of beta-thalassemia trait in premarital couples, future comprehensive programs are needed to know the actual prevalence of beta-thalassemia in Al-Hassa. (author)

  9. Six-day stability of erythrocyte and reticulocyte parameters in-vitro: a comparison of blood samples from healthy, iron-deficient, and thalassemic individuals.

    Science.gov (United States)

    Sudmann-Day, Åshild A; Piehler, Armin; Klingenberg, Olav; Urdal, Petter

    2015-05-01

    Stability for up to 6 days' storage of erythrocyte and reticulocyte parameters in samples from iron-deficient and thalassemic individuals has not yet been reported. This lack of knowledge challenges evaluation of the full blood count in referral samples for hemoglobinopathy evaluation. We therefore hereby present such sample stability data. We included fresh (less than 4 hours old) blood samples from eight healthy, eight iron-deficient, and 11 thalassemic individuals. A full blood count, including reticulocyte parameters, was performed on a Sysmex XE-2100 once daily during a 6-day storage period at room temperature. For healthy individuals, we also studied stability of refrigerated samples and investigated analytical and biological variation. Hemoglobin concentration, erythrocyte count, and mean corpuscular hemoglobin were stable for 6 days in all diagnostic groups. Mean corpuscular volume increased less in samples from iron-deficient individuals while the number of reticulocytes increased more in samples from thalassemic, as compared to healthy individuals. Ret-He stability depended on its baseline value. Within-person biological variation in samples from healthy individuals was low both for erythrocyte parameters and for reticulocyte hemoglobin, while higher for reticulocyte counts. Results for hemoglobin concentration, erythrocyte count, and mean corpuscular hemoglobin are reliable in hemoglobinopathy investigation of referred samples for up to 6 days. Storage time-dependent changes of other erythrocyte and reticulocyte parameters in blood samples from iron-deficient and thalassemic individuals differ from those of healthy individuals.

  10. alpha-thalassemia, HbS, and beta-globin gene cluster haplotypes in two Afro-Uruguayan sub-populations from northern and southern Uruguay

    Directory of Open Access Journals (Sweden)

    Julio A. da Luz

    2006-01-01

    Full Text Available Hemoglobinopathies are the most common monogenic disorders worldwide; however, they have never been systematically studied from a genetic perspective in Uruguay. In this study, we determined the frequencies of hemoglobin variants in Afro-Uruguayans. A sample of 52 healthy unrelated Afro-Uruguayans from the northern (N = 28 and southern (N = 24 regions of the country was analyzed. Eight individuals (15.4% were heterozygous for -alpha3,7thalassemia; seven of them (29.2% were originally from the southern region, whereas one of them (3.6% was from the northern region; the differences between both regions were statistically significant (p = 0.016 +/-0.003. The only structural mutation detected was betaS, which is typical of African populations. Four individuals (10% were heterozygous for betaS, three of them (13.6% from the South, and one (5.6% from the North. The betaS haplotypes were analyzed in eight individuals: two were homozygous betaS/betaS, two were heterozygous betaS/betathal, and four were heterozygous betaS/betaª. This haplotype distribution (60% Bantu, 20% Benin, and 20% Bantu A2 is in agreement with historical records reporting a predominantly Bantu origin for the enslaved Africans brought to Uruguay. Even though this is a preliminary study, due to the small sample size, our results are suggestive of a relatively high incidence of hemoglobinopathies in the Afro-Uruguayan population.

  11. Transfusion Associated Peak in Hb HPLC Chromatogram – a Case Report

    Science.gov (United States)

    Jain, Sonal; Dass, Jasmita; Pati, Hara Prasad

    2012-01-01

    High performance liquid chromatography (HPLC) and electrophoresis are commonly used to diagnose various hemoglobinopathies. However, insufficient information about the transfusion history can lead to unexpected and confusing results. We are reporting a case of Juvenile myelomonocytic leukemia (JMML) in which HbHPLC was done to quantify fetal hemoglobin (HbF). The chromatogram showed elevated HbF along with a peak in the HbD window. A transfusion acquired peak was suspected based on the unexpectedly low percentage of HbD and was subsequently confirmed using parental HbHPLC. PMID:22348188

  12. Intracranial Extramedullary Hematopoiesis in Beta-Thalassemia

    Energy Technology Data Exchange (ETDEWEB)

    Karki, Bivek; Xu, Yi Kai; Wu, Yuan Kui [Nan fang Hospital, Southern Medical University, Guangzhou (China); Tamrakar, Karuna [Zhujiang Hospital, Southern Medical University, Guangzhou (China)

    2012-03-15

    Extramedullary hematopoiesis (EMH) represents tumor-like proliferation of hemopoietic tissue which complicates chronic hemoglobinopathy. Intracranial EMH is an extremely rare occurrence. Magnetic resonance imaging (MRI) offers a precise diagnosis. It is essential to distinguish EMH from other extradural central nervous system tumors, because treatment and prognosis are totally different. Herein, we report the imaging findings of beta-thalassemia in a 13-year-old boy complaining of weakness of left side of the body and gait disturbance; CT and MRI revealed an extradural mass in the right temporoparietal region.

  13. Intracranial extramedullary hematopoiesis in beta-thalassemia.

    Science.gov (United States)

    Karki, Bivek; Xu, Yi-Kai; Tamrakar, Karuna; Wu, Yuan-Kui

    2012-01-01

    Extramedullary hematopoiesis (EMH) represents tumor-like proliferation of hemopoietic tissue which complicates chronic hemoglobinopathy. Intracranial EMH is an extremely rare occurrence. Magnetic resonance imaging (MRI) offers a precise diagnosis. It is essential to distinguish EMH from other extradural central nervous system tumors, because treatment and prognosis are totally different. Herein, we report the imaging findings of beta-thalassemia in a 13-year-old boy complaining of weakness of left side of the body and gait disturbance; CT and MRI revealed an extradural mass in the right temporoparietal region.

  14. Intracranial Extramedullary Hematopoiesis in Beta-Thalassemia

    International Nuclear Information System (INIS)

    Karki, Bivek; Xu, Yi Kai; Wu, Yuan Kui; Tamrakar, Karuna

    2012-01-01

    Extramedullary hematopoiesis (EMH) represents tumor-like proliferation of hemopoietic tissue which complicates chronic hemoglobinopathy. Intracranial EMH is an extremely rare occurrence. Magnetic resonance imaging (MRI) offers a precise diagnosis. It is essential to distinguish EMH from other extradural central nervous system tumors, because treatment and prognosis are totally different. Herein, we report the imaging findings of beta-thalassemia in a 13-year-old boy complaining of weakness of left side of the body and gait disturbance; CT and MRI revealed an extradural mass in the right temporoparietal region.

  15. [Anesthetic considerations in sickle cell anemia: a case report].

    Science.gov (United States)

    Fernández-Meré, L A; Sopena-Zubiría, L A; Alvarez-Blanco, M

    2009-01-01

    Sickle cell anemia is the most common hemoglobinopathy. Advances in therapeutic techniques and anesthetic procedures have led to a considerable increase in the success of surgical procedures in these patients. We report the case of a 16-year-old black boy diagnosed with sickle cell anemia and beta-thalassemia who presented with chronic osteomyelitis of the tibia. He was scheduled for debridement of the lesion and musculocutaneous flap repair. We emphasize the importance of communication between anesthesiologists, surgeons, and hematologists in the perioperative period in order to determine the risk of complications and anticipate them.

  16. Modeling the complex activity of sickle cell and thalassemia specialist nurses in England.

    Science.gov (United States)

    Leary, Alison; Anionwu, Elizabeth N

    2014-01-01

    Specialist advanced practice nursing in hemoglobinopathies has a rich historical and descriptive literature. Subsequent work has shown that the role is valued by patients and families and also by other professionals. However, there is little empirical research on the complexity of activity of these services in terms of interventions offered. In addition, the work of clinical nurse specialists in England has been devalued through a perception of oversimplification. The purpose of this study was to understand the complexity of expert nursing practice in sickle cell and thalassemia. The approach taken to modeling complexity was used from common methods in mathematical modeling and computational mathematics. Knowledge discovery through data was the underpinning framework used in this study using a priori mined data. This allowed categorization of activity and articulation of complexity. In total, 8966 nursing events were captured over 1639 hours from a total of 22.8 whole time equivalents, and several data sources were mined. The work of specialist nurses in this area is complex in terms of the physical and psychosocial care they provide. The nurses also undertook case management activity such as utilizing a very large network of professionals, and others participated in admission avoidance work and education of patients' families and other staff. The work of nurses specializing in hemoglobinopathy care is complex and multidimensional and is likely to contribute to the quality of care in a cost-effective way. An understanding of this complexity can be used as an underpinning to establishing key performance indicators, optimum caseload calculations, and economic evaluation.

  17. Hemoglobin Q-Iran detected in family members from Northern Iran: a case report

    Directory of Open Access Journals (Sweden)

    Khorshidi Mohammad

    2012-02-01

    Full Text Available Abstract Introduction Hemoglobin Q-Iran (α75Asp→His is an important member of the hemoglobin Q family, molecularly characterized by the replacement of aspartic acid by histidine. The first report of hemoglobin Q-Iran and the nomenclature of this hemoglobinopathy dates back to 1970. Iran is known as a country with a high prevalence of α- and β-thalassemia and different types of hemoglobinopathy. Many of these variants are yet to be identified as the practice of molecular laboratory techniques is limited in this part of the world. Applying such molecular methods, we report the first hemoglobin Q-Iran cases in Northern Iran. Case presentation An unusual band was detected in an isoelectric focusing test and cellulose acetate electrophoresis of a sample from a 22-year-old Iranian man from Mazandaran Province. Capillary zone electrophoresis analysis identified this band as hemoglobin Q. A similar band was also detected in his mother's electrophoresis (38 years, Iranian ethnicity. The cases underwent molecular investigation and the presence of a hemoglobin Q-Iran mutation was confirmed by the amplification refractory mutation system polymerase chain reaction method. Direct conventional sequencing revealed a single guanine to cytosine missense mutation (c.226G > C; GAC >CAC at codon 75 in the α-globin gene in both cases. Conclusion The wide spectrum and high frequency of nondeletional α-globin mutations in Mazandaran Province is remarkable and seem to differ considerably from what has been found in Mediterranean populations. This short communication reports the first cases of patients with hemoglobin Q found in that region.

  18. Genetic heterogeneity of hemoglobin AEBart's disease: a large cohort data from a single referral center in northeast Thailand.

    Science.gov (United States)

    Chaibunruang, Attawut; Karnpean, Rossarin; Fucharoen, Goonnapa; Fucharoen, Supan

    2014-04-01

    AEBart's disease is a thalassemia intermedia usually characterized by the interaction of α(0)-thalassemia with either deletional or non-deletional α(+)-thalassemia in Hb E heterozygote. Genotypic and phenotypic features are heterogeneous. We studied the hematologic and molecular characteristics of this disease in a cohort of 173 Thai patients encountered at our center in northeast Thailand. Hemoglobin and DNA analyses identified patients with deletional AEBart's disease (n=84), Hb Constant Spring AEBart's disease (n=81), Hb Paksé-AEBart's disease (n=5), AEBart's disease with codon 30 mutation (n=1) and two hitherto un-described forms of AEBart's disease due to interaction of Hb E heterozygote and α(0)-thalassemia with the -α(16.6)kb deletional α(+)-thalassemia (n=1) and Hb Q-Thailand (n=1). Different phenotypic expression of these AEBart's diseases with low Hb, Hct and MCV and increased RDW values with marked reduction in Hb E levels were observed. It was found that all these forms of AEBart's disease showed similar thalassemia intermedia phenotypes but those with non-deletional forms were relatively more anemic. Our data confirm that in such area with high prevalence of hemoglobinopathies such as Southeast Asia, identification of rare thalassemia alleles in a thalassemia intermedia patient should not be ignored. Careful consideration of different phenotypic expression may help in providing presumptive diagnosis of this disease where access to molecular testing is limited. However, molecular diagnostic is useful for predicting the clinical outcome and improving genetic counseling of these complex hemoglobinopathies. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Genetic determinants and stroke in children with sickle cell disease,

    Directory of Open Access Journals (Sweden)

    Daniela O.W. Rodrigues

    Full Text Available Abstract Objective: To verify genetic determinants associated with stroke in children with sickle cell disease (SCD. Methods: Prospective cohort with 110 children submitted to neonatal screening by the Neonatal Screening Program, between 1998 and 2007, with SCD diagnosis, followed at a regional reference public service for hemoglobinopathies. The analyzed variables were type of hemoglobinopathy, gender, coexistence with alpha thalassemia (α-thal, haplotypes of the beta globin chain cluster, and stroke. The final analysis was conducted with 66 children with sickle cell anemia (SCA, using the chi-squared test in the program SPSS® version 14.0. Results: Among children with SCD, 60% had SCA. The prevalence of coexistence with α-thal was 30.3% and the Bantu haplotype (CAR was identified in 89.2%. The incidence of stroke was significantly higher in those with SCA (27.3% vs. 2.3%; p = 0.001 and males (24.1% vs. 9.6%; p = 0.044. The presence of α-thal (p = 0.196, the CAR haplotype (p = 0.543, and socioeconomic factors were not statistically significant in association with the occurrence of stroke. Conclusion: There is a high incidence of stroke in male children and in children with SCA. Coexistence with α-thal and haplotypes of the beta globin chain cluster did not show any significant association with stroke. The heterogeneity between previously evaluated populations, the non-reproducibility between studies, and the need to identify factors associated with stroke in patients with SCA indicate the necessity of conducting further research to demonstrate the relevance of genetic factors in stroke related to SCD.

  20. Coexistence of Malaria and Thalassemia in Malaria Endemic Areas of Thailand

    Science.gov (United States)

    Kuesap, Jiraporn; Chaijaroenkul, W.; Rungsihirunrat, K.; Pongjantharasatien, K.; Na-Bangchang, Kesara

    2015-01-01

    Hemoglobinopathy and malaria are commonly found worldwide particularly in malaria endemic areas. Thalassemia, the alteration of globin chain synthesis, has been reported to confer resistance against malaria. The prevalence of thalassemia was investigated in 101 malaria patients with Plasmodium falciparum and Plasmodium vivax along the Thai-Myanmar border to examine protective effect of thalassemia against severe malaria. Hemoglobin typing was performed using low pressure liquid chromatography (LPLC) and α-thalassemia was confirmed by multiplex PCR. Five types of thalassemia were observed in malaria patients. The 2 major types of thalassemia were Hb E (18.8%) and α-thalassemia-2 (11.9%). There was no association between thalassemia hemoglobinopathy and malaria parasitemia, an indicator of malaria disease severity. Thalassemia had no significant association with P. vivax infection, but the parasitemia in patients with coexistence of P. vivax and thalassemia was about 2-3 times lower than those with coexistence of P. falciparum and thalassemia and malaria without thalassemia. Furthermore, the parasitemia of P. vivax in patients with coexistence of Hb E showed lower value than coexistence with other types of thalassemia and malaria without coexistence. Parasitemia, hemoglobin, and hematocrit values in patients with coexistence of thalassemia other than Hb E were significantly lower than those without coexistence of thalassemia. Furthermore, parasitemia with coexistence of Hb E were 2 times lower than those with coexistence of thalassemia other than Hb E. In conclusion, the results may, at least in part, support the protective effect of thalassemia on the development of hyperparasitemia and severe anemia in malaria patients. PMID:26174819

  1. HbE/β-Thalassemia and Oxidative Stress: The Key to Pathophysiological Mechanisms and Novel Therapeutics

    Science.gov (United States)

    Sibmooh, Nathawut; Fucharoen, Suthat

    2017-01-01

    Abstract Significance: Oxidative stress and generation of free radicals are fundamental in initiating pathophysiological mechanisms leading to an inflammatory cascade resulting in high rates of morbidity and death from many inherited point mutation-derived hemoglobinopathies. Hemoglobin (Hb)E is the most common point mutation worldwide. The βE-globin gene is found in greatest frequency in Southeast Asia, including Thailand, Malaysia, Indonesia, Vietnam, Cambodia, and Laos. With the wave of worldwide migration, it is entering the gene pool of diverse populations with greater consequences than expected. Critical Issues: While HbE by itself presents as a mild anemia and a single gene for β-thalassemia is not serious, it remains unexplained why HbE/β-thalassemia (HbE/β-thal) is a grave disease with high morbidity and mortality. Patients often exhibit defective physical development, severe chronic anemia, and often die of cardiovascular disease and severe infections. Recent Advances: This article presents an overview of HbE/β-thal disease with an emphasis on new findings pointing to pathophysiological mechanisms derived from and initiated by the dysfunctional property of HbE as a reduced nitrite reductase concomitant with excess α-chains exacerbating unstable HbE, leading to a combination of nitric oxide imbalance, oxidative stress, and proinflammatory events. Future Directions: Additionally, we present new therapeutic strategies that are based on the emerging molecular-level understanding of the pathophysiology of this and other hemoglobinopathies. These strategies are designed to short-circuit the inflammatory cascade leading to devastating chronic morbidity and fatal consequences. Antioxid. Redox Signal. 26, 794–813. PMID:27650096

  2. Regional cerebral blood flow in childhood headache

    International Nuclear Information System (INIS)

    Roach, E.S.; Stump, D.A.

    1989-01-01

    Regional cerebral blood flow (rCBF) was measured in 16 cranial regions in 23 children and adolescents with frequent headaches using the non-invasive Xenon-133 inhalation technique. Blood flow response to 5% carbon dioxide (CO2) was also determined in 21 patients, while response to 50% oxygen was measured in the two patients with hemoglobinopathy. Included were 10 patients with a clinical diagnosis of migraine, 4 with musculoskeletal headaches, and 3 with features of both types. Also studied were 2 patients with primary thrombocythemia, 2 patients with hemoglobinopathy and headaches, 1 patient with polycythemia, and 1 with headaches following trauma. With two exceptions, rCBF determinations were done during an asymptomatic period. Baseline rCBF values tended to be higher in these young patients than in young adults done in our laboratory. Localized reduction in the expected blood flow surge after CO2 inhalation, most often noted posteriorly, was seen in 8 of the 13 vascular headaches, but in none of the musculoskeletal headache group. Both patients with primary thrombocythemia had normal baseline flow values and altered responsiveness to CO2 similar to that seen in migraineurs; thus, the frequently reported headache and transient neurologic signs with primary thrombocythemia are probably not due to microvascular obstruction as previously suggested. These data support the concept of pediatric migraine as a disorder of vasomotor function and also add to our knowledge of normal rCBF values in younger patients. Demonstration of altered vasomotor reactivity to CO2 could prove helpful in children whose headache is atypical

  3. HbE/β-Thalassemia and Oxidative Stress: The Key to Pathophysiological Mechanisms and Novel Therapeutics.

    Science.gov (United States)

    Hirsch, Rhoda Elison; Sibmooh, Nathawut; Fucharoen, Suthat; Friedman, Joel M

    2017-05-10

    Oxidative stress and generation of free radicals are fundamental in initiating pathophysiological mechanisms leading to an inflammatory cascade resulting in high rates of morbidity and death from many inherited point mutation-derived hemoglobinopathies. Hemoglobin (Hb)E is the most common point mutation worldwide. The β E -globin gene is found in greatest frequency in Southeast Asia, including Thailand, Malaysia, Indonesia, Vietnam, Cambodia, and Laos. With the wave of worldwide migration, it is entering the gene pool of diverse populations with greater consequences than expected. While HbE by itself presents as a mild anemia and a single gene for β-thalassemia is not serious, it remains unexplained why HbE/β-thalassemia (HbE/β-thal) is a grave disease with high morbidity and mortality. Patients often exhibit defective physical development, severe chronic anemia, and often die of cardiovascular disease and severe infections. Recent Advances: This article presents an overview of HbE/β-thal disease with an emphasis on new findings pointing to pathophysiological mechanisms derived from and initiated by the dysfunctional property of HbE as a reduced nitrite reductase concomitant with excess α-chains exacerbating unstable HbE, leading to a combination of nitric oxide imbalance, oxidative stress, and proinflammatory events. Additionally, we present new therapeutic strategies that are based on the emerging molecular-level understanding of the pathophysiology of this and other hemoglobinopathies. These strategies are designed to short-circuit the inflammatory cascade leading to devastating chronic morbidity and fatal consequences. Antioxid. Redox Signal. 26, 794-813.

  4. Associations between a+-thalassemia and Plasmodium falciparum malarial infection in northeastern Tanzania

    DEFF Research Database (Denmark)

    Enevold, Anders; Alifrangis, Michael; Sanchez, Juan J

    2007-01-01

    BACKGROUND: The 2 most common hemoglobinopathies, sickle cell trait and alpha (+)-thalassemia, confer partial resistance to fatal forms of malaria, but the molecular basis for this protection is still not understood. Examination of the relationship between these traits and malaria transmission...... the prevalence of the 2 traits and malariometric indices were investigated by logistic regression. Short tandem repeat (STR) microsatellite allele frequencies were used to assess population substructuring. RESULTS: The frequency of alpha (+)-thalassemia ranged from 10%-25% in high-altitude villages (>1200 m......) to 45%-55% in low-altitude villages (thalassemia decreased by approximately 12% per 100-m increase in altitude (P

  5. Complex Interaction of Hb Q-Thailand with α0- and β0-Thalassemia in a Chinese Family.

    Science.gov (United States)

    He, Sheng; Qin, Qian; Lin, Li; Chen, Qiuli; Yi, Shang; Wei, Honhwei; Du, Juan; Zheng, Chenguang; Qiu, Xiaoxia; Chen, Biyan

    2017-01-01

    Hb Q-Thailand [α74(EF3)Asp→His (α1); HBA1: c.223 G>C] is an abnormal hemoglobin (Hb), variant found mainly in China and Southeast Asian countries. The association of the α Q -Thailand allele with other globin gene disorders has important implications in diagnosis. Here, we report a hitherto undescribed condition of patients with a double heterozygosity for Hb Q-Thailand with α 0 -thalassemia (α 0 -thal) and in combination with β 0 -thalassemia (β 0 -thal) in a Chinese family. Our study will provide some clinical manifestations, laboratory diagnosis and genetic counseling for complex hemoglobinopathies.

  6. Renal Medullary Carcinoma with an Aggressive Clinical Course: A Case Report and Review of the Literature

    Directory of Open Access Journals (Sweden)

    Madhumati R. Kalavar

    2017-01-01

    Full Text Available Renal medullary carcinoma (RMC is a rare, yet aggressive malignancy of the kidney that is found predominantly in young patients with African descent and sickle cell hemoglobinopathies and most specifically sickle cell trait. Due to its aggressive nature, most cases have metastasis or local invasion at the time of diagnosis. Prognosis is extremely poor with survival less than 1 year after diagnosis. Here we present a case of metastatic RMC in a 29-year-old African female. Despite chemotherapy with cisplatin, gemcitabine, and paclitaxel, and initial shrinkage of the tumor, the patient died 5 months after diagnosis.

  7. Newborn Screening for Sickle Cell Disease in Liberia: A Pilot Study.

    Science.gov (United States)

    Tubman, Venée N; Marshall, Roseda; Jallah, Wilhemina; Guo, Dongjing; Ma, Clement; Ohene-Frempong, Kwaku; London, Wendy B; Heeney, Matthew M

    2016-04-01

    In malaria-endemic countries in West Africa, sickle cell disease (SCD) contributes to childhood mortality. Historically, Liberia had regions wherein hemoglobin S and beta-thalassemia trait were mutually exclusive. Data on hemoglobinopathies in the Monrovia, the capital, are outdated and do not reflect urban migration. Updating the epidemiology of SCD is necessary to plan a public health and clinical agenda. Neither newborn screening (NBS) nor screening tools were available in country. This pilot study aimed to determine the feasibility of NBS using a South-South partnership and define the incidence of sickle cell trait (SCT) and SCD in Monrovia. This descriptive epidemiologic feasibility study collected dried blood spots from 2,785 consecutive newborns delivered at a hospital in Monrovia. Samples were analyzed by isoelectric focusing at a regional reference laboratory. Infants with SCD were referred for preventive care. SCT occurred in 10.31% of infants screened. SCD occurred in 33 infants screened [1.19% (95% confidence interval [CI]: 0.79-1.59%)] (FS: 28/33, FSB: 2/33, FSA: 2/33, FSX: 1/33). There were no infants with FSC phenotype observed. Nonsickling hemoglobin phenotypes "FC" and "F" were each present in three infants screened. Seventy-six percent of infants with SCD were brought to care, demonstrating the feasibility of our approach. The incidence of SCD and other hemoglobinopathies remains high in Liberia. Additional studies are needed to clarify sickle genotypes and identify the contribution of silent beta-thalassemia alleles. By developing regional partnerships, countries similar to Liberia can acquire current data to inform NBS as an important public health initiative toward improving child health. © 2016 Wiley Periodicals, Inc.

  8. Proliferative sickle cell retinopathy associated with sickle cell trait and gestational diabetes: case report Retinopatia falciforme proliferativa associada a traço falciforme e diabetes gestacional: relato de caso

    Directory of Open Access Journals (Sweden)

    Jefferson Augusto Santana Ribeiro

    2009-06-01

    Full Text Available Proliferative sickle cell retinopathy is an uncommon complication in individuals with sickle cell trait (AS. However, the risk for proliferative retinopathy development is increased in patients with AS hemoglobinopathy associated with systemic conditions or ocular trauma. A case of a patient with AS hemoglobinopathy who developed proliferative sickle cell retinopathy after the occurrence of gestational diabetes and pregnancy-induced hypertension is reported. Hemoglobin electrophoresis revealed presence of A2 5.0%, S 35.0% and A 53.2%. The present case emphasizes the importance of evaluating systemic comorbidities in patients with sickle cell trait during pregnancy since sickle cell retinopathy can progress rapidly, as well as the importance of regular eye fundus examination in these patients.Retinopatia falciforme proliferativa é uma complicação incomum em indivíduos com traço falciforme, havendo, porém, risco aumentado de desenvolver retinopatia proliferativa em pacientes com hemoglobinopatia AS associada a condições sistêmicas ou trauma ocular. Neste artigo será apresentado um caso de paciente com diabetes gestacional, hipertensão arterial sistêmica associada à gravidez e traço falciforme. Eletroforese de hemoglobinas revelou a presença de A2 5,0%, S 35,0% e A 53,2%. Este caso ressalta a importância da avaliação de comorbidades sistêmicas em pacientes com traço falciforme no período gestacional, uma vez que pode ocorrer rápida progressão da retinopatia falciforme, devendo-se realizar também exames regulares do fundo de olho nestes pacientes.

  9. Genetic determinants and stroke in children with sickle cell disease.

    Science.gov (United States)

    Rodrigues, Daniela O W; Ribeiro, Luiz C; Sudário, Lysla C; Teixeira, Maria T B; Martins, Marina L; Pittella, Anuska M O L; Junior, Irtis de O Fernandes

    To verify genetic determinants associated with stroke in children with sickle cell disease (SCD). Prospective cohort with 110 children submitted to neonatal screening by the Neonatal Screening Program, between 1998 and 2007, with SCD diagnosis, followed at a regional reference public service for hemoglobinopathies. The analyzed variables were type of hemoglobinopathy, gender, coexistence with alpha thalassemia (α-thal), haplotypes of the beta globin chain cluster, and stroke. The final analysis was conducted with 66 children with sickle cell anemia (SCA), using the chi-squared test in the program SPSS ® version 14.0. Among children with SCD, 60% had SCA. The prevalence of coexistence with α-thal was 30.3% and the Bantu haplotype (CAR) was identified in 89.2%. The incidence of stroke was significantly higher in those with SCA (27.3% vs. 2.3%; p=0.001) and males (24.1% vs. 9.6%; p=0.044). The presence of α-thal (p=0.196), the CAR haplotype (p=0.543), and socioeconomic factors were not statistically significant in association with the occurrence of stroke. There is a high incidence of stroke in male children and in children with SCA. Coexistence with α-thal and haplotypes of the beta globin chain cluster did not show any significant association with stroke. The heterogeneity between previously evaluated populations, the non-reproducibility between studies, and the need to identify factors associated with stroke in patients with SCA indicate the necessity of conducting further research to demonstrate the relevance of genetic factors in stroke related to SCD. Copyright © 2016 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  10. Oxidative stress in sickle cell disease; pathophysiology and potential implications for disease management.

    Science.gov (United States)

    Nur, Erfan; Biemond, Bart J; Otten, Hans-Martin; Brandjes, Dees P; Schnog, John-John B

    2011-06-01

    Sickle cell disease (SCD) is a hemoglobinopathy characterized by hemolytic anemia, increased susceptibility to infections and vaso-occlusion leading to a reduced quality of life and life expectancy. Oxidative stress is an important feature of SCD and plays a significant role in the pathophysiology of hemolysis, vaso-occlusion and ensuing organ damage in sickle cell patients. Reactive oxygen species (ROS) and the (end-)products of their oxidative reactions are potential markers of disease severity and could be targets for antioxidant therapies. This review will summarize the role of ROS in SCD and their potential implication for SCD management. Copyright © 2011 Wiley-Liss, Inc.

  11. Temporal bone extramedullary hematopoiesis as a causeof pediatric bilateral conductive hearing loss:Case report and review of the literature.

    Science.gov (United States)

    Lanigan, Alexander; Fordham, M Taylor

    2017-06-01

    Extramedullary hematopoiesis occurs in children with hemoglobinopathy and chronic anemia. The liver and spleen are often affected first, but other foci can develop to support erythrocyte demand. We report a case of a nine-year-old with beta thalassemia and temporal bone extramedullary hematopoiesis causing ossicular fixation and bilateral conductive hearing loss. There is only one case in the literature describing this phenomenon in pediatric patients, and this is the first case report of bilateral hearing loss from this physiologic phenomenon. Otolaryngologists should consider this etiology in patients with chronic anemia and conductive hearing loss in the absence of otitis media. Published by Elsevier B.V.

  12. Community Genetics: a new discipline and its application in Brazil

    Directory of Open Access Journals (Sweden)

    Antonio Sérgio Ramalho

    Full Text Available Community genetics is a new discipline which aims to provide genetic services to the community as a whole. As a science, community genetics encompasses all research needed to develop and evaluate its application. There is no question that the development of community genetics is necessary in Brazil. The implementation of such programs in our country, especially for hemoglobinopathies, has been recommended by the World Health Organization and other international organizations. Apart from the need for and appeal of community genetics programs, some aspects require serious review. This article discusses various cultural, social, psychological, and economic factors that can make genetic screening an invasion of individual privacy

  13. Community Genetics: a new discipline and its application in Brazil

    Directory of Open Access Journals (Sweden)

    Ramalho Antonio Sérgio

    2000-01-01

    Full Text Available Community genetics is a new discipline which aims to provide genetic services to the community as a whole. As a science, community genetics encompasses all research needed to develop and evaluate its application. There is no question that the development of community genetics is necessary in Brazil. The implementation of such programs in our country, especially for hemoglobinopathies, has been recommended by the World Health Organization and other international organizations. Apart from the need for and appeal of community genetics programs, some aspects require serious review. This article discusses various cultural, social, psychological, and economic factors that can make genetic screening an invasion of individual privacy

  14. Historical Perspective on the Current Renaissance for Hematopoietic Stem Cell Gene Therapy.

    Science.gov (United States)

    Kohn, Donald B

    2017-10-01

    Gene therapy using hematopoietic stem cells (HSC) has developed over the past 3 decades, with progressive improvements in the efficacy and safety. Autologous transplantation of HSC modified with murine gammaretroviral vectors first showed clinical benefits for patients with several primary immune deficiencies, but some of these patients suffered complications from vector-related genotoxicity. Lentiviral vectors have been used recently for gene addition to HSC and have yielded clinical benefits for primary immune deficiencies, metabolic diseases, and hemoglobinopathies, without vector-related complications. Gene editing using site-specific endonucleases is emerging as a promising technology for gene therapy and is moving into clinical trials. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Hb A1c Separation by High Performance Liquid Chromatography in Hemoglobinopathies

    OpenAIRE

    Chandrashekar, Vani

    2016-01-01

    Hb A1c measurement is subject to interference by hemoglobin traits and this is dependent on the method used for determination. In this paper we studied the difference between Hb A1c measured by HPLC in hemoglobin traits and normal chromatograms. We also studied the correlation of Hb A1c with age. Hemoglobin analysis was carried out by high performance liquid chromatography. Spearman's rank correlation was used to study correlation between A1c levels and age. Mann-Whitney U test was used to st...

  16. Hb A1c Separation by High Performance Liquid Chromatography in Hemoglobinopathies

    Directory of Open Access Journals (Sweden)

    Vani Chandrashekar

    2016-01-01

    Full Text Available Hb A1c measurement is subject to interference by hemoglobin traits and this is dependent on the method used for determination. In this paper we studied the difference between Hb A1c measured by HPLC in hemoglobin traits and normal chromatograms. We also studied the correlation of Hb A1c with age. Hemoglobin analysis was carried out by high performance liquid chromatography. Spearman’s rank correlation was used to study correlation between A1c levels and age. Mann-Whitney U test was used to study the difference in Hb A1c between patients with normal hemoglobin and hemoglobin traits. A total of 431 patients were studied. There was positive correlation with age in patients with normal chromatograms only. No correlation was seen in Hb E trait or beta thalassemia trait. No significant difference in Hb A1c of patients with normal chromatograms and patients with hemoglobin traits was seen. There is no interference by abnormal hemoglobin in the detection of A1c by high performance liquid chromatography. This method cannot be used for detection of A1c in compound heterozygous and homozygous disorders.

  17. Mutation Spectrum of β-Thalassemia and Other Hemoglobinopathies in Chittagong, Southeast Bangladesh.

    Science.gov (United States)

    Chatterjee, Tridip; Chakravarty, Amit; Chakravarty, Sudipa; Chowdhury, Mahmood Ahmed; Sultana, Razia

    2015-01-01

    Thalassemia is one of the most common autosomal recessive blood disorders in the world. It shows a variety of clinical expression, starting from asymptomatic to severe blood transfusion dependence. More than 500 alleles have been characterized in or around the β-globin region. Moreover, most geographical regions have their own characteristics, frequency and availability of these alleles, predominantly circulating within the communities present in that particular region. In this study, we explored the spectrum of β-thalassemia (β-thal) alleles present in Chittagong, Southeast Bangladesh. This study comprises β-thal and Hb E (HBB: c.79 G > A) patients from in and around the area of Chittagong. Not only exploring the complete β-globin mutation spectrum of the area, but we also tried to look at the origin of the mutated alleles. The β-thal mutations of Bangladesh show a relatively wide spectrum of alleles, which further demonstrates the heterogeneity of the disease in this country. Although our study showed that the majority of the mutations have their origin in neighboring countries such as India, countries of Southeast Asia, Pakistan, etc., some unusual alleles do not originate in neighboring countries and put a little more diversity in the overall spectrum of β-thal-specific alleles. Overall, this study demonstrates the mutation spectrum related to β-thal in Chittagong, Southeast Bangladesh.

  18. Profile of hemoglobin D trait in West Bengal, India

    Directory of Open Access Journals (Sweden)

    Tuphan K. Dolai

    2014-04-01

    Full Text Available Hemoglobin (Hb D Punjab is one of the most commonly observed abnormal hemoglobinopathy worldwide. There was no systematic large published study to investigate the characteristic of Hb D Punjab trait in India. This study was conducted in school and college students, newly married couples and pregnant women after proper counseling in the rural areas of West Bengal state in eastern India. Complete blood count was done by Sysmax Automated Hematology Analyzer KX 21 (Sysmex Corp., Kobe, Japan and thalassemia testing was done using high-performance liquid chromatography (Variant TM - Bio-Rad Lab., Hercules, CA, USA. A total of 46,139 individuals were screened for hemoglobinopathies. Hb D trait was found in 0.35%. Hypochromia rather than microcytosis is consistent finding in Hb D trait. Anisocytosis is absent in Hb D trait. In almost all (99.37% cases, Hb D is within 40% of total hemoglobin. This data is likely to be helpful for screening of hemoglobinopathy in resource poor setting.  血红蛋白(Hb D Punjab是全球最普遍的异常血红蛋白病之一。在印度,之前并没有研究D型特征血红蛋白病的大型出版物。本研究在印度东部的西孟加拉邦的农村地区进行,研究对象是接受过相关咨询后的在校生,大学生,新婚夫妇和孕妇。完整的血细胞计数由日本神户市Sysmex公司的KX21自动化血液分析仪完成,血液测试由美国加州赫拉克勒斯Variant-Bio-Rad实验室通过高效液相色谱法完成。总计46139人被筛查,D型特征血红蛋白病的发现率为0.35%。血红蛋白过少而非小红细胞症,是D型特征血红蛋白病的主要症状。红细胞大小不均没有在D型特征血红蛋白病中被检测出。在所有的情况中(99.37%),D型特征血红蛋白占所有血红蛋白总数的40%。这些数据有利于在资源匮乏地区对血红蛋白病的筛查。

  19. Investigation of mutations in the HBB gene using the 1,000 genomes database.

    Science.gov (United States)

    Carlice-Dos-Reis, Tânia; Viana, Jaime; Moreira, Fabiano Cordeiro; Cardoso, Greice de Lemos; Guerreiro, João; Santos, Sidney; Ribeiro-Dos-Santos, Ândrea

    2017-01-01

    Mutations in the HBB gene are responsible for several serious hemoglobinopathies, such as sickle cell anemia and β-thalassemia. Sickle cell anemia is one of the most common monogenic diseases worldwide. Due to its prevalence, diverse strategies have been developed for a better understanding of its molecular mechanisms. In silico analysis has been increasingly used to investigate the genotype-phenotype relationship of many diseases, and the sequences of healthy individuals deposited in the 1,000 Genomes database appear to be an excellent tool for such analysis. The objective of this study is to analyze the variations in the HBB gene in the 1,000 Genomes database, to describe the mutation frequencies in the different population groups, and to investigate the pattern of pathogenicity. The computational tool SNPEFF was used to align the data from 2,504 samples of the 1,000 Genomes database with the HG19 genome reference. The pathogenicity of each amino acid change was investigated using the databases CLINVAR, dbSNP and HbVar and five different predictors. Twenty different mutations were found in 209 healthy individuals. The African group had the highest number of individuals with mutations, and the European group had the lowest number. Thus, it is concluded that approximately 8.3% of phenotypically healthy individuals from the 1,000 Genomes database have some mutation in the HBB gene. The frequency of mutated genes was estimated at 0.042, so that the expected frequency of being homozygous or compound heterozygous for these variants in the next generation is approximately 0.002. In total, 193 subjects had a non-synonymous mutation, which 186 (7.4%) have a deleterious mutation. Considering that the 1,000 Genomes database is representative of the world's population, it can be estimated that fourteen out of every 10,000 individuals in the world will have a hemoglobinopathy in the next generation.

  20. Hemoglobin genetics: recent contributions of GWAS and gene editing

    Science.gov (United States)

    Smith, Elenoe C.; Orkin, Stuart H.

    2016-01-01

    The β-hemoglobinopathies are inherited disorders resulting from altered coding potential or expression of the adult β-globin gene. Impaired expression of β-globin reduces adult hemoglobin (α2β2) production, the hallmark of β-thalassemia. A single-base mutation at codon 6 leads to formation of HbS (α2βS2) and sickle cell disease. While the basis of these diseases is known, therapy remains largely supportive. Bone marrow transplantation is the only curative therapy. Patients with elevated levels of fetal hemoglobin (HbF, α2γ2) as adults exhibit reduced symptoms and enhanced survival. The β-globin gene locus is a paradigm of cell- and developmental stage-specific regulation. Although the principal erythroid cell transcription factors are known, mechanisms responsible for silencing of the γ-globin gene were obscure until application of genome-wide association studies (GWAS). Here, we review findings in the field. GWAS identified BCL11A as a candidate negative regulator of γ-globin expression. Subsequent studies have established BCL11A as a quantitative repressor. GWAS-related single-nucleotide polymorphisms lie within an essential erythroid enhancer of the BCL11A gene. Disruption of a discrete region within the enhancer reduces BCL11A expression and induces HbF expression, providing the basis for gene therapy using gene editing tools. A recently identified, second silencing factor, leukemia/lymphoma-related factor/Pokemon, shares features with BCL11A, including interaction with the nucleosome remodeling deacetylase repressive complex. These findings suggest involvement of a common pathway for HbF silencing. In addition, we discuss other factors that may be involved in γ-globin gene silencing and their potential manipulation for therapeutic benefit in treating the β-hemoglobinopathies. PMID:27340226

  1. Effect of Hereditary Hemochromatosis Gene H63D and C282Y Mutations on Iron Overload in Sickle Cell Disease Patients

    Directory of Open Access Journals (Sweden)

    Yunus Kasım Terzi

    2016-12-01

    Full Text Available Objective: Hemochromatosis is an autosomal recessive disease that is one of the most important reasons for iron overload. Sickle cell disease is a hemoglobinopathy that occurs as a result of a homozygous mutation in the hemoglobin gene. Erythrocyte transfusion is frequently used in the treatment of this disease. Iron overload as a result of transfusion is important in the mortality and morbidity of sickle cell anemia patients as well as in other hemoglobinopathies. In this study, the effect of hemochromatosis gene (HFE p.H63D and p.C282Y mutations on transfusion-related cardiac and liver iron overload in sickle cell disease patients who carry homozygous hemoglobin S mutation has been investigated. Materials and Methods: This is a prospective single-center crosssectional study in patients with homozygous hemoglobin S mutation between the years 2008 and 2013. The patients were divided into two groups. The first group (group A, n=31 was receiving chelation therapy and the second group (group B, n=13 was not. Direct and indirect iron loads were analyzed by magnetic resonance imaging and biochemically, respectively. HFE gene mutations were analyzed by polymerase chain reaction-restriction fragment length polymorphism method. Statistical analyses were performed by independent samples t-test. Results: p.H63D mutation was detected in 10 (32.3% patients in group A and in only 1 patient (7.7% in group B. When the 2 groups were compared for iron overload, iron deposition in the liver was significantly higher in group B (p=0.046. In addition, in group A, iron deposition was significantly higher in HFE mutation carriers compared to patients without the mutation (p=0.05. Conclusion: Results of this study showed that HFE gene mutations are important in iron deposition in the liver in patients with sickle cell disease.

  2. Assessment of response to therapy with hydroxyurea in patients with functional asplenia

    International Nuclear Information System (INIS)

    Santos A, O.; Demange, M.N.; Severiche, F.A.; Bomediano, V.H.; Silva, V.R.; Anjos, A.C.; Brandalise, S.R.; Etchebehere, E.C.S.C.; Cunha, M.L.; Camargo, E.E.

    1997-01-01

    Full text: Functional asplenia is a chronic complication of sickle cell (SC) disease. As the concentration of fetal hemoglobin (hemoglobin F) increases in the re blood cells (RBCs), the polymerization of hemoglobin S declines. This makes it possible for a therapeutic approach with drugs that induce hemoglobin F synthesis, leading to improvement of the acute and chronic consequences of SC disease. Hydroxyurea is a chemotherapeutic agent capable of increasing the levels of hemoglobin F in RBCs. Its long term use as an anti-sicklemic agent has been proposed recently. The purpose of this investigation was to evaluate the long term effects of hydroxyurea on the recovery of splenic function in pts with SC disease. Six pts with the disease (5 males, 1 female; 4 to 22 yrs; 5 with SS hemoglobinopathy, , 1 with Sβ o hemoglobinopathy; 4 black, 2 white) were studied. All pts received an intravenous injection of 74-185 MBq of [Tc-99m] sulfur colloid and liver-spleen imaging was performed 10 minutes later in the anterior and posterior views, with and without hepatic shielding. Pts were studied before and immediately after 6 months of treatment with hydroxyurea. All studied were submitted to visual and semi-quantitative analysis. Liver/spleen ratios were obtained before and after 6 months of treatment. Baseline images showed functional asplenia both visually and semi-quantitatively in all 5 SS pts and severely impaired splenic function in the Sβ o pt. Follow-up images performed after 6 months of treatment demonstrated significant splenic function improvement in 4 pts while 2 pts did not show any improvement. It was to demonstrate, using liver/spleen scintigraphy, that hydroxyurea is capable of reversing functional asplenia in pts with SC disease. The best results were observed in the youngest pts and in the Sβ o pt, probably because the amount of splenic fibrosis was less significant

  3. Programa de prevención de anemia falciforme (III: La electroforesis de hemoglobina: indicación e interpretación

    Directory of Open Access Journals (Sweden)

    Marcos Raúl Martín Ruiz

    1996-04-01

    Full Text Available Se presenta una guía práctica para la indicación de electroforesis de hemoglobina, utilizada en el pesquisaje de hemoglobinas anormales en el Programa de Prevención de Anemia Falciforme, actualmente vigente en Cuba, así como la interpretación del fenotipo y el riesgo de tener hijos afectados con hemoglobinopatías SS y SC.A practical guide is presented for the indication of hemoglobin electrophoresis used in the screening of abnormal hemoglobins in the Programme for Prevention of Sickle Cell Anemia, standing in Cuba at present, as well as the interpretation of phenotype and the risk of having children with hemoglobinopathies SS or SC.

  4. [Blood representations associated to chronic transfused patients: Symbolic interpretations and ethical perspectives].

    Science.gov (United States)

    Petermann, R; Pêchard, M; Gesbert, C; Assez, N

    2016-09-01

    Since the beginning of the 20th century, major technological developments have been made in blood transfusion. Although numerous sociological studies have been conducted on donors, few have highlighted transfused patients, and in this case, the attention has almost exclusively been focused on transfusion risks in patients. Conversely, blood representations associated with the chronically transfused patients have not really been explored in the literature. Based on interviews conducted among chronically transfused patients (patients with hemoglobinopathy, malignant hemopathy or cancer), this present study enables to understand their needs and their expectations through their symbolic representations and their interpretations of blood transfusion, raising tensions as well ethical perspectives. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  5. [Mesenteric venous trombosis and pregnancy--a case report and a short review of the problem].

    Science.gov (United States)

    Terzhumanov, R; Uchikova, E; Paskaleva, V; Milchev, N; Uchikov, A

    2005-01-01

    Mesenteric venous thrombosis is extremely rare surgical pathology during pregnancy and frequently is associated with hemoglobinopathies beta-thalassemia, congenital defects of the coagulation and antiphospholipide syndrome. It has nontypical clinical appearance, which hardens the timely diagnosis and the adequate surgical treatment. We present a case of a 22 year-old girl with hemozygote form of beta thalassemia, pregnant in ml II, with mesenteric venose thrombosis. The diagnosis was made on the 24th hour from the beginning of the disease. The patient was operated successfully by a resection of the necrotic changed part of the intestine. She noticed vaginal bleeding due to a missed abortion on the 22nd day after the operation.

  6. The high prevalence of anemia in Cambodian children and women cannot be satisfactorily explained by nutritional deficiencies or hemoglobin disorders

    DEFF Research Database (Denmark)

    Wieringa, Frank Tammo; Dahl, Miriam; Chamnan, Chhoun

    2016-01-01

    BACKGROUND: Anemia is highly prevalent in Cambodian women and children, but data on causes of anemia are scarce. We performed a national micronutrient survey in children and women that was linked to the Cambodian Demographic Health Survey 2014 (CDHS-2014) to assess the prevalence of micronutrient...... for 1512 subjects (792 children and 720 women). RESULTS: Anemia was found in 43% of the women and 53% of the children. Hemoglobin disorders affected >50% of the population, with Hemoglobin-E the most prevalent disorder. Deficiencies of iron (ferritin ... and hemoglobinopathy were significantly associated with anemia in children, whereas in the women none of the factors was significantly associated with anemia. Iron deficiency anemia (IDA) was more prevalent in children

  7. Evaluation of vaccination efficiency against HBV among Syrian multitransfused patients.

    Science.gov (United States)

    Yazji, Wadad; Habal, Wafaa; Menem, Fawza

    2018-03-05

    This cross-sectional study estimates HBV prevalence and evaluates vaccination efficiency among multitransfused patients. 159 patients with various hemoglobinopathies were tested for HBsAg, anti-HBs, and anti-HBc, using enzyme-linked immunosorbent assay (ELISA). The serological results were then compared with the relevant documentation in medical records. Seropositivity of HBV was detected in 1/8 of recruited patients. Serological immunity was found in only half of patients, while the other half were either infected or non-immune. The vaccination against HBV appeared inefficient in almost half of vaccinated patients and was not documented in the medical records of 1/6 of patients. Thus, multitransfused patients are at risk of acquiring hepatitis B infection. Applying prophylactic vaccination, documenting vaccine doses, and monitoring immune response are highly recommended.

  8. Are we strong enough to assert our rights in quality healthcare?

    Directory of Open Access Journals (Sweden)

    Loris Brunetta

    2014-12-01

    Full Text Available The title of this speech is an important challenge for me, for a patient I mean, to face because it’s not easy to state today if we are really strong enough to assert our rights for a quality healthcare. At first sight, and in an optimistic vision, we could answer to this question YES, we are, but I think we need to explore better the field before to confirm that this is the right answer to the question. The first thing to assess is what we mean with the pronoun WE: the patients and parents’ community represented from TIF? The whole community that plays around thalassemia and hemoglobinopathies, meaning patients and parents and scientists? What else?

  9. The effect of histone deacetylase inhibitors on AHSP expression.

    Directory of Open Access Journals (Sweden)

    Mohammad Ali Okhovat

    Full Text Available Alpha-hemoglobin stabilizing protein (AHSP is a molecular chaperone that can reduce the damage caused by excess free α-globin to erythroid cells in patients with impaired β-globin chain synthesis. We assessed the effect of sodium phenylbutyrate and sodium valproate, two histone deacetylase inhibitors (HDIs that are being studied for the treatment of hemoglobinopathies, on the expression of AHSP, BCL11A (all isoforms, γ-globin genes (HBG1/2, and some related transcription factors including GATA1, NFE2, EKLF, KLF4, and STAT3. For this purpose, the K562 cell line was cultured for 2, 4, and 6 days in the presence and absence of sodium phenylbutyrate and sodium valproate. Relative real-time qRT-PCR analysis of mRNA levels was performed to determine the effects of the two compounds on gene expression. Expression of all target mRNAs increased significantly (p < 0.05, except for the expression of BCL11A, which was down-regulated (p < 0.05 in the cells treated with both compounds relative to the levels measured for untreated cells. The findings indicated that sodium valproate had a more considerable effect than sodium phenylbutyrate (p < 0.0005 on BCL11A repression and the up-regulation of other studied genes. γ-Globin and AHSP gene expression continuously increased during the culture period in the treated cells, with the highest gene expression observed for 1 mM sodium valproate after 6 days. Both compounds repressed the expression of BCL11A (-XL, -L, -S and up-regulated GATA1, NFE2, EKLF, KLF4, STAT3, AHSP, and γ-globin genes expression. Moreover, sodium valproate showed a stronger effect on repressing BCL11A and escalating the expression of other target genes. The findings of this in vitro experiment could be considered in selecting drugs for clinical use in patients with β-hemoglobinopathies.

  10. IS HEMOGLOBIN E GENE WIDELY SPREAD IN THE STATE OF MADHYA PRADESH IN CENTRAL INDIA? EVIDENCE FROM FIVE TYPICAL FAMILIES

    Directory of Open Access Journals (Sweden)

    R S Balgir

    2014-09-01

    Full Text Available Background: Red cell inherited hemoglobin anomalies are commonly encountered in the central region of India. These cause a public health concern due to high degree of morbidity, mortality, and fetal loss in the backward, underprivileged, and vulnerable people. Purpose: To report five typical families of hemoglobin E disorders identified for the first time in the state of Madhya Pradesh from central India. Methods: Out of a total of 445 couples/families (excluding the present study with 1526 persons (848 males and 678 females referred from a tertiary hospital in central India for investigations of anemia/hemoglobinopathies during the period from March 2010 to February 2014, we came across five typical rare couples/families of hemoglobin E disorders worthy of detailed investigations. Laboratory investigations were carried out following the standard procedures after cross checking for quality control from time to time. Results: For the first time, we have encountered nine cases of heterozygous hemoglobin E trait, two members with hemoglobin E-β-thalassemia (double heterozygosity, two cases of sickle cell-hemoglobin E disease (double heterozygosity, and none with homozygous hemoglobin E. Cases  of hemoglobin E trait, hemoglobin E-β-thalassemia, sickle cell-β-thalassemia and sickle cell-E disease showed moderate to severe anemia, and target cells, and reduced values of red cell indices like RBC, Hb level, HCT, MCV, MCH and MCHC, representing abnormal hematological profile and clinical manifestations before blood transfusion. Conclusions: Double heterozygosity for hemoglobinopathies such as occurrence of β-thalassemia mutation with structurally abnormal hemoglobins (Hb S and Hb E is a rare entity, but occurs with severe clinical manifestations only in those areas or communities where these are highly prevalent, testifying the migrations and genetic admixture. Distribution of hemoglobin E and β-thalassemia in different districts of Madhya Pradesh

  11. Recent patents and technology transfer for molecular diagnosis of β-thalassemia and other hemoglobinopathies.

    Science.gov (United States)

    Breveglieri, Giulia; Finotti, Alessia; Borgatti, Monica; Gambari, Roberto

    2015-01-01

    Biological tests and genetic analyses for diagnosis and characterization of hematological diseases in health laboratories are designed with the aim of meeting the major medical needs of hospitals and pharmaceutical companies involved in this field of applied biomedicine. Genetic testing approaches to perform diagnosis consist of molecular techniques, which should be absolutely reproducible, fast, sensitive, cheap, and portable. Biological tests analyzed involve adult/newborn subjects, whereas genetic analyses involve adult thalassemia patients, newborns, embryos/fetuses (including non-invasive prenatal diagnosis), pre-implantation embryos, and pre-fertilization oocytes. The most recent findings in the diagnostic approach for β-thalassemias are related to three major fields of investigation: moving towards ultrasensitive methodologies for effective detection of the primary causative mutation of β-thalassemia, including the development of polymerase chain reaction-free approaches and non-invasive prenatal diagnosis; comparing analyses of the genotype of β-thalassemia patients to high-HbF-associated polymorphisms; introducing whole genome association assays and next-generation sequencing. All these issues should be considered and discussed in the context of several aspects, including regulatory, ethical and social issues. DNA sequence data aligned with the identification of genes central to the induction, development, progression, and outcome of β-thalassemia will be a key point for directing personalized therapy.

  12. Management of Low-Flow Priapism Using the Winter Procedure: A Case Report

    Directory of Open Access Journals (Sweden)

    Chung-Chin Chen

    2003-02-01

    Full Text Available Priapism is a prolonged penile erection that is unrelated to sexual stimulation. Low-flow priapism has been associated with sickle cell disease and other hemoglobinopathies, neoplastic syndrome, anticoagulant therapy, psychotropic medication, and idiopathic causes. We report the successful treatment of idiopathic low-flow priapism using the Winter procedure. Initial treatment consisted of aspiration and intracavernous irrigation with iced saline and a vasoconstrictive agent, but in vain. We then performed the Winter procedure, in which fistulas between the corpora cavernosa and the glans penis were created. This resulted in the simultaneous detumescence of the penis, without complication. The erectile function of the penis was normal 1 year after the procedure. This case shows that idiopathic low-flow priapism can be successfully treated using the Winter procedure when conservative treatment fails.

  13. MULTIMODAL IMAGING OF ANGIOID STREAKS ASSOCIATED WITH TURNER SYNDROME.

    Science.gov (United States)

    Chiu, Bing Q; Tsui, Edmund; Hussnain, Syed Amal; Barbazetto, Irene A; Smith, R Theodore

    2018-02-13

    To report multimodal imaging in a novel case of angioid streaks in a patient with Turner syndrome with 10-year follow-up. Case report of a patient with Turner syndrome and angioid streaks followed at Bellevue Hospital Eye Clinic from 2007 to 2017. Fundus photography, fluorescein angiography, and optical coherence tomography angiography were obtained. Angioid streaks with choroidal neovascularization were noted in this patient with Turner syndrome without other systemic conditions previously correlated with angioid streaks. We report a case of angioid streaks with choroidal neovascularization in a patient with Turner syndrome. We demonstrate that angioid streaks, previously associated with pseudoxanthoma elasticum, Ehlers-Danlos syndrome, Paget disease of bone, and hemoglobinopathies, may also be associated with Turner syndrome, and may continue to develop choroidal neovascularization, suggesting the need for careful ophthalmic examination in these patients.

  14. The Winter Procedure as Management for Prolonged Low-Flow Priapism: A Case Report

    Directory of Open Access Journals (Sweden)

    Hsi-Lin Hsiao

    2007-10-01

    Full Text Available Priapism is a prolonged penile erection that is not associated with sexual stimulation. Although the time course has not been formally defined, it is usually considered to be one that lasts for more than 4–6 hours. Low-flow (ischemic priapism is usually associated with sickle cell disease, hemoglobinopathies, neoplastic syndrome, anticoagulant therapy, psychotropic medication or idiopathic causes. Here, we report a case of prolonged low-flow priapism lasting for 2 weeks, which was successfully treated with the Winter procedure after several attempts of conservative treatment. Although the potency remains unclear and the patient needs a longer period of follow-up, the case reported here still shows that prolonged low-flow priapism can be successfully treated with the Winter procedure when conservative treatments fail.

  15. Clinical and experimental applications of sodium phenylbutyrate.

    Science.gov (United States)

    Iannitti, Tommaso; Palmieri, Beniamino

    2011-09-01

    Histone acetyltransferase and histone deacetylase are enzymes responsible for histone acetylation and deacetylation, respectively, in which the histones are acetylated and deacetylated on lysine residues in the N-terminal tail and on the surface of the nucleosome core. These processes are considered the most important epigenetic mechanisms for remodeling the chromatin structure and controlling the gene expression. Histone acetylation is associated with gene activation. Sodium phenylbutyrate is a histone deacetylase inhibitor that has been approved for treatement of urea cycle disorders and is under investigation in cancer, hemoglobinopathies, motor neuron diseases, and cystic fibrosis clinical trials. Due to its characteristics, not only of histone deacetylase inhibitor, but also of ammonia sink and chemical chaperone, the interest towards this molecule is growing worldwide. This review aims to update the current literature, involving the use of sodium phenylbutyrate in experimental studies and clinical trials.

  16. Abortamentos espontâneos em portadoras do Traço Falciforme (AS Spontaneous miscarriages among sickle cell trait carriers (AS

    Directory of Open Access Journals (Sweden)

    Antonio S. Ramalho

    2003-01-01

    Full Text Available A study carried out in Salvador, Bahia, Northeastern Brazil, has shown a miscarriage rate significantly higher among AS women than that observed among AA controls. Considering this finding, we investigated the miscarriage rate among women cared for by the hemoglobinopathy program in the city of Araras, São Paulo, Southeastern Brazil. The spontaneous miscarriage rate among 165 AS women (17% was significantly higher than that observed among 500 AA women (10% (p = 0.02. Taking into account only women with ages above 20 years, the miscarriage rate among 112 heterozygous AS (22% greatly differed from that observed among 347 AA women (12.6% (p = 0.01. These results confirm the greater tendency of spontaneous miscarriages among AS women, which might be related to a previously described maternal effect in relation to AS heterozygous women.

  17. Imaging Diagnosis of Neonatal Anemia: Report of Two Unusual Etiologies

    Directory of Open Access Journals (Sweden)

    Shabnam Bhandari Grover

    2013-01-01

    Full Text Available Anemia in neonatal period is rare, with the common causes being Rh and ABO blood group incompatibility, hemorrhagic disease of newborn, congenital hemolytic anemia, hemoglobinopathies, and TORCH (toxoplasmosis, rubella, cytomegalovirus, herpes virus infections. Congenital leukemia and infantile osteopetrosis (OP are among the rare causes of neonatal anemia. A review of the literature shows approximately 200 reported cases of congenital leukemia. Articles describing the imaging features of congenital leukemia are still rarer. Infantile OP, another rare disorder with a reported incidence of 1 in 250,000 has characteristic imaging features, which are diagnostic of the disease. We report a case each, of two rare diseases: Congenital leukemia and infantile osteopetrosis. Additionally, our report highlights the radiological and imaging features of congenital leukemia and infantile OP and their crucial role in arriving at an early diagnosis.

  18. Prevalence of sickle cell disease among Grenadian newborns.

    Science.gov (United States)

    Antoine, Magdalene; Lee, Ketty; Donald, Tyhiesia; Belfon, Yonni; Drigo, Ali; Polson, Sharon; Martin, Francis; Mitchell, George; Etienne-Julan, Maryse; Hardy-Dessources, Marie-Dominique

    2018-03-01

    Objective To establish the birth prevalence of sickle cell disease in Grenada, with a view to assess the requirement for a population-based neonatal screening programme. Methods A two-year pilot neonatal screening programme, involving the Ministry of Health of Grenada, the Sickle Cell Association of Grenada, and the diagnostic laboratory of hemoglobinopathies of the University Hospital of Guadeloupe, was implemented in 2014-2015 under the auspices of the Caribbean Network of Researchers on Sickle Cell Disease and Thalassemia. Results Analysis of 1914 samples processed identified the following abnormal phenotypes: 10 FS, 2 FSC, 183 FAS, 63 FAC. These data indicate β s and β c allele frequencies of 0.054 and 0.018, respectively. Conclusion Neonatal screening conducted in the framework of this Caribbean cooperation can allow rapid detection and earlier management of affected children.

  19. Human prenatal diagnosis

    International Nuclear Information System (INIS)

    Filkins, K.; Russo, R.J.

    1985-01-01

    The multiauthor text is written as a ''guide to rationalize and clarify certain aspects of diagnosis, general counseling and intervention'' for ''health professionals who provide care to pregnant women.'' The text is not aimed at the ultrasonographer but rather at the physicians who are clinically responsible for patient management. Chapters of relevance to radiologists include an overview of prenatal screening and counseling, diagnosis of neural tube defects, ultrasonographic (US) scanning of fetal disorders in the first and second trimesters of pregnancy, US scanning in the third trimester, multiple gestation and selective termination, fetal echo and Doppler studies, and fetal therapy. Also included are overviews of virtually all currently utilized prenatal diagnostic techniques including amniocentesis, fetal blood sampling, fetoscopy, recombinant DNA detection of hemoglobinopathies, chorionic villus sampling, embryoscopy, legal issues, and diagnosis of Mendelian disorders by DNA analysis

  20. Preservative Monitoring of a Greek Woman with Hydrops Fetalis due to Parvovirus B19 Infection

    Directory of Open Access Journals (Sweden)

    Zacharias Fasoulakis

    2017-01-01

    Full Text Available Primate erythroparvovirus 1 (parvovirus B19 is a member of the Erythrovirus genus of the Parvoviridae family and it is one of the few members of the family known to be pathogenic in human. B19 infection is common and widespread with the virus being associated with numerous rheumatologic and haematologic manifestations. More specifically, maternal infection with parvovirus B19 during pregnancy can cause severe anemia which may lead to nonimmune hydrops or fetal demise, as a result of fetal erythroid progenitor cells infection with shortened half-life of erythrocytes. We present a rare case reported in the Greek population, of subclinical transient reticulocytopenia due to B19 parvovirus infection, in an asymptomatic pregnant woman, without medical history of hemoglobinopathy, and with the presence of hydrops fetalis during the third trimester of her pregnancy.

  1. Single amino acid substitution in important hemoglobinopathies does not disturb molecular function and biological process

    Directory of Open Access Journals (Sweden)

    Viroj Wiwanitkit

    2008-06-01

    Full Text Available Viroj WiwanitkitDepartment of Laboratory Medicine, Faculty of Medicine, Chulalongkorn University, Bangkok, ThailandAbstract: Hemoglobin is an important protein found in the red cells of many animals. In humans, the hemoglobin is mainly distributed in the red blood cell. Single amino acid substitution is the main pathogenesis of most hemoglobin disorders. Here, the author used a new gene ontology technology to predict the molecular function and biological process of four important hemoglobin disorders with single substitution. The four studied important abnormal hemoglobins (Hb with single substitution included Hb S, Hb E, Hb C, and Hb J-Baltimore. Using the GoFigure server, the molecular function and biological process in normal and abnormal hemoglobins was predicted. Compared with normal hemoglobin, all studied abnormal hemoglobins had the same function and biological process. This indicated that the overall function of oxygen transportation is not disturbed in the studied hemoglobin disorders. Clinical findings of oxygen depletion in abnormal hemoglobin should therefore be due to the other processes rather than genomics, proteomics, and expression levels.Keywords: hemoglobin, amino acid, substitution, function

  2. State of the art and new developments in molecular diagnostics for hemoglobinopathies in multiethnic societies.

    Science.gov (United States)

    Harteveld, C L

    2014-02-01

    For detecting carriers of thalassemia traits, the basic part of diagnostics consists of measurement of the hematological indices followed by mostly automatic separation and measurement of the Hb fractions, while direct Hb separation either on high pressure liquid chromatography or capillary electrophoresis is sufficient to putatively identify carriers of the common Hb variants like HbS, C, E, D, and O-Arab. A putative positive result is reported together with an advice for parents, partner, or family analysis. For couples, presumed at-risk confirmation at the DNA level is essential. In general, this part of diagnostics is done in specialized centers provided with sufficient experience and the technical tools needed to combine hematological and biochemical interpretation with identification of the mutations at the molecular level. State-of-the-art tools are usually available in centers that also provide prenatal diagnosis and should consist of gap-PCR for the common deletions, direct DNA sequencing for all kind of point-mutations and the capacity to uncover novel or rare mutations or disease mechanisms. New developments are MLPA for large and eventually unknown deletion defects and microarray technology for fine mapping and primer design for breakpoint analysis. Gap-PCR primers designed in the region flanking the deletion breakpoints can subsequently be used to facilitate carrier detection of uncommon deletions in family members or isolated populations in laboratories where no microarray technology or MLPA is available. © 2013 John Wiley & Sons Ltd.

  3. Intervention and prevention of hereditary hemolytic disorders in India: a case study of two ethnic communities of Sundargarh district in Orissa.

    Science.gov (United States)

    Balgir, R S

    2008-11-01

    This study was aimed at to sensitize, motivate, and screen two major vulnerable tribal communities--Bhuyan and Kharia, for hemoglobinopathies and allied hemolytic disorders, along with prospective and retrospective genetic/marriage counseling to the affected persons. For sustainability, imparting of relevant training to local paramedical staff, and to undertake periodic follow up for evaluation, intervention and clinical management through local PHCs/hospitals. Tribal people in Orissa live in clusters practicing inter-village marriages following tribal endogamy and clan exogamy. The random sampling procedure for the selection of whole village was followed. Population of each tribe was representative because incoming and outgoing married women represent other surrounding villages belonging to their community. The pre- and post-intervention knowledge, attitude and practice (KAP) studies were conducted. Sensitization, motivation and education for carrier detection were carried out through IEC materials, holding interactive meetings and discussions at district, block and village levels. Standard biochemical and hematological techniques were followed for analysis of blood samples. Relevant training to local health personnel was imparted. Both prospective and retrospective intervention and genetic/marriage counseling was done through local PHC doctor. Study revealed high occurrence of hemoglobinopathies in Bhuyan (9.8%) and Kharia (13.3%) tribes, including uncommon hemoglobin variants like hemoglobin D, E, beta-thalassemia, and hereditary persistence of fetal hemoglobin (HPFH). G-6-PD enzyme deficiency was high in Dhelki Kharia (30.7%) and in Dudh Kharia (19.2%), whereas, it was recorded to be 21.1%, 16.3% and 13.7% in Paraja, Paik and Paudi Bhuyan subtribes, respectively. Use of antimalarials was cautioned in these tribal communities. Due to low frequency of Rhesus (D) negative (0.2-1.2%), the Rhesus (D) incompatibility problem seemed to be absent. Impact of methodical

  4. Peripheral Red Blood Cell Split Chimerism as a Consequence of Intramedullary Selective Apoptosis of Recipient Red Blood Cells in a Case of Sickle Cell Disease

    Directory of Open Access Journals (Sweden)

    Marco Marziali

    2014-08-01

    Full Text Available Allogeneic cellular gene therapy through hematopoietic stem cell transplantation is the only radical cure for congenital hemoglobinopathies like thalassemia and sickle cell anemia. Persistent mixed hematopoietic chimerism (PMC has been described in thalassemia and sickle cell anemia. Here, we describe the clinical course of a 6-year-old girl who had received bone marrow transplant for sickle cell anemia. After the transplant, the patient showed 36% donor hematopoietic stem cells in the bone marrow, whereas in the peripheral blood there was evidence of 80%  circulating donor red blood cells (RBC. The analysis of apoptosis at the Bone Marrow  level suggests that Fas might contribute to the cell death of host erythroid precursors. The increase in NK cells and the regulatory T cell population observed in this patient suggests that these cells might contribute to the condition of mixed chimerism.

  5. Diversity of [beta]-globin mutations in Israeli ethnic groups reflects recent historic events

    Energy Technology Data Exchange (ETDEWEB)

    Filon, D.; Oron, V.; Krichevski, S.; Shaag, A.; Goldfarb, A.; Aker, M.; Rachmilewitz, E.A.; Rund, D.; Oppenheim, A. (Hebrew Univ. Hadassah-Medical School, Jerusalem (Israel)) (and others)

    1994-05-01

    The authors characterized nearly 500 [beta]-thalassemia genes from the Israeli population representing a variety of ethnic subgroups. They found 28 different mutations in the [beta]-globin gene, including three mutations ([beta][sup S], [beta][sup C], and [beta][sup O-Arab]) causing hemoglobinopathies. Marked genetic heterogeneity was observed in both the Arab (20 mutations) and Jewish (17 mutations) populations. On the other hand, two ethnic isolates - Druze and Samaritans - had a single mutation each. Fifteen of the [beta]-thalassemia alleles are Mediterranean in type, 5 originated in Kurdistan, 2 are of Indian origin, and 2 sporadic alleles came from Europe. Only one mutant allele-nonsense codon 37-appears to be indigenous to Israel. While human habitation in Israel dates back to early prehistory, the present-day spectrum of [beta]-globin mutations can be largely explained by migration events that occurred in the past millennium. 26 refs., 2 figs., 3 tabs.

  6. Secondhand Smoke Is an Important Modifiable Risk Factor in Sickle Cell Disease: A Review of the Current Literature and Areas for Future Research

    Directory of Open Access Journals (Sweden)

    S. Christy Sadreameli

    2016-11-01

    Full Text Available Sickle cell disease (SCD is an autosomal recessive hemoglobinopathy that causes significant morbidity and mortality related to chronic hemolytic anemia, vaso-occlusion, and resultant end-organ damage. Tobacco smoke exposure (TSE through secondhand smoke exposure in people with SCD of all ages and through primary smoking in adolescents and adults is associated with significantly increased morbidity, with increased rates of emergency department visits and hospitalizations for painful vaso-occlusive crises and acute chest syndrome (ACS. Secondhand smoke is also associated with pulmonary function abnormalities in children with SCD who are already at risk for pulmonary function abnormalities on the basis of SCD. TSE is emerging as one of the few modifiable risk factors of SCD. This review discusses the current state of the evidence with respect to TSE and SCD morbidity, discusses potential mechanisms, and highlights current gaps in the evidence and future research directions.

  7. Theory and applications of the polymerase chain reaction.

    Science.gov (United States)

    Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A

    1990-04-01

    The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.

  8. NEWBORN SCREENING PROGRAM: WHY TO COLLECT IN HIGH THE HOSPITAL ONE?

    Directory of Open Access Journals (Sweden)

    Maria Ribeiro Lacerda

    2003-12-01

    Full Text Available The National Program of Newborn Screening for research of the Phenylketonuria, Congenital Hypothyroidism,Cystic Fibrosis, Sickle Cell Disease and other Hemoglobinopathies, it has as objective precociously todetect and to treat illnesses that, if prevented, prevent sequels as the mental deficiency and others. We intend,through this article, to awake the attention of the health professionals, mainly of the nurses, who act in the attendanceof the just-been newborn, of the gestante, the woman in labor and in puerperium, on the importance of theprecocious diagnosis of the diseases searched in the Program, with primordial purposes to assist the suckle for itsgood physical, neurological, psychological and intellectual development, besides offering to familiar the o geneticadvise. The examination gratuitous and is supported by law, and so that the prevention is effective, all the Maternitiesmust always carry through the collections of sample of blood of the heel of the high baby in the hospital one.

  9. Osteonecrosis in the knee joint

    International Nuclear Information System (INIS)

    Poeschl, M.

    1981-01-01

    The following forms are discussed: spontaneous osteonecrosis (Ahlbaeck's necrosis), which extends subchondrally into one of the femur condyles. It usually occurs in older patients, especially females. Blunt trauma may cause similar lesions. These often occur with cartilage and bone avulsions (flake fractures), which are often diagnosed much later (arthroscopy). Patellar chondropathy is increasing in frequency due to more intensive participation in sports. Pain localized at the apex of the patella (patellar apex syndrome) can develop from chondropathy, tendon lesions or primary juvenile necrosis of the patellar apex. Gas emboli occur near the knee joint during deep sea diving. Similar cartilage infarctions are seen in many hemoglobinopathies. The incidence of this is increasing due to the increased number of people immigrating from regions were these diseases are common. We have also observed vascular juvenile lesions of the epi- and metaphyses in Klippel-Trenaunay-Weber's syndrome. Their radiological appearance is similar to that of necroses. (orig.) [de

  10. Cellulitis Due to Salmonella infantis.

    Directory of Open Access Journals (Sweden)

    Satish R Patil

    2013-01-01

    Full Text Available Bacteria of the genus Salmonella are highly adapted for the growth in both humans and animals and cause a wide spectrum of disease. The growth of Serotypes S. typhi and S. paratyphi is restricted to human hosts, in whom these organisms cause enteric (typhoid fever. The remaining Serotypes (non typhoidal Salmonella or NTS can colonize the gastrointestinal tracts of the broad range of animals, including mammals, reptiles, birds and insects. The usual clinical presentation of non-typhoidal salmonellae (NTS infection is self limited gastroenteritis; however bacteremia and focal extra intestinal infection may occur. However salmonella localization to the skin presenting as cutaneous ulceration is regarded as a rare event. Rates of morbidity and mortality associated with NTS are highest among the elderly, infants, and immunocompromised individuals, including those with hemoglobinopathies, HIV infection, or infections that cause blockade of the reticuloendothelial system. We isolated S.infantis in 50 years old man with left leg cellulitis. The serotype was confirmed at Central Research Institute, Kasauli.

  11. [Hb Burgos (α1 CD64(E13)(Asp→Asn)): a new hemoglobin variant detected during follow-up of diabetic patients].

    Science.gov (United States)

    de la Fuente-Gonzalo, Félix; Martínez Nieto, Jorge; Torrejón, María José; Mayor, Luis Antonio; Velasco, Diego; González Fernández, Fernando Ataulfo; Ropero Gradilla, Paloma

    2015-01-06

    The glycated hemoglobin (HbA1c) test by high performance liquid chromatography is a useful tool for the follow-up of diabetes mellitus patients. Some structural hemoglobin (Hb) variants are known to cause interference in the analytical measurement of HbA1c. In this study, it has been characterized a new Hb variant in 4 patients during their regular control of HbA1c. Selective α1 gene sequencing showed a mutation GAC>AAC at codon 64 within exon 2. This produces a change of aspartic acid (Asp) by asparagine (Asn) that does not produce any functional alteration so the resultant molecule behaves as a silent hemoglobinopathy. The structural Hb variants can be detected during the analysis of HbA1c and may alter its values. Though rare, this occurrence signals the need to being aware when measuring HbA1c. Copyright © 2014 Elsevier España, S.L.U. All rights reserved.

  12. 32P and acute leukemia: development of leukemia in a patient with hemoglobin Yakima

    International Nuclear Information System (INIS)

    Bagby, G.C. Jr.; Richert-Boe, K.; Koler, R.D.

    1978-01-01

    In 1954 a then 31-yr-old male was found to have erythrocytosis. Over the ensuing decade he received 72 mCi 32 P. In 1964 his daughters were found to have erythrocytosis. Further investigation led to the discovery of hemoglobin Yakima, a variant with high oxygen affinity. He received no further therapy and was well until 1975, when he developed the preleukemic syndrome. Within 12 mo he developed acute nonlymphocytic leukemia accompanied by fetal erythropoiesis. Because the initial discovery of this type of hemoglobinopathy came 27 yr after the introduction of 32 P for use in the treatment of polycythemia vera, and because there are now known to be more than 39 different high-oxygen-affinity hemoglobins, we anticipate that more patients such as ours have been exposed to 32 P. The exposed population should be closely followed, since this will likely permit assessment of the risk of 32 P-induced leukemia in a nonneoplastic condition

  13. Case reports 1964, medicine: infantile hypertrophic pyloric stenosis in four siblings. Retinopathy and keratopathy due to chloroquine. The first instance of hemoglobin E in a Japanese family

    Energy Technology Data Exchange (ETDEWEB)

    Burmeister, R E; Hamilton, H B; Hinds, M J.A.; Slavin, R E; Kamata, Nanao; Shibata, Susumu; Miller, R J; Phair, J P; Kasahara, Masayuki; Shibata, Susumu

    1964-06-18

    This document contains 3 reports. In the first report four siblings are presented who had infantile pyloric stenosis unequivocally demonstrated when pyloromyotomy was performed in the early neonatal period. Their father had symptoms of stenosis as an infant but he was treated medically and it cannot be stated with certainty that he had the disease. Blood groups, determined for the four children and their parents, were not unusual. Chromosome karyotypes, obtained from peripheral blood cultures, were apparently normal. In the second report, a case study of a patient exhibiting side effects due to chloroquine used in the treatment of lupus vulgaris is presented. In the third report, in a survey for hemoglobinopathies in Nagasaki, Japan four members in two generations of a Japanese family were found to have an abnormal hemoglobin, which on detailed chemical analyses was demonstrated to be hemoglobin E. The question of prior introduction of the gene into Japan from Southeast Asia versus independent mutation is briefly discussed. 70 references, 4 figures, 5 tables.

  14. Comparison of Bone Mineral Density in Thalassemia Major Patients with Healthy Controls

    Directory of Open Access Journals (Sweden)

    Mahesh Chand Meena

    2015-01-01

    Full Text Available Chronic hemoglobinopathies like thalassemia are associated with many osteopathies like osteoporosis. Methods. This observational study was carried out to compare the bone mineral density (BMD in transfusion dependent thalassemics with that of healthy controls. Thirty-two thalassemia patients, aged 2–18 years, and 32 age and sex matched controls were studied. The bone mineral concentration (BMC and BMD were assessed at lumbar spine, distal radius, and neck of femur. Biochemical parameters like serum calcium and vitamin D levels were also assessed. Results. The BMC of neck of femur was significantly low in cases in comparison to controls. We also observed significantly lower BMD at the lumbar spine in cases in comparison to controls. A significantly positive correlation was observed between serum calcium levels and BMD at neck of femur. Conclusion. Hence, low serum calcium may be used as a predictor of low BMD especially in populations where incidence of hypovitaminosis D is very high.

  15. Pulmonary hypertension in chronic hemolytic anemias: Pathophysiology and treatment.

    Science.gov (United States)

    Haw, Alexandra; Palevsky, Harold I

    2018-04-01

    Pulmonary hypertension has emerged as a major cause of morbidity and mortality in patients with hemoglobinopathies and chronic hemolytic anemias. These hematological diseases include - but are not limited to - sickle cell disease (SCD), thalassemia, paroxysmal nocturnal hematuria, and hereditary spherocytosis. Although most studies have been based on the use of echocardiography as a screening tool for pulmonary hypertension as opposed to the gold standard of right heart catheterization for definitive diagnosis, the association between chronic hemolytic anemia and pulmonary hypertension is evident. Studies have shown that patients with SCD and a tricuspid regurgitant velocity (TRV) ≥ 2.5 m/sec are at increased risk of pulmonary hypertension and are at increased mortality risk. Additional markers of risk of pulmonary hypertension and increased mortality include a pro-BNP >160 pg/mL combined with a 6-min walk distance of pulmonary hypertension in chronic hemolytic anemias. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. Osteonecrosis in the knee joint

    Energy Technology Data Exchange (ETDEWEB)

    Poeschl, M

    1981-12-01

    The following forms are discussed: spontaneous osteonecrosis (Ahlbaeck's necrosis), which extends subchondrally into one of the femur condyles. It usually occurs in older patients, especially females. Blunt trauma may cause similar lesions. These often occur with cartilage and bone avulsions (flake fractures), which are often diagnosed much later (arthroscopy). Patellar chondropathy is increasing in frequency due to more intensive participation in sports. Pain localized at the apex of the patella (patellar apex syndrome) can develop from chondropathy, tendon lesions or primary juvenile necrosis of the patellar apex. Gas emboli occur near the knee joint during deep sea diving. Similar cartilage infarctions are seen in many hemoglobinopathies. The incidence of this is increasing due to the increased number of people immigrating from regions where these diseases are common. We have also observed vascular juvenile lesions of the epi- and metaphyses in Klippel-Trenaunay-Weber's syndrome. Their radiological appearance is similar to that of necroses.

  17. Mantle Cell Hyperplasia of Peripheral Lymph Nodes as Initial Manifestation of Sickle Cell Disease.

    Science.gov (United States)

    Monabbati, Ahmad; Noori, Sadat; Safaei, Akbar; Ramzi, Mani; Eghbali, Seyedsajjad; Adib, Ali

    2016-01-01

    Sickle cell disease (SCD) is a well known hemoglobinopathy with usual manifestations including anemia, hyperbilirubinemia, and vasoocclusive complications. Despite presence of mild splenomegaly in early phase of the disease, lymphadenopathy is not an often finding of SCD. We introduce an undiagnosed case of SCD who presented in third decade of his life with multiple cervical lymphadenopathies and mild splenomegaly persistent for about five years. Histopathologic examination of the resected lymph nodes showed expansion of the mantle cell layers of secondary follicles as well as several monomorphic mantle cell nodules. To rule out possibility of a malignant process involving lymph nodes, an immunohistochemical panel was ordered which was in favor of benign mantle cell hyperplasia. Immunoglobulin gene rearrangement study showed no clonal bands and confirmed benign nature of the process. Respecting mild abnormalities on Complete Blood Count, peripheral blood smear was reviewed revealing some typical sickle red blood cells as well as rare nucleated red blood cells. Solubility test for hemoglobin (HB) S was positive. Hemoglobin electrophoresis confirmed diagnosis of homozygous HbS disease.

  18. Beta thalassemia major: The effect of age on glomerular filtration rate

    Directory of Open Access Journals (Sweden)

    Majid Malaki

    2011-01-01

    Full Text Available Thalassemia is a common hereditary hemoglobinopathy disorder that affects many organs in the body. Estimation of kidney function is important, as it is the vital organ that plays the major role in the elimination of accumulated iron as well as the chelating drugs that have to be used as therapy. Sixty- three patients aged 1-29 years, with a mean ± SD of 14 ± 6.7 years, affected with beta- thalassemia major in Tabriz Children′s Hospital were evaluated for their renal function on the basis of their age, serum iron, serum ferritin and serum creatinine levels along with two methods of estimating glomerular filtration rate (GFR; by Schwartz method for those under 18 years old and using Modification of Diet in Renal Disease (MDRD formula for those who were 18 years and above. Elevation of serum creatinine denoting renal dysfunction was not seen in our patients, but hyperfiltration was a common finding. An increasing GFR was observed, which corresponded to age, but no relationships were seen between serum iron, serum ferritin, regular blood transfusion, chelating therapy to GFR.

  19. Effects of centrifugation on transmembrane water loss from normal and pathologic erythrocytes

    International Nuclear Information System (INIS)

    Kaperonis, A.A.; Chien, S.

    1989-01-01

    Plasma 125 I-albumin was used as a marker of extracellular dilution in order to study the effect of high-speed centrifugation on transmembrane water distribution in several types of human red cells, including normal (AA), hemoglobin variants (beta A, AS, SC, beta S, and SS), and those from patients with hereditary spherocytosis. SS and AA erythrocytes were also examined for changes in intracellular hemoglobin concentration of three different density fractions and with increasing duration of spin. The minimum force and duration of centrifugation required to impair water permeability were found to vary with the red cell type, the anticoagulant used (heparin or EDTA), the initial hematocrit of the sample centrifuged, as well as among the individual erythrocyte fractions within the same sample. When subjecting pathologic erythrocytes to high-speed centrifugation, the 125 I-albumin dilution technique can be used to determine whether the centrifugation procedure has led to an artifactual red cell water loss and to correct for this when it does occur. An abnormal membrane susceptibility to mechanical stress was demonstrated in erythrocytes from patients with hereditary spherocytosis and several hemoglobinopathies

  20. Interação entre Hb C [beta6(A3Glu>Lys] e IVS II-654 (C>T beta-talassemia no Brasil Hb C [beta6(A3Glu>Lys] and IVS II - 654 (C>T beta thalassemia interaction in Brazil

    Directory of Open Access Journals (Sweden)

    Claudia R. Bonini-Domingos

    2003-06-01

    Full Text Available Thalassemias are a heterogeneous group of inherited disorders characterized by a microcytic hypochromic anemia and an imbalance in the synthesis of the globin-chains. Hb C is the second most frequently variant of hemoglobin found in Brazil. The laboratory diagnosis of hemoglobinopathies, including thalassemias, is growing in importance, particularly because of an increasing requirement for neonatal diagnosis of abnormal hemoglobins. Screening tests were carried out using alkaline and acid electrophoresis, globin-chain analysis by cellulose acetate in alkaline pH, isoelectric focusing and HPLC. The molecular characterization was made by PCR-ASO for Hb C and beta thalassemia mutants. Large-scale screening and discriminative methodologies must provide information about the hemoglobin polymorphisms in Brazilian population. HPLC is a powerful tool in these cases. Molecular characterization is important to genetic counseling and clinical management, in particular for the Brazilian population that have an intense racial admixture, with great variability of hemoglobins. In this paper an association between Hb C and beta thalassemia (IVS-II-654 in a black family from Brazil was described.

  1. Major sickle cell syndromes in children in Kenitra, Morocco

    Directory of Open Access Journals (Sweden)

    Khalid Hafiani

    2017-11-01

    Full Text Available Objective: To highlight the epidemiological characteristics and plot the current mapping of the sickle cell syndromes in children under 15 years old. Methods: A descriptive study was conducted on children with sickle cell disease over a period of 4 years (from January 2011 to December 2015 at the Pediatric Department at El Idrissi Regional Hospital Center in Kenitra, Morocco. Results: The mean age of patients was (8.56 ± 3.97 years and the age group 6–15 years was the most affected. The male gender was the most dominant with 60.94% of cases versus 30.06% for females. The homozygous form SS was the most frequently identified (81.25% of cases while the heterozygous form SC was rarely detected (2.08%. Conclusions: Sickle cell anemia remains a reality in Morocco and may not be perfectly understood yet by health professionals. A screening policy and a sustainable management program can prevent hemoglobinopathies in the studied region. An action plan must be implemented at national level to improve the quality of management of main sickle cell syndromes.

  2. Pediatric Hypovitaminosis D

    Directory of Open Access Journals (Sweden)

    Rafiu Ariganjoye MD, MBA, FAAP, FAIHQ, CPE, CHCQM

    2017-01-01

    Full Text Available Vitamin D, a secosteroid, is essential for the development and maintenance of healthy bone in both the adult and pediatric populations. Low level of 25-hydroxy vitamin D (25-(OH-D is highly prevalent in children worldwide and has been linked to various adverse health outcomes including rickets, osteomalacia, osteomalacic myopathy, sarcopenia, and weakness, growth retardation, hypocalcemia, seizure and tetany, autism, cardiovascular diseases, diabetes mellitus, cancers (prostate, colon, breast, infectious diseases (viral, tuberculosis, and autoimmune diseases, such as multiple sclerosis and Hashimoto’s thyroiditis. Risk factors for hypovitaminosis D are people with darker skin pigmentation, use of sunscreen, insufficient ultraviolet B exposure, prematurity, living in northern latitudes, malnutrition, obesity, exclusive breastfeeding, low maternal vitamin D level, certain medications, drinking unfortified cow’s milk, liver failure, chronic renal insufficiency, cystic fibrosis, asthma, and sickle cell hemoglobinopathy. This review highlights and summarizes the molecular perspectives of vitamin D deficiency and its potential adverse health outcomes in pediatric age groups. The recommended treatment regimen is beyond the scope of this review.

  3. A comprehensive review of the prevalence of beta globin gene variations and the co-inheritance of related gene variants in Saudi Arabians with beta-thalassemia

    Science.gov (United States)

    Alaithan, Mousa A.; AbdulAzeez, Sayed; Borgio, J. Francis

    2018-01-01

    Beta-thalassemia is a genetic disorder that is caused by variations in the beta-hemoglobin (HBB) gene. Saudi Arabia is among the countries most affected by beta-thalassemia, and this is particularly problematic in the Eastern regions. This review article is an attempt to compile all the reported mutations to facilitate further national-level studies to prepare a Saudi repository of HBB gene variations. In Saudi Arabians, IVSI-5 (G>C) and Cd 39 (C>T) are the most prevalent HBB gene variations out of 42 variations. The coinheritance of HBB gene variations with ATRX, HBA1, HBA2, HBA12, AHSP, and KLF1 gene variations were observed to be common in the Saudi population. National surveys on the molecular nature of hemoglobinopathies should be set up through collaborations between research centers from various regions to create a well-documented molecular data bank. This data bank can be used to develop a premarital screening program and lead to the best treatment and prevention strategies for beta-thalassemia. PMID:29619482

  4. A Mosaic Expression of a Hb J-Amiens (HBB: c.54G > T; p.Lys18Asn) and its Interference with Hb A1c Analysis.

    Science.gov (United States)

    Schiemsky, Toon; Van Hoovels, Lieve; Desmet, Koen J O; Phylipsen, Marion; Harteveld, Cornelis L; Kieffer, Davy M J

    2015-01-01

    We report the case of a 56-year-old Caucasian woman in whom hemoglobinopathy screening was triggered following an aberrant Hb A1c analysis. Preliminary diagnosis of the hemoglobin (Hb) variant was obtained through cation exchange high performance liquid chromatography (HPLC) and gel electrophoresis. DNA analysis confirmed the presence of Hb J-Amiens [β17(A14)Lys→Asn; HBB: c.[54G > C or 54G > T)]. However, an unbalanced ratio between wild type and mutant signal after direct sequencing and a lower than expected percentage of this Hb variant led to the suggestion of a mosaic expression. Furthermore, different methods [capillary zone electrophoresis (CZE), cation exchange HPLC and boronate affinity] were tested to study the possible interference of this variant with Hb A1c measurements. These investigations showed a clinically relevant difference between the methods tested. Hb A1c analysis may lead to the discovery of new Hb variants or mosaicism for previously described Hb variants. This may have genetic consequences for the offspring of carriers and brings about the question of partner testing.

  5. Low oxygen saturation and severe anemia in compound heterozygous Hb Louisville [β42(CD1)Phe→Leu] and Hb La Desirade [β129(H7)Ala→Val].

    Science.gov (United States)

    Kamseng, Parin; Trakulsrichai, Satariya; Trachoo, Objoon; Yimniam, Walaiporn; Panthan, Bhakbhoom; Jittorntam, Paisan; Niparuck, Pimjai; Sanguanwit, Pitsucha; Wananukul, Winai; Jindadamrongwech, Sumalee

    2017-03-01

    To investigate the cause(s) of a Thai male proband presenting low oxygen saturation by pulse oximetry (SpO 2 ) and severe anemia. As Hb variant was suspected, Hb typing was determined by high-performance liquid chromatography and capillary electrophoresis, and subsequently Hb variant was identified by DNA sequencing. Complete blood counts were performed using automated blood cell counter and oxygen saturation was measured by pulse oximetry. Proband was compound heterozygous for Hb Louisville [β42(CD1)Phe→Leu] and Hb La Desirade [β129(H7)Ala→Val]. Of the proband's two sons, one was compound heterozygous for Hb Louisville and Hb E and the other for Hb La Desirade and Hb E. The former son had similar clinical features and laboratory findings with those of the proband while the latter showed had no abnormal clinical manifestations. This the first report of compound heterozygosity of Hb Louisville and Hb La Desirade in an individual of Southeast Asian ethnicity. Hb variant identification is crucial for genetic counseling and appropriate treatment in regions where hemoglobinopathies are common.

  6. Anemia: An approach to evaluation, 2014

    Directory of Open Access Journals (Sweden)

    Philip Kuriakose

    2015-01-01

    Full Text Available Anemia is very commonly encountered in general clinical practice among all age groups. The more commonly used way to classify anemia has been to categorize it as being microcytic (mean corpuscular volume [MCV] 100 fL, which in turn allows for a more practical way to attempt to come up with a cause for any decrease in hemoglobin. Microcytic anemias are usually due to iron deficiency (in turn, a result of a number of different etiologies ranging from decreased intake, malabsorption, or blood loss, hemoglobinopathies (thalassemic syndromes, and some cases of severe anemia resulting from chronic disease. Normocytic anemia is often a result of anemia of chronic disease, hemolysis, or secondary to bone marrow failure. Macrocytic anemias are frequently caused by deficiencies of folic acid and/or Vitamin B12, exposure to toxic agents like drugs that interfere with DNA metabolism and alcohol, as also bone marrow failure states, such as from myelodysplastic syndrome. A comprehensive history, physical examination, and directed laboratory evaluation will help to identify a specific cause for anemia.

  7. Molecular analysis of abnormal hemoglobins in beta chain in Aegean region of Turkey and first reports of hemoglobin Andrew-Minneapolis and Hb Hinsdale from Turkey.

    Science.gov (United States)

    Aykut, Ayça; Onay, Hüseyin; Durmaz, Asude; Karaca, Emin; Vergin, Canan; Aydınok, Yeşim; Özkınay, Ferda

    2015-07-01

    The Agean is one of the regions in Turkey where thalassemias and abnormal hemoglobins (Hbs) are prevalent. Combined heterozygosity of thalassemia mutations with a variety of structural Hb variants lead to an extremely wide spectrum of clinical and hematological phenotypes which is of importance for prenatal diagnosis. One hundred and seventeen patients and carriers diagnosed by hemoglobin electrophoresis (HPLC), at risk for abnormal hemoglobinopathies were screened for mutational analysis of the beta-globin gene. The full coding the 5' UTR, and the 3' UTR sequences of beta-globin gene (GenBank accession no. U01317) were amplified and sequenced. In this study, a total of 118 (12.24%) structural Hb variant alleles were identified in 1341 mutated beta-chain alleles in Medical Genetics Department of Ege University between January 2006 and November 2013. Here, we report the mutation spectrum of abnormal Hbs associated with the beta-globin gene in Aegean region of Turkey. In the present study, the Hb Hinsdale and Hb Andrew-Minneapolis variants are demonstrated for the first time in the Turkish population.

  8. Triagem neonatal para hemoglobinopatias no Rio de Janeiro, Brasil Neonatal screening for hemoglobinopathies in Rio de Janeiro, Brazil

    Directory of Open Access Journals (Sweden)

    Clarisse Lopes de Castro Lobo

    2003-03-01

    Full Text Available OBJETIVO: Descrever os principais resultados do programa de triagem neonatal para a doença falciforme do Estado do Rio de Janeiro em 15 meses de funcionamento (agosto de 2000 a novembro de 2001. MÉTODOS: A partir de agosto de 2000, amostras de sangue passaram a ser coletadas de todos os recém-nascidos atendidos em postos de atenção básica à saúde no Estado para triagem neonatal da doença falciforme. Essas amostras são submetidas a cromatografia líquida de alta resolução. Se o cromatograma resultante for compatível com a doença falciforme, a criança e seus pais são encaminhados para confirmação diagnóstica e tratamento. RESULTADOS: De agosto de 2000 a novembro de 2001, 99 260 recém nascidos participaram da triagem. Houve um caso de homozigose para Hb C. Um em cada 27 recém-nascidos triados pelo programa apresentou o traço falciforme (Hb AS. A doença falciforme foi constatada em 83 casos (um caso novo para cada 1 196 nascimentos: 62 Hb S, 18 Hb SC, 3 Hb SD. Uma criança não compareceu para confirmação diagnóstica. As 82 crianças acompanhadas apresentaram 15 intercorrências (infecções de vias aéreas superiores, febre, seqüestro esplênico, síndrome mão-pé e crises de vaso-oclusão, motivando sete internações. Houve necessidade de transfusão sangüínea em 15 crianças, mas nenhuma tornou-se alo-imunizada. Os demais bebês estão evoluindo satisfatoriamente com o uso de penicilina profilática. CONCLUSÕES: Nossos dados evidenciam a importância do diagnóstico precoce da doença falciforme, de forma a prevenir e evitar as freqüentes complicações infecciosas enfrentadas por esses pacientes.OBJECTIVE: To describe the main results obtained in the first 15 months of neonatal screening for sickle cell disease in the state of Rio de Janeiro, Brazil, from August 2000 to November 2001. METHODS: Starting in August 2000, blood samples began to be collected for sickle cell disease screening from all newborns receiving care in primary health care clinics in the state of Rio de Janeiro. The samples were submitted to high-resolution liquid chromatography. If the resulting chromatogram was compatible with sickle cell disease, the child and the parents were referred for diagnostic confirmation and treatment. RESULTS: Between August 2000 and November 2001, 99 260 newborns were screened. There was one case of homozygous Hb C. On average, one of every 27 newborns who were screened presented sickle cell trait (Hb AS. Sickle cell disease was observed in 83 cases, or one new case in each 1 196 births. The 83 consisted of: 62 Hb S, 18 Hb SC, and 3 Hb SD. One child did not appear for diagnostic confirmation. The 82 children who were followed up by the program presented 15 intercurrent illnesses (upper respiratory infections, fever, splenic sequestration crises, hand-foot syndrome, and vascular occlusion, resulting in seven hospital admissions. Blood transfusions were necessary with 15 children, but none developed alloimmunization. All the other babies were doing well with the use of prophylactic penicillin. CONCLUSIONS: Our data show the importance of early diagnosis for sickle cell disease, so as to prevent the frequent infectious complications faced by these patients.

  9. Focalização isoelétrica na identificação das hemoglobinas The isoelectric focusing for hemoglobin identification

    Directory of Open Access Journals (Sweden)

    Luciane Cristina Bertholo

    2006-06-01

    Full Text Available INTRODUÇÃO: Considerando a significativa freqüência das hemoglobinopatias na população brasileira e a necessidade do estabelecimento de metodologia confiável, rápida, reprodutível e possível de ser aplicada a um grande número de amostras, foi objetivo desse trabalho analisar as diferenças observadas pelas metodologias eletroforéticas em acetato de celulose e em ágar amido em comparação com a focalização isoelétrica (IEF e o estabelecimento de um padrão amostral apresentando as principais posições das hemoglobinas anormais, com enfoque nas observadas na população brasileira. CASUÍSTICA E MÉTODOS: O material de estudo foi constituído por amostras de sangue de pacientes laboratoriais e doadores pertencentes à região central do estado de São Paulo, Brasil, e nelas aplicamos os testes de rotina laboratorial. Para efeito de comparação e validade das provas laboratoriais, correlacionamos os resultados dos testes com a técnica de focalização isoelétrica. RESULTADOS E DISCUSSÃO: Os resultados observados em cada procedimento, somados aos dados de literatura, permitiram estabelecer padrões de migração para cada sistema eletroforético das hemoglobinas observadas na população brasileira. Dessa forma foram estruturados quadros com a possibilidade do uso dos mesmos evidenciando a facilidade e a viabilidade dessa técnica por diferentes laboratórios.BACKGROUND: Considering the significant frequency of hemoglobinopathies in the Brazilian population and the necessity of establishing a reliable methodology, quick, reproductive and possible to be applied in a large number of samples, it was the objective of this work to analyze the differences on electrophoretic procedures with cellulose acetate and acid agar compared with isoelectric focusing (IEF, and to establish a standard of migration, presenting main positions of abnormal hemoglobin, based on Brazilian population hemoglobin. MATERIAL AND METHOD: The studied material

  10. Influence of genetic polymorphisms and mutations in the cardiac pathology of iron overload in thalassemia and sickle cell anemia patients: a retrospective study

    Directory of Open Access Journals (Sweden)

    Veronica Agrigento

    2012-11-01

    Full Text Available Cardiac disease in thalassemia is determined by the accumulation of iron in the tissue. Genetic factors could influence the severity and the rapidity of the modifications of the cardiac tissue. Mutations or polymorphisms of genes have already been described as being implicated in cardiac disease. In particular, we studied the polymorphisms C1091T in the Connexin 37 gene (CX 37, 4G -668 5G in the Plasminogen Activator Inhibitor-1 gene (PAI 1 and 5A-1171 6A in the Stromelysin-1 gene (SL in 193 randomly selected patients affected by hemoglobinopathies and 100 normal subjects randomly selected from the general population. A retrospective analysis based on history, clinical data and imaging studies was carried out to assess the presence and type of heart disease. The results of our study do not demonstrate a close association between polymorphism in these candidate genes and cardiac disease, and in particular with myocardial infarction in a cohort of Sicilian patients affected by hemoglobinopathies. 地中海贫血心脏病的关键诱因是组织中的铁沉积。遗传因子可能影响心脏组织修复的严重程度和速度。基因突变或基因多态性与心脏病有关。尤其是,我们研究了193名随机选择的血红蛋白病患者以及从普通人群中随机选择的100名正常受试者的连接蛋白37基因(CX37)的C1091T、纤溶酶原激活物抑制剂-1基因(PAI1)的4G -668 5G 和基质分解素-1基因(SL)的5A-1171 6A等多态性。根据病史、临床资料和影像研究进行回顾性分析,以评估心脏病的存在情况和类型。我们的研究结果并没有表明这些候选基因的多态性和心脏疾病之间存在密切联系,尤其是与一组西西里岛血红蛋白病患者的心肌梗塞存在密切联系。

  11. The effect of UGT1A1 promoter polymorphism in the development of hyperbilirubinemia and cholelithiasis in hemoglobinopathy patients.

    Directory of Open Access Journals (Sweden)

    Suad AlFadhli

    Full Text Available Present study was aimed to explore the effect of (TAn UGT1A1 gene promoter polymorphism on bilirubin metabolism, bilirubinaemia, predisposition to cholelithiasis and subsequent cholecystectomy, in Sickle-Cell Anemia (SCA and beta-Thalasemia major (bTH in Kuwaiti subjects compared to other population. This polymorphism was analyzed and correlated to total bilirubin and cholelithiasis in 270 age, gender, ethnically matched subjects (92 bTH, 116 SCA and 62 Controls using PCR, dHPLC, fragment analysis and direct sequencing. Four genotypes of UGT1A1 were detected in this study (TA6/6, TA6/7, TA6/8 and TA7/7. (TA6/8 was found only in four individuals; hence it was not included in the analysis. There was a statistically significant association of genotypes with serum total bilirubin levels in both bTH and SCA groups (p<0.001. Subjects with (TA7/7 had the highest total serum bilirubin level (178.7 ± 3.5 µmole/l. A significant association was observed between allele (TA7 and cholelithiasis development (p = 0.0001. The 40%, 67.5% and 100% of SCA with (TA6/6, (TA6/7 and (TA7/7 respectively developed cholelithiasis and were subsequently cholecystectomized. Our results confirm UGT1A1 (TA7 allele as one of the factors accounting for the hyperbilirubinemia and cholelithiasis observed in SCA and bTH.

  12. Genetic diagnosis for congenital hemolytic anemia.

    Science.gov (United States)

    Ohga, Shouichi

    2016-01-01

    Congenital hemolytic anemia is a group of monogenic diseases presenting with anemia due to increased destruction of circulating erythrocytes. The etiology of inherited anemia accounts for germline mutations of the responsible genes coding for the structural components of erythrocytes and extra-erythrocytes. The erythrocyte abnormalities are classified into three major disorders of red cell membrane defects, hemoglobinopathies, and red cell enzymopathies. The extra-erythrocyte abnormalities, typified by consumption coagulopathy and intravascular hemolysis, include Upshaw-Schulman syndrome and atypical hemolytic uremic syndrome. The clinical manifestations of congenital hemolytic anemia are anemia, jaundice, cholelithiasis and splenomegaly, while the onset mode and severity are both variable. Genetic overlapping of red cell membrane protein disorders, and distinct frequency and mutation spectra differing among races make it difficult to understand this disease entity. On the other hand, genetic modifiers for the phenotype of β-globin diseases provide useful information for selecting the optimal treatment and for long-term management. Recently, next generation sequencing techniques have enabled us to determine the novel causative genes in patients with undiagnosed hemolytic anemias. We herein review the concept and strategy for genetic diagnosis of inherited hemolytic anemias.

  13. Cord stem-cell transplantation in Ontario: do we need a public bank?

    Science.gov (United States)

    Gassas, A

    2011-06-01

    It has been 21 years since the first successful use of umbilical cord blood as a source of donor cells for hematopoietic stem cell transplantation (HSCT). Over those years, cord blood transplantation (CBT) has shown marked success as an effective modality in the treatment of children and adults with hematologic malignancies, marrow failure, immunodeficiency, hemoglobinopathy, and inherited metabolic diseases. Furthermore, transplantation without full human leukocyte antigen (HLA) matching is possible and, despite a lower incidence of graft-versus-host disease, graft-versus-leukemia effect is preserved. More than 20,000 cbts have been performed worldwide. Ontario is the most populated province in Canada, and its cbt numbers have increased dramatically in recent years, but most of the umbilical cord blood units are purchased from unrelated international registries. There is no public cord bank in Ontario, but there is a private cord banking option, and notably, Ontario has the largest number of live births in Canada [approximately 40% of all Canadian live births per year occur in Ontario (Statistics Canada, 2007)]. In this brief review, the pros and cons of private and public cord banking and the feasibility of starting an Ontario public cord bank are discussed.

  14. Etiology of anemia in primary hypothyroid subjects in a tertiary care center in Eastern India

    Directory of Open Access Journals (Sweden)

    Chanchal Das

    2012-01-01

    Full Text Available Introduction: The association of anemia with primary hypothyroidism has been common knowledge for many years. However; its pathogenesis is far from clear in many cases. Often the causes of anemia are manifold. Aims and objectives: In this study, we evaluated the causes of anemia in patients with primary hypothyroidism. Materials and Methods : Sixty adult nonpregnant untreated primary hypothyroid patients with anemia without any obvious cause were included. All patients were subjected to full medical history, clinical examination, biochemical and imaging studies. Serum iron profile, vitamin B12, folic acid, anti parietal cell antibody, anti TPO antibody, bone marrow study, and stool for occult blood, Coomb′s test, HPLC for hemoglobinopathies and complete hemogram with reticulocyte count were done and analyzed. Results: Normocytic, normochromic anemia was present in 31 patients (51.6% followed by microcytic anemia in 26 patients (43.3%. Six patients (10% had megaloblastic anemia with vitamin B12 deficiency including 3 cases of pernicious anemia. Two patients had combined deficiency of iron and vitamin B12. Conclusion: Normocytic normochromic anemia with normal bone marrow was commonest type of anemia in this study, followed by iron deficiency anemia.

  15. Effects of centrifugation on transmembrane water loss from normal and pathologic erythrocytes

    Energy Technology Data Exchange (ETDEWEB)

    Kaperonis, A.A.; Chien, S.

    1989-02-01

    Plasma /sup 125/I-albumin was used as a marker of extracellular dilution in order to study the effect of high-speed centrifugation on transmembrane water distribution in several types of human red cells, including normal (AA), hemoglobin variants (beta A, AS, SC, beta S, and SS), and those from patients with hereditary spherocytosis. SS and AA erythrocytes were also examined for changes in intracellular hemoglobin concentration of three different density fractions and with increasing duration of spin. The minimum force and duration of centrifugation required to impair water permeability were found to vary with the red cell type, the anticoagulant used (heparin or EDTA), the initial hematocrit of the sample centrifuged, as well as among the individual erythrocyte fractions within the same sample. When subjecting pathologic erythrocytes to high-speed centrifugation, the /sup 125/I-albumin dilution technique can be used to determine whether the centrifugation procedure has led to an artifactual red cell water loss and to correct for this when it does occur. An abnormal membrane susceptibility to mechanical stress was demonstrated in erythrocytes from patients with hereditary spherocytosis and several hemoglobinopathies.

  16. USP38, FREM3, SDC1, DDC, and LOC727982 Gene Polymorphisms and Differential Susceptibility to Severe Malaria in Tanzania.

    Science.gov (United States)

    Manjurano, Alphaxard; Sepúlveda, Nuno; Nadjm, Behzad; Mtove, George; Wangai, Hannah; Maxwell, Caroline; Olomi, Raimos; Reyburn, Hugh; Drakeley, Christopher J; Riley, Eleanor M; Clark, Taane G

    2015-10-01

    Populations exposed to Plasmodium falciparum infection develop genetic mechanisms of protection against severe malarial disease. Despite decades of genetic epidemiological research, the sickle cell trait (HbAS) sickle cell polymorphism, ABO blood group, and other hemoglobinopathies remain the few major determinants in severe malaria to be replicated across different African populations and study designs. Within a case-control study in a region of high transmission in Tanzania (n = 983), we investigated the role of 40 new loci identified in recent genome-wide studies. In 32 loci passing quality control procedures, we found polymorphisms in USP38, FREM3, SDC1, DDC, and LOC727982 genes to be putatively associated with differential susceptibility to severe malaria. Established candidates explained 7.4% of variation in severe malaria risk (HbAS polymorphism, 6.3%; α-thalassemia, 0.3%; ABO group, 0.3%; and glucose-6-phosphate dehydrogenase deficiency, 0.5%) and the new polymorphisms, another 4.3%. The regions encompassing the loci identified are promising targets for the design of future treatment and control interventions. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

  17. Interaction of Hb Grey Lynn (Vientiane) [α91(FG3)Leu>Phe (α1)] with Hb E [β26(B8) Glu>Lys] and α(+)-thalassemia: Molecular and Hematological Analysis.

    Science.gov (United States)

    Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan

    2015-01-01

    Hemoglobin (Hb) Grey Lynn is a Hb variant caused by a mutation at codon 91 of α1-globin gene whereas Hb E is a common β-globin chain variant among Southeast Asian population. We report two hitherto undescribed conditions of Hb Grey Lynn found in Thai individuals. The study was done on two unrelated Thai subjects. Hematological parameters were recorded and Hb analysis was carried out using automated Hb analyzers. Mutations were identified by DNA analysis. Hematological features of the patients were compared with those of various forms of Hb Grey Lynn documented previously. Hb and DNA analyses identified a heterozygous Hb Grey Lynn in one patient and a double heterozygous Hb Grey Lynn and Hb E with α(+)-thalassemia in another. Interaction of α(Grey Lynn) with β(E) chains leads to the formation of a new Hb variant, namely the Hb Grey Lynn E (α(GL)2β(E)2), detectable by liquid chromatography (10.3%) but masked by Hb E on capillary electrophoresis. Interaction of these multiple globin gene defects could lead to complex hemoglobinopathies requiring combined analysis with multiple Hb analyzers followed by DNA testing to provide accurate diagnosis of the cases.

  18. Hemoglobin A1c measurement for the diagnosis of Type 2 diabetes in children

    Directory of Open Access Journals (Sweden)

    Kapadia Chirag

    2012-12-01

    Full Text Available Abstract Laboratory measurements of hemoglobin A1c above 6.5% were approved as an additional diagnostic criteria for diabetes mellitus by the American Diabetes Association in 2010. Several recent pediatric studies have cast HbA1c measurement in children in an unfavorable light in the pediatric population, by comparing HbA1c measurements to results on oral glucose tolerance test (OGTT or fasting plasma glucose (FPG. However, many of these studies do not recognize that diabetes diagnostic criteria are based upon long-term health outcomes. In this sense, OGTT and FPG have themselves never been validated in the pediatric population. Studies to validate diagnostic tests for diabetes in pediatric populations may take a substantial period of time, and may prove unfeasible. However, studies that tie diagnostic results as a child to diagnostic results as an adult may be more feasible and may provide the data needed to determine which pediatric diagnostic criteria to use. Thus, for the time being, except for cases of hemoglobinopathy, cystic fibrosis, and a few other exceptions, describing HbA1c as ‘lacking in sensitivity or specificity’ in the pediatric population because of lack of correlation with OGTT is not scientifically sound.

  19. Avaliação de Hb A2 e Hb F em doadores de sangue de região malarígena da Amazônia Oriental brasileira por HPLC Evaluation of Hb A2 and Hb F by HPLC in blood donors from the malaria endemic region of Eastern Amazon of Brazil

    Directory of Open Access Journals (Sweden)

    Wanessa C. Souza

    2003-01-01

    Full Text Available In malaria endemic regions of Africa, resistance to infection by Plasmodium has been observed in under 6-month-old children, when there are higher fetal hemoglobin (Hb F levels. Research performed in the São José do Rio Preto region, central-east Brazil, reported increased levels of Hb F in blood donors. The purpose of this work was to evaluate the A2 hemoglobin (Hb A2 and Hb F concentrations in blood donors deriving from the Brazilian malaria endemic region. Forty-five blood donor samples from Macapá, from patients with varying genders, ages and ethnic origins, were collected by venous puncture after informed consent was obtained. The samples were analyzed by High Performance Liquid Chromatography (HPLC - System Variant (Bio-Rad. The HPLC demonstrated sensitivity and rapidity in the identification and measurement of the hemoglobins and gave precise results. Moreover, it provided measurement of hemoglobin variants, even when they were present in small amounts, providing a diagnosis of hemoglobinopathies. Hb F levels above the normal were observed in 33.3% of the analyzed samples. The presence of increased Hb F can suggest resistance to infection by Plasmodium falciparum, as there have been reports that infected red blood cells interfere in the development of the parasite.

  20. A systematic analysis of global anemia burden from 1990 to 2010

    Science.gov (United States)

    Jasrasaria, Rashmi; Naghavi, Mohsen; Wulf, Sarah K.; Johns, Nicole; Lozano, Rafael; Regan, Mathilda; Weatherall, David; Chou, David P.; Eisele, Thomas P.; Flaxman, Seth R.; Pullan, Rachel L.; Brooker, Simon J.; Murray, Christopher J. L.

    2014-01-01

    Previous studies of anemia epidemiology have been geographically limited with little detail about severity or etiology. Using publicly available data, we estimated mild, moderate, and severe anemia from 1990 to 2010 for 187 countries, both sexes, and 20 age groups. We then performed cause-specific attribution to 17 conditions using data from the Global Burden of Diseases, Injuries and Risk Factors (GBD) 2010 Study. Global anemia prevalence in 2010 was 32.9%, causing 68.36 (95% uncertainty interval [UI], 40.98 to 107.54) million years lived with disability (8.8% of total for all conditions [95% UI, 6.3% to 11.7%]). Prevalence dropped for both sexes from 1990 to 2010, although more for males. Prevalence in females was higher in most regions and age groups. South Asia and Central, West, and East sub-Saharan Africa had the highest burden, while East, Southeast, and South Asia saw the greatest reductions. Iron-deficiency anemia was the top cause globally, although 10 different conditions were among the top 3 in regional rankings. Malaria, schistosomiasis, and chronic kidney disease–related anemia were the only conditions to increase in prevalence. Hemoglobinopathies made significant contributions in most populations. Burden was highest in children under age 5, the only age groups with negative trends from 1990 to 2010. PMID:24297872

  1. Comparison of the BioRad Variant and Primus Ultra2 high-pressure liquid chromatography (HPLC) instruments for the detection of variant hemoglobins.

    Science.gov (United States)

    Gosselin, R C; Carlin, A C; Dwyre, D M

    2011-04-01

    Hemoglobin variants are a result of genetic changes resulting in abnormal or dys-synchronous hemoglobin chain production (thalassemia) or the generation of hemoglobin chain variants such as hemoglobin S. Automated high-pressure liquid chromatography (HPLC) systems have become the method of choice for the evaluation of patients suspected with hemoglobinopathies. In this study, we evaluated the performance of two HPLC methods used in the detection of common hemoglobin variants: Variant and Ultra2. There were 377 samples tested, 26% (99/377) with HbS, 8.5% (32/377) with HbC, 20.7% (78/377) with other hemoglobin variant or thalassemia, and 2.9% with increased hemoglobin A(1) c. The interpretations of each chromatograph were compared. There were no differences noted for hemoglobins A(0), S, or C. There were significant differences between HPLC methods for hemoglobins F, A(2), and A(1) c. However, there was good concordance between normal and abnormal interpretations (97.9% and 96.2%, respectively). Both Variant and Ultra2 HPLC methods were able to detect most common hemoglobin variants. There was better discrimination for fast hemoglobins, between hemoglobins E and A(2), and between hemoglobins S and F using the Ultra2 HPLC method. © 2010 Blackwell Publishing Ltd.

  2. Prenatal diagnosis in Islamic countries: A narrative review in 2013

    Directory of Open Access Journals (Sweden)

    Mehrnoush Kosaryan

    2014-02-01

    Full Text Available To review the current situation regarding prenatal diagnosis in Islamic countries, a descriptive study (narrative review has been done based on the available data in formal international and national published documents in 2013. The sources were papers, websites and electronic books. Time limitation of searches has started 20 years ago. The main languages were English and Persian. Forty seven nations were officially referred as Islamic since more than 50% of the citizens are Muslims. The holy Qur'an and Islamic traditions (Shari'aht are the core of the civil laws, however, the legal grounds for prenatal diagnosis differ in Islamic countries. The main ground is the endangerment of a mother's life, however, severe suffering of parents (Osr va Haraj is also considered in the Islamic Republic of Iran. Some other important issues such as pregnancies as a result of rape should be discussed more in some Islamic countries. Many “hard to treat diseases” such as chromosomal disorders, major hemoglobinopathies, inborn error of metabolism, Duchene muscular dystrophy, spinal muscular dystrophy are being diagnosed early in embryonic period that medical abortion is advisable. Prenatal diagnosis is an acceptable practice in both religious and secular governments in the so-called Islamic countries

  3. Recommendations regarding splenectomy in hereditary hemolytic anemias

    Science.gov (United States)

    Iolascon, Achille; Andolfo, Immacolata; Barcellini, Wilma; Corcione, Francesco; Garçon, Loïc; De Franceschi, Lucia; Pignata, Claudio; Graziadei, Giovanna; Pospisilova, Dagmar; Rees, David C.; de Montalembert, Mariane; Rivella, Stefano; Gambale, Antonella; Russo, Roberta; Ribeiro, Leticia; Vives-Corrons, Jules; Martinez, Patricia Aguilar; Kattamis, Antonis; Gulbis, Beatrice; Cappellini, Maria Domenica; Roberts, Irene; Tamary, Hannah

    2017-01-01

    Hereditary hemolytic anemias are a group of disorders with a variety of causes, including red cell membrane defects, red blood cell enzyme disorders, congenital dyserythropoietic anemias, thalassemia syndromes and hemoglobinopathies. As damaged red blood cells passing through the red pulp of the spleen are removed by splenic macrophages, splenectomy is one possible therapeutic approach to the management of severely affected patients. However, except for hereditary spherocytosis for which the effectiveness of splenectomy has been well documented, the efficacy of splenectomy in other anemias within this group has yet to be determined and there are concerns regarding short- and long-term infectious and thrombotic complications. In light of the priorities identified by the European Hematology Association Roadmap we generated specific recommendations for each disorder, except thalassemia syndromes for which there are other, recent guidelines. Our recommendations are intended to enable clinicians to achieve better informed decisions on disease management by splenectomy, on the type of splenectomy and the possible consequences. As no randomized clinical trials, case control or cohort studies regarding splenectomy in these disorders were found in the literature, recommendations for each disease were based on expert opinion and were subsequently critically revised and modified by the Splenectomy in Rare Anemias Study Group, which includes hematologists caring for both adults and children. PMID:28550188

  4. In utero hematopoietic stem cell transfer: current status and future strategies.

    Science.gov (United States)

    Surbek, D V; Gratwohl, A; Holzgreve, W

    1999-07-01

    Successful prenatal treatment of severe immunodeficiencies by allogeneic hematopoietic stem cell transplantation in utero has been reported. Though other diseases like hemoglobinopathies or storage diseases are potentially amenable to this novel therapeutic approach, no success has yet been achieved in recipients without severe immunodeficiency. Graft rejection by the developing fetus and/or lack of selective, competitive advantage of donor versus host stem cells preventing stable engraftment seem to be the major obstacles. Several strategies to overcome these hurdles are being explored in preclinical settings, including timing and repeated dosing of stem cell administration to the fetus, ex vivo modification of the transplant, using different fetal compartments as targets for early stem cell transfer, or inducing microchimerism for postnatal transplantation from the same donor. In addition, the exact definition of the basic concept of early fetal immunologic naivete and the understanding of the molecular basics of migration and homing in fetal hematopoiesis system seem mandatory for a successful approach. Gene therapy using ex vivo transduced autologous cord blood cells or direct gene targeting in utero are other potential means to correct hematopoietic and immunologic single gene disorders in utero, though this approach is still away from the stage of clinical trials.

  5. Detection of Hb Constant Spring (HBA2: c.427T>C) Heterozygotes in Combination with β-Thalassemia or Hb E Trait by Capillary Electrophoresis.

    Science.gov (United States)

    Pornprasert, Sakorn; Saoboontan, Supansa; Punyamung, Manoo

    2015-01-01

    Hb Constant Spring (Hb CS; HBA2: c.427T>C) is often missed by routine laboratory testing as its mRNA as well as gene product are unstable and presented at a low level in peripheral blood. This study aimed to analyze the efficacy of capillary electrophoresis (CE) for detecting and quantifying of Hb CS in β-thalassemia (β-thal) trait or Hb E (HBB: c.79G>A) trait samples with reduced β-globin chain expression. Thalassemia diagnostic data were reviewed in 2524 blood samples that were submitted to the laboratory of the Associated Medical Sciences Clinical Service Center, Chiang Mai, Thailand for hemoglobinopathy and thalassemia diagnosis. DNA analysis for Hb CS was performed in 322 β-thal trait and 397 Hb E trait samples using the amplification refractory mutation system (ARMS). The CE electropherogram of Hb CS at zone 2 was observed in all five samples with β-thal trait and nine samples with Hb E trait with levels varying from 0.1-2.8 and 0.1-2.3%, respectively. Thus, the CE method proved useful for screening of Hb CS in samples with β-thal trait or Hb E trait, which is essential for providing accurate diagnosis, genetic counseling, prevention and control programs of Hb H-CS disease.

  6. Diagnosis of Compound Heterozygous Hb Tak/β-Thalassemia and HbD-Punjab/β-Thalassemia by HbA2 Levels on Capillary Electrophoresis.

    Science.gov (United States)

    Panyasai, Sitthichai; Sakkhachornphop, Supachai; Pornprasert, Sakorn

    2018-01-01

    A misdiagnosis of β-thalassemia carrier in samples with Hb Tak and HbD-Punjab, the β-variants, can be a cause of inappropriate genetic counseling thus having a new case of β-thalassemia major. A capillary electrophoresis (CE) is very efficient in separating and quantifying HbA 2 . In this study, HbA 2 levels of samples which were doubted for compound heterozygous Hb Tak/β-thalassemia or heterozygous HbD-Punjab/β-thalassemia were measured and compared between CE and high performance liquid chromatography (HPLC). The molecular confirmation for Hb Tak, HbD-Punjab and β-thalassemia codons 17 (A > T), 41/42 (-TCTT), 71/72 (+A) and IVSI-nt1 (G > T) mutations and 3.4 kb deletion were also performed. Based on DNA analysis, 3 cases were diagnosed as compound heterozygous Hb Tak/β-thalassemia and one for HbD-Punjab/β-thalassemia. The elevated HbA 2 levels were found in all 4 samples with rages of 4.6-7.3% on CE while those were not found on HPLC. Thus, the elevated HbA 2 measured by CE can be used as a screening parameter for differentiating the homozygote of Hb Tak and HbD-Punjab from the compound heterozygote of these hemoglobinopathies and β-thalassemia.

  7. Epidemiology and treatment of relative anemia in children with sickle cell disease in sub-Saharan Africa.

    Science.gov (United States)

    Bello-Manga, Halima; DeBaun, Michael R; Kassim, Adetola A

    2016-11-01

    Sickle cell disease (SCD) is the most common inherited hemoglobinopathy in the world, with the majority of cases in sub-Saharan Africa. Concomitant nutritional deficiencies, infections or exposure to environmental toxins exacerbate chronic anemia in children with SCD. The resulting relative anemia is associated with increased risk of strokes, poor cognitive function and impaired growth. It may also attenuate optimal response to hydroxyurea therapy, the only effective and practical treatment option for SCD in sub-Saharan Africa. This review will focus on the epidemiology, clinical sequelae, and treatment of relative anemia in children with SCD living in low and middle-income countries in sub-Saharan Africa. Areas covered: The causes and treatment of relative anemia in children with SCD in sub-Saharan Africa. The MEDLINE database was searched using medical subject headings (MeSH) and keywords for articles regarding relative anemia in children with SCD in sub-Saharan Africa. Expert commentary: Anemia due to nutritional deficiencies and infectious diseases such as helminthiasis and malaria are prevalent in sub-Saharan Africa. Their co-existence in children with SCD increases morbidity and mortality. Therefore, preventing, diagnosing and treating the underlying cause of this relative anemia will improve SCD-related outcomes in children in sub-Saharan Africa.

  8. KLF10 gene expression is associated with high fetal hemoglobin levels and with response to hydroxyurea treatment in β-hemoglobinopathy patients

    NARCIS (Netherlands)

    Borg, Joseph; Phylactides, Marios; Bartsakoulia, Marina; Tafrali, Christina; Lederer, Carsten; Felice, Alexander E.; Papachatzopoulou, Adamantia; Kourakli, Alexandra; Stavrou, Eleana F.; Christou, Soteroula; Hou, Jun; Karkabouna, Sophia; Lappa-Manakou, Christina; Ozgur, Zeliha; van Ijcken, Wilfred; von Lindern, Marieke; Grosveld, Frank G.; Georgitsi, Marianthi; Kleanthous, Marina; Philipsen, Sjaak; Patrinos, George P.

    2012-01-01

    In humans, fetal hemoglobin (HbF) production is controlled by many intricate mechanisms that, to date, remain only partly understood. Pharmacogenomic analysis of the effects of hydroxyurea (HU) on HbF production was undertaken in a collection of Hellenic β-thalassemia and sickle cell disease (SCD)

  9. Cross-Sectional Study for the Detection of Mutations in the Beta-Globin Gene Among Patients with Hemoglobinopathies in the Bengali Population.

    Science.gov (United States)

    Panja, Amrita; Chowdhury, Prosanto; Chakraborty, Sharmistha; Ghosh, Tapan Kumar; Basu, Anupam

    2017-01-01

    Thalassemia is a common autosomal recessive blood disorder, which is most prevalent in South East Asian and Mediterranean populations. It is considered as a major health burden in the Indian population. The aims of the present study were to investigate the common, as well as uncommon, mutations responsible for thalassemia in the Bengali population. The Bengali state was divided into four sampling zones. Mutation detection was done using Sanger sequencing of the HBB gene. A total of 14 different mutations were observed, including rare mutations IVS1-130(G>C), IVS1-129(A>C), -90(T>C), CD16(-C), -30(T>C), CD15(-T), and a novel mutation CD53(C>T). The frequencies of IVS1-5(G>C) and CD26(G>A) mutations were higher than other mutations. There were also some silent polymorphisms found in the studied group, CD3(T>C), CD10(C>A), IVSII-16(G>C), IVSII-74(T>G), -42(C>G). The present study is the first attempt to screen for β-thalassemia-causing mutations by direct sequencing in different districts of West Bengal. The information obtained from the present study may be helpful for thalassemia management and prenatal mutation detection.

  10. The Injection of Air/Oxygen Bubble into the Anterior Chamber of Rabbits as a Treatment for Hyphema in Patients with Sickle Cell Disease

    Directory of Open Access Journals (Sweden)

    Emre Ayintap

    2014-01-01

    Full Text Available Purpose. To investigate the changes of partial oxygen pressure (PaO2 in aqueous humour after injecting air or oxygen bubble into the anterior chamber in sickle cell hyphema. Methods. Blood samples were taken from the same patient with sickle cell disease. Thirty-two rabbits were divided into 4 groups. In group 1 (n=8, there was no injection. Only blood injection constituted group 2 (n=8, both blood and air bubble injection constituted group 3 (n=8, and both blood and oxygen bubble injection constituted group 4 (n=8. Results. The PaO2 in the aqueous humour after 10 hours from the injections was 78.45 ± 9.9 mmHg (Mean ± SD for group 1, 73.97 ± 8.86 mmHg for group 2, 123.35 ± 13.6 mmHg for group 3, and 306.47 ± 16.5 mmHg for group 4. There was statistically significant difference between group 1 and group 2, when compared with group 3 and group 4. Conclusions. PaO2 in aqueous humour was increased after injecting air or oxygen bubble into the anterior chamber. We offer to leave an air bubble in the anterior chamber of patients with sickle cell hemoglobinopathies and hyphema undergoing an anterior chamber washout.

  11. CRISPR/Cas9 system and its applications in human hematopoietic cells.

    Science.gov (United States)

    Hu, Xiaotang

    2016-11-01

    Since 2012, the CRISPR-Cas9 system has been quickly and successfully tested in a broad range of organisms and cells including hematopoietic cells. The application of CRISPR-Cas9 in human hematopoietic cells mainly involves the genes responsible for HIV infection, β-thalassemia and sickle cell disease (SCD). The successful disruption of CCR5 and CXCR4 genes in T cells by CRISPR-Cas9 promotes the prospect of the technology in the functional cure of HIV. More recently, eliminating CCR5 and CXCR4 in induced pluripotent stem cells (iPSCs) derived from patients and targeting the HIV genome have been successfully carried out in several laboratories. The outcome from these approaches bring us closer to the goal of eradicating HIV infection. For hemoglobinopathies the ability to produce iPSC-derived from patients with the correction of hemoglobin (HBB) mutations by CRISPR-Cas9 has been tested in a number of laboratories. These corrected iPSCs also show the potential to differentiate into mature erythrocytes expressing high-level and normal HBB. In light of the initial success of CRESPR-Cas9 in target mutated gene(s) in the iPSCs, a combination of genomic editing and autogenetic stem cell transplantation would be the best strategy for root treatment of the diseases, which could replace traditional allogeneic stem cell transplantation. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Use of Electronic Consultation System to Improve Access to Care in Pediatric Hematology/Oncology.

    Science.gov (United States)

    Johnston, Donna L; Murto, Kimmo; Kurzawa, Julia; Liddy, Clare; Keely, Erin; Lai, Lillian

    2017-10-01

    Electronic consultations (eConsult) allow for communication between primary care providers and specialists in an asynchronous manner. This study examined provider satisfaction, topics of interest, and efficiency of eConsult in pediatric hematology/oncology in Ottawa, Canada. We conducted a cross-sectional assessment of all eConsult cases directed to pediatric hematology/oncology specialists using the Champlain BASE (Building Access to Specialists through eConsultation) eConsult service from June 1, 2014 to May 31, 2016. There were 1064 eConsults to pediatrics during the study timeperiod and pediatric hematology/oncology consults accounted for 8% (85). During the same study timeperiod, 524 consults were seen in the pediatric hematology/oncology clinic. The majority of the eConsults were for hematology (90.5%) in contrast to oncology topics (9.5%). The most common topics were anemia, hemoglobinopathy, bleeding disorder, and thrombotic state. Primary care providers rated the eConsult service very highly, and their comments were very positive. The eConsult service resulted in deferral of 40% of consults originally contemplated to require a face-to-face specialist visit. This study showed successful implementation and use of the eConsult service for pediatric hematology/oncology and resulted in avoidance of a large number of face-to-face consultation. The common topics identified areas for continuing medical education.

  13. Sickle cell disease and complex congenital cardiac surgery: a case report and review of the pathophysiology and perioperative management.

    Science.gov (United States)

    Sanders, D B; Smith, B P; Sowell, S R; Nguyen, D H; Derby, C; Eshun, F; Nigro, J J

    2014-03-01

    Sickle cell anemia and thalassemia are hemoglobinopathies rarely encountered in the United States. Compounded with congenital heart disease, patients with sickle cell disease (SCD) requiring cardiopulmonary bypass and open-heart surgery represent the proverbial "needle in the haystack". As such, there is some trepidation on the part of clinicians when these patients present for complex cardiac surgery. SCD is an autosomal, recessive condition that results from a single nucleotide polymorphism in the β-globin gene. Hemoglobin SS molecules (HgbSS) with this point mutation can polymerize under the right conditions, stiffening the erythrocyte membrane and distorting the cellular structure to the characteristic sickle shape. This shape change alters cellular transit through the microvasculature. As a result, circumstances such as hypoxia, hypothermia, acidosis or diminished blood flow can lead to aggregation, vascular occlusion and thrombosis. Chronically, SCD can give rise to multiorgan damage secondary to hemolysis and vascular obstruction. This review and case study details an 11-year-old African-American male with known SCD who presented to the cardiothoracic surgical service with congenital heart disease consisting of an anomalous, intramural right coronary artery arising from the left coronary sinus for surgical consultation and subsequent surgical correction. This case report will include a review of the pathophysiology and current literature regarding preoperative, intraoperative and postoperative management of SCD patients.

  14. The influence of hydroxyurea on oxidative stress in sickle cell anemia

    Directory of Open Access Journals (Sweden)

    Lidiane de Souza Torres

    2012-01-01

    Full Text Available OBJECTIVE: The oxidative stress in 20 sickle cell anemia patients taking hydroxyurea and 13 sickle cell anemia patients who did not take hydroxyurea was compared with a control group of 96 individuals without any hemoglobinopathy. METHODS: Oxidative stress was assessed by thiobarbituric acid reactive species production, the Trolox-equivalent antioxidant capacity and plasma glutathione levels. RESULTS: Thiobarbituric acid reactive species values were higher in patients without specific medication, followed by patients taking hydroxyurea and the Control Group (p < 0.0001. The antioxidant capacity was higher in patients taking hydroxyurea and lower in the Control Group (p = 0.0002 for Trolox-equivalent antioxidant capacity and p < 0.0292 for plasma glutathione. Thiobarbituric acid reactive species levels were correlated with higher hemoglobin S levels (r = 0.55; p = 0.0040 and lower hemoglobin F concentrations(r = -0.52; p = 0.0067. On the other hand, plasma glutathione levels were negatively correlated with hemoglobin S levels (r = -0.49; p = 0.0111 and positively associated with hemoglobin F values (r = 0.56; p = 0.0031. CONCLUSION: Sickle cell anemia patients have high oxidative stress and, conversely, increased antioxidant activity. The increase in hemoglobin F levels provided by hydroxyurea and its antioxidant action may explain the reduction in lipid peroxidation and increased antioxidant defenses in these individuals.

  15. Spinal cord compression due to extramedullary hematopoiesis in beta-thalassemia intermedia

    International Nuclear Information System (INIS)

    Munn, Rita K.; Kramer, Carol A.; Arnold, Susanne M.

    1998-01-01

    Background: Extramedullary hematopoiesis (EMH) occurs in many disorders, including thalassemias and other hemoglobinopathies, and commonly presents in the spleen and liver. We present a case of spinal cord compression in a patient with beta-thalassemia intermedia, and review the literature and available treatment options. Patient and Methods: A 35-year-old black female with beta-thalassemia intermedia presented with a 3-week history of back pain and lower extremity weakness. Neurologic examination was consistent with spinal cord compression, and gadolinium enhanced magnetic resonance imaging (MRI) confirmed this diagnosis. She was given intravenous steroids and radiotherapy was begun in 200 cGy fractions to a total dose of 2000 cGy. Results: At the completion of radiotherapy the patient was ambulatory with mild residual weakness. MRI scans 16 months later showed smaller, but persistent masses, and she remains asymptomatic 5 years from her diagnosis. Conclusion: Recognition of spinal cord EMH requires prompt physical examination and MRI for accurate diagnosis. EMH can be managed with radiation, surgery, transfusions, or a combination of these therapies. Radiation in conservative doses of (750-3500 cGy) is non-invasive, avoids the surgical risks of potentially severe hemorrhage and incomplete resection, and has a high complete remission rate in the majority of patients. Relapse rates are moderate (37.5%), but retreatment provides excellent chance for second remission

  16. The New Self-Inactivating Lentiviral Vector for Thalassemia Gene Therapy Combining Two HPFH Activating Elements Corrects Human Thalassemic Hematopoietic Stem Cells

    Science.gov (United States)

    Papanikolaou, Eleni; Georgomanoli, Maria; Stamateris, Evangelos; Panetsos, Fottes; Karagiorga, Markisia; Tsaftaridis, Panagiotis; Graphakos, Stelios

    2012-01-01

    Abstract To address how low titer, variable expression, and gene silencing affect gene therapy vectors for hemoglobinopathies, in a previous study we successfully used the HPFH (hereditary persistence of fetal hemoglobin)-2 enhancer in a series of oncoretroviral vectors. On the basis of these data, we generated a novel insulated self-inactivating (SIN) lentiviral vector, termed GGHI, carrying the Aγ-globin gene with the −117 HPFH point mutation and the HPFH-2 enhancer and exhibiting a pancellular pattern of Aγ-globin gene expression in MEL-585 clones. To assess the eventual clinical feasibility of this vector, GGHI was tested on CD34+ hematopoietic stem cells from nonmobilized peripheral blood or bone marrow from 20 patients with β-thalassemia. Our results show that GGHI increased the production of γ-globin by 32.9% as measured by high-performance liquid chromatography (p=0.001), with a mean vector copy number per cell of 1.1 and a mean transduction efficiency of 40.3%. Transduced populations also exhibited a lower rate of apoptosis and resulted in improvement of erythropoiesis with a higher percentage of orthochromatic erythroblasts. This is the first report of a locus control region (LCR)-free SIN insulated lentiviral vector that can be used to efficiently produce the anticipated therapeutic levels of γ-globin protein in the erythroid progeny of primary human thalassemic hematopoietic stem cells in vitro. PMID:21875313

  17. Identificação e caracterização de variantes novas e raras da hemoglobina humana Identification of characterization of novel and rare variants of human hemoglobin

    Directory of Open Access Journals (Sweden)

    Elza M. Kimura

    2008-08-01

    Full Text Available As anormalidades estruturais da hemoglobina estão entre as doenças genéticas mais comumente encontradas nas populações humanas. O Laboratório de Hemoglobinopatias do Departamento de Patologia Clínica da Faculdade de Ciências Médicas da Universidade Estadual de Campinas - Unicamp, localizado em Campinas, no estado de São Paulo, região Sudeste do Brasil, realizou, em seus 27 anos de existência, cerca de 130.000 diagnósticos. Entre as variantes estruturais detectadas, as hemoglobinas S, C e D-Punjab foram, como esperado, as mais freqüentes, porém um número expressivo de outras hemoglobinas anômalas, novas e raras, também foi encontrado. Esses achados estão sumarizados no presente artigo.Hemoglobin structural abnormalities are among the most commonly found human genetic diseases. The Laboratory of Hemoglobinopathies in the Clinical Pathology Department of the Medical Sciences School of the State University in Campinas - Unicamp, São Paulo, Southeastern Brazil, carried out, in its 27 years of activity, about 130,000 diagnoses. As expected, hemoglobins S, C and D were the most frequently observed variants, but an expressive number of other abnormal, novel and rare hemoglobins, was also detected. These findings are summarized in the present article.

  18. Heterozygote Hemoglobin G-Coushatta as the Cause of a Falsely Decreased Hemoglobin A1C in an Ion-Exchange HPLC Method

    Directory of Open Access Journals (Sweden)

    Kurtoğlu Ayşegül Uğur

    2017-09-01

    Full Text Available Glycated hemoglobin (HbA1c is used for the assessment of glycemic control in patients with diabetes. The presence of genetic variants of hemoglobin can profoundly affect the accuracy of HbA1c measurement. Here, we report two cases of Hemoglobin G-Coushatta (HBB:c.68A>C variant that interferes in the measurement of HbA1c by a cation-exchange HPLC (CE-HPLC method. HbA1c was measured by a CE-HPLC method in a Tosoh HLC-723 G7 instrument. The HbA1c levels were 2.9% and 4%. These results alerted us to a possible presence of hemoglobinopathy. In the hemoglobin variant analysis, HbA2 levels were detected as 78.3% and 40.7% by HPLC using the short program for the Biorad Variant II. HbA1c levels were measured by an immunoturbidimetric assay in a Siemens Dimension instrument. HbA1c levels were reported as 5.5% and 5.3%. DNA mutation analysis was performed to detect the abnormal hemoglobin variant. Presence of Hemoglobin G-Coushatta variant was detected in the patients. The Hb G-Coushatta variants have an impact on the determination of glycated hemoglobin levels using CEHPLC resulting in a false low value. Therefore, it is necessary to use another measurement method.

  19. A Novel High-Content Immunofluorescence Assay as a Tool to Identify at the Single Cell Level γ-Globin Inducing Compounds.

    Directory of Open Access Journals (Sweden)

    Marta Durlak

    Full Text Available The identification of drugs capable of reactivating γ-globin to ameliorate β-thalassemia and Sickle Cell anemia is still a challenge, as available γ-globin inducers still have limited clinical indications. High-throughput screenings (HTS aimed to identify new potentially therapeutic drugs require suitable first-step-screening methods combining the possibility to detect variation in the γ/β globin ratio with the robustness of a cell line. We took advantage of a K562 cell line variant expressing β-globin (β-K562 to set up a new multiplexed high-content immunofluorescence assay for the quantification of γ- and β-globin content at single-cell level. The assay was validated by using the known globin inducers hemin, hydroxyurea and butyric acid and further tested in a pilot screening that confirmed HDACs as targets for γ-globin induction (as proved by siRNA-mediated HDAC3 knockdown and by treatment with HDACs inhibitors entinostat and dacinostat and identified Heme-oxygenases as novel candidate targets for γ-globin induction. Indeed, Heme-oxygenase2 siRNA knockdown as well as its inhibition by Tin protoporphyrin-IX (TinPPIX greatly increased γ-globin expression. This result is particularly interesting as several metalloporphyrins have already been developed for clinical uses and could be tested (alone or in combination with other drugs to improve pharmacological γ-globin reactivation for the treatment of β-hemoglobinopathies.

  20. Thalassemia and Hemoglobin E in Southern Thai Blood Donors

    Directory of Open Access Journals (Sweden)

    Manit Nuinoon

    2014-01-01

    Full Text Available Thalassemia and hemoglobin E (Hb E are common in Thailand. Individuals with thalassemia trait usually have a normal hemoglobin concentration or mild anemia. Therefore, thalassemic individuals who have minimum acceptable Hb level may be accepted as blood donors. This study was aimed at determining the frequency of α-thalassemia 1 trait, β-thalassemia trait, and Hb E-related syndromes in Southern Thai blood donors. One hundred and sixteen voluntary blood donors, Southern Thailand origin, were recruited for thalassemia and Hb E screening by red blood cell indices/dichlorophenolindophenol precipitation test. β-Thalassemia and Hb E were then identified by high performance liquid chromatography and 4 common α-thalassemia deletions were characterized by a single tube-multiplex gap-polymerase chain reaction. Overall frequency of hemoglobinopathies was 12.9%, classified as follows: homozygous α-thalassemia 2 (1.7%, heterozygous α-thalassemia 1 (1.7%, heterozygous β-thalassemia without α-thalassemia (0.9%, heterozygous Hb E without α-thalassemia (5.2%, double heterozygotes for Hb E/α-thalassemia 1 (1.7%, homozygous Hb E without α-thalassemia (0.9%, and homozygous Hb E with heterozygous α-thalassemia 2 (0.9%. The usefulness of thalassemia screening is not only for receiving highly effective red blood cells in the recipients but also for encouraging the control and prevention program of thalassemia in blood donors.

  1. Sox6 directly silences epsilon globin expression in definitive erythropoiesis.

    Directory of Open Access Journals (Sweden)

    2006-02-01

    Full Text Available Sox6 is a member of the Sox transcription factor family that is defined by the conserved high mobility group (HMG DNA binding domain, first described in the testis determining gene, Sry. Previous studies have suggested that Sox6 plays a role in the development of the central nervous system, cartilage, and muscle. In the Sox6-deficient mouse, p100H, epsilony globin is persistently expressed, and increased numbers of nucleated red cells are present in the fetal circulation. Transfection assays in GM979 (erythroleukemic cells define a 36-base pair region of the epsilony proximal promoter that is critical for Sox6 mediated repression. Electrophoretic mobility shift assay (EMSA and chromatin immunoprecipitation (ChIP assays demonstrate that Sox6 acts as a repressor by directly binding to the epsilony promoter. The normal expression of Sox6 in wild-type fetal liver and the ectopic expression of epsilony in p100H homozygous fetal liver demonstrate that Sox6 functions in definitive erythropoiesis. The present study shows that Sox6 is required for silencing of epsilony globin in definitive erythropoiesis and suggests a role for Sox6 in erythroid cell maturation. Thus, Sox6 regulation of epsilony globin might provide a novel therapeutical target in the treatment of hemoglobinopathies such as sickle cell anemia and thalassemia.

  2. Premarital Screening of Beta Thalassemia Minor in north-east of Iran

    Science.gov (United States)

    Hashemizadeh, H; Noori, R

    2013-01-01

    Background Beta thalassemia is a preventable disease. Iran has about 20,000Patients who are homozygote for β-thalassaemia and 3,750,000 carriers. The aim of this study was to determine the prevalence of beta thalassemia minor among men who underwent premarital screening in Quchana city in Khorasan Razavi region of Iran Materials and Methods This research is a descriptive cross-sectional study. From 2010 to 2011, all participants (1000) under marriage coming to health center of Quchan underwent routine mandatory tests. Participants were considered to have beta-thalassemia minor on the condition that hey had a mean corpuscular volume (MCV) 3.5%. Venous blood was taken into an EDTA tube and the complete blood count and red blood cell indices were measured with a Coulter automated cell counter. Electrophoresis was performed on cellulose acetate. Results Mean and SD of hemoglobin, MCV and MCH were 16±2.9, 91±4 and 28.4±2, respectively. Hemoglobin A2 Higher than 3.5 percent was reported as 3.5%.The prevalence of beta-thassemia minor with high hemoglobin A2 and microcytic hypochromic anemia was 3.5% (P-value). Conclusion In countries with high prevalence of hemoglobinopathies, a premarital screening program is helpful for identification and prevention of high-risk marriages. Detecting carrier couples with premarital screening program is an effective way of controlling thalassemia major. PMID:24575266

  3. THE IMPORTANCE OF THE ERYTHROCYTES OSMOTIC FRAGILITY TEST PERFORMED IN CHILDREN WITH INDIRECT HYPERBILIRUB1NEMIA

    Directory of Open Access Journals (Sweden)

    Ivana Stojanović

    2005-07-01

    Full Text Available The osmotic fragility test of erythrocytes is useful in the diagnosis of different types of hereditary hemolytic anemias followed with hyperbilirubinemia. Hemolytic anemias, characterized by accelerated destruction of red blood cells, are usually the consequence of many metabolic abnormalities like cellular membrane defect, erythrocyte enzymes defect or hemoglobin abnormalities – hemoglobinopathies. The object of our study was to assess the relationship between osmotic fragility test of erythrocytes and severity of indirect hyperbilirubinemia in some inherited erythrocytes’ disorders. We did the osmotic fragility test of erythrocytes by using Dacie, s method with normal values of erythrocytes hemolysis between 0,48 to 0,34% NaCl (minimal to maximal hemolysis. In hereditary spherocytosis, fragility of erythrocytes was increased (min. at 0,50 % NaCl to max. 0,44 % NaCl . In the child with β- thalassemia and cycle cell anemia erythrocytes fragility was decreased (min . at 0,42 to max. 0,32 % NaCl, that is 0,40% min. of hemolysis and 0,34% max. hemolysis in the second case. In newborn infants with high levels of indirect bilirubin in serum as a cause of physiological jaundice, the osmotic fragility test was within a normal range. Our findings point out the diagnostic value of osmotic fragility test in assessing patients with the indirect hyperbilirubinemia. This simple and important diagnostic test can be performed in small laboratories.

  4. Synergistic Effect of Sodium Butyrate and Thalidomide in the Induction of Fetal Hemoglobin Expression in Erythroid Progenitors Derived from Cord Blood CD133 + Cells

    Directory of Open Access Journals (Sweden)

    Ali Dehghanifard

    2012-07-01

    Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.

  5. Anemia and malaria in a Yanomami Amerindian population from the southern Venezuelan Amazon.

    Science.gov (United States)

    Pérez Mato, S

    1998-12-01

    The prevalence and age distribution of anemia and malaria among Yanomami Amerindians undergoing sociocultural assimilation are described. Anemia and malaria proportions were determined in 103 individuals randomly selected from 515 villagers in Mavaca in the southern Venezuelan Amazon. The age and sex distribution reflected that of the entire village cluster. Anemia (hematocrit less than World Health Organization/Centers for Disease Control and Prevention reference values) was found in 91% of the study population. As a group, adults (> or = 15 years old) had the highest proportion of anemia (P=0.037). Adult females had lower mean hematocrit values than adult males (P=0.013). The anemia was predominantly hypochromic and microcytic (62%), a finding that could suggest a diagnosis of iron deficiency in the absence of known hereditary hemoglobinopathies in these Amerindians. Malaria was diagnosed in 14% overall. Children (< 10 years old) displayed the highest proportion of Plasmodium falciparum (17%) and P. vivax (14%) parasitemia, splenomegaly (94%), and fever (34%) (P=0.059, 0.039, 0.005, and 0.008, respectively). The high proportions of anemia and splenomegaly observed in the survey may be used as indicators of inadequately controlled malaria in this community. Further studies to assess the epidemiology of risk factors for the high prevalence of anemia, and predominance of P. falciparum infections in the area are urgently needed.

  6. The Saudi Thoracic Society pneumococcal vaccination guidelines-2016

    Science.gov (United States)

    Alharbi, N. S.; Al-Barrak, A. M.; Al-Moamary, M. S.; Zeitouni, M. O.; Idrees, M. M.; Al-Ghobain, M. O.; Al-Shimemeri, A. A.; Al-Hajjaj, Mohamed S.

    2016-01-01

    Streptococcus pneumoniae (pneumococcus) is the leading cause of morbidity and mortality worldwide. Saudi Arabia is a host to millions of pilgrims who travel annually from all over the world for Umrah and the Hajj pilgrimages and are at risk of developing pneumococcal pneumonia or invasive pneumococcal disease (IPD). There is also the risk of transmission of S. pneumoniae including antibiotic resistant strains between pilgrims and their potential global spread upon their return. The country also has unique challenges posed by susceptible population to IPD due to people with hemoglobinopathies, younger age groups with chronic conditions, and growing problem of antibiotic resistance. Since the epidemiology of pneumococcal disease is constantly changing, with an increase in nonvaccine pneumococcal serotypes, vaccination policies on the effectiveness and usefulness of vaccines require regular revision. As part of the Saudi Thoracic Society (STS) commitment to promote the best practices in the field of respiratory diseases, we conducted a review of S. pneumoniae infections and the best evidence base available in the literature. The aim of the present study is to develop the STS pneumococcal vaccination guidelines for healthcare workers in Saudi Arabia. We recommend vaccination against pneumococcal infections for all children Saudi Arabia population <50 years of age, many of whom have risk factors for contracting pneumococcal infections. A section for pneumococcal vaccination before the Umrah and Hajj pilgrimages is included as well. PMID:27168856

  7. Hb TAYBE: clinical and morphological findings IN 43 patients.

    Science.gov (United States)

    Koren, Ariel; Levin, Carina; Zalman, Luci; Palmor, Haya; Filon, Dvora; Chubar, Evgeny; Resnitzky, Peretz; Bennett, Michael

    2016-08-01

    Hereditary sequence variants in globin genes are usually silent and are rarer in α-globin chains than β-globin chains. Some may lead to an unstable protein with a hemolytic or thalassemic phenotype. Hb Taybe is an unstable α-chain hemoglobin variant caused by the deletion of a threonine residue at codon 38 or 39 of the α1 globin gene. This deletion results in a structural abnormality that affects the α1 β2 contact and the α1 β1 interface, producing a highly unstable Hb. We describe the clinical, laboratory, and morphological characteristics of 43 patients with Hb Taybe, sixteen of whom are heterozygous, eight are homozygous, and nineteen are double heterozygous for Hb Taybe and other α-gene mutations or deletions. The clinical presentation is very variable from a mild hemolytic anemia to the need for red cell transfusion. Morphological characteristics include erythroid hyperplasia, defective hemoglobin production, and dyserythropoietic features. On electron microscopy dyserythropoiesis and cytoplasmic precipitation of globin compatible optical dense material is seen. This is the largest report of Hb Taybe patients. Previous reported cohorts are not related to these cases. We conclude that patients carrying Hb Taybe have a unique hematological and clinical phenotype distinct from other hemoglobinopathies and from congenital dyserythropoietic anemia. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Comparative analysis of iron homeostasis in sub-Saharan African children with sickle cell disease and their unaffected siblings

    Directory of Open Access Journals (Sweden)

    Selma eGomez

    2016-02-01

    Full Text Available Iron is an essential trace element subject to tight regulation to ensure adequate running of biological processes. In sub-Saharan Africa where hemoglobinopathies are common, iron homeostasis is likely to be impaired by these conditions. Here we assessed and compared key serum proteins associated with iron metabolism between sub-Saharan African children with sickle cell disease (SCD and their unaffected siblings. Complete blood counts and serum concentrations of four key proteins involved in iron regulation (ferritin, transferrin, sTfR and hepcidin were measured for 73 children with SCD and 68 healthy siblings in Benin, West Africa. We found significant differences in concentration of transferrin, sTfR and ferritin between the two groups. Hepcidin concentrations were found at unusually high concentrations but did not differ among the two groups. We found a significant negative correlation between hepcidin levels and both MCH and MCV in the SCD group and report that sTfR concentrations show a correlation with MCV and MHC in opposite directions in the two groups. These results highlight the unusually high levels of hepcidin in the Beninese population and the patterns of differential iron homeostasis taking place under sickle cell disease status. These results lay the foundation for a systematic evaluation of the underlying mechanisms deregulating iron homeostasis in populations with SCD or high prevalence of iron deficiency.

  9. Thalassemia and Hemoglobin E in Southern Thai Blood Donors

    Science.gov (United States)

    Kruachan, Kwanta; Sengking, Warachaya; Horpet, Dararat; Sungyuan, Ubol

    2014-01-01

    Thalassemia and hemoglobin E (Hb E) are common in Thailand. Individuals with thalassemia trait usually have a normal hemoglobin concentration or mild anemia. Therefore, thalassemic individuals who have minimum acceptable Hb level may be accepted as blood donors. This study was aimed at determining the frequency of α-thalassemia 1 trait, β-thalassemia trait, and Hb E-related syndromes in Southern Thai blood donors. One hundred and sixteen voluntary blood donors, Southern Thailand origin, were recruited for thalassemia and Hb E screening by red blood cell indices/dichlorophenolindophenol precipitation test. β-Thalassemia and Hb E were then identified by high performance liquid chromatography and 4 common α-thalassemia deletions were characterized by a single tube-multiplex gap-polymerase chain reaction. Overall frequency of hemoglobinopathies was 12.9%, classified as follows: homozygous α-thalassemia 2 (1.7%), heterozygous α-thalassemia 1 (1.7%), heterozygous β-thalassemia without α-thalassemia (0.9%), heterozygous Hb E without α-thalassemia (5.2%), double heterozygotes for Hb E/α-thalassemia 1 (1.7%), homozygous Hb E without α-thalassemia (0.9%), and homozygous Hb E with heterozygous α-thalassemia 2 (0.9%). The usefulness of thalassemia screening is not only for receiving highly effective red blood cells in the recipients but also for encouraging the control and prevention program of thalassemia in blood donors. PMID:25050123

  10. Regulatory B cells (CD19(+)CD38(hi)CD24(hi)) in alloimmunized and non-alloimmunized children with β-thalassemia major.

    Science.gov (United States)

    Zahran, Asmaa M; Elsayh, Khalid I; Saad, Khaled; Embaby, Mostafa; Ali, Ahmed M

    2016-03-01

    β-Thalassemia major (BTM) is considered the most common hemoglobinopathy in Egypt and is one of the major health problems in our locality. We investigated the frequency of B-regulatory cells (CD19(+)CD38(hi)CD24(hi)); (Bregs) among polytransfused alloimmunized and non-alloimmunized children with BTM. The study included 110 polytransfused pediatric patients with β-thalassemia major. Clinical and transfusion records of all studied patients were reviewed. Indirect antiglobulin test was performed to detect the presence of alloantibodies. We used flow cytometry for detection of CD19(+)CD38(hi)CD24(hi) regulatory B cells. Alloimmunization was detected in 35.5% of thalassemic patients (39/110). The analysis of our data showed a significantly higher frequency of Bregs (CD19(+)CD38(hi)CD24(hi)) in the peripheral blood of both alloimmunized and non-alloimmunized patients as compared to healthy controls. Our data showed that the frequencies of CD19(+)CD24(hi)CD38(hi) Bregs cells were significantly increased in children with BTM. Our data suggested that Bregs cells could play a role in the clinical course of BTM. The relationship of Bregs to immune disorders in BTM children remains to be determined. Further longitudinal study with a larger sample size is warranted to explore the mechanisms of Breg cells in the disease process in BTM patients. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Gianotti-Crosti syndrome, pityriasis rosea, asymmetrical periflexural exanthem, unilateral mediothoracic exanthem, eruptive pseudoangiomatosis and papular-purpuric gloves and socks syndrome: a brief review and arguments for diagnostic criteria

    Directory of Open Access Journals (Sweden)

    Antonio Chuh

    2012-02-01

    Full Text Available Several exanthems including Gianotti-Crosti syndrome, pityriasis rosea, asymmetrical periflexural exanthem, eruptive pseudoangiomatosis, and papular-purpuric gloves and socks syndrome are suspected to be caused by viruses. These viruses are potentially dangerous. Gianotti-Crosti syndrome is related to hepatitis B virus infection which is the commonest cause of hepatocellular carcinoma, and Epstein-Barr virus infection which is related to nasopharyngeal carcinoma. Pityriasis rosea has been suspected to be related to human herpesvirus 7 and 8 infections, with the significance of the former still largely unknown, and the latter being a known cause of Kaposi’s sarcoma. Papular-purpuric gloves and socks syndrome is significantly associated with human B19 erythrovirus infection which can lead to aplastic anemia in individuals with congenital hemoglobinopathies, and when transmitted to pregnant women, can cause spontaneous abortions and congenital anomalies. With viral DNA sequence detection technologies, false positive results are common. We can no longer apply Koch’s postulates to establish causeeffect relationships. Biological properties of some viruses including lifelong latent infection, asymptomatic shedding, and endogenous reactivation render virological results on various body tissues difficult to interpret. We might not be able to confirm or refute viral causes for these rashes in the near future. Owing to the relatively small number of patients, virological and epidemiology studies, and treatment trials usually recruit few study and control subjects. This leads to low statistical powers and thus results have little clinical significance.

  12. Long-term transfer and expression of the human beta-globin gene in a mouse transplant model.

    Science.gov (United States)

    Raftopoulos, H; Ward, M; Leboulch, P; Bank, A

    1997-11-01

    Somatic gene therapy of hemoglobinopathies depends initially on the demonstration of safe, efficient gene transfer and long-term, high-level expression of the transferred human beta-globin gene in animal models. We have used a beta-globin gene/beta-locus control region retroviral vector containing several modifications to optimize gene transfer and expression in a mouse transplant model. In this report we show that transplantation of beta-globin-transduced hematopoietic cells into lethally irradiated mice leads to the continued presence of the gene up to 8 months posttransplantation. The transferred human beta-globin gene is detected in 3 of 5 mice surviving long term (>4 months) transplanted with bone marrow cells transduced with high-titer virus. Southern blotting confirms the presence of the unrearranged 5.1-kb human beta-globin gene-containing provirus in 2 of these mice. In addition, long-term expression of the transferred gene is seen in 2 mice at levels of 5% and 20% that of endogenous murine beta-globin at 6 and 8 months posttransplantation. We further document stem cell transduction by the successful transfer and high-level expression of the human beta-globin gene from mice transduced 9 months earlier into irradiated secondary recipient mice. These results demonstrate high-level, long-term somatic human beta-globin gene transfer into the hematopoietic stem cells of an animal for the first time, and suggest the potential feasibility of a retroviral gene therapy approach to sickle cell disease and the beta thalassemias.

  13. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  14. Doppler-Defined Pulmonary Hypertension in Sickle Cell Anemia in Kurdistan, Iraq.

    Science.gov (United States)

    Al-Allawi, Nasir; Mohammad, Ameen M; Jamal, Shakir

    2016-01-01

    To determine the frequency, clinical and laboratory associations of pulmonary hypertension in Iraqi Kurds with sickle cell anemia, a total of ninety four such patients attending a major hemoglobinopathy center in Iraqi Kurdistan were enrolled. All patients were re-evaluated clinically and had their blood counts, HbF, serum ferritin, LDH, renal and liver function assessed. Transthoracic Doppler echocardiography with measurement of tricuspid valve regurgitant jet velocity (TRV) was performed. A TRV in excess of 2.8 m/s was considered for the purposes of this study as indicative of pulmonary hypertension (PH). The prevalence of TRV in excess of 2.8m/s was 10.6%. By univariate analysis: significantly higher reticulocyte count, more frequent blood transfusions and pain episodes were encountered in the PH group as compared to the non-PH group (p = 0.001, 0.045 and 0.02 respectively). Moreover, PH patients had significantly higher mean right atrial area, left atrial size, E wave/A wave ratio and ejection fraction by echocardiography (p = 0.027, 0.037, <0.001 and 0.008 respectively). Except for reticulocyte count none of the other parameters remained significant by multivariate analysis (p = 0.024). In conclusion the current study revealed that pulmonary hypertension is rather frequent among Iraqi Kurds with sickle cell anemia, and identified reticulocyte count as an independently associated parameter with PH in this population. Future prospective studies including right heart catheterization and appropriate medical intervention are warranted.

  15. [Assays of HbA1c and Amadori products in human biology].

    Science.gov (United States)

    Gillery, P

    2014-09-01

    Different Amadori products, formed during the early steps of the non-enzymatic glycation of proteins, may be assayed in current practice in human biology. The most important marker is HbA1c, resulting from the binding of glucose to the N-terminal extremity of HbA beta chains. HbA1c may be evaluated by various techniques (ion exchange or affinity high performance liquid chromatography, capillary electrophoresis, immunoassay, enzymatic technique) and is considered the best marker of diabetic patient survey. Due to its irreversible and cumulative formation, it provides a retrospective information on the glycemic balance over the four to eight weeks preceding blood collection. It benefits from an international standardization, based on a reference method using liquid chromatography coupled to capillary electrophoresis or mass spectrometry, maintained by an international network of reference laboratories. When HbA1c assay cannot be used (anemia, hemolysis, hemoglobinopathy) or when a shorter period of glycemic equilibrium must be evaluated (child and adolescent, pregnancy, therapeutic changes), other Amadori products may be assayed, like plasma fructosamine (all plasma glycated proteins) or glycated albumin. Nevertheless, these assays are less used in practice, because their semiological value has been less evidenced. Besides, fructosamine assay lacks specificity, and glycated albumin assay has been described recently. An expanding use of HbA1c assay is expected, especially for the diagnosis of diabetes mellitus and the evaluation of other risks, especially cardiovascular ones. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  16. Hematopoietic Stem Cell Transplantation Activity and Trends at a Pediatric Transplantation Center in Turkey During 1998-2008

    Directory of Open Access Journals (Sweden)

    Volkan Hazar

    2012-06-01

    Full Text Available OBJECTIVE: The aim of this study was to document hematopoietic stem cell transplantation (HSCT activity and trends at our treatment center. METHODS: Data collected over a 10-year period were retrospectively analyzed, concentrating primarily on types of HSCT, transplant-related mortality (TRM, stem cell sources, indications for HSCT, and causes of death following HSCT. RESULTS: In total, 222 allogeneic (allo-HSCT (87.4% and 32 autologous (auto-HSCT (12.6% procedures were performed between 1998 and 2008. Stem cells obtained from unrelated donors were used in 22.6% (50/222 of the allo- HSCTs. Cord blood was the source of hematopoietic stem cells (HSC in 12.2% of all transplants. The most common indication for allo-HSCT was hemoglobinopathy (43.2%, versus neuroblastoma (53.1% for auto-HSCT. The TRM rate 1 year post transplantation was 18.3% ± 2.5% for all transplants, but differed according to transplantation type (23.5% ± 7.9% for auto-HSCT and 17.5% ± 2.6% for allo-HSCT. The most common cause of death 1 year post HSCT was infection (35.9%. CONCLUSION: The TRM rate in the patients that underwent allo-HSCT was similar to that which has been previously reported; however, the TRM rate in the patients that underwent auto-HSCT was higher than previously reported in developed countries. The selection of these patients to be transplanted must be made attentively.

  17. Co-inheritance of the rare β hemoglobin variants Hb Yaounde, Hb Görwihl and Hb City of Hope with other alterations in globin genes: impact in genetic counseling.

    Science.gov (United States)

    Vinciguerra, Margherita; Passarello, Cristina; Leto, Filippo; Cassarà, Filippo; Cannata, Monica; Maggio, Aurelio; Giambona, Antonino

    2015-04-01

    Nearly 1183 different molecular defects of the globin genes leading to hemoglobin variants have been identified (http://globin.bx.psu.edu) over the past decades. The purpose of this study was to report three cases, never described in the literature, of co-inheritance of three β hemoglobin variants with other alterations in globin genes and to evaluate the clinical significance to conduct an appropriate genetic counseling. We report the molecular study performed in three probands and their families, sampling during the screening program conducted at the Laboratory for Molecular Prenatal Diagnosis of Hemoglobinopathies at Villa Sofia-Cervello Hospital in Palermo, Italy. This work allowed us to describe the co-inheritance of three rare β hemoglobin variants with other alterations in globin genes: the β hemoglobin variant Hb Yaounde [β134(H12)Val>Ala], found for the first time in combination with ααα(anti3.7) arrangement, and the β hemoglobin variants Hb Görwihl [β5(A2)Pro>Ala] and Hb City of Hope [β69(E13)Gly>Ser], found both in association with β(0) -thalassemia. The present work emphasizes the importance of a careful evaluation of the hematological data, especially in cases of atypical hematological parameters, to carry out an adequate and complete molecular study and to formulate an appropriate genetic counseling for couples at risk. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. A comprehensive screening program for β-thalassemia and other hemoglobinopathies in the Hooghly District of West Bengal, India, dealing with 21 137 cases.

    Science.gov (United States)

    Bhattacharyya, Kallol Kumar; Chatterjee, Tridip; Mondal, Ujjalendu Bikash

    2016-11-01

    We here present a report of population screening programs (January 2012-December 2015) conducted by the Thalassemia Control Unit, Imambara Sadar Hospital, Chinsurah, Hooghly in the Hooghly District of West Bengal, India for prevention of thalassemia. We screened β-thalassemia (β-thal) heterozygotes and homozygotes, and Hb E (HBB: c.79G > A)-β-thal compound heterozygotes. Among 21 137 cases, we found 1968 heterozygotes and 192 homozygotes or compound heterozygotes. Results were evaluated with standard hematological analyses including red cell indices, hemoglobin (Hb) typing and quantification. The participants of the screening program were divided into six groups (children, pre-marriage cases, post-marital cases, family members of affected individuals, family members of carriers and pregnant women). While considering the average frequency of carriers, many reports recorded both related individuals (family members of trait and affected individuals) as well as unrelated individuals such as school children and pregnant women. These would have to be considered separately and only the unrelated individuals taken to estimate carrier frequencies in this article that would give more realistic data on carrier frequency of unrelated individuals.

  19. Anxiety, depression and quality of life in patients with beta thalassemia major and their caregivers.

    Science.gov (United States)

    Yengil, Erhan; Acipayam, Can; Kokacya, Mehmet Hanifi; Kurhan, Faruk; Oktay, Gonul; Ozer, Cahit

    2014-01-01

    Mental health and health related quality of life is commonly affected in patients with chronic problems and their caregivers. In the present study, it was aimed to assess depression and anxiety in patients with beta thalassemia major (BTM) and in their caregivers; and to evaluate effects of these disorders on quality of life. The study was carried out in a district Hereditary Hemoglobinopathy Center and included 88 patients with BTM and 63 of their caregivers. All subjects were assessed using Beck Depression Inventory (BDI), Beck Anxiety Inventory (BAI) and Short Form-36 (SF-36) by a trained psychiatry resident via face-to-face interview. The BDI scores were 17 or above in 20.5% of the patients with BTM and 28.6% of their caregivers (P = 0.248). Of the patients with BTM, there were mild anxiety symptoms in 19.3%, while moderate and severe anxiety symptoms in 14.8% and 4.5%, respectively. Anxiety levels were similar between the patients with BTM and their caregivers (P = 0.878). It was found that BDI and BAI scores were negatively correlated to scores of physical health and mental health components of SF-36 in patients with BTM and their caregivers. In linear regression analysis, it was seen that depression affected physical and mental health of the patients with BTM and their caregivers regardless from anxiety. BTM leads an increase in the frequency of depression and anxiety in both patients and their caregivers, and affects negatively physical and mental components of quality of life.

  20. Towards a point-of-care strip test to diagnose sickle cell anemia.

    Directory of Open Access Journals (Sweden)

    Meaghan Bond

    Full Text Available A rapid test to identify patients with sickle cell disease could have important benefits in low-resource settings. Sickle cell anemia (SCA affects about 300,000 newborns each year, the majority of whom are born in sub-Saharan Africa. Low-cost therapies are available to treat SCA, but most countries in sub-Saharan Africa lack robust neonatal screening programs needed to identify patients in need of treatment. To address this need, we developed and evaluated a competitive lateral flow assay that identifies patients with SCA (genotype HbSS in 15 minutes using undiluted whole blood. A small volume of blood (0.5 μL- 3 μL is mixed with antibody-coated blue latex beads in a tube and applied to the strip. Strips are then placed in a well of running buffer and allowed to run for 10 minutes. Laboratory evaluation with samples containing different proportions of hemoglobin A (HbA and hemoglobin S (HbS indicated that the test should enable identification of SCA patients but not persons with sickle cell trait (SCT. We evaluated the test using 41 samples from individuals with SCA, SCT, and normal blood. With visual inspection or quantitative analysis, we found a 98% accuracy when differentiating SCA from normal and SCT samples as a group (90% sensitivity and 100% specificity for identifying SCA. This work demonstrates important steps towards making a lateral flow test for hemoglobinopathies more appropriate for point-of-care use; further work is needed before the test is appropriate for clinical use.

  1. Survival of red blood cells after transfusion: processes and consequences

    Directory of Open Access Journals (Sweden)

    Giel eBosman

    2013-12-01

    Full Text Available The currently available data suggest that efforts towards improving the quality of red blood cell (RBC blood bank products should concentrate on: (1 preventing the removal of a considerable fraction of the transfused RBCs that takes place within the first hours after transfusion; (2 minimizing the interaction of the transfused RBCs with the patient's immune system. These issues are important in reducing the number and extent of the damaging side effects of transfusions, such as generation of alloantibodies and autoantibodies and iron accumulation, especially in transfusion-dependent patients. Thus, it becomes important for blood bank research not only to assess the classical RBC parameters for quality control during storage, but even more so to identify the parameters that predict RBC survival, function and behaviour in the patient after transfusion. These parameters are likely to result from elucidation of the mechanisms that underly physiological RBC aging in vivo, and that lead to the generation of senescent cell antigens and the accumulation of damaged molecules in vesicles. Also, study of RBC pathology-related mechanisms, such as encountered in various hemoglobinopathies and membranopathies, may help to elucidate the mechanisms underlying a storage-associated increase in susceptibility to physiological stress conditions. Recent data indicate that a combination of new approaches in vitro to mimick RBC behaviour in vivo, the growing knowledge of the signaling networks that regulate RBC structure and function, and the rapidly expanding set of proteomic and metabolomic data, will be instrumental to identify the storage-associated processes that control RBC survival after transfusion.

  2. Köln's unstable hemoglobin: case report and literature review Hemoglobina instável de Köln: relato de caso e revisão de literatura

    Directory of Open Access Journals (Sweden)

    Sandra Pscheidt

    2003-01-01

    Full Text Available Unstable hemoglobins are a group of genetic variants of hemoglobins caused by the mutation of amino acids into alpha and beta globins and, depending on the points and types of mutation, the result can vary from no clinical symptomatology to severe hemolytic anemia. On the present report, we study the case of a female patient who showed a very exuberant hematological picture for the red series, which suggests hemoglobinic changes; this was confirmed following the conduction of the protocol established by Laboratório Médico Santa Luzia for the study of hemoglobinopathies and which was then sent for a reference laboratory: C.D.A. Naoun Laboratórios de Análises ClínicasAs hemoglobinas instáveis constituem um grupo de variantes genéticas de hemoglobinas causadas pela mutação de aminoácidos nas globinas alfa e beta e, dependendo dos pontos e dos tipos de mutações ocorridos, o resultado pode ser de nenhuma sintomatologia clínica até anemias hemolíticas graves. No presente relato, estudamos o caso de uma paciente que apresentava um quadro hematológico de série vermelha bastante exuberante, sugestivo de alteração hemoglobínica, o que foi confirmado após realização do protocolo estabelecido pelo Laboratório Médico Santa Luzia para estudo de hemoglobinopatias e posteriormente enviado para o laboratório de referência C.D.A. Naoun Laboratórios de Análises Clínicas.

  3. Multiple transfused thalassemia major: Ocular manifestations in a hospital-based population

    Directory of Open Access Journals (Sweden)

    Taneja Rashi

    2010-01-01

    Full Text Available Purpose: To study the ocular manifestations in multiple transfused beta-thalassemia major patients and assess the ocular side-effects of iron chelating agents. Materials and Methods: In this prospective observational study, 45 multiple transfused beta-thalassemia major children between six months and 21 years of age were enrolled and assigned groups according to the treatment regimens suggested. Group A received only blood transfusions, Group B blood transfusions with subcutaneous desferrioxamine, Group C blood transfusions with desferrioxamine and oral deferriprone and Group D blood transfusions with deferriprone. Ocular status at the time of enrolment was documented. Subjects were observed quarterly for one year for changes in ocular status arising due to the disease process and due to iron chelation therapy. Children with hemoglobinopathies other than beta-thalassemia major, congenital ocular anomalies and anemia due to other causes were excluded. Results: Ocular involvement was observed in 58% of patients. Lenticular opacities were the most common ocular finding (44%, followed by decreased visual acuity (33%. An increased occurrence of ocular changes was observed with increase of serum ferritin and serum iron levels as well as with higher number of blood transfusions received. Desferrioxamine seemed to have a protective influence on retinal pigment epithelium (RPE mottling. Occurrence of lenticular opacities and RPE degeneration correlated positively with use of desferrioxamine and deferriprone respectively. Follow-up of patients for one year did not reveal any change in ocular status. Conclusion: Regular ocular examinations can aid in preventing, delaying or ameliorating the ocular complications of thalassemia.

  4. Metabolism of Citrate and Other Carboxylic Acids in Erythrocytes As a Function of Oxygen Saturation and Refrigerated Storage

    Directory of Open Access Journals (Sweden)

    Travis Nemkov

    2017-10-01

    Full Text Available State-of-the-art proteomics technologies have recently helped to elucidate the unanticipated complexity of red blood cell metabolism. One recent example is citrate metabolism, which is catalyzed by cytosolic isoforms of Krebs cycle enzymes that are present and active in mature erythrocytes and was determined using quantitative metabolic flux analysis. In previous studies, we reported significant increases in glycolytic fluxes in red blood cells exposed to hypoxia in vitro or in vivo, an observation relevant to transfusion medicine owing to the potential benefits associated with hypoxic storage of packed red blood cells. Here, using a combination of steady state and quantitative tracing metabolomics experiments with 13C1,2,3-glucose, 13C6-citrate, 13C515N2-glutamine, and 13C1-aspartate via ultra-high performance liquid chromatography coupled on line with mass spectrometry, we observed that hypoxia in vivo and in vitro promotes consumption of citrate and other carboxylates. These metabolic reactions are theoretically explained by the activity of cytosolic malate dehydrogenase 1 and isocitrate dehydrogenase 1 (abundantly represented in the red blood cell proteome, though moonlighting functions of additional enzymes cannot be ruled out. These observations enhance understanding of red blood cell metabolic responses to hypoxia, which could be relevant to understand systemic physiological and pathological responses to high altitude, ischemia, hemorrhage, sepsis, pulmonary hypertension, or hemoglobinopathies. Results from this study will also inform the design and testing of novel additive solutions that optimize red blood cell storage under oxygen-controlled conditions.

  5. Family-directed umbilical cord blood banking.

    Science.gov (United States)

    Gluckman, Eliane; Ruggeri, Annalisa; Rocha, Vanderson; Baudoux, Etienne; Boo, Michael; Kurtzberg, Joanne; Welte, Kathy; Navarrete, Cristina; van Walraven, Suzanna M

    2011-11-01

    Umbilical cord blood transplantation from HLA-identical siblings provides good results in children. These results support targeted efforts to bank family cord blood units that can be used for a sibling diagnosed with a disease which can be cured by allogeneic hematopoietic stem cell transplantation or for research that investigates the use of allogeneic or autologous cord blood cells. Over 500 patients transplanted with related cord blood units have been reported to the Eurocord registry with a 4-year overall survival of 91% for patients with non-malignant diseases and 56% for patients with malignant diseases. Main hematologic indications in children are leukemia, hemoglobinopathies or inherited hematologic, immunological or metabolic disorders. However, family-directed cord blood banking is not widely promoted; many cord blood units used in sibling transplantation have been obtained from private banks that do not meet the necessary criteria required to store these units. Marketing by private banks who predominantly store autologous cord blood units has created public confusion. There are very few current validated indications for autologous storage but some new indications might appear in the future. Little effort is devoted to provide unbiased information and to educate the public as to the distinction between the different types of banking, economic models and standards involved in such programs. In order to provide a better service for families in need, directed-family cord blood banking activities should be encouraged and closely monitored with common standards, and better information on current and future indications should be made available.

  6. Results from transcranial Doppler examination on children and adolescents with sickle cell disease and correlation between the time-averaged maximum mean velocity and hematological characteristics: a cross-sectional analytical study

    Directory of Open Access Journals (Sweden)

    Mary Hokazono

    Full Text Available CONTEXT AND OBJECTIVE: Transcranial Doppler (TCD detects stroke risk among children with sickle cell anemia (SCA. Our aim was to evaluate TCD findings in patients with different sickle cell disease (SCD genotypes and correlate the time-averaged maximum mean (TAMM velocity with hematological characteristics. DESIGN AND SETTING: Cross-sectional analytical study in the Pediatric Hematology sector, Universidade Federal de São Paulo. METHODS: 85 SCD patients of both sexes, aged 2-18 years, were evaluated, divided into: group I (62 patients with SCA/Sß0 thalassemia; and group II (23 patients with SC hemoglobinopathy/Sß+ thalassemia. TCD was performed and reviewed by a single investigator using Doppler ultrasonography with a 2 MHz transducer, in accordance with the Stroke Prevention Trial in Sickle Cell Anemia (STOP protocol. The hematological parameters evaluated were: hematocrit, hemoglobin, reticulocytes, leukocytes, platelets and fetal hemoglobin. Univariate analysis was performed and Pearson's coefficient was calculated for hematological parameters and TAMM velocities (P < 0.05. RESULTS: TAMM velocities were 137 ± 28 and 103 ± 19 cm/s in groups I and II, respectively, and correlated negatively with hematocrit and hemoglobin in group I. There was one abnormal result (1.6% and five conditional results (8.1% in group I. All results were normal in group II. Middle cerebral arteries were the only vessels affected. CONCLUSION: There was a low prevalence of abnormal Doppler results in patients with sickle-cell disease. Time-average maximum mean velocity was significantly different between the genotypes and correlated with hematological characteristics.

  7. Molecular characterization of hemoglobin D Punjab traits and clinical-hematological profile of the patients

    Directory of Open Access Journals (Sweden)

    Sanjay Pandey

    Full Text Available CONTEXT AND OBJECTIVE: Hemoglobin (Hb D hemoglobinopathies are widespread diseases in northwestern India and usually present with mild hemolytic anemia and mild to moderate splenomegaly. The heterozygous form of Hb D is clinically silent, but coinheritance of Hb D with Hb S or beta-thalassemia produces clinically significant conditions like thalassemia intermedia of moderate severity. Under heterozygous conditions with coinheritance of alpha and beta-thalassemia, patients show a degree of clinical variability. Thus, our aim was to molecularly characterize the Hb D trait among individuals who were clinically symptomatic because of co-inheritance of alpha deletions or any beta-globin gene mutations. DESIGN AND SETTING: This was a cross-sectional study conducted in an autonomous tertiary-care hospital. METHODS: Complete blood count and red cell indices were measured using an automated cell analyzer. Quantitative assessment of hemoglobin Hb F, Hb A, Hb A2 and Hb D was performed by means of high performance liquid chromatography (HPLC. DNA extraction was done using the phenol-chloroform method. Molecular analyses on common alpha deletions and common beta mutations were done using the Gap polymerase chain reaction and Amplification Refractory Mutation System, respectively. RESULTS: We evaluated 30 patients and found clinical variation in the behavior of Hb D traits. In six patients, the Hb D traits were clinically symptomatic and behaved like those of thalassemia intermedia. Molecular characterization showed that three out of these six were IVS-1-5 positive. CONCLUSIONS: HPLC may not be the gold standard for diagnosing symptomatic Hb D Punjab traits. Hence, standard confirmation should include molecular studies.

  8. Is BMD testing appropriate for all menopausal women?

    Science.gov (United States)

    Kleerekoper, Michael; Nelson, Dorothy A

    2005-01-01

    The United States Preventive Services Task Force has provided an evidence-based guideline indicating that bone mineral density (BMD) testing is appropriate for all women aged 65 or older. This does not preclude BMD testing in younger postmenopausal women but places the onus on the treating physician to justify the procedure to the patient and often the patient's insurance carrier. There are very few circumstances in which BMD testing is appropriate for healthy premenopausal women, but BMD testing in younger postmenopausal women is often appropriate: when there is a family history of osteoporosis with fracture, a personal history of fracture as an adult, and a medical, surgical or therapeutic history that might be associated with accelerated bone loss or increased risk of fracture. Medical conditions include intestinal diseases associated with malabsorption, such as non-tropical sprue, or primary hyperparathyroidism. Women who have neurologic conditions that increase the risk of falling should also be tested. There are data to suggest that patients with hemoglobinopathy are at increased risk for osteoporosis. Surgical conditions include the increasingly performed surgery for obesity and other surgery resulting in bowel resection (e.g., for inflammatory bowel disease). The major medication-related concern is corticosteroid therapy, but chronic or over-treatment with thyroxine, and chronic heparin therapy, should also be considered risk factors for osteoporosis. When performing a BMD test for the first time, it is essential to remember that 50% of women at menopause will have a negative T-score, but this does not imply that the patient has indeed lost any bone from her peak bone mass.

  9. Detection of Co-inheritance of Hb Hope and Hb Constant Spring in Three Thai Samples by Capillary Electrophoresis.

    Science.gov (United States)

    Panyasai, Sitthichai; Pornprasert, Sakorn

    2016-06-01

    The diagnosis of co-inheritance of Hb Hope [β136(H14)Gly → Asp, GGT > GAT] and Hb constant spring [Hb CS; α142, Term → Gln (TAA > CAA IN α2)] by high performance liquid chromatography (HPLC) is difficult because Hb Hope has a HPLC elution pattern similar to that of Hb Pyrgos, Hb New York, Hb Kodaira, and Hb Phimai. Moreover, the Hb CS mRNA, as well as the gene product, are unstable and present at a low level in peripheral blood. We report the use of a capillary electrophoresis (CE) for diagnosis of co-inheritance of Hb Hope and Hb CS in 3 Thai females who had mild anemia with Hb and Hct varying from 91-114 g/L to 0.28-0.36 L/L, respectively. Hb Hope eluted with a retention time of 125-140 s (Zone 10) of CE electrophoregram. Furthermore, the peak of Hb CS at the retention time of 245-250 s (Zone 2) was observed in these samples. In addition, the manual analysis by taking the non-black area under both peaks of HbA and Hb Hope (inverted V) into account provided the corrected Hb CS levels which are useful in screening of heterozygote or homozygote for Hb CS. Thus, the CE method provides an accurate diagnosis of Hb Hope and Hb CS which is useful in genetic counseling, prevention and control programs for these hemoglobinopathies.

  10. Bilateral avascular necrosis of the femoral head due to the use of heroin: A case report.

    Science.gov (United States)

    Ozkunt, Okan; Sarıyılmaz, Kerim; Sungur, Mustafa; Ilen, Ferhat; Dikici, Fatih

    2015-01-01

    Femoral head avascular necrosis is caused by disruption of the blood supply of the femoral head, which finally results in hip dysfunction. Non traumatic osteonecrosis may related with corticosteroid use, alcohol abuse, SLE, hemoglobinopathies or exposure to cytotoxic agents. But avascular necrosis of the femoral head (ANFH) due to heroin use is a rare condition. We report a patient with bilateral ANFH due to heroin use treated by simultaneous bilateral hip arthroplasty. 37 year-old male patient presented with bilateral hip pain that had been occurring for four years. The patient had no history of smoking, excessive drinking, using corticosteroid and the other drugs or trauma but used heroin for 10 years. In clinic and radiologic examination indicated advanced degenerative changes on both hip due to femoral head avascular necrosis. The patient was treated with simultaneous bilateral total hip arthroplasty. After 6 months postoperatively the active hip range of motion was painless. Avascular femoral head necrosis caused by the using of heroin is rare. Ultimately, osteonecrosis of the femoral head occurs through one final common pathway, which is decreased blood flow to the femoral head that leads bone ischemia and death. But it is still unknown that heroin's systemic effects. Intravenous drug use more as a serious problem for today. There is a need for comprehensive studies to demonstrate effects of heroin on bone and vascularity metabolism. Heroin use will be important problem for population. That's why is crucial to understand the effect of heroin. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  11. [Vitamin D in children and adolescents with sickle cell disease: an integrative review].

    Science.gov (United States)

    de Oliveira, Jacqueline Faria; Vicente, Natália Gomes; Santos, Juliana Pereira Pontes; Weffort, Virgínia Resende Silva

    2015-01-01

    To review the literature about the prevalence of vitamin D deficiency and its consequences in children and adolescents with sickle-cell disease. The literature survey was performed through the bibliographic databases Medline; U.S. National Library of Medicine and National Institutes of Health (PubMed); Literatura Latino-Americana e do Caribe em Ciências da Saúde (Lilacs), and the Cochrane Library. The keywords were selected using Medical Heading Terms (MeSH): "Vitamin D" OR "Vitamin D deficiency" AND "Anemia, Sickle Cell" AND "Child" AND "Adolescent". The search was limited to articles in English, Spanish and Portuguese, published until April 2014. Eleven articles were selected among the 18 found. In 6 of the 11 studies, serum levels of vitamin D in children and/or adolescents with sickle-cell anemia were low. The prevalence of vitamin D deficiency in patients with sickle-cell anemia exceeded that of the comparison group. The low intake of vitamin D, seasonality, exposure to sun, increased metabolism associated with the hemoglobinopathy, and age increase were factors associated with the deficiency. There was an association between a significant vitamin D deficiency and bone weakness and painful crises. There was a positive correlation between increased levels of vitamin D by supplementation and functional, physical capacity. The vitamin D deficiency in children and adolescents with sickle-cell disease is prevalent and requires further studies to demonstrate its association with comorbidities and possible benefits of vitamin D supplementation. Copyright © 2015 Sociedade de Pediatria de São Paulo. Publicado por Elsevier Editora Ltda. All rights reserved.

  12. Vitamin D in children and adolescents with sickle cell disease: an integrative review

    Science.gov (United States)

    de Oliveira, Jacqueline Faria; Vicente, Natália Gomes; Santos, Juliana Pereira Pontes; Weffort, Virgínia Resende Silva

    2015-01-01

    Objective: To review the literature about the prevalence of vitamin D deficiency and its consequences in children and adolescents with sickle-cell disease. Data sources: The literature survey was performed through the bibliographic databases MEDLINE; U.S. National Library of Medicine and National Institutes of Health (PubMed); Literatura Latino-Americana e do Caribe em Ciências da Saúde (Lilacs), and the Cochrane Library. The keywords were selected using Medical Heading Terms (MeSH): “vitamin D” OR “vitamin D deficiency” AND “anemia, sickle cell” AND “child” AND “adolescent”. The search was limited to articles in English, Spanish and Portuguese, published until April 2014. Data synthesis: Eleven articles were selected among the 18 found. In 6 of the 11 studies, serum levels of vitamin D in children and/or adolescents with sickle-cell anemia were low. The prevalence of vitamin D deficiency in patients with sickle-cell anemia exceeded that of the comparison group. The low intake of vitamin D, seasonality, exposure to sun, increased metabolism associated with the hemoglobinopathy, and age increase were factors associated with the deficiency. There was an association between a significant vitamin D deficiency and bone weakness and painful crises. There was a positive correlation between increased levels of vitamin D by supplementation and functional, physical capacity. Conclusions: The vitamin D deficiency in children and adolescents with sickle-cell disease is prevalent and requires further studies to demonstrate its association with comorbidities and possible benefits of vitamin D supplementation. PMID:26141903

  13. Umbilical cord blood donation: public or private?

    Science.gov (United States)

    Ballen, K K; Verter, F; Kurtzberg, J

    2015-10-01

    Umbilical cord blood (UCB) is a graft source for patients with malignant or genetic diseases who can be cured by allogeneic hematopoietic cell transplantation (HCT), but who do not have an appropriately HLA-matched family or volunteer unrelated adult donor. Starting in the 1990s, unrelated UCB banks were established, accepting donations from term deliveries and storing UCB units for public use. An estimated 730 000 UCB units have been donated and stored to date and ~35 000 UCB transplants have been performed worldwide. Over the past 20 years, private and family banks have grown rapidly, storing ~4 million UCB units for a particular patient or family, usually charging an up-front and yearly storage fee; therefore, these banks are able to be financially sustainable without releasing UCB units. Private banks are not obligated to fulfill the same regulatory requirements of the public banks. The public banks have released ~30 times more UCB units for therapy. Some countries have transitioned to an integrated banking model, a hybrid of public and family banking. Today, pregnant women, their families, obstetrical providers and pediatricians are faced with multiple choices about the disposition of their newborn's cord blood. In this commentary, we review the progress of UCB banking technology; we also analyze the current data on pediatric and adult unrelated UCB, including the recent expansion of interest in transplantation for hemoglobinopathies, and discuss emerging studies on the use of autologous UCB for neurologic diseases and regenerative medicine. We will review worldwide approaches to UCB banking, ethical considerations, criteria for public and family banking, integrated banking ideas and future strategies for UCB banking.

  14. The effect of tranexamic acid in unilateral and bilateral total knee arthroplasty in the South Asian population: A retrospective cohort study.

    Science.gov (United States)

    Mufarrih, Syed Hamza; Malik, Azeem Tariq; Qureshi, Nada Qaisar; Lakdawala, Riaz Hussain; Rabbani, Muhammad Umar; Ali, Arif; Noordin, Shahryar

    2018-04-01

    Together with evidence of higher bleeding tendencies, the vulnerability of the South-Asian population to anemia secondary to a higher prevalence of hemoglobinopathies and micronutrient deficiencies merits further exploration of the effects of tranexamic acid on this population. Additionally, limited access to self-care facilities and certain sociocultural beliefs and practices may not be conducive to a speedy recovery from surgical complications. The aim of this study is to investigate the effects of intraoperative administration of tranexamic acid during total knee arthroplasty when considering the South-Asian population. Medical record files of 355 patients who underwent total knee arthroplasty (2007-2015) were reviewed to collect data regarding patient characteristics, surgical variables and post-operative complications. Unilateral and Bilateral total knee arthroplasty were studied separately. Analysis was done using t-test, Mann-Whitney U test, chi-square and Fisher's exact square where appropriate. The threshold for significance was p tranexamic acid caused a significant reduction in estimated blood loss (p-value=0.011), total operative time, calculated blood loss, and hemoglobin change (p-valuetranexamic acid only caused a significant reduction in calculated blood loss (p-value tranexamic acid vs. those who did not, there was a significant increase in length of hospital stay (ptranexamic acid effectively reduces intraoperative blood loss, it does not have an effect on the need for post-operative blood transfusions. The increased length of stay and special care unit admissions associated with tranexamic acid use should be explored further to reveal the complete safety profile of tranexamic acid administration in the South-Asian population during total knee arthroplasty. Copyright © 2018 IJS Publishing Group Ltd. Published by Elsevier Ltd. All rights reserved.

  15. The effect of hydroxyurea on compound heterozygotes for sickle cell-hemoglobin D-Punjab--a single centre experience in eastern India.

    Science.gov (United States)

    Patel, Siris; Purohit, Prasanta; Mashon, Ranjeet Singh; Dehury, Snehadhini; Meher, Satyabrata; Sahoo, Sulia; Dash, Subhransu Sekhar; Das, Kishalaya; Das, Padmalaya; Patel, Dilip Kumar

    2014-08-01

    Although hydroxyurea is the only effective agent for the treatment of sickle cell disease, published experience with this drug is limited to treatment of homozygous sickle cell anemia and HbS/β thalassemia. The role of hydroxyurea in the treatment of patients with HbSD-Punjab, a rare hemoglobinopathy with phenotypic expression similar to that of sickle cell anemia is unknown. Over a period of 10 years, we followed 42 patients with HbSD-Punjab, of which 20 presented with severe clinical manifestations (≥3 episodes of VOC and/or ≥2 units of blood transfusion in the previous 12 months). These 20 patients were enrolled for treatment with hydroxyurea at a dose of 10 mg/kg/day and followed prospectively for a period of 24 months. The frequency of VOC decreased significantly and none of them required blood transfusion while receiving hydroxyurea. The HbF, total hemoglobin, MCV, MCH, and MCHC levels increased significantly, whereas HbS, WBC, platelet count, total serum bilirubin, and LDH levels decreased significantly in all the patients. No short-term drug toxicity was observed. This study describes the use of hydroxyurea therapy in patients with HbSD-Punjab. Low dose hydroxyurea (10 mg/kg/day) was found to be effective in reducing the clinical severity in patients with HbSD-Punjab without any short-term toxicity. In view of easy affordability amongst poor patients, widespread acceptability by patients and doctors, the need of infrequent monitoring and its potential effectiveness, low dose hydroxyurea is suitable for treatment of patients with HbSD-Punjab. © 2014 Wiley Periodicals, Inc.

  16. β-globin haplotypes in normal and hemoglobinopathic individuals from Reconcavo Baiano, State of Bahia, Brazil

    Directory of Open Access Journals (Sweden)

    Wellington dos Santos Silva

    2010-01-01

    Full Text Available Five restriction site polymorphisms in the β-globin gene cluster (HincII-5'ε, HindIII-Gγ, HindIII-ªγ, HincII-'ψβ1 and HincII-3''ψβ1 were analyzed in three populations (n = 114 from Reconcavo Baiano, State of Bahia, Brazil. The groups included two urban populations from the towns of Cachoeira and Maragojipe and one rural Afro-descendant population, known as the "quilombo community", from Cachoeira municipality. The number of haplotypes found in the populations ranged from 10 to 13, which indicated higher diversity than in the parental populations. The haplotypes 2 (+----,3(----+,4(-+--+and6(-++-+onthe βA chromosomes were the most common, and two haplotypes, 9 (-++++and 14 (++--+, were found exclusively in the Maragojipe population. The other haplotypes (1, 5, 9, 11, 12, 13, 14 and 16 had lower frequencies. Restriction site analysis and the derived haplotypes indicated homogeneity among the populations. Thirty-two individuals with hemoglobinopathies (17 sickle cell disease, 12 HbSC disease and 3 HbCC disease were also analyzed. The haplotype frequencies of these patients differed significantly from those of the general population. In the sickle cell disease subgroup, the predominant haplotypes were BEN (Benin and CAR (Central African Republic, with frequencies of 52.9% and 32.4%, respectively. The high frequency of the BEN haplotype agreed with the historical origin of the afro-descendant population in the state of Bahia. However, this frequency differed from that of Salvador, the state capital, where the CAR and BEN haplotypes have similar frequencies, probably as a consequence of domestic slave trade and subsequent internal migrations to other regions of Brazil.

  17. Burden of thalassemia in India: The road map for control

    Directory of Open Access Journals (Sweden)

    Roshan Colah

    2017-12-01

    Full Text Available The thalassemias and structural haemoglobin variants are the commonest monogenic disorders globally. India has a huge burden with an estimated 100,000 patients with a β thalassemia syndrome and around 150,000 patients with sickle cell disease, but few among them are optimally managed, and allogeneic stem cell transplant is unaffordable for the majority of families. A feasible option for control is to promote education and awareness programmes, intensify screening in all the states with micromapping to assess the true burden, and develop adequate facilities for genetic counselling and prenatal diagnosis in public sector Institutions. Government and non-government organizations have been working towards this goal for the last 3 to 4 decades but community control in a vast and diverse country is challenging and a national programme reaching all rural regions where almost 70% of the population resides is yet to begin. Strategies to control thalassemia need to include 1 Educating health professionals, school and college students, pregnant women and the population at large 2 Establishing prenatal diagnosis facilities in different regions of the country 3 Setting up a greater number of Day Care Centres for managing existing thalassemia patients 4 Developing cost-effective facilities for stem cell transplantation across the country. This review explores strategies by which Central and State Governments, NGOs, Parents-Patients Societies and Corporate Houses can work together to successfully reduce the burden of hemoglobinopathies in India. Guidelines for implementation of such a national programme have recently been prepared by the National Health Mission, Ministry of Health and Family Welfare with the help of several experts in the country.

  18. ROLE OF STEM CELL FACTOR IN THE REACTIVATION OF HUMAN FETAL HEMOGLOBIN

    Directory of Open Access Journals (Sweden)

    Ugo Testa

    2009-06-01

    Full Text Available

    In humans the switch from fetal to adult  hemoglobin (HbF→ HbA takes place in the perinatal and postnatal period, determining the progressive replacement of HbF with HbA synthesis ( i.e., the relative HbF content in red blood cells decreases from 80-90% to <1%. In spite of more than twenty years of intensive investigations on this classic model, the molecular mechanisms regulating the Hb switching, as well as HbF synthesis in adults, has been only in part elucidated. In adult life, the residual HbF, restricted to F cell compartment, may be reactivated up to 10-20% of total Hb synthesis in various conditions associated with “stress erythropoiesis”: this reactivation represented until now an interesting model of partial Hb switch reverse with important therapeutic implications in patients with hemoglobinopathies, and particularly in -thalassemia.
    In vitro and in vivo models have led to the identification of several chemical compounds able to reactivate HbF synthesis in adult erythroid cells. Although the impact of these HbF inducers, including hypomethylating agents, histone deacetylase inhibitors and hydroxyurea, was clear on the natural history of sickle cell anemia, the benefit on the clinical course of -thalassemia was only limited: particularly, the toxicity and the modest increase in γ-globin reactivation indicated the need for improved agents able to induce higher levels of HbF.
    In the present review we describe the biologic properties of Stem Cell Factor (SCF, a cytokine sustaining the survival and proliferation of erythroid cells, that at pharmacological doses acts as a potent stimulator of HbF synthesis in adult erythroid cells.

  19. Trajectories of HbA1c Levels in Children and Youth with Type 1 Diabetes

    Science.gov (United States)

    Pinhas-Hamiel, Orit; Hamiel, Uri; Boyko, Valentina; Graph-Barel, Chana; Reichman, Brian; Lerner-Geva, Liat

    2014-01-01

    Purpose To illustrate the distribution of Hemoglobin A1c (HbA1c) levels according to age and gender among children, adolescents and youth with type 1 diabetes (T1DM). Methods Consecutive HbA1c measurements of 349 patients, aged 2 to 30 years with T1DM were obtained from 1995 through 2010. Measurement from patients diagnosed with celiac disease (n = 20), eating disorders (n = 41) and hemoglobinopathy (n = 1) were excluded. The study sample comprised 4815 measurements of HbA1c from 287 patients. Regression percentiles of HbA1c were calculated as a function of age and gender by the quantile regression method using the SAS procedure QUANTREG. Results Crude percentiles of HbA1c as a function of age and gender, and the modeled curves produced using quantile regression showed good concordance. The curves show a decline in HbA1c levels from age 2 to 4 years at each percentile. Thereafter, there is a gradual increase during the prepubertal years with a peak at ages 12 to 14 years. HbA1c levels subsequently decline to the lowest values in the third decade. Curves of females and males followed closely, with females having HbA1c levels about 0.1% (1.1 mmol/mol) higher in the 25th 50th and 75th percentiles. Conclusion We constructed age-specific distribution curves for HbA1c levels for patients with T1DM. These percentiles may be used to demonstrate the individual patient's measurements longitudinally compared with age-matched patients. PMID:25275650

  20. Community Genetics: a new discipline and its application in Brazil Genética Comunitária: uma nova disciplina e sua aplicação no Brasil

    Directory of Open Access Journals (Sweden)

    Antonio Sérgio Ramalho

    2000-01-01

    Full Text Available Community genetics is a new discipline which aims to provide genetic services to the community as a whole. As a science, community genetics encompasses all research needed to develop and evaluate its application. There is no question that the development of community genetics is necessary in Brazil. The implementation of such programs in our country, especially for hemoglobinopathies, has been recommended by the World Health Organization and other international organizations. Apart from the need for and appeal of community genetics programs, some aspects require serious review. This article discusses various cultural, social, psychological, and economic factors that can make genetic screening an invasion of individual privacyA Genética Comunitária é uma nova disciplina, que tem por objetivo o fornecimento de serviços de genética para a comunidade como um todo. Enquanto ciência, engloba todas as pesquisas necessárias ao desenvolvimento e à avaliação das suas aplicações. Indiscutivelmente, o desenvolvimento da disciplina no Brasil é muito necessário e a implantação de programas brasileiros de genética comunitária vem sendo recomendada pela Organização Mundial de Saúde e por outras organizações internacionais, sobretudo para as hemoglobinopatias. Apesar da necessidade e do lado atraente dos programas comunitários, alguns aspectos destes devem ser seriamente considerados. No presente artigo, são discutidos alguns fatores culturais, sociais, psicológicos e econômicos que podem transformar a triagem genética em uma invasão da privacidade dos indivíduos.

  1. Novel interactions of two α-Hb variants with SEA deletion α0-thalassemia: hematological and molecular analyses.

    Science.gov (United States)

    Srivorakun, Hataichanok; Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan

    2018-04-01

    To report the hematological and molecular features as well as diagnostic aspects of the hitherto un-described interactions of two rare α-globin chain variants with α 0 -thalassemia commonly found among Southeast Asian populations. The study was done on two adult Thai patients (P1 and P2) who had hypochromic microcytic anemia. Hb analysis was carried out using high performance liquid chromatography (HPLC) and capillary electrophoresis (CE). Mutations were identified by PCR and related techniques. Hb analysis of P1 using HPLC showed a normal Hb pattern, but CE demonstrated an abnormal peak at zone 7. DNA sequencing identified a CCG-CTG mutation at codon 95 of the α2 globin gene corresponding to the Hb G-Georgia [α95(G2)Pro → Leu(α2)] previously undescribed in the Thai population. In contrast, Hb analysis of P2 demonstrated an abnormal peak not fully separated from Hb A on HPLC, but not on CE. DNA analysis identified the rarely described Hb Nakhon Ratchasima [α63(E12)Ala → Val(α2)] mutation. Routine DNA analysis detected the SEA deletion α 0 -thalassemia in trans to the Hb variants in both cases. Hematological parameters were compared with those of patients with compound heterozygote for other α-globin variants and α 0 -thalassemia previously documented. Identification of the patients confirmed that interaction of these rare Hb variants with α 0 -thalassemia does not lead to the Hb H disease. Differentiation of these two Hb variants from other clinically relevant hemoglobinopathies in a routine setting is, however, necessary. This can be accomplished using a combined Hb-HPLC and CE analysis followed by PCR-RFLP assays.

  2. Identification of Hb Constant Spring (HBA2: c.427T > C) by an Automated High Performance Liquid Chromatography Method.

    Science.gov (United States)

    Wisedpanichkij, Raewadee; Jindadamrongwech, Sumalee; Butthep, Punnee

    2015-01-01

    Laboratory investigation of hemoglobinopathies includes complete blood count (CBC), hemoglobin (Hb) typing by high performance liquid chromatography (HPLC) and DNA analysis. DNA analysis is the most reliable method but requires a manually laborious procedure and is time consuming. A more practical method of detecting abnormal Hbs is the HPLC technique, because it is more rapid and easier to interpret. Hb Constant Spring (Hb CS; HBA2: c.427T > C) is an abnormal variant that is labile and difficult to detect using conventional methods. To evaluate the efficiency of Hb CS determination by HPLC, blood samples from 578 subjects were analyzed using an automated cell analyzer for hematological parameters, automated HPLC for Hb identification, and polymerase chain reaction (PCR) for α-thalassemia (α-thal) and Hb CS confirmation. These included 169 normal, 119 heterozygous α-thal-2, 30 homozygous α-thal-2, 177 heterozygous α-thal-1, 59 heterozygous Hb CS, seven homozygous Hb CS and 17 compound heterozygous α-thal-2 and Hb CS subjects. The results showed that sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) of Hb CS by HPLC were 93.78, 99.80, 98.73 and 99.00%, respectively. The mean of misdiagnosis value of the three groups of Hb CS subjects (total 83) was 6.02% (n = 5), with percentages for heterozygous Hb CS, homozygous Hb CS, and compound heterozygous α-thal-2 and Hb CS being 6.8, 0.0 and 5.9%, respectively. The HPLC method yielded good results, although it may also lead to misdiagnosis of Hb CS due to the relatively small amount and lability.

  3. Hematological Characterizations and Molecular Diagnostic Aspects of Hb Wiangpapao [α44(CE2)Pro→Ser (α1), CCG>TCG; HBA1: c.133C>T], a New α-Globin Variant Found in a Pregnant Thai Woman.

    Science.gov (United States)

    Panyasai, Sitthichai; Pornprasert, Sakorn

    2017-03-01

    We report the hematological parameters and provide a rapid molecular analysis method for detection of Hb Wiangpapao [α44(CE2)Pro→Ser, CCG>TCG; HBA1: c.133C>T], a new α-globin variant found in a pregnant Thai woman. Her red cell indices were measured by an automated blood counter. The results were: red blood cell (RBC) count 4.03 × 10 12 /L, Hb 13.1 (g/dL), packed cell volume (PCV) 0.39 L/L, mean corpuscular volume (MCV) 97.0 fL, mean corpuscular hemoglobin (Hb) (MCH) 32.5 pg, mean corpuscular Hb concentration (MCHC) 33.4 g/dL, and RBC distribution width (RDW) 9.4%. The Hb typing by high performance liquid chromatography (HPLC) showed 13.6% abnormal Hb at a retention time of 2.20 min. that was difficult to distinguish from Hb A. On the capillary electrophoresis (CE) electropherogram, this hemoglobinopathy peak did not separate from the Hb A peak. DNA sequencing showed a C>T transition at the first position of codon 44 (CCG>TCG) of the α1-globin gene that led to a substitution of proline for serine. This mutation has not been recorded in the public databases. Therefore, we named it Hb Wiangpapao as it was first discovered in the Wiangpapao District, Chiang Rai, Thailand. The multiplex allele-specific polymerase chain reaction (ASPCR) for detection of Hb Wiangpapao was developed and revealed a 510 bp specifically amplified fragment. The better understanding of hematological characterizations and the newly developed multiplex ASPCR for diagnosis of Hb Wiangpapao are useful for genetic counseling and family education.

  4. [Clinical and biological manifestations in primary parvovirus B19 infection in immunocompetent adult: a retrospective study of 26 cases].

    Science.gov (United States)

    Parra, D; Mekki, Y; Durieu, I; Broussolle, C; Sève, P

    2014-05-01

    Parvovirus B19 causes erythema infectiosum in children, transient aplastic anemia in patients with hemoglobinopathies, pur red cell aplasia in immunocompromised persons and hydrops fetalis in pregnancy. The spectrum of clinical and biological manifestations in immunocompetent adult continues to grow up. We report on a case series of 26 patients with primary parvovirus B19 infection in immunocompetent adults. This is a retrospective study over the period 2000 to 2010 in two departments of internal medecine. The diagnostic was clinical, serological or molecular. There was a female predominance (sex-ratio 3.33/1). Median patient age at diagnostic was 38.8 years (range: 18-68). The predominant symptoms were fever (65%), peripheral and symmetrical polyarthralgia (62%) and skin rash (58%). Two patients had neurological manifestations (sixth cranial nerve palsy, distal paresthesia) and one patient had myocarditis. Abnormal laboratory values included increased acute phase reactants (73%), thrombocytopenia (43%), lymphopenia (38%) and elevated liver enzymes (37%). Antinuclear (19%), anti-DNA (28%) and anti-phospholipids antibodies (14%), and hypocomplementemia (32%) were observed. False reaction with anti-CMV and anti-EBV IgM positivity was documented in 27% of cases. Two patients had persistent parvovirus B19 infection. The diversity of the clinical manifestations of parvovirus B19 infection may be misleading for the clinician. However, the diagnosis should be suspected in immunocompetent adults to limit the risk of transmission to the patients who could develop a severe infection such as pregnant women or immunocompromised patients. Copyright © 2013 Société nationale française de médecine interne (SNFMI). Published by Elsevier SAS. All rights reserved.

  5. Anemia Falciforme: Um Problema Nosso. Uma abordagem bioética sobre a nova genética Sickle Cell Anaemia: A Brazilian Problem.A bioethical approach to the new genetics

    Directory of Open Access Journals (Sweden)

    Debora Diniz

    2003-12-01

    Full Text Available Este artigo analisa uma das ações educativas adotadas pelo Ministério da Saúde no campo das hemoglobinopatias: o folheto informativo Anemia Falciforme: Um Problema Nosso. O objetivo é discutir as premissas e os valores morais que se encontram associados a iniciativas no campo da educação genética, tendo as políticas públicas sobre anemia falciforme no Brasil como estudo de caso. A análise mostra que o conteúdo do folheto oscila entre políticas de prevenção para doenças e promoção de direitos fundamentais, uma característica da nova genética. Além disso, o excesso de informação biomédica especializada no folheto dificulta sua divulgação em massa. Os resultados encontrados foram discutidos à luz do debate bioético contemporâneo sobre a nova genética.This article analyzes one of the educational initiatives of the Brazilian Ministry of Health on hemoglobinopathies: the leaflet entitled Sickle Cell Anaemia: A Brazilian Problem. The purpose is to discuss the moral values associated with initiatives in genetics education, and the case study focuses on public policies related to sickle cell anaemia in Brazil. The analysis shows that the topics in the leaflets fluctuate between disease prevention policies and human rights protection, a basic characteristic of the new genetics. In addition, the leaflet’s excessive biomedical information hinders understanding by lay readers. The results are analyzed in the light of the contemporary bioethical debate on the new genetics.

  6. Hemoglobinas anormais e dificuldade diagnóstica Abnormal hemoglobins

    Directory of Open Access Journals (Sweden)

    Guilherme G. Leoneli

    2000-12-01

    characteristic polymorphic variation within the Brazilian population, depending on the racial groups of each region. They have appeared under the form of hemoglobin variants or thalassemias, the variant types S and C and the alpha and beta thalassemias being more common, all of them in heterozygote form. During the year of 1999, blood samples from 506 individuals, with suspected anemia or that had already passed through hemoglobinopathies screening, were sent to the Hemoglobin Reference Center -- UNESP for diagnostic confirmation and submitted to electrophoresis proceedings, biochemical and cytological analyses in order to characterize the type of abnormal hemoglobins. The goal of the present study was to verify which abnormal hemoglobin types show greater diagnostic difficulty. The samples came from 24 cities in twelve states. The results showed that 354 (69.96% individuals presented abnormal hemoglobins, 30 (5.93% being Hb AS, 5 (0.98% being Hb AC, 76 (15.02% suggestive of heterozygote alpha thalassemia, 134 (26.48% suggestive of heterozygote beta thalassemia and 109 (21.54% with other forms of abnormal hemoglobin, including rare variants and different forms of thalassemias and variant hemoglobin interactions. It has been concluded that, despite the improved techniques currently available and a constant influx of capacitated personnel, the heterozygote form of thalassemias (210 individuals -- 41.50% is challenging to diagnose, followed in difficulty by rare variant characterization and interactive forms of hemoglobinopathies (109 individuals -- 21,54%, suggesting that the capacity for production of qualified professionals and information about these genetic changes in our population should be increased.

  7. Resting blood lactate in individuals with sickle cell disease

    Directory of Open Access Journals (Sweden)

    Jefferson Petto

    2011-02-01

    Full Text Available BACKGROUND: The most common hereditary hemoglobin disorder, affecting 20 million individuals worldwide, is sickle cell disease. The vascular obstruction resulting from the sickling of cells in this disease can produce local hypoxemia, pain crises and infarction in several tissues, including the bones, spleen, kidneys and lungs. METHODS: The present study is characterized as a case control study, with the aim of identifying the baseline blood lactate concentration in individuals with hemoglobin SS and SC diseases. One-way ANOVA with the Tukey post-test was used to analyze the results and a p-value < 0.05 was considered significant. Calculations were made using the INSTAT statistical program. The graphs were generated using the ORING program. The study sample was composed of 31 men and women residing in the city of Santo Antônio de Jesus, Bahia, Brazil. The individuals were divided into two groups: Group GC of 16 subjects who did not present with any type of structural hemoglobinopathy; and Group GE composed of 15 individuals with ages between 2 and 35 years old, who had the SS and SC genotypes. Sample analyses were performed with 3 mL of blood during fasting. RESULTS: The baseline blood lactate concentration of the SS and SC individuals was higher than that of the control group (p<0.001 with means of 4.86 ± 0.95; 3.30 ± 0.33; 1.31 ± 0.08 IU/L for SS, SC and controls, respectively. This corroborates the initial research hypothesis. CONCLUSION: The baseline blood lactate of SS and SC individuals is 3 to 4 times higher than that of healthy subjects, probably due to the fact that these patients have a metabolic deviation to the anaerobic pathway.

  8. The Correlation between Troponin and Ferritin Serum Levels in the Patients with Major Beta-Thalassemia

    Directory of Open Access Journals (Sweden)

    Iraj Shahramian

    2013-06-01

    Full Text Available Background: Thalassemia is a hereditary hemoglobinopathy whose most common complication is cardiac involvement which ends up in these patients’ death. Since troponin is a sensitive and specific marker for the detection of microinfarct, we studied the relationship between troponin and ferritin serum levels for early diagnosis of cardiac involvement in these patients. Materials and Methods: This case-control study was performed on 80 patients, including 40 patients with major thalassemia and normal echocardiography and 40 healthy volunteers ranging from 6 months to 16 years old. All the children were examined and the eligible children who were not infected with known heart disease, iron deficiency anemia, kidney disease, diabetes, fever, and systemic diseases were enrolled into the study after obtaining written informed consents from their parents. At 8:00 A.M. before breakfast, 5cc blood was drawn from these children. After collecting the samples, ferritin and troponin serum levels were evaluated using ELISA and electro- kymonolonsense methods, respectively. The gathered data were analyzed through the SPSS statistical software (v. 20 and T-test. Besides, P value<0.05 was considered as statistically significant. Results: The study results revealed a significant difference between the two groups regarding the mean of the serum levels of troponin (P=0.045 and ferritin (P=0.001. In this study, no significant correlation was observed between serum troponin and ferritin levels and age and BMI in the two groups. Also, no significant relationship was found between serum troponin level and sex (P=0.264. Conclusions: In microinfarct, troponin increases independent of ferritin; therefore, it can be used for early detection of cardiac involvement in thalassemia patients to determine the sub-clinical effects.

  9. Concepts, Utility and Limitations of Cord Blood Banking: What Clinicians Need to Know.

    Science.gov (United States)

    Narayanan, Dhanya Lakshmi; Phadke, Shubha R

    2018-03-20

    Stem cell transplantation and cord blood banking have received much popularity among general public and medical professionals in the recent past. But information about the scientific aspects, its utility and limitations is incomplete amongst laypersons as well as many medical practitioners. Stem cells differ from all other types of cells in the human body because of their ability to multiply in order to self perpetuate and differentiate into specialized cells. Stems cells could be totipotent, multipotent, pluripotent, oligopotent or unipotent depending on the type of cells that can arise or differentiate from them. Umbilical cord blood serves as a potent source of hematopoeitic stem cells and is being used to treat various disorders like blood cancers, hemoglobinopathies and immunodeficiency disorders for which hematological stem cell transplantation is the standard of care. Cord blood can be collected at ease, without any major complications and has a lower incidence of graft vs. host reaction compared to bone marrow cells or peripheral blood cells. Both public and private banks have been established for collection and storage of umbilical cord blood. However, false claims and misleading commercial advertisements about the use of umbilical cord blood stem cells for the treatment of a variety of conditions ranging from neuromuscular disorders to cosmetic benefits are widespread and create unrealistic expectations in laypersons and clinicians. Many clinicians and laypersons are unaware of the limitations of cord blood banking, as in treating a genetic disorder by autologous cord blood transplant. Knowledge and awareness about the scientific indications of cord blood stem cell transplantation and realistic expectations about the utility of cord blood among medical practitioners are essential for providing accurate information to laypersons before they decide to preserve umbilical cord blood in private banks and thus prevent malpractice.

  10. Molecular Characteristics of Hb New York [β113(G15)Val→Glu, HBB: c.341T>A] in Thailand.

    Science.gov (United States)

    Chaibunruang, Attawut; Singha, Kritsada; Srivorakun, Hataichanok; Fucharoen, Goonnapa; Fucharoen, Supan

    2018-01-01

    Hb New York or Hb Kaohsiung [β113(G15)Val→Glu (GTG>GAG), HBB: c.341T>A] has been considered a rare β hemoglobin (Hb) variant found originally in an Iranian woman and later in diverse populations but its genetic origin has not been elucidated. Here we report molecular and hematological descriptions of this variant found in the Thai population. Among 5643 subjects referred for hemoglobinopathy investigation during January 2015 to September 2017, 183 (3.2%) were found to carry several Hb variants, including β chain variants (n = 135, 2.4%), α chain variants (n = 33, 0.6%), Hb Lepore-Hollandia (NG_000007.3: g.63290_70702del) and Hb Lepore-Boston-Washington (NG_000007.3: g.63632_71046del) (δβ hybrid Hb) (n = 12, 0.2%) and δ chain variants (n = 3, 0.05%). Of patients with β chain variants, six with normal high performance liquid chromatography (HPLC) patterns, had an abnormal Hb in zone 11 of capillary electrophoresis (CE), the amounts of which ranged from 29.6-45.4% with normal levels of Hb A 2 and Hb F. DNA analysis identified a heterozygous Hb New York mutation in all cases. Further screening of α-thalassemia (α-thal) identified coinheritance of α + - and α 0 -thal in two of them who had reduced levels of Hb New York. Haplotype analysis suggested that the Thai Hb New York was likely associated with a single β-globin haplotype [+ - - - - + +], indicating that it was of the same origin. Hematological findings and simple DNA assay based on allele-specific polymerase chain reaction (PCR) for rapid detection of Hb New York are presented.

  11. Bradykinin stimulation of nitric oxide production is not sufficient for gamma-globin induction

    Directory of Open Access Journals (Sweden)

    Čokić Vladan P.

    2014-01-01

    Full Text Available Introduction. Hydroxycarbamide, used in therapy of hemoglobinopathies, enhances nitric oxide (NO production both in primary human umbilical vein endothelial cells (HUVECs and human bone marrow endothelial cell line (TrHBMEC. Moreover, NO increases γ-globin and fetal hemoglobin levels in human erythroid progenitors. Objective. In order to find out whether simple physiologic stimulation of NO production by components of hematopoietic microenvironment can increase γ-globin gene expression, the effects of NO-inducer bradykinin were examined in endothelial cells. Methods. The study was performed in co-cultures of human erythroid progenitors, TrHBMEC and HUVECs by ozone-based chemiluminescent determination of NO and real-time quantitative RT-PCR. Results. In accordance with previous reports, the endogenous factor bradykinin increased endothelial cell production of NO in a dose- and time-dependent manner (0.1-0.6 μM up to 30 minutes. This induction of NO in HUVECs and TrHBMEC by bradykinin was blocked by competitive inhibitors of NO synthase (NOS, demonstrating NOS-dependence. It has been shown that bradykinin significantly reduced endothelial NOS (eNOS mRNA level and eNOS/Я-actin ratio in HUVEC (by twofold. In addition, bradykinin failed to increase γ-globin mRNA expression in erythroid progenitors only, as well as in co-culture studies of erythroid progenitors with TrHBMEC and HUVEC after 24 hours of treatment. Furthermore, bradykinin did not induce γ/β globin ratio in erythroid progenitors in co-cultures with HUVEC. Conclusion. Bradykinin mediated eNOS activation leads to short time and low NO production in endothelial cells, insufficient to induce γ-globin gene expression. These results emphasized the significance of elevated and extended NO production in augmentation of γ-globin gene expression. [Projekat Ministarstva nauke Republike Srbije, br. 175053

  12. Nutritional and Micronutrient Status of Female Workers in a Garment Factory in Cambodia.

    Science.gov (United States)

    Makurat, Jan; Friedrich, Hanna; Kuong, Khov; Wieringa, Frank T; Chamnan, Chhoun; Krawinkel, Michael B

    2016-11-02

    Concerns about the nutritional status of Cambodian garment workers were raised years ago but data are still scarce. The objectives of this study are to examine the nutritional, hemoglobin and micronutrient status of female workers in a garment factory in Phnom Penh, Cambodia, and to assess if body mass index is associated with hemoglobin and/or micronutrient status. A cross-sectional survey was conducted among 223 female workers (nulliparous, non-pregnant) at a garment factory in Phnom Penh. Anthropometric measurements were performed and blood samples were taken to obtain results on hemoglobin, iron, vitamin A, vitamin B12 and inflammation status (hemoglobinopathies not determined). Bivariate correlations were used to assess associations. Overall, 31.4% of workers were underweight, 26.9% showed anemia, 22.1% showed iron deficiency, while 46.5% had marginal iron stores. No evidence of vitamin A or vitamin B12 deficiency was found. Body mass index was associated with serum ferritin (negative) and serum retinol-binding protein (positive) concentrations, but not strongly. A comparison between underweight and not underweight workers resulted in distinctions for iron deficiency and iron deficiency anemia, with a higher prevalence among not underweight. The prevalence of underweight, anemia and poor iron status was high. Young and nulliparous female garment workers in Cambodia might constitute a group with elevated risk for nutritional deficiencies. Strategies need to be developed for improving their nutritional, micronutrient and health status. The poor iron status seems to contribute to the overall prevalence of anemia. Low hemoglobin and iron deficiency affected both underweight and those not underweight. Despite the fact that body mass index was negatively associated with iron stores, true differences in iron status between underweight and not underweight participants cannot be confirmed.

  13. Efficient genome editing in hematopoietic stem cells with helper-dependent Ad5/35 vectors expressing site-specific endonucleases under microRNA regulation

    Directory of Open Access Journals (Sweden)

    Kamola Saydaminova

    Full Text Available Genome editing with site-specific endonucleases has implications for basic biomedical research as well as for gene therapy. We generated helper-dependent, capsid-modified adenovirus (HD-Ad5/35 vectors for zinc-finger nuclease (ZFN– or transcription activator-like effector nuclease (TALEN–mediated genome editing in human CD34+ hematopoietic stem cells (HSCs from mobilized adult donors. The production of these vectors required that ZFN and TALEN expression in HD-Ad5/35 producer 293-Cre cells was suppressed. To do this, we developed a microRNA (miRNA-based system for regulation of gene expression based on miRNA expression profiling of 293-Cre and CD34+ cells. Using miR-183-5p and miR-218-5p based regulation of transgene gene expression, we first produced an HD-Ad5/35 vector expressing a ZFN specific to the HIV coreceptor gene ccr5. We demonstrated that HD-Ad5/35.ZFNmiR vector conferred ccr5 knock out in primitive HSC (i.e., long-term culture initiating cells and NOD/SCID repopulating cells. The ccr5 gene disruption frequency achieved in engrafted HSCs found in the bone marrow of transplanted mice is clinically relevant for HIV therapy considering that these cells can give rise to multiple lineages, including all the lineages that represent targets and reservoirs for HIV. We produced a second HD-Ad5/35 vector expressing a TALEN targeting the DNase hypersensitivity region 2 (HS2 within the globin locus control region. This vector has potential for targeted gene correction in hemoglobinopathies. The miRNA regulated HD-Ad5/35 vector platform for expression of site-specific endonucleases has numerous advantages over currently used vectors as a tool for genome engineering of HSCs for therapeutic purposes.

  14. Neonatal screening for sickle cell disease, Glucose-6-PhosphateDehydrogenase deficiency and Alpha-Thalassemia in Qatif and Al-Hasa

    International Nuclear Information System (INIS)

    Nasserullah, Z.; Srair, Hussain Abu; Al-Jame, A.; Mokhtar, M.; Al-Qatari, G.; Al-Naim, S.; Al-Aqib, A.

    1998-01-01

    Screening programs to determine the frequency of sickle cell,glucose-6-phosphate dehydrogenase deficiency and alpha-thalassemia gene areavailable in Saudi Arabia, although not used frequently. Greater use of theseprograms will decrease the morbidity and mortality of Saudi children affectedby these disorders. Neonatal hemoglobin electrophoresis andglucose-6-dehydrogenase fluorescent spot tests were performed on new bornbabies delivered between December 1992 and December 1993 at the Qatif CentralHospital and at the King Fahd Hospital in Al-Hasa. Cord blood samples werecollected from babies born in these two hospitals. Babies born in otherhospitals had blood collected in their first visit to Qatif primary carecenters at the time of vaccination. All specimens were sent to Dammam CentralLaboratory. The diagnosis of sickle cell and alpha-thalassemia was based oncellulose acetate electrophoresis and confirmed by agar gel electrophoresisand glucose-6-phosphate dehydrgenase was confirmed by fluorescent spot test.A total of 12,220 infants, including 11,313 Saudis (92.6%), were screenedover a 12-month period. The common phenotype detected in these infantsincluded AF, SFA, SFA Bart's, FS and FS Bart's. In Saudi infants, homozygoussickle cell disease was detected in 2.35% and 1.08% in Qatif and Al-Hasa,respectively. The frequencies of sickle cell gene were 0.1545% and 0.1109% inQatif and Al-Hasa. Alpha-thalassemia genes based on an elevated level of HbBart's were 28% and 16.3% in Qatif and Al-Hasa. The screening for G6PDdeficiency revealed a high prevalence of 30.6% and 14.7% in Qatif andAl-Hasa. In the non-Saudi infants the frequencies were low. The outcome ofthis study indicates that the Saudi populations in Qatif and Al-Hasa are atrisk for hemoglobinopathies and G6PD. Neonatal screening programs areessential and cost effective and should be maintained as a routine practice.(author)

  15. Incidental splenic nodules found on MR imaging done for assessment of iron overload in children

    International Nuclear Information System (INIS)

    Ahyad, Rayan A.; Lam, Christopher Z.; Navarro, Oscar M.; Shearkhani, Omid

    2017-01-01

    MR imaging is used to assess iron overload in patients with hemoglobinopathies and in those who have undergone multiple blood transfusions. Sometimes splenic nodules are found incidentally on these examinations and this may cause diagnostic uncertainty. To determine the prevalence, imaging characteristics and evolution of splenic nodules found on MR imaging for iron overload evaluation. Retrospective review of all MR imaging examinations performed for iron overload assessment from 2005 to 2015 in a tertiary pediatric hospital. The presence of focal splenic nodules including number, size, signal characteristics and changes on follow-up MR imaging were recorded. Relevant patient clinical information including underlying hematological disease was also documented. A total of 318 patients had MR imaging for iron overload assessment. Of these, 25 (8%) had at least one incidental splenic nodule. Sickle cell disease was present in 22 patients (88%) and thalassemia in 3 (12%). On intermediate-weighted spin-echo images, the nodules had high signal intensity compared to the remainder of the spleen in 23 patients (92%) and low signal intensity in the remaining 2 (8%). In all patients (100%) the nodules showed progressive loss of signal intensity with increasing echo time values. Follow-up MR imaging was performed in 20 (80%) patients, which showed an increase in the size of the splenic nodules in 7 patients (35%) stability in 11 (55%) and a decrease in size in 2 (10%). It is not uncommon to find splenic nodules during MR evaluation of iron overload. In patients with sickle cell disease, most of these nodules are thought to represent preserved splenic tissue and appear hyperintense compared to the remainder of the spleen. They frequently remain stable on follow-up imaging, although about a third of them may show growth. Awareness of these nodules is important to avoid concern for potential malignancy and unnecessary investigations. (orig.)

  16. Resting blood lactate in individuals with sickle cell disease

    Science.gov (United States)

    Petto, Jefferson; de Jesus, Jaqueline Brito; Vasques, Leila Monique Reis; Pinheiro, Renata Leão Silva; Oliveira, Aila Mascarenhas; Spinola, Kelly Aparecida Borges; Silva, Wellington dos Santos

    2011-01-01

    Background The most common hereditary hemoglobin disorder, affecting 20 million individuals worldwide, is sickle cell disease. The vascular obstruction resulting from the sickling of cells in this disease can produce local hypoxemia, pain crises and infarction in several tissues, including the bones, spleen, kidneys and lungs. Objective To determine red blood group genes in a Brazilian populations. Methods The present study is characterized as a case control study, with the aim of identifying the baseline blood lactate concentration in individuals with hemoglobin SS and SC diseases. One-way ANOVA with the Tukey post-test was used to analyze the results and a p-value < 0.05 was considered significant. Calculations were made using the INSTAT statistical program. The graphs were generated using the ORING program. The study sample was composed of 31 men and women residing in the city of Santo Antônio de Jesus, Bahia, Brazil. The individuals were divided into two groups: Group GC of 16 subjects who did not present with any type of structural hemoglobinopathy; and Group GE composed of 15 individuals with ages between 2 and 35 years old, who had the SS and SC genotypes. Sample analyses were performed with 3 mL of blood during fasting. Results The baseline blood lactate concentration of the SS and SC individuals was higher than that of the control group (p<0.001) with means of 4.86 ± 0.95; 3.30 ± 0.33; 1.31 ± 0.08 IU/L for SS, SC and controls, respectively. This corroborates the initial research hypothesis. Conclusion The baseline blood lactate of SS and SC individuals is 3 to 4 times higher than that of healthy subjects, probably due to the fact that these patients have a metabolic deviation to the anaerobic pathway. PMID:23284239

  17. [Splenic infarction at high altitude, Huaraz-Peru (3,100 masl)].

    Science.gov (United States)

    López de Guimaraes, Douglas; Menacho López, Julio; Villanueva Palacios, Jovita; Mosquera Vásquez, Vitaliano

    2009-01-01

    We report three cases of splenic infarction in healthy men for the first time that amounted to high altitudes, observed in the hospital "Victor Ramos Guardia" Huaraz (3100 m). Case 1 (1995) of 55 years, born in Cuba, from Lima, caucasian suddenly presented acute abdominal pain in epigastrium, distension, nausea and vomiting, was laparotomized for acute abdomen and surgical pathology revealed thrombosis with splenic infarction splenic artery and vein. During follow-up in Lima, hemoglobin electrophoresis showed that it was heterozygous carrier of the sickle trait (Hb A: 57% Hb S: 38.5%). Case 2 (1998) of 23 years, born in Cuba, from Lima, Black said acute abdominal pain in left hypochondrium, shortness of breath and chest pain, clinical examination and radiography of the abdomen showed the spleen volume increased. Case 3 (2006) of 17 years, natural and from Lima, mestizo, who came on tour promotion, acute abdominal pain referred onset in the epigastrium and left hypochondrium, headache, increase heat, nausea and vomiting, pharyngitis was found acute and painful, and spleen increased in size by clinical and x-ray of abdomen simple stand. None had no history of hemoglobinopathy and anemia. In general, medical management was supportive and cases 2 and 3 are recommended hemoglobin electrophoresis. We conclude that we must think of splenic infarction associated with height in any healthy person who is first at high altitude (> 3000m) and having a sudden acute abdominal pain in epigastrium and / or left hypochondrium, pain and palpable spleen and radiological study compatible with image. In this case is indicated by hemoglobin electrophoresis to determine whether there is an individual heterozygous carrier of the sickle trait. splenic infarction, high altitude, sickle trait, Huaraz.

  18. Role of Breastfeeding and Complementary Food on Hemoglobin and Ferritin Levels in a Cambodian Cross-Sectional Sample of Children Aged 3 to 24 Months.

    Directory of Open Access Journals (Sweden)

    Anika Reinbott

    Full Text Available Iron deficiency derives from a low intake of dietary iron, poor absorption of iron, and high requirements due to growth as well as blood loss. An estimated number of about 50% of all anemia may be attributed to iron deficiency among young children in Cambodia.A cross-sectional survey was conducted in rural Cambodia in September 2012. Villages in pre-selected communes were randomly chosen using stunting as a primary indicator of nutritional status. In total, 928 randomly selected households with children aged 3-23 months were included. Hemoglobin, ferritin, soluble transferrin receptor (sTfR, and retinol binding protein (RBP were assessed from capillary blood samples. In addition, length/height and weight of mothers and children were taken and data on dietary diversity was collected. A child feeding index (CFI was created. Associations between biomarkers of iron and vitamin A status and nutritional status or food intake were explored.Anemia prevalence was highest among 6- to 12-months-olds (71%. Ferritin and sTfR inversely correlated and were significantly associated with hemoglobin concentrations. The consumption of animal source foods (ASF significantly impacts on the interaction between ferritin, sTfR and hemoglobin. Concentrations of RBP were significantly higher in children who had received a vitamin A supplement. The CFI was associated with sTfR and hemoglobin. Lower length and weight were associated with lower ferritin levels and showed an indirect effect on hemoglobin through ferritin.Nutrition programs targeting children under 2 years of age need to focus on the preparation of complementary foods with high nutrient density to sustainably prevent micronutrient deficiency and generally improve nutritional status. Future assessments of the micronutrient status should include identification of hemoglobinopathies and parasitic infections to better understand all causes of anemia in Cambodian infants and young children.German Clinical Trials

  19. Systematic documentation and analysis of human genetic variation using the microattribution approach

    Science.gov (United States)

    Giardine, Belinda; Borg, Joseph; Higgs, Douglas R.; Peterson, Kenneth R.; Maglott, Donna; Basak, A. Nazli; Clark, Barnaby; Faustino, Paula; Felice, Alex E.; Francina, Alain; Gallivan, Monica V. E.; Georgitsi, Marianthi; Gibbons, Richard J.; Giordano, Piero C.; Harteveld, Cornelis L.; Joly, Philippe; Kanavakis, Emmanuel; Kollia, Panagoula; Menzel, Stephan; Miller, Webb; Moradkhani, Kamran; Old, John; Papachatzopoulou, Adamantia; Papadakis, Manoussos N.; Papadopoulos, Petros; Pavlovic, Sonja; Philipsen, Sjaak; Radmilovic, Milena; Riemer, Cathy; Schrijver, Iris; Stojiljkovic, Maja; Thein, Swee Lay; Traeger-Synodinos, Jan; Tully, Ray; Wada, Takahito; Waye, John; Wiemann, Claudia; Zukic, Branka; Chui, David H. K.; Wajcman, Henri; Hardison, Ross C.; Patrinos, George P.

    2013-01-01

    We developed a series of interrelated locus-specific databases to store all published and unpublished genetic variation related to these disorders, and then implemented microattribution to encourage submission of unpublished observations of genetic variation to these public repositories 1. A total of 1,941 unique genetic variants in 37 genes, encoding globins (HBA2, HBA1, HBG2, HBG1, HBD, HBB) and other erythroid proteins (ALOX5AP, AQP9, ARG2, ASS1, ATRX, BCL11A, CNTNAP2, CSNK2A1, EPAS1, ERCC2, FLT1, GATA1, GPM6B, HAO2, HBS1L, KDR, KL, KLF1, MAP2K1, MAP3K5, MAP3K7, MYB, NOS1, NOS2, NOS3, NOX3, NUP133, PDE7B, SMAD3, SMAD6, and TOX) are currently documented in these databases with reciprocal attribution of microcitations to data contributors. Our project provides the first example of implementing microattribution to incentivise submission of all known genetic variation in a defined system. It has demonstrably increased the reporting of human variants and now provides a comprehensive online resource for systematically describing human genetic variation in the globin genes and other genes contributing to hemoglobinopathies and thalassemias. The large repository of previously reported data, together with more recent data, acquired by microattribution, demonstrates how the comprehensive documentation of human variation will provide key insights into normal biological processes and how these are perturbed in human genetic disease. Using the microattribution process set out here, datasets which took decades to accumulate for the globin genes could be assembled rapidly for other genes and disease systems. The principles established here for the globin gene system will serve as a model for other systems and the analysis of other common and/or complex human genetic diseases. PMID:21423179

  20. Determination of Mean Glycated Haemoglobin in Healthy Adults of a Local Population.

    Science.gov (United States)

    Nida, Sumbal; Khan, Dilshad Ahmed; Ijaz, Aamir; Khan, Muhammad Qaiser Alam; Aleef, Hira; Abbasi, Maria

    2017-07-01

    To determine the mean hemoglobin HbA1C levels of disease-free adults in a local population and its optimum cutoff for the diagnosis of diabetes. Cross-sectional study. Department of Chemical Pathology and Endocrinology, Armed Forces Institute of Pathology, Rawalpindi, from January to September 2015. Healthy subjects aged 18 years and above of either gender were recruited from local population. Pregnant ladies and individuals with known diabetes, chronic kidney disease, chronic liver disease, congestive cardiac failure, anemia, hemoglobinopathies, mental illness and individuals on glucocorticoid therapy were excluded. Fasting plasma glucose (FPG) or 2-hour plasma glucose (2-h PG) was analyzed using hexokinase methodology and glycated hemoglobin (Hb A1C) was also analyzed using turbidimetric inhibition immunoassay technique. Receiver operating characteristic (ROC) curves were plotted. Differences among the groups were tested by one-way ANOVA, and p <0.05 was considered statistically significant. Among 558 subjects, 88.8% (496) were normoglycaemic (NG), 5.7% (32) were with impaired glucose fasting (IFG), and 5.4% (30) were diagnosed with diabetes mellitus (DM). A1C was 5.00 ±0.44% in NG and 6.28 ±1.16% in diabetics. FPG in NG was 4.55 ±0.95 mmol/Land in diabetics was 8.28 ±1.78 mmol/L. The optimal HbA1C cutoff value for diagnosis of DM was at 6.05% (AUC 0.827 95% CI 0.732 to 0.923, p ≤0.05 with its sensitivity of 53.3% and specificity of 98.5%. However, HbA1C showed suboptimal sensitivity and specificity for prediabetes. The mean HbAIC and cutoff point for diabetes in the study population is 5.07 ±0.58% and 6.05%, respectively (AUC 0.827, 95% CI: 0.732 to 0.923, p<0.001) with 53.3% sensitivity and 98.5% specificity.

  1. Nutritional and Micronutrient Status of Female Workers in a Garment Factory in Cambodia

    Directory of Open Access Journals (Sweden)

    Jan Makurat

    2016-11-01

    Full Text Available Background: Concerns about the nutritional status of Cambodian garment workers were raised years ago but data are still scarce. The objectives of this study are to examine the nutritional, hemoglobin and micronutrient status of female workers in a garment factory in Phnom Penh, Cambodia, and to assess if body mass index is associated with hemoglobin and/or micronutrient status. Methods: A cross-sectional survey was conducted among 223 female workers (nulliparous, non-pregnant at a garment factory in Phnom Penh. Anthropometric measurements were performed and blood samples were taken to obtain results on hemoglobin, iron, vitamin A, vitamin B12 and inflammation status (hemoglobinopathies not determined. Bivariate correlations were used to assess associations. Results: Overall, 31.4% of workers were underweight, 26.9% showed anemia, 22.1% showed iron deficiency, while 46.5% had marginal iron stores. No evidence of vitamin A or vitamin B12 deficiency was found. Body mass index was associated with serum ferritin (negative and serum retinol-binding protein (positive concentrations, but not strongly. A comparison between underweight and not underweight workers resulted in distinctions for iron deficiency and iron deficiency anemia, with a higher prevalence among not underweight. Conclusions: The prevalence of underweight, anemia and poor iron status was high. Young and nulliparous female garment workers in Cambodia might constitute a group with elevated risk for nutritional deficiencies. Strategies need to be developed for improving their nutritional, micronutrient and health status. The poor iron status seems to contribute to the overall prevalence of anemia. Low hemoglobin and iron deficiency affected both underweight and those not underweight. Despite the fact that body mass index was negatively associated with iron stores, true differences in iron status between underweight and not underweight participants cannot be confirmed.

  2. Phase 1 Study of a Sulforaphane-Containing Broccoli Sprout Homogenate for Sickle Cell Disease.

    Directory of Open Access Journals (Sweden)

    Jennifer F Doss

    Full Text Available Sickle cell disease (SCD is the most common inherited hemoglobinopathy worldwide. Our previous results indicate that the reduced oxidative stress capacity of sickle erythrocytes may be caused by decreased expression of NRF2 (Nuclear factor (erythroid-derived 2-like 2, an oxidative stress regulator. We found that activation of NRF2 with sulforaphane (SFN in erythroid progenitors significantly increased the expression of NRF2 targets HMOX1, NQO1, and HBG1 (subunit of fetal hemoglobin in a dose-dependent manner. Therefore, we hypothesized that NRF2 activation with SFN may offer therapeutic benefits for SCD patients by restoring oxidative capacity and increasing fetal hemoglobin concentration. To test this hypothesis, we performed a Phase 1, open-label, dose-escalation study of SFN, contained in a broccoli sprout homogenate (BSH that naturally contains SFN, in adults with SCD. The primary and secondary study endpoints were safety and physiological response to NRF2 activation, respectively. We found that BSH was well tolerated, and the few adverse events that occurred during the trial were not likely related to BSH consumption. We observed an increase in the mean relative whole blood mRNA levels for the NRF2 target HMOX1 (p = 0.02 on the last day of BSH treatment, compared to pre-treatment. We also observed a trend toward increased mean relative mRNA levels of the NRF2 target HBG1 (p = 0.10 from baseline to end of treatment, but without significant changes in HbF protein. We conclude that BSH, in the provided doses, is safe in stable SCD patients and may induce changes in gene expression levels. We therefore propose investigation of more potent NRF2 inducers, which may elicit more robust physiological changes and offer clinical benefits to SCD patients. Trial registration: ClinicalTrials.gov NCT01715480.

  3. Incidental splenic nodules found on MR imaging done for assessment of iron overload in children

    Energy Technology Data Exchange (ETDEWEB)

    Ahyad, Rayan A.; Lam, Christopher Z.; Navarro, Oscar M. [University of Toronto, Department of Medical Imaging, Toronto, ON (Canada); The Hospital for Sick Children, Department of Diagnostic Imaging, Toronto, ON (Canada); Shearkhani, Omid [The Hospital for Sick Children, Department of Diagnostic Imaging, Toronto, ON (Canada)

    2017-06-15

    MR imaging is used to assess iron overload in patients with hemoglobinopathies and in those who have undergone multiple blood transfusions. Sometimes splenic nodules are found incidentally on these examinations and this may cause diagnostic uncertainty. To determine the prevalence, imaging characteristics and evolution of splenic nodules found on MR imaging for iron overload evaluation. Retrospective review of all MR imaging examinations performed for iron overload assessment from 2005 to 2015 in a tertiary pediatric hospital. The presence of focal splenic nodules including number, size, signal characteristics and changes on follow-up MR imaging were recorded. Relevant patient clinical information including underlying hematological disease was also documented. A total of 318 patients had MR imaging for iron overload assessment. Of these, 25 (8%) had at least one incidental splenic nodule. Sickle cell disease was present in 22 patients (88%) and thalassemia in 3 (12%). On intermediate-weighted spin-echo images, the nodules had high signal intensity compared to the remainder of the spleen in 23 patients (92%) and low signal intensity in the remaining 2 (8%). In all patients (100%) the nodules showed progressive loss of signal intensity with increasing echo time values. Follow-up MR imaging was performed in 20 (80%) patients, which showed an increase in the size of the splenic nodules in 7 patients (35%) stability in 11 (55%) and a decrease in size in 2 (10%). It is not uncommon to find splenic nodules during MR evaluation of iron overload. In patients with sickle cell disease, most of these nodules are thought to represent preserved splenic tissue and appear hyperintense compared to the remainder of the spleen. They frequently remain stable on follow-up imaging, although about a third of them may show growth. Awareness of these nodules is important to avoid concern for potential malignancy and unnecessary investigations. (orig.)

  4. Anemia, Micronutrient Deficiencies, and Malaria in Children and Women in Sierra Leone Prior to the Ebola Outbreak - Findings of a Cross-Sectional Study

    Science.gov (United States)

    Wirth, James P; Rohner, Fabian; Woodruff, Bradley A; Chiwile, Faraja; Yankson, Hannah; Koroma, Aminata S; Russel, Feimata; Sesay, Fatmata; Dominguez, Elisa; Petry, Nicolai; Shahab-Ferdows, Setareh; de Onis, Mercedes; Hodges, Mary H

    2016-01-01

    To identify the factors associated with anemia and to document the severity of micronutrient deficiencies, malaria and inflammation, a nationally representative cross-sectional survey was conducted. A three-stage sampling procedure was used to randomly select children anemia (76.3%; 95% CI: 71.8, 80.4), malaria (52.6%; 95% CI: 46.0, 59.0), and acute and chronic inflammation (72.6%; 95% CI: 67.5, 77.1) were high. However, the prevalence of vitamin A deficiency (17.4%; 95% CI: 13.9, 21.6) was moderate, and the prevalence of iron deficiency (5.2%; 95% CI: 3.3, 8.1) and iron-deficiency anemia (3.8%; 95% CI: 2.5, 5.8) were low. Malaria and inflammation were associated with anemia, yet they explained only 25% of the population-attributable risk. In women, 44.8% (95% CI: 40.1, 49.5), 35.1% (95% CI: 30.1, 40.4), and 23.6% (95% CI: 20.4, 27.3) were affected by anemia, malaria, or inflammation, respectively. The prevalence rates of iron deficiency (8.3%; 95% CI: 6.2, 11.1), iron-deficiency anemia (6.1%; 95% CI: 4.4, 8.6), vitamin A deficiency (2.1%; 95% CI: 1.1, 3.1) and vitamin B12 deficiency (0.5%; 95% CI: 0.2, 1.4) were low, while folate deficiency was high (79.2%; 95% CI: 74.1, 83.5). Iron deficiency, malaria, and inflammation were significantly associated with anemia, but explained only 25% of cases of anemia. Anemia in children and women is a severe public health problem in Sierra Leone. Since malaria and inflammation only contributed to 25% of anemia, other causes of anemia, such as hemoglobinopathies, should also be explored. PMID:27163254

  5. Establishing an autologous versus allogeneic hematopoietic cell transplant program in nations with emerging economies.

    Science.gov (United States)

    Chaudhri, Naeem A; Aljurf, Mahmoud; Almohareb, Fahad I; Alzahrani, Hazzaa A; Bashir, Qaiser; Savani, Bipin; Gupta, Vikas; Hashmi, Shahrukh K

    2017-12-01

    More than 70,000 hematopoietic cell transplants are currently performed each year, and these continue to increase every year. However, there is a significant variation in the number of absolute transplants and transplant rates between centers, countries, and global regions. The prospect for emerging countries to develop a hematopoietic cell transplantation (HCT) program, as well as to decide on whether autologous HCT (auto-HCT) or allogeneic HCT (allo-HCT) should be established to start with, relies heavily on factors that can explain differences between these two procedures. Major factors that will influence a decision about establishing the type of HCT program are macroeconomic factors such as organization of the healthcare network, available resources and infrastructure. Prevalence of specific diseases in the region as well genetic background of donors and recipients will also influence the mandate or priority of the HCT in the national healthcare plan to explain some of the country-specific differences. Furthermore, microeconomic factors play a role, such as center-specific experience in treating various disorders requiring hematopoietic stem cell transplantation, along with accreditation status and patient volume. The objective of the transplant procedure was to improve the survival and quality of life of patients. The regional difference that one notices in emerging countries about the higher number of allo-HCT compared with auto-HCT procedures performed is primarily based on suboptimal healthcare network in treating various malignant disorders that are the primary indication for auto-stem cell transplantation. In this context, nonmalignant disorders such as bone marrow failure syndromes, inherited genetic disorders and hemoglobinopathies have become the major indication for stem cell transplantation. Better understanding of these factors will assist in establishing new transplant centers in the emerging countries to achieve their specific objectives and

  6. Priapism in Sickle Cell Disease: A Hematologist’s Perspective

    Science.gov (United States)

    Kato, Gregory J.

    2011-01-01

    Introduction Priapism is a familiar problem to hematologists, well known for its association with sickle cell disease. It also occurs in a variety of other hematological illnesses, nearly all forms of congenital hemolytic anemia, including other hemoglobinopathies and red blood cell membranopathies and enzymopathies. Aim Provide urologists with a comprehensive review of priapism in sickle cell disease, with an emphasis on the perspective of a practicing hematologist. Methods Medline searches through July 2010 were conducted using the terms priapism, erectile dysfunction, and sickle cell. Main Outcome Measure Expert opinion was based on review of the medical literature related to this subject matter. Results In men with sickle cell disease, large epidemiological studies have linked the risk of priapism to clinical markers of the severity of intravascular hemolysis. Extracellular hemoglobin and arginase released during hemolysis has been implicated in reducing nitric oxide bioavailability, although the relevance of hemolysis to vascular dysfunction has been challenged by some scientists. Consistent with the role of impairment of the nitric oxide axis, mice genetically deficient in nitric oxide production have also been shown to develop priapic activity. Provocative new data indicates that hemolysis-linked dysregulation of adenosine signaling in the penis contributes to priapism in sickle cell mice. Serious questions have arisen regarding the efficacy of mainstays of textbook dogma for treatment of acute severe priapism, including intravenous fluids, alkalinization and exchange transfusion, and there is increasing acceptance for early aspiration and irrigation of the corpus cavernosum. Conclusions For sickle cell patients with recurrent priapism, there is very limited evidence for a medical prophylaxis role for hydroxyurea, etilefrine, pseudoephedrine, leuprolide, sildenafil, and other agents. Recent publications have highlighted nitric oxide and adenosine signal

  7. Post-translational transformation of methionine to aspartate is catalyzed by heme iron and driven by peroxide: a novel subunit-specific mechanism in hemoglobin.

    Science.gov (United States)

    Strader, Michael Brad; Hicks, Wayne A; Kassa, Tigist; Singleton, Eileen; Soman, Jayashree; Olson, John S; Weiss, Mitchell J; Mollan, Todd L; Wilson, Michael T; Alayash, Abdu I

    2014-08-08

    A pathogenic V67M mutation occurs at the E11 helical position within the heme pockets of variant human fetal and adult hemoglobins (Hb). Subsequent post-translational modification of Met to Asp was reported in γ subunits of human fetal Hb Toms River (γ67(E11)Val → Met) and β subunits of adult Hb (HbA) Bristol-Alesha (β67(E11)Val → Met) that were associated with hemolytic anemia. Using kinetic, proteomic, and crystal structural analysis, we were able to show that the Met → Asp transformation involves heme cycling through its oxoferryl state in the recombinant versions of both proteins. The conversion to Met and Asp enhanced the spontaneous autoxidation of the mutants relative to wild-type HbA and human fetal Hb, and the levels of Asp were elevated with increasing levels of hydrogen peroxide (H2O2). Using H2(18)O2, we verified incorporation of (18)O into the Asp carboxyl side chain confirming the role of H2O2 in the oxidation of the Met side chain. Under similar experimental conditions, there was no conversion to Asp at the αMet(E11) position in the corresponding HbA Evans (α62(E11)Val → Met). The crystal structures of the three recombinant Met(E11) mutants revealed similar thioether side chain orientations. However, as in the solution experiments, autoxidation of the Hb mutant crystals leads to electron density maps indicative of Asp(E11) formation in β subunits but not in α subunits. This novel post-translational modification highlights the nonequivalence of human Hb α, β, and γ subunits with respect to redox reactivity and may have direct implications to α/β hemoglobinopathies and design of oxidatively stable Hb-based oxygen therapeutics. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Cord Blood Banking for Potential Future Transplantation.

    Science.gov (United States)

    Shearer, William T; Lubin, Bertram H; Cairo, Mitchell S; Notarangelo, Luigi D

    2017-11-01

    This policy statement is intended to provide information to guide pediatricians, obstetricians, and other medical specialists and health care providers in responding to parents' questions about cord blood donation and banking as well as the types (public versus private) and quality of cord blood banks. Cord blood is an excellent source of stem cells for hematopoietic stem cell transplantation in children with some fatal diseases. Cord blood transplantation offers another method of definitive therapy for infants, children, and adults with certain hematologic malignancies, hemoglobinopathies, severe forms of T-lymphocyte and other immunodeficiencies, and metabolic diseases. The development of universal screening for severe immunodeficiency assay in a growing number of states is likely to increase the number of cord blood transplants. Both public and private cord blood banks worldwide hold hundreds of thousands of cord blood units designated for the treatment of fatal or debilitating illnesses. The procurement, characterization, and cryopreservation of cord blood is free for families who choose public banking. However, the family cost for private banking is significant and not covered by insurance, and the unit may never be used. Quality-assessment reviews by several national and international accrediting bodies show private cord blood banks to be underused for treatment, less regulated for quality control, and more expensive for the family than public cord blood banks. There is an unquestionable need to study the use of cord blood banking to make new and important alternative means of reconstituting the hematopoietic blood system in patients with malignancies and blood disorders and possibly regenerating tissue systems in the future. Recommendations regarding appropriate ethical and operational standards (including informed consent policies, financial disclosures, and conflict-of-interest policies) are provided for physicians, institutions, and organizations that

  9. Next-generation sequencing-based molecular diagnosis of chronic non-spherocytic hemolysis in erythrocytic enzymopathies

    Directory of Open Access Journals (Sweden)

    Manu Jamwal

    2017-10-01

    Full Text Available Mutations in genes encoding red blood cell enzymes are often inherited in an autosomal recessive manner and can lead to chronic nonspherocytic hemolytic anemia (CNSHA in homozygotes and compound heterozygotes. Usual clinical manifestations include jaundice, cholelithiasis and splenomegaly with normocytic normochromic hemolysis. Phenotypes range from fully-compensated hemolysis (without anemia to transfusion-dependent states. Definitive diagnosis requires biochemical testing of enzyme levels, which for rarer enzymes are often difficult and not easily available. Molecular diagnosis using a gene-by-gene approach is expensive, time-consuming and cumbersome. Targeted resequencing can expedite the molecular diagnosis in cases where the hemolysis remains unexplained after routine laboratory tests. Ten patients with clinical and laboratory evidence suggestive of hemolytic anemia, but negative family history, were enrolled. Various biochemical and molecular tests were used to exclude glucose-6-phosphate dehydrogenase (G6PD deficiency, thalassemias, hemoglobinopathies, autoimmune hemolysis, hereditary spherocytosis and pyruvate kinase (PKLR deficiency. Common G6PD and PKLR variants were excluded by molecular tests. DNA Libraries were prepared using TruSight One™ panel and sequenced on MiSeq™ Sequencing System. MiSeq Reporter™ and VariantStudio™ v2.1 were used for analysis, classification, and reporting of genomic variants reporting genomic variants. All 10 patients’ diagnoses were resolved by targeted resequencing: two had G6PD deficiency, two had glucose-6-phosphate isomerase (GPI deficiency and six unexpectedly had pyruvate kinase deficiency despite pyruvate kinase enzyme activity assays previously being normal in all. All the mutations were predicted deleterious by PolyPhen, SIFT, Provean, mutpred and Mutationtaster software. The mutations were validated in parents and/or siblings (where available to establish the mode of inheritance. Our

  10. Impact of Multi-Micronutrient Fortified Rice on Hemoglobin, Iron and Vitamin A Status of Cambodian Schoolchildren: a Double-Blind Cluster-Randomized Controlled Trial

    Directory of Open Access Journals (Sweden)

    Marlène Perignon

    2016-01-01

    Full Text Available In Cambodia, micronutrient deficiencies remain a critical public health problem. Our objective was to evaluate the impact of multi-micronutrient fortified rice (MMFR formulations, distributed through a World Food Program school-meals program (WFP-SMP, on the hemoglobin concentrations and iron and vitamin A (VA status of Cambodian schoolchildren. The FORISCA-UltraRice+NutriRice study was a double-blind, cluster-randomized, placebo-controlled trial. Sixteen schools participating in WFP-SMP were randomly assigned to receive extrusion-fortified rice (UltraRice Original, UltraRice New (URN, or NutriRice or unfortified rice (placebo six days a week for six months. Four additional schools not participating in WFP-SMP were randomly selected as controls. A total of 2440 schoolchildren (6–16 years old participated in the biochemical study. Hemoglobin, iron status, estimated using inflammation-adjusted ferritin and transferrin receptors concentrations, and VA status, assessed using inflammation-adjusted retinol-binding protein concentration, were measured at the baseline, as well as at three and six months. Baseline prevalence of anemia, depleted iron stores, tissue iron deficiency, marginal VA status and VA deficiency were 15.6%, 1.4%, 51.0%, 7.9%, and 0.7%, respectively. The strongest risk factors for anemia were hemoglobinopathy, VA deficiency, and depleted iron stores (all p < 0.01. After six months, children receiving NutriRice and URN had 4 and 5 times less risk of low VA status, respectively, in comparison to the placebo group. Hemoglobin significantly increased (+0.8 g/L after three months for the URN group in comparison to the placebo group; however, this difference was no longer significant after six months, except for children without inflammation. MMFR containing VA effectively improved the VA status of schoolchildren. The impact on hemoglobin and iron status was limited, partly by sub-clinical inflammation. MMFR combined with non

  11. Determination of Mean Glycated Haemoglobin in Healthy Adults of a Local Population

    International Nuclear Information System (INIS)

    Nida, S.; Ijaz, A.; Aleef, H.; Khan, D. A.; Khan, M. Q. A.; Abbasi, M.

    2017-01-01

    Objective: To determine the mean hemoglobin HbA1C levels of disease-free adults in a local population and its optimum cutoff for the diagnosis of diabetes. Study Design: Cross-sectional study. Place and Duration of Study: Department of Chemical Pathology and Endocrinology, Armed Forces Institute of Pathology, Rawalpindi, from January to September 2015. Methodology: Healthy subjects aged 18 years and above of either gender were recruited from local population. Pregnant ladies and individuals with known diabetes, chronic kidney disease, chronic liver disease, congestive cardiac failure, anemia, hemoglobinopathies, mental illness and individuals on glucocorticoid therapy were excluded. Fasting plasma glucose (FPG) or 2-hour plasma glucose (2-h PG) was analyzed using hexokinase methodology and glycated hemoglobin (Hb A1C) was also analyzed using turbidimetric inhibition immunoassay technique. Receiver operating characteristic (ROC) curves were plotted. Differences among the groups were tested by one-way ANOVA, and p <0.05 was considered statistically significant. Results: Among 558 subjects, 88.8% (496) were normoglycaemic (NG), 5.7% (32) were with impaired glucose fasting (IFG), and 5.4% (30) were diagnosed with diabetes mellitus (DM). A1C was 5.00 0.44% in NG and 6.28 +-1.16% in diabetics. FPG in NG was 4.55 +-0.95 mmol/L and in diabetics was 8.28 1.78 mmol/L. The optimal HbA1C cutoff value for diagnosis of DM was at 6.05% (AUC 0.827 95% CI 0.732 to 0.923, p <=0.05 with its sensitivity of 53.3% and specificity of 98.5%. However, HbA1C showed suboptimal sensitivity and specificity for prediabetes. Conclusion: The mean HbAIC and cutoff point for diabetes in the study population is 5.07 +-0.58% and 6.05%, respectively (AUC 0.827, 95% CI: 0.732 to 0.923, p<0.001) with 53.3% sensitivity and 98.5% specificity. (author)

  12. The clinical impact of MTHFR polymorphism on the vascular complications of sickle cell disease

    Directory of Open Access Journals (Sweden)

    F. Moreira Neto

    2006-10-01

    Full Text Available Sickle cell disease (SCD is one of the most common inherited diseases in the world and the patients present notorious clinical heterogeneity. It is known that patients with SCD present activation of the blood coagulation and fibrinolytic systems, especially during vaso-occlusive crises, but also during the steady state of the disease. We determined if the presence of the factor V gene G1691A mutation (factor V Leiden, the prothrombin gene G20210A variant, and methylenetetrahydrofolate reductase (MTHFR C677T polymorphism may be risk factors for vascular complications in individuals with SCD. We studied 53 patients with SCD (60% being women, 29 with SS (sickle cell anemia; 28 years, range: 13-52 years and 24 with SC (sickle-hemoglobin C disease; 38.5 years, range: 17-72 years hemoglobinopathy. Factor V Leiden, MTHFR C677T polymorphism, and prothrombin G20210A variant were identified by PCR followed by further digestion of the PCR product with specific endonucleases. The following vascular complications were recorded: stroke, retinopathy, acute thoracic syndrome, and X-ray-documented avascular necrosis. Only one patient was heterozygous for factor V Leiden (1.8% and there was no prothrombin G20210A variant. MTHFR 677TT polymorphism was detected in 1 patient (1.8% and the heterozygous form 677TC was observed in 18 patients (34%, 9 with SS and 9 with SC disease, a prevalence similar to that reported by others. No association was detected between the presence of the MTHFR 677T allele and other genetic modulation factors, such as alpha-thalassemia, ß-globin gene haplotype and fetal hemoglobin. The presence of the MTHFR 677T allele was associated with the occurrence of vascular complications in SCD, although this association was not significant when each complication was considered separately. In conclusion, MTHFR C677T polymorphism might be a risk factor for vascular complications in SCD.

  13. Birth control necessary to limit family size in tribal couples with aberrant heterosis of G-6-PD deficiency and sickle cell disorders in India: an urgency of creating awareness and imparting genetic counseling.

    Science.gov (United States)

    Balgir, R S

    2010-06-01

    (i) To study the outcome of ignorance and lack of awareness about sickle cell disease and G-6-PD deficiency among Dhelki Kharia tribal families of Orissa, and (ii) to study the reproductive output in relation to clinical genetics and patho-physiological implications. A random genetic study of screening for hemoglobinopathies and G-6-PD deficiency among Dhelki Kharia tribal community in Sundargarh district of Orissa was carried out for intervention during the year 2000-2004. A total of 81 Dhelki Kharia families were screened and six families with double heterozygosity for above genetic anomalies were encountered. About 2-3 ml. intravenous blood samples were collected in EDTA by disposable syringes and needles after taking informed consent from each individual in the presence of a doctor and community leaders and sent to laboratory at Bhubaneswar for hematological investigations. Analysis was carried out following the standard procedures after cross checking for quality control. There were 12 (about 52%) children out of 23 who were either suffering from sickle cell trait or disease in concurrence with G-6-PD deficiency in hemizygous/heterozygous/homozygous condition in Dhelki Kharia tribal community of Orissa. There were on an average 3.83 number of surviving (range 2-6) children per mother in families of G-6-PD deficiency and sickle cell disorders. The average number of children (3.83) born (range 2-6 children) per mother to carrier/affected mother was much higher than the average for India (2.73). It is very difficult to maintain the normal health of an affected child with aberrant anomalies due to exorbitant cost of treatment, frequent transfusions and huge involvement of economy. One of the implications of aberrant heterosis is its adverse affects on routine individual physiology and hard activities. It is suggested to limit the family size in carrier couples to avoid aberrant heterosis of hereditary hemolytic disorders in their offsprings.

  14. Characterization of transcription factor networks involved in umbilical cord blood CD34+ stem cells-derived erythropoiesis.

    Directory of Open Access Journals (Sweden)

    Biaoru Li

    Full Text Available Fetal stem cells isolated from umbilical cord blood (UCB possess a great capacity for proliferation and differentiation and serve as a valuable model system to study gene regulation. Expanded knowledge of the molecular control of hemoglobin synthesis will provide a basis for rational design of therapies for β-hemoglobinopathies. Transcriptome data are available for erythroid progenitors derived from adult stem cells, however studies to define molecular mechanisms controlling globin gene regulation during fetal erythropoiesis are limited. Here, we utilize UCB-CD34+ stem cells induced to undergo erythroid differentiation to characterize the transcriptome and transcription factor networks (TFNs associated with the γ/β-globin switch during fetal erythropoiesis. UCB-CD34+ stem cells grown in the one-phase liquid culture system displayed a higher proliferative capacity than adult CD34+ stem cells. The γ/β-globin switch was observed after day 42 during fetal erythropoiesis in contrast to adult progenitors where the switch occurred around day 21. To gain insights into transcription factors involved in globin gene regulation, microarray analysis was performed on RNA isolated from UCB-CD34+ cell-derived erythroid progenitors harvested on day 21, 42, 49 and 56 using the HumanHT-12 Expression BeadChip. After data normalization, Gene Set Enrichment Analysis identified transcription factors (TFs with significant changes in expression during the γ/β-globin switch. Forty-five TFs were silenced by day 56 (Profile-1 and 30 TFs were activated by day 56 (Profile-2. Both GSEA datasets were analyzed using the MIMI Cytoscape platform, which discovered TFNs centered on KLF4 and GATA2 (Profile-1 and KLF1 and GATA1 for Profile-2 genes. Subsequent shRNA studies in KU812 leukemia cells and human erythroid progenitors generated from UCB-CD34+ cells supported a negative role of MAFB in γ-globin regulation. The characteristics of erythroblasts derived from UCB-CD34

  15. Whole transcriptome analysis of human erythropoietic cells during ontogenesis suggests a role of VEGFA gene as modulator of fetal hemoglobin and pharmacogenomic biomarker of treatment response to hydroxyurea in β-type hemoglobinopathy patients

    DEFF Research Database (Denmark)

    Chondrou, Vasiliki; Kolovos, Petros; Sgourou, Argyro

    2017-01-01

    from whole transcriptome analysis of erythroid cells, isolated from erythroid tissues at various developmental stages in an effort to identify distinct molecular signatures of each erythroid tissue. Results: From our in-depth data analysis, pathway analysis, and text mining, we opted to focus...

  16. Programa de Triagem Neonatal do Hospital das Clínicas da Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Brasil Neonatal Screening Program at the University Hospital of the Ribeirao Preto School of Medicine, São Paulo University, Brazil

    Directory of Open Access Journals (Sweden)

    Patrícia Künzle Ribeiro Magalhães

    2009-02-01

    Full Text Available O Programa de Triagem Neonatal do Hospital das Clínicas da Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Brasil, instituído em 1994 diagnosticou, até 2005, 76 crianças com hipotireoidismo congênito, 10 com fenilcetonúria e 25 com hemoglobinopatias, o que representou uma incidência de 1:2.595, 1:19.409, 1:4.120, respectivamente. Foram diagnosticadas 2.747 crianças com traço falciforme (1:37,5 nascidos vivos. A cobertura média do programa foi de 94,5%. Houve uma considerável melhora nos parâmetros de avaliação da qualidade do programa no período, porém, sem atingir os índices ideais. Campanhas visando à maior divulgação da importância da triagem neonatal são necessárias para aumentar a cobertura e a instituição do 3º dia de vida do recém-nascido como sendo o Dia do Teste do Pezinho poderia contribuir para que idades mais precoces de tratamento fossem atingidas, melhorando o prognóstico das crianças acometidas.The Neonatal Screening Program at the University Hospital of the Ribeirao Preto School of Medicine, São Paulo University, Brazil, was introduced in 1994. As of December 2005, congenital hypothyroidism had been diagnosed in 76 infants, phenylketonuria in 10, and hemoglobinopathies in 25, representing incidence rates of 1:2,595, 1:19,409, and 1:4,120, respectively. A total of 2,747 newborns had the sickle cell trait, i.e., were heterozygous for the sickle mutation (1:37.5 live births. The program's mean coverage during this period was 94.5%. There was major improvement in the parameters for evaluating the program's quality, although they were still far from ideal. Public-awareness campaigns on the importance of neonatal screening are needed to increase the program's coverage. Setting postnatal day 3 as the standard Day for the Heel Stick Test would help ensure treatment at earlier ages, thus improving prognosis for affected infants.

  17. Crecimiento y desarrollo en la drepanocitosis Growth and development in drepanocytosis

    Directory of Open Access Journals (Sweden)

    Pedro González Fernández

    2006-04-01

    Full Text Available La drepanocitosis (D es un grupo de anemias hemolíticas congénitas que incluye: la anemia drepanocítica (SS: 60 % la hemoglobinopatía (SC: 30 % y la S/ß talasemia: 10 %. Son las anemias hemolíticas más frecuentes en el mundo. En Cuba, la incidencia del estado de portador es de 13,2 en negros, 4,1 en mestizos y 0,6 en blancos. En la población general alcanza el 3,08. La afectación del crecimiento y desarrollo en estos pacientes ha sido un tópico muy debatido, y se consideran como posibles causas relacionadas con esta alteración las disfunciones hormonales, las deficiencias nutricionales, los factores socioeconómicos y los trastornos del sistema osteoarticular. Se realiza una revisión sobre estos aspectos en la literatura nacional y extranjera. Se concluye que la deficiencia en el crecimiento parece estar relacionada con la hipoxia tisular causada por la anemia severa, los efectos agudos y crónicos de la vasoclusión, la disfunción endocrina asociada con la anemia, el bajo ingreso dietético, los requerimientos energéticos elevados y el bajo estado socioeconómico.Drepanocytosis is a group of congenital hemolytic anemias that includes drepanocytic anemia (SS: 60.0, hemoglobinopathy (SC: 30.0 and S/ß thalassemia: 10.0. These are the most frequent hemolytic anemias in the world. In Cuba, the incidence of the carrier state is of 13.2 % in black, 4.1 in mestizoes and 0.6 in white individuals. It reaches 3.08 % of the general population. The affectation of growth and development in these patients has been a very discussed topic and the hormonal dysfunctions, the nutritional deficiencies, the socioeconomic factors and the disorders of the osteoarticular system are considered as possible causes related to this alteration. A review of these aspects is made in national and foreign literature. It is concluded that growth deficiency may be related to tissue hypoxia caused by severe anemia, the acute and chronic effects of vasoocclusion, the

  18. Toward a noncytotoxic glioblastoma therapy: blocking MCP-1 with the MTZ Regimen

    Directory of Open Access Journals (Sweden)

    Salacz ME

    2016-04-01

    Full Text Available Michael E Salacz,1,2 Richard E Kast,3 Najmaldin Saki,4 Ansgar Brüning,5 Georg Karpel-Massler,6 Marc-Eric Halatsch6 1Department of Internal Medicine, 2Department of Neurosurgery, University of Kansas, Kansas City, KS, USA; 3IIAIGC Study Center, Burlington, VT, USA; 4Health Research Institute, Research Center of Thalassemia and Hemoglobinopathy, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran; 5Molecular Biology Laboratory, University Hospital Munich, Munich, Germany; 6Department of Neurosurgery, University of Ulm, Ulm, Germany Abstract: To improve the prognosis of glioblastoma, we developed an adjuvant treatment directed to a neglected aspect of glioblastoma growth, the contribution of nonmalignant monocyte lineage cells (MLCs (monocyte, macrophage, microglia, dendritic cells that infiltrated a main tumor mass. These nonmalignant cells contribute to glioblastoma growth and tumor homeostasis. MLCs comprise of approximately 10%–30% of glioblastoma by volume. After integration into the tumor mass, these become polarized toward an M2 immunosuppressive, pro-angiogenic phenotype that promotes continued tumor growth. Glioblastoma cells initiate and promote this process by synthesizing 13 kDa MCP-1 that attracts circulating monocytes to the tumor. Infiltrating monocytes, after polarizing toward an M2 phenotype, synthesize more MCP-1, forming an amplification loop. Three noncytotoxic drugs, an antibiotic – minocycline, an antihypertensive drug – telmisartan, and a bisphosphonate – zoledronic acid, have ancillary attributes of MCP-1 synthesis inhibition and could be re-purposed, singly or in combination, to inhibit or reverse MLC-mediated immunosuppression, angiogenesis, and other growth-enhancing aspects. Minocycline, telmisartan, and zoledronic acid – the MTZ Regimen – have low-toxicity profiles and could be added to standard radiotherapy and temozolomide. Re-purposing older drugs has advantages of established safety and low

  19. Hemoglobina C em homozigose e interação com talassemia beta Homozygous hemoglobin C and its interaction with beta thalassemia

    Directory of Open Access Journals (Sweden)

    Ivan L. Angulo

    2009-01-01

    Full Text Available A hemoglobina C (Hb C é originária do oeste da África e é detectada por migração lenta na eletroforese alcalina em acetato de celulose. Consiste na mutação do gene da globina beta no códon 6 (GAG-AAG, resultando na substituição do sexto aminoácido da cadeia beta da hemoglobina humana, o ácido glutâmico, pelo aminoácido lisina. A cromatografia de alto desempenho (HPLC separa completamente as frações C e A2, permitindo caracterizar a presença da interação com talassemia beta. Esta entidade (Hb CC, em homozigoze é considerada benigna em relação à doença falciforme, já que a falcização não faz parte de sua fisiopatologia. A raridade do diagnóstico C homozigoto e C talassemia beta nos pacientes portadores de hemoglobinopatias nos alertou para a necessidade de se conhecer melhor e estudar aspectos clínicos e hematológicos dos casos dessa mutação em homozigose e na interação com a talassemia beta no ambulatório de anemias do Centro Regional de Hematologia e Hemoterapia de Ribeirão Preto, SP, Brasil.Hemoglobin C (Hb C originated in the west of Africa and is detected by alkaline electrophoresis by slow migration in cellulose acetate. It consists of a mutation of the beta globin gene in codon 6 (GAG-AAG, resulting in a substitution of glutamic acid, the sixth amino acid of the beta string of the human hemoglobin, for lysine. High performance chromatography (HPLC separates the C and A2 fractions completely, allowing the characterization of the presence of interactions with thalassemia beta. This entity (Hb CC is considered benign in respect to sickle cell disease, as sickle cells are not part of its physiopathology. The rarity of the diagnosis of homozygous C and beta thalassemia in patients with hemoglobinopathies showed the necessity of studying clinical and hematologic aspects of the cases of this mutation in homozygosis carriers and the interaction with beta thalassemia in the anemias clinic of the Regional Blood

  20. Delta-He, Ret-He and a New Diagnostic Plot for Differential Diagnosis and Therapy Monitoring of Patients Suffering from Various Disease-Specific Types of Anemia.

    Science.gov (United States)

    Weimann, Andreas; Cremer, Malte; Hernáiz-Driever, Pablo; Zimmermann, Mathias

    2016-01-01

    The present study was aimed to prove the usefulness of a new diagnostic plot (Hema-Plot), illustrating the relationship between the hemoglobin content of reticulocytes (Ret-He) as a marker of functional iron deficiency and the difference between the reticulocyte and erythrocyte hemoglobin content (Delta-He) as a marker of an impaired hemoglobinization of newly formed reticulocytes occurring during inflammatory processes, to differentiate between various disease-specific types of anemia. A complete blood and reticulocyte count was performed on routine EDTA blood samples from 345 patients with and without various disease-specific types of anemia using the Sysmex XN-9000 hematology analyzer: blood healthy newborns (n = 23), blood healthy adults (n = 31), patients suffering from anemia of chronic disease (ACD) due to diverse oncological, chronic inflammatory, or autoimmune diseases (total n = 138) with (n = 65) and without therapy (n = 73), patients with thalassemia and/or hemoglobinopathy (n = 18), patients with iron deficiency anemia (IDA) (n = 35), patients with a combination of ACD and IDA (n = 17), as well as patients suffering from sepsis (total n = 83) with (n = 32) and without therapy (n = 51). The results for Ret-He, Delta-He, and C-reactive protein (CRP) were statistically compared (Mann-Whitney U Test) between the particular patient groups and the diagnostic plots were drawn. Delta-Hemoglobin showed a statistically significant difference between blood healthy newborns and blood healthy adults (p ≤ 0.05), while Ret-He and C-reactive protein did not. In addition, of all three biomarkers only Delta-He showed a statistically significant difference (p ≤ 0.05) between the ACD/IDA and IDA cohort. Delta-He, Ret-He, and CRP showed a statistically significant difference between patient cohorts with and without therapy suffering from ACD, ACD/IDA, and sepsis before and after medical therapy (p ≤ 0.05). The Hema-Plot illustrated the dynamic character of Ret-He and

  1. El riñón y el aparato excretor urinario en la embarazada. Consideraciones básicas The kidney and the urinary excretory system in the pregnant woman. Basic considerations

    Directory of Open Access Journals (Sweden)

    Abelardo Toirac Lamarque

    2013-02-01

    eclampsia, and chronic non-communicable diseases of considerable repercussion on the pregnant woman (diabetes mellitus, chronic hypertension, S trait-S hemoglobinopathies and diseases of the collagen were considered. Finally, some elements on the renal tumors in the pregnant women and the fundamental therapeutic means as hemodyalisis, kidney and pancreas transplant, and kidney transplant were briefly pointed out.

  2. Imaging of renal medullary carcinoma in children and young adults: a report from the Children's Oncology Group

    Energy Technology Data Exchange (ETDEWEB)

    Sandberg, Jesse K.; Khanna, Geetika [Washington University School of Medicine, Mallinckrodt Institute of Radiology, St. Louis, MO (United States); Mullen, Elizabeth A. [Children' s Hospital Boston/Dana-Farber Cancer Institute, Department of Pediatric Oncology, Boston, MA (United States); Cajaiba, Mariana M.; Perlman, Elizabeth J. [Northwestern University Feinberg School of Medicine, Department of Pathology and Laboratory Medicine, Ann and Robert H. Lurie Children' s Hospital of Chicago, Chicago, IL (United States); Smith, Ethan A. [University of Michigan Health System, Section of Pediatric Radiology, C. S. Mott Children' s Hospital, Department of Radiology, Ann Arbor, MI (United States); Servaes, Sabah [Children' s Hospital of Philadelphia, Department of Radiology, Philadelphia, PA (United States); Geller, James I. [University of Cincinnati, Division of Pediatric Oncology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States); Ehrlich, Peter F. [University of Michigan Health System, Section of Pediatric Surgery, C. S. Mott Children' s Hospital, Department of Surgery, Ann Arbor, MI (United States); Cost, Nicholas G. [University of Colorado School of Medicine, Division of Urology, Department of Surgery, Aurora, CO (United States); Dome, Jeffrey S. [Children' s National Medical Center, Division of Pediatric Oncology, Washington, DC (United States); Fernandez, Conrad V. [Dalhousie University and IWK Health Centre, Department of Pediatrics, Halifax, NS (Canada)

    2017-11-15

    majority of patients. The diagnosis of renal medullary carcinoma should be considered when a child or young adult presents with a poorly defined/infiltrative, centrally located renal mass, especially in the setting of known sickle cell hemoglobinopathy. Distant metastases are common at initial presentation in the lungs, distant lymph nodes and liver and often involve multiple sites simultaneously. Pulmonary lymphangitic carcinomatosis, a distinctive and uncommon form of lung metastasis in children, is common in this patient population. (orig.)

  3. Reactivation of fetal hemoglobin in thalassemia and sickle cell disease

    Directory of Open Access Journals (Sweden)

    Sandro Eridani

    2014-09-01

    progression of globin gene expression and, particularly, in the reactivation of γ-globin gene expression associated with increased HbF synthesis. Probably, this reactivation is achieved by post-transcriptional inhibition of BCL11A expression. Finally, attention is presently focused on a recently discovered BCL11A enhancer, essential for erythroid expression of BCL11A, which might become a therapeutic target for genome engineering in the β-hemoglobinopathies as its disruption affects only the erythropoietic lineage, without hurting other cell or tissue compartments.

  4. Imaging of renal medullary carcinoma in children and young adults: a report from the Children's Oncology Group

    International Nuclear Information System (INIS)

    Sandberg, Jesse K.; Khanna, Geetika; Mullen, Elizabeth A.; Cajaiba, Mariana M.; Perlman, Elizabeth J.; Smith, Ethan A.; Servaes, Sabah; Geller, James I.; Ehrlich, Peter F.; Cost, Nicholas G.; Dome, Jeffrey S.; Fernandez, Conrad V.

    2017-01-01

    majority of patients. The diagnosis of renal medullary carcinoma should be considered when a child or young adult presents with a poorly defined/infiltrative, centrally located renal mass, especially in the setting of known sickle cell hemoglobinopathy. Distant metastases are common at initial presentation in the lungs, distant lymph nodes and liver and often involve multiple sites simultaneously. Pulmonary lymphangitic carcinomatosis, a distinctive and uncommon form of lung metastasis in children, is common in this patient population. (orig.)

  5. Hemoglobinas anormales en la población neonatal de Costa Rica

    Directory of Open Access Journals (Sweden)

    Gabriela Abarca

    2008-09-01

    Full Text Available Se han analizado un total de 70 943 muestras de sangre total en papel filtro S&S 903 de neonatos de Costa Rica (octubre 2005 a Octubre 2006 con el fin de detectar variantes de hemoglobina mediante la técnica de isoelectroenfoque. Se detectaron 891 casos con alguna variante para una frecuencia de 1/79. Se clasifican 5 casos homocigotos para hemoglobina S (anemia drepanocítica o anemia falciforme y un caso doble heterocigoto para SC. En este estudio se demuestra que las variantes fenotípicas de hemoglobina S como la C, se encuentran distribuidas por todo el país con algunas diferencias locales, razón por la cual es importante que la prevención de nuevos casos se realicé a través de nuestro Programa Nacional de Tamizaje de Hemoglobinas junto con un Programa Nacional interdisciplinario de Educación para el portador del rasgo (AS/AC como, para el enfermo y su familia; al igual que la instauración de programas dirigidos a médicos generales y enfermeras en todas las regiones de salud del país, para asegurar consejo genético a portadores y enfermos, y a la vez, mejorar los sistemas de tratamiento a los pacientes para reducir la morbi -mortalidad.Abnormal haemoglobins in the newborn human population of Costa Rica. Hemoglobinopathies are hereditary autosomic recessive diseases. A total of 70 943 samples of whole blood collected by heel prick in filter paper (S&S 903 from throughout Costa Rica (October 2005-October 2006 were analyzed to detect variants of hemoglobin by the iso-electric focusing technique. Eight hundred ninety one cases presented some variant, for a frecuency of 1/79. Five cases are homozygous for hemoglobin S (sickle cell disease and one shows the double heterozygous genotype SC. in this study the S and C variants of hemoglobin, although with some local differences, are widespread all over the country. Thus, the prevention of new cases is important through the testing of hemoglobin in the Costa Rican National Newborn Screening

  6. Eficácia e toxicidade da hidroxiuréia em crianças com anemia falciforme Effectiveness and toxicity of hydroxyurea in children with sickle cell anemia

    Directory of Open Access Journals (Sweden)

    Michelle C. Silva

    2006-06-01

    Full Text Available A anemia falciforme é uma doença genética caracterizada pelo alto índice de morbimortalidade, considerada como a mais grave entre as doenças falciformes. As opções terapêuticas mais eficazes atualmente disponíveis para tratamento desta hemoglobinopatia são transplante de medula óssea (TMO e hidroxiuréia (HU. O TMO apesar de ser a medida curativa é considerado de alto risco por apresentar diversos graus de complicações e significativo nível de mortalidade. O uso de HU em crianças portadoras de anemia falciforme tem proporcionado redução de complicações clínicas e aumento significativo na expectativa de vida, por promover elevação dos níveis de hemoglobina fetal, da concentração de hemoglobina e do VCM, bem como redução da hemólise e de eventos vaso-oclusivos. Desse modo, a HU é considerada como melhor opção terapêutica atualmente disponível. Porém, por ser apontada como droga potencialmente carcinogênica, há questionamentos quanto aos benefícios e toxicidades quando utilizada por longo período. Este trabalho teve como proposta, avaliar por meio da revisão literária, os riscos, benefícios e efeitos adversos da hidroxiuréia em crianças.Sickle cell anemia is a genetic disease characterized by a high morbimortality rate, it is considered as the most serious among all sickle cell diseases. The most effective therapeutic options available nowadays for the treatment of this hemoglobinopathy are bone morrow transplantation (BMT and hydroxyurea (HU. BMT is considered a high risk procedure due to the different complications and significant mortality rates. The use of HU for children with sickle cell anemia has reduced the clinical complications and given a significant increase in life expectancy by augmenting the fetal hemoglobin levels and hemoglobin concentrations and reducing cytomegalovirus, as well as reducing hemolysis and vaso-occlusive events. Thus, HU is considered the best therapeutic option currently

  7. Amplificação gênica alelo-específica na caracterização das hemoglobinas S, C e D e as interações entre elas e talassemias beta Allele-specific genic amplification in the characterization of hemoglobins S, C, D and interactions among them and with beta thalassemia

    Directory of Open Access Journals (Sweden)

    Luciane Cristina Bertholo

    2006-08-01

    Full Text Available INTRODUÇÃO: As hemoglobinopatias resultam de alterações hereditárias, sendo prevalentes em muitas regiões do mundo, mas atingem a população brasileira de forma significativa. Elas são decorrentes de alterações em genes estruturais responsáveis pelo aparecimento das hemoglobinas variantes e/ou em genes reguladores, resultando nas talassemias. A identificação dessas patologias tem sido rotineiramente realizada por procedimentos eletroforéticos, contudo nossa experiência laboratorial evidencia que as mesmas nem sempre apresentam resoluções suficientes para a correta caracterização da mutação. CASUÍSTICAS E MÉTODOS: O propósito deste trabalho foi estabelecer uma metodologia válida para a caracterização das hemoglobinas S, C e D em homozigose ou heterozigose, e suas possíveis interações, baseada na amplificação gênica alelo-específica (PCR-AE com a utilização de primers sense, antisense e primers que se acoplam na posição do alelo mutante e na respectiva posição do alelo normal. RESULTADOS E DISCUSSÃO: Os resultados evidenciaram a validade dessa metodologia na caracterização das mutações, sendo esse procedimento de fácil realização, reprodutível e possível de ser aplicado em um significativo número de amostras.BRACKGROUND: The hemoglobinopathies are a group of hereditary hemoglobin disorders in worldwide distribution, affecting Brazilian population significantly; they are decurrent of alterations in structural genes, responsible for hemoglobin variants, and/or in regulatory genes, resulting the thalassemia. These disorders have been identified in most cases by electrophoretics procedures, and our laboratory experience points out that sometimes they do not obtain enough resolution for a right characterization of mutation. MATERIAL AND METHOD: The objective of this study was to establish a valid laboratory methodology for the characterization of hemoglobins S, C and D in homozygous or heterozygous and

  8. The role of the arginine metabolome in pain: implications for sickle cell disease

    Directory of Open Access Journals (Sweden)

    Bakshi N

    2016-03-01

    Full Text Available Nitya Bakshi,1–2 Claudia R Morris3–6 1Division of Pediatric Hematology-Oncology, Department of Pediatrics, Emory University School of Medicine, Atlanta, GA, USA; 2Aflac Cancer and Blood Disorders Center, Children’s Healthcare of Atlanta, Atlanta, GA, USA; 3Division of Pediatric Emergency Medicine, Department of Pediatrics, Emory University School of Medicine, Atlanta, GA, USA; 4Department of Emergency Medicine, Emory University School of Medicine, Atlanta, GA, USA; 5Emory-Children’s Center for Cystic Fibrosis and Airways Disease Research, Emory University School of Medicine, Atlanta, GA, USA; 6Pediatric Emergency Medicine, Children’s Healthcare of Atlanta, Atlanta, GA, USA Abstract: Sickle cell disease (SCD is the most common hemoglobinopathy in the US, affecting approximately 100,000 individuals in the US and millions worldwide. Pain is the hallmark of SCD, and a subset of patients experience pain virtually all of the time. Of interest, the arginine metabolome is associated with several pain mechanisms highlighted in this review. Since SCD is an arginine deficiency syndrome, the contribution of the arginine metabolome to acute and chronic pain in SCD is a topic in need of further attention. Normal arginine metabolism is impaired in SCD through various mechanisms that contribute to endothelial dysfunction, vaso-occlusion, pulmonary complications, risk of leg ulcers, and early mortality. Arginine is a semiessential amino acid that serves as a substrate for protein synthesis and is the precursor to nitric oxide (NO, polyamines, proline, glutamate, creatine, and agmatine. Since arginine is involved in multiple metabolic processes, a deficiency of this amino acid has the potential to disrupt many cellular and organ functions. NO is a potent vasodilator that is depleted in SCD and may contribute to vaso-occlusive pain. As the obligate substrate for NO production, arginine also plays a mechanistic role in SCD-related pain, although its

  9. CLINICO PATHOLOGICAL STUDY OF PATTERNS OF ANEMIA DURING PREGNANCY

    Directory of Open Access Journals (Sweden)

    Chamakuri

    2015-10-01

    Full Text Available INTRODUCTION: Anemia is defined as haemoglobin level in the blood below the lower extreme of the normal range for the age and sex of the individual. According to WHO, in developing countries the prevalence of anemia among pregnant women averages 60%, ranging between 35 to 100% among different regions of the world. A hemoglobin concentration below 11.0g/dl or packed cell volume (PCV of less than 33.0% is regarded as anemia during pregnancy by the WHO. It occurs in 40 - 80% of the pregnant women. Iron and folic acid defici encies, malaria, intestinal parasitic infections and hemoglobinopathies are the principal causes of anemia in pregnancy. Predisposing factors include young age, grand multiparity, low socioeconomic status, illiteracy, ignorance and short intervals of pregn ancy. AIM AND OBJECTIVES: 1. To study various patterns of anemia in pregnant women having haemoglobin level < 11 gm%. 2. To determine the most common pattern of anemia in pregnancy based on red cell morphology. MATERIALS AND METHODS: This study is a prospe ctive study over a period of one year from September 2014 to August 2015 in the department of pathology, Andhra medical college, Visakhapatnam . The study was conducted on 120 pregnant women whose haemoglobin level is < 11 gm/dl. All the haemotological parameters & peripheral blood smear stained by Leishman’s stain were evaluated. Complete clinical & obstetric history was recorded. Socioeconomic status was also noted. RESULTS: Out of 120 cases of anemia, we found 47 patie nts (39.1% having dimorphic anemia, 36(30% – microcytic hypochromic anemia, 23(19.1% - normocytic hypochromic anemia, 11(9.16% - sickle cell anemia and 1(0.83% case of pancytopenia. Maximum cases were seen in the age group of 21 - 30 years. 52 cases (43. 3% were primigravida and remaining 68 cases (56.6% were gravida two to four. 20 cases (16.6% were diagnosed in the first trimester, 38 cases (31.6% in the second trimester & 62 cases (51.6s% in the

  10. Aportes al estudio de la drepanocitosis: Análisis clínico y hematológico en los primeros 5 años de la vida Contributions to the study of drepanocytosis: Clinical and hematological analysis in the first 5 years of life

    Directory of Open Access Journals (Sweden)

    Tania García Peralta

    1999-08-01

    Full Text Available Se estudiaron 104 pacientes menores de 6 años de edad. En el 93,1 % el diagnóstico se hizo antes del primer año de la vida y en el 47,6 % fue prenatal. La mediana de seguimiento fue de 31 meses (1-108. La mayor incidencia de eventos clínicos en la anemia drepanocítica (AD ocurrió entre 1y 3 años. El 91,6 % de las infecciones fueron pulmonares y el 21,7 % de los cuadros respiratorios se catalogaron como síndrome torácico agudo. Los eventos en la hemoglobinopatía SC (HSC fueron menos frecuentes que en la AD. Sólo 1 paciente falleció en los casi 10 años transcurridos desde que se inició el estudio. La hemoglobina y la hemoglobina fetal (HbF estuvieron más altas en el sexo femenino en la AD. Los haplotipos del bloque de genes b más frecuentes fueron el Benin y el Bantú. Se constató una frecuencia de a talasemia de 23,8 % en la AD y de 23,07 % en la HSC. No existió correlación entre los haplotipos Bantú y no Bantú y la a talasemia con las manifestaciones clínicas ni con los parámetros hematológicos. El seguimiento sistemático de los pacientes desde temprano en la vida disminuye la mortalidad en este período104 patients under 6 were studied. In 93,1 % of them the diagnosis was made before the first year of life, whereas in 47.6 % it was prenatal. The median of follow-up was 31 months (1-108. The highest incidence of clinical events in sickle cell anemia (SCA occurred between 1 and 3 years old. 91.6 % of the infections were pulmonary and 21.7 % of the respiratory episodes were considered as acute chest syndrome. The events in hemoglobinopathy SC (HSC were less frequent than in sickle cell anemia. Only one patient died in a period of almost 10 years since the study began. Hemoglobin and fetal hemoglobin (HbF were higher among females with SCA. The commonest haplotypes of the block of genes b were Benin and Bantu. It was observed a frequency of thalassemia of 23.8 % in sickle cell anemia and of 23.7 % in HSC. Bantu and non

  11. [Prenatal diagnosis. Review, personal and prospective studies].

    Science.gov (United States)

    Engel, E; Empson, J; DeLozier, D; McGee, B; da Costa Woodson, E; Engel-de Montmollin, M; Carter, T; Lorber, C; Cassidy, S B; Millis, J; Heller, R M; Boehm, F; Vanhooydonk, J

    1979-07-07

    1. In a review of methods developed for the identification of fetal malformations, the technique, risks and results of amniocentesis are presented. 2. Large series already published have demonstrated the relative simplicity and feasibility of the procedure as well as current indications for its utilization. These include the detection of chromosomal anomalies, the determination of sex (in certain sex-linked disorders), documentation of enzymatic and metabolic deficiencies, and the demonstration of open lesions of the neural tube by appropriate techniques. 3. Experience with over 500 cases personally tested by the authors entirely confirms the major indications for and benefits of this modern method for the detection and prevention of severe congenital anomalies during early pregnancy. 4. The identification of chromosomal alterations is currently the major objective of the method. Increased risks are associated with pregnancies involving a maternal age of 35 years or older (which account for 1-3% of aneuploidies), the birth of a previous infant with free trisomy 21 (1% recurrence risk) or secondary to a parental chromosome translocation (as much as 10% risk of aneuploidy). Fetal karyotyping for determination of sex, in cases where the mother is a carrier of an X-linked recessive gene (on average, 50% of male offspring will be affected), is an inadequate method of diagnosis to be utilized only until alternative techniques render possible specific diagnosis of the anomalies under consideration (hemophilias A and B, muscular dystrophy, etc). 5. Several of these techniques are now nearing development through the advent of fetoscopy and advanced ultrasound methodology, and have already been applied to the detection of certain sex-linked disorders and also for diagnosis of hemoglobinopathies (thalassemias, sickel cell anemia) and other conditions requiring the obtaining of fetal blood for diagnosis. Technology allowing direct examination of fetal parts by means of optical

  12. Prevalência de hemoglobina S em recém-nascidos de Fortaleza: importância da investigação neonatal The prevalence of hemoglobin S in newborns from Fortaleza, Brazil: the importance of neonatal research

    Directory of Open Access Journals (Sweden)

    Luciano Silveira Pinheiro

    2006-02-01

    Full Text Available OBJETIVOS: avaliar a prevalência de hemoglobina S (HbS, traços falciformes em recém-nascidos, por meio de investigação clínico-laboratorial. MÉTODOS: foi elaborado protocolo que estabelece a coleta de 10 ml de sangue de segmento de cordão umbilical, após ser ligado e seccionado pelo obstetra em seguida ao parto, sendo as amostras introduzidas em um tubo contendo EDTA a 5% e submetidas a estudo cromatográfico líquido de alta resolução (high-performance liquid chromatography. Preenchia-se também protocolo clínico mediante entrevista com a puérpera, analisava-se o seu prontuário e efetuava-se o exame físico do recém-nascido. As variáveis analisadas foram peso do recém-nascido, sexo, Apgar no primeiro minuto e cor da mãe. A análise estatística foi baseada no programa Epi-Info versão 6.0, utilizando-se o teste t de Student, considerando-se o nível de significância de pPURPOSE: to evaluate the prevalence of hemoglobin S (HbS in newborns, through clinical investigation and laboratory data. METHODS: a protocol established the drawing of 10 mL blood from the umbilical cord after its ligature and section, immediately after birth. The samples were kept in a tube with 5% EDTA and then submitted to high-performance liquid chromatography. The study included a clinical record taken from an interview with the mother, her physical and biochemical condition, as well as that of her newborn. Main criteria were newborn's weight, sex, first minute Apgar, and the mother's color. Statistical analysis was based on the Epi-Info 6.0 program and performed by Student's t test, with the level of significance set at p<0.05. RESULTS: from August 2001 to September 2002, 389 umbilical cord blood samples showed HbS in 16 newborn babies (4.1%. Fifteen of these presented sickle-cell traits (HbS and the other had a diagnostic hypothesis of sickle-cell anemia (HbSS. Hemoglobinopathy prevailed among male babies. No significant difference was observed between

  13. Child and Adolescent Health From 1990 to 2015

    Science.gov (United States)

    Kyu, Hmwe Hmwe; Zoeckler, Leo; Olsen, Helen Elizabeth; Thomas, Katie; Pinho, Christine; Bhutta, Zulfiqar A.; Dandona, Lalit; Ferrari, Alize; Ghiwot, Tsegaye Tewelde; Hay, Simon I.; Kinfu, Yohannes; Liang, Xiaofeng; Lopez, Alan; Malta, Deborah Carvalho; Mokdad, Ali H.; Naghavi, Mohsen; Patton, George C.; Salomon, Joshua; Sartorius, Benn; Topor-Madry, Roman; Vollset, Stein Emil; Werdecker, Andrea; Whiteford, Harvey A.; Abate, Kalkidan Hasen; Abbas, Kaja; Damtew, Solomon Abrha; Ahmed, Muktar Beshir; Akseer, Nadia; Al-Raddadi, Rajaa; Alemayohu, Mulubirhan Assefa; Altirkawi, Khalid; Abajobir, Amanuel Alemu; Amare, Azmeraw T.; Antonio, Carl A. T.; Arnlov, Johan; Artaman, Al; Asayesh, Hamid; Avokpaho, Euripide Frinel G. Arthur; Awasthi, Ashish; Ayala Quintanilla, Beatriz Paulina; Bacha, Umar; Betsu, Balem Demtsu; Barac, Aleksandra; Bärnighausen, Till Winfried; Baye, Estifanos; Bedi, Neeraj; Bensenor, Isabela M.; Berhane, Adugnaw; Bernabe, Eduardo; Bernal, Oscar Alberto; Beyene, Addisu Shunu; Biadgilign, Sibhatu; Bikbov, Boris; Boyce, Cheryl Anne; Brazinova, Alexandra; Hailu, Gessessew Bugssa; Carter, Austin; Castañeda-Orjuela, Carlos A.; Catalá-López, Ferrán; Charlson, Fiona J.; Chitheer, Abdulaal A.; Choi, Jee-Young Jasmine; Ciobanu, Liliana G.; Crump, John; Dandona, Rakhi; Dellavalle, Robert P.; Deribew, Amare; deVeber, Gabrielle; Dicker, Daniel; Ding, Eric L.; Dubey, Manisha; Endries, Amanuel Yesuf; Erskine, Holly E.; Faraon, Emerito Jose Aquino; Faro, Andre; Farzadfar, Farshad; Fernandes, Joao C.; Fijabi, Daniel Obadare; Fitzmaurice, Christina; Fleming, Thomas D.; Flor, Luisa Sorio; Foreman, Kyle J.; Franklin, Richard C.; Fraser, Maya S.; Frostad, Joseph J.; Fullman, Nancy; Gebregergs, Gebremedhin Berhe; Gebru, Alemseged Aregay; Geleijnse, Johanna M.; Gibney, Katherine B.; Gidey Yihdego, Mahari; Ginawi, Ibrahim Abdelmageem Mohamed; Gishu, Melkamu Dedefo; Gizachew, Tessema Assefa; Glaser, Elizabeth; Gold, Audra L.; Goldberg, Ellen; Gona, Philimon; Goto, Atsushi; Gugnani, Harish Chander; Jiang, Guohong; Gupta, Rajeev; Tesfay, Fisaha Haile; Hankey, Graeme J.; Havmoeller, Rasmus; Hijar, Martha; Horino, Masako; Hosgood, H. Dean; Hu, Guoqing; Jacobsen, Kathryn H.; Jakovljevic, Mihajlo B.; Jayaraman, Sudha P.; Jha, Vivekanand; Jibat, Tariku; Johnson, Catherine O.; Jonas, Jost; Kasaeian, Amir; Kawakami, Norito; Keiyoro, Peter N.; Khalil, Ibrahim; Khang, Young-Ho; Khubchandani, Jagdish; Ahmad Kiadaliri, Aliasghar A.; Kieling, Christian; Kim, Daniel; Kissoon, Niranjan; Knibbs, Luke D.; Koyanagi, Ai; Krohn, Kristopher J.; Kuate Defo, Barthelemy; Kucuk Bicer, Burcu; Kulikoff, Rachel; Kumar, G. Anil; Lal, Dharmesh Kumar; Lam, Hilton Y.; Larson, Heidi J.; Larsson, Anders; Laryea, Dennis Odai; Leung, Janni; Lim, Stephen S.; Lo, Loon-Tzian; Lo, Warren D.; Looker, Katharine J.; Lotufo, Paulo A.; Magdy Abd El Razek, Hassan; Malekzadeh, Reza; Markos Shifti, Desalegn; Mazidi, Mohsen; Meaney, Peter A.; Meles, Kidanu Gebremariam; Memiah, Peter; Mendoza, Walter; Abera Mengistie, Mubarek; Mengistu, Gebremichael Welday; Mensah, George A.; Miller, Ted R.; Mock, Charles; Mohammadi, Alireza; Mohammed, Shafiu; Monasta, Lorenzo; Mueller, Ulrich; Nagata, Chie; Naheed, Aliya; Nguyen, Grant; Nguyen, Quyen Le; Nsoesie, Elaine; Oh, In-Hwan; Okoro, Anselm; Olusanya, Jacob Olusegun; Olusanya, Bolajoko O.; Ortiz, Alberto; Paudel, Deepak; Pereira, David M.; Perico, Norberto; Petzold, Max; Phillips, Michael Robert; Polanczyk, Guilherme V.; Pourmalek, Farshad; Qorbani, Mostafa; Rafay, Anwar; Rahimi-Movaghar, Vafa; Rahman, Mahfuzar; Rai, Rajesh Kumar; Ram, Usha; Rankin, Zane; Remuzzi, Giuseppe; Renzaho, Andre M. N.; Roba, Hirbo Shore; Rojas-Rueda, David; Ronfani, Luca; Sagar, Rajesh; Sanabria, Juan Ramon; Kedir Mohammed, Muktar Sano; Santos, Itamar S.; Satpathy, Maheswar; Sawhney, Monika; Schöttker, Ben; Schwebel, David C.; Scott, James G.; Sepanlou, Sadaf G.; Shaheen, Amira; Shaikh, Masood Ali; She, June; Shiri, Rahman; Shiue, Ivy; Sigfusdottir, Inga Dora; Singh, Jasvinder; Silpakit, Naris; Smith, Alison; Sreeramareddy, Chandrashekhar; Stanaway, Jeffrey D.; Stein, Dan J.; Steiner, Caitlyn; Sufiyan, Muawiyyah Babale; Swaminathan, Soumya; Tabarés-Seisdedos, Rafael; Tabb, Karen M.; Tadese, Fentaw; Tavakkoli, Mohammad; Taye, Bineyam; Teeple, Stephanie; Tegegne, Teketo Kassaw; Temam Shifa, Girma; Terkawi, Abdullah Sulieman; Thomas, Bernadette; Thomson, Alan J.; Tobe-Gai, Ruoyan; Tonelli, Marcello; Tran, Bach Xuan; Troeger, Christopher; Ukwaja, Kingsley N.; Uthman, Olalekan; Vasankari, Tommi; Venketasubramanian, Narayanaswamy; Vlassov, Vasiliy Victorovich; Weiderpass, Elisabete; Weintraub, Robert; Gebrehiwot, Solomon Weldemariam; Westerman, Ronny; Williams, Hywel C.; Wolfe, Charles D. A.; Woodbrook, Rachel; Yano, Yuichiro; Yonemoto, Naohiro; Yoon, Seok-Jun; Younis, Mustafa Z.; Yu, Chuanhua; Zaki, Maysaa El Sayed; Zegeye, Elias Asfaw; Zuhlke, Liesl Joanna; Murray, Christopher J. L.; Vos, Theo

    2017-01-01

    -term sequelae of conditions present at birth (eg, neonatal disorders, congenital birth defects, and hemoglobinopathies) and complications of a variety of infections and nutritional deficiencies. Anemia, developmental intellectual disability, hearing loss, epilepsy, and vision loss are important contributors to childhood disability that can arise from multiple causes. Maternal and reproductive health remains a key cause of disease burden in adolescent females, especially in lower-SDI countries. In low-SDI countries, mortality is the primary driver of health loss for children and adolescents, whereas disability predominates in higher-SDI locations; the specific pattern of epidemiological transition varies across diseases and injuries. Conclusions and Relevance Consistent international attention and investment have led to sustained improvements in causes of health loss among children and adolescents in many countries, although progress has been uneven. The persistence of infectious diseases in some countries, coupled with ongoing epidemiologic transition to injuries and noncommunicable diseases, require all countries to carefully evaluate and implement appropriate strategies to maximize the health of their children and adolescents and for the international community to carefully consider which elements of child and adolescent health should be monitored. PMID:28384795

  14. Prevalência da hemoglobina S no Estado do Paraná, Brasil, obtida pela triagem neonatal Prevalence of hemoglobin S in the State of Paraná, Brazil, based on neonatal screening

    Directory of Open Access Journals (Sweden)

    Alexandra M. Watanabe

    2008-05-01

    Full Text Available O Ministério da Saúde instituiu o Programa Nacional de Triagem Neonatal através da Portaria nº. 822/GM, incluindo a pesquisa das hemoglobinopatias nos recém-nascidos. No Paraná, é realizada pela Fundação Ecumênica de Proteção ao Excepcional. Determinou-se a prevalência da hemoglobina S em homozigose, heterozigose e Sbeta-talassemia no estado. O sangue coletado em papel filtro foi examinado por focalização isoelétrica e cromatografia líquida de alta precisão (HPLC. De janeiro de 2002 a dezembro de 2004, foram triados 548.810 recém-nascidos e detectados 21 recém-nascidos com os resultados FS, dois FSA e/ou FS e quatro FSA. Após exames confirmatórios aos seis meses de idade, 12 foram definidos como anemia falciforme, com prevalência de 2,2:100 mil recém-nascidos; a interação Sbeta-talassemia foi confirmada em quinze (2,7:100 mil recém-nascidos; e 8.321 recém-nascidos foram diagnosticados como heterozigotos para HbS (1.500:100 mil recém-nascidos. A prevalência da HbS no Paraná é menor do que nas regiões Centro-Oeste, Norte e Nordeste do país. Origem étnica da população, óbitos fetais e casamentos preferenciais podem estar contribuindo para não haver maior número de homozigotos no estado. A interação Sbeta-talassemia sugere presença de povos euro-mediterrâneos na miscigenação dessa população.The Brazilian Ministry of Health created the National Neonatal Screening Program under ruling no. 822/2001, including neonatal screening for hemoglobinopathies. In the State of Paraná, neonatal screening is conducted by the Ecumenical Foundation for the Protection of the Handicapped. The prevalence rates were determined for homozygous and heterozygous hemoglobin S and Sbeta-thalassemia. Blood samples drawn on filter paper were examined by isoelectric focusing (IEF and high-performance liquid chromatography (HPLC. From January 2002 to December 2004, 548,810 newborns were screened, with the detection of 21 with FS

  15. The Hematopoietic Stem Cell Therapy for Exploration of Space

    Science.gov (United States)

    Ohi, S.

    Departments of Biochemistry &Molecular Biology, Genetics &Human Genetics, Pediatrics &Child Long-duration space missions require countermeasures against severe/invasive disorders in astronauts that are caused by space environments, such as hematological/cardiac abnormalities, bone/muscle losses, immunodeficiency, neurological disorders, and cancer. Some, if not all, of these disorders may be amenable to hematopoietic stem cell therapy and gene therapy. Growing evidence indicates that hematopoietic stem cells (HSCs) possess extraordinary plasticity to differentiate not only to all types of blood cells but also to various tissues, including bone, muscle, skin, liver and neuronal cells. Therefore, our working hypothesis is that the hematopoietic stem cell-based therapy, herein called as the hematopoietic stem cell therapy (HSCT), might provide countermeasure/prevention for hematological abnormalities, bone and muscle losses in space, thereby maintaining astronauts' homeostasis. Our expertise lies in recombinant adeno-associated virus (rAAV)-mediated gene therapy for the hemoglobinopathies, -thalassemia and sickle cell disease (Ohi S, Kim BC, J Pharm Sci 85: 274-281, 1996; Ohi S, et al. Grav Space Biol Bull 14: 43, 2000). As the requisite steps in this protocol, we established procedures for purification of HSCs from both mouse and human bone marrow in 1 G. Furthermore, we developed an easily harvestable, long-term liquid suspension culture system, which lasts more than one year, for growing/expanding HSCs without stromal cells. Human globin cDNAs/gene were efficiently expressed from the rAAVs in the mouse HSCs in culture. Additionally, the NASA Rotating Wall Vessel (RWV) culture system is being optimized for the HSC growth/expansion. Thus, using these technologies, the above hypothesis is being investigated by the ground-based experiments as follows: 1) -thalassemic mice (C57BL/6-Hbbth/Hbbth, Hbd-minor) are transplanted with normal isologous HSCs to correct the

  16. Child and Adolescent Health From 1990 to 2015: Findings From the Global Burden of Diseases, Injuries, and Risk Factors 2015 Study.

    Science.gov (United States)

    Kassebaum, Nicholas; Kyu, Hmwe Hmwe; Zoeckler, Leo; Olsen, Helen Elizabeth; Thomas, Katie; Pinho, Christine; Bhutta, Zulfiqar A; Dandona, Lalit; Ferrari, Alize; Ghiwot, Tsegaye Tewelde; Hay, Simon I; Kinfu, Yohannes; Liang, Xiaofeng; Lopez, Alan; Malta, Deborah Carvalho; Mokdad, Ali H; Naghavi, Mohsen; Patton, George C; Salomon, Joshua; Sartorius, Benn; Topor-Madry, Roman; Vollset, Stein Emil; Werdecker, Andrea; Whiteford, Harvey A; Abate, Kalkidan Hasen; Abbas, Kaja; Damtew, Solomon Abrha; Ahmed, Muktar Beshir; Akseer, Nadia; Al-Raddadi, Rajaa; Alemayohu, Mulubirhan Assefa; Altirkawi, Khalid; Abajobir, Amanuel Alemu; Amare, Azmeraw T; Antonio, Carl A T; Arnlov, Johan; Artaman, Al; Asayesh, Hamid; Avokpaho, Euripide Frinel G Arthur; Awasthi, Ashish; Ayala Quintanilla, Beatriz Paulina; Bacha, Umar; Betsu, Balem Demtsu; Barac, Aleksandra; Bärnighausen, Till Winfried; Baye, Estifanos; Bedi, Neeraj; Bensenor, Isabela M; Berhane, Adugnaw; Bernabe, Eduardo; Bernal, Oscar Alberto; Beyene, Addisu Shunu; Biadgilign, Sibhatu; Bikbov, Boris; Boyce, Cheryl Anne; Brazinova, Alexandra; Hailu, Gessessew Bugssa; Carter, Austin; Castañeda-Orjuela, Carlos A; Catalá-López, Ferrán; Charlson, Fiona J; Chitheer, Abdulaal A; Choi, Jee-Young Jasmine; Ciobanu, Liliana G; Crump, John; Dandona, Rakhi; Dellavalle, Robert P; Deribew, Amare; deVeber, Gabrielle; Dicker, Daniel; Ding, Eric L; Dubey, Manisha; Endries, Amanuel Yesuf; Erskine, Holly E; Faraon, Emerito Jose Aquino; Faro, Andre; Farzadfar, Farshad; Fernandes, Joao C; Fijabi, Daniel Obadare; Fitzmaurice, Christina; Fleming, Thomas D; Flor, Luisa Sorio; Foreman, Kyle J; Franklin, Richard C; Fraser, Maya S; Frostad, Joseph J; Fullman, Nancy; Gebregergs, Gebremedhin Berhe; Gebru, Alemseged Aregay; Geleijnse, Johanna M; Gibney, Katherine B; Gidey Yihdego, Mahari; Ginawi, Ibrahim Abdelmageem Mohamed; Gishu, Melkamu Dedefo; Gizachew, Tessema Assefa; Glaser, Elizabeth; Gold, Audra L; Goldberg, Ellen; Gona, Philimon; Goto, Atsushi; Gugnani, Harish Chander; Jiang, Guohong; Gupta, Rajeev; Tesfay, Fisaha Haile; Hankey, Graeme J; Havmoeller, Rasmus; Hijar, Martha; Horino, Masako; Hosgood, H Dean; Hu, Guoqing; Jacobsen, Kathryn H; Jakovljevic, Mihajlo B; Jayaraman, Sudha P; Jha, Vivekanand; Jibat, Tariku; Johnson, Catherine O; Jonas, Jost; Kasaeian, Amir; Kawakami, Norito; Keiyoro, Peter N; Khalil, Ibrahim; Khang, Young-Ho; Khubchandani, Jagdish; Ahmad Kiadaliri, Aliasghar A; Kieling, Christian; Kim, Daniel; Kissoon, Niranjan; Knibbs, Luke D; Koyanagi, Ai; Krohn, Kristopher J; Kuate Defo, Barthelemy; Kucuk Bicer, Burcu; Kulikoff, Rachel; Kumar, G Anil; Lal, Dharmesh Kumar; Lam, Hilton Y; Larson, Heidi J; Larsson, Anders; Laryea, Dennis Odai; Leung, Janni; Lim, Stephen S; Lo, Loon-Tzian; Lo, Warren D; Looker, Katharine J; Lotufo, Paulo A; Magdy Abd El Razek, Hassan; Malekzadeh, Reza; Markos Shifti, Desalegn; Mazidi, Mohsen; Meaney, Peter A; Meles, Kidanu Gebremariam; Memiah, Peter; Mendoza, Walter; Abera Mengistie, Mubarek; Mengistu, Gebremichael Welday; Mensah, George A; Miller, Ted R; Mock, Charles; Mohammadi, Alireza; Mohammed, Shafiu; Monasta, Lorenzo; Mueller, Ulrich; Nagata, Chie; Naheed, Aliya; Nguyen, Grant; Nguyen, Quyen Le; Nsoesie, Elaine; Oh, In-Hwan; Okoro, Anselm; Olusanya, Jacob Olusegun; Olusanya, Bolajoko O; Ortiz, Alberto; Paudel, Deepak; Pereira, David M; Perico, Norberto; Petzold, Max; Phillips, Michael Robert; Polanczyk, Guilherme V; Pourmalek, Farshad; Qorbani, Mostafa; Rafay, Anwar; Rahimi-Movaghar, Vafa; Rahman, Mahfuzar; Rai, Rajesh Kumar; Ram, Usha; Rankin, Zane; Remuzzi, Giuseppe; Renzaho, Andre M N; Roba, Hirbo Shore; Rojas-Rueda, David; Ronfani, Luca; Sagar, Rajesh; Sanabria, Juan Ramon; Kedir Mohammed, Muktar Sano; Santos, Itamar S; Satpathy, Maheswar; Sawhney, Monika; Schöttker, Ben; Schwebel, David C; Scott, James G; Sepanlou, Sadaf G; Shaheen, Amira; Shaikh, Masood Ali; She, June; Shiri, Rahman; Shiue, Ivy; Sigfusdottir, Inga Dora; Singh, Jasvinder; Silpakit, Naris; Smith, Alison; Sreeramareddy, Chandrashekhar; Stanaway, Jeffrey D; Stein, Dan J; Steiner, Caitlyn; Sufiyan, Muawiyyah Babale; Swaminathan, Soumya; Tabarés-Seisdedos, Rafael; Tabb, Karen M; Tadese, Fentaw; Tavakkoli, Mohammad; Taye, Bineyam; Teeple, Stephanie; Tegegne, Teketo Kassaw; Temam Shifa, Girma; Terkawi, Abdullah Sulieman; Thomas, Bernadette; Thomson, Alan J; Tobe-Gai, Ruoyan; Tonelli, Marcello; Tran, Bach Xuan; Troeger, Christopher; Ukwaja, Kingsley N; Uthman, Olalekan; Vasankari, Tommi; Venketasubramanian, Narayanaswamy; Vlassov, Vasiliy Victorovich; Weiderpass, Elisabete; Weintraub, Robert; Gebrehiwot, Solomon Weldemariam; Westerman, Ronny; Williams, Hywel C; Wolfe, Charles D A; Woodbrook, Rachel; Yano, Yuichiro; Yonemoto, Naohiro; Yoon, Seok-Jun; Younis, Mustafa Z; Yu, Chuanhua; Zaki, Maysaa El Sayed; Zegeye, Elias Asfaw; Zuhlke, Liesl Joanna; Murray, Christopher J L; Vos, Theo

    2017-06-01

    , neonatal disorders, congenital birth defects, and hemoglobinopathies) and complications of a variety of infections and nutritional deficiencies. Anemia, developmental intellectual disability, hearing loss, epilepsy, and vision loss are important contributors to childhood disability that can arise from multiple causes. Maternal and reproductive health remains a key cause of disease burden in adolescent females, especially in lower-SDI countries. In low-SDI countries, mortality is the primary driver of health loss for children and adolescents, whereas disability predominates in higher-SDI locations; the specific pattern of epidemiological transition varies across diseases and injuries. Consistent international attention and investment have led to sustained improvements in causes of health loss among children and adolescents in many countries, although progress has been uneven. The persistence of infectious diseases in some countries, coupled with ongoing epidemiologic transition to injuries and noncommunicable diseases, require all countries to carefully evaluate and implement appropriate strategies to maximize the health of their children and adolescents and for the international community to carefully consider which elements of child and adolescent health should be monitored.

  17. Indications and complications of splenectomy for children with sickle cell disease.

    Science.gov (United States)

    Al-Salem, Ahmed H

    2006-11-01

    Sickle cell anemia (SCA), which is characterized by high hemoglobin (Hb) F level and persistent splenomegaly into the older age group (up to 18 years of age) or even adults, is one of the commonest hemoglobinopathies in the Eastern Province of Saudi Arabia. This makes them liable to develop splenic complications requiring splenectomy. This is a review of our experience in the management of 134 children with SCA who had splenectomy as part of their management at our hospital, with emphasis given to the indications and complications of splenectomy. The medical records of all children who had splenectomy at our hospital were retrospectively reviewed for the following: age at splenectomy, sex, Hb electrophoresis, indication for splenectomy, preoperative investigations, type of surgery, spleen weight, histology, perioperative management, and postoperative complications. From 1990 to 2004, 170 children with various hematologic disorders had splenectomy at our hospital. Of these, 134 had SCA (118 had sickle cell disease and 16 had sickle-beta-thalassemia). Recurrent acute splenic sequestration crisis (ASSC) was the commonest indication for splenectomy in 103 (76.9%) patients, followed by hypersplenism in 18 (13.4%). Seven (5.2%) of our patients had splenectomy for splenic abscess (SA) and 2 had splenectomy for massive splenic infarction; 103 (61 boys, 42 girls) patients with a mean age of 7.6 years (range, 1.8-13 years) had splenectomy for ASSC. Their mean Hb F level was 20.5% (range, 9.2%-39.6%). Thirty-two of them had major attacks. Their Hb levels at the time of admission ranged from 1.4 to 4.1 g/dL (mean, 2.5 g/dL). The remaining 71 had minor recurrent attacks. Eighteen had splenectomy for hypersplenism and all had a significant increase in their blood parameters after splenectomy. Seven had splenectomy for SA. In 5 patients, Salmonella was the causative organism; in 1, it was Enterobacter sakazaki, whereas in 1, no organisms were identified. Two of our patients had

  18. Reduced-intensity conditioning for the treatment of malignant and life-threatening non-malignant disorders.

    Science.gov (United States)

    Slavin, Shimon; Aker, Mehmet; Shapira, Michael Y; Resnick, Igor; Bitan, Menachem; Or, Reuven

    2003-01-01

    to durable engraftment of immunocompetent donor lymphocytes, which may be necessary for induction of effective biologic warfare against host-type immunohematopoietic cells. Consequently, stem-cell therapy following induction of transplantation tolerance by selective elimination of alloreactive donor lymphocytes may represent the treatment of choice for a wide range of otherwise incurable diseases, including cancer (hematologic malignancies and certain metastatic solid tumors), genetic disorders (hemoglobinopathies and enzyme deficiency disorders), diseases caused by self-reactive lymphocytes (autoimmune diseases such as multiple sclerosis, rheumatoid arthritis) to mention just a few. Using reduced intensity conditioning, non-myeloablative stem cell transplantation (NST) can be accomplished with no major procedure-related toxicity or mortality. Thus, NST offers the feasibility of safe stem cell transplantation and cell-mediated procedures for a large and constantly growing spectrum of clinical indications for all patients in need without lower or upper age limit. Future strategies currently under investigation include developing new approaches for control of alloreactivity of host-versus-graft and graft-versus host reactivity reactions and developing better approaches for maximizing the capacity of donor lymphocytes to eliminate cancer cells more selectively, while avoiding or minimizing GVHD for safer and more effective treatment of patients in need of BMT.

  19. Prevalência de talassemias e hemoglobinas variantes em pacientes com anemia não ferropênica Prevalence of thalassemias and variant hemoglobins in patients with non-ferropenic anemia

    Directory of Open Access Journals (Sweden)

    Sandrine C. Wagner

    2005-03-01

    Full Text Available Para estabelecer a freqüência de hemoglobinopatias e talassemias em pacientes com anemia não ferropênica foram estudados 58 casos de pacientes comprovadamente com anemia não ferropênica e 235 controles obtidos de pessoas sem anemia. Todas as amostras foram obtidas do Hospital de Clínicas de Porto Alegre (HCPA, RS, Brasil. As técnicas realizadas foram eletroforese em acetato de celulose, pH alcalino, pesquisa citológica de Hb H, HPLC, hemograma e ferritina. A análise dos dados realizada no grupo de pacientes com anemia não ferropênica demonstrou que 63,8% eram portadores de alguma forma de anemia hereditária: 25,9% de talassemia alfa heterozigota, 32,8% de talassemia beta heterozigota, 3,4% de heterozigose para hemoglobina S (Hb AS e 1,7% de homozigose para hemoglobina C (Hb CC. No grupo dos controles, foram identificados 14,1% de anemias hereditárias, sendo destas 11,5% de talassemia alfa, 0,9% de talassemia beta, 1,3% de heterozigose para hemoglobina S (Hb AS e 0,4% de heterozigose para hemoglobina C (Hb AC. Os resultados obtidos permitem concluir que a prevalência de talassemias e hemoglobinas variantes no grupo controle é coincidente com a descrita na literatura. Entretanto, a excepcional prevalência dessas hemopatias hereditárias em pessoas com anemia não ferropênica deve ser divulgada entre médicos e serviços de saúde dada a sua importância no diagnóstico definitivo de anemia e dos corretos procedimentos terapêuticos.To establish the frequency of hemoglobinopathies and thalassemias in patients with non-ferropenic anemia, 58 patients with confirmed non-ferropenic anemia and 235 non-anemic individuals (control group were studied. All samples were obtained from the Hospital de Clínicas de Porto Alegre (HCPA, Rio Grande do Sul, Brazil. The techniques used were Alkaline pH cellulose acetate electrophoresis and cytological screening of Hb, Hl, HPLC, hemogram and ferritin. The data analysis showed that 63% of the

  20. Triagem de hemoglobinopatias e avaliação da degeneração oxidativa da hemoglobina em trabalhadores portadores do traço falciforme (HbAS, expostos a riscos ocupacionais Screening of abnormal hemoglobin and the evaluation of oxidative degeneration of hemoglobin among workers with the sickle cell trait (HbAS, exposed to occupational hazards

    Directory of Open Access Journals (Sweden)

    Isaac L. Silva Filho

    2005-09-01

    Full Text Available Desde os anos 40, quando foram realizados os primeiros trabalhos de triagem para hemoglobinas anormais na população brasileira, tem sido descrita uma elevada prevalência destas em nosso meio, especialmente a hemoglobina S que, a despeito da heterogeneidade de sua distribuição geográfica, quase sempre é a mais freqüente nas diversas regiões estudadas. Aliado a este fato, estudos recentes têm demonstrado uma maior susceptibilidade desta a oxidação, tornando-a mais sensível ao estresse oxidativo que a hemoglobina normal (HbAA, mesmo em se tratando de portadores heterozigotos (HbAS. Tendo em vista que algumas substâncias químicas são comprovadamente meta-hemoglobinizantes, que alguns fatores ambientais podem influenciar na morbidade da anemia falciforme e também o pouco e controverso conhecimento de que se dispõe a respeito de portadores do traço falciforme, este estudo, além da pesquisa de hemo-globinas anormais, avaliou também a degeneração oxidativa da hemoglobina, através da pesquisa de corpos de Heinz e dosagem de meta-hemoglobina em uma população de trabalhadores portadores do traço falciforme, expostos a riscos ocupacionais. Foram triadas 2.190 amostras sangüíneas entre Outubro de 1999 e Dezembro de 2001. A população estudada foi constituída de trabalhadores de ambos os sexos com idades variando entre 18 e 76 anos. Os resultados evidenciaram 4,7% portadores de hemoglobinas anormais na população analisada, sendo que a hemoglobina S foi a mais freqüente - 3,2% (71. Trabalhadores portadores do traço falciforme apresentaram uma chance 14 vezes maior de possuírem valores aumentados de meta-hemoglobina em relação aos trabalhadores com genótipo AA, porém, esta diferença não foi estatisticamente significativa.Hemoglobinopathies are frequent hereditary diseases in Brazilian population and have been a public health problem. This study reports the screening of abnormal hemoglobin among Fiocruz`s employees, as

  1. Riesgo de ictus isquémico en niños con Sβ talasemia. Estudio con Doppler transcraneal Risks of ischemic stroke in children suffering Sβ-thalassemia. Transcranial Doppler study

    Directory of Open Access Journals (Sweden)

    Claudio Enrique Scherle-Matamoros

    2012-06-01

    Full Text Available En niños con anemia por células falciformes, el riesgo de ictus isquémico varía según el genotipo de la hemoglobinopatía. En estos casos, la determinación de la velocidad de flujo sanguíneo mediante Doppler transcraneal (DTC puede predecir la ocurrencia de isquemia cerebral. Con el objetivo de describir las características del DTC en la Sβ talasemia, se estudiaron 32 enfermos menores de 18 años atendidos en el Instituto de Hematología e Inmunología y remitidos para su evaluación con ultrasonido. La edad media de los niños fue de 10,5 años. Se estudió la misma cantidad de enfermos con cada genotipo Sβ; solamente en un paciente la ventana temporal no fue útil. En el 97 % de los enfermos la velocidad media de flujo en las arterias cerebrales medias era inferior a 170 cm/s y solo en un niño estaban en el rango del grupo condicional. Se registraron asimetrías interhemisféricas en la velocidad media de flujo de las arterias cerebrales anteriores en el 29 % de los casos; en el 19,6 % en las arterias cerebrales medias; y en el 6,4 % en las carótidas internas extracraneales. Los niveles más altos de velocidad media de flujo se registraron en los enfermos con Sβ0 talasemia y en las arterias cerebrales medias. Existió una correlación inversa entre la edad y los niveles de hemoglobina con la velocidad de flujo de los 3 vasos estudiados. El riesgo de ictus isquémico en la Sβ talasemia es bajo, sin diferencia entre los 2 genotipos evaluados.In children with sickle cell anemia, the risk of ischemic stroke varies according to genotype of hemoglobinopathy. In these cases, determining the velocity of blood flow by transcranial Doppler (TCD can predict the occurrence of cerebral ischemia. In order to describe the characteristics of DTC in Sβ thalassemia, we studied 32 patients younger than 18 treated at the Institute of Hematology and Immunology, who were referred for ultrasound assessment. The age rate of children was 10.5 years old

  2. Study of gonadal hormones in Egyptian female children with sickle cell anemia in correlation with iron overload: Single center study.

    Science.gov (United States)

    Hagag, Adel A; El-Farargy, Mohamed S; Elrefaey, Shaymaa; Abo El-enein, Amany M

    2016-03-01

    Sickle cell disease is a hereditary hemoglobinopathy characterized by abnormal hemoglobin production, hemolytic anemia, and intermittent occlusion of small blood vessels, leading to tissue ischemia, chronic organ damage, and organ dysfunction including endocrine organs. The aim of this work was to evaluate some gonadal hormones in female children with sickle cell anemia (SCA) in correlation with iron overload. This study was conducted on 40 female children with SCA with a serum ferritin of > 1000ng/mL, who were attendants at the Hematology Unit, Pediatric Department, Tanta University, Tanta, Egypt in the period from May 2012 to April 2014. Their ages ranged from 11 years to 15years and the mean age value was 12.63±1.36 years (Group I). Forty female children with SCA of matched age with no iron overload served as a control Group (Group II). For all patients in Groups I and II the following were performed/assessed: complete blood count, hemoglobin electrophoresis, serum iron status, serum estrogen, luteinizing hormone (LH), and follicle-stimulating hormone (FSH). There were significantly higher serum ferritin and serum iron levels and significantly lower total iron binding capacity, FSH, LH, and estrogen levels in Group I compared with Group II (mean serum ferritin was 2635.1±918.9 in Group I vs. 292.55±107.2 in Group II with a p value of .001; mean serum iron was 196.3±55.6 in Group I vs. 120±16.57 in Group II with a p value of .001 and mean serum total iron binding capacity was 247.3±28.6 in Group I vs. 327.8.7±21.96 in Group II with a p value of .001; mean FSH level was 1.36±0.22mIU/mL in Group I vs. 2.64±0.81mIU/mL in Group II with a p value of .021; mean LH level was 0.11±0.006mIU/mL in Group I vs. 1.78±1.12mIU/mL in Group II with a p value of .003; mean estrogen level was 21.45±10.23pg/mL in Group I vs. 42.36±15.44pg/mL in Group II with a p value of 0.001) with significant negative correlation between serum gonadal hormones and serum ferritin (r

  3. Prevalência de talassemias e hemoglobinas variantes em pacientes portadores de lúpus eritematoso sistêmico Prevalence of thalassemias and variant hemoglobins in patients with systemic lupus erythematosus

    Directory of Open Access Journals (Sweden)

    Frank S. Castro

    2008-02-01

    causes of SLE are not totally known, but It is known that environmental and genetic factors are involved. Among various clinical manifestations observed in lupus patients, anemia calls the attention because of a prevalence of 52.5% of the patients with RBC indices suggestive of anemia identified in this study. Although anemia is usually seen in patients with SLE, studies of the prevalence of hereditary anemias, particularly hemoglobinopathies, have not been carried out in populations. The objective of this work was to evaluate the prevalence of hemoglobinophaties in patients with SLE. We studied 80 blood samples of patients with SLE in Hospital das Clínicas in Goiania, Brazil. The frequency of alterations of the hemoglobin was 10.0% (8 patients. Among these alterations, the most prevalent was alpha thalassemia in 4 patients (5.0% of the studied population. The heterozygosity for hemoglobin S was seen in 2 patients (2.5%, hemoglobin C in one patient (1.25% and one patient was identified with beta thalassemia minor. No homozygous cases were found in the present study. According to this work no difference in the prevalence of hemoglobin disorders was observed between general population and patients with SLE.

  4. Role of novel and rare nucleotide substitutions of the β-globin gene

    Directory of Open Access Journals (Sweden)

    Margherita Vinciguerra

    2012-11-01

    Full Text Available The Laboratory for Molecular Prenatal Diagnosis of Hemoglobinopathies at the Villa Sofia-Cervello Hospital in Palermo, Italy, carries out an intensive screening program aimed at identifying the healthy carriers of thalassemia and, consequently, the couples at risk of bearing an affected fetus. The diagnostic process is basically divided into two phases: i hematologic and hemoglobin data; ii molecular analysis of globin genes and, when possible, a genetic study of the family. Since 2003, we have been performing DNA sequence analysis on those cases in which classical molecular methods failed to give a complete diagnostic response, particularly in phenotypes with borderline values of HbA2 with mild or absent microcytosis. During ten years of screening activities (from 2003 to 2012, twenty- seven unknown or rare nucleotide changes of the β-globin gene have been identified; hematologic and hemoglobin data have been carefully evaluated and, wherever possible, we have conducted a family study to evaluate whether a phenotypic expression could be associated to these nucleotide changes. Because of the limited numbers of cases for each mutation, the significance of these nucleotide substitutions has still not been fully clarified, and this raises a number of questions that need to be answered when carrying out appropriate genetic counseling for couples presumed to be at risk. 意大利巴勒莫Villa Sofia-Cervello医院血红蛋白病分子产前诊断实验室进行密集的筛选程序,旨在识别健康的地中海贫血携带者和有怀上地中海贫血胎儿风险的夫妇。 诊断过程基本上分为两个阶段:1)血液及血红蛋白数据;2)珠蛋白基因分子分析以及家族遗传研究(如有可能)。 自2003年以来,我们已对这类病例进行DNA序列分析:传统的分子方法无法给出完整的诊断响应,尤其是有轻微小红细胞症或缺乏小红细胞症的HbA2临界值表型。

  5. The prevalence and characterization of β-thalassemia trait by using high-performance liquid chromatography among the rural population in West Bengal, India

    Directory of Open Access Journals (Sweden)

    Suman K. Maji

    2014-04-01

    Full Text Available Hemoglobinopathies, common genetic disorders of hemoglobin, can be prevented by population screening and genetic counseling. Identification of these disorders is immensely important epidemiologically and aid in prevention of more serious hemoglobin disorders. Thalassemia is the commonest monogenic disorder in India, which belongs to the thalassemia belt of the world. The present study was undertaken to find out the characteristics of β-thalassemia trait and spectrum of this disorder among the rural population, screened under the hospital-based screening program in West Bengal, a state in eastern part of India. This study was carried out in school and college students, newly married couples and pregnant women after proper counseling in the rural areas of five southern districts of this state. Blood samples were tested by high-performance liquid chromatography. Total 1429 β-thalassemia traits were detected by random screening from this population. The mean value of HbA2 of the study population, having β-thalassemia trait is 4.9%. The prevalence (10.5% of β-thalassemia trait in West Bengal is higher than other parts of the country. These data are likely to help us in future planning for screening programmes in rural areas of West Bengal, India.  血红蛋白病——常见的血红蛋白遗传疾病,是可以通过人口筛查和遗传咨询的方法来预防的。鉴定此种疾病,对于其传播性及预防其导致的更加严重的血红蛋白疾患有非常重大的意义。印度所处世界地中海贫血带,地中海贫血在印度是最常见的单基因疾病。本研究的目的是通过医院筛查程序来研究印度西孟买邦农村人口有关β-地中海贫血症频谱和特征。该研究在印度南部的五个农村地区进行,研究对象是接受过相关咨询后的在校生,大学生,新婚夫妇和孕妇。血液样本通过高效液相色谱法检测。总计1429

  6. Assistência de enfermagem a portadores de anemia falciforme, à luz do referencial de Roy Atención de enfermería a portadores de anemia falciforme apoyada en el modelo conceptual de Roy Nursing care to patiens with sickle cell disease in the light of Roy's model

    Directory of Open Access Journals (Sweden)

    Maria Lúcia Ivo

    2003-03-01

    ón; cuanto a la interdependencia, la madre fue referida como el otro significante más frecuente. Se identificó la oclusión de vasos sanguíneos como estímulo causador de comportamientos inefectivos y se verificó que la función fisiológica afectada altera otros modos de adaptación.This study aimed at applying the concepts from Roy's Adaptation Model in order to identify the behaviors (adaptive and ineffective of patients with sickle cell disease as well as the focal, contextual and residual stimuli that are responsible for such behaviors. Data collection was conducted in the Hemoglobinopathy Outpatient Unit of the University Hospital at the University of São Paulo at Ribeirão Preto School of Medicine. Nine subjects (8 females and 1 male were investigated. With respect to the physiological aspect, the ineffective behavior of low oxygenation and its outcomes (compromised physical development, sexual retardation hemolysis jaundice, respiratory alterations were evidenced. Regarding the psychosocial aspects, self-image showed a reduction in self-esteem as the most distinguished behavior; role performance was characterized by occupation change. Considering interdependence, the mother was reported as the most frequent significant "other". Vaso-occlusion was predominantly identified as the causing stimulus for ineffective behaviors. It was verified that the affected physiological function alters other adaptive aspects.

  7. La drepanocitosis en Cuba. Estudio en niños: Study in children Drepanocytosis in Cuba

    Directory of Open Access Journals (Sweden)

    Eva Svarch

    2011-03-01

    -blood cells, the adhesion molecules, the inflammatory cytokines, the coagulation factors and the lesions of the vascular endothelium. The more frequent clinical manifestations are: painful vaso-occlusive crises, the acute thoracic syndrome, the splenic sequestration crisis, the aplastic crisis, the aseptic necrosis of femur head and malleolar ulcer. The clinical picture is very variable: from children dying early in life up to patients achieve the sixth decade of life. In the Institute of Hematology and Immunology there is an Integral Care Program including: systematic follow-up from early in life in a specialized consultation, permanent administration of folic acid and of prophylactic oral penicillin during the first 5 years of age; as well as the child education and of parents. From 1986 it is carried out the partial splenectomy in crises of splenic sequestration with excellent results. Between 2004-2008 in all the country deceased only 16 patients and in 397 adults the survival rate was of 53 years in the drepanocythemia and of 58 in the SC hemoglobinopathy. As result of this program, in past years the survival has increased, the quality of life of patient improved and the costs spent in treatment of complications has decrease.

  8. Hidroxiuréia em pacientes com síndromes falciformes acompanhados no Hospital Hemope, Recife, Brasil Hydroxyurea in sickle cell disease patients in Recife, Brazil

    Directory of Open Access Journals (Sweden)

    Flavia M. G. C. Bandeira

    2004-01-01

    children with ages ranging from 5 to 17 years and also in young adults with SS or Sbeta0 hemoglobinopathies. The patients were treated in the outpatient clinic of the Hemope Hospital. Young patients were treated with hydroxyurea at 10 mg/kg/day which was increased by 5 mg/kg/day at 8-week intervals until reaching a maximum dose of 25 mg/kg/day. For adults, the treatment started at 500 mg/day and increased until a dose of 1000 mg/day was reached. Total Hb F levels and the Mean Corpuscular Volume rose with hydroxyurea therapy and there was a reduction of events involving pain as well as the necessity of hospitalization among the pediatric patients. With the over 18-year-old patients, a better clinical state was noticed together with a rise in hemoglobin levels and a reduction in the reticulocyte, leukocyte and platelet counts. No signs or symptoms in respect to drug toxicity were evidenced in either group. The use of hydroxyurea seems to be safe and effective in both children and young adults with sickle cell disease. The drug also improves the quality of life of these patients and their families. Additionally, the dosages of hydroxyurea used in this group of patients did not cause any bone marrow toxicity or other side effects.

  9. Prevalência de talassemias e hemoglobinas variantes no estado de Goiás, Brasil Prevalence of thalassemias and variant hemoglobins in the state of Goiás, Brazil

    Directory of Open Access Journals (Sweden)

    Paulo Roberto de Melo-Reis

    2006-12-01

    Full Text Available As anemias hereditárias, em especial as talassemias e hemoglobinas (Hb variantes, são as mais comuns das alterações genéticas humanas; sua freqüência na população brasileira é muito variável, dependendo dos grupos raciais formadores de cada região. O povoamento de Goiás, que teve início logo após o seu descobrimento, em 1726, motivado pela procura de ouro, foi composto principalmente por portugueses e escravos africanos, contexto que favoreceu a mestiçagem entre eles. Considerando que esses povos apresentam genes para as hemoglobinas anormais com freqüências variadas, é esperado que se encontrem essas alterações genéticas na nossa população. O objetivo deste trabalho foi avaliar a prevalência de talassemias e hemoglobinas variantes na população de Goiás. Para isso a casuística foi composta por 404 alunos participantes dos diversos cursos da Universidade Católica de Goiás (UCG, oriundos de 55 cidades do estado de Goiás. A prevalência de anemia hereditária por talassemias e hemoglobinas variantes em Goiás foi de 10,1%, cuja ordem decrescente foi a seguinte: talassemia alfa heterozigótica (5,2%, heterozigose para hemoglobina S (Hb AS (2,2%, heterozigose para hemoglobina C (Hb AC (1%, talassemia beta menor (0,7%, associação entre talassemia alfa e heterozigose para Hb S (0,5%, associação entre talassemia alfa e heterozigose para Hb C (0,3% e heterozigose para hemoglobina D (Hb AD (0,3%. Nenhum caso de homozigose foi encontrado no presente estudo. Este trabalho demonstrou a dispersão dos genes para Hb S, Hb C e Hb D, bem como de talassemias alfa e beta em uma população do estado de Goiás. Por essa razão, concluímos que é importante realizar programas com maior abrangência da população para estudo da epidemiologia das talassemias e hemoglobinas variantes no estado de Goiás.The hereditary anemias, especially the thalassemies and hemoglobinopathies are the most common human genetic abnormalities. Their

  10. Distribuição das mutações da β-talassemia em Fortaleza, Ceará Distribution of β-thalassemia mutations in Fortaleza, Ceará

    Directory of Open Access Journals (Sweden)

    Lilianne Brito da Silva Rocha

    2010-12-01

    to define the mutation profile of this hemoglobinopathy in the Northeast region and Brazil. METHODS: β-thalassemia was diagnosed by hematological study conducted in automatic blood cell counter, with review of slides through the test of globular osmotic resistance in NaCl 0.36% and the alkaline electrophoresis on cellulose acetate strips. DNA was isolated from leukocytes extracted from whole blood samples. The analysis of mutations was performed using the technique of allele specific polymerase chain reaction. CD 39, IVSI-1-6 and IVSI-110 were evaluated according to the protocol used in the Hemoglobin and Genetics Laboratory of Hematologic Diseases (LHGDH/UNESP. RESULTS: The distribution of identified mutations was: IVS-I-1 (14.3%, IVS-I-6 (35.7% and CD 39 (21.4%. The other thalassemia patients (28.6% showed none of the studied mutations. The highest frequency was IVS-I-6 as anticipated, since studies show that this mutation is more prevalent in the Northeast, as well as IVS-I-1 in the South, and IVSI-110 and CD39 in Southeast of the country. CONCLUSION: These results demonstrate the profile of β-thalassemia mutations in the Northeast region, thus contributing to the study of their distribution in Brazil.

  11. Joint SOGC-CCMG Opinion for Reproductive Genetic Carrier Screening: An Update for All Canadian Providers of Maternity and Reproductive Healthcare in the Era of Direct-to-Consumer Testing.

    Science.gov (United States)

    Wilson, R Douglas; De Bie, Isabelle; Armour, Christine M; Brown, Richard N; Campagnolo, Carla; Carroll, June C; Okun, Nan; Nelson, Tanya; Zwingerman, Rhonda; Audibert, Francois; Brock, Jo-Ann; Brown, Richard N; Campagnolo, Carla; Carroll, June C; De Bie, Isabelle; Johnson, Jo-Ann; Okun, Nan; Pastruck, Melanie; Vallée-Pouliot, Karine; Wilson, R Douglas; Zwingerman, Rhonda; Armour, Christine; Chitayat, David; De Bie, Isabelle; Fernandez, Sara; Kim, Raymond; Lavoie, Josee; Leonard, Norma; Nelson, Tanya; Taylor, Sherry; Van Allen, Margot; Van Karnebeek, Clara

    2016-08-01

    the most responsible maternity provider through the informed consent process with the patient. (III-A; GRADE low/moderate) SOGC OVERVIEW OF RECOMMENDATIONS QUALITY AND GRADE: There was a strong observational/expert opinion (quality and grade) for the genetic carrier literature with randomized controlled trial evidence being available only for the invasive testing. Both the Canadian Task Force on Preventive Health Care quality and classification and the GRADE evidence quality and grade are provided. MEDLINE; PubMed; government neonatal screening websites; key words/common reproductive genetic carrier screened diseases/previous SOGC Guidelines/medical academic societies (Society of Maternal-Fetal Medicine [SMFM]; American College of Medical Genetics and Genomics; American College of Obstetricians and Gynecologists [ACOG]; CCMG; Royal College Obstetrics and Gynaecology [RCOG] [UK]; American Society of Human Genetics [ASHG]; International Society of Prenatal Diagnosis [ISPD])/provincial neonatal screening policies and programs; search terms (carrier screening, prenatal screening, neonatal genetic/metabolic screening, cystic fibrosis (CF), thalassemia, hemoglobinopathy, hemophilia, Fragile X syndrome (FXS), spinal muscular atrophy, Ashkenazi Jewish carrier screening, genetic carrier screening protocols, AR, AD, XL). 10 years (June 2005-September 2015); initial search dates June 30, 2015 and September 15, 2015; completed final search January 4, 2016. Validation of articles was completed by primary authors RD Wilson and I De Bie. Benefits are to provide an evidenced based reproductive genetic carrier screening update consensus based on international opinions and publications for the use of Canadian women, who are planning a pregnancy or who are pregnant and have been identified to be at risk (personal or male partner family or reproductive history) for the transmission of a clinically significant genetic condition to their offspring with associated morbidity and

  12. Caracterización de la aloinmunización eritrocitaria en el Hospital Universitario del Valle entre 2011 y 2013 / Characterization of Red Blood Cells Alloimmunization at Hospital Universitario del Valle between 2011 and 2013 / Caracterização de aloimunização eritrocitária no Hospital Universitário do Valle no período de 2011 a 2013

    Directory of Open Access Journals (Sweden)

    José Arnulfo Pérez-Carrillo, Esp. MD.

    2014-11-01

    és A. Caracterización de la aloinmunizacióneEritrocitaria en el Hospital Universitario del Valle entre 2011 y 2013. MedUNAB 2014; 17(2:X-X] Background: The national blood needs are partially covered. The use of blood involves the detection and identification of unexpected red cell receptor antibodies. Objective: The objective was to characterize demographically and clinically cases of erythrocyte alloimmunization at Transfusion Service of the University Hospital of the Valle (Cali, Valle del Cauca between 2011 and 2013. Methodology: A cross-sectional design of cases of red cell alloimmunization transfused between august 1th 2011 until july 31th 2013. The cases were included through a systematic random sampling. Epi-Info for Windows® was used for the development of the instrument, data entry and statistical analysis. The research was approved by the Ethics Committee on Research of the Universidad Autónoma de Bucaramanga and HUV. Results: Out of the eighty cases, 53.8 % were female and 46.2% were male. 65% were Hispanic and 35% African-American. 22.5% had a history of hematopoietic diseases and 45% were hospitalized for diagnoses included in this category of ICD-10. 79% of women had obstetric history. 18.75% were transfused previously. 36% of the cases had a CceeK- phenotype. 31.25% had alloantibody Anti-E followed by Anti-K 21.25%. Conclusions: The major alloantibody identified was Anti-E followed by Anti-K. Additionally, the associated alloantibody could not be identified in a large group mainly due to antibody mixture. Also, most cases correspond to young adults and adults. In the clinical characteristics of the sample a discrete representation of congenital hemoglobinopathies was observed and most were not previously polytransfused. [Pérez JA, Cortés A. Characterization of Red Blood Cells Alloimmunization at Hospital Universitario del Valle between 2011 and 2013. MedUNAB 2014; 17(2:X-X] Introdução: As necessidades nacionais de sangue estão parcialmente

  13. Evolution and Innovations of the National Neonatal and High Risk Screening Program in Costa Rica

    Directory of Open Access Journals (Sweden)

    Carlos de Céspedes

    2004-09-01

    hemoglobinopathies and toxoplasmosis is planned. The Center for Prevention of Disabilities, which started its functions on September 23, 2002, made feasible to integrate neonatal screening, high risk screening and diagnostic confirmation of the diseases now included in the national screening program as well as those to be added in the future. Rev. Biol. Trop. 52(3: 451-466. Epub 2004 Dic 15.Presentamos la evolución, organización y los resultados del Programa Nacional de Tamizaje Neonatal y de Alto Riesgo en Costa Rica (PNT. Este programa ha estado trabajando ininterrumpidamente por más de catorce años. Actualmente Costa Rica tiene una tasa de alfabetización del 95%. En agosto de 2004 la tasa de mortalidad infantil fue de 9.74 por 1000 nacimientos y en el 2003, la expectativa de vida era de 76.3 años para hombres y de 81.1 para mujeres. El control de las enfermedades infecciosas y parasíticas, así como de la malnutrición severa, ha dado lugar a la prevalencia de enfermedades crónicas con un perfil patológico similar a los de los países desarrollados. La observación clínica, principalmente iniciando desde los años 70, de un número creciente de pacientes con retardo mental y otras discapacidades causadas por hipotiroidismo congénito y enfermedades metabólicas hereditarias que podrían haber sido prevenidas en muchos casos con un diagnóstico temprano y un tratamiento oportuno, nos llevo a tomar la decisión de implementar un sistema de tamizaje neonatal masivo para estas enfermedades. La presencia de un sistema público de seguridad social en Costa Rica, el cual actualmente incluye desde la atención primaria de la salud hasta la atención terciaria en los hospitales, con unúnico Hospital de Niños para todo el país, así como las facilidades de comunicación, son factores que ofrecen, en principio, condiciones favorables para este esfuerzo, aun en un país subdesarrollado. De esta manera, luego de un Decreto Ejectutivo, el PNT empezó en marzo de 1990. Las

  14. Prevention and management of stroke in sickle cell disease

    Directory of Open Access Journals (Sweden)

    Y. Kilinç

    2011-12-01

    Full Text Available Sickle Cell Disease(SCD is one of the most common hemoglobinopathies in the world which causes stroke. The management of stroke depends on the manifestations and the age of the patient. Especially in childhood, anatomic and physiological abnormalities of CNS may be a predisposing factors. Stroke mostly affects the distal segments of the Internal Carotid Artery, but also middle and anterior segments of the cerebral arteries are involved. The most important predisposing factors are the arterial malformations, stenosis and obstructions in cranial arteries, generally involving Internal Carotid Artery, frequently Proximal Middle Cerebral or Anterior Cerebral Arteries. After infarcts at brain vessels, most frequent clinical findings are hemiparesis or hemiplegia, impaired speech, focal seizures, gait disturbances. Risk factors for predisposing stroke are prior transient ischemia, baseline Hb decrease, acute chest sydrome within previous two weeks, systolic blood pressure rises, leucocyte increases. The patient with silent stroke or transient ischemic attacks may be asymptomatic or without neurological symptoms. Neuroimaging abnormalities may be seen without significant clinical findings in children with SCD. We talk about silent stroke if there are neuroradiological abnormalities without clinical findings. Children with silent strokes are more prone to new strokes. If there is a significant stroke a ischemic stroke often present with focal neurological signs and symptoms. If patient is asymptomatic or have suspected stroke, first step may be performance of Transcranial Doppler Ultrasonography (TCD. Children with time-averaged mean velocity (TAMV, measured in Middle Carotid Artery or in distal internal carotid Artery abnormally elevated, defined as TAMV≥200cm/sec, have sixfold increase for stroke than those with normal TAMV≤170cm/sec. For these patients under the risk of stroke, chronic blood transfusion is recommended for prevention of primary

  15. Haemoglobinopathy prevention program in Turkey

    Directory of Open Access Journals (Sweden)

    D. Canatan

    2011-12-01

    26 cities by MOH and TFT. A total 3.600 health persons were educated on thalassemia prevention and therapy with NTES in 18 centres in 2009 and 2010. In conclusion, according to reports of MOH, 46 first level haemoglobinopathy diagnosis centres, 5 second level diagnosis and therapy centre and 5 third level prenatal diagnosis centre were setup and licenced in 30 cities between 2003 and 2009. While premarital screening tests were 30% of all couples in 2003, it increased continuously during 6 years and it reached 81% in 2008. The number of new born with thalassemias and hemoglobinopathies was 272 in 2002, it was decreased to 23 in 2008, as a result there has been an 90% reduction in new affected births. 地中海贫血和异常血红蛋白是土耳其国内的两大严重的健康问题。 从2000年起,土耳其卫生部(MOH、土耳其国家血红蛋白病委员会(TNHC)和土耳其地中海贫血联合会(TFT)采取了多种预防地中海贫血的重要措施。1993年,土耳其颁布了名为“抵抗遗传性血色病”(主要针对地中海贫血和异常血红蛋白)的法律, 旨在防止血红蛋白病和治疗所有血红蛋白病患者和地中海贫血患者。 在土耳其南部各省的卫生部所属医院启动了试点项目并成立了多个卫生中心。 2000年,土耳其国家血红蛋白病委员会成立。该委员会和所有卫生中心、基金会和协会组成一个庞大组织,归属卫生部管理。 2001年,MOH和TNHC登记了所有记录在案的地中海贫血患者和异常血红蛋白患者,共计4513人。 2002年,颁布了抵抗遗传性血色病的书面法规。 MOH和TNHC确定了位于色雷斯、马尔马拉、爱琴海、地中海和东南地区等血红蛋白病出生高发地区的33个省。 2003年,成立血红蛋白病科学委员会,出版了一本指导手册并在高危地区启动了血红蛋白病预防项目(HPP)。 该项目在这些省成功执行。 2005