WorldWideScience

Sample records for hemi-nested multiplex pcr

  1. Genotyping canine distemper virus (CDV) by a hemi-nested multiplex PCR provides a rapid approach for investigation of CDV outbreaks

    DEFF Research Database (Denmark)

    Blixenkrone-Møller, Merete; Martella, Vito

    2007-01-01

    CDV is a highly contagious viral pathogen causing a lethal systemic disease in dogs and other carnivores. Several lineages or genotypes of CDV exist that are variously distributed throughout several continents. Legal or uncontrolled trading of animals may modify the epidemiology of CDV, introducing...... novel strains in CDV-naïve areas or accounting for the resurgence of CDV in areas where vaccine prophylaxis was effective and successful to control the disease. A hemi-nested PCR system was developed to genotype strains of the major CDV lineages, America-1, Europe, Asia-1, Asia-2 and Arctic. The assay...

  2. Diagnosis of Cutaneous Leishmaniasis by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    M Heiat

    2010-07-01

    Full Text Available Introduction: Annually, more than 14 million people are reported to be infected with Leishmaniasis all over the world. In Iran, this disease is seen in the form of cutaneous and visceral leishmaniasis, of which the cutaneous form is more wide spread. In recent years, cutaneous leishmaniaisis is diagnosed by PCR utilizing specific primers in order to amplify different parasite genes including ribosomal RNA genes, kinetoplast DNA or tandem repeating sequences. The aim of this research was to detect early stage cutaneous leishmaniasis using Multiplex-PCR technique. Methods: In this study, 67 samples were prepared from patients with cutaneous leishmaniasis. DNA was extracted with phenolchloroform. Each specimen was analyzed using two different pairs of PCR primers. The sensitivity of each PCR was optimized on pure Leishmania DNA prior to use for diagnosis. Two standard parasites L. major and L. tropica were used as positive control. Results: DNA amplification fragments were two 115 bp and 683 bp for AB and UL primers, respectively. The sensitivity of two primers was not equal for detection of L. major and L. tropica. The sensivity of PCR with AB primer was 35 cells, while that for UL primer was 40 cells. Conclusion: The results of this study indicate that PCR is a sensitive diagnostic assay for cutaneous leishmaniasis and could be employed as the new standard for routine diagnosis when species identification is not required. However, the ability to identify species is especially important in prognosis of the disease and in deciding appropriate therapy, especially in regions where more than one type of species and disease are seen by clinicians.

  3. Clostridium perfringens isolate typing by multiplex PCR

    Directory of Open Access Journals (Sweden)

    MR Ahsani

    2010-01-01

    Full Text Available Clostridium perfringens is an important pathogen that provokes numerous different diseases. This bacterium is classified into five different types, each of which capable of causing a different disease. There are various methods for the bacterial identification, many are labor-intensive, time-consuming, expensive and also present low sensitivity and specificity. The aim of this research was to identify the different types of C. perfringens using PCR molecular method. In this study, 130 sheep-dung samples were randomly collected from areas around the city of Kerman, southeastern Iran. After processing and culturing of samples, the produced colonies were morphologically studied, gram stain test was also carried out and the genera of these bacteria were identified through biochemical tests. DNA extracted from isolated bacteria for genotyping was tested by multiplex PCR with specific primers. Based on length of synthesized fragments by PCR, toxin types and bacterial strains were detected. C. perfringens isolated types were divided as follows: 17.39% type A, 21.74% type B, 34.78% type C and 26.09% type D. It should be emphasized that, up to the present moment, C. perfringens type A has not been reported in Iran.

  4. Multiplex real-time PCR (MRT-PCR) for diarrheagenic.

    Science.gov (United States)

    Barletta, Francesca; Ochoa, Theresa J; Cleary, Thomas G

    2013-01-01

    Diarrheagenic Escherichia coli strains are important causes of diarrhea in children from the developing world and are now being recognized as emerging enteropathogens in the developed world. Current methods of detection are too expensive and labor-intensive for routine detection of these organisms to be practical. We developed a real-time fluorescence-based multiplex PCR for the detection of all six of the currently recognized classes of diarrheagenic E. coli. The primers were designed to specifically amplify eight different virulence genes in the same reaction: aggR for enteroaggregative E. coli (EAEC), stIa/stIb and lt for enterotoxigenic E. coli (ETEC), eaeA for enteropathogenic E. coli (EPEC), stx1 and stx2 for Shiga toxin-producing E. coli (STEC), ipaH for enteroinvasive E. coli (EIEC), and daaD for diffusely adherent E. coli (DAEC).

  5. Evaluation of PCR and multiplex PCR in relation to nested PCR for diagnosing Theileria equi

    Directory of Open Access Journals (Sweden)

    Danielle C. Leal

    2011-07-01

    Full Text Available Conventional PCR (PCRTeq for diagnosing Theileria equi and multiplex PCR (M/PCRTeq-Bc for diagnosing T. equi and Babesia caballi were comparatively evaluated with nested PCR (N/PCR-Teq for diagnosing equine piroplasmosis. In DNA sensitivity determinations, in multiple dilutions of equine blood that had tested positive for T. equi, PCR-Teq and N/PCR-Teq detected hemoparasite DNA in the larger dilutions (1:128, but did not differ significantly from the M/PCRTeq-Bc (1:64. In analyses on equine serum tested by ELISA, there was high agreement between this serological test and PCR-Teq (k = 0.780 and moderate agreement with N/PCR-Teq (k = 0.562 and M/PCRTeq-Bc (k = 0.488. PCR-Teq found a higher frequency of T. equi both in extensively and intensively reared horses, but this was not significant in relation to N/PCR-Teq (P>0.05, and both PCRs indicated that there was an endemic situation regarding T. equi in the population of horses of this sample. PCR-Teq was only significantly different from M/PCR-Teq-Bc (P<0.05. PCR-Teq presented high sensitivity and specificity, comparable to N/PCR-Teq, but with the advantage of higher speed in obtaining results and lower costs and risks of laboratory contamination. This accredits PCR-Teq for epidemiological studies and for determinations on affected horses.

  6. Application of a nested, multiplex PCR to psittacosis outbreaks.

    OpenAIRE

    Messmer, T O; Skelton, S K; Moroney, J F; Daugharty, H; Fields, B S

    1997-01-01

    We developed a nested, multiplex PCR for simultaneous detection of three species of chlamydiae in human and avian specimens. The PCR was designed to increase sensitivity and to circumvent inhibitors of PCR present in clinical specimens. The target sequence was the 16S rRNA gene. The first-step PCR was genus specific, and the second-step PCR was multiplexed (i.e., had multiple primer sets in the same tube) and could discriminate among Chlamydia pneumoniae, Chlamydia psittaci, and Chlamydia tra...

  7. Multiplex polymerase chain reaction (PCR) on a SU-8 chip

    DEFF Research Database (Denmark)

    Christensen, Troels Balmer; Bang, Dang Duong; Wolff, Anders

    2008-01-01

    We present the detection of Campylobacter at species level using multiplex PCR in a micro fabricated PCR chip. The chip is based on the polymer SU-8 that allows integration with different microfluidic components, e.g., sample pre-treatment before PCR, and DNA detection simultaneously with or afte...

  8. Multiplex polymerase chain reaction (PCR) assay for simultaneous ...

    African Journals Online (AJOL)

    Multiplex polymerase chain reaction (PCR) assay for simultaneous detection of shiga-like toxin ( stx 1 and stx 2), intimin (eae) and invasive plasmid antigen H ( ipaH ) genes in diarrheagenic Escherichia coli.

  9. Multiplex PCR for the identification of white Tuber species.

    Science.gov (United States)

    Amicucci, A; Guidi, C; Zambonelli, A; Potenza, L; Stocchi, V

    2000-08-15

    Species-specific primers selected from the internal transcribed spacer region sequence were used to set up a multiplex polymerase chain reaction (PCR) able to simultaneously identify the white truffle species Tuber magnatum, Tuber borchii, Tuber maculatum and Tuber puberulum. Furthermore, a primer specific for the competitive fungus Sphaerosporella brunnea was designed and added to the multiplex PCR set, allowing the detection of the Tuber species and the contaminant fungus in a one-step reaction.

  10. A multiplex PCR for detection of six viruses in ducks.

    Science.gov (United States)

    Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong

    2017-10-01

    In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.

  11. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  12. Computational tradeoffs in multiplex PCR assay design for SNP genotyping

    Directory of Open Access Journals (Sweden)

    Cantor Charles

    2005-07-01

    Full Text Available Abstract Background Multiplex PCR is a key technology for detecting infectious microorganisms, whole-genome sequencing, forensic analysis, and for enabling flexible yet low-cost genotyping. However, the design of a multiplex PCR assays requires the consideration of multiple competing objectives and physical constraints, and extensive computational analysis must be performed in order to identify the possible formation of primer-dimers that can negatively impact product yield. Results This paper examines the computational design limits of multiplex PCR in the context of SNP genotyping and examines tradeoffs associated with several key design factors including multiplexing level (the number of primer pairs per tube, coverage (the % of SNP whose associated primers are actually assigned to one of several available tube, and tube-size uniformity. We also examine how design performance depends on the total number of available SNPs from which to choose, and primer stringency criterial. We show that finding high-multiplexing/high-coverage designs is subject to a computational phase transition, becoming dramatically more difficult when the probability of primer pair interaction exceeds a critical threshold. The precise location of this critical transition point depends on the number of available SNPs and the level of multiplexing required. We also demonstrate how coverage performance is impacted by the number of available snps, primer selection criteria, and target multiplexing levels. Conclusion The presence of a phase transition suggests limits to scaling Multiplex PCR performance for high-throughput genomics applications. Achieving broad SNP coverage rapidly transitions from being very easy to very hard as the target multiplexing level (# of primer pairs per tube increases. The onset of a phase transition can be "delayed" by having a larger pool of SNPs, or loosening primer selection constraints so as to increase the number of candidate primer pairs

  13. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  14. Multiplex PCR to detect four different tomato-infecting pathogens.

    Science.gov (United States)

    Quintero-Vásquez, Gabriela Alejandra; Bazán-Tejeda, María Luisa; Martínez-Peñafiel, Eva; Kameyama-Kawabe, Luis; Bermúdez-Cruz, Rosa María

    2013-07-01

    This work was aimed to develop a multiplex PCR assay to detect infectious agents such as Clavibacter michiganensis subsp. michiganensis, Fusarium sp, Leveillula taurica, and begomoviruses in tomato (Solanum lycopersicum) plants. Specific primer sets of each pathogen were designed based on intergenic ribosomal RNA sequences for the first three, whereas for begomoviruses, primers were designed based on conserved regions. The design also considered that the length (200-800 bp) of the PCR products was resolvable by electrophoresis; thus 296, 380, 457, and 731 bp fragments for Clavibacter, Fusarium, Leveillula, and begomoviruses, respectively, were considered. PCR conditions were optimized to amplify all the products in a single tube from genomic DNA and circumvent PCR inhibitors from infected plants. Finally, when the multiplex PCR assay was tested with tomato plants infected with any of the four pathogens, specific PCR products confirmed the presence of the pathogens. Optimized PCR multiplex allowed for the accurate and simultaneous detection of Clavibacter, Fusarium, Leveillula, and begomoviruses in infected plants or seeds from tomato.

  15. Development of a multiplex PCR assay detecting 52 autosomal SNPs

    DEFF Research Database (Denmark)

    Sanchez Sanchez, Juan Jose; Phillips, C.; Børsting, Claus

    2006-01-01

    for amplifying 52 genomic DNA fragments, each containing one SNP, in a single tube, and accurately genotyping the PCR product mixture using two single base extension reactions. This multiplex approach reduces the cost of SNP genotyping and requires as little as 0.5 ng of genomic DNA to detect 52 SNPs. We used...

  16. Multiplex polymerase chain reaction (PCR) and fluorescence-based ...

    African Journals Online (AJOL)

    Multiplex polymerase chain reaction (PCR) and fluorescence-based capillary electrophoresis (CE) of blood and tissue samples have been used to distinguish between deer species such as red deer, sika deer, wapiti and reindeer. We constructed 4 species-specific primers by using the D-loop of mitochondrial DNA and ...

  17. Typing of Y chromosome SNPs with multiplex PCR methods

    DEFF Research Database (Denmark)

    Sanchez Sanchez, Juan Jose; Børsting, Claus; Morling, Niels

    2005-01-01

    We describe a method for the simultaneous typing of Y-chromosome single nucleotide polymorphism (SNP) markers by means of multiplex polymerase chain reaction (PCR) strategies that allow the detection of 35 Y chromosome SNPs on 25 amplicons from 100 to 200 pg of chromosomal deoxyribonucleic acid...

  18. Rapid detection of methicillin-resistant staphylococci by multiplex PCR

    African Journals Online (AJOL)

    Administrator

    2010-11-08

    Nov 8, 2010 ... Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification. Nucleic Acids Res. 16: 11141-11156. Fang H, Hedin G (2003). Rapid screening and identification of methicillin-resistant Staphylococcus aureus from clinical samples by selective-broth and real-time PCR assay.

  19. Multiplex PCR Tests for Detection of Pathogens Associated with Gastroenteritis

    OpenAIRE

    Zhang, Hongwei; Morrison, Scott; Tang, Yi-Wei

    2015-01-01

    A wide range of enteric pathogens can cause infectious gastroenteritis. Conventional diagnostic algorithms including culture, biochemical identification, immunoassay and microscopic examination are time consuming and often lack sensitivity and specificity. Advances in molecular technology have as allowed its use as clinical diagnostic tools. Multiplex PCR based testing has made its way to gastroenterology diagnostic arena in recent years. In this article we present a review of recent laborato...

  20. Multiplex PCR Assay for Identification of Human Diarrheagenic Escherichia coli

    OpenAIRE

    Toma, Claudia; Lu, Yan; Higa, Naomi; Nakasone, Noboru; Chinen, Isabel; Baschkier, Ariela; Rivas, Marta; Iwanaga, Masaaki

    2003-01-01

    A multiplex PCR assay for the identification of human diarrheagenic Escherichia coli was developed. The targets selected for each category were eae for enteropathogenic E. coli, stx for Shiga toxin-producing E. coli, elt and est for enterotoxigenic E. coli, ipaH for enteroinvasive E. coli, and aggR for enteroaggregative E. coli. This assay allowed the categorization of a diarrheagenic E. coli strain in a single reaction tube.

  1. Detection of diarrheagenic Escherichia coli by multiplex PCR

    Directory of Open Access Journals (Sweden)

    A Hegde

    2012-01-01

    Full Text Available Background: Diarrheagenic E.coli (DEC are an important cause of childhood diarrhea.Identification of DEC strains needs to detect factors that determine the virulence of these organisms. There is not much data regarding the importance of DEC as a cause of diarrhea in children in India.The prevalence of DEC in children belowfive years with and without diarrhea was studied using two multiplex PCR assays. Materials and Methods: Two multiplex polymerase chain reaction assays were used to detect genes of five types of DEC.The targets selected for each category were eae and bfpA (bundle-forming pilus forEnteropathogenic E.coli (EPEC, hlyA for Enterohemorrhagic E.coli (EHEC, elt and stla for Enterotoxigenic E.coli (ETEC, CVD432 for Enteroaggregative E.coli (EAEC and ial for Enteroinvasive E.coli (EIEC. Results: In 200 children with diarrhea 52 (26% DEC infections were found. Among 100 controls 8 (8% DEC infections were found. EAEC was the most common DEC by multiplex PCR both in cases (26, 13%and controls (5,5%, followed byEPEC seen in 16% cases and 3% controls. ETEC and EIEC were found in 7 (3.5% and 3 (1.5% of the diarrheal cases. EIEC and ETEC were not detected in the control cases. EHEC was not isolated from either the diarrheal or control cases. Conclusion: DEC strains are a significant cause of diarrhea in children. The two Multiplex PCR assays can be used for the detection of DEC in routine diagnostic laboratories. These assays are specific and sensitive for the rapid detection of DEC. EAEC was the most frequent pathotype in the population under study.

  2. Optimization of ultrahigh-speed multiplex PCR for forensic analysis.

    Science.gov (United States)

    Gibson-Daw, Georgiana; Crenshaw, Karin; McCord, Bruce

    2018-01-01

    In this paper, we demonstrate the design and optimization of an ultrafast PCR amplification technique, used with a seven-locus multiplex that is compatible with conventional capillary electrophoresis systems as well as newer microfluidic chip devices. The procedure involves the use of a high-speed polymerase and a rapid cycling protocol to permit multiplex PCR amplification of forensic short tandem repeat loci in 6.5 min. We describe the selection and optimization of master mix reagents such as enzyme, buffer, MgCl 2 , and dNTPs, as well as primer ratios, total volume, and cycle conditions, in order to get the best profile in the shortest time possible. Sensitivity and reproducibility studies are also described. The amplification process utilizes a small high-speed thermocycler and compact laptop, making it portable and potentially useful for rapid, inexpensive on-site genotyping. The seven loci of the multiplex were taken from conventional STR genotyping kits and selected for their size and lack of overlap. Analysis was performed using conventional capillary electrophoresis and microfluidics with fluorescent detection. Overall, this technique provides a more rapid method for rapid sample screening of suspects and victims. Graphical abstract Rapid amplification of forensic DNA using high speed thermal cycling followed by capillary or microfluidic electrophoresis.

  3. A visual multiplex PCR microchip with easy sample loading.

    Science.gov (United States)

    Chen, Jian-Wei; Shao, Ning; Zhang, Yuchen; Zhu, Yuanshou; Yang, Litao; Tao, Sheng-Ce

    2017-06-20

    There is an urgent demand for affordable, rapid and easy-to-use technology to simultaneously detect many different DNA targets within one reaction. Conventional multiplex PCR is an effective methodology to simultaneously amplify different DNA targets. However, its multiplicity is limited due to the intrinsic interference and competition among primer pairs within one tube. Here, we present an easy multiplex PCR microchip system, which can simultaneously detect 54 targets. The design of the microchip is quite simple. There is a microchannel connected with multiple underlying parallel microwells. And every microchannel has an inlet/outlet for loading PCRmix. The surface of the microchannel is hydrophobic and the inner surface of the microwell is hydrophilic, which enables us to load and separate the PCRmix into different microwells simultaneously. Different primer pairs and low melting agarose are pre-fixed in different microwells, and the microchip is assembled with top glass. The PCRmix is loaded into inlets and then mineral oil is sequentially pipetted into channels to push the PCRmix into all microwells and subsequently mineral oil fills the channels to avoid cross contaminations. After the PCRmix is loaded, it would be placed on a plat thermal cycler for PCR. During PCR, the low melting gel in the well is liquid and after PCR it would be solidified due to temperature changes. When PCR is completed, a nucleic acid dye is introduced into channels and then results are visualized by a home-made, potable UV detector. In our platform we successfully detected seven frequently used targets of genetically modified (GM) organisms. The results demonstrate that our platform has high flexibility and specificity. Due to the excellent performance of this technology, we believe that it can be applied to multiple nucleic acid detection fields including GM organisms.

  4. Evaluation of dual priming oligonucleotide-based multiplex PCR for detection of HBV YMDD mutants.

    Science.gov (United States)

    Woo, H Y; Park, H; Kim, B I; Jeon, W K; Kim, Y J

    2008-01-01

    We evaluated the usefulness of dual priming oligonucleotide (DPO)-based multiplex PCR, Seeplex HBV Lami-DR assay (Seegene Institute of Life Sciences, Seoul, Korea), to detect lamivudine-resistant HBV mutants in a comparison with the use of TRUGENE HBV genotyping and restriction fragment mass polymorphism (RFMP). Sera from 44 chronic hepatitis B patients were analyzed for the presence of mutations at codons 180 and 204 by performing DPO-based multiplex PCR, RFMP, and TRUGENE. The overall concordance rate among the three assays was 40.9% (18/44). Concordance rates between multiplex PCR and RFMP or multiplex PCR and TRUGENE were 61.4% (27/44) and 50.0% (22/44), respectively. In ten patients, multiplex PCR identified additional mutants not found using the other two methods. DPO-based multiplex PCR is a highly sensitive method to identify minor mutant populations and could be a practical tool in the monitoring of lamivudine resistance.

  5. Multiplex real-time PCR assay for Legionella species.

    Science.gov (United States)

    Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja

    2015-12-01

    Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Multiplex PCR testing for nine different sexually transmitted infections.

    Science.gov (United States)

    Kriesel, John D; Bhatia, Amiteshwar S; Barrus, Cammie; Vaughn, Mike; Gardner, Jordan; Crisp, Robert J

    2016-12-01

    Current sexually transmitted infection (STI) testing is not optimal due to delays in reporting or missed diagnoses due to a lack of comprehensive testing. The FilmArray® (BioFire Diagnostics, LLC, Salt Lake City, Utah) is a user-friendly, fully automated, multiplex PCR system that is being developed for rapid point-of-care use. A research-use-only STI panel including multiple PCR primer sets for each organism was designed to detect Chlamydia trachomatis, Neisseria gonorrhoeae, Treponema pallidum, Trichomonas vaginalis, Mycoplasma genitalium, Ureaplasma urealyticum, Haemophilus ducreyi, and herpes simplex virus (HSV) types 1 and 2. Standard clinical testing included Gram stain, nucleic acid amplification, wet mount examination, herpes simplex virus culture, and syphilis IgG. Standard clinical tests were not available for all the organisms tested by the FilmArray STI panel. Two hundred and ninety-five clinical specimens from 190 subjects were directly compared to standard testing. Urine (n = 146), urethral/cervical swabs (31), oral swabs (60), rectal swabs (43), and ulcer swabs (15) were tested. Among the tested samples, FilmArray detected C. trachomatis in 39 (13%), N. gonorrhoeae in 20 (7%), T. vaginalis in nine (3%), HSV 1 in five (2%), HSV 2 in five (2%), U. urealyticum in 36 (12%), M. genitalium in eight (3%), and T. pallidum in 11 (4%). Concordance between the FilmArray STI panel and standard nucleic acid amplification testing for C. trachomatis was 98% and for N. gonorrhoeae was 97%. Multiplex PCR STI testing has the potential to improve public health by providing rapid, sensitive, and reliable results within the clinic or nearby laboratory. © The Author(s) 2016.

  7. Large scale multiplex PCR improves pathogen detection by DNA microarrays

    Directory of Open Access Journals (Sweden)

    Krönke Martin

    2009-01-01

    Full Text Available Abstract Background Medium density DNA microchips that carry a collection of probes for a broad spectrum of pathogens, have the potential to be powerful tools for simultaneous species identification, detection of virulence factors and antimicrobial resistance determinants. However, their widespread use in microbiological diagnostics is limited by the problem of low pathogen numbers in clinical specimens revealing relatively low amounts of pathogen DNA. Results To increase the detection power of a fluorescence-based prototype-microarray designed to identify pathogenic microorganisms involved in sepsis, we propose a large scale multiplex PCR (LSplex PCR for amplification of several dozens of gene-segments of 9 pathogenic species. This protocol employs a large set of primer pairs, potentially able to amplify 800 different gene segments that correspond to the capture probes spotted on the microarray. The LSplex protocol is shown to selectively amplify only the gene segments corresponding to the specific pathogen present in the analyte. Application of LSplex increases the microarray detection of target templates by a factor of 100 to 1000. Conclusion Our data provide a proof of principle for the improvement of detection of pathogen DNA by microarray hybridization by using LSplex PCR.

  8. Design of Two Multiplex PCR Assays for Serotyping Shigella flexneri.

    Science.gov (United States)

    van der Ploeg, Claudia A; Rogé, Ariel D; Bordagorría, Ximena L; de Urquiza, Maria T; Celi Castillo, Ana B; Bruno, Susana B

    2017-10-10

    Shigella flexneri is a major health problem in developing countries. There are 19 serotypes recognized based on O-antigen structure and its typing is important for epidemiological purposes. However, the diversity of serotypes and the difficulties presented by phenotypic serotyping, for example, unavailable antisera for less common antigens, require the implementation of molecular techniques. In this study, we developed two multiplex PCR assays targeting the O-antigen synthesis genes and the O-antigen modification genes, for the rapid identification of S. flexneri serotypes 1/7, 2, 4, 5, and 6 (PCR A) and serotype 7 and group antigenic factors (3,4; 6; 7,8; E1037) (PCR B). A total of 73 S. flexneri strains representing 18 serotypes, except serotype 1d, were used in the study. Specific amplification patterns were obtained for each of the different serotypes. All strains tested had concordant results with phenotypic and genotypic serotyping; therefore, its implementation in the microbiology clinical laboratory will significantly improve S. flexneri serotyping.

  9. Multiplex PCR assay for direct identification of group B streptococcal alpha-protein-like protein genes.

    Science.gov (United States)

    Creti, Roberta; Fabretti, Francesca; Orefici, Graziella; von Hunolstein, Christina

    2004-03-01

    We developed a group B streptococcus multiplex PCR assay which allows, by direct analysis of the amplicon size, determination of the surface protein antigen genes of alpha-C protein, epsilon protein, Rib, Alp2, Alp3, and Alp4. The multiplex PCR assay offers a rapid and simple method of subtyping Streptococcus agalactiae based on surface protein genes.

  10. Multiplex PCR for the assignment of some major branches of the Y ...

    Indian Academy of Sciences (India)

    Unknown

    genetic recombination during meioses, it is a powerful tool in phylogenetic studies. In order to increase the pro- ductivity of such studies, the first choice will be to study simultaneously more SNPs in a single multiplex PCR reaction. Two papers concerning the use of multiplex PCR in the study of the human Y chromosome ...

  11. Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus.

    Science.gov (United States)

    Milheiriço, Catarina; Oliveira, Duarte C; de Lencastre, Hermínia

    2007-09-01

    Staphylococcal cassette chromosome mec (SCCmec) typing is important for the identification and definition of methicillin-resistant Staphylococcus aureus clones, and for routine purposes, multiplex PCR assays are the most adequate for SCCmec typing. Here, we describe an update to the multiplex PCR strategy for SCCmec typing that we described in 2002 so that SCCmec types IV and V may be properly identified.

  12. Validation of the multiplex PCR for identification of Brucella spp.

    Directory of Open Access Journals (Sweden)

    Lívia de Lima Orzil

    2016-05-01

    Full Text Available ABSTRACT: A multiplex PCR technique for detection of Brucella spp. in samples of bacterial suspension was validated as a complementary tool in the diagnosis of the disease. This technique allows the characterization of the agent without performing biochemical tests, which greatly reduces the time for a final diagnosis, and provides more security for the analyst by reducing the time of exposure to microorganisms. The validation was performed in accordance with the Manual of Diagnostic Tests from OIE (2008 and following the requirements present in the ABNT NBR ISO/IEC 17025:2005. The mPCR validated in this study identified the different species of Brucella ( Brucella abortus , B. suis , B. ovis e B. melitensis of bacterial suspension obtained from the slaughterhouse samples, as well as distinguished the biovars (1, 2 e 4; 3b, 5, 6 e 9 of B. abortus in grouped form and differentiated the field strains from vaccine strains, as a quick, useful and less expensive technique in diagnosis of brucellosis in Brazil.

  13. Oncogenic human papillomavirus genotyping by multiplex PCR and fragment analysis.

    Science.gov (United States)

    Souho, Tiatou; Bennani, Bahia

    2014-02-01

    Human papillomavirus (HPV) detection and genotyping are determinant in cervical cancer prevention. They help to identify women at risk and allow the establishment of epidemiologic profiles. Many PCR-based genotyping methods have been developed. They require many steps or specialized equipment increasing the assay duration and cost. This affects their routine use, especially in developing countries. Therefore, the aim of this study was to develop a new HPV genotyping method that can be routinely used also in low incomes countries. For this purpose, fifteen high risk HPV type specific reverse primers were designed on L1 gene and fluorescently labeled. These primers were used on two multiplex PCR with one common forward primer (MY11). The lengths of products were revealed by capillary electrophoresis. This technique identifies sixteen high risk HPVs (types 16, 18, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 68, 73 and 82). It was optimized on HPV genome plasmids and evaluated on artificial and cervical samples. All the sixteen targeted genotypes were identified specifically and repeatedly in simple and multiple infections in both artificial and clinical samples. The developed technique is sensitive, specific, easy to perform and appropriate for routine laboratory use and high throughput screening programs. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Robust SNP genotyping by multiplex PCR and arrayed primer extension

    Directory of Open Access Journals (Sweden)

    Podder Mohua

    2008-01-01

    Full Text Available Abstract Background Arrayed primer extension (APEX is a microarray-based rapid minisequencing methodology that may have utility in 'personalized medicine' applications that involve genetic diagnostics of single nucleotide polymorphisms (SNPs. However, to date there have been few reports that objectively evaluate the assay completion rate, call rate and accuracy of APEX. We have further developed robust assay design, chemistry and analysis methodologies, and have sought to determine how effective APEX is in comparison to leading 'gold-standard' genotyping platforms. Our methods have been tested against industry-leading technologies in two blinded experiments based on Coriell DNA samples and SNP genotype data from the International HapMap Project. Results In the first experiment, we genotyped 50 SNPs across the entire 270 HapMap Coriell DNA sample set. For each Coriell sample, DNA template was amplified in a total of 7 multiplex PCRs prior to genotyping. We obtained good results for 41 of the SNPs, with 99.8% genotype concordance with HapMap data, at an automated call rate of 94.9% (not including the 9 failed SNPs. In the second experiment, involving modifications to the initial DNA amplification so that a single 50-plex PCR could be achieved, genotyping of the same 50 SNPs across each of 49 randomly chosen Coriell DNA samples allowed extremely robust 50-plex genotyping from as little as 5 ng of DNA, with 100% assay completion rate, 100% call rate and >99.9% accuracy. Conclusion We have shown our methods to be effective for robust multiplex SNP genotyping using APEX, with 100% call rate and >99.9% accuracy. We believe that such methodology may be useful in future point-of-care clinical diagnostic applications where accuracy and call rate are both paramount.

  15. Modified multiplex PCR methods for comprehensive detection of Pectinatus and beer-spoilage cocci.

    Science.gov (United States)

    Iijima, Kazumaru; Asano, Shizuka; Suzuki, Koji; Ogata, Tomoo; Kitagawa, Yasushi

    2008-10-01

    Specific PCR primers were designed based on the 16S rRNA genes of recently proposed beer-spoilage species, Pectinatus haikarae, Megasphaera sueciensis, and M. paucivorans, and two sets of our previously reported multiplex PCR methods for Pectinatus spp. and beer-spoilage cocci were reconstructed. Each modified multiplex PCR method was found specifically to detect beer-spoilage species of Pectinatus and cocci, including new species.

  16. [Multiplex quantitative PCR detection for female carrier in an X-linked ichthyosis family].

    Science.gov (United States)

    Zhu, Hai-yan; Li, Hai-bo; Wu, Ling-qian; Zhu, Xiang-yu; Li, Jie; Yang, Ying; Zhu, Rui-fang; Wu, Xing; Duan, Hong-lei; Zhang, Ying; Hu, Ya-li

    2008-12-16

    To analyze the pathogenic mutation of an X-linked ichthyosis (XLI) family, and identify the genetic diagnosis of three probable female carriers in this family. To evaluate the availability of different detect methods for steroid sulfatase (STS) gene mutation. Peripheral blood samples were collected from the family, including the proband, proband's mother, younger sister, and younger female cousin, and 10 males and 10 females as controls. Ordinary PCR was used to detect whether there was STS gene deletion in the male proband. Then, multiplex quantitative fluorescent PCR (QF-PCR) was used to detect the STS gene in the proband and his 3 female family members. Fluorescence in situ hybridization (FISH) was used to authenticate the results of multiplex QF-PCR method. No amplified product of the exons 1-10 of STS gene deletion was detected by ordinary PCR in the proband. The proband's mother was diagnosed as a carrier, but his sister and cousin were diagnosed as normal females by multiplex QF-PCR. FISH confirmed the results of multiplex QF-PCR. Both multiplex QF-PCR and FISH are effective to detect the complete deletion mutation of STS gene and identify the female carrier, and multiplex QF-PCR is more convenient and automatic compared with FISH.

  17. [Detection of Staphylococcus aureus, Shigella spp., Salmonella spp. in food by multiplex PCR].

    Science.gov (United States)

    Li, Bo; Chen, Fusheng; Wang, Xiaohong; Shao, Yanchun

    2008-07-01

    To establish a multiplex PCR method for simultaneous detection of Staphylococcus aureus, Shigella spp., Salmonella spp. in food. Staphylococcus aureus was enriched by 7.5% NaCl broth while Shigella spp. and Salmonella spp. were enriched by GN medium . The primers were designed according to the gene nuc of Staphylococcus aureus, the gene ipaH of Shigella spp. and the gene invA of Salmonella spp. The target genes of these pathogens in food were amplified by multiplex PCR, which reaction conditions were optimized specifically. The multiplex PCR method established in this experment was of high specificity, which detection limit was 1 cfu/ml of Staphylococcus aureus, Shigella spp. and Salmonella spp. when the milk samples contaminated with these pathogens. The multiplex PCR method, which was rapid, convenient, and with high sensitivity, could be suitable for rapid detection of Staphylococcus aureus, Shigella spp., Salmonella spp. in food, and could have a great prospect.

  18. Capsular typing of Streptococcus agalactiae (Lancefield group B streptococci) from fish using multiplex PCR and serotyping

    Science.gov (United States)

    Streptococcus spp. including Streptococcus agalactiae (Lancefield group B streptococci) are considered emerging pathogens responsible for approximately $1 billion USD in annual losses to the global tilapia (Oreochromis sp.) aquaculture industry. This study evaluated a published multiplex PCR capsul...

  19. A multiplex RT-PCR for rapid and simultaneous detection of viruses and viroids in chrysanthemum.

    Science.gov (United States)

    Song, A; You, Y; Chen, F; Li, P; Jiang, J; Chen, S

    2013-01-01

    Chrysanthemum plants are subject to serious virus diseases, so detection and identification of virus pathogens is important to prevent the virus spread. A reliable one-step multiplex RT-PCR was developed to simultaneously detect two viruses and two viriods: chrysanthemum virus B, tomato Aspermy virus, chrysanthemum stunt viroid and chrysanthemum chlorotic mottle viroid. In addition, we investigated the detection limit and the efficiency of single and multiplex RT-PCR assays. The results showed that the multiplex RT-PCR assay proved to be as sensitive as the single one. In conclusion, this technique is potentially useful in routine diagnosis of chrysanthemum viruses and viroids. The multiplex RT-PCR assay described in this study is the first report of simultaneous detection of virus and viroid in chrysanthemum, which provides a fast, convenient, cost-saving way to detect the virus and viroid mixed infections in plants. © 2012 The Society for Applied Microbiology.

  20. gyrB Multiplex PCR To Differentiate between Acinetobacter calcoaceticus and Acinetobacter Genomic Species 3 ▿

    OpenAIRE

    Higgins, Paul G.; Lehmann, Marlene; Wisplinghoff, Hilmar; Seifert, Harald

    2010-01-01

    A previously established multiplex PCR that identifies to the species level Acinetobacter baumannii and Acinetobacter genomic species 13TU (GS13TU) was expanded to include Acinetobacter calcoaceticus and Acinetobacter genomic species 3.

  1. Design of a multiplex PCR assay for the simultaneous detection and confirmation of Neisseria gonorrhoeae.

    LENUS (Irish Health Repository)

    O'Callaghan, Isabelle

    2010-05-01

    To improve the detection of Neisseria gonorrhoeae by designing a multiplex PCR assay using two N gonorrhoeae-specific genes as targets, thereby providing detection and confirmation of a positive result simultaneously.

  2. Detection and differentiation of Burkholderia pseudomallei, Burkholderia mallei and Burkholderia thailandensis by multiplex PCR.

    Science.gov (United States)

    Lee, May-Ann; Wang, Dongling; Yap, Eu Hian

    2005-03-01

    Burkholderia pseudomallei, a Gram-negative bacterium that causes melioidosis may be differentiated from closely related species of Burkholderia mallei that causes glanders and non-pathogenic species of Burkholderia thailandensis by multiplex PCR. The multiplex PCR consists of primers that flank a 10-bp repetitive element in B. pseudomallei and B. mallei amplifying PCR fragment of varying sizes between 400-700 bp, a unique sequence in B. thailandensis amplifying a PCR fragment of 308 bp and the metalloprotease gene amplifying a PCR fragment of 245 bp in B. pseudomallei and B. thailandensis. The multiplex PCR not only can differentiate the three Burkholderia species but can also be used for epidemiological typing of B. pseudomallei and B. mallei strains.

  3. Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.

    Science.gov (United States)

    Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing

    2018-02-01

    The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.

  4. Application of Multiplex RT-PCR for Detection of Cucurbit-infecting Tobamovirus

    OpenAIRE

    Daryono, Budi Setiadi; Natsuaki, Keiko T.

    2016-01-01

    Cucumber green mottle mosaic virus (CGMMV) and Kyuri green mottle mosaic virus (KGMMV) are seed borne viruses and they are also transmitted mechanically during agricultural practice and through water. Hence, these viruses have potential diseases widely distributed throughout the world. To detect different strains of CGMMV and KGMMV, several specific primers for each virus were designed for single and multiplex RT-PCR. The results of single and multiplex RT-PCR showed that CGMMV was detected i...

  5. Development of multiplex-PCR assay for rapid detection of Candida spp.

    Directory of Open Access Journals (Sweden)

    Ni Made A. Tarini

    2010-05-01

    Full Text Available Aim Candida spp. infection commonly occur in immunocompromised patients. Biochemical assay for identification of Candida spp. is time-consuming and shows many undetermined results. Specific detection for antibody, antigen and metabolites of Candida spp. had low sensitivity and specificity. In this study, we developed a rapid diagnostic method, Multiplex-PCR, to identify Candida spp.Methods Five Candida spp. isolates were cultured, identifi ed with germ tube and API® 20 C AUX (BioMerieux® SA kit. Furthermore, DNA was purified by QIAamp DNA mini (Qiagen® kit for Multiplex-PCR assay.Results DNA detection limit by Multiplex-PCR assays for C. albicans, C. tropicalis, C. parapsilosis, C. krusei and C. glabrata were 4 pg, 0.98 pg, 0.98 pg, 0.5 pg and 16 pg respectively. This assay was also more sensitive than culture in that Multiplex-PCR could detect 2.6-2.9 x 100 CFU/ml, whereas culture 2.6-2.9 x 102 CFU/ml.Conclusion Multiplex-PCR is much more sensitive than culture and thus, can be recommended as a sensitive and specific assay for identification of Candida spp. (Med J Indones 2010; 19:83-7Keywords: Candida spp., multiplex-PCR

  6. Simplified development of multiplex real-time PCR through master mix augmented by universal fluorogenic reporters.

    Science.gov (United States)

    Wadle, Simon; Lehnert, Michael; Schuler, Friedrich; Köppel, René; Serr, Annerose; Zengerle, Roland; von Stetten, Felix

    2016-01-01

    Mediator probe (MP) PCR is a real-time PCR approach that uses standardized universal fluorogenic reporter oligonucleotides (UR) in conjunction with label-free sequence-specific probes. To enable multiplex real-time MP PCR, we designed a set of five optimized URs with different fluorescent labels. Performance of the optimized URs was verified in multiplex real-time MP PCR for the detection of a pentaplex food panel and a quadruplex methicillin-resistant Staphylococcus aureus (MRSA) panel. Results were comparable to corresponding multiplex hydrolysis probe (HP) PCR, also designated as TaqMan PCR. Analyses of MRSA DNA standards and DNA extracted from patient swab samples showed improved lower limits of detection (LoDs) by a factor of 2-5 when using quadruplex real-time MP PCR instead of HP PCR. The novel set of standardized URs we present here simplifies development of multiplex real-time PCR assays by requiring only the design of label-free probes. In the future, real-time PCR master mixes could be augmented with up to five standardized fluorogenic URs, each emitting light at a different wavelength.

  7. Multiplex enrichment quantitative PCR (ME-qPCR): a high-throughput, highly sensitive detection method for GMO identification.

    Science.gov (United States)

    Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang

    2017-04-01

    Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for

  8. Use of Multiplex PCR and PCR Restriction Enzyme Analysis for Detection and Exploration of the Variability in the Free-Living Amoeba Naegleria in the Environment

    Science.gov (United States)

    Pélandakis, Michel; Pernin, Pierre

    2002-01-01

    A multiplex PCR was developed to simultaneously detect Naegleria fowleri and other Naegleria species in the environment. Multiplex PCR was also capable of identifying N. fowleri isolates with internal transcribed spacers of different sizes. In addition, restriction fragment length polymorphism analysis of the PCR product distinguished the main thermophilic Naegleria species from the sampling sites. PMID:11916734

  9. High throughput multiplex PCR and probe-based detection with Luminex beads for seven intestinal parasites.

    Science.gov (United States)

    Taniuchi, Mami; Verweij, Jaco J; Noor, Zannatun; Sobuz, Shihab U; Lieshout, Lisette van; Petri, William A; Haque, Rashidul; Houpt, Eric R

    2011-02-01

    Polymerase chain reaction (PCR) assays for intestinal parasites are increasingly being used on fecal DNA samples for enhanced specificity and sensitivity of detection. Comparison of these tests against microscopy and copro-antigen detection has been favorable, and substitution of PCR-based assays for the ova and parasite stool examination is a foreseeable goal for the near future. One challenge is the diverse list of protozoan and helminth parasites. Several existing real-time PCR assays for the major intestinal parasites-Cryptosporidium spp., Giardia intestinalis, Entamoeba histolytica, Ancylostoma duodenale, Ascaris lumbricoides, Necator americanus, and Strongyloides stercoralis-were adapted into a high throughput protocol. The assay involves two multiplex PCR reactions, one with specific primers for the protozoa and one with specific primers for the helminths, after which PCR products are hybridized to beads linked to internal oligonucleotide probes and detected on a Luminex platform. When compared with the parent multiplex real-time PCR assays, this multiplex PCR-bead assay afforded between 83% and 100% sensitivity and specificity on a total of 319 clinical specimens. In conclusion, this multiplex PCR-bead protocol provides a sensitive diagnostic screen for a large panel of intestinal parasites.

  10. A multiplex real-time PCR assay for routine diagnosis of bacterial vaginosis

    NARCIS (Netherlands)

    Kusters, J. G.; Reuland, E. A.; Bouter, S.; Koenig, P.; Dorigo-Zetsma, J. W.

    2015-01-01

    A semi-quantitative multiplex PCR assay for the diagnosis of bacterial vaginosis (BV) was evaluated in a prospective study in a population of Dutch women with complaints of abnormal vaginal discharge. The PCR targets Gardnerella vaginalis, Atopobium vaginae, Megasphaera phylotype 1, Lactobacillus

  11. Development of touch down-multiplex PCR for the diagnosis of toxoplasmosis

    Directory of Open Access Journals (Sweden)

    V Hallur

    2015-01-01

    Full Text Available Purpose: The diagnosis of toxoplasmosis is challenging since conventional methods like culture and immunofluorescence are not universally available. Serology, which is used regularly might be negative during early phase of infection and in immunosuppressed patients or may remain positive for a long time. Several molecular tests have been used for the diagnosis of toxoplasmosis, but none of them have an internal control which would inform us regarding the presence of polymerase chain reaction (PCR inhibitors thus, undermining the confidence of a laboratory physician. Materials and Methods: We designed a multiplex PCR containing primers targeting human beta globin gene which would act as internal control and two primers against the B1 gene and 5s gene which aid in sensitive detection of T. gondii. Results: Multiplex PCR had a sensitivity of 83.3% and specificity of 100%. Conclusion: Multiplex PCR may provide a sensitive and specific tool for diagnosis of human toxoplasmosis.

  12. Comparison of multiplex-PCR and antigen detection for differential diagnosis of Entamoeba histolytica

    Directory of Open Access Journals (Sweden)

    Helena Lúcia Carneiro Santos

    Full Text Available Amebiasis is an infection caused by Entamoeba histolytica. However, differentiation between E. histolytica and Entamoeba dispar, which are morphologically identical species, is essential for treatment decision, precaution of the invasive disease and public health. The purpose of the present study was to evaluate a Multiplex -PCR for detection and differentiation of E. histolytica from E. dispar from fresh stool samples in comparison with the coproantigen commercial ELISA. Microscopic examination of stools using the Coprotest method, detection of stool antigen by enzyme-linked immunosorbent assay kit and a home made Multiplex-PCR, were used for the diagnosis of amoebiasis infection. Analysis of the 127 stools samples by microscopy examination demonstrated that only 27 (21% samples were positive for E. histolytica/E. dispar complex. Among these stool samples, 11 were positive by Multiplex-PCR, with nine presenting the diagnostic fragment characteristic of E. dispar (96 bp and two presenting diagnostic fragment of E. histolytica (132 bp. Among negative samples detected by microscopic examination, three positive samples for E. dispar and one positive for E. histolytica by Multiplex-PCR was observed. This denotes a low sensibility of microscopic examination when a single stool sample is analyzed. Assay for detection of E. histolytica antigen was concordant with multiplex-PCR in relation to E. histolytica. Statistical analysis comparing the sensibility tests was not done because of the low number of E. histolytica cases. The results demonstrate the importance of the specific techniques use for the differentiation between E. histolytica and E. dispar.

  13. Detection of sexually transmitted infection and human papillomavirus in negative cytology by multiplex-PCR

    Directory of Open Access Journals (Sweden)

    Chung Hyun-Jae

    2010-09-01

    Full Text Available Abstract Background The aim of this study was to determine the prevalence of human papillomavirus (HPV and 15 species that cause sexually transmitted infections (STIs in negative cytology. In addition, we compared the diagnostic performance of multiplex polymerase chain reaction (PCR with widely available techniques used to detect HPV. Methods We recruited 235 women of reproductive age who had negative cytology findings in a liquid-based cervical smear. STIs were identified by multiplex PCR, and HPV genotypes by multiplex PCR, hybrid capture 2, and DNA microaray; discordant results were analyzed by direct sequencing. Results Approximately 96.6% of patients with negative cytology results were positive for pathogens that cause STIs. The pathogens most frequently detected were Gardnerella vaginalis, Ureaplasma urealyticum. The incidence of HPV in negative cytology was 23.3%. Low-risk HPV infection was significantly correlated with Chalmaydia trachomatis, and high-risk HPV infection was significantly correlated with Group β streptococcus. The analytical sensitivities of the multiplex PCR and DNA microarray were higher than 80%, and the analytical specificity was nearly 100% for all tests. Conclusions Multiplex PCR yielded results that most of patients with negative cytology were positive for pathogens that cause STIs, and were more similar to that of DNA microarray, than that of hybrid capture 2 in terms of analytical sensitivity and prediction value of HPV infection.

  14. Development of a multiplex PCR for the genetic analysis of paddlefish (Polyodon spathula Walbaum,1792 populations

    Directory of Open Access Journals (Sweden)

    K. Kurta

    2017-12-01

    Full Text Available Purpose. Paddlefish is commercially important species owing to its biological features and consumer characteristics, namely it produces valuable and delicious fish products, such as high quality meat and black caviar. Consequently, its cultivation under Ukrainian fish farm conditions and further realization in domestic and foreign markets are economically efficient. However, the paddlefish broodstock in Ukraine requires the efficient solution of increasing its productivity, identification and assessment of its genetic variation. Thus, the aim of our study was to develop and implement a multiplex PCR-analysis of paddlefish (Polyodon spathula for population-genetic monitoring of its artificial broodstocks in Ukraine. Methodology. A multiplex PCR was used for the study. The multiplex PCR development was performed for four microsatellite DNA markers: Psp12, Psp21, Psp26 and Psp28. Each investigated DNA loci, for which the multiplex PCR was optimized, was selected in such a way that the colored PCR products labeled with fluorescent dye did not overlap the length of the amplified fragments. Evaluation of the multiplex PCR effectiveness and processing of the data were performed by fragment analysis of DNA on the genetic analyzer ABI Prism 3130 (Applied Biosystem, USA. The size of the identified alleles was determined using the "Gene Mapper 3.7" program (Applied Biosystems, USA and LIZ-500 size standard (Applied Biosystems, USA. Results. Based on the results of capillary electrophoresis of multiplex PCR products, it was found that the amplified fragments for each of the four studied loci: Psp12, Psp21, Psp26 and Psp28 in one PCR reaction were within the expected size range. Data analysis on the electrophoregram demonstrated that Psp21 had the highest peak intensity at 611 fluorescent units (FU and the lowest peak intensity at 105 FU was observed for Psp26 locus. In the multiplex PCR after proper interpretation of the data we identified heterozygous

  15. A new trilocus sequence-based multiplex-PCR to detect major Acinetobacter baumannii clones.

    Science.gov (United States)

    Martins, Natacha; Picão, Renata Cristina; Cerqueira-Alves, Morgana; Uehara, Aline; Barbosa, Lívia Carvalho; Riley, Lee W; Moreira, Beatriz Meurer

    2016-08-01

    A collection of 163 Acinetobacter baumannii isolates detected in a large Brazilian hospital, was potentially related with the dissemination of four clonal complexes (CC): 113/79, 103/15, 109/1 and 110/25, defined by University of Oxford/Institut Pasteur multilocus sequence typing (MLST) schemes. The urge of a simple multiplex-PCR scheme to specify these clones has motivated the present study. The established trilocus sequence-based typing (3LST, for ompA, csuE and blaOXA-51-like genes) multiplex-PCR rapidly identifies international clones I (CC109/1), II (CC118/2) and III (CC187/3). Thus, the system detects only one (CC109/1) out of four main CC in Brazil. We aimed to develop an alternative multiplex-PCR scheme to detect these clones, known to be present additionally in Africa, Asia, Europe, USA and South America. MLST, performed in the present study to complement typing our whole collection of isolates, confirmed that all isolates belonged to the same four CC detected previously. When typed by 3LST-based multiplex-PCR, only 12% of the 163 isolates were classified into groups. By comparative sequence analysis of ompA, csuE and blaOXA-51-like genes, a set of eight primers was designed for an alternative multiplex-PCR to distinguish the five CC 113/79, 103/15, 109/1, 110/25 and 118/2. Study isolates and one CC118/2 isolate were blind-tested with the new alternative PCR scheme; all were correctly clustered in groups of the corresponding CC. The new multiplex-PCR, with the advantage of fitting in a single reaction, detects five leading A. baumannii clones and could help preventing the spread in healthcare settings. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. A Multiplex PCR for Detection of Mycoplasma pneumoniae, Chlamydophila pneumoniae, Legionella pneumophila, and Bordetella pertussis in Clinical Specimens

    National Research Council Canada - National Science Library

    McDonough, E. A; Barrozo, C. P; Russell, K. L; Metzgar, D

    2005-01-01

    A multiplex PCR was developed that is capable of detecting four of the most important bacterial agents of atypical pneumophia, Mycaplasma pneumoniae, Chlamydophia pneumoniae, Legionella pneumophila...

  17. Multiplex PCR-based identification of Streptococcus canis, Streptococcus zooepidemicus and Streptococcus dysgalactiae subspecies from dogs.

    Science.gov (United States)

    Moriconi, M; Acke, E; Petrelli, D; Preziuso, S

    2017-02-01

    Streptococcus canis (S. canis), Streptococcus equi subspecies zooepidemicus (S. zooepidemicus) and Streptococcus dysgalactiae subspecies (S. dysgalactiae subspecies) are β-haemolytic Gram positive bacteria infecting animals and humans. S. canis and S. zooepidemicus are considered as two of the major zoonotic species of Streptococcus, while more research is needed on S. dysgalactiae subspecies bacteria. In this work, a multiplex-PCR protocol was tested on strains and clinical samples to detect S. canis, S. dysgalactiae subspecies and S. equi subspecies bacteria in dogs. All strains were correctly identified as S. canis, S. equi subspecies or S. dysgalactiae subspecies by the multiplex-PCR. The main Streptococcus species isolated from symptomatic dogs were confirmed S. canis. The multiplex-PCR protocol described is a rapid, accurate and efficient method for identifying S. canis, S. equi subspecies and S. dysgalactiae subspecies in dogs and could be used for diagnostic purposes and for epidemiological studies. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. A multiplex PCR for detection of genes encoding exfoliative toxins from Staphylococcus hyicus

    DEFF Research Database (Denmark)

    Andresen, Lars Ole; Ahrens, Peter

    2004-01-01

    Aims: To develop a multiplex PCR for detection of genes encoding the exfoliative toxins ExhA, ExhB, ExhC and ExhD from Staphylococcus hyicus and to estimate the prevalence of exfoliative toxins among Staph. hyicus isolates from Danish pig herds with exudative epidermitis (EE). Methods and Results......: A multiplex PCR employing specific primers for each of the genes encoding four different exfoliative toxins was developed and evaluated using a collection of Staph. hyicus with known toxin type and a number of other staphylococcal species. A total of 314 Staph. hyicus isolates from pigs with EE were screened...... by multiplex PCR and the combined results of the present and previous investigations showed that ExhA, ExhB, ExhC and ExhD was found in 20, 33, 18 and 22%, respectively, of 60 cases of EE investigated. Conclusions: This study has provided a new tool for detection of toxigenic Staph. hyicus and a more...

  19. A novel universal primer-multiplex-PCR method with sequencing gel electrophoresis analysis.

    Directory of Open Access Journals (Sweden)

    Wentao Xu

    Full Text Available In this study, a novel universal primer-multiplex-PCR (UP-M-PCR method adding a universal primer (UP in the multiplex PCR reaction system was described. A universal adapter was designed in the 5'-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP. PCR products were analyzed on sequencing gel electrophoresis (SGE which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on.

  20. A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

    Science.gov (United States)

    Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

    2012-01-01

    In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

  1. Designing multiplex PCR system of Campylobacter jejuni for efficient typing by improving monoplex PCR binary typing method.

    Science.gov (United States)

    Yamada, Kazuhiro; Ibata, Ami; Suzuki, Masahiro; Matsumoto, Masakado; Yamashita, Teruo; Minagawa, Hiroko; Kurane, Ryuichiro

    2015-01-01

    Campylobacter jejuni is responsible for the majority of Campylobacter infections. As the molecular epidemiological study of outbreaks, pulsed-field gel electrophoresis (PFGE) is performed in general. But PFGE has several problems. PCR binary typing (P-BIT) method is a typing method for Campylobacter spp. that was recently developed, and was reported to have a similar discriminatory power and stability to those of PFGE. We modified the P-BIT method from 18 monoplex PCRs to two multiplex PCR systems (mP-BIT). The same results were obtained from monoplex PCRs using original primers and multiplex PCR in the representative isolates. The mP-BIT can analyze 48 strains at a time by using 96-well PCR systems and can identify C. jejuni because mP-BIT includes C. jejuni marker. The typing of the isolates by the mP-BIT and PFGE demonstrated generally concordant results and the mP-BIT method (D = 0.980) has a similar discriminatory power to that of PFGE with SmaI digest (D = 0.975) or KpnI digest (D = 0.987) as with original article. The mP-BIT method is quick, simple and easy, and comes to be able to perform it at low cost by having become a multiplex PCR system. Therefore, the mP-BIT method with two multiplex PCR systems has high potential for a rapid first-line surveillance typing assay of C. jejuni and can be used for routine surveillance and outbreak investigations of C. jejuni in the future. Copyright © 2014 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  2. Diagnostic accuracy study of multiplex PCR for detecting tuberculosis drug resistance.

    Science.gov (United States)

    Molina-Moya, B; Lacoma, A; Prat, C; Pimkina, E; Diaz, J; García-Sierra, N; Haba, L; Maldonado, J; Samper, S; Ruiz-Manzano, J; Ausina, V; Dominguez, J

    2015-08-01

    To study the diagnostic accuracy of a multiplex real-time PCR (Anyplex II MTB/MDR/XDR, Seegene, Corea) that detects Mycobacterium tuberculosis resistant to isoniazid (INH), rifampicin (RIF), fluoroquinolones (FLQ) and injectable drugs (kanamycin [KAN], amikacin [AMK] and capreomycin [CAP]) in isolates and specimens. One hundred fourteen cultured isolates and 73 sputum specimens were retrospectively selected. Results obtained with multiplex PCR were compared with those obtained with BACTEC. Discordant results between multiplex PCR and BACTEC were tested by alternative molecular methods. Sensitivity and specificity of multiplex PCR for detecting drug resistance in isolates were 76.5% and 100%, respectively, for INH; 97.2% and 96.0%, respectively, for RIF; 70.4% and 87.9%, respectively, for FLQ; 81.5% and 84.8%, respectively, for KAN; 100% and 60%, respectively, for AMK, and 100% and 72.3%, respectively, for CAP. Sensitivity and specificity of Anyplex for detecting drug resistance in specimens were 93.3% and 100%, respectively, for INH; 100% and 100%, respectively, for RIF; 50.0% and 100%, respectively, for FLQ; and 100% and 94.4%, respectively, for both KAN and CAP. Among the discordant results, 87.7% (71/81) of results obtained with the multiplex PCR were concordant with at least one of the alternative molecular methods. This multiplex PCR may be a useful tool for the rapid identification of drug resistant tuberculosis in isolates and specimens, thus allowing an initial therapeutic approach. Nevertheless, for a correct management of patients, results should be confirmed by a phenotypic method. Copyright © 2015 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  3. Universal Multiplex PCR: a novel method of simultaneous amplification of multiple DNA fragments

    Directory of Open Access Journals (Sweden)

    Wen Daxing

    2012-08-01

    Full Text Available Abstract Background Multiplex PCR has been successfully applied in many areas since it was first reported in 1988; however, it suffers from poor universality. Results A novel method called Universal Multiplex PCR (UM-PCR was created, which simultaneously amplifies multiple target fragments from genomic DNA. The method has two steps. First, the universal adapter-F and universal adapter-R are connected to the forward primers and the reverse primers, respectively. Hairpin structures and cross dimers of five pairs of adapter-primers are detected. Second, UM-PCR amplification is implemented using a novel PCR procedure termed “Two Rounds Mode” (three and 28–32 cycles. The first round (the first three cycles is named the “One by One Annealing Round”. The second round (28–32 cycles combines annealing with extension. In the first two cycles of the first round, primers only amplify the specific templates; there are no templates for the universal adapters. The templates of universal adapters begin to be synthesized from the second cycle of the first round, and universal adapters and primers commence full amplification from the third cycle of the first round. Conclusions UM-PCR greatly improves the universality of multiplex PCR. UM-PCR could rapidly detect the genetic purity of maize seeds. In addition, it could be applied in other areas, such as analysis of polymorphisms, quantitative assays and identifications of species.

  4. Comparison of multiplex reverse transcription-PCR-enzyme ...

    African Journals Online (AJOL)

    Mervat Gamal Eldin Mansour

    transcription-PCR-enzyme hybridization assay and immunofluorescence antigen detection techniques for the detection of four viral respiratory ... processing but has questionable sensitivity. In this study, our aim was to ... RT-PCR, positive RNA controls from all four viruses were assayed in the presence of all primer pairs ...

  5. Rapid detection of methicillin-resistant staphylococci by multiplex PCR

    African Journals Online (AJOL)

    A rapid and sensitive method for excluding the presence of methicillin-resistant Staphylococcus aureus (MRSA) in clinical samples was developed. The combination of MRSA detection by mecA coaA PCR with prior enrichment in selective broth was tested for 300 swabs. PCR identified 26 MRSApositive samples, ...

  6. Realtime PCR is more sensitive than multiplex PCR for diagnosis and serotyping in children with culture negative pneumococcal invasive disease.

    Directory of Open Access Journals (Sweden)

    Chiara Azzari

    Full Text Available BACKGROUND: Pneumococcal serotyping is usually performed by Quellung reaction, considered the gold standard test. However the method cannot be used on culture-negative samples. Molecular methods can be a useful alternative. The aim of the study was to evaluate the use of Multiplex-sequential-PCR (MS-PCR or Realtime-PCR on blood samples for diagnosis and serotyping of invasive pneumococcal disease (IPD in a pediatric clinical setting. METHODOLOGY/PRINCIPAL FINDINGS: Sensitivity and specificity of MS-PCR and Realtime-PCR have been evaluated both on 46 well characterized pneumococcal isolates and on 67 clinical samples from children with culture-negative IPD. No difference in sensitivity and specificity between MS-PCR and Realtime PCR was found when the methods were used on isolates: both methods could type 100% isolates and the results were always consistent with culture-based methods. On the contrary, when used on clinical samples 43/67 (64.2% were typeable by MS-PCR and 61/67 (91.0% by Realtime-PCR (p = 0.0004,K Cohen 0.3, McNemar's p<0.001. Non-typeability by MS-PCR was associated in 18/20 cases (90.0% with low bacterial load. The difference between the two methods was present both when they were used on normally sterile fluids (respectively 31/33 (93.9% typeable samples for Realtime-PCR and 24/33 (72.7% for MS-PCR, p = 0.047, 95%CL 0.03-0.98; K Cohen 0.3; McNemar's p = 0.0016 and when they were used on nasopharyngeal swabs (respectively 30/34 (88.2% typeable samples for Realtime-PCR and 19/34 (55.9% for MS-PCR, p = 0.007, 95%CL 0.04-0.66; the presence of multiple pneumococcal serotypes in nasopharyngeal swabs was found more frequently by Realtime PCR (19/30; 63.3% than by Multiplex-sequential PCR (3/19; 15.8%; p = 0.003;95%CL 1.87-39.97. CONCLUSIONS/SIGNIFICANCE: In conclusion, both MS-PCR and Realtime PCR can be used for pneumococcal serotyping of most serotypes/serogroups directly on clinical samples from culture-negative patients but

  7. Realtime PCR is more sensitive than multiplex PCR for diagnosis and serotyping in children with culture negative pneumococcal invasive disease.

    Science.gov (United States)

    Azzari, Chiara; Moriondo, Maria; Indolfi, Giuseppe; Cortimiglia, Martina; Canessa, Clementina; Becciolini, Laura; Lippi, Francesca; de Martino, Maurizio; Resti, Massimo

    2010-02-19

    Pneumococcal serotyping is usually performed by Quellung reaction, considered the gold standard test. However the method cannot be used on culture-negative samples. Molecular methods can be a useful alternative. The aim of the study was to evaluate the use of Multiplex-sequential-PCR (MS-PCR) or Realtime-PCR on blood samples for diagnosis and serotyping of invasive pneumococcal disease (IPD) in a pediatric clinical setting. Sensitivity and specificity of MS-PCR and Realtime-PCR have been evaluated both on 46 well characterized pneumococcal isolates and on 67 clinical samples from children with culture-negative IPD. No difference in sensitivity and specificity between MS-PCR and Realtime PCR was found when the methods were used on isolates: both methods could type 100% isolates and the results were always consistent with culture-based methods. On the contrary, when used on clinical samples 43/67 (64.2%) were typeable by MS-PCR and 61/67 (91.0%) by Realtime-PCR (p = 0.0004,K Cohen 0.3, McNemar's p<0.001). Non-typeability by MS-PCR was associated in 18/20 cases (90.0%) with low bacterial load. The difference between the two methods was present both when they were used on normally sterile fluids (respectively 31/33 (93.9%) typeable samples for Realtime-PCR and 24/33 (72.7%) for MS-PCR, p = 0.047, 95%CL 0.03-0.98; K Cohen 0.3; McNemar's p = 0.0016) and when they were used on nasopharyngeal swabs (respectively 30/34 (88.2%) typeable samples for Realtime-PCR and 19/34 (55.9%) for MS-PCR, p = 0.007, 95%CL 0.04-0.66); the presence of multiple pneumococcal serotypes in nasopharyngeal swabs was found more frequently by Realtime PCR (19/30; 63.3%) than by Multiplex-sequential PCR (3/19; 15.8%; p = 0.003;95%CL 1.87-39.97). In conclusion, both MS-PCR and Realtime PCR can be used for pneumococcal serotyping of most serotypes/serogroups directly on clinical samples from culture-negative patients but Realtime-PCR appears more sensitive.

  8. Detection of respiratory bacterial pathogens causing atypical pneumonia by multiplex Lightmix®RT-PCR.

    Science.gov (United States)

    Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M

    2018-01-31

    Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensitivity as in-house singleplex RT-PCRs for pathogen detection. The Lightmix ® multiplex RT-PCR assay represents a low-cost, time-saving and accurate diagnostic tool with high throughput potential. The time-to-result using an automated DNA extraction device for respiratory specimens followed by multiplex RT-PCR detection was

  9. Development of a One-Step Multiplex PCR Assay for Differential Detection of Major Mycobacterium Species.

    Science.gov (United States)

    Chae, Hansong; Han, Seung Jung; Kim, Su-Young; Ki, Chang-Seok; Huh, Hee Jae; Yong, Dongeun; Koh, Won-Jung; Shin, Sung Jae

    2017-09-01

    The prevalence of tuberculosis continues to be high, and nontuberculous mycobacterial (NTM) infection has also emerged worldwide. Moreover, differential and accurate identification of mycobacteria to the species or subspecies level is an unmet clinical need. Here, we developed a one-step multiplex PCR assay using whole-genome analysis and bioinformatics to identify novel molecular targets. The aims of this assay were to (i) discriminate between the Mycobacterium tuberculosis complex (MTBC) and NTM using rv0577 or RD750, (ii) differentiate M. tuberculosis ( M. tuberculosis ) from MTBC using RD9, (iii) selectively identify the widespread M. tuberculosis Beijing genotype by targeting mtbk_20680 , and (iv) simultaneously detect five clinically important NTM ( M. avium , M. intracellulare , M. abscessus , M. massiliense , and M. kansasii ) by targeting IS 1311 , DT1, mass_3210 , and mkan_rs12360 An initial evaluation of the multiplex PCR assay using reference strains demonstrated 100% specificity for the targeted Mycobacterium species. Analytical sensitivity ranged from 1 to 10 pg for extracted DNA and was 10 3 and 10 4 CFU for pure cultures and nonhomogenized artificial sputum cultures, respectively, of the targeted species. The accuracy of the multiplex PCR assay was further evaluated using 55 reference strains and 94 mycobacterial clinical isolates. Spoligotyping, multilocus sequence analysis, and a commercial real-time PCR assay were employed as standard assays to evaluate the multiplex PCR assay with clinical M. tuberculosis and NTM isolates. The PCR assay displayed 100% identification agreement with the standard assays. Our multiplex PCR assay is a simple, convenient, and reliable technique for differential identification of MTBC, M. tuberculosis , M. tuberculosis Beijing genotype, and major NTM species. Copyright © 2017 American Society for Microbiology.

  10. Multiplex PCR for Detection of Botulinum Neurotoxin-Producing Clostridia in Clinical, Food, and Environmental Samples▿

    Science.gov (United States)

    De Medici, Dario; Anniballi, Fabrizio; Wyatt, Gary M.; Lindström, Miia; Messelhäußer, Ute; Aldus, Clare F.; Delibato, Elisabetta; Korkeala, Hannu; Peck, Michael W.; Fenicia, Lucia

    2009-01-01

    Botulinum neurotoxin (BoNT), the most toxic substance known, is produced by the spore-forming bacterium Clostridium botulinum and, in rare cases, also by some strains of Clostridium butyricum and Clostridium baratii. The standard procedure for definitive detection of BoNT-producing clostridia is a culture method combined with neurotoxin detection using a standard mouse bioassay (SMB). The SMB is highly sensitive and specific, but it is expensive and time-consuming and there are ethical concerns due to use of laboratory animals. PCR provides a rapid alternative for initial screening for BoNT-producing clostridia. In this study, a previously described multiplex PCR assay was modified to detect all type A, B, E, and F neurotoxin genes in isolated strains and in clinical, food, environmental samples. This assay includes an internal amplification control. The effectiveness of the multiplex PCR method for detecting clostridia possessing type A, B, E, and F neurotoxin genes was evaluated by direct comparison with the SMB. This method showed 100% inclusivity and 100% exclusivity when 182 BoNT-producing clostridia and 21 other bacterial strains were used. The relative accuracy of the multiplex PCR and SMB was evaluated using 532 clinical, food, and environmental samples and was estimated to be 99.2%. The multiplex PCR was also used to investigate 110 freshly collected food and environmental samples, and 4 of the 110 samples (3.6%) were positive for BoNT-encoding genes. PMID:19684163

  11. Multiplex PCR for detection of botulinum neurotoxin-producing clostridia in clinical, food, and environmental samples.

    Science.gov (United States)

    De Medici, Dario; Anniballi, Fabrizio; Wyatt, Gary M; Lindström, Miia; Messelhäusser, Ute; Aldus, Clare F; Delibato, Elisabetta; Korkeala, Hannu; Peck, Michael W; Fenicia, Lucia

    2009-10-01

    Botulinum neurotoxin (BoNT), the most toxic substance known, is produced by the spore-forming bacterium Clostridium botulinum and, in rare cases, also by some strains of Clostridium butyricum and Clostridium baratii. The standard procedure for definitive detection of BoNT-producing clostridia is a culture method combined with neurotoxin detection using a standard mouse bioassay (SMB). The SMB is highly sensitive and specific, but it is expensive and time-consuming and there are ethical concerns due to use of laboratory animals. PCR provides a rapid alternative for initial screening for BoNT-producing clostridia. In this study, a previously described multiplex PCR assay was modified to detect all type A, B, E, and F neurotoxin genes in isolated strains and in clinical, food, environmental samples. This assay includes an internal amplification control. The effectiveness of the multiplex PCR method for detecting clostridia possessing type A, B, E, and F neurotoxin genes was evaluated by direct comparison with the SMB. This method showed 100% inclusivity and 100% exclusivity when 182 BoNT-producing clostridia and 21 other bacterial strains were used. The relative accuracy of the multiplex PCR and SMB was evaluated using 532 clinical, food, and environmental samples and was estimated to be 99.2%. The multiplex PCR was also used to investigate 110 freshly collected food and environmental samples, and 4 of the 110 samples (3.6%) were positive for BoNT-encoding genes.

  12. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    , in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...... of newly designed primers targeting Salmonella spp. at subtype level were incorporated in the multiplex Direct PCR. To maximize the efficiency of the Direct PCR, the ratio between sample and dilution buffer was optimized. The sensitivity and specificity of the multiplex Direct PCR were tested using...... and integration into a point-of-need Lab-on-a-chip system for rapid online pathogen detection....

  13. Simultaneous Detection of Genetically Modified Organisms in a Mixture by Multiplex PCR-Chip Capillary Electrophoresis.

    Science.gov (United States)

    Patwardhan, Supriya; Dasari, Srikanth; Bhagavatula, Krishna; Mueller, Steffen; Deepak, Saligrama Adavigowda; Ghosh, Sudip; Basak, Sanjay

    2015-01-01

    An efficient PCR-based method to trace genetically modified food and feed products is in demand due to regulatory requirements and contaminant issues in India. However, post-PCR detection with conventional methods has limited sensitivity in amplicon separation that is crucial in multiplexing. The study aimed to develop a sensitive post-PCR detection method by using PCR-chip capillary electrophoresis (PCR-CCE) to detect and identify specific genetically modified organisms in their genomic DNA mixture by targeting event-specific nucleotide sequences. Using the PCR-CCE approach, novel multiplex methods were developed to detect MON531 cotton, EH 92-527-1 potato, Bt176 maize, GT73 canola, or GA21 maize simultaneously when their genomic DNAs in mixtures were amplified using their primer mixture. The repeatability RSD (RSDr) of the peak migration time was 0.06 and 3.88% for the MON531 and Bt176, respectively. The RSD (RSDR) of the Cry1Ac peak ranged from 0.12 to 0.40% in multiplex methods. The method was sensitive in resolving amplicon of size difference up to 4 bp. The PCR-CCE method is suitable to detect multiple genetically modified events in a composite DNA sample by tagging their event specific sequences.

  14. Species Identification of Fox-, Mink-, Dog-, and Rabbit-Derived Ingredients by Multiplex PCR and Real-Time PCR Assay.

    Science.gov (United States)

    Wu, Qingqing; Xiang, Shengnan; Wang, Wenjun; Zhao, Jinyan; Xia, Jinhua; Zhen, Yueran; Liu, Bang

    2017-10-25

    Various detection methods have been developed to date for identification of animal species. New techniques based on PCR approach have raised the hope of developing better identification methods, which can overcome the limitations of the existing methods. PCR-based methods used the mitochondrial DNA (mtDNA) as well as nuclear DNA sequences. In this study, by targeting nuclear DNA, multiplex PCR and real-time PCR methods were developed to assist with qualitative and quantitative analysis. The multiplex PCR was found to simultaneously and effectively distinguish four species (fox, dog, mink, and rabbit) ingredients by the different sizes of electrophoretic bands: 480, 317, 220, and 209 bp. Real-time fluorescent PCR's amplification profiles and standard curves showed good quantitative measurement responses and linearity, as indicated by good repeatability and coefficient of determination R 2  > 0.99. The quantitative results of quaternary DNA mixtures including mink, fox, dog, and rabbit DNA are in line with our expectations: R.D. (relative deviation) varied between 1.98 and 12.23% and R.S.D. (relative standard deviation) varied between 3.06 and 11.51%, both of which are well within the acceptance criterion of ≤ 25%. Combining the two methods is suitable for the rapid identification and accurate quantification of fox-, dog-, mink-, and rabbit-derived ingredients in the animal products.

  15. The validation of a 15 STR multiplex PCR for Cannabis species.

    Science.gov (United States)

    Köhnemann, Stephan; Nedele, Johanna; Schwotzer, Daniela; Morzfeld, Julia; Pfeiffer, Heidi

    2012-07-01

    Trade and acquisition of Cannabis drugs are illegal in many countries worldwide; nevertheless, crimes related with these drugs are a major problem for the investigative authorities. With this manuscript, we want to introduce a 15 short tandem repeat (STR) Cannabis marker set that can be amplified in one PCR reaction. This multiplex PCR is specific to Cannabis species and combines highly informative STR markers. The 15 STR multiplex is easy to use and was validated according to common laboratory quality standards. Due to the fact that a lot of Cannabis plants are cultivated by clonal propagation and may show aneuploidy, polyploidy or multiple gene loci, it is not possible to apply biostatistics that follow the Hardy-Weinberg law. However, this multiplex will help the police to trace back trade routes of drug syndicates or dealers and it can help to link Cannabis plants to a crime scene.

  16. A novel capillary electrophoresis-based multiplex PCR assay for detection of respiratory pathogens.

    Science.gov (United States)

    Stevenson, Jeffery B; Hymas, Weston C; Hillyard, David R

    2011-01-01

    The field of infectious disease testing has recently experienced rapid expansion in the number of multiplexed PCR-based assays available for detecting respiratory pathogens. This study provides a preliminary evaluation of a multiplex assay from Seegene that uses capillary electrophoresis as the detection platform for viral and bacterial respiratory pathogens. We compared this technology to a real-time PCR assay for 3 viral targets. Thirty respiratory samples were collected that had previously tested positive for either Flu A, Flu B, or RSV (ten of each). The Seegene assay detected 9/10 Flu A samples, 9/10 Flu B, and 10/10 RSV, for a total detection rate of 93%. The two samples that were undetected by the Seegene assay both generated late-crossing thresholds on the real-time platform, consistent with low viral loads. The Seeplex assay provides a promising alternative for multiplex respiratory testing.

  17. Standardization of a multiplex PCR for the identification of coagulase-positive Staphylococcus

    OpenAIRE

    Gandra,Eliezer Avila; Fernandez,Maria Aparecida; Silva,Jorge Adolfo; Silva,Wladimir Padilha da

    2011-01-01

    The enterotoxigenic species Staphylococcus aureus, S. hyicus and S. intermedius show very similar characteristics, making their identification through conventional microbiological methods difficult. This study aimed at the development of a Multiplex PCR (mPCR) for the identification of S. aureus, S. intermedius and S. hyicus using the nuc gene as the target sequence. The results obtained suggest that the set of primers used was specific for the three species of Staphylococcus evaluate with a ...

  18. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    OpenAIRE

    Nelly eDatukishvili; Tamara eKutateladze; Inga eGabriadze; Kakha eBitskinashvili; Boris eVishnepolsky

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of C...

  19. [Evaluation of the efficacies of rapid antigen test, multiplex PCR, and real-time PCR for the detection of a novel influenza A (H1N1) virus].

    Science.gov (United States)

    Hwang, Yusun; Kim, Kyounghee; Lee, Miae

    2010-04-01

    In April 2009, a novel influenza A (H1N1) virus was detected in the US, and at the time of conducting this study, H1N1 infection had reached pandemic proportions. In Korea, rapid antigen tests and PCR assays have been developed to detect the H1N1 virus. We evaluated the efficacies of rapid antigen test, multiplex PCR, and real-time PCR for detecting the H1N1 virus. From August to September 2009, we tested 734 samples obtained from nasopharyngeal swab or nasal swab using rapid antigen test (SD Influenza Antigen, Standard Diagnostics, Inc., Korea) and multiplex PCR (Seeplex FluA ACE Subtyping, Seegene, Korea). We also tested 224 samples using the AdvanSure real-time PCR (LG Life Sciences, Korea) to compare the results obtained using real-time PCR with those obtained using multiplex PCR. Furthermore, 99 samples were tested using the AdvanSure real-time PCR and the AccuPower real-time PCR (Bioneer, Korea). In comparison with the results of multiplex PCR, the sensitivity and specificity of the rapid antigen test were 48.0% and 99.8%, respectively. The concordance rate for multiplex PCR and the AdvanSure real-time PCR was 99.6% (kappa=0.991, P=0.000), and that for the AdvanSure real-time PCR and the AccuPower real-time PCR was 97.0% (kappa=0.936, P=0.000). The rapid antigen test is significantly less sensitive than PCR assay; therefore, it is not useful for H1N1 detection; however multiplex PCR, the AdvanSure real-time PCR, and the Accu-Power real-time PCR can be useful for H1N1 detection.

  20. Real time quantitative amplification detection on a microarray: towards high multiplex quantitative PCR.

    NARCIS (Netherlands)

    Pierik, A.; Moamfa, M; van Zelst, M.; Clout, D.; Stapert, H.; Dijksman, Johan Frederik; Broer, D.; Wimberger-Friedl, R.

    2012-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) is widely used as a research and diagnostic tool. Notwithstanding its many powerful features, the method is limited in the degree of multiplexing to about 6 due to spectral overlap of the available fluorophores. A new method is presented that

  1. Nested-multiplex PCR detection of Orthopoxvirus and Parapoxvirus directly from exanthematic clinical samples

    Directory of Open Access Journals (Sweden)

    Trindade Giliane S

    2009-09-01

    Full Text Available Abstract Background Orthopoxvirus (OPV and Parapoxvirus (PPV have been associated with worldwide exanthematic outbreaks. Some species of these genera are able to infect humans and domestic animals, causing serious economic losses and public health impact. Rapid, useful and highly specific methods are required to detect and epidemiologically monitor such poxviruses. In the present paper, we describe the development of a nested-multiplex PCR method for the simultaneous detection of OPV and PPV species directly from exanthematic lesions, with no previous viral isolation or DNA extraction. Methods and Results The OPV/PPV nested-multiplex PCR was developed based on the evaluation and combination of published primer sets, and was applied to the detection of the target pathogens. The method showed high sensitivity, and the specificity was confirmed by amplicon sequencing. Exanthematic lesion samples collected during bovine vaccinia or contagious ecthyma outbreaks were submitted to OPV/PPV nested-multiplex PCR and confirmed its applicability. Conclusion These results suggest that the presented multiplex PCR provides a highly robust and sensitive method to detect OPV and PPV directly from clinical samples. The method can be used for viral identification and monitoring, especially in areas where OPV and PPV co-circulate.

  2. A multiplex PCR for detection of Listeria monocytogenes and its lineages.

    Science.gov (United States)

    Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B

    2016-11-01

    A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Multiplex PCR To Identify Macrolide Resistance Determinants in Mannheimia haemolytica and Pasteurella multocida

    DEFF Research Database (Denmark)

    Rose, Simon; Desmolaize, Benoit; Jaju, Puneet

    2012-01-01

    isolates of P. multocida and M. haemolytica and correlated with MICs for the veterinary macrolides tulathromycin and tilmicosin, and the newer compounds gamithromycin and tildipirosin. The multiplex PCR system gives a rapid and robustly accurate determination of macrolide resistance genotypes and bacterial...

  4. Multiplex PCR for Diagnosis of Enteric Infections Associated with Diarrheagenic Escherichia coli

    Science.gov (United States)

    Vidal, Roberto; Vidal, Maricel; Lagos, Rossana; Levine, Myron; Prado, Valeria

    2004-01-01

    A multiplex PCR for detection of three categories of diarrheagenic Escherichia coli was developed. With this method, enterohemorrhagic E. coli, enteropathogenic E. coli, and enterotoxigenic E. coli were identified in fecal samples from patients with hemorrhagic colitis, watery diarrhea, or hemolytic-uremic syndrome and from food-borne outbreaks. PMID:15071051

  5. RPE65 gene: multiplex PCR and mutation screening in patients from ...

    Indian Academy of Sciences (India)

    Unknown

    Medical and Vision Research Foundations, Sankara Nethralaya, Chennai 600 006, India. Abstract. We used multiplex PCR followed by sequencing to screen for mutations in the 14 exons of the RPE65 gene in early- childhood-onset autosomal recessive retinitis pigmentosa (arRP) and Leber's congenital amaurosis (LCA) ...

  6. RPE65 gene: multiplex PCR and mutation screening in patients from ...

    Indian Academy of Sciences (India)

    We used multiplex PCR followed by sequencing to screen for mutations in the 14 exons of the RPE65 gene in early-childhood-onset autosomal recessive retinitis pigmentosa (arRP) and Leber's congenital amaurosis (LCA) patients. The RPE65 protein is believed to play an important role in the metabolism of vitamin A in ...

  7. New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  8. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Directory of Open Access Journals (Sweden)

    Nelly eDatukishvili

    2015-07-01

    Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  9. Deletion-targeted multiplex PCR (DTM-PCR) for identification of Beijing/W genotypes of Mycobacterium tuberculosis.

    Science.gov (United States)

    Chen, Jing; Tsolaki, Anthony G; Shen, Xin; Jiang, Xi; Mei, Jian; Gao, Qian

    2007-09-01

    Beijing/W strains of Mycobacterium tuberculosis cause the vast majority of tuberculosis cases in Shanghai, China. Such highly prevalent strains are considered as hypervirulent and are often associated with multi-drug resistance, treatment failure and HIV status. We present a reliable and fast detection method to identify these Beijing/W strains, which can be applied to screening large numbers of samples at low cost. Using this Deletion-Targeted Multiplex PCR (DTM-PCR) method for detecting these strains, we obtained 100% sensitivity and specificity.

  10. Development of a multiplex-PCR probe system for the proper identification of Klebsiella variicola.

    Science.gov (United States)

    Garza-Ramos, Ulises; Silva-Sánchez, Jesús; Martínez-Romero, Esperanza; Tinoco, Perla; Pina-Gonzales, Marisol; Barrios, Humberto; Martínez-Barnetche, Jesús; Gómez-Barreto, Rosa Elena; Tellez-Sosa, Juan

    2015-03-13

    Klebsiella variicola was very recently described as a new bacterial species and is very closely related to Klebsiella pneumoniae; in fact, K. variicola isolates were first identified as K. pneumoniae. Therefore, it might be the case that some isolates, which were initially classified as K. pneumoniae, are actually K. variicola. The aim of this study was to devise a multiplex-PCR probe that can differentiate isolates from these sister species. This work describes the development of a multiplex-PCR method to identify K. variicola. This development was based on sequencing a K. variicola clinical isolate (801) and comparing it to other K. variicola and K. pneumoniae genomes. The phylogenetic analysis showed that K. variicola isolates form a monophyletic group that is well differentiated from K. pneumoniae. Notably, the isolate K. pneumoniae 342 and K. pneumoniae KP5-1 might have been misclassified because in our analysis, both clustered with K. variicola isolates rather than with K. pneumoniae. The multiplex-PCR (M-PCR-1 to 3) probe system could identify K. variicola with high accuracy using the shared unique genes of K. variicola and K. pneumoniae genomes, respectively. M-PCR-1 was used to assay a collection of multidrug-resistant (503) and antimicrobial-sensitive (557) K. pneumoniae clinical isolates. We found K. variicola with a prevalence of 2.1% (23/1,060), of them a 56.5% (13/23) of the isolates were multidrug resistant, and 43.5% (10/23) of the isolates were antimicrobial sensitive. The phylogenetic analysis of rpoB of K. variicola-positive isolates identified by multiplex-PCR support the correct identification and differentiation of K. variicola from K. pneumoniae clinical isolates. This multiplex-PCR provides the means to reliably identify and genotype K. variicola. This tool could be very helpful for clinical, epidemiological, and population genetics studies of this species. A low but significant prevalence of K. variicola isolates was found, implying that

  11. Multiplexed DNA sequence capture of mitochondrial genomes using PCR products.

    Directory of Open Access Journals (Sweden)

    Tomislav Maricic

    Full Text Available BACKGROUND: To utilize the power of high-throughput sequencers, target enrichment methods have been developed. The majority of these require reagents and equipment that are only available from commercial vendors and are not suitable for the targets that are a few kilobases in length. METHODOLOGY/PRINCIPAL FINDINGS: We describe a novel and economical method in which custom made long-range PCR products are used to capture complete human mitochondrial genomes from complex DNA mixtures. We use the method to capture 46 complete mitochondrial genomes in parallel and we sequence them on a single lane of an Illumina GA(II instrument. CONCLUSIONS/SIGNIFICANCE: This method is economical and simple and particularly suitable for targets that can be amplified by PCR and do not contain highly repetitive sequences such as mtDNA. It has applications in population genetics and forensics, as well as studies of ancient DNA.

  12. Improved detection of episomal Banana streak viruses by multiplex immunocapture PCR.

    Science.gov (United States)

    Le Provost, Grégoire; Iskra-Caruana, Marie-Line; Acina, Isabelle; Teycheney, Pierre-Yves

    2006-10-01

    Banana streak viruses (BSV) are currently the main viral constraint to Musa germplasm movement, genetic improvement and mass propagation. Therefore, it is necessary to develop and implement BSV detection strategies that are both reliable and sensitive, such as PCR-based techniques. Unfortunately, BSV endogenous pararetrovirus sequences (BSV EPRVs) are present in the genome of Musa balbisiana. They interfere with PCR-based detection of episomal BSV in infected banana and plantain, such as immunocapture PCR. Therefore, a multiplex, immunocapture PCR (M-IC-PCR) was developed for the detection of BSV. Musa sequence tagged microsatellite site (STMS) primers were selected and used in combination with BSV species-specific primers in order to monitor possible contamination by Musa genomic DNA, using multiplex PCR. Furthermore, immunocapture conditions were optimized in order to prevent Musa DNA from interfering with episomal BSV DNA during the PCR step. This improved detection method successfully allowed the accurate, specific and sensitive detection of episomal DNA only from distinct BSV species. Its implementation should benefit PCR-based detection of viruses for which homologous sequences are present in the genome of their hosts, including transgenic plants expressing viral sequences.

  13. A multiplex PCR assay for the detection and quantification of Sclerotinia sclerotiorum and Botrytis cinerea.

    Science.gov (United States)

    Reich, J D; Alexander, T W; Chatterton, S

    2016-05-01

    Traditional culture methods for identifying the plant fungal pathogens Sclerotinia sclerotiorum (Lib.) de Bary and Botrytis cinerea Pers.:Fr. are slow and laborious. The goal of this study was to develop a multiplex real-time PCR (qPCR) assay to detect and quantify DNA from S. sclerotiorum and B. cinerea. A primer set (SsIGS_5) for S. sclerotiorum was designed that targeted the intergenic spacer (IGS) regions of the ribosomal DNA. Addition of a probe to the assay increased its specificity: when the primer/probe set was tested against 21 fungal species (35 strains), amplification was detected from all S. sclerotiorum strains and no other species. For qPCR, the SsIGS_5 primer and probe set exhibited a linear range from 7·0 ng to 0·07 pg target DNA (R(2)  = 0·99). SsIGS_5 was then multiplexed with a previously published primer/probe set for B. cinerea to develop a high-throughput method for the detection and quantification of DNA from both pathogens. When multiplexed, the sensitivity and specificity of both assays were not different from individual qPCR reactions. The multiplex assay is currently being used to detect and quantify S. sclerotiorum and B. cinerea DNA from aerosol samples collected in commercial seed alfalfa fields. A primer and probe set for the quantification of Sclerotinia sclerotiorum DNA in a PCR assay was developed. The probe-based nature of this assay signifies an improvement over previous assays for this species by allowing multiplex reactions while maintaining high sensitivity. The primer/probe set was used in a multiplex real-time PCR assay for the quantification of S. sclerotiorum and Botrytis cinerea DNA, enabling rapid analysis of environmental samples. In crops susceptible to both pathogens, this multiplex assay can be used to quickly quantify the presence of each pathogen. © 2016 Her Majesty the Queen in Right of Canada © 2016 The Society for Applied Microbiology. Reproduced with the permission of the Office of the

  14. Simultaneous detection and differentiation of Campylobacter jejuni, C. coli, and C. lari in chickens by multiplex real-time PCR

    Science.gov (United States)

    A multiplex real-time PCR (qPCR) assay was developed to detect and differentiate the three most commonly found and harmful species of Campylobacter in a single PCR reaction. The qPCR primers and TaqMan probes were designed to amplify the unique DNA sequences of hipO, cdtA, and pepT genes which are s...

  15. SCAR makers and multiplex PCR-based rapid molecular typing of Lentinula edodes strains.

    Science.gov (United States)

    Wu, Xueqian; Li, Haibo; Zhao, Weiwei; Fu, Lizhong; Peng, Huazheng; He, Liang; Cheng, Junwen; Wei, Hailong; Wu, Qingqi

    2010-11-01

    Lentinula edodes is the second most important cultivated mushroom worldwide, the most commercial strains have been identified only through traditional phenotypic analysis. In this study, a simple rapid PCR-based molecular method was developed for distinguishing commercial strains of L. edodes by developing specific sequence characterized amplified region (SCAR) markers and establishing multiplex PCR assays with the SCAR primers. Derived from the randomly amplified polymorphic DNA (RAPD) and sequence-related amplified polymorphism (SRAP) techniques, 10 informative SCAR markers were generated from 10 polymorphic RAPD and SRAP bands. The differences in SCAR phenotypes among different strains made these SCAR markers potentially useful to characterize 6 strains and identify them from other studied strains. Moreover, different SCAR phenotypes also made the other 17 studied strains to be divided into four distinguishable groups. The multiplex PCR assays were further established for the joint use of some SCAR markers efficiently. Compared with some identification methods reported previously, the special feature of this new molecular method is technically rapid and convenient in the practical use and suitable for analyzing large numbers of samples. Thus, the simple rapid PCR-based molecular method can be used as a helpful assistant tool for the lentinula industry. To our knowledge, this study is the first to describe a development of a new SCAR maker-based multiplex PCR assay for rapid molecular typing of edible mushroom.

  16. Development of a multiplex PCR test for identification of Actinobacillus pleuropneumoniae serovars 1, 7, and 12

    DEFF Research Database (Denmark)

    Angen, Øystein; Ahrens, Peter; Jessing, Stine Graakjær

    2008-01-01

    test based on the omlA gene. The PCR test was evaluated with the serovar reference strains of A. pleuropneumoniae as well as 183 Danish field isolates. For all typable strains, a complete correspondence was found between results obtained with the multiplex PCR test and results from the traditional...... serotyping methods. Among eight serologically cross-reacting strains designated K1:O7, seven isolates produced amplicons of similar sizes as serovar 1 and one isolate produced amplicons of similar sizes as serovar 7. The species specificity of the assay was evaluated using a collection of 126 strains...... representing 25 different species within the family Pasteurellaceae including 45 field strains of the phylogenetically affiliated species Actinobacillus lignieresii. All these isolates tested negative for the cps genes by the multiplex PCR test except for 6 isolates of A. lignieresii. Five of these isolates...

  17. Rapid detection and differentiation of mycobacterial species using a multiplex PCR system

    Directory of Open Access Journals (Sweden)

    Andrea Santos Lima

    2013-07-01

    Full Text Available Introduction The early diagnosis of mycobacterial infections is a critical step for initiating treatment and curing the patient. Molecular analytical methods have led to considerable improvements in the speed and accuracy of mycobacteria detection. Methods The purpose of this study was to evaluate a multiplex polymerase chain reaction system using mycobacterial strains as an auxiliary tool in the differential diagnosis of tuberculosis and diseases caused by nontuberculous mycobacteria (NTM Results Forty mycobacterial strains isolated from pulmonary and extrapulmonary origin specimens from 37 patients diagnosed with tuberculosis were processed. Using phenotypic and biochemical characteristics of the 40 mycobacteria isolated in LJ medium, 57.5% (n=23 were characterized as the Mycobacterium tuberculosis complex (MTBC and 20% (n=8 as nontuberculous mycobacteria (NTM, with 22.5% (n=9 of the results being inconclusive. When the results of the phenotypic and biochemical tests in 30 strains of mycobacteria were compared with the results of the multiplex PCR, there was 100% concordance in the identification of the MTBC and NTM species, respectively. A total of 32.5% (n=13 of the samples in multiplex PCR exhibited a molecular pattern consistent with NTM, thus disagreeing with the final diagnosis from the attending physician. Conclusions Multiplex PCR can be used as a differential method for determining TB infections caused by NTM a valuable tool in reducing the time necessary to make clinical diagnoses and begin treatment. It is also useful for identifying species that were previously not identifiable using conventional biochemical and phenotypic techniques.

  18. On-Chip integration of sample pretreatment and Multiplex polymerase chain reaction (PCR) for DNA analysis

    DEFF Research Database (Denmark)

    Brivio, Monica; Snakenborg, Detlef; Søgaard, E.

    2008-01-01

    In this paper we present a modular lab-on-a-chip system for integrated sample pre-treatment (PT) by magnetophoresis and DNA amplification by polymerase chain reaction (PCR). It consists of a polymer-based microfluidic chip mounted on a custom-made thermocycler (Figure 1) and includes a simple...... and efficient method for switching the liquid flow between the PT and PCR chamber. Purification of human genomic DNA from EDTA-treated blood and multiplex PCR were successfully carried out on-chip using the developed lab-on-a-chip system....

  19. Detection of Bacillus sphaericus mosquitocidal toxin genes by multiplex colony PCR.

    Science.gov (United States)

    Jagtap, Santosh C; Jagtap, Chandrakant B; Kumar, Pradeep; Srivastava, R B

    2009-02-01

    A multiplex colony PCR assay was developed for the detection of 5 genes encoding Bacillus sphaericus mosquito larvicidal toxins, namely binA, binB, mtx1, mtx2, and mtx3. Primers designed for these 5 genes yielded specific PCR amplicons of the expected size from type cultures of B. sphaericus. This method of detecting multiple toxin genes by colony PCR in a single tube reaction is a simple, rapid, and economical technique for identification of highly toxic environmental B. sphaericus isolates.

  20. Development of multiplex real-time PCR assay for the detection of Brucella spp., Leptospira spp. and Campylobacter foetus

    Directory of Open Access Journals (Sweden)

    Abdelfattah M. Selim

    2014-12-01

    Full Text Available Abortion among dairy cattle is one of the major causes of economic losses in the livestock industry. This study describes a 1-step multiplex real-time polymerase chain reaction (PCR to detect Brucella spp., Leptospira spp. and Campylobacter foetus, these are significant bacteria commonly implicated in bovine abortion. ß-actin was added to the same PCR reaction as an internal control to detect any extraction failure or PCR inhibition. The detection limit of multiplex real-time PCR using purified DNA from cultured organisms was set to 5 fg for Leptospira spp. and C. foetus and to 50 fg for Brucella spp. The multiplex real-time PCR did not produce any non-specific amplification when tested with different strains of the 3 pathogens. This multiplex real-time PCR provides a valuable tool for diagnosis, simultaneous and rapid detection for the 3 pathogens causing abortion in bovine.

  1. Multiplex real-time PCR assays for detection of four seedborne spinach pathogens.

    Science.gov (United States)

    Feng, C; Mansouri, S; Bluhm, B H; du Toit, L J; Correll, J C

    2014-08-01

    To develop multiplex TaqMan real-time PCR assays for detection of spinach seedborne pathogens that cause economically important diseases on spinach. Primers and probes were designed from conserved sequences of the internal transcribed spacer (for Peronospora farinosa f. sp. spinaciae and Stemphylium botryosum), the intergenic spacer (for Verticillium dahliae) and the elongation factor 1 alpha (for Cladosporium variabile) regions of DNA. The TaqMan assays were tested on DNA extracted from numerous isolates of the four target pathogens, as well as a wide range of nontarget, related fungi or oomycetes and numerous saprophytes commonly found on spinach seed. Multiplex real-time PCR assays were evaluated by detecting two or three target pathogens simultaneously. Singular and multiplex real-time PCR assays were also applied to DNA extracted from bulked seed and single spinach seed. The real-time PCR assays were species-specific and sensitive. Singular or multiplex real-time PCR assays could detect target pathogens from both bulked seed samples as well as single spinach seed. The freeze-blotter assay that is currently routinely used in the spinach seed industry to detect and quantify three fungal seedborne pathogens of spinach (C. variabile, S. botryosum and V. dahliae) is quite laborious and takes several weeks to process. The real-time PCR assays developed in this study are more sensitive and can be completed in a single day. As the assays can be applied easily for routine seed inspections, these tools could be very useful to the spinach seed industry. © 2014 The Society for Applied Microbiology.

  2. Multiplex PCR Assay for Identifi cation and Differentiation of Campylobacter jejuni and Campylobacter coli Isolates.

    Science.gov (United States)

    Pavlova, Maria R; Dobreva, Elina G; Ivanova, Katucha I; Asseva, Galina D; Ivanov, Ivan N; Petrov, Peter K; Velev, Valeri R; Tomova, Ivelina I; Tiholova, Maida M; Kantardjiev, Todor V

    2016-01-01

    Campylobacter spp. are important causative agents of gastrointestinal infections in humans. The most frequently isolated strains of this bacterial genus are Campylobacter jejuni and Campylobacter coli. To date, genetic methods for bacterial identification have not been used in Bulgaria. We optimized the multiplex PSR assay to identify Campylobacter spp. and differentiate C. jejuni from C. coli in clinical isolates. We also compared this method with the routinely used biochemical methods. To identify Campylobacter spp. and discriminate C. coli from C. jejuni in clinical isolates using multiplex PCR assay. Between February 2014 and January 2015 we studied 93 stool samples taken from patients with diarrheal syndrome and identified 40 species of Campylobacter spp. in them. The clinical material was cultured in microaerophilic atmosphere, the isolated strains being biochemically diff erentiated (hydrolysis of sodium hippurate for C. jejuni, and hydrolysis of indoxyl acetate for C. coli). DNA was isolated from the strains using QiaAmp MiniKit (QIAGEN, Germany). Twenty strains were tested with multiplex PCR for the presence of these genes: cadF, characteristic for Campylobacter spp., hipO for C. jejuni and asp for C. coli. The biochemical tests identified 16 strains of C. jejuni, 3 strains of C. coli, and 1 strain of C. upsaliensis. After the multiplex PCR assay the capillary gel electrophoresis confirmed 16 strains of C. jejuni, 2 strains of C. coli and 2 strains of Campylobacter spp. - because of the presence of the gene cadF. C. jejuni has the gene hipO, and it is possible that this gene may not be expressed in the biochemical differentiation yielding a negative reaction as a result. In comparison, we can conclude that the genetic differentiation is a more accurate method than the biochemical tests. The multiplex PCR assay is a fast, accurate method for identifi cation of Campylobacter spp. which makes it quite necessary in the clinical diagnostic practice.

  3. Analytical Sensitivity Comparison between Singleplex Real-Time PCR and a Multiplex PCR Platform for Detecting Respiratory Viruses.

    Directory of Open Access Journals (Sweden)

    Jayme Parker

    Full Text Available Multiplex PCR methods are attractive to clinical laboratories wanting to broaden their detection of respiratory viral pathogens in clinical specimens. However, multiplexed assays must be well optimized to retain or improve upon the analytic sensitivity of their singleplex counterparts. In this experiment, the lower limit of detection (LOD of singleplex real-time PCR assays targeting respiratory viruses is compared to an equivalent panel on a multiplex PCR platform, the GenMark eSensor RVP. LODs were measured for each singleplex real-time PCR assay and expressed as the lowest copy number detected 95-100% of the time, depending on the assay. The GenMark eSensor RVP LODs were obtained by converting the TCID50/mL concentrations reported in the package insert to copies/μL using qPCR. Analytical sensitivity between the two methods varied from 1.2-1280.8 copies/μL (0.08-3.11 log differences for all 12 assays compared. Assays targeting influenza A/H3N2, influenza A/H1N1pdm09, influenza B, and human parainfluenza 1 and 2 were most comparable (1.2-8.4 copies/μL, <1 log difference. Largest differences in LOD were demonstrated for assays targeting adenovirus group E, respiratory syncytial virus subtype A, and a generic assay for all influenza A viruses regardless of subtype (319.4-1280.8 copies/μL, 2.50-3.11 log difference. The multiplex PCR platform, the GenMark eSensor RVP, demonstrated improved analytical sensitivity for detecting influenza A/H3 viruses, influenza B virus, human parainfluenza virus 2, and human rhinovirus (1.6-94.8 copies/μL, 0.20-1.98 logs. Broader detection of influenza A/H3 viruses was demonstrated by the GenMark eSensor RVP. The relationship between TCID50/mL concentrations and the corresponding copy number related to various ATCC cultures is also reported.

  4. Analytical Sensitivity Comparison between Singleplex Real-Time PCR and a Multiplex PCR Platform for Detecting Respiratory Viruses.

    Science.gov (United States)

    Parker, Jayme; Fowler, Nisha; Walmsley, Mary Louise; Schmidt, Terri; Scharrer, Jason; Kowaleski, James; Grimes, Teresa; Hoyos, Shanann; Chen, Jack

    2015-01-01

    Multiplex PCR methods are attractive to clinical laboratories wanting to broaden their detection of respiratory viral pathogens in clinical specimens. However, multiplexed assays must be well optimized to retain or improve upon the analytic sensitivity of their singleplex counterparts. In this experiment, the lower limit of detection (LOD) of singleplex real-time PCR assays targeting respiratory viruses is compared to an equivalent panel on a multiplex PCR platform, the GenMark eSensor RVP. LODs were measured for each singleplex real-time PCR assay and expressed as the lowest copy number detected 95-100% of the time, depending on the assay. The GenMark eSensor RVP LODs were obtained by converting the TCID50/mL concentrations reported in the package insert to copies/μL using qPCR. Analytical sensitivity between the two methods varied from 1.2-1280.8 copies/μL (0.08-3.11 log differences) for all 12 assays compared. Assays targeting influenza A/H3N2, influenza A/H1N1pdm09, influenza B, and human parainfluenza 1 and 2 were most comparable (1.2-8.4 copies/μL, <1 log difference). Largest differences in LOD were demonstrated for assays targeting adenovirus group E, respiratory syncytial virus subtype A, and a generic assay for all influenza A viruses regardless of subtype (319.4-1280.8 copies/μL, 2.50-3.11 log difference). The multiplex PCR platform, the GenMark eSensor RVP, demonstrated improved analytical sensitivity for detecting influenza A/H3 viruses, influenza B virus, human parainfluenza virus 2, and human rhinovirus (1.6-94.8 copies/μL, 0.20-1.98 logs). Broader detection of influenza A/H3 viruses was demonstrated by the GenMark eSensor RVP. The relationship between TCID50/mL concentrations and the corresponding copy number related to various ATCC cultures is also reported.

  5. Sensitive simultaneous detection of seven sexually transmitted agents in semen by multiplex-PCR and of HPV by single PCR.

    Directory of Open Access Journals (Sweden)

    Fabrícia Gimenes

    Full Text Available Sexually transmitted diseases (STDs may impair sperm parameters and functions thereby promoting male infertility. To date limited molecular studies were conducted to evaluate the frequency and type of such infections in semen Thus, we aimed at conceiving and validating a multiplex PCR (M-PCR assay for the simultaneous detection of the following STD pathogens in semen: Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, Herpes virus simplex (HSV -1 and -2, and Treponema pallidum; We also investigated the potential usefulness of this M-PCR assay in screening programs for semen pathogens. In addition, we aimed: to detect human Papillomavirus (HPV and genotypes by single PCR (sPCR in the same semen samples; to determine the prevalence of the seven STDs, HPV and co-infections; to assess the possibility that these infections affect semen parameters and thus fertility. The overall validation parameters of M-PCR were extremely high including agreement (99.2%, sensitivity (100.00%, specificity (99.70%, positive (96.40% and negative predictive values (100.00% and accuracy (99.80%. The prevalence of STDs was very high (55.3%. Furthermore, associations were observed between STDs and changes in semen parameters, highlighting the importance of STD detection in semen. Thus, this M-PCR assay has great potential for application in semen screening programs for pathogens in infertility and STD clinics and in sperm banks.

  6. Sensitive simultaneous detection of seven sexually transmitted agents in semen by multiplex-PCR and of HPV by single PCR.

    Science.gov (United States)

    Gimenes, Fabrícia; Medina, Fabiana Soares; Abreu, André Luelsdorf Pimenta de; Irie, Mary Mayumi Taguti; Esquiçati, Isis Baroni; Malagutti, Natália; Vasconcellos, Vinícius Rodrigo Bulla; Discacciati, Michele Garcia; Bonini, Marcelo Gialluisi; Maria-Engler, Silvya Stuchi; Consolaro, Marcia Edilaine Lopes

    2014-01-01

    Sexually transmitted diseases (STDs) may impair sperm parameters and functions thereby promoting male infertility. To date limited molecular studies were conducted to evaluate the frequency and type of such infections in semen Thus, we aimed at conceiving and validating a multiplex PCR (M-PCR) assay for the simultaneous detection of the following STD pathogens in semen: Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, Herpes virus simplex (HSV) -1 and -2, and Treponema pallidum; We also investigated the potential usefulness of this M-PCR assay in screening programs for semen pathogens. In addition, we aimed: to detect human Papillomavirus (HPV) and genotypes by single PCR (sPCR) in the same semen samples; to determine the prevalence of the seven STDs, HPV and co-infections; to assess the possibility that these infections affect semen parameters and thus fertility. The overall validation parameters of M-PCR were extremely high including agreement (99.2%), sensitivity (100.00%), specificity (99.70%), positive (96.40%) and negative predictive values (100.00%) and accuracy (99.80%). The prevalence of STDs was very high (55.3%). Furthermore, associations were observed between STDs and changes in semen parameters, highlighting the importance of STD detection in semen. Thus, this M-PCR assay has great potential for application in semen screening programs for pathogens in infertility and STD clinics and in sperm banks.

  7. Screening for circulating RAS/RAF mutations by multiplex digital PCR

    DEFF Research Database (Denmark)

    Andersen, Rikke Fredslund; Jakobsen, Anders

    2016-01-01

    by technical challenges primarily due to the low levels of ctDNA in patients with localized disease and in patients responding to therapy. The approach presented here is a multiplex digital PCR method of screening for 31 mutations in the KRAS, NRAS, BRAF, and PIK3CA genes in the plasma. The upper level...... of the limit of blank, which defines the specificity of the multiplexes, was 0.006%-0.06%. Mutations found by multiplex analyses were identified and quantified by duplex analyses. The method was tested on samples from cholangiocarcinoma patients with known tumor mutational status. Mutations found in the tumor...... were also found in plasma samples in all cases with analyses for all other mutations being negative. There was a perfect agreement as to wild type status in tumor and plasma. The method combines a high sensitivity with the ability to analyze for several mutations at a time and could be a step towards...

  8. A novel multiplex PCR for the simultaneous detection of Salmonella enterica and Shigella species

    Directory of Open Access Journals (Sweden)

    M. Radhika

    2014-06-01

    Full Text Available Salmonella enterica and Shigella species are commonly associated with food and water borne infections leading to gastrointestinal diseases. The present work was undertaken to develop a sensitive and reliable PCR based detection system for simultaneous detection of Salmonella enterica and Shigella at species level. For this the conserved regions of specific genes namely ipaH1, ipaH, wbgZ, wzy and invA were targeted for detection of Shigella genus, S. flexneri, S. sonnei, S. boydii and Salmonella enterica respectively along with an internal amplification control (IAC. The results showed that twenty Salmonella and eleven Shigella spp., were accurately identified by the assay without showing non-specificity against closely related other Enterobacteriaceae organisms and also against other pathogens. Further evaluation of multiplex PCR was undertaken on 50 natural samples of chicken, eggs and poultry litter and results compared with conventional culture isolation and identification procedure. The multiplex PCR identified the presence of Salmonella and Shigella strains with a short pre-enrichment step of 5 h in peptone water and the same samples were processed by conventional procedures for comparison. Therefore, this reported multiplex PCR can serve as an alternative to the tedious time-consuming procedure of culture and identification in food safety laboratories.

  9. A novel multiplex PCR for the simultaneous detection of Salmonella enterica and Shigella species.

    Science.gov (United States)

    Radhika, M; Saugata, Majumder; Murali, H S; Batra, H V

    2014-01-01

    Salmonella enterica and Shigella species are commonly associated with food and water borne infections leading to gastrointestinal diseases. The present work was undertaken to develop a sensitive and reliable PCR based detection system for simultaneous detection of Salmonella enterica and Shigella at species level. For this the conserved regions of specific genes namely ipaH1, ipaH, wbgZ, wzy and invA were targeted for detection of Shigella genus, S. flexneri, S. sonnei, S. boydii and Salmonella enterica respectively along with an internal amplification control (IAC). The results showed that twenty Salmonella and eleven Shigella spp., were accurately identified by the assay without showing non-specificity against closely related other Enterobacteriaceae organisms and also against other pathogens. Further evaluation of multiplex PCR was undertaken on 50 natural samples of chicken, eggs and poultry litter and results compared with conventional culture isolation and identification procedure. The multiplex PCR identified the presence of Salmonella and Shigella strains with a short pre-enrichment step of 5 h in peptone water and the same samples were processed by conventional procedures for comparison. Therefore, this reported multiplex PCR can serve as an alternative to the tedious time-consuming procedure of culture and identification in food safety laboratories.

  10. Identification of methicillin-resistant Staphylococcus aureus (MRSA) strains isolated from burn patients by multiplex PCR.

    Science.gov (United States)

    Montazeri, Effat Abbasi; Khosravi, Azar Dokht; Jolodar, Abbas; Ghaderpanah, Mozhgan; Azarpira, Samireh

    2015-05-01

    Methicillin-resistant Staphylococcus aureus (MRSA) and methicillin-resistant coagulase-negative staphylococci (MRCoNS) as important human pathogens are causes of nosocomial infections worldwide. Burn patients are at a higher risk of local and systemic infections with these microorganisms. A screening method for MRSA by using a multiplex polymerase chain reaction (PCR) targeting the 16S ribosomal RNA (rRNA), mecA, and nuc genes was developed. The aim of the present study was to investigate the potential of this PCR assay for the detection of MRSA strains in samples from burn patients. During an 11-month period, 230 isolates (53.11%) of Staphylococcus spp. were collected from burn patients. The isolates were identified as S. aureus by using standard culture and biochemical tests. DNA was extracted from bacterial colonies and multiplex PCR was used to detect MRSA and MRCoNS strains. Of the staphylococci isolates, 149 (64.9%) were identified as S. aureus and 81 (35.21%) were described as CoNS. Among the latter, 51 (62.97%) were reported to be MRCoNS. From the total S. aureus isolates, 132 (88.6%) were detected as MRSA and 17 (11.4%) were methicillin-susceptible S. aureus (MSSA). The presence of the mecA gene in all isolates was confirmed by using multiplex PCR as a gold standard method. This study presented a high MRSA rate in the region under investigation. The 16S rRNA-mecA-nuc multiplex PCR is a good tool for the rapid characterization of MRSA strains. This paper emphasizes the need for preventive measures and choosing effective antimicrobials against MRSA and MRCoNS infections in the burn units. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

  11. Multiplex nested PCR for detection of Xanthomonas axonopodis pv. allii from onion seeds.

    Science.gov (United States)

    Robène-Soustrade, Isabelle; Legrand, Delphine; Gagnevin, Lionel; Chiroleu, Frédéric; Laurent, Annie; Pruvost, Olivier

    2010-05-01

    Bacterial blight of onion (BBO) is an emerging disease that is present in many onion-producing areas. The causal agent, Xanthomonas axonopodis pv. allii, is seed transmitted. A reliable and sensitive diagnostic tool for testing seed health is needed. Detection of X. axonopodis pv. allii was achieved using a multiplex nested PCR assay developed using two randomly amplified polymorphic DNA (RAPD) and amplified fragment length polymorphism (AFLP) sequences corresponding to pilus assembly genes (pilW and pilX) and the avrRxv gene, respectively. The multiplex nested PCR was used with a large collection of X. axonopodis pv. allii strains pathogenic to onion and/or other Allium species isolated in different regions of the world. The internal primers used in the multiplex PCR assay directed amplification for all 86 X. axonopodis pv. allii strains tested, resulting in a 401-bp amplicon, a 444- to 447-bp amplicon, or both amplicons, depending on the strain. No amplification was obtained for 41 unrelated phytopathogenic bacteria and for 14 saprophytic bacteria commonly isolated from onion leaves and seeds. Most Xanthomonas strains also did not produce amplicons, except for nine strains classified in X. axonopodis genetic subgroup 9.1 or 9.2 and not pathogenic to onion. Nevertheless, sequence signatures distinguished most of these strains from X. axonopodis pv. allii. The assay detected X. axonopodis pv. allii in seed lots with contamination levels of 5 x 10(2) CFU g(-1) or higher. The sensitivity threshold of the multiplex nested PCR assay was found to be 1 infected seed in 27,340 seeds. This PCR-based assay should be useful for certifying that commercial seed lots are free of this important seed-borne pathogen.

  12. Rapid multiplex PCR assay to identify respiratory viral pathogens: moving forward diagnosing the common cold.

    Science.gov (United States)

    Layman, Clifton P; Gordon, Sarah M; Elegino-Steffens, Diane U; Agee, Willie; Barnhill, Jason; Hsue, Gunther

    2013-09-01

    Upper respiratory tract infections (URIs) can be a serious burden to the healthcare system. The majority of URIs are viral in etiology, but definitive diagnosis can prove difficult due to frequently overlapping clinical presentations of viral and bacterial infections, and the variable sensitivity, and lengthy turn-around time of viral culture. We tested new automated nested multiplex PCR technology, the FilmArray(®) system, in the TAMC department of clinical investigations, to determine the feasibility of replacing the standard viral culture with a rapid turn-around system. We conducted a feasibility study using a single-blinded comparison study, comparing PCR results with archived viral culture results from a convenience sample of cryopreserved archived nasopharyngeal swabs from acutely ill ED patients who presented with complaints of URI symptoms. A total of 61 archived samples were processed. Viral culture had previously identified 31 positive specimens from these samples. The automated nested multiplex PCR detected 38 positive samples. In total, PCR was 94.5% concordant with the previously positive viral culture results. However, PCR was only 63.4% concordant with the negative viral culture results, owing to PCR detection of 11 additional viral pathogens not recovered on viral culture. The average time to process a sample was 75 minutes. We determined that an automated nested multiplex PCR is a feasible alternative to viral culture in an acute clinical setting. We were able to detect at least 94.5% as many viral pathogens as viral culture is able to identify, with a faster turn-around time.

  13. Simultaneous detection of four foodborne viruses in food samples using a one-step multiplex reverse transcription PCR.

    Science.gov (United States)

    Lee, Shin-Young; Kim, Mi-Ju; Kim, Hyun-Joong; Jeong, KwangCheol Casey; Kim, Hae-Yeong

    2017-11-15

    A one-step multiplex reverse transcription PCR (RT-PCR) method comprising six primer sets (for the detection of norovirus GI and GII, hepatitis A virus, rotavirus, and astrovirus) was developed to simultaneously detect four kinds of pathogenic viruses. The size of the PCR products for norovirus GI and GII, hepatitis A virus (VP3/VP1 and P2A regions), rotavirus, and astrovirus were 330, 164, 244, 198, 629, and 449 bp, respectively. The RT-PCR with the six primer sets showed specificity for the pathogenic viruses. The detection limit of developed multiplex RT-PCR, as evaluated using serially diluted viral RNAs, was comparable to that of one-step single RT-PCR. Also, this multiplex RT-PCR was evaluated using food samples such as water, oysters, lettuce, and vegetable product. These food samples were artificially spiked with four kinds of viruses in diverse combinations, and the spiked viruses in all food samples were detected successfully.

  14. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  15. Detection of Lymnaea columella infection by Fasciola hepatica through Multiplex-PCR

    Directory of Open Access Journals (Sweden)

    Kelly Grace Magalhães

    2004-06-01

    Full Text Available From complete mitochondrial DNA sequence of Fasciola hepatica available in Genbank, specific primers were designed for a conserved and repetitive region of this trematode. A pair of primers was used for diagnosis of infected Lymnaea columella by F. hepatica during the pre-patent period simultaneously with another pair of primers which amplified the internal transcribed spacer (ITS region of rDNA from L. columella in a single Multiplex-PCR. The amplification generated a ladder band profile specific for F. hepatica. This profile was observed in positive molluscs at different times of infection, including adult worms from the trematode. The Multiplex-PCR technique showed to be a fast and safe tool for fascioliasis diagnosis, enabling the detection of F. hepatica miracidia in L. columella during the pre-patent period and identification of transmission areas.

  16. Multiplex real-time PCR for identification of canine parvovirus antigenic types.

    Science.gov (United States)

    Kaur, Gurpreet; Chandra, Mudit; Dwivedi, P N; Narang, Deepti

    2016-07-01

    Canine parvovirus (CPV) is an important disease causing gastroenteritis and/or haemorrhagic gastroenteritis in dogs. There are four antigenic types of CPV reported worldwide viz. CPV 2, CPV 2a, CPV 2b and CPV 2c. The diagnosis of CPV with the identification of the antigen type responsible remains problematic. In the present study, identification as well as antigenic typing of CPV was done using a de novo multiplex real time PCR to combat the problem of antigenic type identification. From the study it could be concluded that the here developed multiplex real time PCR assay could be used for rapid detection of CPV as well as typing of its three antigenic types. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Rapid identification and differentiation of Saccharomyces cerevisiae, Saccharomyces bayanus and their hybrids by multiplex PCR.

    Science.gov (United States)

    Torriani, S; Zapparoli, G; Malacrinò, P; Suzzi, G; Dellaglio, F

    2004-01-01

    To develop a multiplex PCR assay for the specific identification and differentiation of Saccharomyces cerevisiae, S. bayanus and their hybrids. Two sets of primers with sequences complementary to the region YBR033w were used. A single amplicon of 1710 bp or 329 bp was obtained with species S. cerevisiae and S. bayanus, respectively, while the presence of both bands was observed in S. pastorianus because of its hybrid nature. Both amplification products were also obtained after amplification from DNA of several laboratory S. cerevisiae x S. bayanus hybrid strains. Multiplex PCR was optimized for the rapid and reliable identification of S. cerevisiae, S. bayanus and their hybrids. The procedure may be used for routine detection of the most common Saccharomyces sensu stricto yeasts involved in industrial fermentation processes, overcoming the problems of conventional techniques.

  18. Candida albicans identification: comparison among nine phenotypic systems and a multiplex PCR.

    Science.gov (United States)

    Liguori, G; Di Onofrio, V; Gallé, F; Lucariello, A; Albano, L; Catania, M R; Guida, M

    2010-09-01

    Candida albicans is the most common fungal pathogen isolated from clinical samples and is also the most common yeast species carried as a commensal by healthy individuals although some non-C. albicans species account for an important number of infections. To compare nine phenotypic systems for C. albicans identification [API 20C AUX; RapID Yeast Identification panel (RYIP); Vitek2 ID-YST system; chromogenic media, CHRO-Magar, Oxoid Chromogenic Candida Agar (OCCA), Candida ID2, Candida Identification Agar, CandiSelect 4, and Chromalbicans Agar] with multiplex PCR. A collection of 390 yeast strains was obtained by routine isolation from oral and vaginal swabs. All of the yeasts isolated were tested for germ tube formation, and then submitted to a multiplex PCR protocol tested in previous studies, and to nine phenotypical commercial methods, together with the reference ATCC strains. Comparison was limited to the ability of the tests to identify C. albicans. 253 isolates were provisionally identified as C. albicans by germ tube, and their identities were further confirmed with the multiplex PCR. Sensitivity of phenotypical systems ranged from 81.9% (Vitek2) to 87.7% (Candida ID2 e CHROMagar). For specificity, the highest value was 96.8% for Candida ID2, and the lowest value (75.1%) was for Chromalbicans Agar. Although with differences in discriminatory power, the methods tested showed overall acceptable levels of sensitivity and specificity respect to the multiplex PCR; therefore, all could be useful for C. albicans identification where molecular differentiation is not available.

  19. Akuutin gastroenteriitin aiheuttajavirusten tunnistaminen multiplex-PCR -menetelmällä

    OpenAIRE

    Saari, Hanna; Koskinen, Siru; Luoma, Linda

    2016-01-01

    TIIVISTELMÄ Tampereen ammattikorkeakoulu Bioanalyytikkokoulutus KOSKINEN SIRU, LUOMA LINDA & SAARI HANNA: Akuutin gastroenteriitin aiheuttajavirusten tunnistaminen multiplex-PCR -menetelmällä Opinnäytetyö 64 sivua, joista liitteitä 3 sivua Lokakuu 2016 Akuutti gastroenteriitti, eli oksenteluna ja ripulina ilmenevä suoliston limakalvon tulehdus, on merkittävä maailmanlaajuinen terveysongelma. Virusperäiset gastroenteriitit ovat erittäin tartuntavaarallisia ja niiden ai...

  20. Comparative Evaluation of Six Commercialized Multiplex PCR Kits for the Diagnosis of Respiratory Infections

    OpenAIRE

    Sylvie Pillet; Marina Lardeux; Julia Dina; Florence Grattard; Paul Verhoeven; Jérôme Le Goff; Astrid Vabret; Bruno Pozzetto

    2013-01-01

    The molecular diagnosis of respiratory infection can be performed using different commercial multiplex-based PCR kits whose performances have been previously compared individually to those of conventional techniques. This study compared the practicability and the diagnostic performances of six CE-marked kits available in 2011 on the French market, including 2 detecting viruses and atypical bacteria (from Pathofinder and Seegene companies) and 4 detecting only viruses (from Abbott, Genomica, Q...

  1. Utility of multiplex real-time PCR in the diagnosis of extrapulmonary tuberculosis

    Directory of Open Access Journals (Sweden)

    Reena Raveendran

    Full Text Available Abstract Objective The diagnosis of extrapulmonary tuberculosis is still a challenge because of its pauci-bacillary nature. The aim of the study was to evaluate the role of a multiplex PCR assay in the diagnosis of extrapulmonary tuberculosis and to compare the efficiency of two targets, IS6110 and MPB64 to detect Mycobacterium tuberculosis. Methods 150 extrapulmonary samples (61 pus/aspirate, 46 tissue, 32 body fluids, and 11 urine from clinically suspected cases of tuberculosis were included in the study. All the samples were subjected to direct fluorescent microscopy, TB culture (BacT/ALERT 3D, biomerieux, Durham, North Carolina, USA and a Multiplexed Tandem PCR targeting two mycobacterial DNA sequences, IS6110 and MPB64. Master-Mix reagents and primers were prepared by AusDiagnostics Pvt. Ltd (Alexandria, New South Wales, Australia. The performance of the assay was assessed using a composite gold standard, which included clinical characteristics, microbiology smear as well as culture, histopathology, cytology, radiology, and response to antitubercular therapy. Results 20.3%, 23.6%, and 45.3% of specimens were positive by smear, culture, and PCR, respectively. The sensitivity and specificity of the multiplex PCR was 91.9% and 88.4%, respectively, using the composite gold standard. Positive and negative predictive values of the PCR were estimated as 85.1% and 93.8%, respectively. Higher positivity was observed with target IS6110 (44.6% as compared to target MPB64 (18.9%. The sensitivities of IS6110 and MPB64 individual targets were 90.3% and 64.5%, respectively, and specificities were 88.4% and 97.7%, respectively. Conclusion PCR can play an important role in rapid and accurate diagnosis of extrapulmonary tuberculosis. IS6110 alone is an effective target in our part of the country.

  2. Detection of virulence genes in Uropathogenic E. coli (UPEC strains by Multiplex-PCR method

    Directory of Open Access Journals (Sweden)

    Javad Mohammadi

    2017-06-01

    Full Text Available Background & Objectives: Urinary tract infection caused by E. coli is one of the most common illnesses in all age groups worldwide. Presence of virulence genes is a key factor in bacterial pathogens in uroepithelial cells. The present study was performed to detect iha, iroN, ompT genes in the Uropathogenic E.coli isolates from clinical samples using multiplex-PCR method in Kerman. Materials & Methods: In this descriptive cross-sectional study, 200 samples of patients with urinary tract infections in Kerman hospitals were collected. After biochemical and microbiological tests, all strains were tested with regard to the presence of iha, iroN, and ompT genes using multiplex-PCR method. Results: The results of Multiplex-PCR showed that all specimens had one, two, or three virulence genes simultaneously. The highest and lowest frequency distribution of genes was related to iha (56.7% and iroN (20% respectively. Conclusion: According to the prevalence of urinary tract infection in the community and distribution of resistance and virulence factors, the fast and accurate detection of the strains and virulence genes is necessary

  3. Multiplex PCR to identify macrolide resistance determinants in Mannheimia haemolytica and Pasteurella multocida.

    Science.gov (United States)

    Rose, Simon; Desmolaize, Benoit; Jaju, Puneet; Wilhelm, Cornelia; Warrass, Ralf; Douthwaite, Stephen

    2012-07-01

    The bacterial pathogens Mannheimia haemolytica and Pasteurella multocida are major etiological agents in respiratory tract infections of cattle. Although these infections can generally be successfully treated with veterinary macrolide antibiotics, a few recent isolates have shown resistance to these drugs. Macrolide resistance in members of the family Pasteurellaceae is conferred by combinations of at least three genes: erm(42), which encodes a monomethyltransferase and confers a type I MLS(B) (macrolide, lincosamide, and streptogramin B) phenotype; msr(E), which encodes a macrolide efflux pump; and mph(E), which encodes a macrolide-inactivating phosphotransferase. Here, we describe a multiplex PCR assay that detects the presence of erm(42), msr(E), and mph(E) and differentiates between these genes. In addition, the assay distinguishes P. multocida from M. haemolytica by amplifying distinctive fragments of the 23S rRNA (rrl) genes. One rrl fragment acts as a general indicator of gammaproteobacterial species and confirms whether the PCR assay has functioned as intended on strains that are negative for erm(42), msr(E), and mph(E). The multiplex system has been tested on more than 40 selected isolates of P. multocida and M. haemolytica and correlated with MICs for the veterinary macrolides tulathromycin and tilmicosin, and the newer compounds gamithromycin and tildipirosin. The multiplex PCR system gives a rapid and robustly accurate determination of macrolide resistance genotypes and bacterial genus, matching results from microbiological methods and whole-genome sequencing.

  4. [new multiplex PCR for species-specific diagnosis of human candidiasis].

    Science.gov (United States)

    García, Liliana Torcoroma; Luna, Liany Johanna; Velasco, Tania Katherine; Guerra, Beatriz Elena

    2017-06-01

    Candidiases is a group of opportunistic infections caused by yeasts belonging to the genus Candida. Candida albicans is the most prevalent species in both superficial and deep infections, however, the clinical importance of non-albicans Candida has increased during the last decade, driving an urgent need for diagnostic tests that allow for species-level resolution and selection of the optimum therapeutic approach. To design and to optimize a new multiplex PCR assay for the simultaneous identification of the five most relevant species of Candida involved in human candidiasis etiology. For primers design, the physical and thermodynamic restrictions that affect multiplex PCR performance were analyzed using Gene Runner and Mult-PSOS. As templates, the internal transcribed region 2 (ITR2) was selected for C. albicans (AJ249486.1), and topoisomerase II (TOPII) for C. parasilopsis (AB049144.1), C. krusei (AB049139.1), C. tropicalis (AB049141.1), and C. guillermondii (AB049145.1). We used ATCC strains of all these five species and clinical isolates as templates. We designed ten oligonucleotides for the simultaneous amplification of the Candida species. The electrophoresis band profile was: C. albicans (206 bp), C. guillermondii (244 bp), C. tropicalis (474 bp), C. parasilopsis (558 bp), and C. krusei (419 bp). The new multiplex PCR assay designed in this study allowed a simultaneous and efficient amplification of the amplicons corresponding to the five species of Candida under study, with an adequate resolution in standard agarose gel.

  5. Multiplex PCR To Identify Macrolide Resistance Determinants in Mannheimia haemolytica and Pasteurella multocida

    Science.gov (United States)

    Rose, Simon; Desmolaize, Benoit; Jaju, Puneet; Wilhelm, Cornelia; Warrass, Ralf

    2012-01-01

    The bacterial pathogens Mannheimia haemolytica and Pasteurella multocida are major etiological agents in respiratory tract infections of cattle. Although these infections can generally be successfully treated with veterinary macrolide antibiotics, a few recent isolates have shown resistance to these drugs. Macrolide resistance in members of the family Pasteurellaceae is conferred by combinations of at least three genes: erm(42), which encodes a monomethyltransferase and confers a type I MLSB (macrolide, lincosamide, and streptogramin B) phenotype; msr(E), which encodes a macrolide efflux pump; and mph(E), which encodes a macrolide-inactivating phosphotransferase. Here, we describe a multiplex PCR assay that detects the presence of erm(42), msr(E), and mph(E) and differentiates between these genes. In addition, the assay distinguishes P. multocida from M. haemolytica by amplifying distinctive fragments of the 23S rRNA (rrl) genes. One rrl fragment acts as a general indicator of gammaproteobacterial species and confirms whether the PCR assay has functioned as intended on strains that are negative for erm(42), msr(E), and mph(E). The multiplex system has been tested on more than 40 selected isolates of P. multocida and M. haemolytica and correlated with MICs for the veterinary macrolides tulathromycin and tilmicosin, and the newer compounds gamithromycin and tildipirosin. The multiplex PCR system gives a rapid and robustly accurate determination of macrolide resistance genotypes and bacterial genus, matching results from microbiological methods and whole-genome sequencing. PMID:22564832

  6. Identification of Candida Species Associated with Vulvovaginal Candidiasis by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    Mahnaz Mahmoudi Rad

    2012-01-01

    Full Text Available Background. Vulvovaginal candidiasis is a common infection. The aim of this study was to identify the species of vaginal Candida isolates by using multiplex PCR technique. Methods. 191 isolates from patients admitted to Mahdieh hospital were identified. The vaginal swab specimens were cultured on Sabouraud Dextrose Agar. The ITS1 region between the 18S and 5.8S rRNA genes and a specific DNA fragment within the ITS2 region were amplified. The multiplex PCR products were separated by electrophoresis in 2% agarose gel, visualized by staining with ethidium bromide, and photographed. Descriptive statistics, Chi-square test, and Spearman correlation were used to summarize the findings. Results. C. albicans and C. glabrata were the most common species isolated from the specimens. A mix of C. glabrata and C. albicans was the most common mixed infection isolated from the samples. The analysis revealed a significant positive association between older age and infection with C. glabrata isolates (Spearman’s rho = 0.89, P=0.015. Conclusion. Multiplex PCR is a fast, yet reliable method to identify Candida species. C. albicans and then C. glabrata are the two most common causes of vulvovaginal candidiasis. The number of mixed fungal infections is higher among Iranian population compared to international reports.

  7. Standardization of a multiplex PCR for the identification of coagulase-positive Staphylococcus

    Directory of Open Access Journals (Sweden)

    Eliezer Avila Gandra

    2011-12-01

    Full Text Available The enterotoxigenic species Staphylococcus aureus, S. hyicus and S. intermedius show very similar characteristics, making their identification through conventional microbiological methods difficult. This study aimed at the development of a Multiplex PCR (mPCR for the identification of S. aureus, S. intermedius and S. hyicus using the nuc gene as the target sequence. The results obtained suggest that the set of primers used was specific for the three species of Staphylococcus evaluate with a detection limit of 10² CFU.mL-1.

  8. Multiplex real-time PCR assay for rapid detection of methicillin-resistant staphylococci directly from positive blood cultures.

    Science.gov (United States)

    Wang, Hye-Young; Kim, Sunghyun; Kim, Jungho; Park, Soon-Deok; Uh, Young; Lee, Hyeyoung

    2014-06-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is the most prevalent cause of bloodstream infections (BSIs) and is recognized as a major nosocomial pathogen. This study aimed to evaluate a newly designed multiplex real-time PCR assay capable of the simultaneous detection of mecA, S. aureus, and coagulase-negative staphylococci (CoNS) in blood culture specimens. The Real-MRSA and Real-MRCoNS multiplex real-time PCR assays (M&D, Republic of Korea) use the TaqMan probes 16S rRNA for Staphylococcus spp., the nuc gene for S. aureus, and the mecA gene for methicillin resistance. The detection limit of the multiplex real-time PCR assay was 10(3) CFU/ml per PCR for each gene target. The multiplex real-time PCR assay was evaluated using 118 clinical isolates from various specimen types and a total of 350 positive blood cultures from a continuous monitoring blood culture system. The results obtained with the multiplex real-time PCR assay for the three targets were in agreement with those of conventional identification and susceptibility testing methods except for one organism. Of 350 positive bottle cultures, the sensitivities of the multiplex real-time PCR kit were 100% (166/166 cultures), 97.2% (35/36 cultures), and 99.2% (117/118 cultures) for the 16S rRNA, nuc, and mecA genes, respectively, and the specificities for all three targets were 100%. The Real-MRSA and Real-MRCoNS multiplex real-time PCR assays are very useful for the rapid accurate diagnosis of staphylococcal BSIs. In addition, the Real-MRSA and Real-MRCoNS multiplex real-time PCR assays could have an important impact on the choice of appropriate antimicrobial therapy, based on detection of the mecA gene. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  9. Multiplex Real-Time PCR Assay for Rapid Detection of Methicillin-Resistant Staphylococci Directly from Positive Blood Cultures

    Science.gov (United States)

    Wang, Hye-young; Kim, Sunghyun; Kim, Jungho; Park, Soon-Deok

    2014-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is the most prevalent cause of bloodstream infections (BSIs) and is recognized as a major nosocomial pathogen. This study aimed to evaluate a newly designed multiplex real-time PCR assay capable of the simultaneous detection of mecA, S. aureus, and coagulase-negative staphylococci (CoNS) in blood culture specimens. The Real-MRSA and Real-MRCoNS multiplex real-time PCR assays (M&D, Republic of Korea) use the TaqMan probes 16S rRNA for Staphylococcus spp., the nuc gene for S. aureus, and the mecA gene for methicillin resistance. The detection limit of the multiplex real-time PCR assay was 103 CFU/ml per PCR for each gene target. The multiplex real-time PCR assay was evaluated using 118 clinical isolates from various specimen types and a total of 350 positive blood cultures from a continuous monitoring blood culture system. The results obtained with the multiplex real-time PCR assay for the three targets were in agreement with those of conventional identification and susceptibility testing methods except for one organism. Of 350 positive bottle cultures, the sensitivities of the multiplex real-time PCR kit were 100% (166/166 cultures), 97.2% (35/36 cultures), and 99.2% (117/118 cultures) for the 16S rRNA, nuc, and mecA genes, respectively, and the specificities for all three targets were 100%. The Real-MRSA and Real-MRCoNS multiplex real-time PCR assays are very useful for the rapid accurate diagnosis of staphylococcal BSIs. In addition, the Real-MRSA and Real-MRCoNS multiplex real-time PCR assays could have an important impact on the choice of appropriate antimicrobial therapy, based on detection of the mecA gene. PMID:24648566

  10. Multiplex Real-Time PCR Method for Simultaneous Identification and Toxigenic Type Characterization of Clostridium difficile From Stool Samples.

    Science.gov (United States)

    Kilic, Abdullah; Alam, Mohammad J; Tisdel, Naradah L; Shah, Dhara N; Yapar, Mehmet; Lasco, Todd M; Garey, Kevin W

    2015-05-01

    The aim of this study was to develop and validate a multiplex real-time PCR assay for simultaneous identification and toxigenic type characterization of Clostridium difficile. The multiplex real-time PCR assay targeted and simultaneously detected triose phosphate isomerase (tpi) and binary toxin (cdtA) genes, and toxin A (tcdA) and B (tcdB) genes in the first and sec tubes, respectively. The results of multiplex real-time PCR were compared to those of the BD GeneOhm Cdiff assay, targeting the tcdB gene alone. The toxigenic culture was used as the reference, where toxin genes were detected by multiplex real-time PCR. A total of 351 stool samples from consecutive patients were included in the study. Fifty-five stool samples (15.6%) were determined to be positive for the presence of C. difficile by using multiplex real-time PCR. Of these, 48 (87.2%) were toxigenic (46 tcdA and tcdB-positive, two positive for only tcdB) and 11 (22.9%) were cdtA-positive. The sensitivity, specificity, negative predictive value (NPV), and positive predictive value (PPV) of the multiplex real-time PCR compared with the toxigenic culture were 95.6%, 98.6%, 91.6%, and 99.3%, respectively. The analytical sensitivity of the multiplex real-time PCR assay was determined to be 10(3) colony forming unit (CFU)/g spiked stool sample and 0.0625 pg genomic DNA from culture. Analytical specificity determined by using 15 enteric and non-clostridial reference strains was 100%. The multiplex real-time PCR assay accurately detected C. difficile isolates from diarrheal stool samples and characterized its toxin genes in a single PCR run.

  11. Development of one-tube multiplex polymerase chain reaction (PCR) for detecting Mycobacterium bovis.

    Science.gov (United States)

    Quan, Zhang; Haiming, Tan; Xiaoyao, Cai; Weifeng, Yuan; Hong, Jia; Hongfei, Zhu

    2017-01-10

    A multiplex PCR (m-PCR) with primers targeting the 16S rRNA, Rv3873 and a 12.7-kb fragment in the genomes of a Mycobacterium tuberculosis complex was designed for the differential diagnosis of M. tuberculosis, M. bovis, M. bovis BCG and non-tuberculosis Mycobacterium (NTM). The specificity of this assay was 100%, and the detection limit was 15 pg of genomic DNA. Of the 206 blinded clinical samples, the detection rate of M. bovis infection by m-PCR was lower than that of the interferon gamma (IFN-γ) release assay; however, the false-positive rate by the tuberculin skin test and false-negative samples in the IFN-γ release assay were reduced. Our findings indicated that our m-PCR method is a useful tool for complementation to differentiate M. bovis from M. tuberculosis and NTM species.

  12. Development of a novel multiplex PCR assay for rapid detection of virulence associated genes of Pasteurella multocida from pigs

    National Research Council Canada - National Science Library

    Rajkhowa, S

    2015-01-01

    Significance and Impact of the Study: The study reports the development and evaluation of a novel multiplex PCR assay for the rapid detection of 11 important VAGs of Pasteurella multocida isolates from pigs...

  13. Application of a Multiplex Quantitative PCR to Assess Prevalence and Intensity Of Intestinal Parasite Infections in a Controlled Clinical Trial

    DEFF Research Database (Denmark)

    Llewellyn, Stacey; Inpankaew, Tawin; Nery, Susana Vaz

    2016-01-01

    multiplex real-time PCR reactions the first targeting: Necator americanus, Ancylostoma spp., Ascaris spp., and Trichuris trichiura; and the second Entamoeba histolytica, Cryptosporidium spp., Giardia. duodenalis, and Strongyloides stercoralis. Samples were also subject to sodium nitrate flotation...

  14. Amplification of tlh gene in other Vibrionaceae specie by specie-specific multiplex PCR of Vibrio parahaemolyticus

    National Research Council Canada - National Science Library

    Romina Yáñez; Roberto Bastías; Gastón Higuera; Oscar Salgado; Pantelis Katharios; Jaime Romero; Romilio Espejo; Katherine García

    2015-01-01

    Background: The surveillance of Vibrio parahaemolyticus in the Chilean coast has been mainly performed by multiplex PCR amplification of three different hemolysin genes, which are specie-specific virulence factors...

  15. Development of a Multiplex PCR Assay for Rapid Molecular Serotyping of Haemophilus parasuis

    Science.gov (United States)

    Peters, Sarah E.; Wang, Jinhong; Hernandez-Garcia, Juan; Weinert, Lucy A.; Luan, Shi-Lu; Chaudhuri, Roy R.; Angen, Øystein; Aragon, Virginia; Williamson, Susanna M.; Langford, Paul R.; Rycroft, Andrew N.; Wren, Brendan W.; Maskell, Duncan J.; Tucker, Alexander W.

    2015-01-01

    Haemophilus parasuis causes Glässer's disease and pneumonia in pigs. Indirect hemagglutination (IHA) is typically used to serotype this bacterium, distinguishing 15 serovars with some nontypeable isolates. The capsule loci of the 15 reference strains have been annotated, and significant genetic variation was identified between serovars, with the exception of serovars 5 and 12. A capsule locus and in silico serovar were identified for all but two nontypeable isolates in our collection of >200 isolates. Here, we describe the development of a multiplex PCR, based on variation within the capsule loci of the 15 serovars of H. parasuis, for rapid molecular serotyping. The multiplex PCR (mPCR) distinguished between all previously described serovars except 5 and 12, which were detected by the same pair of primers. The detection limit of the mPCR was 4.29 × 105 ng/μl bacterial genomic DNA, and high specificity was indicated by the absence of reactivity against closely related commensal Pasteurellaceae and other bacterial pathogens of pigs. A subset of 150 isolates from a previously sequenced H. parasuis collection was used to validate the mPCR with 100% accuracy compared to the in silico results. In addition, the two in silico-nontypeable isolates were typeable using the mPCR. A further 84 isolates were analyzed by mPCR and compared to the IHA serotyping results with 90% concordance (excluding those that were nontypeable by IHA). The mPCR was faster, more sensitive, and more specific than IHA, enabling the differentiation of 14 of the 15 serovars of H. parasuis. PMID:26424843

  16. Reliability of a multiplex PCR assay for the identification of the major Campylobacter taxa.

    Science.gov (United States)

    Hayashi, K; Tazumi, A; Nakajima, T; Endo, A; Moore, J E; Millar, B C; Matsuda, M

    2011-01-01

    The primer pair (C412F/C1228R) constructed previously for the polymerase chain reaction (PCR) identification of the genus Campylobacter using an approximate 800 base pair (bp) 16S rRNA gene target segment proved to be useful for the identification of a total of 49 Campylobacter lari isolates including urease-positive thermophilic Campylobacter (UPTC) organisms (n=25). When the primer pair (CLF/R) developed previously for the PCR identification of C. lari species using an approximate 250 bp glyA segment was employed, 27 C. lari isolates, including all the UPTC isolates, were identified to be PCR-negative (55%). Therefore, this PCR procedure developed for the molecular identification of C. lari was shown to be unreliable for C. lari identification. Nucleotide sequencing analysis clarified the reason(s) why PCR-negative examples occurred in many C. lari isolates, including UPTC isolates. The primer pair target sequences in the C. lari-specific PCR-negative isolates apparently varied at the 3' end region, as compared with C. lari-specific PCR-positive isolates. Thus, the multiplex PCR assay developed previously was shown to be unreliable for the molecular identification of C. lari subspecies organisms.

  17. Differential identification of Sporothrix spp. and Leishmania spp. by conventional PCR and qPCR in multiplex format.

    Science.gov (United States)

    Rodríguez-Brito, Sabrina; Camacho, Emma; Mendoza, Mireya; Niño-Vega, Gustavo A

    2015-01-01

    Sporotrichosis and cutaneous leishmaniasis are skin infections with similar clinical manifestations but different treatment methods. The present study aimed to evaluate qPCR and conventional PCR for differential detection of the etiological agents of both infections in multiplex format. Assays were designed using two sets of reported primers: SS1/SS2, designed on the 18S ribosomal RNA gene from Sporothrix spp., and JW11/JW12, designed on the kinetoplast DNA (kDNA) minicircles of Leishmania spp. qPCR detected 200 fg of DNA per reaction for both Sporothrix and Leishmania. Melting curve analysis revealed two distinctive Tm peaks for Sporothrix spp. (85.5°C), and Leishmania spp. (82.6°C). A detection limit of 20 pg was determined for the diagnosis of both with conventional PCR. No other clinically important organisms were detected by either PCR or qPCR. However, a Blast analysis on GenBank databases, using as query the sequence of the PCR fragment obtained with primers SS1/SS2, showed 100% identity to environmental fungi of the Ophiostomales order. Lower percentages of identity (≤80%), with mismatches at primers' sequence regions were obtained for other environmental or clinically important fungi. Proper handling of clinical samples is required to avoid false negatives due to contamination with environmental fungi of the Ophiostomales order. © The Author 2014. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Differentiating Botulinum Neurotoxin-Producing Clostridia with a Simple, Multiplex PCR Assay.

    Science.gov (United States)

    Williamson, Charles H D; Vazquez, Adam J; Hill, Karen; Smith, Theresa J; Nottingham, Roxanne; Stone, Nathan E; Sobek, Colin J; Cocking, Jill H; Fernández, Rafael A; Caballero, Patricia A; Leiser, Owen P; Keim, Paul; Sahl, Jason W

    2017-09-15

    Diverse members of the genus Clostridium produce botulinum neurotoxins (BoNTs), which cause a flaccid paralysis known as botulism. While multiple species of clostridia produce BoNTs, the majority of human botulism cases have been attributed to Clostridium botulinum groups I and II. Recent comparative genomic studies have demonstrated the genomic diversity within these BoNT-producing species. This report introduces a multiplex PCR assay for differentiating members of C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Coding region sequences unique to each of the four species/subgroups were identified by in silico analyses of thousands of genome assemblies, and PCR primers were designed to amplify each marker. The resulting multiplex PCR assay correctly assigned 41 tested isolates to the appropriate species or subgroup. A separate PCR assay to determine the presence of the ntnh gene (a gene associated with the botulinum neurotoxin gene cluster) was developed and validated. The ntnh gene PCR assay provides information about the presence or absence of the botulinum neurotoxin gene cluster and the type of gene cluster present ( ha positive [ ha + ] or orfX + ). The increased availability of whole-genome sequence data and comparative genomic tools enabled the design of these assays, which provide valuable information for characterizing BoNT-producing clostridia. The PCR assays are rapid, inexpensive tests that can be applied to a variety of sample types to assign isolates to species/subgroups and to detect clostridia with botulinum neurotoxin gene ( bont ) clusters. IMPORTANCE Diverse clostridia produce the botulinum neurotoxin, one of the most potent known neurotoxins. In this study, a multiplex PCR assay was developed to differentiate clostridia that are most commonly isolated in connection with human botulism cases: C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Since Bo

  19. Comparison of blood culture and multiplex real-time PCR for the diagnosis of nosocomial sepsis.

    Science.gov (United States)

    Dinç, Fatih; Akalin, Halis; Özakin, Cüneyt; Sinirtaş, Melda; Kebabçi, Nesrin; Işçimen, Remzi; Kelebek Girgin, Nermin; Kahveci, Ferda

    2016-03-01

    In many cases of suspected sepsis, causative microorganisms cannot be isolated. Multiplex real-time PCR generates results more rapidly than conventional blood culture systems. In this study, we evaluated the diagnostic performance of multiplex real-time PCR (LightCycler® SeptiFast, Roche, Mannheim, Germany), and compared with blood cultures and cultures from focus of infection in nosocomial sepsis. Seventy-eight nosocomial sepsis episodes in 67 adult patients were included in this study. The rates of microorganism detection by blood culture and PCR were 34.2% and 47.9%, respectively. Sixty-five microorganisms were detected by both methods from 78 sepsis episodes. Nineteen of these microorganisms were detected by both blood culture and PCR analysis from the same sepsis episode. There was statistically moderate concordance between the two methods (κ=0.445, Pdetected (κ=0.160, P=0.07). Comparison of the results of PCR and cultures from focus of infection revealed no significant agreement (κ=0.110, P=0.176). However, comparison of the results of PCR and blood cultures plus cultures from focus of infection (positive blood culture and/or positive culture from focus of infection) showed poor agreement (κ=0.17, P=0.026). When the blood culture was used as the gold standard, the sensitivity, specificity, positive and negative predictive value of PCR in patients with bacteremia was 80%, 69%, 57% and 87%, respectively. SeptiFast may be useful when added to blood culture in the diagnosis and management of sepsis.

  20. Detecting and genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays

    Energy Technology Data Exchange (ETDEWEB)

    Call, Douglas R.; Brockman, Fred J.; Chandler, Darrell P.

    2001-07-05

    Rapid detection and characterization of food borne pathogens such as Escherichia coli O157:H7 is crucial for epidemiological investigations and food safety surveillance. As an alternative to conventional technologies, we examined the sensitivity and specificity of nucleic acid microarrays for detecting and genotyping E. coli O157:H7. The array was composed of oligonucleotide probes (25-30 mer) complementary to four virulence loci (intimin, Shiga-like toxins I and II, and hemolysin A). Target DNA was amplified from whole cells or from purified DNA via single or multiplexed polymerase chain reaction (PCR), and PCR products were hybridized to the array without further modification or purification. The array was 32-fold more sensitive than gel electrophoresis and capable of detecting amplification products from < 1 cell equivalent of genomic DNA (1 fg). Immunomagnetic capture, PCR and a microarray were subsequently used to detect 55 CFUs ml-1 (E. coli O157:H7) from chicken rinsate without the aid of pre-enrichment. Four isolates of E. coli O157:H7 and one isolate of O91:H2, for which genotypic data were available, were unambiguously genotyped with this array. Glass based microarrays are relatively simple to construct and provide a rapid and sensitive means to detect multiplexed PCR products and the system is amenable to automation.

  1. Detecting and Genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays

    Energy Technology Data Exchange (ETDEWEB)

    Call, Douglas R.(Michigan, Univ Of - Ann Arbor); Brockman, Fred J.(BATTELLE (PACIFIC NW LAB)); Chandler, Darrell P.(Pacific Northwest National Laboratory)

    2000-12-01

    Rapid detection and characterization of food borne pathogens such as Escherichia coli O157:H7 is crucial for epidemiological investigations and food safety surveillance. As an alternative to conventional technologies, we examined the sensitivity and specificity of nucleic acid microarrays for detecting and genotyping E. coli O157:H7. The array was composed of oligonucleotide probes (25-30 mer) complementary to four virulence loci (intimin, Shiga-like toxins I and II, and hemolysin A). Target DNA was amplified from whole cells or from purified DNA via single or multiplexed polymerase chain reaction (PCR), and PCR products were hybridized to the array without further modification or purification. The array was 32-fold more sensitive than gel electrophoresis and capable of detecting amplification products from < 1 cell equivalent of genomic DNA (1 fg). Immunomagnetic capture, PCR and a microarray were subsequently used to detect 55 CFU ml-1 (E. coli O157:H7) from chicken rinsate without the aid of pre-enrichment. Four isolates of E. coli O157:H7 and one isolate of O91:H2, for which genotypic data were available, were unambiguously genotyped with this array. Glass based microarrays are relatively simple to construct and provide a rapid and sensitive means to detect multiplexed PCR products and the system is amenable to automation.

  2. A Multiplex PCR-coupled Liquid Bead Array for the Simultaneous Detection of Four Biothreat Agents

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, W J; Erler, A M; Nasarabadi, S L; Skowronski, E W; McCready, P M

    2004-02-04

    We have developed a 10-plexed PCR assay coupled to a 12-plexed liquid bead array to rapidly screen environmental samples for B. anthracis, Y. pestis, F. tularensis, and B. melitensis. Highly validated species -specific primer sets were used to simultaneously amplify multiple diagnostic regions unique to each individual pathogen. Resolution of the mix of amplified products was achieved by PCR product hybridization to corresponding probe sequences, attached to unique sets of fluorescent beads. The hybridized beads were processed through a flow cytometer, which detected presence and quantity of each PCR product. The assay was optimized to allow for maximum sensitivity in a multiplexed format. A high- throughput demonstration was performed where 384 simulated environmental samples were spiked with different amounts of B. thuringensis spores and pathogen DNA. The samples were robotically processed to extract DNA and arrayed for multiplexed PCR-liquid bead detection. The assay correctly identified the presence or absence of each pathogen and collected over 3,000 individual data points within a single 8-hour shift for approximately $1.20 per sample in a 10-plexed assay.

  3. Usefulness of capillary electrophoresis-based multiplex PCR assay for species-specific identification of Candida spp.

    Science.gov (United States)

    Mallus, F; Martis, S; Serra, C; Loi, G; Camboni, T; Manzin, A

    2013-02-15

    The study evaluated the performances of a commercial multiplex PCR assay, the Seegene Seeplex STI Master Panel 3, for Candida spp. identification. Eighty clinical strains of Candida spp. were identified with this system and a homemade multiplex PCR assay. The results were also compared with those obtained with two phenotypic methods. The study provided a preliminary evaluation of a multiplex assay from Seegene that uses capillary electrophoresis as the detection of amplified products. The Seeplex assay was found to be a rapid and useful method for identifying large numbers of yeast isolates in the clinical laboratory context. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Multiplex RT-PCR method for the simultaneous detection of nine grapevine viruses.

    Science.gov (United States)

    Gambino, Giorgio

    2015-01-01

    Viral diseases are a serious pathological problem for grapevines, and in recent years the need for increasingly specific and rapid diagnostic methods for the selection of propagation materials has grown. Arabis mosaic virus, Grapevine fanleaf virus, Grapevine virus A, Grapevine virus B, Grapevine rupestris stem pitting-associated virus, Grapevine fleck virus, and Grapevine leafroll-associated viruses 1, 2, and 3 are nine of the most widespread viruses that naturally infect grapevines. A multiplex RT-PCR was developed for simultaneous detection of these nine grapevine viruses, in combination with a plant RNA internal control used as an indicator of the effectiveness of the reaction. One to ten fragments specific for the viruses and an internal control were simultaneously amplified from infected samples and identified by their specific molecular sizes in agarose gel. The protocol reported is an update of previously published protocols for RNA extraction and multiplex diagnosis of viruses. After several years of use and hundreds of samples tested, and following validation in several laboratories, this multiplex RT-PCR provides a reliable and rapid method for detecting grapevine viruses from a large number of samples.

  5. High-throughput quantification of chloroplast RNA editing extent using multiplex RT-PCR mass spectrometry.

    Science.gov (United States)

    Germain, Arnaud; Hanson, Maureen R; Bentolila, Stéphane

    2015-08-01

    RNA editing in plants, animals, and humans modifies genomically encoded cytidine or adenosine nucleotides to uridine or inosine, respectively, in mRNAs. We customized the MassARRAY System (Sequenom Inc., San Diego, CA, USA, www.sequenom.com) to assay multiplex PCR-amplified single-stranded cDNAs and easily analyse and display the captured data. By using appropriate oligonucleotide probes, the method can be tailored to any organism and gene where RNA editing occurs. Editing extent of up to 40 different nucleotides in each of either 94 or 382 different samples (3760 or 15 280 editing targets, respectively) can be examined by assaying a single plate and by performing one repetition. We have established this mass spectrometric method as a dependable, cost-effective and time-saving technique to examine the RNA editing efficiency at 37 Arabidopsis thaliana chloroplast editing sites at a high level of multiplexing. The high-throughput editing assay, named Multiplex RT-PCR Mass Spectrometry (MRMS), is ideal for large-scale experiments such as identifying population variation, examining tissue-specific changes in editing extent, or screening a mutant or transgenic collection. Moreover, the required amount of starting material is so low that RNA from fewer than 50 cells can be examined without amplification. We demonstrate the use of the method to identify natural variation in editing extent of chloroplast C targets in a collection of Arabidopsis accessions. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  6. Multiplex, Quantitative, Reverse Transcription PCR Detection of Influenza Viruses Using Droplet Microfluidic Technology

    Directory of Open Access Journals (Sweden)

    Ravi Prakash

    2014-12-01

    Full Text Available Quantitative, reverse transcription, polymerase chain reaction (qRT-PCR is facilitated by leveraging droplet microfluidic (DMF system, which due to its precision dispensing and sample handling capabilities at microliter and lower volumes has emerged as a popular method for miniaturization of the PCR platform. This work substantially improves and extends the functional capabilities of our previously demonstrated single qRT-PCR micro-chip, which utilized a combination of electrostatic and electrowetting droplet actuation. In the reported work we illustrate a spatially multiplexed micro-device that is capable of conducting up to eight parallel, real-time PCR reactions per usage, with adjustable control on the PCR thermal cycling parameters (both process time and temperature set-points. This micro-device has been utilized to detect and quantify the presence of two clinically relevant respiratory viruses, Influenza A and Influenza B, in human samples (nasopharyngeal swabs, throat swabs. The device performed accurate detection and quantification of the two respiratory viruses, over several orders of RNA copy counts, in unknown (blind panels of extracted patient samples with acceptably high PCR efficiency (>94%. The multi-stage qRT-PCR assays on eight panel patient samples were accomplished within 35–40 min, with a detection limit for the target Influenza virus RNAs estimated to be less than 10 RNA copies per reaction.

  7. Sex determination and milk protein genotyping of preimplantation stage bovine embryos using multiplex PCR.

    Science.gov (United States)

    Agrawala, P L; Wagner, V A; Geldermann, H

    1992-11-01

    A method for determining the sex and milk protein genotypes (RFLPs) of preimplantation stage bovine embryos using multiplex polymerase chain reaction (PCR) is described. Day 6 to 7 embryos were micromanipulated to isolate 5 to 6 cells. These cells were then dried in reaction tubes for transport to the laboratory. Subsequently, two sets of PCRs were performed using Y chromosome, k-casein and beta-lactoglobulin gene specific primers, followed by electrophoretic analysis of the PCR products. The presence or absence of the Y chromosome was ascertained in 90 of 92 embryos. Moreover, the k-casein specific fragment was amplified and detected in all these embryos. The PCR products were digested in order to genotype the k-casein gene. In 70% of the embryos, the beta-lactoglobulin specific fragment was amplified, although together with some unspecific fragments.

  8. Multiplex PCR for Differential Identification of Broad Tapeworms (Cestoda: Diphyllobothrium) Infecting Humans▿

    Science.gov (United States)

    Wicht, Barbara; Yanagida, Tetsuya; Scholz, Tomáš; Ito, Akira; Jiménez, Juan A.; Brabec, Jan

    2010-01-01

    The specific identification of broad tapeworms (genus Diphyllobothrium) infecting humans is very difficult to perform by morphological observation. Molecular analysis by PCR and sequencing represents the only reliable tool to date to identify these parasites to the species level. Due to the recent spread of human diphyllobothriosis in several countries, a correct diagnosis has become crucial to better understand the distribution and the life cycle of human-infecting species as well as to prevent the introduction of parasites to disease-free water systems. Nevertheless, PCR and sequencing, although highly precise, are too complicated, long, and expensive to be employed in medical laboratories for routine diagnostics. In the present study we optimized a cheap and rapid molecular test for the differential identification of the most common Diphyllobothrium species infecting humans (D. latum, D. dendriticum, D. nihonkaiense, and D. pacificum), based on a multiplex PCR with the cytochrome c oxidase subunit 1 gene of mitochondrial DNA. PMID:20592146

  9. Multiplex Amplification Refractory Mutation System PCR (ARMS-PCR) provides sequencing independent typing of canine parvovirus.

    Science.gov (United States)

    Chander, Vishal; Chakravarti, Soumendu; Gupta, Vikas; Nandi, Sukdeb; Singh, Mithilesh; Badasara, Surendra Kumar; Sharma, Chhavi; Mittal, Mitesh; Dandapat, S; Gupta, V K

    2016-12-01

    Canine parvovirus-2 antigenic variants (CPV-2a, CPV-2b and CPV-2c) ubiquitously distributed worldwide in canine population causes severe fatal gastroenteritis. Antigenic typing of CPV-2 remains a prime focus of research groups worldwide in understanding the disease epidemiology and virus evolution. The present study was thus envisioned to provide a simple sequencing independent, rapid, robust, specific, user-friendly technique for detecting and typing of presently circulating CPV-2 antigenic variants. ARMS-PCR strategy was employed using specific primers for CPV-2a, CPV-2b and CPV-2c to differentiate these antigenic types. ARMS-PCR was initially optimized with reference positive controls in two steps; where first reaction was used to differentiate CPV-2a from CPV-2b/CPV-2c. The second reaction was carried out with CPV-2c specific primers to confirm the presence of CPV-2c. Initial validation of the ARMS-PCR was carried out with 24 sequenced samples and the results were matched with the sequencing results. ARMS-PCR technique was further used to screen and type 90 suspected clinical samples. Randomly selected 15 suspected clinical samples that were typed with this technique were sequenced. The results of ARMS-PCR and the sequencing matched exactly with each other. The developed technique has a potential to become a sequencing independent method for simultaneous detection and typing of CPV-2 antigenic variants in veterinary disease diagnostic laboratories globally. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Synovial fluid multiplex PCR is superior to culture for detection of low-virulent pathogens causing periprosthetic joint infection.

    Science.gov (United States)

    Morgenstern, Christian; Cabric, Sabrina; Perka, Carsten; Trampuz, Andrej; Renz, Nora

    2018-02-01

    Analysis of joint aspirate is the standard preoperative investigation for diagnosis of periprosthetic joint infection (PJI). We compared the diagnostic performance of culture and multiplex polymerase chain reaction (PCR) of synovial fluid for diagnosis of PJI. Patients in whom aspiration of the prosthetic hip or knee joint was performed before revision arthroplasty were prospectively included. The performance of synovial fluid culture and multiplex PCR was compared by McNemar's chi-squared test. A total of 142 patients were included, 82 with knee and 60 with hip prosthesis. PJI was diagnosed in 77 patients (54%) and aseptic failure in 65 patients (46%). The sensitivity of synovial fluid culture and PCR was 52% and 60%, respectively, showing concordant results in 116 patients (82%). In patients with PJI, PCR missed 6 high-virulent pathogens (S. aureus, streptococci, E. faecalis, E. coli) which grew in synovial fluid culture, whereas synovial fluid culture missed 12 pathogens detected by multiplex PCR, predominantly low-virulent pathogens (Cutibacterium acnes and coagulase-negative staphylococci). In patients with aseptic failure, PCR detected 6 low-virulent organisms (predominantly C. acnes). While the overall performance of synovial fluid PCR was comparable to culture, PCR was superior for detection of low-virulent bacteria such as Cutibacterium spp. and coagulase-negative staphylococci. In addition, synovial fluid culture required several days for growth, whereas multiplex PCR provided results within 5hours in an automated manner. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Molecular characterization of the capsular antigens of Pasteurella multocida isolates using multiplex PCR

    Directory of Open Access Journals (Sweden)

    Khalid S. Al-Maary

    2017-02-01

    Full Text Available The use of molecular techniques for detection and characterization of the Pasteurella multocida is very important for rapid and specific detection and characterization of the organism. During the period from 15th February, 2014 to 15th April, 2015, 425 nasopharyngeal swabs and 175 lung and spleen samples were collected and examined by conventional methods, 80 strains (18.82% of P. multocida were isolated from the calves, sheep and goat with respiratory manifestation. Meanwhile, 77 strains (44% were isolated from emergency slaughtered animals. All the recovered strains were positive for specific PCR for detection of P. multocida strains previously identified as P. multocida by standard microbiological techniques. Multiplex PCR for molecular typing of the capsular antigens of the recovered P. multocida revealed positive amplification of 1044 bp fragments specific to the capsular antigen type A with 105 strains (66.88%, and amplification 511 bp fragments of the capsular antigen type E with 52 strain (33.12% and absence of B, D and F antigens. Multiplex PCR for molecular typing of the capsular antigens of P. multocida can be used as a simple, sensitive, rapid, reliable technique instead of the serological techniques for identification of the capsular antigens of P. multocida

  12. Simultaneous detection of peanut and hazelnut allergens in food matrices using multiplex PCR method

    Directory of Open Access Journals (Sweden)

    Eva Renčová

    2014-01-01

    Full Text Available Multiplex PCR analysis for the detection of two targeting segments of genes coding major food protein allergens as peanut (Arachis hypogaea Ara h 1 gene and hazelnut (Corylus avellana Cor a 1 gene was developed. Two sets of primers were designed and tested to their specificity on a broad range of ingredients. The identity of amplicons (Ara h 1- 180 bp, Cor a 1 – 258 bp by sequencing and alignment of sequences with sequences deposited in Genbank was confirmed. When testing the specificity of designed primer pairs on a spectrum of food ingredients, no cross reactions were detected. A potential inhibition of PCR reaction was eliminated using the universal plant primers of chloroplast gene 124 bp for the plant matrices confirmation. The intrinsic detection limit was 10 pg·ml-1 and the practical detection limit was 0.001% w/w (10 mg·kg-1 for both peanuts and hazelnuts. The method was applied to the investigation of 60 commercial food samples. The developed multiplex PCR method is cheap, specific and sensitive enough and can be used as a simple, one day procedure for the checking of undeclared peanut and hazelnut major allergens in food.

  13. A Multiplex-PCR approach to identification of the Brazilian intermediate hosts of Schistosoma mansoni

    Directory of Open Access Journals (Sweden)

    THDA Vidigal

    2002-10-01

    Full Text Available Due to difficulties concerning morphological identification of planorbid snails of the genus Biomphalaria, and given a high variation of characters and in the organs with muscular tissue, we designed specific polymerase chain reaction (PCR primers for Brazilian snail hosts of Schistosoma mansoni from available sequences of internal transcribed spacer 2 (ITS2 of the ribosomal RNA gene. From the previous sequencing of the ITS2 region, one primer was designed to anchor in the 5.8S conserved region and three other species-specific primers in the 28S region, flanking the ITS2 region. These four primers were simultaneously used in the same reaction (Multiplex-PCR, under high stringency conditions. Amplification of the ITS2 region of Biomphalaria snails produced distinct profiles (between 280 and 350 bp for B. glabrata, B. tenagophila and B. straminea. The present study demonstrates that Multiplex-PCR of ITS2-DNAr showed to be a promising auxiliary tool for the morphological identification of Biomphalaria snails, the intermediate hosts of S. mansoni.

  14. Rapid detection of Actinobacillus actinomycetemcomitans, Prevotella intermedia and Porphyromona gingivalis by multiplex PCR.

    Science.gov (United States)

    García, L; Tercero, J C; Legido, B; Ramos, J A; Alemany, J; Sanz, M

    1998-01-01

    The identification of specific periodontal pathogens by conventional methods, mainly anaerobic cultivation, is difficult, time consuming and even sometimes unreliable. Therefore, a multiplex PCR method for simultaneous detection of Actinobacillus actinomycetemcomitans (A.a.), Porphyromona gingivalis (P.g.) and Prevotella intermedia (P.i.) was developed for rapid and easy identification of these specific bacterial pathogens in subgingival plaque samples. In this paper, there is a detailed description of the oligonucleotide primer selection, DNA extraction and PCR conditions and the sequencing of the amplified products. The locus chosen to be amplified is a highly variable region in the 16S ribosomal DNA. For the development of this technique ATCC cultures and pure cultures from subgingival plaque samples taken from periodontitis patients were used. As an internal positive control a recombinant plasmid was developed. This simple DNA extraction procedure and the DNA amplification and visualization of the amplified product permits the detection of the bacteria in a working day. Thus, this multiplex PCR method is a rapid and effective detection method for specific periodontal pathogens.

  15. Detection and quantification of Campylobacter jejuni and Campylobacter coli using real-time multiplex PCR.

    Science.gov (United States)

    Toplak, N; Kovač, M; Piskernik, S; Možina, S Smole; Jeršek, B

    2012-04-01

    We describe a real-time quantitative multiplex polymerase chain reaction (qmPCR) assay to identify and discriminate between isolates of Campylobacter jejuni and Campylobacter coli. Two novel sets of primers and hydrolysis probes were designed to amplify the unique DNA sequences within the hipO, ccoN and cadF genes that are specific to Camp. jejuni and Camp. coli. Using the designed optimized qmPCR assay conditions, the amplification efficiency is in range from 108 to 116%. These qmPCR assays are highly specific for Camp. jejuni and Camp. coli, as seen through testing of 40 Campylobacter strains and 17 non-Campylobacter strains. In chicken juice and tap water models spiked with known quantities of Camp. jejuni, qmPCR detected 10(2) -10(3) CFU ml(-1) within 4 h. The qmPCR assays developed in this study provide reliable and simultaneous detection and quantification of Camp. jejuni and Camp. coli, with good amplification reaction parameters. Following further validation, the qmPCR assay reported here has the potential to be applied to various sample types as an alternative and rapid methodology. © 2012 The Authors. Journal of Applied Microbiology © 2012 The Society for Applied Microbiology.

  16. Rapid diagnostic multiplex PCR (RD-PCR) to discriminate Schistosoma haematobium and S. bovis.

    Science.gov (United States)

    Webster, B L; Rollinson, D; Stothard, J R; Huyse, T

    2010-03-01

    Schistosoma haematobium and S. bovis are widespread schistosome species causing human and cattle schistosomiasis, respectively, in Africa. The sympatric occurrence of these two species and their ability to infect the same Bulinus intermediate snail hosts necessitates precise methods of identification of the larval stages. A rapid diagnostic 'mulitplex' one-step polymerase chain reaction protocol (RD-PCR) was developed using cytochrome oxidase subunit 1 (COX1) mitochondrial DNA (mtDNA) to discriminate between S. haematobium and S. bovis. A single forward primer and two species-specific reverse primers were used to produce a polymerase chain reaction (PCR) fragment of 306 bp and 543 bp for S. bovis and S. haematobium, respectively. Serial dilutions were carried out on various lifecycle stages and species combinations to test the sensitivity and specificity of the primers. This RD-PCR proved highly sensitive, detecting a single larval stage and as little as 0.78 ng of genomic DNA (gDNA) from an adult schistosome, providing a cost-effective, rapid and robust molecular tool for high-throughput screening of S. haematobium and S. bovis populations. In areas where human and cattle schistosomiasis overlap and are transmitted in close proximity, this mitochondrial assay will be a valuable identification tool for epidemiological studies, especially when used in conjunction with other nuclear diagnostic markers.

  17. Simultaneous Detection of 13 Key Bacterial Respiratory Pathogens by Combination of Multiplex PCR and Capillary Electrophoresis.

    Science.gov (United States)

    Jiang, Lu Xi; Ren, Hong Yu; Zhou, Hai Jian; Zhao, Si Hong; Hou, Bo Yan; Yan, Jian Ping; Qin, Tian; Chen, Yu

    2017-08-01

    Lower respiratory tract infections continue to pose a significant threat to human health. It is important to accurately and rapidly detect respiratory bacteria. To compensate for the limits of current respiratory bacteria detection methods, we developed a combination of multiplex polymerase chain reaction (PCR) and capillary electrophoresis (MPCE) assay to detect thirteen bacterial pathogens responsible for lower respiratory tract infections, including Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Mycoplasma pneumoniae, Legionella spp., Bordetella pertussis, Mycobacterium tuberculosis complex, Corynebacterium diphtheriae, and Streptococcus pyogenes. Three multiplex PCR reactions were built, and the products were analyzed by capillary electrophoresis using the high-throughput DNA analyzer. The specificity of the MPCE assay was examined and the detection limit was evaluated using DNA samples from each bacterial strain and the simulative samples of each strain. This assay was further evaluated using 152 clinical specimens and compared with real-time PCR reactions. For this assay, three nested-multiplex-PCRs were used to detect these clinical specimens. The detection limits of the MPCE assay for the 13 pathogens were very low and ranged from 10-7 to 10-2 ng/μL. Furthermore, analysis of the 152 clinical specimens yielded a specificity ranging from 96.5%-100.0%, and a sensitivity of 100.0% for the 13 pathogens. This study revealed that the MPCE assay is a rapid, reliable, and high-throughput method with high specificity and sensitivity. This assay has great potential in the molecular epidemiological survey of respiratory pathogens. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  18. Diagnosis of periprosthetic joint infection using alpha-defensin test or multiplex-PCR: ideal diagnostic test still not found.

    Science.gov (United States)

    Suda, Arnold J; Tinelli, Marco; Beisemann, Nils D; Weil, Yoram; Khoury, Amal; Bischel, Oliver E

    2017-07-01

    Diagnosing periprosthetic infection remains a challenge. Multiplex-PCR and biomarkers such as alpha-defensin are potentially useful and fast methods for detecting periprosthetic infection. This study compared these new methods with clinical assessment, conventional microbiological methods and histo-pathological examination. Twenty-eight consecutive patients with 30 joints and a mean age of 67.7 years (range 39 to 88) with removal of total hip arthroplasty (THA) or total knee replacement (TKR) were included in this study. Patients were classified according to the modified Musculoskeletal Infection Society score (MSIS) for infected joints. Punction fluid and tissue specimens were taken for conventional microbiological examination, alphadefensin test was performed, a synovial membrane specimen was used for multiplex-PCR and histopathological examination was carried out. The alpha-defensin test and multiplex-PCR showed a sensitivity of 76.9 vs. 30.8% and a specificity of 82.4 vs. 100%, respectively. We found a significant difference between the positive and negative results (p = 0.0023). The conventional microbiological methods were not significantly different from the alpha-defensin test (p = 0.244) with a sensitivity of 84.6% and a specificity of 100% but did differ significantly from the multiplex PCR (p = 0.0030). There was a significant difference between modified MSIS classification and multiplex PCR (p = 0.0007). Neither alpha-defensin test nor multiplex-PCR could detect periprosthetic infection immediately and reliably. Multiplex-PCR was suitable for detecting the non-infected but not the truly infected. Alpha-defensin test was helpful but showed no satisfactory results. Conventional microbiological methods remain the most reliable for periprosthetic infection diagnosis.

  19. [Evaluation of Seeplex Pneumobacter multiplex PCR kit for the detection of respiratory bacterial pathogens in pediatric patients].

    Science.gov (United States)

    Park, Joowon; Kim, Jae Kyoung; Rheem, Insoo; Kim, Jongwan

    2009-08-01

    Rapid identification of the causative agent among potential bacterial and viral pathogens is important for the management of acute respiratory disease. In this study, we evaluated the analytical performance and clinical usefulness of a recently-introduced multiplex PCR assay, Seeplex Pneumobacter detection kit (Seegene Inc., Korea) for the identification of respiratory bacterial pathogens. One hundred and eighty one nasopharyngeal aspirates were collected from pediatric patients with respiratory symptoms and analysed by multiplex PCR for the detection of Streptococcus pneumoniae (S.P), Haemophilus influenzae (H.I), Mycoplasma pneumoniae (M.P), Chlamydophila pneumoniae (C.P), Bordetella pertussis (B.P) and Legionella pneumophila (L.P). A comparison of multiplex PCR with conventional culture for the isolation of S.P and H.I was performed on 112 specimens. The cross reactivity of multiplex PCR was also evaluated. Of 181 cases, 81 cases were positive by multiplex PCR (44.8%): 52 cases for S.P (28.7%), 47 cases for H.I (26.0%), 9 cases for M.P (5.0%), 3 cases for B.P (1.7%) and 1 case for C.P (0.6%) including multiple infection cases. The agreement rates between multiplex PCR and culture for S.P and H.I were 92.9% (kappa index=0.84, P<0.001) and 91.1% (kappa index=0.75, P<0.001), respectively. There was no cross reactivity with common bacterial and viral pathogens. Seeplex Pneumobacter detection kit could be a useful screening tool for the rapid detection of respiratory bacterial pathogens. Further studies with lower respiratory tract specimens would be needed for the clinical evaluation of S. pneumoniae and H. influenzae detected by multiplex PCR.

  20. Development and validation of a multiplex-PCR assay for X-linked intellectual disability

    Science.gov (United States)

    2013-01-01

    Background X-linked intellectual disability is a common cause of inherited cognitive deficit affecting mostly males. There are several genetic causes implicated in this condition, which has hampered the establishment of an accurate diagnosis. We developed a multiplex-PCR assay for the mutational hotspot regions of the FMR1, AFF2 and ARX genes. Methods The multiplex-PCR was validated in a cohort of 100 males selected to include known alleles for the FMR1 repetitive region: five full mutations (250–650 CGGs), ten premutations (70–165 CGGs) and eighty-five in the normal range (19–42 CGGs). Sequencing or Southern blotting was used to confirm the results, depending on the allele class. In this cohort, with the exception of one sample showing an AFF2 intermediate-sized allele, all other samples were normal (8–34 CCGs). No ARX variant was found besides the c.429_452dup. The validated assay was applied to 5000 samples (64.4% males and 35.6% females). Results The normal-allelic range of both FMR1 and AFF2 genes as well as the nature of ARX variants identified was similar in both genders. The rate of homozygosity observed in female samples, 27.5% for FMR1 and 17.8% for AFF2 alleles, is comparable to that published by others. Two FMR1 premutations were identified, in a male (58 CGGs) and a female case [(CGG)47/(CGG)61], as well as several FMR1 or AFF2 intermediate-sized alleles. One AFF2 premutation (68 CCGs) and two putative full expansions were picked up in male subjects, which seems relevant considering the rarity of reported AFF2 mutations found in the absence of a family history. Conclusions We developed a robust multiplex-PCR that can be used to screen the mutational hotspot regions of FMR1, AFF2 and ARX genes. Moreover, this strategy led to the identification of variants in all three genes, representing not only an improvement in allele-sizing but also in achieving a differential diagnosis. Although the distinction between females who are truly homozygous and

  1. Prevalence of Porphyromonas gingivalis and Bacteroides forsythus in chronic Periodontitis by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    faranak Rezaei

    2009-01-01

    Full Text Available Rezaei F1, Chalabi M1, Moghim SH2, Moghareh Abed A3, Faghri J1 1. Instructor, Department of Microbiology, Faculty of Medicine, Lorestan University of Medical Sciences 2. MSc in Microbiology, Medical Biology Recearch Center, Kermanshah 3. Assistant Professor, Department of Microbiology, Faculty of Medicine, Isfahan University of Medical Sciences 4. Assistant Professor, Department of Periodontology, Faculty of Dentistry, Isfahan University of Medical Sciences, Abstract Background: Periodontitis is a common inflammatory and infectious disease which destroys the supporting structure of the teeth. Recent studies show that periodontal infection significantly increases the risk of some systemic diseases. It is generally accepted that bacterial species notably Porphyromonas gingivalis and Bacteroides forsythus are highly associated with periodontium. Molecular methods such as Multiplex PCR seem to be more sensitive and faster. Multiplex PCR alone can lower the limit of bacterial detection. Several pathogens can be detected simultaneously by this method. Materials and methods: The Subgingival plaque samples from 61 patients including 34 women and 27 men in the age range of 24-69 years and an average age of 43 suffering from chronic periodontitis with probing depth of PD³6, and from 40 periodontally healthy controls including 22 women and 18 men in the age range of 21-69 years and an average age of 41.35 were collected by sterile curette. In this study, two species-specific forward primers were used in combination with a single reverse primer. The samples DNA was extracted and Multiplex PCR was administered. Results: Porphyromonas gingivalis was detected in 51 samples (83.61% and 16 samples (40% of the chronic periodontitis patients and the healthy subjects respectively. Moreover, Bacteroides forsythus was detected in 32 samples (52.50% of the chronic periodontitis patients but it was not detected in any of the samples from the healthy group. Conclusion

  2. Detection of diarrhoea-causing protozoa in general practice patients in The Netherlands by multiplex real-time PCR

    NARCIS (Netherlands)

    ten Hove, R.; Schuurman, T.; Kooistra, M.; Moeller, L.; van Lieshout, L.; Verweij, J. J.

    2007-01-01

    The diagnostic value of a multiplex real-time PCR for the detection of Entamoeba histolytica, Giardia lamblia and Cryptosporidium parvum/Cryptosporidium hominis was evaluated by comparing the PCR results obtained with those of routinely performed microscopy of faecal samples from patients consulting

  3. Comparison of two multiplex PCR assays for the detection of Listeria spp. and Listeria monocytogenes in biological samples

    Directory of Open Access Journals (Sweden)

    Budniak Sylwia

    2016-12-01

    Full Text Available Introduction: The aim of the study was to optimise and compare two multiplex PCR assays for the detection of Listeria spp. and Listeria monocytogenes in biological samples including the liver, brain, and blood. Material and Methods: Three strains of L. monocytogenes and single strains of each of the species: L. ivanovii, L. innocua, L. grayi, L. welshimeri, and L. seeligeri were used. Additionally, five other species of bacterium were used to evaluate the specificity of the tests. Results: Specific amplification products were obtained for both multiplex PCR assays, which confirmed the tested strains as Listeria spp. and L. monocytogenes, respectively. Isolates of other species did not yield PCR products. Conclusion: Both multiplex PCR assays proved to be significantly sensitive and highly-specific methods for the detection of Listeria strains.

  4. Detection by multiplex PCR of Staphylococcus aureus , S. intermedius and S. hyicus in artificially contaminated milk

    Directory of Open Access Journals (Sweden)

    Eliezer Avila Gandra

    2016-01-01

    Full Text Available ABSTRACT: This research aimed to detect coagulase-positive Staphylococcus (CPS directly in samples of artificially contaminated milk, using multiplex PCR (mPCR. Standard and isolated bacterial strains of S. aureus, S. epidermidis, S. hyicus, S. intermedius, Listeria monocytogenes and Escherichia coli species were used, evaluating the specificity and detection limit of mPCR, for artificially contaminated UHT milk. Primers specific for the nuc gene (NUC1-NUC2 were used for S. aureus, NUC3-NUC4 for S. hyicus and NUC5-NUC6 for S. intermedius. It was possible to detect the three target species by mPCR, directly from bovine whole milk, with adequate specificity and acceptable detention limit for identification of coagulase-positive Staphylococcus (CPS in foods. The specificity was determined by the amplification of species-specific fragments, and the detection limit was assessed by the detection thresholds obtained for the three species (103 CFU mL-1. From these results, the mPCR described, with the proposed set of primers, has the potential for use in precise identification and differentiation between CPSs in milk samples.

  5. Performance of automated multiplex PCR using sonication fluid for diagnosis of periprosthetic joint infection: a prospective cohort.

    Science.gov (United States)

    Renz, Nora; Feihl, Susanne; Cabric, Sabrina; Trampuz, Andrej

    2017-12-01

    Sonication of explanted prostheses improved the microbiological diagnosis of periprosthetic joint infections (PJI). We evaluated the performance of automated multiplex polymerase chain reaction (PCR) using sonication fluid for the microbiological diagnosis of PJI. In a prospective cohort using uniform definition criteria for PJI, explanted joint prostheses were investigated by sonication and the resulting sonication fluid was analyzed by culture and multiplex PCR. McNemar's Chi-squared test was used to compare the performance of diagnostic tests. Among 111 patients, PJI was diagnosed in 78 (70%) and aseptic failure in 33 (30%). For the diagnosis of PJI, the sensitivity and specificity of periprosthetic tissue culture was 51 and 100%, of sonication fluid culture 58 and 100%, and of sonication fluid PCR 51 and 94%, respectively. Among 70 microorganisms, periprosthetic tissue culture grew 52 (74%), sonication fluid culture grew 50 (71%) and sonication fluid PCR detected 37 pathogens (53%). If only organisms are considered, for which primers are included in the test panel, PCR detected 37 of 58 pathogens (64%). The sonication fluid PCR missed 19 pathogens (predominantly oral streptococci and anaerobes), whereas 7 additional microorganisms were detected only by PCR (including Cutibacterium spp. and coagulase-negative staphylococci). The performance of multiplex PCR using sonication fluid is comparable to culture of periprosthetic tissue or sonication fluid. The advantages of PCR are short processing time (PCR, especially of low-virulent organisms.

  6. Autonomous Detection of Aerosolized Biological Agents by Multiplexed Immunoassay with PCR Confirmation

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; McBride, M T; Makarewicz, A J; Henderer, B D; Setlur, U S; Smith, S M; Gutierrez, D M; Metz, T R; Nasarabadi, S L; Venkateswaran, K S; Farrow, S W; Colston, Jr., B W; Dzenitis, J M

    2004-05-27

    The autonomous pathogen detection system (APDS) is an automated, podium-sized instrument that continuously monitors the air for biological threat agents (bacteria, viruses, and toxins). The system has been developed to warn of a biological attack in critical or high-traffic facilities and at special events. The APDS performs continuous aerosol collection, sample preparation, and detection using multiplexed immunoassay followed by confirmatory PCR using real-time TaqMan assays. We have integrated completely reusable flow-through devices that perform DNA extraction and PCR amplification. The fully integrated system was challenged with aerosolized Bacillus anthracis, Yersinia pestis, Bacillus globigii and botulinum toxoid. By coupling highly selective antibody and DNA based assays, the probability of an APDS reporting a false positive is extremely low.

  7. Short communication: Detection of stx2 and elt genes in bovine milk by using a multiplex PCR system.

    Science.gov (United States)

    Nandi, R D S; Campos, A C; Puño-Sarmiento, J J; Maluta, R P; Rocha, S P D; Kobayashi, R K T; Nakazato, G

    2017-10-01

    The aim of this study was to detect 2 important toxin genes from diarrheagenic Escherichia coli (DEC) in bovine milk using a new multiplex PCR. To standardize the multiplex PCR, the stx2 and elt genes were investigated for the detection of Shiga toxin-producing Escherichia coli (STEC) and enterotoxigenic E. coli (ETEC), respectively. The DNA template was prepared with a thermal procedure (boiling) and a commercial kit. Samples consisted of UHT and pasteurized milk, both skimmed, and STEC and ETEC were tested in concentrations between 10 1 and 10 9 cfu/mL. With the thermal procedure, the multiplex PCR system detected both pathotypes of E. coli at 10 9 cfu/mL in UHT and pasteurized milk. When the commercial kit was used for template preparation, STEC and ETEC could be detected at concentrations as low as 10 4 cfu/mL in UHT and pasteurized milk. Negative controls (Listeria monocytogenes, Salmonella Typhimurium, Salmonella Enteritidis, and Escherichia coli strain APEC 13) were not amplified with the multiplex PCR. These results indicate that the multiplex PCR was a rapid (less than 6 h) and efficient method to detect STEC and ETEC in milk using different methods for DNA preparation; however, the commercial kit was more sensitive than the thermal procedure. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  8. Development a rapid and accurate multiplex real time PCR method for the detection Chlamydia trachomatis and Mycoplasma hominis.

    Science.gov (United States)

    Safarkar, Roya; Mehrabadi, Jalil Fallah; Noormohammadi, Zahra; Mirnejad, Reza

    2017-11-01

    Sexually transmitted diseases easily spread among sexually active people and often have no symptoms. Rapid and accurate method for detecting these infections are necessary in early stages. The traditional detection methods of them are difficult and time-consuming. In this study, multiplex real time PCR was optimized for rapid identification of Chlamydia trachomatis and Mycoplasma hominis in a single tube and was performed with our designed primers. The sensitivity test was carried out to designed primers with diluted genomic DNA. To defined the specificity, non STD bacteria were used as DNA template. This study indicated that the developed multiplex real time PCR can be an effective alternative procedure to the conventional methods for rapid and accurate identification of C Chlamydia trachomatis and Mycoplasma hominis. Multiplex real-time PCR Results of them were checked with melting curves. The sensitivity of our designed primer by multiplex real time PCR for Chlamydia trachomatis and Mycoplasma hominis were 4.78×1010 and 8.35×1010 , respectively, Which the primers did not amplify any product from a non-STD species. Multiplex real time PCR by our new primers and analysis of melting curves were successfully usable for rapid and accurate detection of Chlamydia trachomatis and Mycoplasma hominis. This assay instead of traditional culture method, has considerable potential to be rapid, accurate and highly sensitive molecular diagnostic tool for simultaneous and direct detection. © 2017 Wiley Periodicals, Inc.

  9. Development of a multiplex real-time PCR assay for the rapid diagnosis of neonatal late onset sepsis.

    Science.gov (United States)

    van den Brand, Marre; Peters, Remco P H; Catsburg, Arnold; Rubenjan, Anna; Broeke, Ferdi J; van den Dungen, Frank A M; van Weissenbruch, Mirjam M; van Furth, A Marceline; Kõressaar, Triinu; Remm, Maido; Savelkoul, Paul H M; Bos, Martine P

    2014-11-01

    The diagnosis of late onset sepsis (LOS), a severe condition with high prevalence in preterm infants, is hampered by the suboptimal sensitivity and long turnaround time of blood culture. Detection of the infecting pathogen directly in blood by PCR would provide a much more timely result. Unfortunately, PCR-based assays reported so far are labor intensive and often lack direct species identification. Therefore we developed a real-time multiplex PCR assay tailored to LOS diagnosis which is easy-to-use, is applicable on small blood volumes and provides species-specific results within 4h. Species-specific PCR assays were selected from literature or developed using bioinformatic tools for the detection of the most prevalent etiologic pathogens: Enterococcus faecalis, Staphylococcus aureus, Staphylococcus spp., Streptococcus agalactiae, Escherichia coli, Pseudomonas aeruginosa, Klebsiella spp. and Serratia marcescens. The PCR assays showed 100% specificity, full coverage of the target pathogens and a limit of detection (LOD) of ≤10CFUeq./reaction. These LOD values were maintained in the multiplex format or when bacterial DNA was isolated from blood. Clinical evaluation showed high concordance between the multiplex PCR and blood culture. In conclusion, we developed a multiplex PCR that allows the direct detection of the most important bacterial pathogens causing LOS in preterm infants. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Diagnosis of Upper and Lower Respiratory Tract Bacterial Infections with the Use of Multiplex PCR Assays

    Directory of Open Access Journals (Sweden)

    Jenny Kourea-Kremastinou

    2013-03-01

    Full Text Available The investigation of respiratory infections by molecular techniques provides important information about the epidemiology of respiratory disease, especially during the post-vaccination era. The objective of the present study was the detection of bacterial pathogens directly in clinical samples from patients with upper and lower respiratory tract infections using multiplex polymerase chain reaction (PCR assays developed in our laboratory. Clinical samples taken over a three-year period (2007–2009 and obtained from 349 patients (adults (n = 66; children (n = 283 with signs and symptoms of certain upper or lower respiratory tract infections, consisted of: bronchoalveolar lavages (BAL, n = 83, pleural fluids (n = 29, and middle-ear aspirates (n = 237. Overall, 212 samples (61% were confirmed by culture and/or PCR. Among the positive samples, Streptococcus pneumoniae (mainly serotype 3 was predominant (104/212; 49.0%, followed by non-typable Haemophilus influenzae (NTHi 59/212; 27.8% and Streptococcus pyogenes (47/212; 22%. Haemophilus influenzae type b was detected in only three samples. The underlying microbiology of respiratory infections is gradually changing in response to various selective pressures, such as vaccine use and antibiotic consumption. The application of multiplex PCR (mPCR assays is particularly useful since it successfully identified the microorganisms implicated in acute otitis media or lower respiratory tract infections in nearly 75% of patients with a positive result compared to conventional cultures. Non-culture identification of the implicated pneumococcal serotypes is also an important issue for monitoring pneumococcal infections in the era of conjugate pneumococcal vaccines.

  11. Detection of Gastrointestinal Pathogens from Stool Samples on Hemoccult Cards by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    Martin Alberer

    2017-01-01

    Full Text Available Purpose. Up to 30% of international travelers are affected by travelers’ diarrhea (TD. Reliable data on the etiology of TD is lacking. Sufficient laboratory capacity at travel destinations is often unavailable and transporting conventional stool samples to the home country is inconvenient. We evaluated the use of Hemoccult cards for stool sampling combined with a multiplex PCR for the detection of model viral, bacterial, and protozoal TD pathogens. Methods. Following the creation of serial dilutions for each model pathogen, last positive dilution steps (LPDs and thereof calculated last positive sample concentrations (LPCs were compared between conventional stool samples and card samples. Furthermore, card samples were tested after a prolonged time interval simulating storage during a travel duration of up to 6 weeks. Results. The LPDs/LPCs were comparable to testing of conventional stool samples. After storage on Hemoccult cards, the recovery rate was 97.6% for C. jejuni, 100% for E. histolytica, 97.6% for norovirus GI, and 100% for GII. Detection of expected pathogens was possible at weekly intervals up to 42 days. Conclusion. Stool samples on Hemoccult cards stored at room temperature can be used in combination with a multiplex PCR as a reliable tool for testing of TD pathogens.

  12. Multiplex real-time PCR SYBR Green for detection and typing of group III Clostridium botulinum.

    Science.gov (United States)

    Anniballi, Fabrizio; Auricchio, Bruna; Delibato, Elisabetta; Antonacci, Monia; De Medici, Dario; Fenicia, Lucia

    2012-01-27

    Clostridium botulinum type C and type D belonging to the group III organisms, are mainly responsible for animal botulism outbreaks. Clinical signs alone are often insufficient to make a diagnosis of botulism and a laboratory confirmation is required. Laboratory confirmation can be performed by demonstrating the presence of botulinum neurotoxins in serum, gastrointestinal contents, liver, wound of sick or dead animals, or by demonstrating the presence of C. botulinum in gastrointestinal contents, liver, and wound. Demonstration of spores in gastrointestinal contents or tissue of animals with clinical signs indicative of botulism reinforces the clinical diagnosis. With the aim of detecting and typing C. botulinum group III organisms, a multiplex real-time PCR SYBR Green was developed and in-house validated. Selectivity, limit of detection, relative accuracy, relative specificity, relative sensitivity, and repeatability of the method were investigated. The multiplex real-time PCR SYBR green used showed a 100% selectivity, 100% relative accuracy, 100% relative specificity, 100% relative sensitivity and a limit of detection of 277 and 580 DNA copies for C. botulinum type C and C. botulinum type D, respectively. The method reported here represents a suitable tool for laboratory diagnosis of type C and D botulism and for testing a large number of samples collected during the animal botulism surveillance and prevention activities. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. Detection of human beta defensin-1 and -2 by RT-competitive multiplex PCR.

    Science.gov (United States)

    Kippenberger, Stefan; Loitsch, Stefan; Thaci, Diamant; Kaufmann, Roland; Bernd, August

    2005-05-01

    Although, the human epithelium is constantly challenged by a broad spectrum of microorganisms, invasive infections are rather rare. Recent findings suggest the expression of antimicrobial peptides by skin cells in order to provide an innate defensive barrier. In particular, peptides of the beta-defensin family offer antimicrobial activity against different pathogens including bacteria and fungi. Within this peptide family, hBD-1 is rather constitutively expressed while hBD-2 and hBD-3 expression depends on environmental conditions. The present paper introduces RT-competitive multiplex PCR as a precise tool to detect hBD-1 and hBD-2 expression on the transcriptional level. The method makes use of co-amplification of synthetic competitors along with referring wildtype targets. Competitor- and wildtype-derived products differ in size allowing signal discrimination using agarose gel electrophoresis. Regulation of gene transcripts is evaluated by comparison of competitor and corresponding wildtype signals. It was found that primary human keratinocytes stimulated with Escherichia coli cells for 8 h offered an upregulation of hBD-2 to about 2,000 fold, while hBD-1 was only marginally regulated. RT-competitive multiplex PCR is a simple and accurate method that enables new insights into defensin regulation under physiological and pathophysiological conditions.

  14. A two-step multiplex PCR system identifying Central European fish species

    Directory of Open Access Journals (Sweden)

    Johannes Oehm

    2015-12-01

    Full Text Available The morphological identification of fish samples can be difficult, for example, when dealing with eggs, larvae, tissue samples, or dietary samples of piscivores. Hard parts such as otoliths, chewing pads, pharyngeal bones or scales can enable morphological identification if present. However, species-specific identification is often not possible, especially in species-rich groups like the cyprinids. Here, we present a two-step multiplex PCR system, tailored for rapid, sensitive, and specific molecular detection of Central European fish species. It is composed of six assays, covers 79 fish and lamprey species, and enables the identification of 31 species, six genera, two families, two orders, and two fish family clusters. This novel approach is tailored for samples with bad DNA quality and has been successfully applied to identify fish prey in feces of the Eurasian otter, the Common Kingfisher, as well as feces and regurgitated pellets of cormorants. More than 4,000 dietary samples of the latter were collected within a two-year field study in the Alpine foreland. These samples have already been analyzed cost-effectively with the presented approach thus generating a detailed picture of cormorant diet in relation to fish phenology. The high sensitivity and specificity of the multiplex PCR system makes it also suitable for applications outside the field of trophic ecology such as the identification of juvenile fish, environmental monitoring, or environmental DNA studies.

  15. Identifying krill eggs in the central California current using novel multiplex PCR primers: Applications and limitations

    Science.gov (United States)

    Carrion, C. N.; Slesinger, E.; Marinovic, B.

    2016-02-01

    Euphausiids, otherwise known as krill, are an important link between primary producers and higher trophic levels within the central California current upwelling system. Euphausia pacifica and Thysanoessa spinifera, two of the most common euphausiid species along the central California coast, are both broadcast spawners and have some overlap in habitat, e.g. near marine life hotspots like the Monterey Bay and Gulf of Farallones. Species composition of euphausiid egg population within these regions is currently unknown. Distinct morphological differences between their eggs are lost once the egg dies or is preserved via formalin, alcohol, or freezing. In this project we designed genus specific DNA primers (mtCOI) for use in a multiplex PCR to distinguish among spawned euphausiid eggs of Euphausia spp. and Thysanoessa spp. in central California current surface waters. Effective and ineffective application of primers in a multiplex versus single-plex PCR is discussed, with an emphasis on primer design limitations in reference to the available barcoded regions of mitochondrial cytochrome oxidase subunit I (mtCOI) for each species in GenBank. This new protocol expands current monitoring efforts into sampling a non-swimming portion of the population which has the potential to improve euphausiid biomass estimates.

  16. Use of Multiplex Real-Time PCR To Diagnose Scrub Typhus.

    Science.gov (United States)

    Tantibhedhyangkul, Wiwit; Wongsawat, Ekkarat; Silpasakorn, Saowaluk; Waywa, Duangdao; Saenyasiri, Nuttawut; Suesuay, Jintapa; Thipmontree, Wilawan; Suputtamongkol, Yupin

    2017-05-01

    Scrub typhus, caused by Orientia tsutsugamushi , is a common cause of acute undifferentiated febrile illness in the Asia-Pacific region. However, its nonspecific clinical manifestation often prevents early diagnosis. We propose the use of PCR and serologic tests as diagnostic tools. Here, we developed a multiplex real-time PCR assay using hydrolysis (TaqMan) probes targeting O. tsutsugamushi 47-kDa, groEL , and human interferon beta (IFN-β gene) genes to improve early diagnosis of scrub typhus. The amplification efficiency was higher than 94%, and the lower detection limit was 10 copies per reaction. We used a human gene as an internal DNA quality and quantity control. To determine the sensitivity of this PCR assay, we selected patients with confirmed scrub typhus who exhibited a clear 4-fold increase in the level of IgG and/or IgM. The PCR assay result was positive in 45 of 52 patients, indicating a sensitivity of 86.5% (95% confidence interval [CI]: 74.2 to 94.4). The PCR assessment was negative for all 136 non-scrub typhus patients, indicating a specificity of 100% (95% CI: 97.3 to 100). In addition, this test helped diagnose patients with inconclusive immunofluorescence assay (IFA) results and using single blood samples. In conclusion, the real-time PCR assay proposed here is sensitive and specific in diagnosing scrub typhus. Combining PCR and serologic tests will improve the diagnosis of scrub typhus among patients presenting with acute febrile illness. Copyright © 2017 American Society for Microbiology.

  17. Clinical usefulness of multiplex PCR lateral flow in MRSA detection: a novel, rapid genetic testing method.

    Science.gov (United States)

    Nihonyanagi, Shin; Kanoh, Yuhsaku; Okada, Kiyomi; Uozumi, Toshiki; Kazuyama, Yukumasa; Yamaguchi, Tokiko; Nakazaki, Nobuhiko; Sakurai, Keizou; Hirata, Yasuyoshi; Munekata, Shinichi; Ohtani, Shinichi; Takemoto, Tsuyoshi; Bandoh, Yuki; Akahoshi, Tohru

    2012-06-01

    Methicillin-resistant Staphylococcus aureus (MRSA) with exogenous cassette DNA containing the methicillin-resistant gene mecA (SCCmec) poses a problem as a drug-resistant bacterium responsible for hospital- and community-acquired infections. The frequency of MRSA detection has recently been increasing rapidly in Japan, and SCCmec has also been classified more diversely into types I-V. A rapid test is essential for early diagnosis and treatment of MRSA infections, but detection by conventional methods requires at least two days. The newly developed multiplex PCR lateral flow method allows specific amplification of femA to detect S. aureus, mecA to detect SCCmec, and kdpC to detect SCCmec type II; moreover, PCR products can be evaluated visually in about 3 h. In the present study, we developed a PCR lateral flow method for MRSA using this method and investigated its clinical usefulness in the detection of MRSA. The results showed a diagnostic concordance rate of 91.7% for MRSA and methicillin-susceptible S. aureus between bacteriological examination and PCR lateral flow, and a high level of specificity in PCR lateral flow. In addition, a higher detection rate for S. aureus using the same sample was observed for PCR lateral flow (70.2%) than for bacteriological tests (48.6%). The above results show that PCR lateral flow for MRSA detection has high sensitivity, specificity, and speed, and its clinical application as a method for early diagnosis of MRSA infections appears to be feasible.

  18. A multiplex PCR assay to diagnose and quantify Nosema infections in honey bees (Apis mellifera).

    Science.gov (United States)

    Hamiduzzaman, Mollah Md; Guzman-Novoa, Ernesto; Goodwin, Paul H

    2010-10-01

    Correct identification of the microsporidia, Nosema apis and Nosema ceranae, is key to the study and control of Nosema disease of honey bees (Apis mellifera). A rapid DNA extraction method combined with multiplex PCR to amplify the 16S rRNA gene with species-specific primers was compared with a previously published assay requiring spore-germination buffer and a DNA extraction kit. When the spore germination-extraction kit method was used, 10 or more bees were required to detect the pathogens, whereas the new extraction method made it possible to detect the pathogens in single bees. Approx. 4-8 times better detection of N. ceranae was found with the new method compared to the spore germination-extraction kit method. In addition, the time and cost required to process samples was lower with the proposed method compared to using a kit. Using the new DNA extraction method, a spore quantification procedure was developed using a triplex PCR involving co-amplifying the N. apis and N. ceranae 16S rRNA gene with the ribosomal protein gene, RpS5, from the honey bee. The accuracy of this semi-quantitative PCR was determined by comparing the relative band intensities to the number of spores per bee determined by microscopy for 23 samples, and a high correlation (R(2)=0.95) was observed. This method of Nosema spore quantification revealed that spore numbers as low as 100 spores/bee could be detected by PCR. The new semi-quantitative triplex PCR assay is more sensitive, economical, rapid, simple, and reliable than previously published standard PCR-based methods for detection of Nosema and will be useful in laboratories where real-time PCR is not available. Copyright 2010 Elsevier Inc. All rights reserved.

  19. Use of Multiplex Real-Time PCR To Diagnose Scrub Typhus

    Science.gov (United States)

    Wongsawat, Ekkarat; Silpasakorn, Saowaluk; Waywa, Duangdao; Saenyasiri, Nuttawut; Suesuay, Jintapa; Thipmontree, Wilawan

    2017-01-01

    ABSTRACT Scrub typhus, caused by Orientia tsutsugamushi, is a common cause of acute undifferentiated febrile illness in the Asia-Pacific region. However, its nonspecific clinical manifestation often prevents early diagnosis. We propose the use of PCR and serologic tests as diagnostic tools. Here, we developed a multiplex real-time PCR assay using hydrolysis (TaqMan) probes targeting O. tsutsugamushi 47-kDa, groEL, and human interferon beta (IFN-β gene) genes to improve early diagnosis of scrub typhus. The amplification efficiency was higher than 94%, and the lower detection limit was 10 copies per reaction. We used a human gene as an internal DNA quality and quantity control. To determine the sensitivity of this PCR assay, we selected patients with confirmed scrub typhus who exhibited a clear 4-fold increase in the level of IgG and/or IgM. The PCR assay result was positive in 45 of 52 patients, indicating a sensitivity of 86.5% (95% confidence interval [CI]: 74.2 to 94.4). The PCR assessment was negative for all 136 non-scrub typhus patients, indicating a specificity of 100% (95% CI: 97.3 to 100). In addition, this test helped diagnose patients with inconclusive immunofluorescence assay (IFA) results and using single blood samples. In conclusion, the real-time PCR assay proposed here is sensitive and specific in diagnosing scrub typhus. Combining PCR and serologic tests will improve the diagnosis of scrub typhus among patients presenting with acute febrile illness. PMID:28202789

  20. New multiplex real-time PCR approach to detect gene mutations for spinal muscular atrophy.

    Science.gov (United States)

    Liu, Zhidai; Zhang, Penghui; He, Xiaoyan; Liu, Shan; Tang, Shi; Zhang, Rong; Wang, Xinbin; Tan, Junjie; Peng, Bin; Jiang, Li; Hong, Siqi; Zou, Lin

    2016-08-17

    Spinal muscular atrophy (SMA) is the most common autosomal recessive disease in children, and the diagnosis is complicated and difficult, especially at early stage. Early diagnosis of SMA is able to improve the outcome of SMA patients. In our study, Real-time PCR was developed to measure the gene mutation or deletion of key genes for SMA and to further analyse genotype-phenotype correlation. The multiple real-time PCR for detecting the mutations of survival of motor neuron (SMN), apoptosis inhibitory protein (NAIP) and general transcription factor IIH, polypeptide 2 gene (GTF2H2) was established and confirmed by DNA sequencing and multiplex ligation-dependent probe amplification (MLPA). The diagnosis and prognosis of 141 hospitalized children, 100 normal children and further 2000 cases of dry blood spot (DBS) samples were analysed by this multiple real-time PCR. The multiple real-time PCR was established and the accuracy of it to detect the mutations of SMN, NAIP and GTF2H2 was at least 98.8 % comparing with DNA sequencing and MLPA. Among 141 limb movement disorders children, 75 cases were SMA. 71 cases of SMA (94.67 %) were with SMN c.840 mutation, 9 cases (12 %) with NAIP deletion and 3 cases (4 %) with GTF2H2 deletion. The multiple real-time PCR was able to diagnose and predict the prognosis of SMA patients. Simultaneously, the real-time PCR was applied to detect trace DNA from DBS and able to make an early diagnosis of SMA. The clinical and molecular characteristics of SMA in Southwest of China were presented. Our work provides a novel way for detecting SMA in children by using real-time PCR and the potential usage in newborn screening for early diagnosis of SMA.

  1. Guidelines for optimisation of a multiplex oligonucleotide ligation-PCR for characterisation of microbial pathogens in a microsphere suspension array.

    Science.gov (United States)

    Wuyts, Véronique; Roosens, Nancy H C; Bertrand, Sophie; Marchal, Kathleen; De Keersmaecker, Sigrid C J

    2015-01-01

    With multiplex oligonucleotide ligation-PCR (MOL-PCR) different molecular markers can be simultaneously analysed in a single assay and high levels of multiplexing can be achieved in high-throughput format. As such, MOL-PCR is a convenient solution for microbial detection and identification assays where many markers should be analysed, including for routine further characterisation of an identified microbial pathogenic isolate. For an assay aimed at routine use, optimisation in terms of differentiation between positive and negative results and of cost and effort is indispensable. As MOL-PCR includes a multiplex ligation step, followed by a singleplex PCR and analysis with microspheres on a Luminex device, several parameters are accessible for optimisation. Although MOL-PCR performance may be influenced by the markers used in the assay and the targeted bacterial species, evaluation of the method of DNA isolation, the probe concentration, the amount of microspheres, and the concentration of reporter dye is advisable in the development of any MOL-PCR assay. Therefore, we here describe our observations made during the optimisation of a 20-plex MOL-PCR assay for subtyping of Salmonella Typhimurium with the aim to provide a possible workflow as guidance for the development and optimisation of a MOL-PCR assay for the characterisation of other microbial pathogens.

  2. Development of a multiplex real-time PCR assay for phylogenetic analysis of Uropathogenic Escherichia coli.

    Science.gov (United States)

    Hasanpour, Mojtaba; Najafi, Akram

    2017-06-01

    Uropathogenic Escherichia coli (UPEC) is among major pathogens causing 80-90% of all episodes of urinary tract infections (UTIs). Recently, E. coli strains are divided into eight main phylogenetic groups including A, B1, B2, C, D, E, F, and clade I. This study was aimed to develop a rapid, sensitive, and specific multiplex real time PCR method capable of detecting phylogenetic groups of E. coli strains. This study was carried out on E. coli strains (isolated from the patient with UTI) in which the presence of all seven target genes had been confirmed in our previous phylogenetic study. An EvaGreen-based singleplex and multiplex real-time PCR with melting curve analysis was designed for simultaneous detection and differentiation of these genes. The primers were selected mainly based on the production of amplicons with melting temperatures (T m ) ranging from 82°C to 93°C and temperature difference of more than 1.5°C between each peak.The multiplex real-time PCR assays that have been developed in the present study were successful in detecting the eight main phylogenetic groups. Seven distinct melting peaks were discriminated, with Tm value of 93±0.8 for arpA, 89.2±0.1for chuA, 86.5±0.1 for yjaA, 82.3±0.2 for TspE4C2, 87.8±0.1for trpAgpC, 85.4±0.6 for arpAgpE genes, and 91±0.5 for the internal control. To our knowledge, this study is the first melting curve-based real-time PCR assay developed for simultaneous and discrete detection of these seven target genes. Our findings showed that this assay has the potential to be a rapid, reliable and cost-effective alternative for routine phylotyping of E. coli strains. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Confirmed identification and toxin profiling of Campylobacter jejuni using a thermostabilized multiplex PCR formulation.

    Science.gov (United States)

    Ramachandran, Nitya; Ramlal, Shylaja; Batra, Harsh Vardhan

    2017-07-01

    Cytolethal distending toxin (CDT) producing Campylobacter jejuni species are one of the leading causes of human gastroenteritis worldwide. The main intent of the study was to develop a multiplex PCR assay for the confirmed identification and toxin profiling of C. jejuni. The genes targeted were rpo B as genus specific, hip O for species; cdt A, cdt B, cdt C encoding respective subunit proteins of CDT with Internal Amplification Control (IAC). To enhance its application as a pre-mixed ready-to-use format, the master mix of developed mPCR was dried by lyophilization and stability was assessed. Thermostabilized reagents showed stability of 1.5 months at room-temperature and upto six months at 4 °C without any loss of functionality. The assay was evaluated on a number of presumptive Campylobacter isolates along with biochemical tests. Results obtained indicated the accurate identification of C. jejuni by developed mPCR format in contrast to misconception associated with biochemical assays. The assay was also tested on spiked samples for its real-time utility. Altogether, the room-temperature storable and ready-to- use mPCR format developed in this study could be preferred for rapid detection and confirmed identification of toxigenic strains of C. jejuni in place of conventional biochemical assays. © 2017 APMIS. Published by John Wiley & Sons Ltd.

  4. Simultaneous detection of three fish rhabdoviruses using multiplex real-time quantitative RT-PCR assay.

    Science.gov (United States)

    Liu, Zongxiao; Teng, Yong; Liu, Hong; Jiang, Yulin; Xie, Xiayang; Li, Huifang; Lv, Jiangqiang; Gao, Longying; He, Junqiang; Shi, Xiujie; Tian, Feiyan; Yang, Jingshun; Xie, Congxin

    2008-04-01

    Spring viremia of carp virus (SVCV), infectious hematopoietic necrosis virus (IHNV) and viral hemorrhagic septicemia virus (VHSV) are three important fish rhabdoviruses, causing serious Office International des Epizooties (OIE) classified diseases in wild and farmed fish. Here, a new multiplex real-time quantitative RT-PCR (mqRT-PCR) assay was developed for simultaneous detection, identification and quantification of these three rhabdoviruses. The sets of primers and probes were targeted to conserved regions of glycoprotein (G) gene of SVCV, nucleoprotein (N) gene of IHNV and G gene of VHSV and used to amplify. The sensitivity, specificity and interference test of mqRT-PCR assay was analyzed. It was shown that the detection levels of 100 copies of SVCV, 220 copies of IHNV and 140 copies of VHSV were achieved, and there was no non-specific amplification and cross-reactivity using RNA of pike fry rhabdovirus (PFRV), infectious pancreatic necrosis virus (IPNV) and grass carp reovirus (GCRV). A total of 80 clinical fish samples were tested using the mqRT-PCR assay and the results were confirmed by antigen-capture ELISA and cell culture assay. This assay has the potential to be used for both research applications and diagnosis.

  5. Using multiplex PCR amplification and typing kits for the analysis of DNA evidence in a serial killer case.

    Science.gov (United States)

    Hochmeister, M N; Budowle, B; Eisenberg, A; Borer, U V; Dirnhofer, R

    1996-01-01

    Analysis of DNA evidence in a serial killer case was performed using the AmpliType HLA-DQ alpha-, AmpliType PM-, and the GenePrint STR Multiplex System PCR Amplification Kits. In addition, a sex typing procedure using the X-Y homologous gene amelogenin was carried out. DNA profiles from a single hair with attached sheath material, recovered from underneath the seat cover of the suspect's car seat were compared with DNA profiles derived from reference head hairs from a homicide victim. From the evidentiary sample only 9 ng of human DNA could be recovered. In a sample, where the quantity of DNA becomes a critical issue a powerful route is the simultaneous amplification of several loci (multiplex PCR). This is the first report where commercially available multiplex PCR amplification and typing kits have been introduced for the analysis of DNA evidence in a serial killer case and the analysis has been admitted in court.

  6. Multiplex quantification of four DNA targets in one reaction with Bio-Rad droplet digital PCR system for GMO detection

    Science.gov (United States)

    Dobnik, David; Štebih, Dejan; Blejec, Andrej; Morisset, Dany; Žel, Jana

    2016-10-01

    The advantages of the digital PCR technology are already well documented until now. One way to achieve better cost efficiency of the technique is to use it in a multiplexing strategy. Droplet digital PCR platforms, which include two fluorescence filters, support at least duplex reactions and with some developments and optimization higher multiplexing is possible. The present study not only shows a development of multiplex assays in droplet digital PCR, but also presents a first thorough evaluation of several parameters in such multiplex digital PCR. Two 4-plex assays were developed for quantification of 8 different DNA targets (7 genetically modified maize events and maize endogene). Per assay, two of the targets were labelled with one fluorophore and two with another. As current analysis software does not support analysis of more than duplex, a new R- and Shiny-based web application analysis tool (http://bit.ly/ddPCRmulti) was developed that automates the analysis of 4-plex results. In conclusion, the two developed multiplex assays are suitable for quantification of GMO maize events and the same approach can be used in any other field with a need for accurate and reliable quantification of multiple DNA targets.

  7. Multiplexed and Sensitive DNA Methylation Testing Using Methylation-Sensitive Restriction Enzymes "MSRE-qPCR".

    Science.gov (United States)

    Beikircher, Gabriel; Pulverer, Walter; Hofner, Manuela; Noehammer, Christa; Weinhaeusel, Andreas

    2018-01-01

    DNA methylation is a chemically stable key-player in epigenetics. In the vertebrate genome the 5-methyl cytosine (5mC) has been found almost exclusively in the CpG dinucleotide context. CpG dinucleotides are enriched in CpG islands very frequently located within or close to gene promoters. Analyses of DNA methylation changes in human diagnostics have been conducted classically using methylation-sensitive restriction enzymes (MSRE). Since the discovery of bisulfite conversion-based sequencing and PCR assays, MSRE-based PCR assays have been less frequently used, although especially in the field of cancer epigenetics MSRE-based genome-wide discovery and targeted screening applications have been and are still performed successfully. Even though epigenome-wide discovery of altered DNA methylation patterns has found its way into various fields of human disease and molecular genetics research, the validation of findings upon discovery is still a bottleneck. Usually several multiples of 10 up to 100 candidate biomarkers from discovery have to be confirmed or are of interest for further work. In particular, bisulfite PCR assays are often limited in the number of candidates which can be analyzed, due to their low multiplexing capability, especially, if only small amounts of DNA are available from for example clinical specimens. In clinical research and diagnostics a similar situation arises for the analyses of cell-free DNA (cfDNA) in body fluids or circulating tumor cells (CTCs). Although tissue- or disease- (e.g., cancer) specific DNA methylation patterns can be deduced very efficiently in a genome-wide manner if around 100 ng of DNA are available, confirming these candidates and selecting target-sequences for studying methylation changes in liquid biopsies using cfDNA or CTCs remains a big challenge. Along these lines we have developed MSRE-qPCR and introduce here method details, which have been found very suitable for the efficient confirmation and testing of DNA

  8. Detection of Shiga toxins genes by Multiplex PCR in clinical samples

    Directory of Open Access Journals (Sweden)

    2013-09-01

    Full Text Available Background: Different methods have been used for detection of shiga toxins; such as,  cell culture, ELISA, and RFPLA. However, all of these methods suffer from high cost, time-consumption and relatively low sensitivity. In this study we used Multiplex PCR method for detection of genes encoding shiga toxins. Material and Methods: In this study, 63 clinical samples were obtained from positive cultures of Shigella and E. coli O157, from Bahman 1391 until Ordibehesht 1392 in Mazandaran province. Initial confirmation of shiga toxins producing bacteria was performed by biochemical and serological methods. After DNA extraction, detection of stx1 and stx2 genes was accomplished by multiplex PCR.  For confirmation of the PCR amplicon, DNA sequencing was used. Antibiotic sensitivity tests were performed by disk diffusion method. Results:  Among the positive strains, 13 strains contained stx2 genes, 4 strains contained Stx/Stx1 genes and 4 strains harbored both Stx/Stx1 and Stx2. The DNA extracted from other Gram-negative bacteria was not protected by the relevant parts of these toxins. Sequencing of the amplified fragments indicated the correct toxin sequences.  The sensitivity for identification of Stx/Stx1 gene was 1.56 pg/ µl and for Stx2 was 1.08 pg/µl. The toxin positive strains were all sensitive to Cefixime, Gentamicin, Amikacin, Ceftriaxone, and Nitrofurantoin. Conclusion: This method is fast and accurate for detection of bacteria producing shiga toxin and can be used to identify different types of shiga toxin.

  9. New multiplex PCR method for the simultaneous diagnosis of the three known species of equine tapeworm.

    Science.gov (United States)

    Bohórquez, G Alejandro; Luzón, Mónica; Martín-Hernández, Raquel; Meana, Aránzazu

    2015-01-15

    Although several techniques exist for the detection of equine tapeworms in serum and feces, the differential diagnosis of tapeworm infection is usually based on postmortem findings and the morphological identification of eggs in feces. In this study, a multiplex polymerase chain reaction (PCR)-based method for the simultaneuos detection of Anoplocephala magna, Anoplocephala perfoliata and Anoplocephaloides mamillana has been developed and validated. The method simultaneously amplifies hypervariable SSUrRNA gene regions in the three tapeworm species in a single reaction using three pairs of primers, which exclusively amplify the internal transcribed spacer 2 (ITS-2) in each target gene. The method was tested on three types of sample: (a) 1/10, 1/100, 1/500, 1/1000, 1/2000 and 1/5000 dilutions of 70 ng of genomic DNA of the three tapeworm species, (b) DNA extracted from negative aliquots of sediments of negative control fecal samples spiked with 500, 200, 100, 50 and 10 eggs (only for A. magna and A. perfoliata; no A. mamillana eggs available) and (c) DNA extracted from 80, 50, 40, 30, 10 and 1 egg per 2 μl of PCR reaction mix (only for A. magna and A. perfoliata; no A. mamillana eggs available). No amplification was observed against the DNA of Gasterophilus intestinalis, Parascaris equorum and Strongylus vulgaris. The multiplex PCR method emerged as specific for the three tapeworms and was able to identify as few as 50 eggs per fecal sample and as little as 0.7 ng of control genomic DNA obtained from the three species. The method proposed is able to differentiate infections caused by the two most frequent species A. magna or A. perfoliata when the eggs are present in feces and is also able to detect mixed infections by the three cestode species. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Comparative evaluation of six commercialized multiplex PCR kits for the diagnosis of respiratory infections.

    Science.gov (United States)

    Pillet, Sylvie; Lardeux, Marina; Dina, Julia; Grattard, Florence; Verhoeven, Paul; Le Goff, Jérôme; Vabret, Astrid; Pozzetto, Bruno

    2013-01-01

    The molecular diagnosis of respiratory infection can be performed using different commercial multiplex-based PCR kits whose performances have been previously compared individually to those of conventional techniques. This study compared the practicability and the diagnostic performances of six CE-marked kits available in 2011 on the French market, including 2 detecting viruses and atypical bacteria (from Pathofinder and Seegene companies) and 4 detecting only viruses (from Abbott, Genomica, Qiagen and Seegene companies). The respective sensitivity, specificity, accuracy and agreement of each multiplex technique were calculated by comparison to commercial duplex PCR tests (Argene/bioMérieux) used as gold standard. Eighty-eight respiratory specimens with no pathogen (n = 11), single infections (n = 33) or co-infections (n = 44) were selected to cover 9 viruses or groups of viruses and 3 atypical bacteria. All samples were extracted using the NUCLISENS® easyMAG™ instrument (bioMérieux). The overall sensitivity ranged from 56.25% to 91.67% for viruses and was below 50% with both tests for bacteria. The overall specificity was excellent (>94% for all pathogens). For each tested kit, the overall agreement with the reference test was strong for viruses (kappa test >0.60) and moderate for bacteria. After the extraction step, the hands-on time varied from 50 min to 2h30 and the complete results were available in 2h30 to 9 h. The spectrum of tested agents and the technology used to reveal the PCR products as well as the laboratory organization are determinant for the selection of a kit.

  11. Comparative evaluation of six commercialized multiplex PCR kits for the diagnosis of respiratory infections.

    Directory of Open Access Journals (Sweden)

    Sylvie Pillet

    Full Text Available The molecular diagnosis of respiratory infection can be performed using different commercial multiplex-based PCR kits whose performances have been previously compared individually to those of conventional techniques. This study compared the practicability and the diagnostic performances of six CE-marked kits available in 2011 on the French market, including 2 detecting viruses and atypical bacteria (from Pathofinder and Seegene companies and 4 detecting only viruses (from Abbott, Genomica, Qiagen and Seegene companies. The respective sensitivity, specificity, accuracy and agreement of each multiplex technique were calculated by comparison to commercial duplex PCR tests (Argene/bioMérieux used as gold standard. Eighty-eight respiratory specimens with no pathogen (n = 11, single infections (n = 33 or co-infections (n = 44 were selected to cover 9 viruses or groups of viruses and 3 atypical bacteria. All samples were extracted using the NUCLISENS® easyMAG™ instrument (bioMérieux. The overall sensitivity ranged from 56.25% to 91.67% for viruses and was below 50% with both tests for bacteria. The overall specificity was excellent (>94% for all pathogens. For each tested kit, the overall agreement with the reference test was strong for viruses (kappa test >0.60 and moderate for bacteria. After the extraction step, the hands-on time varied from 50 min to 2h30 and the complete results were available in 2h30 to 9 h. The spectrum of tested agents and the technology used to reveal the PCR products as well as the laboratory organization are determinant for the selection of a kit.

  12. A multiplex real-time PCR panel assay for simultaneous detection and differentiation of 12 common swine viruses.

    Science.gov (United States)

    Shi, Xiju; Liu, Xuming; Wang, Qin; Das, Amaresh; Ma, Guiping; Xu, Lu; Sun, Qing; Peddireddi, Lalitha; Jia, Wei; Liu, Yanhua; Anderson, Gary; Bai, Jianfa; Shi, Jishu

    2016-10-01

    Mixed infection with different pathogens is common in swine production systems especially under intensive production conditions. Quick and accurate detection and differentiation of different pathogens are necessary for epidemiological surveillance, disease management and import and export controls. In this study, we developed and validated a panel of multiplex real-time PCR/RT-PCR assays composed of four subpanels, each detects three common swine pathogens. The panel detects 12 viruses or viral serotypes, namely, VSV-IN, VSV-NJ, SVDV, CSFV, ASFV, FMDV, PCV2, PPV, PRV, PRRSV-NA, PRRSV-EU and SIV. Correlation coefficients (R(2)) and PCR amplification efficiencies of all singular and triplex real-time PCR reactions are within the acceptable range. Comparison between singular and triplex real-time PCR assays of each subpanel indicates that there is no significant interference on assay sensitivities caused by multiplexing. Specificity tests on 226 target clinical samples or 4 viral strains and 91 non-target clinical samples revealed that the real-time PCR panel is 100% specific, and there is no cross amplification observed. The limit of detection of each triplex real-time PCR is less than 10 copies per reaction for DNA, and less than 16 copies per reaction for RNA viruses. The newly developed multiplex real-time PCR panel also detected different combinations of co-infections as confirmed by other means of detections. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Development of a GeXP-multiplex PCR assay for the simultaneous detection and differentiation of six cattle viruses.

    Directory of Open Access Journals (Sweden)

    Qing Fan

    Full Text Available Foot-and-mouth disease virus (FMDV, Bluetongue virus (BTV, Vesicular stomatitis Virus (VSV, Bovine viral diarrheal (BVDV, Bovine rotavirus (BRV, and Bovine herpesvirus 1 (IBRV are common cattle infectious viruses that cause a great economic loss every year in many parts of the world. A rapid and high-throughput GenomeLab Gene Expression Profiler (GeXP analyzer-based multiplex PCR assay was developed for the simultaneous detection and differentiation of these six cattle viruses. Six pairs of chimeric primers consisting of both the gene-specific primer and a universal primer were designed and used for amplification. Then capillary electrophoresis was used to separate the fluorescent labeled PCR products according to the amplicons size. The specificity of GeXP-multiplex PCR assay was examined with samples of the single template and mixed template of six viruses. The sensitivity was evaluated using the GeXP-multiplex PCR assay on serial 10-fold dilutions of ssRNAs obtained via in vitro transcription. To further evaluate the reliability, 305 clinical samples were tested by the GeXP-multiplex PCR assay. The results showed that the corresponding virus specific fragments of genes were amplified. The detection limit of the GeXP-multiplex PCR assay was 100 copies/μL in a mixed sample of ssRNAs containing target genes of six different cattle viruses, whereas the detection limit for the Gexp-mono PCR assay for a single target gene was 10 copies/μL. In detection of viruses in 305 clinical samples, the results of GeXP were consistent with simplex real-time PCR. Analysis of positive samples by sequencing demonstrated that the GeXP-multiplex PCR assay had no false positive samples of nonspecific amplification. In conclusion, this GeXP-multiplex PCR assay is a high throughput, specific, sensitive, rapid and simple method for the detection and differentiation of six cattle viruses. It is an effective tool that can be applied for the rapid differential diagnosis

  14. Comparison of Real-Time Multiplex Human Papillomavirus (HPV) PCR Assays with INNO-LiPA HPV Genotyping Extra Assay▿

    OpenAIRE

    Else, Elizabeth A.; Swoyer, Ryan; Zhang, Yuhua; Taddeo, Frank J; Bryan, Janine T.; Lawson, John; Van Hyfte, Inez; Roberts, Christine C.

    2011-01-01

    Real-time type-specific multiplex human papillomavirus (HPV) PCR assays were developed to detect HPV DNA in samples collected for the efficacy determination of the quadrivalent HPV (type 6, 11, 16, and 18) L1 virus-like particle (VLP) vaccine (Gardasil). Additional multiplex (L1, E6, and E7 open reading frame [ORF]) or duplex (E6 and E7 ORF) HPV PCR assays were developed to detect high-risk HPV types, including HPV type 31 (HPV31), HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, and H...

  15. Enhanced capillary electrophoretic screening of Alzheimer based on direct apolipoprotein E genotyping and one-step multiplex PCR.

    Science.gov (United States)

    Woo, Nain; Kim, Su-Kang; Sun, Yucheng; Kang, Seong Ho

    2018-01-01

    Human apolipoprotein E (ApoE) is associated with high cholesterol levels, coronary artery disease, and especially Alzheimer's disease. In this study, we developed an ApoE genotyping and one-step multiplex polymerase chain reaction (PCR) based-capillary electrophoresis (CE) method for the enhanced diagnosis of Alzheimer's. The primer mixture of ApoE genes enabled the performance of direct one-step multiplex PCR from whole blood without DNA purification. The combination of direct ApoE genotyping and one-step multiplex PCR minimized the risk of DNA loss or contamination due to the process of DNA purification. All amplified PCR products with different DNA lengths (112-, 253-, 308-, 444-, and 514-bp DNA) of the ApoE genes were analyzed within 2min by an extended voltage programming (VP)-based CE under the optimal conditions. The extended VP-based CE method was at least 120-180 times faster than conventional slab gel electrophoresis methods In particular, all amplified DNA fragments were detected in less than 10 PCR cycles using a laser-induced fluorescence detector. The detection limits of the ApoE genes were 6.4-62.0pM, which were approximately 100-100,000 times more sensitive than previous Alzheimer's diagnosis methods In addition, the combined one-step multiplex PCR and extended VP-based CE method was also successfully applied to the analysis of ApoE genotypes in Alzheimer's patients and normal samples and confirmed the distribution probability of allele frequencies. This combination of direct one-step multiplex PCR and an extended VP-based CE method should increase the diagnostic reliability of Alzheimer's with high sensitivity and short analysis time even with direct use of whole blood. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples.

    Science.gov (United States)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas; Quyen, Than Linh; Engelsmann, Pia; Wolff, Anders; Bang, Dang Duong

    2017-04-01

    Salmonellosis, an infectious disease caused by Salmonella spp., is one of the most common foodborne diseases. Isolation and identification of Salmonella by conventional bacterial culture method is time consuming. In response to the demand for rapid on line or at site detection of pathogens, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair of newly designed primers targeting Salmonella spp. at subtype level were incorporated in the multiplex Direct PCR. To maximize the efficiency of the Direct PCR, the ratio between sample and dilution buffer was optimized. The sensitivity and specificity of the multiplex Direct PCR were tested using naturally contaminated pork meat samples for detecting and subtyping of Salmonella spp. Conventional bacterial culture methods were used as reference to evaluate the performance of the multiplex Direct PCR. Relative accuracy, sensitivity and specificity of 98.8%; 97.6% and 100%, respectively, were achieved by the method. Application of the multiplex Direct PCR to detect Salmonella in pork meat at slaughter reduces the time of detection from 5 to 6 days by conventional bacterial culture and serotyping methods to 14 h (including 12 h enrichment time). Furthermore, the method poses a possibility of miniaturization and integration into a point-of-need Lab-on-a-chip system for rapid online pathogen detection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Simultaneous quantitative assessment of circulating cell-free mitochondrial and nuclear DNA by multiplex real-time PCR

    Directory of Open Access Journals (Sweden)

    Peng Xia

    2009-01-01

    Full Text Available Quantification of circulating nucleic acids in plasma and serum could be used as a non-invasive diagnostic tool for monitoring a wide variety of diseases and conditions. We describe here a rapid, simple and accurate multiplex real-time PCR method for direct synchronized analysis of circulating cell-free (ccf mitochondrial (mtDNA and nuclear (nDNA DNA in plasma and serum samples. The method is based on one-step multiplex real-time PCR using a FAM-labeled MGB probe and primers to amplify the mtDNA sequence of the ATP 8 gene, and a VIC-labeled MGB probe and primers to amplify the nDNA sequence of the glycerinaldehyde-3-phosphate-dehydrogenase (GAPDH gene, in plasma and serum samples simultaneously. The efficiencies of the multiplex assays were measured in serial dilutions. Based on the simulation of the PCR reaction kinetics, the relative quantities of ccf mtDNA were calculated using a very simple equation. Using our optimised real-time PCR conditions, close to 100% efficiency was obtained from the two assays. The two assays performed in the dilution series showed very good and reproducible correlation to each other. This optimised multiplex real-time PCR protocol can be widely used for synchronized quantification of mtDNA and nDNA in different samples, with a very high rate of efficiency.

  18. Multiplex PCR for the detection and differentiation of Vibrio parahaemolyticus strains using the groEL, tdh and trh genes.

    Science.gov (United States)

    Hossain, Muhammad Tofazzal; Kim, Young-Ok; Kong, In-Soo

    2013-01-01

    Vibrio parahaemolyticus is a significant cause of human gastrointestinal disorders worldwide, transmitted primarily by ingestion of raw or undercooked contaminated seafood. In this study, a multiplex PCR assay for the detection and differentiation of V. parahaemolyticus strains was developed using primer sets for a species-specific marker, groEL, and two virulence markers, tdh and trh. Multiplex PCR conditions were standardised, and extracted genomic DNA of 70 V. parahaemolyticus strains was used for identification. The sensitivity and efficacy of this method were validated using artificially inoculated shellfish and seawater. The expected sizes of amplicons were 510 bp, 382 bp, and 171 bp for groEL, tdh and trh, respectively. PCR products were sufficiently different in size, and the detection limits of the multiplex PCR for groEL, tdh and trh were each 200 pg DNA. Specific detection and differentiation of virulent from non-virulent strains in shellfish homogenates and seawater was also possible after artificial inoculation with various V. parahaemolyticus strains. This newly developed multiplex PCR is a rapid assay for detection and differentiation of pathogenic V. parahaemolyticus strains, and could be used to prevent disease outbreaks and protect public health by helping the seafood industry maintain a safe shellfish supply. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Red Cell Genotyping by Multiplex PCR Identifies Antigen-Matched Blood Units for Transfusion-Dependent Thai Patients

    Science.gov (United States)

    Intharanut, Kamphon; Bejrachandra, Sasitorn; Nathalang, Siriporn; Leetrakool, Nipapan; Nathalang, Oytip

    2017-01-01

    Background Antigen-negative red cell transfusion is required for transfusion-dependent patients. We developed multiplex PCR for red cell genotyping and calculated the possibility of finding compatible predicted phenotypes in Thai blood donor populations according to red cell alloantibodies found among Thai patients. Methods 600 DNA samples obtained from unrelated healthy central and northern Thai blood donors were tested with the newly developed multiplex PCR for FY*A, FY*B, JK*A, JK*B, RHCE*e, RHCE*E, DI*A and GYP*Hut, GYP*Mur, GYP*Hop, GYP*Bun, and GYP*HF allele detections. Additionally, the possibility of finding compatible predicted phenotypes in two Thai blood donor populations was calculated to estimate the minimal number of tests needed to provide compatible blood. Results The validity of multiplex PCR using known DNA controls and the phenotyping and genotyping results obtained by serological and PCR-SSP techniques were in agreement. The possibility of finding at least one compatible blood unit for patients with multiple antibodies was comparable in Thai populations. Conclusions The multiplex PCR for red cell genotyping simultaneously interprets 7 alleles and 1 hybrid GP group. Similar strategies can be applied in other populations depending on alloantibody frequencies in transfusion-dependent patients, especially in a country with limited resources. PMID:29070981

  20. Validation of carbapenemase and extended-spectrum β-lactamase multiplex endpoint PCR assays according to ISO 15189.

    Science.gov (United States)

    Bogaerts, P; Rezende de Castro, R; de Mendonça, R; Huang, T-D; Denis, O; Glupczynski, Y

    2013-07-01

    To validate and accredit a set of three multiplex endpoint PCR assays, targeting the most important carbapenemase and minor extended-spectrum β-lactamase (ESBL) resistance genes, according to the international ISO 15189 particular requirements for the quality and competence of medical laboratories. Specific primers targeting ESBLs and carbapenemases were collected from the literature or designed internally. The multiplex PCRs were validated for sensitivity, specificity, intra- and inter-run reproducibility and accuracy by means of external quality control (EQC) using a collection of 137 characterized and referenced isolates. For each multiplex PCR assay, the presence of an extraction control ruled out false-negative results due to PCR inhibition or extraction faults. Amplicons were separated by capillary electrophoresis (QIAxcel system, Qiagen). The protocols and validation files were reviewed in the setting of an external audit conducted by the Belgian organization for accreditation (BELAC). Sensitivity, specificity and reproducibility for each targeted gene were 100%. All isolates from the three EQC panels were correctly identified by each PCR assay (accuracy 100%). The validation files were controlled by BELAC, and the PCR protocols were accepted as accredited according to ISO 15189. Three home-made multiplex PCRs targeting the major carbapenemases and four minor class A ESBL genes encountered in Gram-negative bacteria were accredited according to the ISO 15189 standards. This validation scheme could provide a useful model for laboratories aiming to accredit their own protocols.

  1. Identification and Differentiation of Verticillium Species and V. longisporum Lineages by Simplex and Multiplex PCR Assays

    Science.gov (United States)

    Inderbitzin, Patrik; Davis, R. Michael; Bostock, Richard M.; Subbarao, Krishna V.

    2013-01-01

    Accurate species identification is essential for effective plant disease management, but is challenging in fungi including Verticillium sensu stricto (Ascomycota, Sordariomycetes, Plectosphaerellaceae), a small genus of ten species that includes important plant pathogens. Here we present fifteen PCR assays for the identification of all recognized Verticillium species and the three lineages of the diploid hybrid V. longisporum. The assays were based on DNA sequence data from the ribosomal internal transcribed spacer region, and coding and non-coding regions of actin, elongation factor 1-alpha, glyceraldehyde-3-phosphate dehydrogenase and tryptophan synthase genes. The eleven single target (simplex) PCR assays resulted in amplicons of diagnostic size for V. alfalfae, V. albo-atrum, V. dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii, V. nonalfalfae, V. nubilum, V. tricorpus, V. zaregamsianum, and Species A1 and Species D1, the two undescribed ancestors of V. longisporum. The four multiple target (multiplex) PCR assays simultaneously differentiated the species or lineages within the following four groups: Verticillium albo-atrum, V. alfalfae and V. nonalfalfae; Verticillium dahliae and V. longisporum lineages A1/D1, A1/D2 and A1/D3; Verticillium dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii and V. tricorpus; Verticillium isaacii, V. klebahnii and V. tricorpus. Since V. dahliae is a parent of two of the three lineages of the diploid hybrid V. longisporum, no simplex PCR assay is able to differentiate V. dahliae from all V. longisporum lineages. PCR assays were tested with fungal DNA extracts from pure cultures, and were not evaluated for detection and quantification of Verticillium species from plant or soil samples. The DNA sequence alignments are provided and can be used for the design of additional primers. PMID:23823707

  2. Rapid detection of carbapenemase genes by multiplex real-time PCR.

    Science.gov (United States)

    Monteiro, Jussimara; Widen, Raymond H; Pignatari, Antonio C C; Kubasek, Carly; Silbert, Suzane

    2012-04-01

    To develop a single multiplex real-time PCR assay to detect six different genetic types of carbapenemases already identified in Enterobacteriaceae (KPC, GES, NDM, IMP, VIM and OXA-48). A total of 58 bacterial isolates were tested. Thirty were previously characterized as resistant to carbapenems and documented by PCR and sequencing analysis to carry the following genes: bla(KPC) type, bla(GES) type, bla(IMP) type, bla(VIM) type, bla(OXA-48) and bla(NDM-1). These positive strains included 21 Enterobacteriaceae, 1 Acinetobacter baumannii and 8 Pseudomonas aeruginosa isolates. The remaining 28 isolates previously tested susceptible to carbapenems and were negative for these genes. Bacterial DNA was extracted using the easyMag extractor (bioMérieux, France). The real-time PCR was performed using the Rotor-Gene 6000 instrument (Corbett Life Science, Australia) and specific primers for each carbapenemase target were designed using the DNAStar software (Madison, WI, USA). Each one of the six carbapenemase genes tested presented a different melting curve after PCR amplification. The melting temperature (T(m)) analysis of the amplicons identified was as follows: bla(IMP) type (T(m) 80.1°C), bla(OXA-48) (T(m) 81.6°C), bla(NDM-1) (T(m) 84°C), bla(GES) type (T(m) 88.6°C), bla(VIM) type (T(m) 90.3°C) and bla(KPC) type (T(m) 91.6°C). No amplification was detected among the negative samples. The results showed 100% concordance with the genotypes previously identified. The new assay was able to detect the presence of six different carbapenemase gene types in a single 3 h PCR.

  3. Identification and Differentiation of Verticillium Species and V. longisporum Lineages by Simplex and Multiplex PCR Assays.

    Directory of Open Access Journals (Sweden)

    Patrik Inderbitzin

    Full Text Available Accurate species identification is essential for effective plant disease management, but is challenging in fungi including Verticillium sensu stricto (Ascomycota, Sordariomycetes, Plectosphaerellaceae, a small genus of ten species that includes important plant pathogens. Here we present fifteen PCR assays for the identification of all recognized Verticillium species and the three lineages of the diploid hybrid V. longisporum. The assays were based on DNA sequence data from the ribosomal internal transcribed spacer region, and coding and non-coding regions of actin, elongation factor 1-alpha, glyceraldehyde-3-phosphate dehydrogenase and tryptophan synthase genes. The eleven single target (simplex PCR assays resulted in amplicons of diagnostic size for V. alfalfae, V. albo-atrum, V. dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii, V. nonalfalfae, V. nubilum, V. tricorpus, V. zaregamsianum, and Species A1 and Species D1, the two undescribed ancestors of V. longisporum. The four multiple target (multiplex PCR assays simultaneously differentiated the species or lineages within the following four groups: Verticillium albo-atrum, V. alfalfae and V. nonalfalfae; Verticillium dahliae and V. longisporum lineages A1/D1, A1/D2 and A1/D3; Verticillium dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii and V. tricorpus; Verticillium isaacii, V. klebahnii and V. tricorpus. Since V. dahliae is a parent of two of the three lineages of the diploid hybrid V. longisporum, no simplex PCR assay is able to differentiate V. dahliae from all V. longisporum lineages. PCR assays were tested with fungal DNA extracts from pure cultures, and were not evaluated for detection and quantification of Verticillium species from plant or soil samples. The DNA sequence alignments are provided and can be used for the design of additional primers.

  4. Improved detection of Escherichia coli and coliform bacteria by multiplex PCR.

    Science.gov (United States)

    Molina, Felipe; López-Acedo, Elena; Tabla, Rafael; Roa, Isidro; Gómez, Antonia; Rebollo, José E

    2015-06-04

    The presence of coliform bacteria is routinely assessed to establish the microbiological safety of water supplies and raw or processed foods. Coliforms are a group of lactose-fermenting Enterobacteriaceae, which most likely acquired the lacZ gene by horizontal transfer and therefore constitute a polyphyletic group. Among this group of bacteria is Escherichia coli, the pathogen that is most frequently associated with foodborne disease outbreaks and is often identified by β-glucuronidase enzymatic activity or by the redundant detection of uidA by PCR. Because a significant fraction of essential E. coli genes are preserved throughout the bacterial kingdom, alternative oligonucleotide primers for specific E. coli detection are not easily identified. In this manuscript, two strategies were used to design oligonucleotide primers with differing levels of specificity for the simultaneous detection of total coliforms and E. coli by multiplex PCR. A consensus sequence of lacZ and the orphan gene yaiO were chosen as targets for amplification, yielding 234 bp and 115 bp PCR products, respectively. The assay designed in this work demonstrated superior detection ability when tested with lab collection and dairy isolated lactose-fermenting strains. While lacZ amplicons were found in a wide range of coliforms, yaiO amplification was highly specific for E. coli. Additionally, yaiO detection is non-redundant with enzymatic methods.

  5. The Prevalence of Human Papilloma Virus(HPV in Malignant Cervical Lesion, Using Multiplex PCR

    Directory of Open Access Journals (Sweden)

    M. R. Keyhkhaee

    2006-07-01

    Full Text Available Background: Cervical cancer is the second leading cause of cancer death among women. In this cancer, the effects of prevention, early diagnosis and treatment more than other cancers decrease the mortality rate. In 1970 human papilloma virus (HPV was introduction as major etiologic factor of cervical cancer. Different studies throughout the world revealed strong correlation between HPV and cancerous & precancerous changes in epithelial cells. Since cell culture and serological methods can not recognize the virus and its subtypes, the importance of the molecular methods including polymerase chain reaction (PCR in early and definite diagnosis of virus is obvious. Methods: In this study, after patient selection using the related protocol and completion of the questionnaires, 100 samples from cancer lesions of cervix selected. Then DNA extraction from paraffin blocks performed using standard method. Multiplex PCR with two pairs of primer (one as internal control performed and the PCR product run on 8% polyacrylamid gel. Results: The results showed that 73% of the tissues were infected by HPV. Conclusion: This finding confirm the previous results based of correlation between HPV,and cervical cancer.

  6. Comparison of three human papillomavirus DNA detection methods: Next generation sequencing, multiplex-PCR and nested-PCR followed by Sanger based sequencing.

    Science.gov (United States)

    da Fonseca, Allex Jardim; Galvão, Renata Silva; Miranda, Angelica Espinosa; Ferreira, Luiz Carlos de Lima; Chen, Zigui

    2016-05-01

    To compare the diagnostic performance for HPV infection using three laboratorial techniques. Ninty-five cervicovaginal samples were randomly selected; each was tested for HPV DNA and genotypes using 3 methods in parallel: Multiplex-PCR, the Nested PCR followed by Sanger sequencing, and the Next_Gen Sequencing (NGS) with two assays (NGS-A1, NGS-A2). The study was approved by the Brazilian National IRB (CONEP protocol 16,800). The prevalence of HPV by the NGS assays was higher than that using the Multiplex-PCR (64.2% vs. 45.2%, respectively; P = 0.001) and the Nested-PCR (64.2% vs. 49.5%, respectively; P = 0.003). NGS also showed better performance in detecting high-risk HPV (HR-HPV) and HPV16. There was a weak interobservers agreement between the results of Multiplex-PCR and Nested-PCR in relation to NGS for the diagnosis of HPV infection, and a moderate correlation for HR-HPV detection. Both NGS assays showed a strong correlation for detection of HPVs (k = 0.86), HR-HPVs (k = 0.91), HPV16 (k = 0.92) and HPV18 (k = 0.91). NGS is more sensitive than the traditional Sanger sequencing and the Multiplex PCR to genotype HPVs, with promising ability to detect multiple infections, and may have the potential to establish an alternative method for the diagnosis and genotyping of HPV. © 2015 Wiley Periodicals, Inc.

  7. Detection of pathogenic strains by multiplex PCR and antimicrobial sensitivity of Escherichia coli isolated from piglets

    OpenAIRE

    Macêdo, N.R.; Menezes,C.P.L.; Lage, A.P.; Ristow,L.E.; Reis, A.; Guedes,R.M.C.

    2007-01-01

    Avaliou-se a freqüência dos genes de fímbrias (K88, K99, 987P, F18 e F41) e toxinas (LT, Stb, StaP e Stx2e) de cepas de E. coli isoladas de leitões com diarréia usando a técnica de PCR multiplex com primers específicos para esses genes, e estudou-se o padrão de sensibilidade das cepas patogênicas pelo método de difusão em disco ao florfenicol, ceftiofur sódico, colistina, fosfomicina, neomicina, norfloxacina, sulfa + trimetoprim, doxiciclina, tetraciclina e lincomicina. Foram utilizadas 144 a...

  8. Use of Multiplex PCR for Diagnosis of Bacterial Infection Respiratory Mixed

    Directory of Open Access Journals (Sweden)

    Al-ssum, R. M.

    2010-01-01

    Full Text Available Atypical bacteria grow very slowly in culture or they do not grow at all leading to delays in detection and diagnosis. PCR multiplex was performed on template DNAs extracted from seventy three collected specimens. Thirty seven showed positive indication for the presence of bacterial infection. The incidence of Mycoplasma pneumoniae, Chlamydia pneumonia and Legionella pneumophila as a single infecting agent was 31.5%, 27.5% and 20 % respectively. Dual agent infection caused by Mycoplasma + Chlamydia, Mycoplasma + Legionella and Legionella + Chlamydia was 24%, 20% and 15% respectively. Triple agent infection caused by Legionella + Mycoplasma + Chlamydia was 17.5%. The etiology of the infection was M. pneumoniae, L. pneumophila or C. pneumoniae as a single etiology or in combination of two or three organisms.

  9. Detection of Chlamydia trachomatis and Mycoplasma genitalium in semen samples of infertile men using multiplex PCR

    Directory of Open Access Journals (Sweden)

    Sadrpour P

    2013-01-01

    Full Text Available Background: Chlamydia trachomatis is the most common bacterial sexually transmitted infection in the world, but the effect of this infection on male fertility is still controversial. Despite reports of interaction between Mycoplasma genitalium and sperm, this pathogen in semen samples of infertile men is less studied. We studied, the prevalence of Chlamydia trachomatis and Mycoplasma genitalium infection in infertile men.Methods: Among attending Avicenna Infertility Center, 120 men who had abnormal semen analysis tests were selected and the samples were taken. After detailed analysis of semen quality, DNA was extracted from each sample by chelex. Samples were evaluated for these two pathogens by multiplex PCR. Results were statistically analyzed.Results: Chlamydia trachomatis and Mycoplasma genitalium was detected in 23/3% and 12/5% of the samples, respectively. Although, Mycoplasma genitalium infection rises by increasing (P=0.640 and decreasing in age of first sexually activity (P=0.203, and also positive cases of Chlamydia trachomatis infection showed increase regarding age increase (P=0.619 and age decrease in first sexually activity (P=0.511, but these differences were not statistically significant. Conclusion: All in all, regarding to the increased prevalence of Chlamydia trachomatis infection compared with the only similar study in Iran and high prevalence of Mycoplasma genitalium infection in infertile men, this assessment was done. A multiplex PCR protocol rapidly and simultaneously identify these organisms in comparison with uniplex from clinical samples. Based on our results screening for Chlamydia trachomatis and Mycoplasma genitalium infection among infertile men seems to be valuable.

  10. Comparison of two multiplex PCR assays for the detection of respiratory viral infections.

    Science.gov (United States)

    Kim, Hanah; Hur, Mina; Moon, Hee-Won; Yun, Yeo-Min; Cho, Hyun Chan

    2014-10-01

    Respiratory viruses are the main causes of upper and lower respiratory tract diseases. Rapid and accurate detection of respiratory viruses is crucial for appropriate patient treatment and prevention of endemic spread. We compared two multiplex polymerase chain reaction (PCR) assays for the detection of respiratory viral pathogens. A total of 245 respiratory specimens (229 sputum samples, 14 bronchoalveolar lavage samples, 6 nasal swabs, 3 throat swabs, 7 unknown) were analyzed using two multiplex assays: One-step RV real-time PCR (BioSewoom, Seoul, Korea) and Seeplex RV 12 Detection kit (Seegene, Seoul, Korea). The results were further confirmed using sequencing as a reference. Among 245 samples (265 identifications including co-infections), the identification of respiratory viruses was 44.9% (119/265), 44.2% (117/265) and 45.3% (120/265) by One-step RV assay, Seeplex RV assay and sequencing, respectively. The concordance rate between One-step RV assay and sequencing was 95.5% (253/265), and that between Seeplex RV assay and sequencing was 89.8% (238/265) (P = 0.0189). The sensitivities of One-step RV and Seeplex RV assays were 94.1% [95% confidential interval (CI), 88.3%-97.6%] and 83.3% (95% CI, 75.4%-89.5%), respectively (P = 0.0002). The specificities of One-step RV and Seeplex RV assays were 96.6% (95% CI, 92.2%-98.9%) and 95.2% (95% CI, 90.3%-98.0%), respectively. Although the performances of One-step RV and Seeplex RV assays were overall comparable, One-step RV assay showed better sensitivity and concordance with sequencing. One-step RV assay can be a useful option for respiratory virus testing in clinical laboratories. © 2013 John Wiley & Sons Ltd.

  11. A simplified multiplex PCR assay for fast and easy discrimination of globally distributed staphylococcal cassette chromosome mec types in meticillin-resistant Staphylococcus aureus

    NARCIS (Netherlands)

    E. Ghaznavi Rad (Ehsanollah); N.S. Mariana (Nor Shamsudin); Z. Sekawi (Zamberi); A.F. van Belkum (Alex); V. Neela (Vasanthakumari)

    2010-01-01

    textabstractA multiplex PCR assay was developed for the identification of major types and subtypes of staphylococcal cassette chromosome mec (SCCmec) in meticillin-resistant Staphylococcus aureus (MRSA) strains. The method uses a novel 9 valent multiplex PCR plus two primer pairs for S. aureus

  12. Simultaneous detection of papaya ringspot virus, papaya leaf distortion mosaic virus, and papaya mosaic virus by multiplex real-time reverse transcription PCR.

    Science.gov (United States)

    Huo, P; Shen, W T; Yan, P; Tuo, D C; Li, X Y; Zhou, P

    2015-12-01

    Both the single infection of papaya ringspot virus (PRSV), papaya leaf distortion mosaic virus (PLDMV) or papaya mosaic virus (PapMV) and double infection of PRSV and PLDMV or PapMV which cause indistinguishable symptoms, threaten the papaya industry in Hainan Island, China. In this study, a multiplex real-time reverse transcription PCR (RT-PCR) was developed to detect simultaneously the three viruses based on their distinctive melting temperatures (Tms): 81.0±0.8°C for PRSV, 84.7±0.6°C for PLDMV, and 88.7±0.4°C for PapMV. The multiplex real-time RT-PCR method was specific and sensitive in detecting the three viruses, with a detection limit of 1.0×10(1), 1.0×10(2), and 1.0×10(2) copies for PRSV, PLDMV, and PapMV, respectively. Indeed, the reaction was 100 times more sensitive than the multiplex RT-PCR for PRSV, and 10 times more sensitive than multiplex RT-PCR for PLDMV. Field application of the multiplex real-time RT-PCR demonstrated that some non-symptomatic samples were positive for PLDMV by multiplex real-time RT-PCR but negative by multiplex RT-PCR, whereas some samples were positive for both PRSV and PLDMV by multiplex real-time RT-PCR assay but only positive for PLDMV by multiplex RT-PCR. Therefore, this multiplex real-time RT-PCR assay provides a more rapid, sensitive and reliable method for simultaneous detection of PRSV, PLDMV, PapMV and their mixed infections in papaya.

  13. Evaluation of a modular multiplex-PCR methicillin-resistant Staphylococcus aureus detection assay adapted for mecC detection

    NARCIS (Netherlands)

    Becker, Karsten; Larsen, Anders R; Skov, Robert L; Paterson, Gavin K; Holmes, Mark A; Sabat, Artur J; Friedrich, Alexander W; Köck, Robin; Peters, Georg; Kriegeskorte, André

    A mecC (mecA(LGA251))-adapted multiplex PCR-based methicillin-resistant Staphylococcus aureus (MRSA) detection assay was evaluated using an international, spa-typed Staphylococcus aureus collection comprising 51 mecC-positive MRSA, 240 mecA-positive MRSA, and 50 mecA-and mecC-negative

  14. Use of a new single multiplex PCR-based assay for direct simultaneous characterization of six Neisseria meningitidis serogroups.

    Science.gov (United States)

    Fraisier, Christophe; Stor, Richard; Tenebray, Bernard; Sanson, Yannick; Nicolas, Pierre

    2009-08-01

    We developed a new Neisseria meningitidis multiplex PCR to determine six serogroups, including X-specific primers, and to allow direct W135/Y discrimination. This assay offers a simple and low-cost method for serogrouping N. meningitidis from cerebrospinal fluid that could be useful in Africa.

  15. Use of a New Single Multiplex PCR-Based Assay for Direct Simultaneous Characterization of Six Neisseria meningitidis Serogroups▿

    Science.gov (United States)

    Fraisier, Christophe; Stor, Richard; Tenebray, Bernard; Sanson, Yannick; Nicolas, Pierre

    2009-01-01

    We developed a new Neisseria meningitidis multiplex PCR to determine six serogroups, including X-specific primers, and to allow direct W135/Y discrimination. This assay offers a simple and low-cost method for serogrouping N. meningitidis from cerebrospinal fluid that could be useful in Africa. PMID:19553584

  16. Entamoeba spp. diagnosis in patients with inflmmatory diarrhea by staining, copro-antigen ELISA and multiplex PCR methods

    Directory of Open Access Journals (Sweden)

    Zahra Gharibi

    2017-10-01

    Full Text Available Objective: To evaluate Entamoeba spp. diagnosis in patients with inflammatory diarrhea by staining, copro-antigen ELISA and multiplex PCR methods. Methods: In this descriptive cross-sectional survey, 200 stool samples were randomly collected during 2015–2016. The stool samples were evaluated microscopically for the presence of the parasite using direct and formalin-ether concentration and trichrome staining methods. Then, the stool samples were examined by copro-antigen ELISA (Biomerica Company and multiplex PCR methods. Results: Of 200 samples, 17, 29 and 23 cases were positive for Entamoeba species by the staining, copro-antigen ELISA and multiplex PCR methods, respectively. Of 23 positive samples in multiplex PCR test, 13 and 10 samples were positive for Entamoeba dispar (E. dispar and Entamoeba histolytica (E. histolytica, respectively. Conclusions: Our finding indicated a relatively high prevalence of Entamoeba species in patients with inflammatory diarrhea in Ahvaz city. Due to the complications of E. histolytica/ dispar infection, the health authorities of the city must pay more attention to control and prevent the transmission of E. histolytica/dispar to individuals.

  17. Development of a multiplex PCR assay for rapid identification of Burkholderia pseudomallei, Burkholderia thailandensis, Burkholderia mallei and Burkholderia cepacia complex.

    Science.gov (United States)

    Koh, Seng Fook; Tay, Sun Tee; Sermswan, Rasana; Wongratanacheewin, Surasakdi; Chua, Kek Heng; Puthucheary, Savithri D

    2012-09-01

    We have developed a multiplex PCR assay for rapid identification and differentiation of cultures for Burkholderia pseudomallei, Burkholderia thailandensis, Burkholderia mallei and Burkholderia cepacia complex. The assay is valuable for use in clinical and veterinary laboratories, and in a deployable laboratory during outbreaks. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Development of a multiplex real-time PCR to quantify aflatoxin, ochratoxin A and patulin producing molds in foods.

    Science.gov (United States)

    Rodríguez, Alicia; Rodríguez, Mar; Andrade, María J; Córdoba, Juan J

    2012-04-02

    A multiplex real-time PCR (qPCR) method to quantify aflatoxin, ochratoxin A (OTA) and patulin producing molds in foods was developed. For this, the primer pairs F/R-omt, F/R-npstr and F/R-idhtrb and the TaqMan probes, OMTprobe, NPSprobe and IDHprobe targeting the omt-1, otanpsPN and idh genes involved in aflatoxin, OTA and patulin biosynthesis, respectively, were used. The functionality of the developed qPCR method was demonstrated by the high linear relationship of the standard curves constructed with the omt-1, otanpsPN and idh gene copies and threshold cycle (Ct) values for the respective producing molds tested to quantify aflatoxin, OTA and patulin producing molds. The ability of the optimized qPCR protocol to quantify producing molds was evaluated in different artificially inoculated foods (fruits, nuts, cereals and dry-ripened meat and cheese products). Efficiency values ranged from 81 to 110% in all inoculated foods. The detection limit was between 3 and 1logcfu/g for aflatoxin, OTA and patulin producing molds. The developed multiplex qPCR was shown be an appropriate tool for sensitive quantification of growth of toxigenic fungi in foods throughout the incubation time. Thus, the multiplex qPCR is a useful, rapid and efficient method to quantify simultaneously aflatoxin, OTA and patulin producing molds in food products. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Simultaneous detection and differentiation of Entamoeba histolytica, E. dispar, E. moshkovskii, Giardia lamblia and Cryptosporidium spp. in human fecal samples using multiplex PCR and qPCR-MCA.

    Science.gov (United States)

    Zebardast, Nozhat; Yeganeh, Farshid; Gharavi, Mohammad Javad; Abadi, Alireza; Seyyed Tabaei, Seyyed Javad; Haghighi, Ali

    2016-10-01

    Entamoeba histolytica, Giardia lamblia and Cryptosporidium spp. are common causes of diarrheal and intestinal diseases all over the world. Microscopic methods are useful in the diagnosis of intestinal parasites (IPs), but their sensitivity was assessed approximately 60 percent. Recently, molecular techniques have been used increasingly for the identification and characterization of the parasites. Among those, in this study we have used multiplex PCR and Real-time PCR with melting curve analysis (qPCR-MCA) for simultaneous detection and differentiation of E. histolytica, E. dispar, E. moshkovskii, G. lamblia and Cryptosporidium spp. in human fecal samples. Twenty DNA samples from 12 E. histolytica and 8 E. dispar samples and twenty stool samples confirmed positive for G. lamblia and Cryptosporidium spp. were analyzed. After DNA extraction from the samples, multiplex PCR was done for detection and differentiation of above mentioned parasites. QPCR-MCA was also performed for the detection and differentiation of 11 isolates of above mentioned parasite in a cycle with a time and temperature. Multiplex PCR was able to simultaneous detect and differentiate of above mentioned parasite in a single reaction. QPCR-MCA was able to differentiate genus and species those five protozoa using melting temperature simultaneously at the same time and temperature programs. In total, qPCR-MCA diagnosed 7/11 isolation of E. histolytica, 6/8 isolation of E. dispar, 1/1 E. moshkovskii Laredo, 10/11 G. Lamblia and 6/11 Cryptosporidium spp. Application of multiplex PCR for detection of more than one species in a test in developing countries, at least in reference laboratories has accurate diagnosis and plays a critical role in differentiation of protozoan species. Multiplex PCR assay with a template and multi template had different results and it seems that using a set of primers with one template has higher diagnostic capability in compare with multi template. The results of this study

  20. Development and Validation of a Multiplex Reverse Transcription PCR Assay for Simultaneous Detection of Three Papaya Viruses

    Directory of Open Access Journals (Sweden)

    Decai Tuo

    2014-10-01

    Full Text Available Papaya ringspot virus (PRSV, Papaya leaf distortion mosaic virus (PLDMV, and Papaya mosaic virus (PapMV produce similar symptoms in papaya. Each threatens commercial production of papaya on Hainan Island, China. In this study, a multiplex reverse transcription PCR assay was developed to detect simultaneously these three viruses by screening combinations of mixed primer pairs and optimizing the multiplex RT-PCR reaction conditions. A mixture of three specific primer pairs was used to amplify three distinct fragments of 613 bp from the P3 gene of PRSV, 355 bp from the CP gene of PLDMV, and 205 bp from the CP gene of PapMV, demonstrating the assay’s specificity. The sensitivity of the multiplex RT-PCR was evaluated by showing plasmids containing each of the viral target genes with 1.44 × 103, 1.79 × 103, and 1.91 × 102 copies for the three viruses could be detected successfully. The multiplex RT-PCR was applied successfully for detection of three viruses from 341 field samples collected from 18 counties of Hainan Island, China. Rates of single infections were 186/341 (54.5%, 93/341 (27.3%, and 3/341 (0.9%, for PRSV, PLDMV, and PapMV, respectively; 59/341 (17.3% of the samples were co-infected with PRSV and PLDMV, which is the first time being reported in Hainan Island. This multiplex RT-PCR assay is a simple, rapid, sensitive, and cost-effective method for detecting multiple viruses in papaya and can be used for routine molecular diagnosis and epidemiological studies in papaya.

  1. Listeria monocytogenes in spontaneous abortions in humans and its detection by multiplex PCR.

    Science.gov (United States)

    Kaur, S; Malik, S V S; Vaidya, V M; Barbuddhe, S B

    2007-11-01

    To assess the extent of Listeria monocytogenes in causation of human spontaneous abortions by isolation methods and PCR analysis for the presence of virulence-associated genes. A total of 305 samples comprising blood, urine, placental bits, faecal and vaginal swabs were collected from 61 patients with spontaneous abortions. Listeria spp. were isolated from 10 samples collected from nine (14.8%) patients. Confirmation of these isolates was based on biochemical tests, haemolysis on blood agar, CAMP test, phosphatidylinositol-specific phospholipase C (PI-PLC) assay followed by in vivo pathogenicity tests and multiplex PCR to detect virulence-associated genes (prfA, plcA, hlyA, actA and iap). Three isolates were confirmed as L. monocytogenes. Of these, two isolates turned out to be pathogenic and found to posses all five genes. However, the remaining two haemolytic L. monocytogenes isolates lacking the plcA gene and activity in the PI-PLC assay were found to be nonpathogenic by in vivo tests. The occurrence of pathogenic L. monocytogenes in cases of spontaneous abortions was 3.3%. It seems that the plcA gene and its expression have an important role as essential virulence determinants in pathogenic Listeria spp. The recovery of pathogenic L. monocytogenes isolates from cases of spontaneous abortion indicates the significance of listeric infection in pregnant women.

  2. Multiplex PCR method to discriminate Artemisia iwayomogi from other Artemisia plants.

    Science.gov (United States)

    Doh, Eui Jeong; Oh, Seung-Eun

    2012-01-01

    Some plants in the genus Artemisia have been used for medicinal purposes. Among them, Artemisia iwayomogi, commonly referred to as "Haninjin," is one of the major medicinal materials used in traditional Korean medicine. By contrast, Artemisia capillaris and both Artemisia argyi and Artemisia princeps, referred to as "Injinho" and "Aeyup," respectively, are used to treat diseases different from those for which "Haninjin" is prescribed. Therefore, the development of a reliable method to differentiate each Artemisia herb is necessary. We found that a random amplified polymorphic DNA (RAPD) method can be used to efficiently discriminate a few Artemisia plants from one another. To improve the reliability of RAPD amplification, we designed primer sets based on the nucleotide sequences of RAPD products to amplify a sequence-characterized amplified region (SCAR) marker of A. iwayomogi. In addition, we designed two other primer sets to amplify SCAR markers of "Aeyup" (A. argyi and A. princeps) along with "Injinho" (A. capillaris) and Artemisia japonica, which are also traded in Korean herbal markets. Using these three primer sets, we developed a multiplex PCR method concurrently not only to discriminate A. iwayomogi from other Artemisia plants, but also to identify Artemisia plants using a single PCR process.

  3. A multiplex PCR mini-barcode assay to identify processed shark products in the global trade.

    Science.gov (United States)

    Cardeñosa, Diego; Fields, Andrew; Abercrombie, Debra; Feldheim, Kevin; Shea, Stanley K H; Chapman, Demian D

    2017-01-01

    Protecting sharks from overexploitation has become global priority after widespread population declines have occurred. Tracking catches and trade on a species-specific basis has proven challenging, in part due to difficulties in identifying processed shark products such as fins, meat, and liver oil. This has hindered efforts to implement regulations aimed at promoting sustainable use of commercially important species and protection of imperiled species. Genetic approaches to identify shark products exist but are typically based on sequencing or amplifying large DNA regions and may fail to work on heavily processed products in which DNA is degraded. Here, we describe a novel multiplex PCR mini-barcode assay based on two short fragments of the cytochrome oxidase I (COI) gene. This assay can identify to species all sharks currently listed on the Convention of International Trade of Endangered Species (CITES) and most shark species present in the international trade. It achieves species diagnosis based on a single PCR and one to two downstream DNA sequencing reactions. The assay is capable of identifying highly processed shark products including fins, cooked shark fin soup, and skin-care products containing liver oil. This is a straightforward and reliable identification method for data collection and enforcement of regulations implemented for certain species at all governance levels.

  4. Single-Step Multiplex PCR Assay for Characterization of New World Leishmania Complexes

    Science.gov (United States)

    Harris, Eva; Kropp, Gerald; Belli, Alejandro; Rodriguez, Betzabé; Agabian, Nina

    1998-01-01

    We have developed a PCR assay for one-step differentiation of the three complexes of New World Leishmania (Leishmania braziliensis, Leishmania mexicana, and Leishmania donovani). This multiplex assay is targeted to the spliced leader RNA (mini-exon) gene repeats of these organisms and can detect all three complexes simultaneously, generating differently sized products for each complex. The assay is specific to the Leishmania genus and does not recognize related kinetoplastid protozoa, such as Trypanosoma cruzi, Trypanosoma brucei, and Crithidia fasciculata. It correctly identified Leishmania species with a broad geographic distribution in Central and South America. The sensitivity of the PCR amplification ranged from 1 fg to 10 pg of DNA (0.01 to 100 parasites), depending on the complex detected. Crude extracts of cultured parasites, prepared simply by boiling diluted cultures, served as excellent templates for amplification. Crude preparations of clinical material were also tested. The assay detected L. braziliensis in dermal scrapings from cutaneous leishmanial lesions, Leishmania chagasi in dermal scrapings of atypical cutaneous leishmaniasis, and L. mexicana from lesion aspirates from infected hamsters. We have minimized the material requirements and maximized the simplicity, rapidity, and informative content of this assay to render it suitable for use in laboratories in countries where leishmaniasis is endemic. This assay should be useful for rapid in-country identification of Leishmania parasites, particularly where different Leishmania complexes are found in the same geographical area. PMID:9650950

  5. Multiplex PCR for the detection of toxigenic cyanobacteria in dietary supplements produced for human consumption.

    Science.gov (United States)

    Saker, Martin L; Welker, Martin; Vasconcelos, Vitor M

    2007-01-01

    The production of food supplements containing cyanobacteria is a growing worldwide industry. While there have been several reports of health benefits that can be gained from the consumption of these supplements, there have also been a growing number of studies showing the presence of toxins some of which (for example microcystins) are known to affect human health. In this paper, we report a multiplex polymerase chain reaction (PCR) technique that can be used to identify microcystin contamination in dietary supplements produced for human consumption. This method involves a PCR reaction containing three primer pairs, the first of which is used to amplify a 220-bp fragment of 16s rDNA specific to Microcystis, the most common microcystin-producing cyanobacterium. The second primer pair is used to amplify a 300-bp fragment of the mcyA gene, linked to microcystin biosynthesis in Anabaena, Microcystis, and Planktothrix. A third primer pair, used as a positive control, results in the amplification of a 650-bp fragment from the phycocyanin operon common to all cyanobacteria. This technique was found to be useful for detecting the presence of toxigenic Microcystis in all dietary supplements produced from the nontoxic cyanobacterium Aphanizomenon flos-aquae.

  6. Detection of Coccidioides immitis in Kern County, California, by multiplex PCR.

    Science.gov (United States)

    Lauer, Antje; Baal, Joe Darryl Hugo; Baal, Jed Cyril Hugo; Verma, Mona; Chen, Jeffrey M

    2012-01-01

    Coccidioides immitis is a fungal human pathogen endemic to semiarid soils in southern California and Baja California (Mexico). Results of culture-dependent detection of C. immitis in the past indicated a spotty distribution and unreliable prediction of C. immitis growth sites and accumulation sites. In this project we investigated bulk soil samples for the presence of the pathogen in nonagricultural loamy soils at nine different locations around Bakersfield, Kern County, California, for almost 2 y (2008-2009). To detect the pathogen we used a multiplex PCR method with optimized soil handling and storage, DNA extraction procedure and PCR protocol. With this method we were able to detect C. immitis in 8.42% of our samples in 2008 (n = 285), mostly from early spring to early summer. In 2009 however the percentage of samples positive for C. immitis from the same sites declined to 2.68% (n = 261). We also were able to distinguish C. immitis growth sites from accumulation sites. One site close to a recreation area (Lake Webb, Buena Vista Lake Basin), not previously known to support the growth of C. immitis, was identified as a strong growth site of the fungus. The cultivation-independent method in this study together with soil parameters can be used to predict and confirm C. immitis growth sites and might be a valuable tool for public health institutions.

  7. Molecular detection of human Plasmodium species in Sabah using PlasmoNex™ multiplex PCR and hydrolysis probes real-time PCR.

    Science.gov (United States)

    Lee, Ping Chin; Chong, Eric Tzyy Jiann; Anderios, Fread; Al Lim, Yvonne; Chew, Ching Hoong; Chua, Kek Heng

    2015-01-28

    Malaria is a vector borne-parasitic disease transmitted through the bite of the infective female Anopheles mosquitoes. Five Plasmodium species have been recognized by World Health Organization (WHO) as the causative agents of human malaria. Generally, microscopic examination is the gold standard for routine malaria diagnosis. However, molecular PCR assays in many cases have shown improvement on the sensitivity and specificity over microscopic or other immunochromatographic assays. The present study attempts to screen 207 suspected malaria samples from patients seeking treatment in clinics around Sabah state, Malaysia, using two panels of multiplex PCRs, conventional PCR system (PlasmoNex™) and real-time PCR based on hydrolysis probe technology. Discordance results between two PCR assays were further confirmed by sequencing using 18S ssu rRNA species-specific primers. Of the 207 malaria samples, Plasmodium knowlesi (73.4% vs 72.0%) was the most prevalent species based on two PCR assays, followed by Plasmodium falciparum (15.9% vs 17.9%), and Plasmodium vivax (9.7% vs 7.7%), respectively. Neither Plasmodium malariae nor Plasmodium ovale was detected in this study. Nine discrepant species identification based on both the PCR assays were further confirmed through DNA sequencing. Species-specific real-time PCR only accurately diagnosed 198 of 207 (95.7%) malaria samples up to species level in contrast to PlasmoNex™ assay which had 100% sensitivity and specificity based on sequencing results. Multiplex PCR accelerate the speed in the diagnosis of malaria. The PlasmoNex™ PCR assay seems to be more accurate than real-time PCR in the speciation of all five human malaria parasites. The present study also showed a significant increase of the potential fatal P. knowlesi infection in Sabah state as revealed by molecular PCR assays.

  8. [Application of multiplex quantitative fluorescent PCR with non-polymorphic loci in prenatal diagnosis].

    Science.gov (United States)

    Zhu, Xiang-Yu; Hu, Ya-Li; Wang, Ya-Ping; Zhu, Hai-Yan; Li, Jie; Zhu, Rui-Fang; Zhang, Ying; Wu, Xing; Yang, Ying

    2008-11-01

    To explore the feasibility of application of multiplex quantitative fluorescent PCR with non-polymorphic loci in prenatal diagnosis of aneuploidies. From Mar 2006 to Nov 2007, a total of 63 samples were collected from the Department of Obstetrics and Gynecology, Affiliated Drum Tower Hospital of Medical College, Nanjing University, including 54 villous samples obtained for karyotyping because of spontaneous abortion, six amniotic fluid samples of second trimester and three umbilical cord blood samples of third trimester. Blood samples of 60 healthy adults were obtained at the same time as a control group, including 30 males and 30 females. Non-polymorphic QF-PCR was performed on both testing group and control group for the detection of aneuploidies. The Amelogenin gene (AMXY) was selected as an internal control, and dosage quotiety (DQ) of each locus was calculated according to the known formula. If DQ was between 0.7 and 1.3, the sample was considered as normal. If the figure turned out to be > 1.3 or Cell culture and karyotyping were carried out for every sample simultaneously. The results of non-polymorphic QF-PCR were checked with karyotypes. (1) In the control group, all female samples presented only an AMX peak for sex chromosome while all males showed AMX and AMY amplified peaks. The AMY/AMX ratios were between 0.7 - 1.3, and SD was between 0.05 - 0.12. (2) Among 19 QF-PCR abnormal cases, 13 cases were proved by karyotyping. Of the six cases which turned out to be conflicting, one case of trisomy 18 shown by karyotyping was not completely detected by QF-PCR, a locus on chromosome 18 implied trisomy, while another turned out to be normal (DQ = 1.28). Four cases were detected by non-polymorphic QF-PCR as trisomies but showed normal female karyotype because of maternal contamination during cell culture. A karyotypingly '46, XY' case did not present an AMY peak. Thirty-six out of 44 (82%) normal results implied by non-polymorphic QF-PCR were in accordance with

  9. [Application of multiplex nested RT- PCR assay for screening the fusion genes in acute myeloid leukemia and its clinical significance].

    Science.gov (United States)

    Xu, Yuanyuan; Gao, Li; Sun, Junzhong; Ding, Yi; Xu, Yihan; Lyu, Chao; Liu, Wenwen; Wang, Nan; Wang, Lili; Yu, Li

    2014-01-01

    To investigate the clinical value of multiplex nested reverse transcription PCR (RT-nPCR) in screening acute myeloid leukemia(AML)fusion genes. A novel multiplex RT-nPCR assay was developed to detect 16 AML-related fusion genes (AML1-EVI1, AML1-ETO, AML1-MDS1, AML1-MTG16, MLL-AF9, MLL-AF6, MLL-AF10, MLL-ENL, MLL-MLL, PML-RARα, PLZFRARα, NPM1-RARα, CBFB-MYH11, DEK-CAN, SET-CAN and TLS-ERG) according to 2008 WHO classification of AML. The chromosome reciprocal translocations of 356 AML cases were detected by multiplex RT-nPCR and karyotyping. The positive samples were further confirmed by split- out PCR and FISH. The fusion genes were detected in 172 patients with the positive detection rate of 48.31%(172/356), which was higher than that of karyotyping (31.46%) (χ²=70.314, Pfusion genes in AML patients, which can provide important evidence for assessing diagnosis and treatment, and also provide necessary information for minimal residual disease (MRD) and prognosis.

  10. Multiplex PCR system for identifying the carnivore origins of faeces for an epidemiological study on Echinococcus multilocularis in Hokkaido, Japan.

    Science.gov (United States)

    Nonaka, Nariaki; Sano, Takafumi; Inoue, Takashi; Teresa Armua, Maria; Fukui, Daisuke; Katakura, Ken; Oku, Yuzaburo

    2009-12-01

    A multiplex PCR system was developed to identify the carnivore origins of faeces collected in Hokkaido, Japan, for epidemiological studies on Echinococcus multilocularis. Primers were designed against the D-loop region of mitochondrial DNA. Two separate primer mixtures (mix 1, specific forward primers to fox, raccoon dog and dog, and a universal reverse primer [prH]; and mix 2, specific forward primers to cat, raccoon and weasels and prH) were used so that the PCR products (160 bp, fox and cat; 240 bp, raccoon dog and raccoon; and 330 bp, dog and weasel) were distinguished by size. The multiplex PCR exhibited no cross-reactivity between carnivore species and did not amplify DNA from rodent prey. When 270 field-collected faeces were examined, 250 showed single PCR products belonging to specific target sizes, suggesting successful carnivore identification for 92.6% of samples. Taeniid eggs were detected in 11.1% of samples and coproantigen in 30.4%; whereas the prevalences of taeniid eggs and coproantigen were 12.9% and 34.0% in fox faeces, and 0% and 26.3% in cat faeces, respectively. These results suggest that the prevalence in different target animals can be evaluated individually and precisely using multiplex PCR system.

  11. A multiplex PCR for rapid identification of Brassica species in the triangle of U.

    Science.gov (United States)

    Koh, Joshua C O; Barbulescu, Denise M; Norton, Sally; Redden, Bob; Salisbury, Phil A; Kaur, Sukhjiwan; Cogan, Noel; Slater, Anthony T

    2017-01-01

    Within the Brassicaceae, six species from the genus Brassica are widely cultivated throughout the world as oilseed, condiment, fodder or vegetable crops. The genetic relationships among the six Brassica species are described by U's triangle model. Extensive shared traits and diverse morphotypes among Brassica species make identification and classification based on phenotypic data alone challenging and unreliable, especially when dealing with large germplasm collections. Consequently, a major issue for genebank collections is ensuring the correct identification of species. Molecular genotyping based on simple sequence repeat (SSR) marker sequencing or the Illumina Infinium Brassica napus 60K single nucleotide polymorphism (SNP) array has been used to identify species and assess genetic diversity of Brassica collections. However, these methods are technically challenging, expensive and time-consuming, making them unsuitable for routine or rapid screening of Brassica accessions for germplasm management. A cheaper, faster and simpler method for Brassica species identification is described here. A multiplex polymerase chain reaction (MPCR) consisting of new and existing primers specific to the Brassica A, B and C genomes was able to reliably distinguish all six Brassica species in the triangle of U with 16 control samples of known species identity. Further validation against 120 Brassica accessions previously genotyped showed that the MPCR is highly accurate and comparable to more advanced techniques such as SSR marker sequencing or the Illumina Infinium B. napus 60K SNP array. In addition, the MPCR was sensitive enough to detect seed contaminations in pooled seed samples of Brassica accessions. A cheap and fast multiplex PCR assay for identification of Brassica species in the triangle of U was developed and validated in this study. The MPCR assay can be readily implemented in any basic molecular laboratory and should prove useful for the management of Brassica

  12. Penerapan Metode Diagnosis Cepat Virus Avian Influenza H5N1 dengan Metode Single Step Multiplex RT-PCR

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2010-12-01

    Full Text Available Avian influenza (AI virus is a segmented single stranded (ss RNA virus with negative polarity andbelong to the Orthomyxoviridae family. Diagnose of AI virus can be performed using conventional methodsbut it has low sensitivity and specificity. The objective of the research was to apply rapid, precise, andaccurate diagnostic method for AI virus and also to determine its type and subtype based on the SingleStep Multiplex Reverse Transcriptase-Polymerase Chain Reaction targeting M, H5, and N1 genes. In thismethod M, H5 and NI genes were simultaneously amplified in one PCR tube. The steps of this researchconsist of collecting viral RNAs from 10 different AI samples originated from Maros Disease InvestigationCenter during 2007. DNA Amplification was conducted by Simplex RT-PCR using M primer set. Then, bysingle step multiplex RT-PCR were conducted simultaneously using M, H5 and N1 primers set. The RTPCRproducts were then separated on 1.5% agarose gel, stained by ethidum bromide and visualized underUV transilluminator. Results showed that 8 of 10 RNA virus samples could be amplified by Simplex RTPCRfor M gene which generating a DNA fragment of 276 bp. Amplification using multiplex RT-PCRmethod showed two of 10 samples were AI positive using multiplex RT-PCR, three DNA fragments weregenerated consisting of 276 bp for M gene, 189 bp for H5 gene, and 131 bp for N1. In this study, rapid andeffective diagnosis method for AI virus can be conducted by using simultaneous Single Step Multiplex RTPCR.By this technique type and subtype of AI virus, can also be determined, especially H5N1.

  13. Development of multiplex PCR assay for simultaneous detection of Salmonella genus, Salmonella subspecies I, Salm. Enteritidis, Salm. Heidelberg and Salm. Typhimurium.

    Science.gov (United States)

    Park, S H; Ricke, S C

    2015-01-01

    The aim of this research was to develop multiplex PCR assay that could simultaneously detect Salmonella genus, Salmonella subsp. I, Salm. Enteritidis, Heidelberg and Typhimurium because these Salmonella serovars are the most common isolates associated with poultry products. Five primers were utilized to establish multiplex PCR and applied to Salmonella isolates from chickens and farm environments. These isolates were identified as Salmonella subsp. I and 16 of 66 isolates were classified as Salm. Enteritidis, while Heidelberg or Typhimurium was not detected. We also spiked three Salmonella strains on chicken breast meat to evaluate the specificity and sensitivity of multiplex PCR as well as qPCR to optimize quantification of Salmonella in these samples. The optimized multiplex PCR and qPCR could detect approx. 2·2 CFU of Salmonella per gram after 18 h enrichment. The multiplex PCR and qPCR would provide rapid and consistent results. Also, these techniques would be useful for the detection and quantification of Salmonella in contaminated poultry, foods and environmental samples. The strategy for the rapid detection of Salmonella serovars in poultry is needed to further reduce the incidence of salmonellosis in humans. The optimized multiplex PCR will be useful to detect prevalent Salmonella serovars in poultry products. © 2014 The Society for Applied Microbiology.

  14. Application of a Multiplex Quantitative PCR to Assess Prevalence and Intensity Of Intestinal Parasite Infections in a Controlled Clinical Trial.

    Directory of Open Access Journals (Sweden)

    Stacey Llewellyn

    2016-01-01

    Full Text Available Accurate quantitative assessment of infection with soil transmitted helminths and protozoa is key to the interpretation of epidemiologic studies of these parasites, as well as for monitoring large scale treatment efficacy and effectiveness studies. As morbidity and transmission of helminth infections are directly related to both the prevalence and intensity of infection, there is particular need for improved techniques for assessment of infection intensity for both purposes. The current study aimed to evaluate two multiplex PCR assays to determine prevalence and intensity of intestinal parasite infections, and compare them to standard microscopy.Faecal samples were collected from a total of 680 people, originating from rural communities in Timor-Leste (467 samples and Cambodia (213 samples. DNA was extracted from stool samples and subject to two multiplex real-time PCR reactions the first targeting: Necator americanus, Ancylostoma spp., Ascaris spp., and Trichuris trichiura; and the second Entamoeba histolytica, Cryptosporidium spp., Giardia. duodenalis, and Strongyloides stercoralis. Samples were also subject to sodium nitrate flotation for identification and quantification of STH eggs, and zinc sulphate centrifugal flotation for detection of protozoan parasites. Higher parasite prevalence was detected by multiplex PCR (hookworms 2.9 times higher, Ascaris 1.2, Giardia 1.6, along with superior polyparasitism detection with this effect magnified as the number of parasites present increased (one: 40.2% vs. 38.1%, two: 30.9% vs. 12.9%, three: 7.6% vs. 0.4%, four: 0.4% vs. 0%. Although, all STH positive samples were low intensity infections by microscopy as defined by WHO guidelines the DNA-load detected by multiplex PCR suggested higher intensity infections.Multiplex PCR, in addition to superior sensitivity, enabled more accurate determination of infection intensity for Ascaris, hookworms and Giardia compared to microscopy, especially in samples

  15. Study comparing human papillomavirus (HPV) real-time multiplex PCR and Hybrid Capture II INNO-LiPA v2 HPV genotyping PCR assays

    DEFF Research Database (Denmark)

    Iftner, Thomas; Germ, Liesje; Swoyer, Ryan

    2009-01-01

    Human papillomavirus (HPV) DNA genotyping is an essential test to establish efficacy in HPV vaccine clinical trials and HPV prevalence in natural history studies. A number of HPV DNA genotyping methods have been cited in the literature, but the comparability of the outcomes from the different...... methods has not been well characterized. Clinically, cytology is used to establish possible HPV infection. We evaluated the sensitivity and specificity of HPV multiplex PCR assays compared to those of the testing scheme of the Hybrid Capture II (HCII) assay followed by an HPV PCR/line hybridization assay...

  16. Performance of a multiplex PCR for the determination of Haemophilus influenzae capsular types in the clinical microbiology laboratory.

    Science.gov (United States)

    Gonin, P; Lorange, M; Delage, G

    2000-05-01

    To improve tools for the surveillance of invasive H. influenzae in the context of the drastic decrease of type b infections following the implementation of vaccination, a two-step PCR technique was developed to detect the capsule and type specific regions of H. influenzae. The technique of Falla et al (1994) was modified to amplify in a first step the capsule and type b regions by multiplex PCR. For non-b capsulated strains, the type a, c, d, e, and f loci were afterward detected simultaneously by an optimized touch-down PCR technique. An internal control of extraction and amplification (16S rDNA) was included for both PCR techniques. Overall, this technique was shown to perform as efficiently or better than the slide agglutination without risks of interpretation errors. Of the 138 H. influenzae strains tested, seven that had given doubtful results by the agglutination technique were unequivocally typed by PCR.

  17. Development of a Multiplex PCR Method to Detect Fungal Pathogens for Quarantine on Exported Cacti

    Directory of Open Access Journals (Sweden)

    Hyun ji Cho

    2016-02-01

    Full Text Available Major diseases in grafted cacti have been reported and Fusarium oxysporum, Bipolaris cactivora, Phytophthora spp. and Collectotrichum spp. are known as causal pathogens. These pathogens can lead to plant death after infection. Therefore, some European countries have quarantined imported cacti that are infected with specific fungal pathogens. Consequently, we developed PCR detection methods to identify four quarantined fungal pathogens and reduce export rejection rates of Korean grafted cacti. The pathogen specific primer sets F.oF-F.oR, B.CF-B.CR, P.nF-P.nR, and P.cF-P.CR were tested for F. oxysporum, B. cactivora, P. nicotinae, and P. cactorum, respectively. The F.oF-F.oR primer set was designed from the Fusarium ITS region; the B.CF-B.CR and P.nF-P.nR primers respectively from Bipolaris and Phytophthora ITS1; and the P.cF-P.CR primer set from the Ypt1protein gene region. The quarantine fungal pathogen primer pairs were amplified to the specific number of base pairs in each of the following fungal pathogens: 210-bp (F. oxysporum, 510-bp (B. cactivora, 313-bp (P. nicotinae, and 447-bp (P. cactorum. The detection limit for the mono- and multiplex PCR primer sets was 0.1 ng of template DNA under in vitro conditions. Therefore, each primer set successfully diagnosed contamination of quarantine pathogens in export grafted cacti. Consequently, our methodology is a viable tool to screen contamination of the fungal pathogen in exported grafted cacti.

  18. Multiplex-PCR for Identification of Two Species in Genus Hishimonus (Hemiptera: Cicadellidae) in Jujube Orchards.

    Science.gov (United States)

    Hao, Shaodong; Wang, He; Tao, Wanqiang; Wang, Jinzhong; Zhang, Zhiyong; Zhang, Qiuling; Zhang, Minzhao; Guo, Li; Shi, Xiaoyu

    2015-10-01

    The insect family Cicadellidae includes economically important vectors of plant pathogens. Hishimonus sellatus (Uhler) transmits jujube witches'-broom (JWB). Currently, H. sellatus and Hishimonus lamellatus Cai et Kuoh are observed to co-occur at the same locality on jujube. H. lamellatus is now suspected to be a JWB vector. As such, correct identification of Hishimonus species present in vineyards is essential for epidemiological surveys. However, traditional identification of Hishimonus by morphology is limited to the adult male. We provide a comprehensive description of morphological and molecular tools for discriminating between H. sellatus and H. lamellatus, for use in identification and monitoring of the two Hishimonus species and studies of their plant hosts. A rapid and inexpensive method is introduced to identify H. sellatus and H. lamellatus occurring in jujube orchards. This method is based on amplification of mitochondrial cytochrome oxidase I (COI) gene, using PCR with multiplexed, species-specific primers. The reliability of this new method has been tested on different populations from different sites in Beijing region of China. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  19. DNAemia detection by multiplex PCR and biomarkers for infection in systemic inflammatory response syndrome patients.

    Directory of Open Access Journals (Sweden)

    Catherine Fitting

    Full Text Available Fast and reliable assays to precisely define the nature of the infectious agents causing sepsis are eagerly anticipated. New molecular biology techniques are now available to define the presence of bacterial or fungal DNA within the bloodstream of sepsis patients. We have used a new technique (VYOO® that allows the enrichment of microbial DNA before a multiplex polymerase chain reaction (PCR for pathogen detection provided by SIRS-Lab (Jena, Germany. We analyzed 72 sepsis patients and 14 non-infectious systemic inflammatory response syndrome (SIRS patients. Among the sepsis patients, 20 had a positive blood culture and 35 had a positive microbiology in other biological samples. Of these, 51.4% were positive using the VYOO® test. Among the sepsis patients with a negative microbiology and the non-infectious SIRS, 29.4% and 14.2% were positive with the VYOO® test, respectively. The concordance in bacterial identification between microbiology and the VYOO® test was 46.2%. This study demonstrates that these new technologies offer great hopes, but improvements are still needed.

  20. Multiplex real-time PCR for detection of Campylobacter, Salmonella, and Shigella.

    Science.gov (United States)

    Barletta, F; Mercado, E H; Lluque, A; Ruiz, J; Cleary, T G; Ochoa, T J

    2013-09-01

    Infectious diarrhea can be classified based on its clinical presentation as noninflammatory or inflammatory disease. In developing countries, among inflammatory diarrhea cases, Shigella is the most common cause, followed by Campylobacter and Salmonella. Because the time frame in which treatment choices must be made is short and conventional stool cultures lack good sensitivity, there is a need for a rapid, sensitive, and inexpensive detection technique. The purpose of our study was to develop a multiplex real-time PCR procedure to simultaneously identify Campylobacter spp., Salmonella spp., and Shigella spp. Primers were designed to amplify the invA, ipaH, and 16S rRNA genes simultaneously in a single reaction to detect Salmonella, Shigella, and Campylobacter, respectively. Using this approach, we correctly identified 102 of 103 strains of the targeted enteropathogens and 34 of 34 other pathogens. The melting temperatures were 82.96 ± 0.05 °C for invA, 85.56 ± 0.28 °C for ipaH, and 89.21 ± 0.24 °C for 16S rRNA. The limit of accurate quantification for the assay in stool samples was 10(4) CFU g(-1); however, the limit of detection was 10(3) CFU g(-1). This assay is a simple, rapid, inexpensive, and reliable system for the practical detection of these three enteropathogens in clinical specimens.

  1. A multiplex RT-PCR assay for the detection of fish picornaviruses.

    Science.gov (United States)

    Mor, Sunil K; Phelps, Nicholas B D; Barbknecht, Marisa; Hoffman, Michael A; Goyal, Sagar M

    2015-09-01

    With the emergence of high profile fish diseases in the Great Lakes region, surveillance and regulatory inspections of fish populations have increased. This has resulted in a better understanding of known pathogens and isolation of many new pathogens of fish. In this study, a multiplex RT-PCR assay was developed for the detection of three newly discovered fish picornaviruses: bluegill picornavirus-1 (BGPV-1), fathead minnow picornavirus (FHMPV), and eel picornavirus-1 (EPV-1). This assay was found to be very sensitive with a detection limit of 81.9pg/μl of extracted RNA from a pool of FHMPV and BGPV-1 and was able to detect 501 and 224 gene copies/μl of BGPV-1 and FHMPV, respectively. The assay was highly reproducible and did not cross react with other closely related pathogens. We believe that this new assay provides a rapid and cost effective tool for confirming cell culture isolates and conducting prevalence studies of these newly detected fish picornaviruses. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Identification of New World Leishmania species from Peru by biochemical techniques and multiplex PCR assay.

    Science.gov (United States)

    Rodríguez-González, Isabel; Marín, Clotilde; Longoni, Silvia S; Mateo, Hector; Alunda, José M; Minaya, Gloria; Gutiérrez-Sánchez, Ramón; Vargas, Franklin; Sánchez-Moreno, Manuel

    2007-02-01

    We have characterized diverse strains or species of Leishmania isolated in humans that are currently circulating throughout Peru, by means of isoenzymatic characterization, kDNA analysis by restriction enzymes, and multiplex PCR assay. The cluster analysis gave five groups. Cluster 1 includes L. (L.) donovani together with the isolates LP4 and LP7, forming the donovani complex. Thus, this complex corresponds to the New World visceral form, L. (L.) chagasi. Cluster 2 is formed by the isolates LP1-LP3, LP6, LP10, LP9, and LP11, phylogenetically intermediate between Cluster 1 and Cluster 3, or they can be treated as hybrids. Cluster 3 is divided into two subgroups: one formed by L. (V.) peruviana, together with the isolates LP14 and LP5, and the second one formed by L. (V.) brazilensis and the isolate LP8. These two subgroups form part of the brazilensis complex. The three strains of L. (L.) infantum [L. (L.) infantum I and II and la LSI] make up Cluster 4. In Cluster 5, we include the three Mexican strains (LM1-LM3) forming one subgroup while we would place L. (L.) amazonensis in another subgroup. These two subgroups would comprise the complex mexicana.

  3. Multiplex PCR assay discriminates rabbit, rat and squirrel meat in food chain.

    Science.gov (United States)

    Ahamad, Mohammad Nasir Uddin; Ali, Md Eaqub; Hossain, M A Motalib; Asing, Asing; Sultana, Sharmin; Jahurul, M H A

    2017-12-01

    Rabbit meat is receiving increasing attention because it contains a high level of proteins with relatively little fat. On the other hand, squirrel meat is served in upper-class meals in certain countries, so is sold at higher prices. The other side of the coin is rat meat, which has family ties with rabbit and squirrel but poses substantial threats to public health because it is a potential carrier of several zoonotic organisms. Recently, rat meat was mislabelled and sold as lamb after chemical modification. Thus, the chances of rabbit and squirrel meat substitution by rat meat cannot be ruled out. For the first time, a multiplex PCR assay was developed in Malaysia for the discriminatory identification of rat, rabbit and squirrel in the food chain. Rabbit (123 bp), rat (108 bp) and squirrel (243 bp) targets were amplified from ATP6 and cytb genes, along with a eukaryotic internal control (141bp). The products were sequenced and cross-tested against 22 species. A total of 81 reference samples and 72 meatball specimens were screened to validate the assay. Analyte stability was evaluated through boiling, autoclaving and micro-oven cooking. The tested lower limits of detection were 0.01 ng DNA for pure meat and 0.1% for meatballs.

  4. A higher sensitivity and efficiency of common primer multiplex PCR assay in identification of meat origin using NADH dehydrogenase subunit 4 gene.

    Science.gov (United States)

    Hanapi, Ummi Kalthum; Desa, Mohd Nasir Mohd; Ismail, Amin; Mustafa, Shuhaimi

    2015-07-01

    A Common Primer Multiplex PCR (CP-M-PCR) was developed to detect meat origin of four groups of animal (pig, ruminant, avian and rabbit). This method demonstrated higher sensitivity and efficiency than the conventional multiplex PCR. In this approach, a common forward primer was designed in the 5' end of a homologous region of mitochondrial NADH dehyrogenase subunit 4 (Nad 4) gene sequences of all the animal groups. Specific adapter reverse primers were designed by adding an adapter sequence at the 5' end. The same adapter sequence was used as the common adapter reverse primer. The primers generated specific fragments of 267, 370, 504, and 548 bp lengths for pig, ruminant, avian and rabbit meats, respectively. The use of adapter sequence at the 5' end of the common adapter reverse primers increased the efficiency of the amplification and the application of a common forward primer solved the complexity in multiplex PCR system. Bands of specific amplification can be detected in the PCR assays containing as low as 10(-6) μM of adapter reverse primer. This result indicated that the sensitivity was tremendously increased as compared to the conventional multiplex PCR (10(-3) μM). CP-M-PCR detection limit of the DNA samples was 0.1 ng for the four groups of meats. CP-M-PCR has greatly improved the sensitivity and efficiency of the PCR system for a more reliable and accurate outcome than conventional multiplex PCR system.

  5. Application of multiplex PCR for the simultaneous detection of Taenia spp. from domestic dogs in the north of Iran

    Directory of Open Access Journals (Sweden)

    Rahimi M.T.

    2016-09-01

    Full Text Available The family Taeniidae is of great importance in the medical and veterinary fields, particularly in the tropics and subtropics. Identification of eggs of different Taenia spp. in the final host by morphological examination is difficult owing to their similarity. Therefore, a multiplex polymerase chain reaction (PCR targeting a mitochondrial gene was applied to identify morphologically indistinguishable eggs. Fecal samples from 100 domestic dogs, from the Mazandaran province in Iran, were examined using the flotation/sieving method followed by multiplex PCR. Taeniid eggs were observed in 24 % samples, of which 12 %, 10 %, and 2 % were infected with Echinococcus granulosus, Taenia spp., and both E. granulosus and Taenia spp., respectively. E. multilocularis was absent in these samples. The prevalence of E. granulosus in the examined domestic dogs as definitive hosts in north of Iran was high (14 %. Therefore, people living in this region of Iran are in danger of acquiring hydatid cyst, which is a serious public health problem.

  6. Multiplex-Touchdown PCR to Simultaneously Detect Cryptosporidium parvum, Giardia lamblia, and Cyclospora cayetanensis, the Major Causes of Traveler's Diarrhea.

    Science.gov (United States)

    Shin, Ji-Hun; Lee, Sang-Eun; Kim, Tong Soo; Ma, Da-Won; Chai, Jong-Yil; Shin, Eun-Hee

    2016-10-01

    This study aimed to develop a multiplex-touchdown PCR method to simultaneously detect 3 species of protozoan parasites, i.e., Cryptosporidium parvum, Giardia lamblia, and Cyclospora cayetanensis, the major causes of traveler's diarrhea and are resistant to standard antimicrobial treatments. The target genes included the Cryptosporidium oocyst wall protein for C. parvum, Glutamate dehydrogenase for G. lamblia, and 18S ribosomal RNA (18S rRNA) for C. cayetanensis. The sizes of the amplified fragments were 555, 188, and 400 bps, respectively. The multiplex-touchdown PCR protocol using a primer mixture simultaneously detected protozoa in human stools, and the amplified gene was detected in >1×103 oocysts for C. parvum, >1×104 cysts for G. lamblia, and >1 copy of the 18S rRNA gene for C. cayetanensis. Taken together, our protocol convincingly demonstrated the ability to simultaneously detect C. parvum, G. lamblia, and C. cayetanenesis in stool samples.

  7. Comparison of two multiplex PCR assays for the detection of Listeria spp. and Listeria monocytogenes in biological samples

    OpenAIRE

    Budniak Sylwia; Kędrak-Jabłońska Agnieszka; Szczawińska Anna; Reksa Monika; Krupa Marek; Szulowski Krzysztof

    2016-01-01

    Introduction: The aim of the study was to optimise and compare two multiplex PCR assays for the detection of Listeria spp. and Listeria monocytogenes in biological samples including the liver, brain, and blood. Material and Methods: Three strains of L. monocytogenes and single strains of each of the species: L. ivanovii, L. innocua, L. grayi, L. welshimeri, and L. seeligeri were used. Additionally, five other species of bacterium were used to evaluate the specificity of the tests. Results: Sp...

  8. Single Multiplex PCR Assay To Identify Simultaneously the Six Categories of Diarrheagenic Escherichia coli Associated with Enteric Infections

    Science.gov (United States)

    Vidal, Maricel; Kruger, Eileen; Durán, Claudia; Lagos, Rosanna; Levine, Myron; Prado, Valeria; Toro, Cecilia; Vidal, Roberto

    2005-01-01

    We designed a multiplex PCR for the detection of all categories of diarrheagenic Escherichia coli. This method proved to be specific and rapid in detecting virulence genes from Shiga toxin-producing (stx1, stx2, and eae), enteropathogenic (eae and bfp), enterotoxigenic (stII and lt), enteroinvasive (virF and ipaH), enteroaggregative (aafII), and diffuse adherent (daaE) Escherichia coli in stool samples. PMID:16208019

  9. Diagnostic Performance of a Multiplex PCR assay for meningitis in an HIV-infected population in Uganda

    OpenAIRE

    Rhein, Joshua; Bahr, Nathan C; Hemmert, Andrew C; Cloud, Joann L; Bellamkonda, Satya; Oswald, Cody; Lo, Eric; Nabeta, Henry; Kiggundu, Reuben; Akampurira, Andrew; Musubire, Abdu; Williams, Darlisha; Meya, David B; Boulware, David R

    2015-01-01

    Meningitis remains a worldwide problem, and rapid diagnosis is essential to optimize survival. We evaluated the utility of a multiplex PCR test in differentiating possible etiologies of meningitis. Cerebrospinal fluid (CSF) from 69 HIV-infected Ugandan adults with meningitis was collected at diagnosis (n=51) and among persons with cryptococcal meningitis during therapeutic lumbar punctures (n=68). Cryopreserved CSF specimens were analyzed with BioFire FilmArray? Meningitis/Encephalitis panel,...

  10. A new multiplex PCR for easy screening of methicillin-resistant Staphylococcus aureus SCCmec types I-V

    DEFF Research Database (Denmark)

    Boye, Kit; Bartels, Mette Damkjær; Andersen, Ina S

    2007-01-01

    A multiplex PCR with four primer-pairs was designed to identify the five main known SCCmec types. A clear and easily discriminated band pattern was obtained for all five types. The SCCmec type was identified for 98% of 312 clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA......). SCCmec type IV was by far the most common SCCmec type among both hospital- and community-acquired MRSA isolates in Denmark....

  11. A one-step multiplex PCR to identify Klebsiella pneumoniae, Klebsiella variicola, and Klebsiella quasipneumoniae in the clinical routine.

    Science.gov (United States)

    Fonseca, Erica Lourenço; Ramos, Nilceia da Veiga; Andrade, Bruno G Nascimento; Morais, Lena L C S; Marin, Michel F Abanto; Vicente, Ana Carolina P

    2017-04-01

    Klebsiella pneumoniae, Klebsiella variicola and Klebsiella quasipneumoniae are difficult to differentiate phenotypically, leading to misinterpretation of their infection prevalence. We propose a multiplex PCR for bla SHV , bla LEN and bla OKP and their flanking gene (deoR). Since this scheme focuses only on chromosomal genes, it will be feasible for Klebsiella identification in the clinical routine. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Comparison between Saliva and Nasopharyngeal Swab Specimens for Detection of Respiratory Viruses by Multiplex Reverse Transcription-PCR.

    Science.gov (United States)

    Kim, Young-Gon; Yun, Seung Gyu; Kim, Min Young; Park, Kwisung; Cho, Chi Hyun; Yoon, Soo Young; Nam, Myung Hyun; Lee, Chang Kyu; Cho, Yun-Jung; Lim, Chae Seung

    2017-01-01

    Nasopharyngeal swabs (NPSs) are being widely used as specimens for multiplex real-time reverse transcription (RT)-PCR for respiratory virus detection. However, it remains unclear whether NPS specimens are optimal for all viruses targeted by multiplex RT-PCR. In addition, the procedure to obtain NPS specimens causes coughing in most patients, which possibly increases the risk of nosocomial spread of viruses. In this study, paired NPS and saliva specimens were collected from 236 adult male patients with suspected acute respiratory illnesses. Specimens were tested for 16 respiratory viruses by multiplex real-time RT-PCR. Among the specimens collected from the 236 patients, at least 1 respiratory virus was detected in 183 NPS specimens (77.5%) and 180 saliva specimens (76.3%). The rates of detection of respiratory viruses were comparable for NPS and saliva specimens (P = 0.766). Nine virus species and 349 viruses were isolated, 256 from NPS specimens and 273 from saliva specimens (P = 0.1574). Adenovirus was detected more frequently in saliva samples (P saliva samples was excluded by direct sequencing. In conclusion, neither of the sampling methods was consistently more sensitive than the other. We suggest that these cost-effective methods for detecting respiratory viruses in mixed NPS-saliva specimens might be valuable for future studies. Copyright © 2016 American Society for Microbiology.

  13. Rapid detection and identification of 12 respiratory viruses using a dual priming oligonucleotide system-based multiplex PCR assay.

    Science.gov (United States)

    Kim, Suk Ran; Ki, Chang-Seok; Lee, Nam Yong

    2009-03-01

    Acute viral respiratory infections are among the most common causes of human disease. Rapid and accurate diagnosis of viral respiratory infections is important for providing timely therapeutic interventions. This study evaluated a new multiplex PCR assay (Seegene Inc., Seoul, Korea) for simultaneous detection and identification of 12 respiratory viruses using two primer mixes. The viruses included parainfluenza viruses 1, 2, and 3, human metapneumovirus, human coronavirus 229E/NL63 and OC43, adenovirus, influenza viruses A and B, human respiratory syncytial viruses A and B, and human rhinovirus A. The analytical sensitivity of the assay was 10-100 copies per reaction for each type of virus. There was no cross-reactivity with common bacterial or viral pathogens. A comparison with conventional viral culture and immunofluorescence was carried out using 101 respiratory specimens from 92 patients. Using viral culture, 57 specimens (56.4%) were positive without co-infection. The same viruses were identified in all 57 specimens using the multiplex PCR. Seven of the 57 specimens (12.3%) were found to be co-infected with other respiratory viruses, and 19 of 44 (43.2%) specimens which were negative by culture were positive by the multiplex PCR. The Seeplex Respiratory Virus Detection assay represents a significant improvement over the conventional methods for the detection of a broad spectrum of respiratory viruses.

  14. Improved efficiency and robustness in qPCR and multiplex end-point PCR by twisted intercalating nucleic acid modified primers.

    Directory of Open Access Journals (Sweden)

    Uffe Vest Schneider

    Full Text Available We introduce quantitative polymerase chain reaction (qPCR primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA molecule at the 5'-end. In qPCR, the 5'-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5'-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5'-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5'-o-TINA modified primers allows for a further reduction (>45% or approximately one hour in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5'-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5'-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions.

  15. Narcissus yellow stripe virus and Narcissus mosaic virus detection in Narcissus via multiplex TaqMan-based reverse transcription-PCR assay.

    Science.gov (United States)

    Jin, J; Shen, J G; Cai, W; Xie, G H; Liao, F R; Gao, F L; Ma, J F; Chen, X H; Wu, Z J

    2017-05-01

    Development of a multiplex TaqMan RT-qPCR assay to simultaneously detect Narcissus yellow stripe virus (NYSV) and Narcissus mosaic virus (NMV), frequently causing mixed narcissus infection. Feasibility verification was confirmed in natural samples. Primers and probes were designed based on the conserved CP gene regions of NYSV or NMV and their suitability for singleplex and multiplex TaqMan RT-qPCR assays as well as for conventional RT-PCR. Conventional RT-PCR, singleplex and multiplex TaqMan RT-qPCR assays proved to be NYSV and NMV specific. P-values and coefficients of variation of TaqMan RT-qPCR assays indicated high reproducibility. Significantly increased sensitivity was achieved compared to conventional RT-PCR. The detection limit of both viruses was 103 copies with superior correlation coefficients and linear standard curve responses between plasmid concentrations and Ct values. NYSV and NMV infection of narcissus leaves, petals and bulbs could successfully be detected via our multiplex RT-qPCR method at 1·25 mg. Our multiplex TaqMan RT-qPCR assay provides rapid, specific, sensitive and reliable testing to simultaneously detect NYSV and NMV, supplying useful routine monitoring for different narcissus samples. Efficient identification and discrimination of the narcissus viruses provides reliable information for scientists and conventional growers. Furthermore, it enriches the information of NYSV, NMV and other narcissus viruses. © 2017 The Society for Applied Microbiology.

  16. Clinical utility of an optimised multiplex real-time PCR assay for the identification of pathogens causing sepsis in Vietnamese patients

    Directory of Open Access Journals (Sweden)

    Ngo Tat Trung

    2018-02-01

    Conclusion: The combination of culture and the multiplex RT-PCR assay provided an excellent diagnostic accomplishment and significantly supported the identification of causative pathogens in clinical samples obtained from septic patients.

  17. Development of a Multiplex PCR for Discrimination of the TLC:RS1:CTX array ofVibrio choleraeWave 3 El Tor Strains.

    Science.gov (United States)

    Kim, Eun Jin; Yu, Hyun Jin; Nair, G Balakrish; Kim, Dong Wook

    2016-12-28

    Vibrio cholerae O1 serogroup Wave 3 El Tor strains are presently prevalent worldwide. The Wave 3 El Tor strains contain a TLC:RS1:CTX array on chromosome 1, and no element is integrated on chromosome 2. A multiplex PCR optimized to identify the TLC:RS1:CTX array of Wave 3 strains has been developed in this study. By using eight primers, the multiplex PCR can identify the characteristic CTX and RS1 array of Wave 3 strains from various arrays of strains belonging to other Waves. The four amplified DNA fragments of Wave 3 strains have been cloned in a vector, which could be used as a positive control for the multiplex PCR. This multiplex PCR and the positive control set could be useful tools for rapid recognition of Wave 3 El Tor strains.

  18. Development of a multiplex PCR assay for identification of Campylobacter coli, Campylobacter fetus, Campylobacter hyointestinalis subsp. hyointestinalis, Campylobacter jejuni, Campylobacter lari and Campylobacter upsaliensis

    National Research Council Canada - National Science Library

    Yamazaki-Matsune, Wataru; Taguchi, Masumi; Seto, Kazuko; Kawahara, Ryuji; Kawatsu, Kentaro; Kumeda, Yuko; Kitazato, Miyoshi; Nukina, Masafumi; Misawa, Naoaki; Tsukamoto, Teizo

    2007-01-01

    ...{at}iph.pref.osaka.jp Received 26 April 2007 Accepted 9 July 2007 A multiplex PCR assay has been developed for the identification of the six common Campylobacter taxa associated with human gastroenteritis...

  19. One-Step Multiplex RT-qPCR Assay for the Detection of Peste des petits ruminants virus, Capripoxvirus, Pasteurella multocida and Mycoplasma capricolum subspecies (ssp.) capripneumoniae

    National Research Council Canada - National Science Library

    Settypalli, Tirumala Bharani Kumar; Lamien, Charles Euloge; Spergser, Joachim; Lelenta, Mamadou; Wade, Abel; Gelaye, Esayas; Loitsch, Angelika; Minoungou, Germaine; Thiaucourt, Francois; Diallo, Adama

    2016-01-01

    ..., where detection of different pathogens is carried out in a single reaction. In the present study, a one-step multiplex RT-qPCR assay was developed for simultaneous detection of Capripoxvirus (CaPV...

  20. Use of a multiplex PCR to detect and identify Mycobacterium avium and M. intracellulare in blood culture fluids of AIDS patients.

    OpenAIRE

    Kulski, J. K.; Khinsoe, C; Pryce, T; Christiansen, K

    1995-01-01

    The presence of mycobacteria in blood culture fluids (BACTEC) of AIDS patients with positive growth indices (GIs, > 20 U) was investigated by using a multiplex PCR to detect and identify members of the genus Mycobacterium, M. avium, M. intracellulare, and M. tuberculosis. Three different methods of extracting mycobacterial DNA from blood culture fluid were compared for use with the multiplex PCR. Mycobacterial cells were pelleted from a small aliquot of blood culture fluid by centrifugation, ...

  1. A multiplex real-time PCR for the detection and differentiation of Campylobacter phages.

    Science.gov (United States)

    Jäckel, Claudia; Hammerl, Jens A; Rau, Jörg; Hertwig, Stefan

    2017-01-01

    Campylobacter jejuni and C. coli are important food-borne pathogens that are widespread in animal husbandry. To combat Campylobacter along the food chain, the application of lytic phages has been shown to be a promising tool. Campylobacter phages are currently classified into three groups, of which group II and group III phages are the most common. Members of each group are closely related, whereas the two groups share only little DNA similarity. Moreover, while group III phages are specific for C. jejuni, group II phages additionally infect C. coli. Phage cocktails intended to be used for applications should be composed of various phages that differ in their host range and growth kinetics. The isolation of phages is generally performed by plaque assays. This approach has the limitation that phages are merely identified by their lytic activity on certain indicator strains and that relatively high numbers of phages must be present in a tested sample. Therefore, a more sensitive molecular detection system would be beneficial, which allows a pre-screening of samples and the quick detection and discrimination of group II and group III phages. New phages can then be isolated by use of indicator strains that may be different from those typically applied. On the basis of available Campylobacter phage genome sequences, we developed a multiplex PCR system for group II and group III phages selecting the tail tube gene and the gene for the base plate wedge, respectively, as target. Phages of both groups could be identified with primers deduced from the putative tail fiber gene. Efficient release of phage DNA from capsids was achieved by an extended heat treatment or digestion of phage particles with proteinase K/SDS yielding a detection limit of 1 pfu/ml. Individual detection of group II phages, group III phages and of both groups was studied with artificially contaminated chicken skin. To recover phages that had strongly adhered to the skin, stomaching was the most efficient

  2. A Multiplex RT-PCR Assay for S. aureus, L. monocytogenes, and Salmonella spp. Detection in Raw Milk with Pre-enrichment

    Directory of Open Access Journals (Sweden)

    Tian Ding

    2017-05-01

    Full Text Available This study firstly developed a multiplex real-time PCR (RT-PCR technique combined with a pre-enrichment step to simultaneously detect Staphylococcus aureus (S. aureus, Listeria monocytogenes (L. monocytogenes and Salmonella spp. in raw milk and the dairy farm environment (feces, soil, feed, water in one reaction. Brain heart infusion (BHI broth was selected for the enrichment step to increase the density of the target bacteria by using an incubation of 4 h before multiplex RT-PCR. The results showed that the detection limit of the multiplex real-time assay was approximately 102 CFU/mL for pure cultures and artificially contaminated milk without enrichment, while 12, 14, and 10 CFU/25 mL, respectively, for S. aureus, L. monocytogenes, and Salmonella spp. after pre-enrichment. The newly developed multiplex RT-PCR assay was applied to 46 dairy farm environmental samples and raw milk samples covering a wide variety of sample types. The results demonstrated that the multiplex RT-PCR assay coupled with the BHI enrichment broth was suitable for the simultaneous screening of S. aureus, L. monocytogenes, and Salmonella spp. in the pasture environment and in raw milk. The multiplex RT-PCR assay clearly and successfully shortened the total detection time and reduced labor compared to conventional culture-based methods for testing natural samples.

  3. Multiplex PCR method for use in real-time PCR for identification of fish fillets from grouper (Epinephelus and Mycteroperca species) and common substitute species.

    Science.gov (United States)

    Trotta, Michele; Schönhuth, Susana; Pepe, Tiziana; Cortesi, M Luisa; Puyet, Antonio; Bautista, José M

    2005-03-23

    Mitochondrial 16S rRNA sequences from morphological validated grouper (Epinephelus aeneus, E. caninus, E. costae, and E. marginatus; Mycteroperca fusca and M. rubra), Nile perch (Lates niloticus), and wreck fish (Polyprion americanus) were used to develop an analytical system for group diagnosis based on two alternative Polymerase Chain Reaction (PCR) approaches. The first includes conventional multiplex PCR in which electrophoretic migration of different sizes of bands allowed identification of the fish species. The second approach, involving real-time PCR, produced a single amplicon from each species that showed different Tm values allowing the fish groups to be directly identified. Real-time PCR allows the quick differential diagnosis of the three groups of species and high-throughput screening of multiple samples. Neither PCR system cross-reacted with DNA samples from 41 common marketed fish species, thus conforming to standards for species validation. The use of these two PCR-based methods makes it now possible to discriminate grouper from substitute fish species.

  4. Simultaneous differential detection of Chlamydophila abortus, Chlamydophila pecorum and Coxiella burnetii from aborted ruminant's clinical samples using multiplex PCR

    Directory of Open Access Journals (Sweden)

    Rodolakis Annie

    2009-07-01

    Full Text Available Abstract Background Chlamydiosis and Q fever, two zoonosis, are important causes of ruminants' abortion around the world. They are caused respectively by strictly intracellular and Gram negative bacterium Chlamydophila abortus (Cp. abortus and Coxiella burnetii (C. burnetii. Chlamydophila pecorum (Cp. pecorum is commonly isolated from the digestive tract of clinically inconspicuous ruminants but the abortive and zoonotic impact of this bacterium is still unknown because Cp. pecorum is rarely suspected in abortion cases of small ruminants. We have developed a multiplex PCR (m-PCR for rapid simultaneous differential detection of Cp. abortus, Cp. pecorum and C. burnetii in clinical samples taken from infected animals. Results Specific PCR primers were designed and a sensitive and specific m-PCR was developed to detect simultaneously, in one tube reaction, three specific fragments of 821, 526 and 687-bp long for Cp. abortus, Cp. pecorum and C. burnetii respectively. This m-PCR assay was performed on 253 clinical samples taken from infected ruminant's flocks that have showed problems of abortion diseases. Thus, 67 samples were infected by either one of the three pathogens: 16 (13 vaginal swabs and 3 placentas were positive for Cp. abortus, 2 were positive for Cp. pecorum (1 vaginal swab and 1 placenta and 49 samples (33 vaginal swabs, 11 raw milks, 4 faeces and 1 placenta were positive for C. burnetii. Two vaginal swabs were m-PCR positive of both Cp. abortus and C. burnetii and none of the tested samples was shown to be infected simultaneously with the three pathogens. Conclusion We have successfully developed a rapid multiplex PCR that can detect and differentiate Cp. abortus, Cp. pecorum and C. burnetii; with a good sensitivity and specificity. The diagnosis of chlamydiosis and Q fever may be greatly simplified and performed at low cost. In addition, the improvement in diagnostic techniques will enhance our knowledge regarding the prevalence and

  5. Usefulness of Multiplex Real-Time PCR for Simultaneous Pathogen Detection and Resistance Profiling of Staphylococcal Bacteremia

    Directory of Open Access Journals (Sweden)

    Yousun Chung

    2016-01-01

    Full Text Available Staphylococci are the leading cause of nosocomial blood stream infections. Fast and accurate identification of staphylococci and confirmation of their methicillin resistance are crucial for immediate treatment with effective antibiotics. A multiplex real-time PCR assay that targets mecA, femA specific for S. aureus, femA specific for S. epidermidis, 16S rRNA for universal bacteria, and 16S rRNA specific for staphylococci was developed and evaluated with 290 clinical blood culture samples containing Gram-positive cocci in clusters (GPCC. For the 262 blood cultures identified to the species level with the MicroScan WalkAway system (Siemens Healthcare Diagnostics, USA, the direct real-time PCR assay of positive blood cultures showed very good agreement for the categorization of staphylococci into methicillin-resistant S. aureus (MRSA, methicillin-susceptible S. aureus (MSSA, methicillin-resistant S. epidermidis (MRSE, methicillin-susceptible S. epidermidis (MSSE, methicillin-resistant non-S. epidermidis CoNS (MRCoNS, and methicillin-susceptible non-S. epidermidis CoNS (MSCoNS (κ=0.9313. The direct multiplex real-time PCR assay of positive blood cultures containing GPCC can provide essential information at the critical point of infection with a turnaround time of no more than 4 h. Further studies should evaluate the clinical outcome of using this rapid real-time PCR assay in glycopeptide antibiotic therapy in clinical settings.

  6. Usefulness of Multiplex Real-Time PCR for Simultaneous Pathogen Detection and Resistance Profiling of Staphylococcal Bacteremia.

    Science.gov (United States)

    Chung, Yousun; Kim, Taek Soo; Min, Young Gi; Hong, Yun Ji; Park, Jeong Su; Hwang, Sang Mee; Song, Kyoung-Ho; Kim, Eu Suk; Park, Kyoung Un; Kim, Hong Bin; Song, Junghan; Kim, Eui-Chong

    2016-01-01

    Staphylococci are the leading cause of nosocomial blood stream infections. Fast and accurate identification of staphylococci and confirmation of their methicillin resistance are crucial for immediate treatment with effective antibiotics. A multiplex real-time PCR assay that targets mecA, femA specific for S. aureus, femA specific for S. epidermidis, 16S rRNA for universal bacteria, and 16S rRNA specific for staphylococci was developed and evaluated with 290 clinical blood culture samples containing Gram-positive cocci in clusters (GPCC). For the 262 blood cultures identified to the species level with the MicroScan WalkAway system (Siemens Healthcare Diagnostics, USA), the direct real-time PCR assay of positive blood cultures showed very good agreement for the categorization of staphylococci into methicillin-resistant S. aureus (MRSA), methicillin-susceptible S. aureus (MSSA), methicillin-resistant S. epidermidis (MRSE), methicillin-susceptible S. epidermidis (MSSE), methicillin-resistant non-S. epidermidis CoNS (MRCoNS), and methicillin-susceptible non-S. epidermidis CoNS (MSCoNS) (κ = 0.9313). The direct multiplex real-time PCR assay of positive blood cultures containing GPCC can provide essential information at the critical point of infection with a turnaround time of no more than 4 h. Further studies should evaluate the clinical outcome of using this rapid real-time PCR assay in glycopeptide antibiotic therapy in clinical settings.

  7. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR.

    Directory of Open Access Journals (Sweden)

    Kerstin Wernike

    Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.

  8. Usefulness of Multiplex Real-Time PCR for Simultaneous Pathogen Detection and Resistance Profiling of Staphylococcal Bacteremia

    Science.gov (United States)

    Chung, Yousun; Kim, Taek Soo; Min, Young Gi; Hong, Yun Ji; Park, Jeong Su; Hwang, Sang Mee; Song, Kyoung-Ho; Kim, Eu Suk; Kim, Hong Bin; Song, Junghan; Kim, Eui-Chong

    2016-01-01

    Staphylococci are the leading cause of nosocomial blood stream infections. Fast and accurate identification of staphylococci and confirmation of their methicillin resistance are crucial for immediate treatment with effective antibiotics. A multiplex real-time PCR assay that targets mecA, femA specific for S. aureus, femA specific for S. epidermidis, 16S rRNA for universal bacteria, and 16S rRNA specific for staphylococci was developed and evaluated with 290 clinical blood culture samples containing Gram-positive cocci in clusters (GPCC). For the 262 blood cultures identified to the species level with the MicroScan WalkAway system (Siemens Healthcare Diagnostics, USA), the direct real-time PCR assay of positive blood cultures showed very good agreement for the categorization of staphylococci into methicillin-resistant S. aureus (MRSA), methicillin-susceptible S. aureus (MSSA), methicillin-resistant S. epidermidis (MRSE), methicillin-susceptible S. epidermidis (MSSE), methicillin-resistant non-S. epidermidis CoNS (MRCoNS), and methicillin-susceptible non-S. epidermidis CoNS (MSCoNS) (κ = 0.9313). The direct multiplex real-time PCR assay of positive blood cultures containing GPCC can provide essential information at the critical point of infection with a turnaround time of no more than 4 h. Further studies should evaluate the clinical outcome of using this rapid real-time PCR assay in glycopeptide antibiotic therapy in clinical settings. PMID:27403436

  9. Real-time multiplex RT-PCR for the simultaneous detection of the five main grapevine viruses.

    Science.gov (United States)

    López-Fabuel, Irene; Wetzel, Thierry; Bertolini, Edson; Bassler, Alexandra; Vidal, Eduardo; Torres, Luis B; Yuste, Alberto; Olmos, Antonio

    2013-03-01

    A real-time multiplex RT-PCR has been developed for the simultaneous detection and identification of the major RNA viruses that infect grapevines (Grapevine fanleaf virus, Arabis mosaic virus, Grapevine leafroll-associated virus 1, Grapevine leafroll-associated virus 3 and Grapevine fleck virus). Serial dilutions of infected plant extracts were tested using the new method, and the results were compared with those obtained using a commercially available ELISA and real-time singleplex RT-PCR. The two real-time RT-PCR versions detected up to the same level of dilution and were at least 10,000 times more sensitive than the ELISA. In addition, 158 grapevine plants collected in a survey of the Protected Designation of Origin in Alicante, Spain were compared using the three methods. The results of the molecular methods were very similar, with only four discordant results, and both were able to detect many more infected plants than the ELISA. The high prevalence of Grapevine fleck virus, Grapevine leafroll-associated virus 3 and Grapevine fanleaf virus suggests that the main pathways of viral introduction are infected plant material that has escaped controls and/or uncontrolled traffic of propagating plant material. Real-time multiplex RT-PCR could be used to facilitate a better control of grapevine viruses. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Multiplex-PCR for simultaneous detection of 3 bacterial fish pathogens, Flavobacterium columnare, Edwardsiella ictaluri, and Aeromonas hydrophila.

    Science.gov (United States)

    Panangala, Victor S; Shoemaker, Craig A; Van Santen, Vicky L; Dybvig, Kevin; Klesius, Phillip H

    2007-03-13

    A multiplex PCR (m-PCR) method was developed for simultaneous detection of 3 important fish pathogens in warm water aquaculture. The m-PCR to amplify target DNA fragments from Flavobacterium columnare (504 bp), Edwardsiella ictaluri (407 bp) and Aeromonas hydrophila (209 bp) was optimized by adjustment of reaction buffers and a touchdown protocol. The lower detection limit for each of the 3 bacteria was 20 pg of nucleic acid template from each bacteria per m-PCR reaction mixture. The sensitivity threshold for detection of the 3 bacteria in tissues ranged between 3.4 x 10(2) and 2.5 x 10(5) cells g(-1) of tissue (channel catfish Ictalurus punctatus Rafinesque). The diagnostic sensitivity and specificity of the m-PCR was evaluated with 10 representative isolates of each of the 3 bacteria and 11 other Gram-negative and 2 Gram-positive bacteria that are taxonomically related or ubiquitous in the aquatic environment. Except for a single species (A. salmonicida subsp. salmonicida), each set of primers specifically amplified the target DNA of the cognate species of bacteria. m-PCR was compared with bacteriological culture for identification of bacteria in experimentally infected fish. The m-PCR appears promising for the rapid, sensitive and simultaneous detection of Flavobacterium columnare, E. ictaluri and A. hydrophila in infected fish compared to the time-consuming traditional bacteriological culture techniques.

  11. A Novel Multiplex PCR Discriminates Bacillus anthracis and Its Genetically Related Strains from Other Bacillus cereus Group Species

    Science.gov (United States)

    Ogawa, Hirohito; Fujikura, Daisuke; Ohnuma, Miyuki; Ohnishi, Naomi; Hang'ombe, Bernard M.; Mimuro, Hitomi; Ezaki, Takayuki; Mweene, Aaron S.; Higashi, Hideaki

    2015-01-01

    Anthrax is an important zoonotic disease worldwide that is caused by Bacillus anthracis, a spore-forming pathogenic bacterium. A rapid and sensitive method to detect B. anthracis is important for anthrax risk management and control in animal cases to address public health issues. However, it has recently become difficult to identify B. anthracis by using previously reported molecular-based methods because of the emergence of B. cereus, which causes severe extra-intestinal infection, as well as the human pathogenic B. thuringiensis, both of which are genetically related to B. anthracis. The close genetic relation of chromosomal backgrounds has led to complexity of molecular-based diagnosis. In this study, we established a B. anthracis multiplex PCR that can screen for the presence of B. anthracis virulent plasmids and differentiate B. anthracis and its genetically related strains from other B. cereus group species. Six sets of primers targeting a chromosome of B. anthracis and B. anthracis-like strains, two virulent plasmids, pXO1 and pXO2, a bacterial gene, 16S rRNA gene, and a mammalian gene, actin-beta gene, were designed. The multiplex PCR detected approximately 3.0 CFU of B. anthracis DNA per PCR reaction and was sensitive to B. anthracis. The internal control primers also detected all bacterial and mammalian DNAs examined, indicating the practical applicability of this assay as it enables monitoring of appropriate amplification. The assay was also applied for detection of clinical strains genetically related to B. anthracis, which were B. cereus strains isolated from outbreaks of hospital infections in Japan, and field strains isolated in Zambia, and the assay differentiated B. anthracis and its genetically related strains from other B. cereus group strains. Taken together, the results indicate that the newly developed multiplex PCR is a sensitive and practical method for detecting B. anthracis. PMID:25774512

  12. A novel multiplex PCR discriminates Bacillus anthracis and its genetically related strains from other Bacillus cereus group species.

    Directory of Open Access Journals (Sweden)

    Hirohito Ogawa

    Full Text Available Anthrax is an important zoonotic disease worldwide that is caused by Bacillus anthracis, a spore-forming pathogenic bacterium. A rapid and sensitive method to detect B. anthracis is important for anthrax risk management and control in animal cases to address public health issues. However, it has recently become difficult to identify B. anthracis by using previously reported molecular-based methods because of the emergence of B. cereus, which causes severe extra-intestinal infection, as well as the human pathogenic B. thuringiensis, both of which are genetically related to B. anthracis. The close genetic relation of chromosomal backgrounds has led to complexity of molecular-based diagnosis. In this study, we established a B. anthracis multiplex PCR that can screen for the presence of B. anthracis virulent plasmids and differentiate B. anthracis and its genetically related strains from other B. cereus group species. Six sets of primers targeting a chromosome of B. anthracis and B. anthracis-like strains, two virulent plasmids, pXO1 and pXO2, a bacterial gene, 16S rRNA gene, and a mammalian gene, actin-beta gene, were designed. The multiplex PCR detected approximately 3.0 CFU of B. anthracis DNA per PCR reaction and was sensitive to B. anthracis. The internal control primers also detected all bacterial and mammalian DNAs examined, indicating the practical applicability of this assay as it enables monitoring of appropriate amplification. The assay was also applied for detection of clinical strains genetically related to B. anthracis, which were B. cereus strains isolated from outbreaks of hospital infections in Japan, and field strains isolated in Zambia, and the assay differentiated B. anthracis and its genetically related strains from other B. cereus group strains. Taken together, the results indicate that the newly developed multiplex PCR is a sensitive and practical method for detecting B. anthracis.

  13. Screening newborn blood spots for 22q11.2 deletion syndrome using multiplex droplet digital PCR.

    Science.gov (United States)

    Pretto, Dalyir; Maar, Dianna; Yrigollen, Carolyn M; Regan, Jack; Tassone, Flora

    2015-01-01

    The diagnosis of 22q11 deletion syndrome (22q11DS) is often delayed or missed due to the wide spectrum of clinical involvement ranging from mild to severe, often life-threatening conditions. A delayed diagnosis can lead to life-long health issues that could be ameliorated with early intervention and treatment. Owing to the high impact of 22q11DS on public health, propositions have been made to include 22q11DS in newborn screening panels; however, the method of choice for detecting 22q11DS, fluorescent in situ hybridization, requires specialized equipment and is cumbersome for most laboratories to implement as part of their routine screening. We sought to develop a new genetic screen for 22q11DS that is rapid, cost-effective, and easily used by laboratories currently performing newborn screening. We evaluated the accuracy of multiplex droplet digital PCR (ddPCR) in the detection of copy number of 22q11DS by screening samples from 26 patients with 22q11DS blindly intermixed with 1096 blood spot cards from the general population (total n = 1122). Multiplex ddPCR correctly identified all 22q11DS samples and distinguished between 1.5- and 3-Mb deletions, suggesting the approach is sensitive and specific for the detection of 22q11DS. These data demonstrate the utility of multiplex ddPCR for large-scale population-based studies that screen for 22q11DS. The use of samples from blood spot cards suggests that this approach has promise for newborn screening of 22q11DS, and potentially for other microdeletion syndromes, for which early detection can positively impact clinical outcome for those affected. © 2014 American Association for Clinical Chemistry.

  14. Multiplex PCR with minisequencing as an effective high-throughput SNP typing method for formalin-fixed tissue

    DEFF Research Database (Denmark)

    Gilbert, Marcus T P; Sanchez, Juan J; Haselkorn, Tamara

    2007-01-01

    Extensive collections of formalin-fixed paraffin-embedded (FFPE) tissues exist that could be exploited for genetic analyses in order to provide important insights into the genetic basis of disease or host/pathogen cointeractions. We report here an evaluation of a 44 SNP multiplex genotyping method...... extracts varied significantly. In this study, we demonstrate that although direct measures of DNA concentration in the extracts provide no useful information with regard to subsequent MPMS success, the success of the assay can be determined to some degree a priori, through initial screening of the DNA...... quality using a simple quantitative real-time PCR (qPCR) assay for nuclear DNA, and/or an assay of the maximum PCR amplifiable size of nuclear DNA. MPMS promises to be of significant use in future genetic studies on FFPE material. It provides a streamlined approach for retrieving a large amount of genetic...

  15. Multiplex hydrolysis probe real-time PCR for simultaneous detection of hepatitis A virus and hepatitis E virus.

    Science.gov (United States)

    Qiu, Feng; Cao, Jingyuan; Su, Qiudong; Yi, Yao; Bi, Shengli

    2014-05-30

    Detection of hepatitis viral infections has traditionally relied on the circulating antibody test using the enzyme-linked immunosorbent assay. However, multiplex real-time PCR has been increasingly used for a variety of viral nucleic acid detections and has proven to be superior to traditional methods. Hepatitis A virus (HAV) and hepatitis E virus (HEV) are the major causes of acute hepatitis worldwide; both HAV and HEV infection are a main public health problem. In the present study, a one-step multiplex reverse transcriptase quantitative polymerase chain reaction assay using hydrolysis probes was developed for simultaneously detecting HAV and HEV. This novel detection system proved specific to the target viruses, to be highly sensitive and to be applicable to clinical sera samples, making it useful for rapid, accurate and feasible identification of HAV and HEV.

  16. Simultaneous detection of four garlic viruses by multiplex reverse transcription PCR and their distribution in Indian garlic accessions.

    Science.gov (United States)

    Majumder, S; Baranwal, V K

    2014-06-01

    Indian garlic is infected with Onion yellow dwarf virus (OYDV), Shallot latent virus (SLV), Garlic common latent virus (GarCLV) and allexiviruses. Identity and distribution of garlic viruses in various garlic accessions from different geographical regions of India were investigated. OYDV and allexiviruses were observed in all the garlic accessions, while SLV and GarCLV were observed only in a few accessions. A multiplex reverse transcription (RT)-PCR method was developed for the simultaneous detection and identification of OYDV, SLV, GarCLV and Allexivirus infecting garlic accessions in India. This multiplex protocol standardized in this study will be useful in indexing of garlic viruses and production of virus free seed material. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Development of a novel multiplex PCR assay for rapid detection of virulence associated genes of Pasteurella multocida from pigs.

    Science.gov (United States)

    Rajkhowa, S

    2015-09-01

    As the pathogenicity of Pasteurella multocida is associated with various virulence factors (VFs), the aim of the study was to develop a novel multiplex PCR (m-PCR) assay for the rapid detection of important virulence associated genes (VAGs) of P. multocida isolates from pigs. The target recognized VFs used in the study were diverse adhesins (ptfA and pfhA), toxins (toxA), siderophores (tonB and hgbA), sialidases (nanB, nanH) and outer membrane proteins (ompA, ompH, oma87 and plpB). The primers for the genes encoding these VFs were designed by primer3 software (http://bioinfo.ut.ee/primer3-0.4.0/) using gene sequences available in Genbank. The detection limit of the developed assay was 10(2)  CFU ml(-1) . The m-PCR did not produce any nonspecific amplification products when tested against Bordetella bronchiseptica which also commonly infects pigs. We applied m-PCR to the field samples, and the results obtained were the same as the single PCR results. The developed assay would be very useful for veterinary diagnostic laboratories and for others interested in the rapid virulence profiling of porcine P. multocida isolates circulating in the piggeries. The study reports the development and evaluation of a novel multiplex PCR assay for the rapid detection of 11 important VAGs of Pasteurella multocida isolates from pigs. Rapid and simultaneous detection of recognized VFs of the organism are essential to know the virulo-types of P. multocida isolates circulating in the piggeries. The developed novel assay will be very useful for the rapid detection of VAGs of P. multocida isolates from pigs. © 2015 The Society for Applied Microbiology.

  18. Monitoramento de pacientes com AIDS para o desenvolvimento de doença por citomegalovirus (CMV usando-se PCR multiplex Monitoring AIDS patients for the development of cytomegalovirus (CMV disease using multiplex PCR

    Directory of Open Access Journals (Sweden)

    Ana Paula Sarreta Terra

    2000-12-01

    Full Text Available O citomegalovirus é um patógeno importante em indivíduos infectados pelo vírus da imunodeficiência humana (HIV. A carga viral do CMV parece ser preditora da sintomatologia das infecções citomegálicas em pacientes com a síndrome da imunodeficiência adquirida (AIDS. Um protocolo de PCR multiplex que fornece informações de quantificação de DNA amplificando somente um ou dois genes alvo do CMV foi utilizado neste trabalho. Amostras mensais de sangue foram coletadas de 270 pacientes com AIDS. Vinte pacientes tiveram positividade para dois alvos por 3 ou mais consecutivas e apresentaram doença por CMV no decorrer do estudo. Os pacientes que não apresentaram positividade ou alternância de amostras positivas somente para um gene viral não desenvolveram doença ligada ao CMV. Os resultados sugerem que a PCR multiplex é um protocolo útil para a identificação dos pacientes com alta carga viral e maior risco de desenvolvimento de doença por CMV.The human cytomegalovirus is an important pathogen in patients infected with the human immunodeficiency virus (HIV. The CMV viral load seems to be predictor of the development of the CMV disease in these patients. We used a multiplex PCR protocol that also provides quantitative information in those samples from which a single band is amplified and contains fewer viral genomes than those from which both targets are amplified. Monthly blood samples were collected from 270 AIDS patients. From twenty patients, two CMV targets were amplified three or more consecutive times and these patients developed CMV related disease during the study. In contrast, patients who did not result positive for both viral targets, for three or more consecutive times, or who had alternating positive and negative samples during the follow up did not present CMV related disease. The results suggest that the PCR multiplex can be used for the identification of HIV positive patients with higher risk of development of CMV

  19. Early non-invasive detection of fetal Y chromosome sequences in maternal plasma using multiplex PCR.

    Science.gov (United States)

    Kolialexi, Aggeliki; Tounta, Georgia; Apostolou, Paraskevi; Vrettou, Christina; Papantoniou, Nikos; Kanavakis, Emmanuel; Antsaklis, Aris; Mavrou, Ariadni

    2012-03-01

    Clinical indications for fetal sex determination include risk of X-linked disorders, a family history of conditions associated with ambiguous development of the external genitalia, and some fetal ultrasound findings. It is usually performed in the first trimester from fetal material obtained through CVS and is associated with an approximately 1% risk of miscarriage. Ultrasound fetal sex determination is often performed after 11 weeks of gestation. This study aims to validate a reliable method for non-invasive prenatal diagnosis of fetal gender using maternal plasma cell-free fetal DNA (cffDNA) for fetal sex assessment in the first trimester of pregnancy and test its clinical utility in the diagnosis of potentially affected pregnancies in carriers of X-linked disorders. In the validation study, blood samples from 100 pregnant women at 6-11 weeks of gestation were analysed. In the clinical study, 17 pregnancies at risk of having an affected fetus were tested. 7 ml of maternal blood in EDTA were obtained and cffDNA was extracted using a commercially available kit. DNA was enzymatically digested using a methylation sensitive endonuclease (AciI) to remove maternal unmethylated sequences of the RASSF1A gene. A multiplex PCR was performed for the simultaneous amplification of target sequences of SRY and DYS14 from chromosome Y, along with RASSF1A and ACTB sequences. Amplification of these loci indicates fetal gender, confirms the presence of cffDNA and allows assessment of digestion efficiency. After establishing the appropriate experimental conditions, validation studies were successful in all 100 cases tested with no false negative or false positive results. Y chromosome-specific sequences were detected in 68 samples, and 32 cases were diagnosed as female based on the amplification of RASFF1A sequences only, in the absence of ACTB. In the clinical studies, fetal sex was correctly diagnosed in 16 pregnancies, and one case was reported as inconclusive. Fetal sex

  20. Clinical impact of a commercially available multiplex PCR system for rapid detection of pathogens in patients with presumed sepsis

    Directory of Open Access Journals (Sweden)

    Linde Hans-Jörg

    2009-08-01

    Full Text Available Abstract Background Timely identification of pathogens is crucial to minimize mortality in patients with severe infections. Detection of bacterial and fungal pathogens in blood by nucleic acid amplification promises to yield results faster than blood cultures (BC. We analyzed the clinical impact of a commercially available multiplex PCR system in patients with suspected sepsis. Methods Blood samples from patients with presumed sepsis were cultured with the Bactec 9240™ system (Becton Dickinson, Heidelberg, Germany and aliquots subjected to analysis with the LightCycler® SeptiFast® (SF Test (Roche Diagnostics, Mannheim, Germany at a tertiary care centre. For samples with PCR-detected pathogens, the actual impact on clinical management was determined by chart review. Furthermore a comparison between the time to a positive blood culture result and the SF result, based on a fictive assumption that it was done either on a once or twice daily basis, was made. Results Of 101 blood samples from 77 patients, 63 (62% yielded concordant negative results, 14 (13% concordant positive and 9 (9% were BC positive only. In 14 (13% samples pathogens were detected by SF only, resulting in adjustment of antibiotic therapy in 5 patients (7,7% of patients. In 3 samples a treatment adjustment would have been made earlier resulting in a total of 8 adjustments in all 101 samples (8%. Conclusion The addition of multiplex PCR to conventional blood cultures had a relevant impact on clinical management for a subset of patients with presumed sepsis.

  1. A multiplex RT-PCR for simultaneous detection and identification of five viruses and two viroids infecting chrysanthemum.

    Science.gov (United States)

    Zhao, Xiting; Liu, Xingliang; Ge, Beibei; Li, Mingjun; Hong, Bo

    2015-05-01

    Pathogens causing significant economic losses in chrysanthemum include tomato aspermy virus (TAV), chrysanthemum virus B (CVB), cucumber mosaic virus (CMV), tobacco mosaic virus (TMV), potato virus Y (PVY), chrysanthemum stunt viroid (CSVd) and chrysanthemum chlorotic mottle viroid (CChMVd). A multiplex reverse transcription polymerase chain reaction (RT-PCR) method, using specific primer sets for each virus or viroid, was developed for simultaneous detection and differentiation of TAV, CVB, CMV, TMV, PVY, CChMVd, and CSVd. The RT-PCR method was validated by testing chrysanthemum samples collected from different regions of China. In this study, CVB, TAV, TMV, PVY, CSVd, CMV, and CChMVd were detected, respectively, in 24.7 %, 17.5 %, 4.4 %, 4.4 %, 2.9 %, 2.5 %, and 1.5 % of the samples tested. These results indicate that CVB and TAV (24.7 % and 17.5 %) are common, whereas CMV, TMV, CChMVd, CSVd, and PVY (all below 5 %) are less frequently encountered. This new multiplex RT-PCR method has potential to be used routinely in large-scale virus and viroid surveys.

  2. Rapid detection and typing of pathogenic nonpneumophila Legionella spp. isolates using a multiplex real-time PCR assay.

    Science.gov (United States)

    Benitez, Alvaro J; Winchell, Jonas M

    2016-04-01

    We developed a single tube multiplex real-time PCR assay that allows for the rapid detection and typing of 9 nonpneumophila Legionella spp. isolates that are clinically relevant. The multiplex assay is capable of simultaneously detecting and discriminating L. micdadei, L. bozemanii, L. dumoffii, L. longbeachae, L. feeleii, L. anisa, L. parisiensis, L. tucsonensis serogroup (sg) 1 and 3, and L. sainthelensis sg 1 and 2 isolates. Evaluation of the assay with nucleic acid from each of these species derived from both clinical and environmental isolates and typing strains demonstrated 100% sensitivity and 100% specificity when tested against 43 other Legionella spp. Typing of L. anisa, L. parisiensis, and L. tucsonensis sg 1 and 3 isolates was accomplished by developing a real-time PCR assay followed by high-resolution melt (HRM) analysis targeting the ssrA gene. Further typing of L. bozemanii, L. longbeachae, and L. feeleii isolates to the serogroup level was accomplished by developing a real-time PCR assay followed by HRM analysis targeting the mip gene. When used in conjunction with other currently available diagnostic tests, these assays may aid in rapidly identifying specific etiologies associated with Legionella outbreaks, clusters, sporadic cases, and potential environmental sources. Published by Elsevier Inc.

  3. Detection of diarrheagenic Escherichia coli by use of melting-curve analysis and real-time multiplex PCR.

    Science.gov (United States)

    Guion, Chase E; Ochoa, Theresa J; Walker, Christopher M; Barletta, Francesca; Cleary, Thomas G

    2008-05-01

    Diarrheagenic Escherichia coli strains are important causes of diarrhea in children from the developing world and are now being recognized as emerging enteropathogens in the developed world. Current methods of detection are too expensive and labor-intensive for routine detection of these organisms to be practical. We developed a real-time fluorescence-based multiplex PCR for the detection of all six of the currently recognized classes of diarrheagenic E. coli. The primers were designed to specifically amplify eight different virulence genes in the same reaction: aggR for enteroaggregative E. coli, stIa/stIb and lt for enterotoxigenic E. coli, eaeA for enteropathogenic E. coli and Shiga toxin-producing E. coli (STEC), stx(1) and stx(2) for STEC, ipaH for enteroinvasive E. coli, and daaD for diffusely adherent E. coli (DAEC). Eighty-nine of ninety diarrheagenic E. coli and 36/36 nonpathogenic E. coli strains were correctly identified using this approach (specificity, 1.00; sensitivity, 0.99). The single false negative was a DAEC strain. The total time between preparation of DNA from E. coli colonies on agar plates and completion of PCR and melting-curve analysis was less than 90 min. The cost of materials was low. Melting-point analysis of real-time multiplex PCR is a rapid, sensitive, specific, and inexpensive method for detection of diarrheagenic E. coli.

  4. Detection of Diarrheagenic Escherichia coli by Use of Melting-Curve Analysis and Real-Time Multiplex PCR

    Science.gov (United States)

    Guion, Chase E.; Ochoa, Theresa J.; Walker, Christopher M.; Barletta, Francesca; Cleary, Thomas G.

    2008-01-01

    Diarrheagenic Escherichia coli strains are important causes of diarrhea in children from the developing world and are now being recognized as emerging enteropathogens in the developed world. Current methods of detection are too expensive and labor-intensive for routine detection of these organisms to be practical. We developed a real-time fluorescence-based multiplex PCR for the detection of all six of the currently recognized classes of diarrheagenic E. coli. The primers were designed to specifically amplify eight different virulence genes in the same reaction: aggR for enteroaggregative E. coli, stIa/stIb and lt for enterotoxigenic E. coli, eaeA for enteropathogenic E. coli and Shiga toxin-producing E. coli (STEC), stx1 and stx2 for STEC, ipaH for enteroinvasive E. coli, and daaD for diffusely adherent E. coli (DAEC). Eighty-nine of ninety diarrheagenic E. coli and 36/36 nonpathogenic E. coli strains were correctly identified using this approach (specificity, 1.00; sensitivity, 0.99). The single false negative was a DAEC strain. The total time between preparation of DNA from E. coli colonies on agar plates and completion of PCR and melting-curve analysis was less than 90 min. The cost of materials was low. Melting-point analysis of real-time multiplex PCR is a rapid, sensitive, specific, and inexpensive method for detection of diarrheagenic E. coli. PMID:18322059

  5. Development and application of a multiplex PCR assay for rapid detection of 4 major bacterial pathogens in ducks.

    Science.gov (United States)

    Wei, B; Cha, S-Y; Kang, M; Park, I-J; Moon, O-K; Park, C-K; Jang, H-K

    2013-05-01

    Infections with Pasteurella multocida, Salmonella enterica, Riemerella anatipestifer, and Escherichia coli result in high morbidity and mortality, which cause significant economic loss in the poultry industry. It can be difficult to distinguish these pathogens based on clinical signs because these pathogens can cause similar clinical signs and coinfections can occur. Thus, rapid and sensitive detection of these 4 major bacterial pathogens are important in ducks. The aim of this study was to develop a multiplex PCR (mPCR) assay for simultaneously detecting and identifying these 4 pathogenic bacteria in a single tube reaction. The target genes used were KMT1 of P. multocida, the invasion protein gene of S. enterica, 16S rDNA of R. anatipestifer, and the alkaline phosphatase gene of E. coli. The detection limit of the assay for all bacterial DNA was 10 pg. The mPCR did not produce any nonspecific amplification products when tested against other related pathogens, including Staphylococcus aureus, Streptococcus pyogenes, Clostridium perfringens, Mycoplasma gallinarum, Mycoplasma synoviae, and Mycoplasma gallisepticum, which can also infect ducks. We applied mPCR to field samples, and the results were the same as the single PCR results. These results suggest that mPCR for the 4 bacteria is a useful and rapid technique to apply to field samples.

  6. Comparative Evaluation of Several Gene Targets for Designing a Multiplex-PCR for an Early Diagnosis of Extrapulmonary Tuberculosis.

    Science.gov (United States)

    Raj, Ankush; Singh, Netrapal; Gupta, Krishna B; Chaudhary, Dhruva; Yadav, Aparna; Chaudhary, Anil; Agarwal, Kshitij; Varma-Basil, Mandira; Prasad, Rajendra; Khuller, Gopal K; Mehta, Promod K

    2016-01-01

    Diagnosis of extrapulmonary tuberculosis (EPTB) poses serious challenges. A careful selection of appropriate gene targets is essential for designing a multiplex-polymerase chain reaction (M-PCR) assay. We compared several gene targets of Mycobacterium tuberculosis, including IS6110, devR, and genes encoding MPB-64 (mpb64), 38kDa (pstS1), 65kDa (hsp65), 30kDa (fbpB), ESAT-6 (esat6), and CFP-10 (cfp10) proteins, using PCR assays on 105 EPTB specimens. From these data, we chose the two best gene targets to design an M-PCR. Among all gene targets tested, mpb64 showed the highest sensitivity (84% in confirmed cases and 77.5% in clinically suspected cases), followed by IS6110, hsp65, 38kDa, 30kDa, esat6, cfp10, and devR. We used mpb64+IS6110 for designing an M-PCR assay. Our M-PCR assay demonstrated a high sensitivity of 96% in confirmed EPTB cases and 88.75% in clinically suspected EPTB cases with a high specificity of 100%, taking clinical diagnosis as the gold standard. These M-PCR results along with the clinical findings may facilitate an early diagnosis of EPTB patients and clinical management of disease.

  7. Differentiation of Campylobacter jejuni and Campylobacter coli Using Multiplex-PCR and High Resolution Melt Curve Analysis.

    Science.gov (United States)

    Banowary, Banya; Dang, Van Tuan; Sarker, Subir; Connolly, Joanne H; Chenu, Jeremy; Groves, Peter; Ayton, Michelle; Raidal, Shane; Devi, Aruna; Vanniasinkam, Thiru; Ghorashi, Seyed A

    2015-01-01

    Campylobacter spp. are important causes of bacterial gastroenteritis in humans in developed countries. Among Campylobacter spp. Campylobacter jejuni (C. jejuni) and C. coli are the most common causes of human infection. In this study, a multiplex PCR (mPCR) and high resolution melt (HRM) curve analysis were optimized for simultaneous detection and differentiation of C. jejuni and C. coli isolates. A segment of the hippuricase gene (hipO) of C. jejuni and putative aspartokinase (asp) gene of C. coli were amplified from 26 Campylobacter isolates and amplicons were subjected to HRM curve analysis. The mPCR-HRM was able to differentiate between C. jejuni and C. coli species. All DNA amplicons generated by mPCR were sequenced. Analysis of the nucleotide sequences from each isolate revealed that the HRM curves were correlated with the nucleotide sequences of the amplicons. Minor variation in melting point temperatures of C. coli or C. jejuni isolates was also observed and enabled some intraspecies differentiation between C. coli and/or C. jejuni isolates. The potential of PCR-HRM curve analysis for the detection and speciation of Campylobacter in additional human clinical specimens and chicken swab samples was also confirmed. The sensitivity and specificity of the test were found to be 100% and 92%, respectively. The results indicated that mPCR followed by HRM curve analysis provides a rapid (8 hours) technique for differentiation between C. jejuni and C. coli isolates.

  8. Differentiation of Campylobacter jejuni and Campylobacter coli Using Multiplex-PCR and High Resolution Melt Curve Analysis.

    Directory of Open Access Journals (Sweden)

    Banya Banowary

    Full Text Available Campylobacter spp. are important causes of bacterial gastroenteritis in humans in developed countries. Among Campylobacter spp. Campylobacter jejuni (C. jejuni and C. coli are the most common causes of human infection. In this study, a multiplex PCR (mPCR and high resolution melt (HRM curve analysis were optimized for simultaneous detection and differentiation of C. jejuni and C. coli isolates. A segment of the hippuricase gene (hipO of C. jejuni and putative aspartokinase (asp gene of C. coli were amplified from 26 Campylobacter isolates and amplicons were subjected to HRM curve analysis. The mPCR-HRM was able to differentiate between C. jejuni and C. coli species. All DNA amplicons generated by mPCR were sequenced. Analysis of the nucleotide sequences from each isolate revealed that the HRM curves were correlated with the nucleotide sequences of the amplicons. Minor variation in melting point temperatures of C. coli or C. jejuni isolates was also observed and enabled some intraspecies differentiation between C. coli and/or C. jejuni isolates. The potential of PCR-HRM curve analysis for the detection and speciation of Campylobacter in additional human clinical specimens and chicken swab samples was also confirmed. The sensitivity and specificity of the test were found to be 100% and 92%, respectively. The results indicated that mPCR followed by HRM curve analysis provides a rapid (8 hours technique for differentiation between C. jejuni and C. coli isolates.

  9. Estudio mediante PCR múltiple de serotipos de Listeria monocytogenes aislados en Argentina Study by multiplex PCR of Listeria monocytogenes serotypes isolated in Argentine

    Directory of Open Access Journals (Sweden)

    R. Callejo

    2008-06-01

    Full Text Available Se comparó una PCR múltiple recientemente validada para la caracterización de serotipos de Listeria monocytogenes con el método tradicional de serotipificación. Se estudiaron 342 aislamientos de origen humano, alimentario, veterinario y ambiental obtenidos durante el período 1992-2005. La concordancia entre ambos métodos para los serotipos 1/2a, 1/2b y 1/2c fue del 100%, y para el serotipo 4b fue del 98%. La serotipificación constituye una herramienta importante como primer nivel de diferenciación de cepas de L. monocytogenes para llevar a cabo la vigilancia epidemiológica y, sobre todo, el estudio de brotes. La PCR múltiple es una técnica alternativa rápida, de bajo costo y fácilmente adaptable en laboratorios de bacteriología clínica y bromatología.A multiplex PCR assay, recently validated to characterize the serotypes of Listeria monocytogenes was evaluated in comparison to conventional serotyping. Three hundred forty two L. monocytogenes strains isolated from human, food, animal and environmental sources during the 1992-2005 period were assayed. The concordance between the two methods for serotypes 1/2a, 1/2b and 1/2c was 100%, whereas for serotype 4b it was 98%. Serotyping is a useful tool for first line strain differentiation during epidemiological surveillance and outbreaks. The multiplex PCR assay offers a fast and low-cost alternative, which is easily adaptable to clinical bacteriology and bromatology laboratories.

  10. Mutation spectrum of 122 hemophilia A families from Taiwanese population by LD-PCR, DHPLC, multiplex PCR and evaluating the clinical application of HRM

    Directory of Open Access Journals (Sweden)

    Chang Chieh-Ting

    2008-06-01

    Full Text Available Abstract Background Hemophilia A represents the most common and severe inherited hemorrhagic disorder. It is caused by mutations in the F8 gene, which leads to a deficiency or dysfunctional factor VIII protein, an essential cofactor in the factor X activation complex. Methods We used long-distance polymerase chain reaction and denaturing high performance liquid chromatography for mutation scanning of the F8 gene. We designed the competitive multiplex PCR to identify the carrier with exonal deletions. In order to facilitate throughput and minimize the cost of mutation scanning, we also evaluated a new mutation scanning technique, high resolution melting analysis (HRM, as an alternative screening method. Results We presented the results of detailed screening of 122 Taiwanese families with hemophilia A and reported twenty-nine novel mutations. There was one family identified with whole exons deletion, and the carriers were successfully recognized by multiplex PCR. By HRM, the different melting curve patterns were easily identified in 25 out of 28 cases (89% and 15 out of 15 (100% carriers. The sensitivity was 93 % (40/43. The overall mutation detection rate of hemophilia A was 100% in this study. Conclusion We proposed a diagnostic strategy for hemophilia A genetic diagnosis. We consider HRM as a powerful screening tool that would provide us with a more cost-effective protocol for hemophilia A mutation identification.

  11. Multiplex RT-PCR and indirect immunofluorescence assays for detection and subtyping of human influenza virus in Tunisia.

    Science.gov (United States)

    Ben M'hadheb, Manel; Harrabi, Myriam; Souii, Amira; Jrad-Battikh, Nadia; Gharbi, Jawhar

    2015-03-01

    Influenza viruses are negative stranded segmented RNA viruses belonging to Orthomyxoviridae family. They are classified into three types A, B, and C. Type A influenza viruses are classified into subtypes according to the antigenic characters of the surface glycoproteins: hemagglutinin (H) and neuraminidase (N). The aim of the present study is to develop a fast and reliable multiplex RT-PCR technique for detecting simultaneously the subtypes A/H1N1 and A/H3N2 of influenza virus. Our study included 398 patients (mean age 30.33 ± 19.92 years) with flu or flu-like syndromes, consulting physicians affiliated with collaborating teams. A multiplex RT-PCR detecting A/H1N1 and A/H3N2 influenza viruses and an examination by indirect immunofluorescence (IFI) were performed. In the optimized conditions, we diagnosed by IFI a viral infection in 90 patients (22.6 %): 85 cases of influenza type A, four cases of influenza type B, and only one case of coinfection with types A and B. An evaluation of the technique was performed on 19 clinical specimens positive in IFI, and we detected eight cases of A/H3N2, five cases of A/H1N1, one case of influenza virus type A which is not an H1N1 nor H3N2, and five negative cases. Multiplex RT-PCR is a sensitive technique allowing an effective and fast diagnosis of respiratory infections caused by influenza viruses in which the optimization often collides with problems of sensibility.

  12. Comparison of culture and a multiplex probe PCR for identifying Mycoplasma species in bovine milk, semen and swab samples.

    Directory of Open Access Journals (Sweden)

    Alysia M Parker

    Full Text Available Mycoplasma spp. are a major cause of mastitis, arthritis and pneumonia in cattle, and have been associated with reproductive disorders in cows. While culture is the traditional method of identification the use of PCR has become more common. Several investigators have developed PCR protocols to detect M. bovis in milk, yet few studies have evaluated other sample types or other important Mycoplasma species. Therefore the objective of this study was to develop a multiplex PCR assay to detect M. bovis, M. californicum and M. bovigenitalium, and evaluate its analytical performance against traditional culture of bovine milk, semen and swab samples. The PCR specificity was determined and the limit of detection evaluated in spiked milk, semen and swabs. The PCR was then compared to culture on 474 field samples from individual milk, bulk tank milk (BTM, semen and swab (vaginal, preputial, nose and eye samples. Specificity analysis produced appropriate amplification for all M. bovis, M. californicum and M. bovigenitalium isolates. Amplification was not seen for any of the other Mollicutes or eubacterial isolates. The limit of detection of the PCR was best in milk, followed by semen and swabs. When all three Mycoplasma species were present in a sample, the limit of detection increased. When comparing culture and PCR, overall there was no significant difference in the proportion of culture and PCR positive samples. Culture could detect significantly more positive swab samples. No significant differences were identified for semen, individual milk or BTM samples. PCR identified five samples with two species present. Culture followed by 16S-23S rRNA sequencing did not enable identification of more than one species. Therefore, the superior method for identification of M. bovis, M. californicum and M. bovigenitalium may be dependent on the sample type being analysed, and whether the identification of multiple target species is required.

  13. [Simultaneous detection of respiratory viruses and influenza A virus subtypes using multiplex PCR].

    Science.gov (United States)

    Ciçek, Candan; Bayram, Nuri; Anıl, Murat; Gülen, Figen; Pullukçu, Hüsnü; Saz, Eylem Ulaş; Telli, Canan; Cok, Gürsel

    2014-10-01

    This study was conducted to investigate the respiratory viruses and subtyping of influenza A virus when positive by multiplex PCR in patients with flu-like symptoms, after the pandemic caused by influenza A (H1N1)pdm09. Nasopharyngeal swab samples collected from 700 patients (313 female, 387 male; age range: 24 days-94 yrs, median age: 1 yr) between December 2010 - January 2013 with flu-like symptoms including fever, headache, sore throat, rhinitis, cough, myalgia as defined by the World Health Organization were included in the study. Nucleic acid extractions (Viral DNA/RNA Extraction Kit, iNtRON, South Korea) and cDNA synthesis (RevertAid First Strand cDNA Synthesis Kits, Fermentas, USA) were performed according to the manufacturer's protocol. Multiplex amplification of nucleic acids was performed using DPO (dual priming oligonucleotide) primers and RV5 ACE Screening Kit (Seegene, South Korea) in terms of the presence of influenza A (INF-A) virus, influenza B (INF-B) virus, respiratory syncytial virus (RSV), and the other respiratory viruses. PCR products were detected by automated polyacrylamide gel electrophoresis using Screen Tape multiple detection system. Specimens which were positive for viral nucleic acids have been further studied by using specific DPO primers, FluA ACE Subtyping and RV15 Screening (Seegene, South Korea) kits. Four INF-A virus subtypes [human H1 (hH1), human H3 (hH3), swine H1 (sH1), avian H5 (aH5)] and 11 other respiratory viruses [Adenovirus, parainfluenza virus (PIV) types 1-4, human bocavirus (HBoV), human metapneumovirus (HMPV), rhinovirus types A and B, human coronaviruses (HCoV) OC43, 229E/NL63] were investigated with those tests. In the study, 53.6% (375/700) of the patients were found to be infected with at least one virus and multiple respiratory virus infections were detected in 15.7% (59/375) of the positive cases, which were mostly (49/59, 83%) in pediatric patients. RSV and rhinovirus coinfections were the most prevalent (18

  14. Multiplex real-time PCR using SYBR® GreenER™ for the detection of DNA allergens in food.

    Science.gov (United States)

    Pafundo, Simona; Gullì, Mariolina; Marmiroli, Nelson

    2010-03-01

    We describe the development of a six-target real-time multiplex PCR assay with the SYBR® GreenER™ fluorescent dye, targeted to genes encoding for allergenic proteins commonly present in many processed food products (patent application pending). The assay was successfully trialled on reconstructed food matrices and on a range of commercial foodstuffs, and is proposed as a ready-to-use analytical tool for food manufacturers to detect the presence or confirm the absence of sequences encoding for important allergenic proteins of plant origin.

  15. Comparison of a capillary gel electrophoresis-based multiplex PCR assay and ribosomal intergenic transcribed spacer-2 amplicon sequencing for identification of clinically important Candida species.

    Science.gov (United States)

    Monstein, Hans-Jürg; Tärnberg, Maria; Persis, Shohreh; Johansson, Anders G

    2014-01-01

    The performance of a commercially available Seegene Seeplex STI Master Panel 3 multiplex PCR for Candida species identification was compared with an internal transcribed spacer 2 (ITS2) PCR assay. We found that the Seeplex assay was specific for identification of C. albicans, C. krusei, C. parapsilosis, C. glabrata, C. tropicalis and C. dubliniensis. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. A simplified multiplex PCR assay for fast and easy discrimination of globally distributed staphylococcal cassette chromosome mec types in meticillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Ghaznavi-Rad, Ehsanollah; Nor Shamsudin, Mariana; Sekawi, Zamberi; van Belkum, Alex; Neela, Vasanthakumari

    2010-10-01

    A multiplex PCR assay was developed for the identification of major types and subtypes of staphylococcal cassette chromosome mec (SCCmec) in meticillin-resistant Staphylococcus aureus (MRSA) strains. The method uses a novel 9 valent multiplex PCR plus two primer pairs for S. aureus identification and detection of meticillin resistance. All 389 clinical MRSA isolates from Malaysia and 18 European isolates from the Harmony collection harbouring different SCCmec types that we tested were correctly characterized by our PCR assay. SCCmec type III and V were by far the most common types among both hospital- and community-acquired Malaysian MRSA isolates, with an apparent emergence of MRSA harbouring the IVh type.

  17. A novel multiplex RT-qPCR method based on dual-labelled probes suitable for typing all known genotypes of viral haemorrhagic septicaemia virus

    DEFF Research Database (Denmark)

    Vázquez, D.; López-Vázquez, C.; Skall, Helle Frank

    2016-01-01

    relationship. In this study, we have designed and validated a new procedure – named binary multiplex RT-qPCR (bmRT-qPCR) – for simultaneous detection and typing of all four genotypes of VHSV by real-time RT-PCR based on dual-labelled probes and composed by two multiplex systems designed for European......, resulting in a correct detection and typing of all strains. The analytical sensitivity was evaluated in a comparative assay with titration in cell culture, observing that both methods provided similar limits of detection. The proposed method can be a powerful tool for epidemiological analysis of VHSV...

  18. A multiplexed reverse transcriptase PCR assay for identification of viral respiratory pathogens at point-of-care

    Energy Technology Data Exchange (ETDEWEB)

    Letant, S E; .Ortiz, J I; Tammero, L; Birch, J M; Derlet, R W; Cohen, S; Manning, D; McBride, M T

    2007-04-11

    We have developed a nucleic acid-based assay that is rapid, sensitive, specific, and can be used for the simultaneous detection of 5 common human respiratory pathogens including influenza A, influenza B, parainfluenza type 1 and 3, respiratory syncytial virus, and adenovirus group B, C, and E. Typically, diagnosis on an un-extracted clinical sample can be provided in less than 3 hours, including sample collection, preparation, and processing, as well as data analysis. Such a multiplexed panel would enable rapid broad-spectrum pathogen testing on nasal swabs, and therefore allow implementation of infection control measures, and timely administration of antiviral therapies. This article presents a summary of the assay performance in terms of sensitivity and specificity. Limits of detection are provided for each targeted respiratory pathogen, and result comparisons are performed on clinical samples, our goal being to compare the sensitivity and specificity of the multiplexed assay to the combination of immunofluorescence and shell vial culture currently implemented at the UCDMC hospital. Overall, the use of the multiplexed RT-PCR assay reduced the rate of false negatives by 4% and reduced the rate of false positives by up to 10%. The assay correctly identified 99.3% of the clinical negatives, 97% of adenovirus, 95% of RSV, 92% of influenza B, and 77% of influenza A without any extraction performed on the clinical samples. The data also showed that extraction will be needed for parainfluenza virus, which was only identified correctly 24% of the time on un-extracted samples.

  19. A cytolethal distending toxin gene-based multiplex PCR assay for detection of Campylobacter spp. in stool specimens and comparison with culture method.

    Science.gov (United States)

    Shiramaru, Sachi; Asakura, Masahiro; Inoue, Haruna; Nagita, Akira; Matsuhisa, Akio; Yamasaki, Shinji

    2012-07-01

    In this study, we evaluated the applicability of cytolethal distending toxin (cdt) gene-based species-specific multiplex PCR for the direct detection and identification of Campylobacter jejuni, C. coli and C. fetus from stool specimens of patients with gastroenteritis in comparison to culture methods. A total of 711 stool specimens were examined for the isolation or detection of campylobacters by using Skirrow's selective agar culture plates, a filtration method and the multiplex PCR assay. Forty-one and 36 C. jejuni strains were isolated by culture and filtration methods, respectively. In addition, 2 and 3 C. coli strains were isolated by Skirrow and the filtration methods, respectively. However, when the multiplex PCR was employed, the cdtB genes of C. jejuni and C. coli were detected in 45 and 4 stool samples, respectively, and 9 C. jejuni PCR-positive samples by multiplex PCR were negative by culture method. Sequence analysis of the PCR products obtained from 8 stool specimens from which campylobacters were not isolated by culture method but the sequences exactly matched with that of the cdtB gene of C. jejuni strain 81-176. None of the remaining stool samples which were culture negative for campylobacters produced any amplicon. Stool samples were defined as Campylobacter-positive if detected by any method. The sensitivity of the multiplex PCR was 83%, which was higher than Skirrow (74%) and filtration method (66%). These data indicate that cdtB gene-based multiplex PCR is a rapid and more sensitive method to identify the most important species of Campylobacter for human diseases. (248).

  20. Comparison of nested-multiplex, Taqman & SYBR Green real-time PCR in diagnosis of amoebic liver abscess in a tertiary health care institute in India

    Science.gov (United States)

    Dinoop, K.P.; Parija, Subhash Chandra; Mandal, Jharna; Swaminathan, R.P.; Narayanan, P.

    2016-01-01

    Background & objectives: Amoebiasis is a common parasitic infection caused by Entamoeba histolytica and amoebic liver abscess (ALA) is the most common extraintestinal manifestation of amoebiasis. The aim of this study was to standardise real-time PCR assays (Taqman and SYBR Green) to detect E. histolytica from liver abscess pus and stool samples and compare its results with nested-multiplex PCR. Methods: Liver abscess pus specimens were subjected to DNA extraction. The extracted DNA samples were subjected to amplification by nested-multiplex PCR, Taqman (18S rRNA) and SYBR Green real-time PCR (16S-like rRNA assays to detect E. histolytica/E. dispar/E. moshkovskii). The amplification products were further confirmed by DNA sequence analysis. Receiver operator characteristic (ROC) curve analysis was done for nested-multiplex and SYBR Green real-time PCR and the area under the curve was calculated for evaluating the accuracy of the tests to dignose ALA. Results: In all, 17, 19 and 25 liver abscess samples were positive for E. histolytica by nested-multiplex PCR, SYBR Green and Taqman real-time PCR assays, respectively. Significant differences in detection of E. histolytica were noted in the real-time PCR assays evaluated (PPCR, SYBR Green real-time PCR and Taqman real-time PCR evaluated showed a positivity rate of 34, 38 and 50 per cent, respectively. Based on ROC curve analysis (considering Taqman real-time PCR as the gold standard), it was observed that SYBR Green real-time PCR was better than conventional nested-multiplex PCR for the diagnosis of ALA. Interpretation & conclusions: Taqman real-time PCR targeting the 18S rRNA had the highest positivity rate evaluated in this study. Both nested multiplex and SYBR Green real-time PCR assays utilized were evaluated to give accurate results. Real-time PCR assays can be used as the gold standard in rapid and reliable diagnosis, and appropriate management of amoebiasis, replacing the conventional molecular methods. PMID

  1. Comparison of nested-multiplex, Taqman & SYBR Green real-time PCR in diagnosis of amoebic liver abscess in a tertiary health care institute in India.

    Science.gov (United States)

    Dinoop, K P; Parija, Subhash Chandra; Mandal, Jharna; Swaminathan, R P; Narayanan, P

    2016-01-01

    Amoebiasis is a common parasitic infection caused by Entamoeba histolytica and amoebic liver abscess (ALA) is the most common extraintestinal manifestation of amoebiasis. The aim of this study was to standardise real-time PCR assays (Taqman and SYBR Green) to detect E. histolytica from liver abscess pus and stool samples and compare its results with nested-multiplex PCR. Liver abscess pus specimens were subjected to DNA extraction. The extracted DNA samples were subjected to amplification by nested-multiplex PCR, Taqman (18S rRNA) and SYBR Green real-time PCR (16S-like rRNA assays to detect E. histolytica/E. dispar/E. moshkovskii). The amplification products were further confirmed by DNA sequence analysis. Receiver operator characteristic (ROC) curve analysis was done for nested-multiplex and SYBR Green real-time PCR and the area under the curve was calculated for evaluating the accuracy of the tests to dignose ALA. In all, 17, 19 and 25 liver abscess samples were positive for E. histolytica by nested-multiplex PCR, SYBR Green and Taqman real-time PCR assays, respectively. Significant differences in detection of E. histolytica were noted in the real-time PCR assays evaluated ( PPCR, SYBR Green real-time PCR and Taqman real-time PCR evaluated showed a positivity rate of 34, 38 and 50 per cent, respectively. Based on ROC curve analysis (considering Taqman real-time PCR as the gold standard), it was observed that SYBR Green real-time PCR was better than conventional nested-multiplex PCR for the diagnosis of ALA. Taqman real-time PCR targeting the 18S rRNA had the highest positivity rate evaluated in this study. Both nested multiplex and SYBR Green real-time PCR assays utilized were evaluated to give accurate results. Real-time PCR assays can be used as the gold standard in rapid and reliable diagnosis, and appropriate management of amoebiasis, replacing the conventional molecular methods.

  2. Detection of Neisseria meningitidis in cerebrospinal fluid using a multiplex PCR and the Luminex detection technology

    DEFF Research Database (Denmark)

    Møller, Jens Kjølseth

    2012-01-01

    laser. Reporter signals from each reaction are simultaneously quantified by fluorescence generated by a green reporter laser. This nonculture, multiplex assay may prove to be an important tool for optimal laboratory diagnosis, not only of meningococcal meningitis, but also of meningitis caused by other...... bacterial or viral pathogens....

  3. A nested, multiplex, PCR assay for the simultaneous detection and differentiation of Entamoeba histolytica and Entamoeba dispar in faeces.

    Science.gov (United States)

    Evangelopoulos, A; Spanakos, G; Patsoula, E; Vakalis, N; Legakis, N

    2000-04-01

    The detection of and differentiation between Entamoeba histolytica and Entamoeba dispar are of great importance, both for diagnosis and for epidemiological studies. Most PCR-based methods for the discrimination of these two species employ complex procedures for DNA extraction and require different protocols for E. histolytica and E. dispar, leading to relatively high expenditure, labour costs and turnaround times. A simple, rapid, cost-effective and yet sensitive and specific multiplex PCR technique has now been developed for the simultaneous detection and differentiation of E. histolytica and E. dispar in faecal samples. The detection limit is 200 trophozoites of E. dispar or 1000 trophozoites of E. histolytica/g stool sample. The sensitivity of the assay remains practically unchanged, even in the presence of 20,000 trophozoites of the other species/g stool sample. Thus, this technique may also easily reveal mixed infections, without the danger of misdiagnosis caused by one strain displacing the other in culture.

  4. Molecular diagnosis of Salmonella typhi and its virulence in suspected typhoid blood samples through nested multiplex PCR.

    Science.gov (United States)

    Prabagaran, Solai Ramatchandirane; Kalaiselvi, Vellingiri; Chandramouleeswaran, Naganathan; Deepthi, Krishnan Nair Geetha; Brahmadathan, Kootallur Narayanan; Mani, Mariappa

    2017-08-01

    A nested multiplex polymerase chain reaction (PCR) based diagnosis was developed for the detection of virulent Salmonella typhi in the blood specimens from patients suspected for typhoid fever. After the Widal test, two pairs of primers were used for the detection of flagellin gene (fliC) of S. typhi. Among them, those positive for fliC alone were subjected to identification of genes in Via B operon of Salmonella Pathogenesity Island (SPI-7) where four primer pairs were used to detect tviA and tviB genes. Among 250 blood samples tested, 115 were positive by fliC PCR; 22 of these were negative for tviA and tviB. Hence, the method described here can be used to diagnose the incidence of Vi-negative serovar typhi especially in endemic regions where the Vi vaccine is administered. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. A colony multiplex quantitative PCR-Based 3S3DBC method and variations of it for screening DNA libraries.

    Directory of Open Access Journals (Sweden)

    Yang An

    Full Text Available A DNA library is a collection of DNA fragments cloned into vectors and stored individually in host cells, and is a valuable resource for molecular cloning, gene physical mapping, and genome sequencing projects. To take the best advantage of a DNA library, a good screening method is needed. After describing pooling strategies and issues that should be considered in DNA library screening, here we report an efficient colony multiplex quantitative PCR-based 3-step, 3-dimension, and binary-code (3S3DBC method we used to screen genes from a planarian genomic DNA fosmid library. This method requires only 3 rounds of PCR reactions and only around 6 hours to distinguish one or more desired clones from a large DNA library. According to the particular situations in different research labs, this method can be further modified and simplified to suit their requirements.

  6. [Development of a GeXP based multiplex RT-PCR assay for simultaneous differentiation of nine human hand food mouth disease pathogens].

    Science.gov (United States)

    Hu, Xiu-Mei; Zhang, Yong; Xu, Bang-Lao; Yang, Meng-Jie; Wang, Miao; Zhang, Chen; Li, Jin; Bai, Ru-Yin; Zhou, Xiao-Mian; Xu, Wen-Bo; Ma, Xue-Jun

    2011-07-01

    A multiplex RT-PCR assay based on GeXP system was developed in order to detect simultaneously human enterovirus 71 (EV71) and coxsackievirus A16 (CVA16) and other coxsackieviruses (CVA4, 5, 9 and 10, CVB1, 3 and 5). Enterovirus detection was performed with a mixture of 12 pairs of oligonucleotide primers including one pair of published primers for amplifying all known pan-enterovirus genomes and eleven primer pairs specific for detection of the VP1 genes of EV71, C A16, CVA4, CVA5, CVA9, CVA10, CVB1, CVB3 and CVB5, respectively. The specificity of multiplex RT-PCR system was examined using enterovirus cell cultures and positive strains identified previously from hand-foot-and-mouth disease (HFMD) patients. Serial dilution of titrated EV71 and C A16 cell cultures and in vitro transcripted RNA of enterovirus VP1 regions were used to detect the sensitivity of the multiplex RT-PCR system. The limit of detection for this multiplex RT-PCR system was 10(0.5) TCID50/microL for EV71 and C A16 cell cultures and 1000 copies for in vitro transcripted RNA of nine viruses per assay. This multiplex RT-PCR assay is a rapid, sensitive and specific assay for the diagnosis of common enterovirus infection in cases of HFMD outbreak and is also potentially useful for molecular epidemiological investigation.

  7. Rapid genetically modified organism (GMO screening of various food products and animal feeds using multiplex polymerase chain reaction (PCR

    Directory of Open Access Journals (Sweden)

    Lisha, V.

    2017-01-01

    Full Text Available modified crops which brought up a controversy on the safety usage of genetically modified organisms (GMOs. It has been implemented globally that all GMO products and its derived ingredients should have regulations on the usage and labelling. Thus, it is necessary to develop methods that allow rapid screening of GMO products to comply with the regulations. This study employed a reliable and flexible multiplex polymerase chain reaction (PCR method for the rapid detection of transgenic elements in genetically modified soy and maize along with the soybean LECTIN gene and maize ZEIN gene respectively. The selected four common transgenic elements were 35S promoter (35S; Agrobacterium tumefaciens nopaline synthase terminator (NOS; 5-enolypyruvylshikimate-3-phosphate synthase (epsps gene; and Cry1Ab delta-endotoxin (cry1Ab gene. Optimization of the multiplex PCR methods were carried out by using 1% Roundup ReadyTM Soybean (RRS as the certified reference material for soybean that produced fourplex PCR method detecting 35S promoter, NOS terminator, epsps gene and soybean LECTIN gene and by using 1% MON810 as the certified reference material for maize that produced triplex PCR method detecting 35S promoter, cry1Ab gene and maize ZEIN gene prior to screening of the GMO traits in various food products and animal feeds. 1/9 (11.1% of the animal feed contained maize and 1/15 (6.7% of the soybean food products showed positive results for the detection of GMO transgenic gene. None of the maize food products showed positive results for GMO transgenic gene. In total, approximately 4% of the food products and animal feed were positive as GMO. This indicated GMOs have not widely entered the food chain. However, it is necessary to have an appropriate screening method due to GMOs’ unknown potential risk to humans and to animals. This rapid screening method will provide leverage in terms of being economically wise, time saving and reliable.

  8. Correlation between API 20 STREP and multiplex PCR for identification of Enterococcus spp. isolated from Brazilian foods Correlação entre API 20 STREP e PCR multiplex para identificação de Enterococcus spp. isolados de amostras de alimentos no Brasil

    Directory of Open Access Journals (Sweden)

    Bruna C. Gomes

    2007-12-01

    Full Text Available We evaluated the suitability of API 20 STREP and multiplex PCR to speciate 52 Enterococcus spp. obtained from Brazilian foods. A high percentage of isolates (78.9% presented discrepant results between evaluated tests. Similar results were obtained for six E. faecalis and five E. faecium. The PCR multiplex was more effective than API 20 STREP for complete identification of the isolates.A identificação das espécies de 52 Enterococcus spp. isolados de amostras de alimentos foi realizada empregando-se duas metodologias: sistema API 20 STREP e PCR multiplex. Os resultados obtidos revelaram que 78,9% dos isolados apresentaram resultados diferentes nos dois testes utilizados. Apenas seis E. faecalis e cinco E. faecium apresentaram resultados concordantes pelos dois métodos. PCR multiplex permitiu a identificação completa de um número significantemente maior de enterococos do que o sistema API 20 STREP.

  9. Multiplex PCR method for MinION and Illumina sequencing of Zika and other virus genomes directly from clinical samples.

    Science.gov (United States)

    Quick, Joshua; Grubaugh, Nathan D; Pullan, Steven T; Claro, Ingra M; Smith, Andrew D; Gangavarapu, Karthik; Oliveira, Glenn; Robles-Sikisaka, Refugio; Rogers, Thomas F; Beutler, Nathan A; Burton, Dennis R; Lewis-Ximenez, Lia Laura; de Jesus, Jaqueline Goes; Giovanetti, Marta; Hill, Sarah C; Black, Allison; Bedford, Trevor; Carroll, Miles W; Nunes, Marcio; Alcantara, Luiz Carlos; Sabino, Ester C; Baylis, Sally A; Faria, Nuno R; Loose, Matthew; Simpson, Jared T; Pybus, Oliver G; Andersen, Kristian G; Loman, Nicholas J

    2017-06-01

    Genome sequencing has become a powerful tool for studying emerging infectious diseases; however, genome sequencing directly from clinical samples (i.e., without isolation and culture) remains challenging for viruses such as Zika, for which metagenomic sequencing methods may generate insufficient numbers of viral reads. Here we present a protocol for generating coding-sequence-complete genomes, comprising an online primer design tool, a novel multiplex PCR enrichment protocol, optimized library preparation methods for the portable MinION sequencer (Oxford Nanopore Technologies) and the Illumina range of instruments, and a bioinformatics pipeline for generating consensus sequences. The MinION protocol does not require an Internet connection for analysis, making it suitable for field applications with limited connectivity. Our method relies on multiplex PCR for targeted enrichment of viral genomes from samples containing as few as 50 genome copies per reaction. Viral consensus sequences can be achieved in 1-2 d by starting with clinical samples and following a simple laboratory workflow. This method has been successfully used by several groups studying Zika virus evolution and is facilitating an understanding of the spread of the virus in the Americas. The protocol can be used to sequence other viral genomes using the online Primal Scheme primer designer software. It is suitable for sequencing either RNA or DNA viruses in the field during outbreaks or as an inexpensive, convenient method for use in the lab.

  10. Simultaneous detection of cow and buffalo species in milk from China, India, and Pakistan using multiplex real-time PCR.

    Science.gov (United States)

    Cottenet, G; Blancpain, C; Golay, P-A

    2011-08-01

    Asian countries are major producers of cow and buffalo milk. For quality and authenticity purposes, a multiplex real-time PCR assay was developed to specifically and simultaneously detect DNA from these 2 bovine species. Targeting the cytochrome b gene of mitochondrial DNA, common PCR primers amplified a 105-bp fragment, and 2 fluorescent probes specific to either cow or buffalo were designed for their identification. Specificity was successfully tested on 6 other species, including sheep and goat, and sensitivity reached 1% of cow DNA in buffalo DNA and vice versa. As an evaluation, the method was tested using 119 freeze-dried Asian milk samples from regional industrial milk facilities. Although these samples did not cover the entire Asian zone, the multiplex assay indicated that approximately 20% of the samples (mainly from India) showed high levels of cross-contamination of cow milk by buffalo milk, and vice versa. Fast, sensitive, and straightforward, this method is fit-for-purpose for the authenticity control of Asian milk. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  11. Evaluation of the multiplex PCR Allplex-GI assay in the detection of bacterial pathogens in diarrheic stool samples.

    Science.gov (United States)

    Martín, Ariadna; Pérez-Ayala, Ana; Chaves, Fernando; Lora, David; Orellana, M Ángeles

    2017-10-31

    Rapid and accurate detection of the pathogens that cause gastrointestinal infection is important for appropriate therapy and proper infection control. This study assesses the performance of a new molecular assay for simultaneous detection of 13 different gastrointestinal bacteria in stool specimens. Using the Allplex GI-Bacteria (AGI-BI/AGI-BII) assay, a total of 394 stool samples were tested and the results were compared with culturing on selective differential followed by identification by mass spectroscopy. Discordant results were analyzed by a different multiplex PCR method, the Fast-Track Diagnostics Bacterial gastroenteritis (FTD-BG). The routine method (RM) detected 109 (27.7%) positive samples and the Allplex-GI assay, 261 (66.2%). Analysis of discordant results revealed that the molecular assay detected 44 pathogens that were not detected by the RM, including 23 Campylobacter spp., 11 Salmonella spp, 3 Y. enterocolitica, 2 EIEC/Shigella spp, 2 E. coli 0157, 2 C. difficile and 1 Aeromonas spp. Five cases not detected by the molecular method were detected by the RM (3 Aeromonas spp, 1 Salmonella spp and 1 Y. enterocolitica). For all targets, the percentages of sensitivity and specificity were >95%, except for Aeromonas spp., which were 81% and 99% respectively. This study suggests that Allplex-GI multiplex PCR is a sensitive and specific assay that enables a rapid and accurate diagnosis of bacterial gastrointestinal infections. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Comparison of nested-multiplex, Taqman & SYBR Green real-time PCR in diagnosis of amoebic liver abscess in a tertiary health care institute in India

    Directory of Open Access Journals (Sweden)

    K P Dinoop

    2016-01-01

    Interpretation & conclusions: Taqman real-time PCR targeting the 18S rRNA had the highest positivity rate evaluated in this study. Both nested multiplex and SYBR Green real-time PCR assays utilized were evaluated to give accurate results. Real-time PCR assays can be used as the gold standard in rapid and reliable diagnosis, and appropriate management of amoebiasis, replacing the conventional molecular methods.

  13. High throughput multiplex-PCR for direct detection and diagnosis of dermatophyte species, Candida albicans and Candida parapsilosis in clinical specimen.

    Science.gov (United States)

    Vahidnia, Ali; Bekers, Wouter; Bliekendaal, Harry; Spaargaren, Joke

    2015-06-01

    We have developed and validated a multiplex-PCR method for detection of dermatophyte spp., Candida albicans and parapsilosis for routine diagnostics. Our m-PCR showed excellent concordance with culture results in 475 clinical samples. Through the rapid diagnosis by our m-PCR, clinicians are able to initiate adequate antimycotic therapy much earlier. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Identificação de Campylobacter jejuni e Campylobacter coli isoladas de carcaças resfriadas de Frango pela Multiplex PCR | Identification of Campylobacter jejuni and Campylobacter coli from refrigerated cicken carcasses by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    Valeria de Mello Medeiros

    2015-08-01

    Full Text Available Campylobacter jejuni e C. coli constituem as espécies termofílicas mais frequentemente isoladas em casos de enterites humanas, devido à ingestão de alimentos à base de frango mal cozido ou através da contaminação cruzada durante a manipulação de alimentos crus. A diferenciação bioquímica de C. jejuni e C. coli apresenta inconsistências, como a hidrólise do hipurato e a sensibilidade ao ácido nalidíxico e à cefalotina. Desta forma, a aplicação de métodos moleculares se faz necessário na identificação dessas espécies. O objetivo deste trabalho foi realizar a identificação de C. jejuni e C. coli isolados de carcaças resfriadas de frango pela Multiplex PCR. Para isso, o gene que codifica uma subunidade de oxirredutase (160 pb e o gene de virulência ceuE (894 pb específicos para C. jejuni e C. coli, respectivamente, foram submetidos a PCR, simultaneamente. Dos 21 isolados analisados pela bioquímica, 19 (90,48% foram identificados como C. jejuni um (4,76% como C. coli e um (4,76% não identificado. A Multiplex PCR confirmou a presença de 90,48% de C. jejuni e 9,52% de C. coli. A abordagem proposta apresentou rapidez, sensibilidade e especificidade e, assim, poderia ser considerada uma boa alternativa para ensaios clínicos de rotina e estudos epidemiológicos. --------------------------------------------------------------------------------------------- Campylobacter jejuni and C. coli are the most frequently identified thermophilic species in cases of human enteritis caused by the consumption of food products made with undercooked chicken or cross-contamination during handling of raw food products. The biochemical differentiation of C. jejuni and C. coli shows inconsistencies, such as hippurate hydrolysis and sensitivity to nalidixic acid and cephalothin. Consequently, the use of molecular methods is necessary to identify these species. The objective of this study was to identify C. jejuni and C. coli isolates from

  15. Development and validation of a multiplex reverse transcription quantitative PCR (RT-qPCR) assay for the rapid detection of Citrus tristeza virus, Citrus psorosis virus, and Citrus leaf blotch virus.

    Science.gov (United States)

    Osman, Fatima; Hodzic, Emir; Kwon, Sun-Jung; Wang, Jinbo; Vidalakis, Georgios

    2015-08-01

    A single real-time multiplex reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay for the simultaneous detection of Citrus tristeza virus (CTV), Citrus psorosis virus (CPsV), and Citrus leaf blotch virus (CLBV) was developed and validated using three different fluorescently labeled minor groove binding qPCR probes. To increase the detection reliability, coat protein (CP) genes from large number of different isolates of CTV, CPsV and CLBV were sequenced and a multiple sequence alignment was generated with corresponding CP sequences from the GenBank and a robust multiplex RT-qPCR assay was designed. The capacity of the multiplex RT-qPCR assay in detecting the viruses was compared to singleplex RT-qPCR designed specifically for each virus and was assessed using multiple virus isolates from diverse geographical regions and citrus species as well as graft-inoculated citrus plants infected with various combination of the three viruses. No significant difference in detection limits was found and specificity was not affected by the inclusion of the three assays in a multiplex RT-qPCR reaction. Comparison of the viral load for each virus using singleplex and multiplex RT-qPCR assays, revealed no significant differences between the two assays in virus detection. No significant difference in Cq values was detected when using one-step and two-step multiplex RT-qPCR detection formats. Optimizing the RNA extraction technique for citrus tissues and testing the quality of the extracted RNA using RT-qPCR targeting the cytochrome oxidase citrus gene as an RNA specific internal control proved to generate better diagnostic assays. Results showed that the developed multiplex RT-qPCR can streamline viruses testing of citrus nursery stock by replacing three separate singleplex assays, thus reducing time and labor while retaining the same sensitivity and specificity. The three targeted RNA viruses are regulated pathogens for California's mandatory "Section 3701

  16. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth and look-alike disease viruses

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; Baker, B R; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; Reid, S M; Ebert, K; Ferris, N P; King, D P

    2007-09-18

    A high-throughput multiplexed assay (Multiplex Version 1.0) was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRTPCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  17. Simultaneous detection and differentiation of four closely related sweet potato potyviruses by a multiplex one-step RT-PCR.

    Science.gov (United States)

    Li, Fan; Zuo, Ruijuan; Abad, Jorge; Xu, Donglin; Bao, Gaili; Li, Ruhui

    2012-12-01

    Four closely related potyviruses, Sweet potato feathery mottle virus (SPFMV), Sweet potato virus C (SPVC), Sweet potato virus G (SPVG) and/or Sweet potato virus 2 (SPV2), are involved in sweet potato virus disease complexes worldwide. Identification and detection of these viruses are complicated by high similarity among their genomic sequences, frequent occurrence as mixed infections and low titer in many sweet potato cultivars. A one-tube multiplex reverse transcription-PCR (mRT-PCR) assay was developed for simultaneous detection and differentiation of SPFMV, SPVC, SPVG and SPV2. Four specific forward primers unique to each virus and one reverse primer based on the region conserved in all four viruses were selected and used in the assay. The mRT-PCR assay was optimized for primer concentration and cycling conditions. It was tested using sweet potato plants infected naturally with one to four target viruses and then evaluated using field samples collected from southwestern China. The mRT-PCR assay is reliable and sensitive as a simple, rapid and cost-effective method to detect these pathogens in sweet potato. This assay will be useful to quarantine and certification programs and virus surveys when large numbers of samples are tested. Published by Elsevier B.V.

  18. Screening the three LHON primary mutations in the general Chinese population by using an optimized multiplex allele-specific PCR.

    Science.gov (United States)

    Bi, Rui; Zhang, A-Mei; Yu, Dandan; Chen, Diana; Yao, Yong-Gang

    2010-11-11

    Leber hereditary optic neuropathy (LHON) is one of the most common mitochondrial diseases, which is mainly caused by three mitochondrial DNA (mtDNA) mutations (m.3460G>A, m.11778G>A and m.14484T>C). Incomplete penetrance suggests that there might be asymptomatic carriers in general populations. These asymptomatic carriers are clinically important as they are potential future patients and the female carriers could transfer the pathogenic mutations to their offspring. Thus, screening the three LHON primary mutations in general populations is important for genetic counseling. We optimized a multiplex allele-specific PCR method based on previous studies, and the sensitivity was evaluated. The three LHON primary mutations were screened by using this MAS-PCR method in 1571 subjects from general Chinese populations that are without symptoms or family history of optic neuropathy. The optimized MAS-PCR approach can detect a heteroplasmy level at 5%, 5%, and 20% for m.3460G>A, m.11778G>A and m.14484T>C, respectively. None of the three LHON primary mutations was detected in the 1571 subjects. The three LHON primary mutations are rare in general Chinese populations. The optimized MAS-PCR assay provides an easier, faster and more cost-effective method for detection of the three LHON primary mutations, making it practical for clinical diagnosis. 2010 Elsevier B.V. All rights reserved.

  19. Ultra-fast DNA-based multiplex convection PCR method for meat species identification with possible on-site applications.

    Science.gov (United States)

    Song, Kyung-Young; Hwang, Hyun Jin; Kim, Jeong Hee

    2017-08-15

    The aim of this study was to develop an ultra-fast molecular detection method for meat identification using convection Palm polymerase chain reaction (PCR). The mitochondrial cytochrome b (Cyt b) gene was used as a target gene. Amplicon size was designed to be different for beef, lamb, and pork. When these primer sets were used, each species-specific set specifically detected the target meat species in singleplex and multiplex modes in a 24min PCR run. The detection limit was 1pg of DNA for each meat species. The convection PCR method could detect as low as 1% of meat adulteration. The stability of the assay was confirmed using thermal processed meats. We also showed that direct PCR can be successfully performed with mixed meats and food samples. These results suggest that the developed assay may be useful in the authentication of meats and meat products in laboratory and rapid on-site applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Evaluation of a PCR multiplex for detection and differentiation of Mycoplasma synoviae, M. gallisepticum, and M. gallisepticum strain F-vaccine

    Directory of Open Access Journals (Sweden)

    Elena Mettifogo

    2015-01-01

    Full Text Available Mycoplasma gallisepticum (MG and Mycoplasma synoviae (MS are the mycoplasma infections of most concern for commercial poultry industry. MG infection is commonly designated as chronic respiratory disease (CRD of chickens and infections sinusitis of turkeys. MS causes sub clinical upper respiratory infection and tenosynovitis or bursitis in chickens and turkeys. The multiplex PCR was standardized to detect simultaneously the MS, MG field strains and MG F-vaccine strain specific. The generic PCR for detection of any species of Mollicutes Class was performed and compared to the multiplex PCR and to PCR using species-specific primers. A total of 129 avian tracheal swabs were collected from broiler-breeders, layer hens and broilers in seven different farms and were examined by multiplex PCR methods. The system (multiplex PCR demonstrated to be very rapid, sensitive, and specific. Therefore, the results showed a high prevalence of MS in the flocks examined (27.9%, and indicate that the MS is a recurrent pathogen in Brazilian commercial poultry flocks.

  1. Detection of virulence, antibiotic resistance and toxin (VAT) genes in Campylobacter species using newly developed multiplex PCR assays.

    Science.gov (United States)

    Laprade, Natacha; Cloutier, Michel; Lapen, David R; Topp, Edward; Wilkes, Graham; Villemur, Richard; Khan, Izhar U H

    2016-05-01

    Campylobacter species are one of the leading causes of bacterial gastroenteritis in humans worldwide. This twofold study was sought to: i) develop and optimize four single-tube multiplex PCR (mPCR) assays for the detection of six virulence (ciaB, dnaJ, flaA, flaB, pldA and racR), three toxin (cdtA, cdtB and cdtC) and one antibiotic resistance tet(O) genes in thermophilic Campylobacter spp. and ii) apply and evaluate the developed mPCR assays by testing 470 previously identified C. jejuni, C. coli and C. lari isolates from agricultural water. In each mPCR assay, a combination of two or three sets of primer pairs for virulence, antibiotic resistance and toxin (VAT) genes was used and optimized. Assay 1 was developed for the detection of dnaJ, racR and cdtC genes with expected amplification sizes of 720, 584 and 182bp. Assay 2 generated PCR amplicons for tet(O) and cdtA genes of 559 and 370bp. Assay 3 amplified cdtB ciaB, and pldA genes with PCR amplicon sizes of 620, 527 and 385bp. Assay 4 was optimized for flaA and flaB genes that generated PCR amplicons of 855 and 260bp. The primer pairs and optimized PCR protocols did not show interference and/or cross-amplification with each other and generated the expected size of amplification products for each target VAT gene for the C. jejuni ATCC 33291 reference strain. Overall, all ten target VAT genes were detected at a variable frequency in tested isolates of thermophilic Campylobacter spp. where cdtC, flaB, ciaB, cdtB, cdtA and pldA were commonly detected compared to the flaA, racR, dnaJ and tet(O) genes which were detected with less frequency. The developed mPCR assays are simple, rapid, reliable and sensitive tools for simultaneously assessing potential pathogenicity and antibiotic resistance profiling in thermophilic Campylobacter spp. The mPCR assays will be useful in diagnostic and analytical settings for routine screening of VAT characteristics of Campylobacter spp. as well as being applicable in epidemiological

  2. Comparison of two broadly multiplexed PCR systems for viral detection in clinical respiratory tract specimens from immunocompromised children.

    Science.gov (United States)

    Hayden, Randall T; Gu, Zhengming; Rodriguez, Alicia; Tanioka, Lisa; Ying, Claire; Morgenstern, Markus; Bankowski, Matthew J

    2012-04-01

    The detection of viral respiratory tract infections has evolved greatly with the development of PCR based commercial systems capable of simultaneously detecting a wide variety of pathogens. Evaluate the relative performance of two commercial broad range systems for the detection of viral agents in clinical respiratory tract specimens from immunocompromised children. A total of 176 patient samples were included in the analysis, representing only the first sample collected for each patient, and excluding failed reactions. Samples were de-identified and assayed in parallel using two different, broadly multiplexed PCR systems: ResPlex™ II Panel v2.0 (ResPlex), Qiagen, Hilden, Germany and FilmArray(®) Respiratory Panel (FilmArray), Idaho Technology Inc., Salt Lake City, UT. Method comparison was based upon pair-wise concordance of results according to patient age, viral target and number of targets detected. The two systems showed an overall concordance, by patient, of 83.8% (p=0.0001). FilmArray detected at least one target in 68.8% of samples, while ResPlex detected at least one target in 56.8%. ResPlex failed to detect 20.7% of FilmArray positives, and FilmArray failed to detect 4% of ResPlex positives. The relative performance of each system (including which system detected a higher number of positive samples) varied when stratified by target viral pathogen. Broadly multiplexed PCR is an effective means of detecting large numbers of clinically relevant respiratory viral pathogens. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Rapid detection and differentiation of Campylobacter jejuni, Campylobacter coli, and Campylobacter lari in food, using multiplex real-time PCR.

    Science.gov (United States)

    Mayr, A M; Lick, S; Bauer, J; Thärigen, D; Busch, U; Huber, I

    2010-02-01

    A multiplex real-time PCR assay based on four differently labeled TaqMan probes for detection and differentiation of the thermophilic Campylobacter species C. jejuni, C. coli, and C. lari was established and validated in food products. This assay combines two previously published PCR assays for C. jejuni and C. coli with a newly developed detection assay for C. lari and an internal amplification control system. The selectivity of the method was determined by analyzing 70 Campylobacter strains and 43 strains of other bacteria. The sensitivity was 50 fg of C. jejuni and C. lari DNA and 500 fg of C. coli DNA per PCR. It was possible to detect 1 to 10 CFU/25 g of food before preenrichment of all three species. More than 400 samples of various foods (poultry, seafood, and meat) were analyzed after 48 h of preenrichment parallel to the conventional diagnostic method of culture and biochemical identification. Using the established real-time PCR assay, 55.4% of the samples were recognized as positive for thermophilic Campylobacter species, whereas with the conventional method only 40.3% of the samples were positive. The real-time PCR assay also detected contaminations with two different Campylobacter species in 32.6% of the analyzed poultry samples, a finding of epidemiological interest. Compared with the original PCR method, which was established for the differentiation of bacterial isolates of C. jejuni and C. coli, this new method also detects and distinguishes C. lari, was validated as an analytical tool for food analysis, and provides reliable and extensive results within 2 days.

  4. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  5. Simultaneous Detection of CDC Category "A" DNA and RNA Bioterrorism Agents by Use of Multiplex PCR & RT-PCR Enzyme Hybridization Assays

    Directory of Open Access Journals (Sweden)

    Kelly J. Henrickson

    2009-10-01

    Full Text Available Assays to simultaneously detect multiple potential agents of bioterrorism are limited. Two multiplex PCR and RT-PCR enzyme hybridization assays (mPCR-EHA, mRT-PCR-EHA were developed to simultaneously detect many of the CDC category “A” bioterrorism agents. The “Bio T” DNA assay was developed to detect: Variola major (VM, Bacillus anthracis (BA, Yersinia pestis (YP, Francisella tularensis (FT and Varicella zoster virus (VZV. The “Bio T” RNA assay (mRT-PCR-EHA was developed to detect: Ebola virus (Ebola, Lassa fever virus (Lassa, Rift Valley fever (RVF, Hantavirus Sin Nombre species (HSN and dengue virus (serotypes 1-4. Sensitivity and specificity of the 2 assays were tested by using genomic DNA, recombinant plasmid positive controls, RNA transcripts controls, surrogate (spiked clinical samples and common respiratory pathogens. The analytical sensitivity (limit of detection (LOD of the DNA asssay for genomic DNA was 1×100~1×102 copies/mL for BA, FT and YP. The LOD for VZV whole organism was 1×10-2 TCID50/mL. The LOD for recombinant controls ranged from 1×102~1×103copies/mL for BA, FT, YP and VM. The RNA assay demonstrated LOD for RNA transcript controls of 1×104~1×106 copies/mL without extraction and 1×105~1×106 copies/mL with extraction for Ebola, RVF, Lassa and HSN. The LOD for dengue whole organisms was ~1×10-4 dilution for dengue 1 and 2, 1×104 LD50/mL and 1×102 LD50/mL for dengue 3 and 4. The LOD without extraction for recombinant plasmid DNA controls was ~1×103 copies/mL (1.5 input copies/reaction for Ebola, RVF, Lassa and HSN. No cross-reactivity of primers and probes used in both assays was detected with common respiratory pathogens or between targeted analytes. Clinical sensitivity was estimated using 264 surrogate clinical samples tested with the BioT DNA assay and 549 samples tested with the BioT RNA assay. The clinical specificity is 99.6% and 99.8% for BioT DNA assay and BioT RNA assay, respectively. The

  6. Isolation, identification and differentiation of Campylobacter spp. using multiplex PCR assay from goats in Khartoum State, Sudan.

    Science.gov (United States)

    Elbrissi, Atif; Sabeil, Y A; Khalifa, Khalda A; Enan, Khalid; Khair, Osama M; El Hussein, A M

    2017-03-01

    The aim of this study was to identify and characterize thermophilic Campylobacter species in faecal samples from goats in Khartoum State, Sudan, by application of multiplex polymerase chain reaction. Campylobacteriosis is a zoonotic disease of global concern, and the organisms can be transmitted to human via food, water and through contact with farm animals and pets. There are five clinically related Campylobacter species: Campylobacter jejuni (C. jejuni). Campylobacter coli, Campylobacter lari, Campylobacter upsaliensis and Campylobacter fetus. Conventional cultural methods to diagnose campylobacteriosis are tedious and time consuming. Wide ranges of genes have been reported to be used for PCR-based identification of Campylobacter spp. We used a multiplex PCR assay to simultaneously detect genes from the major five clinically significant Campylobacter spp. The genes selected were hipO (hippuricase) and 23S rRNA from glyA (serine hydroxymethyl transferase) from each of C. jejuni. C. coli, C. lari, and C. upsaliensis; and sapB2 (surface layer protein) from C. fetus subsp. fetus. The assay was used to identify Campylobacter isolates recovered from 336 cultured faecal samples from goats in three localities in Khartoum State. C. coli was the most predominant isolate (234; 69.6%), followed by C. jejuni (19; 5.7%), C. upsaliensis (13; 3.9%), C. fetus subsp. fetus (7; 2.1%) and C. lari (6; 1.8%). Twenty-nine goats showed mixed infection with Campylobacter spp., 21 of which harbored two Campylobacter spp., while eight animals were infected with three species. Ten out of twelve goats that displayed diarrhea harbored C. coli only. C. coli, C. jejuni and C. upsaliensis showed significant variation with localities. The prevalence of C. coli was significantly higher (87; 25.9%) in goats from Omdurman, whereas C. jejuni and C. upsaliensis were significantly higher (11; 3.3%, 9; 2.7%) in goats from Khartoum. The multiplex PCR assay was found to be rapid and easy to perform and

  7. Detection of respiratory viruses in sputum from adults by use of automated multiplex PCR.

    Science.gov (United States)

    Branche, Angela R; Walsh, Edward E; Formica, Maria A; Falsey, Ann R

    2014-10-01

    Respiratory tract infections (RTI) frequently cause hospital admissions among adults. Diagnostic viral reverse transcriptase PCR (RT-PCR) of nose and throat swabs (NTS) is useful for patient care by informing antiviral use and appropriate isolation. However, automated RT-PCR systems are not amenable to utilizing sputum due to its viscosity. We evaluated a simple method of processing sputum samples in a fully automated respiratory viral panel RT-PCR assay (FilmArray). Archived sputum and NTS samples collected in 2008-2012 from hospitalized adults with RTI were evaluated. A subset of sputum samples positive for 10 common viruses by a uniplex RT-PCR was selected. A sterile cotton-tip swab was dunked in sputum, swirled in 700 μL of sterile water (dunk and swirl method) and tested by the FilmArray assay. Quantitative RT-PCR was performed on "dunked" sputum and NTS samples for influenza A (Flu A), respiratory syncytial virus (RSV), coronavirus OC43 (OC43), and human metapneumovirus (HMPV). Viruses were identified in 31% of 965 illnesses using a uniplex RT-PCR. The sputum sample was the only sample positive for 105 subjects, including 35% (22/64) of influenza cases and significantly increased the diagnostic yield of NTS alone (302/965 [31%] versus 197/965 [20%]; P = 0.0001). Of 108 sputum samples evaluated by the FilmArray assay using the dunk and swirl method, 99 (92%) were positive. Quantitative RT-PCR revealed higher mean viral loads in dunked sputum samples compared to NTS samples for Flu A, RSV, and HMPV (P = 0.0001, P = 0.006, and P = 0.011, respectively). The dunk and swirl method is a simple and practical method for reliably processing sputum samples in a fully automated PCR system. The higher viral loads in sputa may increase detection over NTS testing alone. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  8. Simultaneous Detection of Mycoplasma pneumoniae, Mycoplasma hominis and Mycoplasma arthritidis in Synovial Fluid of Patients with Rheumatoid Arthritis by Multiplex PCR.

    Science.gov (United States)

    Ataee, Ramezan Ali; Golmohammadi, Reza; Alishiri, Gholam Hossein; Mirnejad, Reza; Najafi, Ali; Esmaeili, Davood; Jonaidi-Jafari, Nematollah

    2015-06-01

    It has been recognized that infectious agents, such as different bacteria and viruses, may play a role in the developing of rheumatoid arthritis (RA). Recently, the mycoplasma species has been implicated in the pathogenesis of RA. The aim of this study was to design a multiplex PCR for rapid and simultaneous detection of Mycoplasma pneumoniae, Mycoplasma hominis, and Mycoplasma arthritidis in the synovial fluid of patients with rheumatoid arthritis (RA). A total of 131 synovial fluid (SF) samples from patients with RA were assayed. Mycoplasma pneumoniae (ATCC: 29342), M. hominis (native strain), and the synthetic complete genome of M. arthritidis mitogen (MAM) superantigen were used as controls. All SF samples were subjected to DNA extraction separately and multiplex PCR was performed. The PCR products were confirmed by sequencing. The designed multiplex PCR was able to detect M. pneumoniae, M. hominis, and M. arthritidis in the SF of patients with RA with a frequency of 30 (22.9%), 23 (17.5%) and 13 (9.9%), respectively. In this study, the overall detection of the Mycoplasma species in RA patients was 53.4%; thus, we recommend the application of multiplex PCR assays when searching for a specific anti mycoplasma treatment for RA patients.

  9. Detection of Mycobacterium chelonae, Mycobacterium abscessus Group, and Mycobacterium fortuitum Complex by a Multiplex Real-Time PCR Directly from Clinical Samples Using the BD MAX System.

    Science.gov (United States)

    Rocchetti, Talita T; Silbert, Suzane; Gostnell, Alicia; Kubasek, Carly; Campos Pignatari, Antonio C; Widen, Raymond

    2017-03-01

    A new multiplex PCR test was designed to detect Mycobacterium chelonae, Mycobacterium abscessus group, and Mycobacterium fortuitum complex on the BD MAX System. A total of 197 clinical samples previously submitted for mycobacterial culture were tested using the new protocol. Samples were first treated with proteinase K, and then each sample was inoculated into the BD MAX Sample Buffer Tube. Extraction and multiplex PCR were performed by the BD MAX System, using the BD MAX ExK TNA-3 extraction kit and BD TNA Master Mix, along with specific in-house designed primers and probes for each target. The limit of detection of each target, as well as specificity, was evaluated. Of 197 clinical samples included in this study, 133 were positive and 60 were negative for mycobacteria by culture, and another 4 negative samples were spiked with M. chelonae ATCC 35752. The new multiplex PCR on the BD MAX had 97% concordant results with culture for M. abscessus group detection, 99% for M. chelonae, and 100% for M. fortuitum complex. The new multiplex PCR test performed on the BD MAX System proved to be a sensitive and specific test to detect M. chelonae, M. abscessus group, and M. fortuitum complex by real-time PCR on an automated sample-in results-out platform. Copyright © 2017 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  10. [Evaluation of the usefulness of selective chromogenic agar medium (chromID VRE) and multiplex PCR method for the detection of vancomycin-resistant enterococci].

    Science.gov (United States)

    Kim, Do-Hoon; Lee, Jae-Hee; Ha, Jung-Sook; Ryoo, Nam-Hee; Jeon, Dong-Seok; Kim, Jae-Ryong

    2010-12-01

    Accurate and early detection of vancomycin-resistant enterococci (VRE) is critical for controlling nosocomial infection. In this study, we evaluated the usefulness of a selective chromogenic agar medium and of multiplex PCR for detection of VRE, and both these techniques were compared with the conventional culture method for VRE detection. We performed the following 3 methods for detecting VRE infection in stool specimens: the routine culture method, culturing in selective chromogenic agar medium (chromID VRE, bioMérieux, France), and multiplex PCR using the Seeplex® VRE ACE Detection kit (Seegene Inc., Korea) with additional PCR for vanC genes. We isolated 109 VRE strains from 100 stool specimens by the routine culture method. In chromID VRE, all the isolates showed purple colonies, including Enterococcus gallinarum and E. raffinosus, which were later identified using the Vitek card. All VRE isolates were identified by the multiplex PCR method; 100 were vanA-positive E. faecium, 8 were vanA- and vanC-1-positive E. gallinarum, and 1 was vanA-positive E. raffinosus. For VRE surveillance, culturing the isolates in chromID VRE after broth enrichment appears to be an accurate, rapid, and easy method for routine screening test. Multiplex PCR is relatively expensive and needs skilled techniques for detecting VRE, but it can be an auxiliary tool for rapid detection of genotype during a VRE outbreak.

  11. Use of multiplex allele-specific polymerase chain reaction (MAS-PCR to detect multidrug-resistant tuberculosis in Panama.

    Directory of Open Access Journals (Sweden)

    Bing-Shao Chia

    Full Text Available The frequency of individual genetic mutations conferring drug resistance (DR to Mycobacterium tuberculosis has not been studied previously in Central America, the place of origin of many immigrants to the United States. The current gold standard for detecting multidrug-resistant tuberculosis (MDR-TB is phenotypic drug susceptibility testing (DST, which is resource-intensive and slow, leading to increased MDR-TB transmission in the community. We evaluated multiplex allele-specific polymerase chain reaction (MAS-PCR as a rapid molecular tool to detect MDR-TB in Panama. Based on DST, 67 MDR-TB and 31 drug-sensitive clinical isolates were identified and cultured from an archived collection. Primers were designed to target five mutation hotspots that confer resistance to the first-line drugs isoniazid and rifampin, and MAS-PCR was performed. Whole-genome sequencing confirmed DR mutations identified by MAS-PCR, and provided frequencies of genetic mutations. DNA sequencing revealed 70.1% of MDR strains to have point mutations at codon 315 of the katG gene, 19.4% within mabA-inhA promoter, and 98.5% at three hotspots within rpoB. MAS-PCR detected each of these mutations, yielding 82.8% sensitivity and 100% specificity for isoniazid resistance, and 98.4% sensitivity and 100% specificity for rifampin resistance relative to DST. The frequency of individual DR mutations among MDR strains in Panama parallels that of other TB-endemic countries. The performance of MAS-PCR suggests that it may be a relatively inexpensive and technically feasible method for rapid detection of MDR-TB in developing countries.

  12. Multiplex PCR for simultaneous detection and differentiation of sheeppox, goatpox and orf viruses from clinical samples of sheep and goats.

    Science.gov (United States)

    Venkatesan, G; Balamurugan, V; Bhanuprakash, V

    2014-01-01

    A multiplex polymerase chain reaction (mPCR) was developed and evaluated for detection of pox viral infections simultaneously using clinical samples from sheep and goats. Specific primers for three pox viruses of sheep and goats including sheeppox virus (SPPV), goatpox virus (GTPV) and orf virus (ORFV) were designed targeting conserved sequences of the DNA binding phosphoprotein (I3L) coding gene of Capripoxvirus (CaPV) and the DNA polymerase (E9L) gene of parapoxvirus for identification of these viruses. The mPCR assay was found to be sensitive for detecting as low as 350 pg of viral genomic DNA or 10(2) copies of standard plasmid of individual targets; and 10(3) copies of plasmid in a mixture of two or three viruses. The assay was specific for detecting one or more of the viruses in various combinations from clinical specimens. Two hundred and thirty five (n=235) clinical samples from sheep and goats received from different geographical regions of the country for diagnosis of pox infection were evaluated by developed uniplex and mPCR assays. The assay had improved diagnostic sensitivity and specificity over to in-use laboratory diagnostic methods and can be useful for clinical differential diagnosis of these infections in sheep and goats. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Genome-wide mRNA profiling and multiplex quantitative RT-PCR for forensic body fluid identification.

    Science.gov (United States)

    Park, Seong-Min; Park, Seong-Yeon; Kim, Jeong-Hwan; Kang, Tae-Wook; Park, Jong-Lyul; Woo, Kwang-Man; Kim, Jong-Sik; Lee, Han-Chul; Kim, Seon-Young; Lee, Seung-Hwan

    2013-01-01

    In forensic science, identifying a tissue where a forensic specimen was originated is one of the principal challenges. Messenger RNA (mRNA) profile clearly reveals tissue-specific gene expression patterns that many attempts have been made to use RNA for forensic tissue identification. To systematically investigate the body-fluid-specific expression of mRNAs and find novel mRNA markers for forensic body fluid identification, we performed DNA microarray experiment with 24 Korean body fluid samples. Shannon entropy and Q-values were calculated for each gene, and 137 body-fluid-specific candidate genes were selected. By applying more stringent criteria, we further selected 28 candidate genes and validated them by RT-PCR and qRT-PCR. As a result, we suggest a novel combination of four body-fluid-specific mRNA makers: PPBP for blood, FDCSP for saliva, MSMB for semen and MSLN for vaginal secretion. Multiplex qRT-PCR assay was designed using the four mRNA markers and DNA/RNA co-extraction method was tested for forensic use. This study will provide a thorough examination of body-fluid-specifically expressed mRNAs, which will enlarge the possibility of practical use of RNA for forensic purpose. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  14. One-step multiplex PCR method for the determination of pecan and Brazil nut allergens in food products.

    Science.gov (United States)

    Hubalkova, Zora; Rencova, Eva

    2011-10-01

    A one-step polymerase chain reaction (PCR) method for the simultaneous detection of the major allergens of pecan and Brazil nuts was developed. Primer pairs for the amplification of partial sequences of genes encoding the allergens were designed and tested for their specificity on a range of food components. The targeted amplicon size was 173 bp of Ber e 1 gene of Brazil nuts and 72 bp of vicilin-like seed storage protein gene in pecan nuts. The primer pair detecting the noncoding region of the chloroplast DNA was used as the internal control of amplification. The intrinsic detection limit of the PCR method was 100 pg mL(-1) pecan or Brazil nuts DNA. The practical detection limit was 0.1% w/w (1 g kg(-1)). The method was applied for the investigation of 63 samples with the declaration of pecans, Brazil nuts, other different nut species or nuts generally. In 15 food samples pecans and Brazil nuts allergens were identified in the conformity with the food declaration. The presented multiplex PCR method is specific enough and can be used as a fast approach for the detection of major allergens of pecan or Brazil nuts in food. Copyright © 2011 Society of Chemical Industry.

  15. Rapid screening of pyogenic Staphylococcus aureus for confirmation of genus and species, methicillin resistance and virulence factors by using two novel multiplex PCR.

    Science.gov (United States)

    Haque, Abdul; Haque, Asma; Saeed, Muhammad; Azhar, Aysha; Rasool, Samreen; Shan, Sidra; Ehsan, Beenish; Nisar, Zohaib

    2017-01-01

    Emergence of methicillin resistant Staphylococcus aureus (MRSA) is a major medical problem of current era. These bacteria are resistant to most drugs and rapid diagnosis can provide a clear guideline to clinicians. They possess specific virulence factors and relevant information can be very useful. We designed this study to develop multiplex PCRs to provide rapid information. We studied 60 Staphylococcus aureus isolates and detected methicillin resistance by cefoxitin sensitivity and targeting of mecA gene. After initial studies with uniplex PCRs we optimized two multiplex PCRs with highly reproducible results. The first multiplex PCR was developed to confirm genus, species and methicillin resistance simultaneously, and the second multiplex PCR was for screening of virulence factors. We found 38.33% isolates as methicillin resistant. α -toxin, the major cytotoxic factor, was detected in 40% whereas β-hemolysin was found in 25% cases. Panton Valentine leucocidin was detected in 8.33% and toxic shock syndrome toxin in5% cases. The results of uniplex and multiplex PCRs were highly compatible. These two multiplex PCRs when run simultaneously can provide vital information about methicillin resistance and virulence status of the isolate within a few hours as compared to several days needed by routine procedures.

  16. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth disease virus and look-alike disease viruses

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P

    2007-07-26

    A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  17. Impact of Early Detection of Respiratory Viruses by Multiplex PCR Assay on Clinical Outcomes in Adult Patients.

    Science.gov (United States)

    Rappo, Urania; Schuetz, Audrey N; Jenkins, Stephen G; Calfee, David P; Walsh, Thomas J; Wells, Martin T; Hollenberg, James P; Glesby, Marshall J

    2016-08-01

    Rapid and definitive diagnosis of viral respiratory infections is imperative in patient triage and management. We compared the outcomes for adult patients with positive tests for respiratory viruses at a tertiary care center across two consecutive influenza seasons (winters of 2010-2011 and 2012). Infections were diagnosed by conventional methods in the first season and by multiplex PCR (FilmArray) in the second season. FilmArray decreased the time to diagnosis of influenza compared to conventional methods (median turnaround times of 1.7 h versus 7.7 h, respectively; P = 0.015); FilmArray also decreased the time to diagnosis of non-influenza viruses (1.5 h versus 13.5 h, respectively; P FilmArray was associated with significantly lower odds ratios (ORs) for admission (P = 0.046), length of stay (P = 0.040), duration of antimicrobial use (P = 0.032), and number of chest radiographs (P = 0.005), when controlling for potential confounders. We conclude that the rapid turnaround time, multiplex nature of the test (allowing simultaneous detection of an array of viruses), and superior sensitivity of FilmArray may improve the evaluation and management of patients suspected of having respiratory virus infections. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  18. Identification of Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid by multiplex real-time PCR.

    Science.gov (United States)

    Sanz, Juan Carlos; Ríos, Esther; Rodríguez-Avial, Iciar; Ramos, Belén; Marín, Mercedes; Cercenado, Emilia

    2017-08-14

    The aim was to evaluate the utility of a multiplex real-time PCR to detect Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid (PF). A collection of 81 PF samples was used. Sixty were considered positive for S. pneumoniae according to previous results (54 by an in-house lytA gene PCR and eight by universal rRNA PCR). The sensitivity for detection of the lytA, plyA and psaA genes by multiplex PCR was 100% (60/60), 98.3% (59/60) and 91.7% (55/60), respectively. The detection of all three genes was negative in 21 samples formerly confirmed as negative for S. pneumoniae (100% specificity) by the other procedures (9 by in-house lytA PCR and 12 by rRNA PCR). The use of this multiplex PCR may be a useful option to identify S. pneumoniae directly in PF samples. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  19. A multiplex PCR for detection of knockdown resistance mutations, V1016G and F1534C, in pyrethroid-resistant Aedes aegypti.

    Science.gov (United States)

    Saingamsook, Jassada; Saeung, Atiporn; Yanola, Jintana; Lumjuan, Nongkran; Walton, Catherine; Somboon, Pradya

    2017-10-10

    Mutation of the voltage-gated sodium channel (VGSC) gene, or knockdown resistance (kdr) gene, is an important resistance mechanism of the dengue vector Aedes aegypti mosquitoes against pyrethroids. In many countries in Asia, a valine to glycine substitution (V1016G) and a phenylalanine to cysteine substitution (F1534C) are common in Ae. aegypti populations. The G1016 and C1534 allele frequencies have been increasing in recent years, and hence there is a need to have a simple and inexpensive tool to monitor the alleles in large scale. A multiplex PCR to detect V1016G and F1534C mutations has been developed in the current study. This study utilized primers from previous studies for detecting the mutation at position 1016 and newly designed primers to detect variants at position 1534. The PCR conditions were validated and compared with DNA sequencing using known kdr mutant laboratory strains and field collected mosquitoes. The efficacy of this method was also compared with allele-specific PCR (AS-PCR). The results of our multiplex PCR were in complete agreement with sequencing data and better than the AS-PCR. In addition, the efficiency of two non-toxic DNA staining dyes, Ultrapower™ and RedSafe™, were evaluated by comparing with ethidium bromide (EtBr) and the results were satisfactory. Our multiplex PCR method is highly reliable and useful for implementing vector surveillance in locations where the two alleles co-occur.

  20. Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number)

    Science.gov (United States)

    Fatemeh, Dehghan; Reza, Zolfaghari Mohammad; Mohammad, Arjomandzadegan; Salomeh, Kalantari; Reza, Ahmari Gholam; Hossein, Sarmadian; Maryam, Sadrnia; Azam, Ahmadi; Mana, Shojapoor; Negin, Najarian; Reza, Kasravi Alii; Saeed, Falahat

    2014-01-01

    Objective To analyse molecular detection of coliforms and shorten the time of PCR. Methods Rapid detection of coliforms by amplification of lacZ and uidA genes in a multiplex PCR reaction was designed and performed in comparison with most probably number (MPN) method for 16 artificial and 101 field samples. The molecular method was also conducted on isolated coliforms from positive MPN samples; standard sample for verification of microbial method certificated reference material; isolated strains from certificated reference material and standard bacteria. The PCR and electrophoresis parameters were changed for reducing the operation time. Results Results of PCR for lacZ and uidA genes were similar in all of standard, operational and artificial samples and showed the 876 bp and 147 bp bands of lacZ and uidA genes by multiplex PCR. PCR results were confirmed by MPN culture method by sensitivity 86% (95% CI: 0.71-0.93). Also the total execution time, with a successful change of factors, was reduced to less than two and a half hour. Conclusions Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN. PMID:25182727

  1. Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number).

    Science.gov (United States)

    Fatemeh, Dehghan; Reza, Zolfaghari Mohammad; Mohammad, Arjomandzadegan; Salomeh, Kalantari; Reza, Ahmari Gholam; Hossein, Sarmadian; Maryam, Sadrnia; Azam, Ahmadi; Mana, Shojapoor; Negin, Najarian; Reza, Kasravi Alii; Saeed, Falahat

    2014-05-01

    To analyse molecular detection of coliforms and shorten the time of PCR. Rapid detection of coliforms by amplification of lacZ and uidA genes in a multiplex PCR reaction was designed and performed in comparison with most probably number (MPN) method for 16 artificial and 101 field samples. The molecular method was also conducted on isolated coliforms from positive MPN samples; standard sample for verification of microbial method certificated reference material; isolated strains from certificated reference material and standard bacteria. The PCR and electrophoresis parameters were changed for reducing the operation time. Results of PCR for lacZ and uidA genes were similar in all of standard, operational and artificial samples and showed the 876 bp and 147 bp bands of lacZ and uidA genes by multiplex PCR. PCR results were confirmed by MPN culture method by sensitivity 86% (95% CI: 0.71-0.93). Also the total execution time, with a successful change of factors, was reduced to less than two and a half hour. Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN.

  2. Rapid molecular characterization of Acinetobacter baumannii clones with rep-PCR and evaluation of carbapenemase genes by new multiplex PCR in Hospital District of Helsinki and Uusimaa.

    Directory of Open Access Journals (Sweden)

    Tanja Pasanen

    Full Text Available Multidrug-resistant Acinetobacter baumannii (MDRAB is an increasing problem worldwide. Prevalence of carbapenem resistance in Acinetobacter spp. due to acquired carbapenemase genes is not known in Finland. The purpose of this study was to examine prevalence and clonal spread of multiresistant A. baumannii group species, and their carbapenemase genes. A total of 55 Acinetobacter isolates were evaluated with repetitive PCR (DiversiLab to analyse clonality of isolates, in conjunction with antimicrobial susceptibility profile for ampicillin/sulbactam, colistin, imipenem, meropenem, rifampicin and tigecycline. In addition, a new real-time PCR assay, detecting most clinically important carbapenemase genes just in two multiplex reactions, was developed. The assay detects genes for KPC, VIM, IMP, GES-1/-10, OXA-48, NDM, GIM-1, SPM-1, IMI/NMC-A, SME, CMY-10, SFC-1, SIM-1, OXA-23-like, OXA-24/40-like, OXA-58 and ISAbaI-OXA-51-like junction, and allows confident detection of isolates harbouring acquired carbapenemase genes. There was a time-dependent, clonal spread of multiresistant A. baumannii strongly correlating with carbapenamase gene profile, at least in this geographically restricted study material. The new carbapenemase screening assay was able to detect all the genes correctly suggesting it might be suitable for epidemiologic screening purposes in clinical laboratories.

  3. An alternative suite of universal primers for genotyping in multiplex PCR.

    Directory of Open Access Journals (Sweden)

    Cheng Ge

    Full Text Available The universal primer three-primer approach can dramatically reduce the cost when genotyping the microsatellites. One former research reported four universal primers that can be used in singleplex and multiplex genotyping. In this study, we proposed an alternative suite of universal primers with four dyes for genotyping 8-12 loci in one single run. This multiplex method was tested on Tetranychus truncatus. Published microsatellite loci of T. kanzawai, Frankliniella occidentalis and Nilaparvata lugens were modified as needed and also tested. The robustness of the method was confirmed by comparing with singleplex using multiple fluorophores and genotyping two populations of T. truncatus. This method showed lower signal strength than the singleplex three-primer system, but it was still sufficient to determine the fragment length. The cost of such a project can be reduced dramatically when many loci of different species are involved. In this way, laboratories performing population genetic analyses or studying several different species may benefit from the use of this cost-effective protocol.

  4. Species-specific differentiation of variola, monkeypox, and varicella-zoster viruses by multiplex real-time PCR assay.

    Science.gov (United States)

    Maksyutov, Rinat A; Gavrilova, Elena V; Shchelkunov, Sergei N

    2016-10-01

    A method of one-stage rapid detection and differentiation of epidemiologically important variola virus (VARV), monkeypox virus (MPXV), and varicella-zoster virus (VZV) utilizing multiplex real-time TaqMan PCR assay was developed. Four hybridization probes with various fluorescent dyes and the corresponding fluorescence quenchers were simultaneously used for the assay. The hybridization probes specific for the VARV sequence contained FAM/BHQ1 as a dye/quencher pair; MPXV-specific, JOE/BHQ1; VZV-specific, TAMRA/BHQ2; and internal control-specific, Cy5/BHQ3. The specificity and sensitivity of the developed method were assessed by analyzing DNA of 32 strains belonging to orthopoxvirus and herpesvirus species. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. A novel enterovirus and parechovirus multiplex one-step real-time PCR-validation and clinical experience

    DEFF Research Database (Denmark)

    Nielsen, A. C. Y.; Bottiger, B.; Midgley, S. E.

    2013-01-01

    testing and routine usage. During 15 months of routine use, from October 2008 to December 2009, we received and analysed 2187 samples (stool samples, cerebrospinal fluids, blood samples, respiratory samples and autopsy samples) were tested, from 1546 patients and detected enteroviruses and parechoviruses...... in 171 (8%) and 66(3%) of the samples, respectively. 180 of the positive samples could be genotyped by PCR and sequencing and the most common genotypes found were human parechovirus type 3, echovirus 9, enterovirus 71, Coxsackievirus A16, and echovirus 25. During 2009 in Denmark, both enterovirus...... and human parechovirus type 3 had a similar seasonal pattern with a peak during the summer and autumn. Human parechovirus type 3 was almost invariably found in children less than 4 months of age. In conclusion, a multiplex assay was developed allowing simultaneous detection of 2 viruses, which can cause...

  6. Differentiation of five strains of infectious bursal disease virus: Development of a strain-specific multiplex PCR

    DEFF Research Database (Denmark)

    Kusk, M.; Kabell, Susanne; Jørgensen, Poul Henrik

    2005-01-01

    Infectious bursal disease virus (IBDV) is a major cause of disease problems in the poultry industry and vaccination has therefore been applied intensively to control the infection. The classical methods of detection and characterization of IBDV are by the use of immunodiffusion test and histopath......Infectious bursal disease virus (IBDV) is a major cause of disease problems in the poultry industry and vaccination has therefore been applied intensively to control the infection. The classical methods of detection and characterization of IBDV are by the use of immunodiffusion test...... and histopathology. Since these methods are laborious and have low specificity alternatives are needed. In the present study, we report the development of a strain-specific multiplex RT-PCR technique, which can detect and differentiate between field strains of IBDV and vaccine virus strains including a so-called hot...

  7. Prevalence, antimicrobial susceptibility and multiplex PCR-serotyping of Listeria monocytogenes isolated from humans, foods and livestock in Iran.

    Science.gov (United States)

    Lotfollahi, Lida; Chaharbalesh, Ardalan; Ahangarzadeh Rezaee, Mohammad; Hasani, Alka

    2017-06-01

    Listeria monocytogenes is a foodborne pathogen causing listeriosis, which potentially affects all individuals, especially pregnant women and immunocompromised persons. The present study investigated the prevalence, antimicrobial susceptibility and serotypes distribution of the isolated L. monocytogenes from Iran. Twenty two (4.97%) of 442 human, food and livestock samples were found to be positive for L. monocytogenes. L. monocytogenes was identified in 8.8% of 125 human samples, 2.99% of 267 food and 6% of 50 livestock samples. The standard disk diffusion method and minimum inhibitory concentration (MIC) assay were used for antimicrobial susceptibility testing and multiplex PCR for serotyping. Among the 22 isolates tested, 6 (27.2%) displayed resistance to penicillin G, with all of the isolates and 2 (9%) of them showing intermediate susceptibility to clindamycin and rifampicin, respectively. According to the MIC assay, the rate of resistance to penicillin G was the same as that of disk diffusion method, but 16 (72.7%) of isolates showed intermediate susceptibility to clindamycin using E-test. In the multiplex PCR, 19 (86.4%) of isolates belonged to serotype 1/2c or 3c and the remaining 3 isolates were identified as (4b, 4d or 4e) and (1/2a or 3a), respectively. The occurrence of resistance to penicillin G, which can be used in the treatment of listeriosis, is very alarming and more prevalence of 1/2c serotype, in comparison to 3 other important ones (1/2a, 1/2b and 4b), in Iran has been reported for the first time. To the best of our knowledge, this is the first study showing the distribution of various serogroups of L. monocytogenes from human and livestock in Iran. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Development of a qualitative, multiplex real-time PCR kit for screening of genetically modified organisms (GMOs).

    Science.gov (United States)

    Dörries, Hans-Henno; Remus, Ivonne; Grönewald, Astrid; Grönewald, Cordt; Berghof-Jäger, Kornelia

    2010-03-01

    The number of commercially available genetically modified organisms (GMOs) and therefore the diversity of possible target sequences for molecular detection techniques are constantly increasing. As a result, GMO laboratories and the food production industry currently are forced to apply many different methods to reliably test raw material and complex processed food products. Screening methods have become more and more relevant to minimize the analytical effort and to make a preselection for further analysis (e.g., specific identification or quantification of the GMO). A multiplex real-time PCR kit was developed to detect the 35S promoter of the cauliflower mosaic virus, the terminator of the nopaline synthase gene of Agrobacterium tumefaciens, the 35S promoter from the figwort mosaic virus, and the bar gene of the soil bacterium Streptomyces hygroscopicus as the most widely used sequences in GMOs. The kit contains a second assay for the detection of plant-derived DNA to control the quality of the often processed and refined sample material. Additionally, the plant-specific assay comprises a homologous internal amplification control for inhibition control. The determined limits of detection for the five assays were 10 target copies/reaction. No amplification products were observed with DNAs of 26 bacterial species, 25 yeasts, 13 molds, and 41 not genetically modified plants. The specificity of the assays was further demonstrated to be 100% by the specific amplification of DNA derived from reference material from 22 genetically modified crops. The applicability of the kit in routine laboratory use was verified by testing of 50 spiked and unspiked food products. The herein described kit represents a simple and sensitive GMO screening method for the reliable detection of multiple GMO-specific target sequences in a multiplex real-time PCR reaction.

  9. Detection of virulence-associated genes of Pasteurella multocida isolated from cases of fowl cholera by multiplex-PCR

    Directory of Open Access Journals (Sweden)

    Thales Q. Furian

    2013-02-01

    Full Text Available The current systems of breeding poultry, based on high population density, increase the risk of spreading pathogens, especially those causing respiratory diseases and those that have more than one host. Fowl Cholera (FC is one such pathogen, and even though it represents one of several avian diseases that should be considered in the differential diagnosis of notifiable diseases that present with sudden death, the pathogenesis and virulence factors involved in FC are still poorly understood. The objective of this study was to investigate twelve genes related to virulence in 25 samples of Pasteurella multocida isolated from FC cases in the southern region of Brazil through the development of multiplex PCR protocols. The protocols developed were capable of detecting all of the proposed genes. The ompH, oma87, sodC, hgbA, hgbB, exBD-tonB and nanB genes were present in 100% of the samples (25/25, the sodA and nanH genes were present in 96% (24/25, ptfA was present in 92% (23/25, and pfhA was present in 60% (15/25. Gene toxA was not identified in any of the samples studied (0/25. Five different genetic profiles were obtained, of which P1 (negative to toxA was the most common. We concluded that the multiplex-PCR protocols could be useful tools for rapid and simultaneous detection of virulence genes. Despite the high frequency of the analyzed genes and the fact that all samples belonged to the same subspecies of P. multocida, five genetic profiles were observed, which should be confirmed in a study with a larger number of samples.

  10. Laser capture microdissection and multiplex-tandem PCR analysis of proximal tubular epithelial cell signaling in human kidney disease.

    Directory of Open Access Journals (Sweden)

    Ray Wilkinson

    Full Text Available Interstitial fibrosis, a histological process common to many kidney diseases, is the precursor state to end stage kidney disease, a devastating and costly outcome for the patient and the health system. Fibrosis is historically associated with chronic kidney disease (CKD but emerging evidence is now linking many forms of acute kidney disease (AKD with the development of CKD. Indeed, we and others have observed at least some degree of fibrosis in up to 50% of clinically defined cases of AKD. Epithelial cells of the proximal tubule (PTEC are central in the development of kidney interstitial fibrosis. We combine the novel techniques of laser capture microdissection and multiplex-tandem PCR to identify and quantitate "real time" gene transcription profiles of purified PTEC isolated from human kidney biopsies that describe signaling pathways associated with this pathological fibrotic process. Our results: (i confirm previous in-vitro and animal model studies; kidney injury molecule-1 is up-regulated in patients with acute tubular injury, inflammation, neutrophil infiltration and a range of chronic disease diagnoses, (ii provide data to inform treatment; complement component 3 expression correlates with inflammation and acute tubular injury, (iii identify potential new biomarkers; proline 4-hydroxylase transcription is down-regulated and vimentin is up-regulated across kidney diseases, (iv describe previously unrecognized feedback mechanisms within PTEC; Smad-3 is down-regulated in many kidney diseases suggesting a possible negative feedback loop for TGF-β in the disease state, whilst tight junction protein-1 is up-regulated in many kidney diseases, suggesting feedback interactions with vimentin expression. These data demonstrate that the combined techniques of laser capture microdissection and multiplex-tandem PCR have the power to study molecular signaling within single cell populations derived from clinically sourced tissue.

  11. A Cytolethal Distending Toxin Gene-Based Multiplex PCR Assay for Campylobacter jejuni, C. fetus, C. coli, C. upsaliensis, C. hyointestinalis, and C. lari.

    Science.gov (United States)

    Kamei, Kazumasa; Kawabata, Hiroki; Asakura, Masahiro; Samosornsuk, Worada; Hinenoya, Atsushi; Nakagawa, Shinsaku; Yamasaki, Shinji

    2016-05-20

    In this study, we devised a multiplex PCR assay based on the gene of cytolethal distending toxin (cdt) B subunit to simultaneously detect and discriminate Campylobacter jejuni, C. fetus, C. coli, C. upsaliensis, C. hyointestinalis, and C. lari. Species-specific PCR products were successfully obtained from all 38 C. jejuni, 12 C. fetus, 39 C. coli, 22 C. upsaliensis, 24 C. hyointestinalis, and 7 C. lari strains tested. On the other hand, no specific PCR products were obtained from other campylobacters and bacterial species tested (41 strains in total). The proposed multiplex PCR assay is a valuable tool for detection and descrimination of 6 major Campylobacter species, that are associated with gastrointestinal diseases in humans.

  12. A Multiplex real-time PCR for detection of Mycoplasma gallisepticum and Mycoplasma synoviae in clinical samples from Brazilian commercial poultry flocks

    Directory of Open Access Journals (Sweden)

    Aline Padilha Fraga

    2013-01-01

    Full Text Available Mycoplasma gallisepticum (MS and Mycoplasma synoviae (MS are important avian pathogens and cause economic losses to the poultry industry. Molecular biology techniques are currently used for a rapid detection of these pathogens and the adoption of control measures of the diseases. The aim of this study was to develop and validate a technique for simultaneous detection of MG and MS by multiplex real time polymerase chain reaction (PCR. The complete assay (Multiplex MGMS was designed with primers and probes specific for each pathogen and developed to be carried out in a single tube reaction. Vaccines, MG and MS isolates and DNA from other Mycoplasma species were used for the development and validation of the method. Further, 78 pooled clinical samples from different poultry flocks in Brazil were obtained and used to determine the sensitivity and specificity of the technique in comparison to 2 real time PCR assays specific for MG (MG PCR and MS (MS PCR. The results demonstrated an agreement of 100% (23 positive and 44 negative samples between Multiplex MGMS and MG PCR in the analysis of 67 samples from MG positive and negative poultry flocks, and an agreement of 96.9% between Multiplex MGMS and MS PCR in the analysis of 64 samples from MS positive and negative poultry flocks. Considering the single amplification tests as the gold standard, the Multiplex MGMS showed 100% of specificity and sensitivity in the MG analysis and 94.7% sensitivity and 100% specificity in the MS analysis. This new assay could be used for rapid analysis of MG and MS in the poultry industry laboratories.

  13. Evaluation of a cytolethal distending toxin (cdt) gene-based species-specific multiplex PCR assay for the identification of Campylobacter strains isolated from diarrheal patients in Japan.

    Science.gov (United States)

    Kabir, S M Lutful; Kikuchi, Ken; Asakura, Masahiro; Shiramaru, Sachi; Tsuruoka, Naoki; Goto, Aeko; Hinenoya, Atsushi; Yamasaki, Shinji

    2011-01-01

    We have developed a cytolethal distending toxin (cdt) gene-based species-specific multiplex PCR assay for the detection and identification of Campylobacter jejuni, C. coli, and C. fetus. The applicability of this assay was evaluated with 325 Campylobacter strains isolated from diarrheal patients in Japan and the results were compared with those obtained by other genetic methods, including hipO gene detection and 16S rRNA gene sequencing. Of the 325 strains analyzed, 314 and 11 were identified as C. jejuni and C. coli, respectively, by combination of hipO gene detection and 16S rRNA gene sequencing. When the multiplex PCR assay was employed, 309, 310, and 314 strains were identified as C. jejuni on the basis of cdtA, cdtB, and cdtC gene-specific primers, respectively. Similarly, 11, 11, and 10 strains were identified as C. coli on the basis of cdtA, cdtB, and cdtC gene-specific primers, respectively. Sequence analysis of the cdt gene region of 6 strains (5 C. jejuni and 1 C. coli) which did not yield specific PCR products in any of the cdt gene-based multiplex PCR assays revealed deletions or mutations of the cdt genes. Pulsed-field gel electrophoresis indicated that C. jejuni and C. coli strains were genetically diverse. Taken together, these findings suggest that the cdtC gene-based multiplex PCR seems to be a particularly simple and rapid method for differentiating between species of Campylobacter strains, such as C. jejuni and C. coli. However, combination of these multiplex PCR assays will allow more accurate identification.

  14. Rapid and accurate identification of Mycobacterium tuberculosis complex and common non-tuberculous mycobacteria by multiplex real-time PCR targeting different housekeeping genes.

    Science.gov (United States)

    Nasr Esfahani, Bahram; Rezaei Yazdi, Hadi; Moghim, Sharareh; Ghasemian Safaei, Hajieh; Zarkesh Esfahani, Hamid

    2012-11-01

    Rapid and accurate identification of mycobacteria isolates from primary culture is important due to timely and appropriate antibiotic therapy. Conventional methods for identification of Mycobacterium species based on biochemical tests needs several weeks and may remain inconclusive. In this study, a novel multiplex real-time PCR was developed for rapid identification of Mycobacterium genus, Mycobacterium tuberculosis complex (MTC) and the most common non-tuberculosis mycobacteria species including M. abscessus, M. fortuitum, M. avium complex, M. kansasii, and the M. gordonae in three reaction tubes but under same PCR condition. Genetic targets for primer designing included the 16S rDNA gene, the dnaJ gene, the gyrB gene and internal transcribed spacer (ITS). Multiplex real-time PCR was setup with reference Mycobacterium strains and was subsequently tested with 66 clinical isolates. Results of multiplex real-time PCR were analyzed with melting curves and melting temperature (T (m)) of Mycobacterium genus, MTC, and each of non-tuberculosis Mycobacterium species were determined. Multiplex real-time PCR results were compared with amplification and sequencing of 16S-23S rDNA ITS for identification of Mycobacterium species. Sensitivity and specificity of designed primers were each 100 % for MTC, M. abscessus, M. fortuitum, M. avium complex, M. kansasii, and M. gordonae. Sensitivity and specificity of designed primer for genus Mycobacterium was 96 and 100 %, respectively. According to the obtained results, we conclude that this multiplex real-time PCR with melting curve analysis and these novel primers can be used for rapid and accurate identification of genus Mycobacterium, MTC, and the most common non-tuberculosis Mycobacterium species.

  15. Multiplex PCR provides a low-cost alternative to DNA probe methods for rapid identification of Mycobacterium avium and Mycobacterium intracellulare.

    OpenAIRE

    Cousins, D; Francis, B; Dawson, D

    1996-01-01

    A multiplex PCR designed to differentiate Mycobacterium tuberculosis complex organisms from M. avium and M. intracellulare was used to test 105 isolates identified by DNA probe methods as M. avium, M. intracellulare, or M. avium complex type X. The multiple PCR correctly identified 33 of 34 isolates identified by commercial probe methods as M. avium and all 51 isolates identified as M. intracellulare. The 20 isolates identified as M. avium complex type X by probe were identified as Mycobacter...

  16. Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number)

    OpenAIRE

    fatemeh, Dehghan; Reza, Zolfaghari Mohammad; Mohammad, Arjomandzadegan; Salomeh, Kalantari; Reza, Ahmari Gholam; Hossein, Sarmadian; Maryam, Sadrnia; Azam, Ahmadi; Mana, Shojapoor; Negin, Najarian; Reza, Kasravi Alii; Saeed, Falahat

    2014-01-01

    Objective: To analyse molecular detection of coliforms and shorten the time of PCR. Methods: Rapid detection of coliforms by amplification of lacZ and uidA genes in a multiplex PCR reaction was designed and performed in comparison with most probably number (MPN) method for 16 artificial and 101 field samples. The molecular method was also conducted on isolated coliforms from positive MPN samples; standard sample for verification of microbial method certificated reference material; isolated...

  17. Performance of the Real Fungus-ID kit based on multiplex RT-PCR assay for the rapid detection and identification of Trichophyton spp. and Microsporum spp. in clinical specimens with suspected dermatophyte infection.

    Science.gov (United States)

    Wang, H-Y; Kim, H; Choi, E H; Lee, H

    2016-01-01

    The aim of this study was to evaluate the performance of a commercially available multiplex RT-PCR assay for the rapid detection and identification of dermatophytes directly from clinical samples and cultures. The multiplex RT-PCR assay was used to evaluate 118 clinical isolates from various specimen types and a total of 140 known specimens were compared with both conventional methods, commercially available PCR-REBA, and ITS sequence analysis. In this study, multiplex RT-PCR assay yield significantly more positive results than culture (91·9 vs 39·5%) and conventional methods including KOH microscopy (91·9 vs 71·3%). Although the results among the multiplex RT-PCR, PCR-REBA and ITS sequence analysis were concordant (100%) in 118 clinical isolates, concordant results between multiplex RT-PCR assay and culture were at 66% (78/118). The overall positive rates for the PCR-REBA, multiplex RT-PCR assay and ITS sequence analysis were 98·8, 91·9, and 52·9% respectively. In addition, the concordance rate of multiplex RT-PCR assay and the PCR-REBA assay was 93% (95% confidence interval (CI), 89·9-96·1, P culture can take up to 2-3 weeks. The use of the multiplex RT-PCR molecular diagnostic assay was rapid and reliable for detecting pathogen infections. Even though the use of molecular diagnostic technology is more expensive than conventional methods, the clinical and economic benefit of saving time relative to expense remains to be elucidated. Therefore, the multiplex RT-PCR assay may provide the essential information to accelerate therapeutic decisions for earlier and adequate antibiotic treatment in the acute phase of fungal pathogen infections. © 2015 The Society for Applied Microbiology.

  18. Dataset of proinflammatory cytokine and cytokine receptor gene expression in rainbow trout (Oncorhynchus mykiss) measured using a novel GeXP multiplex, RT-PCR assay

    Science.gov (United States)

    A GeXP multiplex, RT-PCR assay was developed and optimized that simultaneously measures expression of a suite of immune-relevant genes in rainbow trout (Oncorhynchus mykiss), concentrating on tumor necrosis factor and interleukin-1 ligand/receptor systems and acute phase response genes. The dataset ...

  19. Development of a Multiplex PCR Method for Detection of the Genes Encoding 16S rRNA, Coagulase, Methicillin Resistance and Enterotoxins in Staphylococcus aureus

    Science.gov (United States)

    A multiplex PCR method was developed for simultaneous detection of the genes encoding methicillin resistance (mecA), staphylococcal enterotoxins A, B and C (sea, seb and sec), coagulase (coa) and 16S rRNA. The primers for amplification of the 16S rRNA gene were specific for Staphylococcus spp., and ...

  20. Identification of high-risk Listeria monocytogenes serotypes in lineage I (serotype 1/2a, 1/2c, 3a and 3c) using multiplex PCR

    Science.gov (United States)

    Aims: Using molecular subtyping techniques, Listeria monocytogenes is divided into three major phylogenetic lineages, and a multiplex PCR method can differentiate five L. monocytogenes subgroups: 1/2a-3a, 1/2c-3c, 1/2b-3b-7, 4b-4d-4e, and 4a-4c. In the current study, we conducted genome comparison...

  1. Multiplex PCR assays for simultaneous detection of six major serotypes and two virulence-associated phenotypes of Streptococcus suis in tonsillar specimens from pigs

    NARCIS (Netherlands)

    Wisselink, H.J.; Joosten, J.J.; Smith, H.E.

    2002-01-01

    Multiplex PCR assays for the detection and identification of various Streptococcus suis strains in tonsillar specimens from pigs were developed and evaluated. In two separate reactions, five distinct DNA targets were amplified. Three targets, based on the S. suis capsular polysaccharide (cps) genes

  2. Development of a multiplex TaqMan real-time PCR assay for the detection of Chlamydia psittaci and Chlamydia pneumoniae in human clinical specimens.

    Science.gov (United States)

    Wolff, Bernard J; Morrison, Shatavia S; Winchell, Jonas M

    2017-11-27

    Diagnosis of Chlamydia psittaci and Chlamydia pneumoniae infections has traditionally relied on serological assays. We developed a multiplex real-time PCR assay for detection of C. psittaci, C. pneumoniae and an internal control. Results of this assay demonstrated 100% concordance compared to results of previously tested human clinical specimens. Published by Elsevier Inc.

  3. Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number

    Directory of Open Access Journals (Sweden)

    Dehghan fatemeh

    2014-05-01

    Conclusions: Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN.

  4. A novel RT-multiplex PCR for detection of Aichi virus, human parechovirus, enteroviruses, and human bocavirus among infants and children with acute gastroenteritis.

    Science.gov (United States)

    Pham, Ngan Thi Kim; Trinh, Quang Duy; Chan-It, Wisoot; Khamrin, Pattara; Shimizu, Hideaki; Okitsu, Shoko; Mizuguchi, Masashi; Ushijima, Hiroshi

    2010-10-01

    A novel reverse transcription-multiplex polymerase chain reaction assay was developed to detect Aichi virus, human parechovirus, enteroviruses, and human bocavirus. A mixture of four pairs of published specific primers, 6261 and 6779, ev22(+) and ev22(-), F1 and R1, 188F and 542R, was used to amplify the viral genomes and specifically generate four different amplicon sizes of 519, 270, 440, and 354 bp for Aichi virus, human parechovirus, enteroviruses, and human bocavirus, respectively. A total of 247 fecal specimens previously screened for rotavirus, adenovirus, norovirus, sapovirus, and astrovirus-negative, collected from infants and children with acute gastroenteritis in Japan from July 2007 to June 2008, were tested further for the presence of the four viruses, Aichi virus, human parechovirus, enteroviruses, and human bocavirus, by RT-multiplex PCR. The total detection rate of these viruses was 26.7% (66 out of 247 samples). Of these, HPeV, EVs, and HBoV were identified in 20, 41, and 5 specimens. No Aichi virus was found among these subjects. The sensitivity and specificity of RT-multiplex PCR were assessed and demonstrated a strong validation against RT-monoplex PCR. This is the first report of detecting these types of viruses in fecal samples from infants and children with acute gastroenteritis by RT-multiplex PCR. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  5. Detection of Giardia lamblia, Cryptosporidium spp. and Entamoeba histolytica in clinical stool samples by using multiplex real-time PCR after automated DNA isolation

    NARCIS (Netherlands)

    Van Lint, P; Rossen, J W; Vermeiren, S; Ver Elst, K; Weekx, S; Van Schaeren, J; Jeurissen, A

    2013-01-01

    Diagnosis of intestinal parasites in stool samples is generally still carried out by microscopy; however, this technique is known to suffer from a low sensitivity and is unable to discriminate between certain protozoa. In order to overcome these limitations, a real-time multiplex PCR was evaluated

  6. Simultaneous detection of virulence factors from a colony in diarrheagenic Escherichia coli by a multiplex PCR assay with Alexa Fluor-labeled primers.

    Science.gov (United States)

    Kuwayama, Masaru; Shigemoto, Naoki; Oohara, Sachiko; Tanizawa, Yukie; Yamada, Hiroko; Takeda, Yoshihiro; Matsuo, Takeshi; Fukuda, Shinji

    2011-07-01

    We have developed simultaneous detection of eight genes associated with the five categories of diarrheagenic Escherichia coli by the multiplex PCR assay with Alexa Fluor-labeled primers. This assay can easily distinguish eight genes based on the size and color of amplified products without gel staining. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Evaluation of a Multiplex PCR Assay (Bruce-ladder) for Molecular Typing of All Brucella Species, Including the Vaccine Strains▿ †

    Science.gov (United States)

    López-Goñi, I.; García-Yoldi, D.; Marín, C. M.; de Miguel, M. J.; Muñoz, P. M.; Blasco, J. M.; Jacques, I.; Grayon, M.; Cloeckaert, A.; Ferreira, A. C.; Cardoso, R.; Corrêa de Sá, M. I.; Walravens, K.; Albert, D.; Garin-Bastuji, B.

    2008-01-01

    An evaluation of a multiplex PCR assay (Bruce-ladder) was performed in seven laboratories using 625 Brucella strains from different animal and geographical origins. This robust test can differentiate in a single step all of the classical Brucella species, including those found in marine mammals and the S19, RB51, and Rev.1 vaccine strains. PMID:18716225

  8. Multiplex PCR Study of Plasmid-Mediated AmpC Beta-Lactamases Genes in Clinical Isolates of Escherichia coli

    Directory of Open Access Journals (Sweden)

    Maryam Dehghani

    2017-02-01

    Full Text Available Background:   AmpC β-lactamases are important cephalosporinases chromosomally encoded in many of Enterobacteriaceae and a few other organisms where they mediate resistance to cephalothin, cefazolin, cefoxitin and penicillins. The six different families of plasmid-mediated AmpC β-lactamases have been described, but no phenotypic test can discriminate among them. AmpC multiplex PCR has been successfully used to discriminate plasmid-mediated ampC specific families in organisms such as Klebsiella pneumonia and Escherichia coli. The aim of this study was to indicate the prevalence of AmpC β-lactamase genes by specifically designed primers through PCR test.Methods:   243 total clinical urine samples were collected, and 227 isolates were identified as Escherichia coli based on standard biochemical tests. Subsequently, the isolates were screened by disc diffusion and combined disc test for β-lactamase production. Resistant isolates were evaluated by PCR for ampC family determination. Results:  Antibiotic resistance pattern were observed as follows: cefepime (%25, ceftazidime (%31, ceftriaxone (%37, cefotaxime (%38. The ratio of isolates was detected as ESBLs and AmpC producers were 34% and 5.2%, respectively. PCR performed on 12 selected isolates via phenotypic tests and the results revealed that among 12 isolates, 11 contained blaCMY-42. Conclusion:  Unfortunately, antibiotic resistance has become an increasingly critical problem in many countries like Iran and occurrence of isolates co-expressing AmpC-β-lactamases and ESBLs can create serious problems in the future. As antibiotic options in the treatment of AmpC β-lactamases and ESBLs producing organisms are extremely limited, molecular screening by laboratories is suggested to reduce the risk of therapeutic defeat.

  9. Clinical utility of an optimised multiplex real-time PCR assay for the identification of pathogens causing sepsis in Vietnamese patients.

    Science.gov (United States)

    Tat Trung, Ngo; Van Tong, Hoang; Lien, Tran Thi; Van Son, Trinh; Thanh Huyen, Tran Thi; Quyen, Dao Thanh; Hoan, Phan Quoc; Meyer, Christian G; Song, Le Huu

    2018-02-01

    For the identification of bacterial pathogens, blood culture is still the gold standard diagnostic method. However, several disadvantages apply to blood cultures, such as time and rather large volumes of blood sample required. We have previously established an optimised multiplex real-time PCR method in order to diagnose bloodstream infections. In the present study, we evaluated the diagnostic performance of this optimised multiplex RT-PCR in blood samples collected from 110 septicaemia patients enrolled at the 108 Military Central Hospital, Hanoi, Vietnam. Positive results were obtained by blood culture, the Light Cylcler-based SeptiFast ® assay and our multiplex RT-PCR in 35 (32%), 31 (28%), and 31 (28%) samples, respectively. Combined use of the three methods confirmed 50 (45.5%) positive cases of bloodstream infection, a rate significantly higher compared to the exclusive use of one of the three methods (P=0.052, 0.012 and 0.012, respectively). The sensitivity, specificity and area under the curve (AUC) of our assay were higher compared to that of the SeptiFast ® assay (77.4%, 86.1% and 0.8 vs. 67.7%, 82.3% and 0.73, respectively). Combined use of blood culture and multiplex RT-PCR assay showed a superior diagnostic performance, as the sensitivity, specificity, and AUC reached 83.3%, 100%, and 0.95, respectively. The concordance between blood culture and the multiplex RT-PCR assay was highest for Klebsiella pneumonia (100%), followed by Streptococcus spp. (77.8%), Escherichia coli (66.7%), Staphylococcus spp. (50%) and Salmonella spp. (50%). In addition, the use of the newly established multiplex RT-PCR assay increased the spectrum of identifiable agents (Acintobacter baumannii, 1/32; Proteus mirabilis, 1/32). The combination of culture and the multiplex RT-PCR assay provided an excellent diagnostic accomplishment and significantly supported the identification of causative pathogens in clinical samples obtained from septic patients. Copyright © 2017 The

  10. A Multiplexed, Probe-Based Quantitative PCR Assay for DNA of Phytophthora sojae

    Science.gov (United States)

    Phytophthora sojae (Kaufm. & Gerd.) causes seed rot, pre- and post-emergence damping off, and sometimes foliar blight in soybean (Glycine max). Crop loss may approach 100% with susceptible cultivars. We report here the development of a unique quantitative PCR assay specific to DNA of P. sojae, and a...

  11. Multiplex one-step Real-time PCR by Taqman-MGB method for rapid detection of pan and H5 subtype avian influenza viruses.

    Directory of Open Access Journals (Sweden)

    Zhujun Zhang

    Full Text Available Avian influenza virus (AIV can infect a variety of avian species and mammals, leading to severe economic losses in poultry industry and posing a substantial threat to public health. Currently, traditional virus isolation and identification is inadequate for the early diagnosis because of its labor-intensive and time-consuming features. Real-time RT-PCR (RRT-PCR is an ideal method for the detection of AIV since it is highly specific, sensitive and rapid. In addition, as the new quencher MGB is used in RRT-PCR, it only needs shorter probe and helps the binding of target gene and probe. In this study, a pan-AIV RRT-PCR for the detection of all AIVs and H5-AIV RRT-PCR for detection of H5 AIV based on NP gene of AIV and HA gene of H5 AIV were successfully established using Taqman-MGB method. We tested 14 AIV strains in total and the results showed that the pan-AIV RRT-PCR can detect AIV of various HA subtypes and the H5-AIV RRT-PCR can detect H5 AIV circulating in poultry in China in recent three years, including H5 viruses of clade 7.2, clade 2.3.4.4 and clade 2.3.2.1. Furthermore, the multiplex detection limit for pan-AIV and H5-AIV RRT-PCR was 5 copies per reaction. When this multiplex method was applied in the detection of experimental and live poultry market samples, the detection rates of pan-AIV and H5 AIV in RRT-PCR were both higher than the routine virus isolation method with embryonated chicken eggs. The multiplex RRT-PCR method established in our study showed high sensitivity, reproducibility and specificity, suggesting the promising application of our method for surveillance of both pan AIV and prevalent H5 AIV in live poultry markets and clinical samples.

  12. Simple, multiplexed, PCR-based barcoding of DNA enables sensitive mutation detection in liquid biopsies using sequencing.

    Science.gov (United States)

    Ståhlberg, Anders; Krzyzanowski, Paul M; Jackson, Jennifer B; Egyud, Matthew; Stein, Lincoln; Godfrey, Tony E

    2016-06-20

    Detection of cell-free DNA in liquid biopsies offers great potential for use in non-invasive prenatal testing and as a cancer biomarker. Fetal and tumor DNA fractions however can be extremely low in these samples and ultra-sensitive methods are required for their detection. Here, we report an extremely simple and fast method for introduction of barcodes into DNA libraries made from 5 ng of DNA. Barcoded adapter primers are designed with an oligonucleotide hairpin structure to protect the molecular barcodes during the first rounds of polymerase chain reaction (PCR) and prevent them from participating in mis-priming events. Our approach enables high-level multiplexing and next-generation sequencing library construction with flexible library content. We show that uniform libraries of 1-, 5-, 13- and 31-plex can be generated. Utilizing the barcodes to generate consensus reads for each original DNA molecule reduces background sequencing noise and allows detection of variant alleles below 0.1% frequency in clonal cell line DNA and in cell-free plasma DNA. Thus, our approach bridges the gap between the highly sensitive but specific capabilities of digital PCR, which only allows a limited number of variants to be analyzed, with the broad target capability of next-generation sequencing which traditionally lacks the sensitivity to detect rare variants. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Development and Application of a Multiplex Real-Time PCR Assay as an Indicator of Potential Allergenicity in Citrus Fruits.

    Science.gov (United States)

    Wu, Jinlong; Chen, Lin; Lin, Dingbo; Ma, Zhaocheng; Deng, Xiuxin

    2016-11-30

    The effects of tissue type, harvest maturity, and genetic factors on the expression of genes that related to citrus fruit allergies remain poorly understood. In the present study, a multiplex real-time PCR assay was developed to monitor the expression of citrus allergen genes individually with the advantages of much fewer sample requirements and simultaneously multiple target genes detection. Gene specific primer pairs and Taqman probes of three citrus allergen genes Cit s 1.01, Cit s 2.01, and Cit s 3.01 and the house-keeping gene β-actin were designed based on gene sequence differences. The PCR results showed that differential expression patterns were found during the ripening process. The expression levels of Cit s 3.01 were much higher than those of Cit s 1.01 and Cit s 2.01 in both peel and pulp tissues among 10 citrus cultivars. Data suggested that Kao Phuang Pummelo could be safely consumed with a potential low risk in allergenicity. Considering that assessing allergenicity is one of the tests in food safety, this assay might also facilitate the breeding and production of "allergy-friendly" citrus fruits.

  14. Development of a Multiplex Real-Time PCR for Determination of Apricot in Marzipan Using the Plexor System.

    Science.gov (United States)

    Schelm, Stefanie; Haase, Ilka; Fischer, Christin; Fischer, Markus

    2017-01-18

    Marzipan is a confectionary which is mostly offered in form of filled chocolate, pralines, or pure. According to the German guidelines for oil seeds only almonds, sugar and water are admitted ingredients of marzipan. A product very similar in taste is persipan which is used in the confectionary industry because of its stronger flavor. For persipan production almonds are replaced by debittered apricot or peach kernels. To guarantee high quality products for consumers, German raw paste producers have agreed a limit of apricot kernels in marzipan raw paste of 0.5%. Different DNA-based methods for quantitation of persipan contaminations in marzipan are already published. To increase the detection specificity compared to published intercalation dye-based assays, the present work demonstrate the utilization of a multiplex real-time PCR based on the Plexor technology. Thus, the present work enables the detection of at least 0.1% apricot DNA in almond DNA or less. By analyzing DNA mixtures, the theoretical limit of quantification of the duplex PCR for the quantitation of persipan raw paste DNA in marzipan raw paste DNA was determined as 0.05%.

  15. Detection and identification of Salmonella species in minced beef and chicken meats by using Multiplex PCR in Assiut city

    Directory of Open Access Journals (Sweden)

    Raafat Hassanein

    2011-02-01

    Full Text Available The present study was undertaken to determine the incidence and distribution of Salmonella species in selected meat and chicken products purchased from retail supermarkets in Assiut, Egypt. A total of 75 samples including 25 samples each of minced frozen beef, frozen chicken legs and frozen chicken fillets were collected over a 7-month period between January and July 2009 and examined for the presence of Salmonella species. In addition, 28 children stool cultures were collected from hospitalized children resident in Pediatric University Hospital with diarrhea or fever. Out of the total 75 meat samples examined, Salmonella was detected in 5 (20% of minced frozen beef, 9 (36% of frozen chicken leg and 13 (52% of frozen chicken fillet samples analyzed. Regarding the examined 28 children stool cultures, 3 (10.71 % were found Salmonella positive. Of the total 30 Salmonella positive samples from all examined samples, five selected Salmonella isolates were further identified using multiplex PCR (m-PCR. Two serovars were the dominant serovar identified was Salmonella entrica subsp. entrica serovar Enteritidis (2 chicken leg isolates and 2 chicken breast fillets followed by Salmonella entrica subsp. entrica serovar Kentucky (one minced beef isolate. The public health hazards of Salmonella were discussed and the suggestive measures to protect the consumers and improve the quality of meat and chicken products were given. [Veterinary World 2011; 4(1.000: 5-11

  16. Detection of Salmonella spp, Salmonella Enteritidis and Typhimurium in naturally infected broiler chickens by a multiplex PCR-based assay

    Directory of Open Access Journals (Sweden)

    F.G. Paião

    2013-01-01

    Full Text Available The presence of Salmonella in the intestinal tract, on the chickens skin and among their feathers, may cause carcasses contamination during slaughtering and processing and possibly it is responsible by the introduction of this microorganism in the slaughterhouses. A rapid method to identify and monitor Salmonella and their sorovars in farm is becoming necessary. A pre-enriched multiplex polymerase chain reaction (m-PCR assay employing specific primers was developed and used to detect Salmonella at the genus level and to identify the Salmonella enterica serovar Enteritidis (S. Enteritidis and Salmonella enterica serovar Typhimurium (S. Typhimurium in broiler chicken swab samples. The method was validated by testing DNA extract from 90 fresh culture cloacal swab samples from poultry chicken cultured in phosphate buffer peptone water at 37 ºC for 18 h. The final results showed the presence of Salmonella spp. in 25% of samples, S. Enteritidis was present in 12% of the Salmonella-positive samples and S. Typhimurium in 3% of the samples. The m-PCR assay developed in this study is a specific and rapid alternative method for the identification of Salmonella spp. and allowed the observation of specific serovar contamination in the field conditions within the locations where these chickens are typically raised.

  17. Detection of Salmonella spp, Salmonella Enteritidis and Typhimurium in naturally infected broiler chickens by a multiplex PCR-based assay.

    Science.gov (United States)

    Paião, F G; Arisitides, L G A; Murate, L S; Vilas-Bôas, G T; Vilas-Boas, L A; Shimokomaki, M

    2013-01-01

    The presence of Salmonella in the intestinal tract, on the chickens skin and among their feathers, may cause carcasses contamination during slaughtering and processing and possibly it is responsible by the introduction of this microorganism in the slaughterhouses. A rapid method to identify and monitor Salmonella and their sorovars in farm is becoming necessary. A pre-enriched multiplex polymerase chain reaction (m-PCR) assay employing specific primers was developed and used to detect Salmonella at the genus level and to identify the Salmonella enterica serovar Enteritidis (S. Enteritidis) and Salmonella enterica serovar Typhimurium (S. Typhimurium) in broiler chicken swab samples. The method was validated by testing DNA extract from 90 fresh culture cloacal swab samples from poultry chicken cultured in phosphate buffer peptone water at 37 °C for 18 h. The final results showed the presence of Salmonella spp. in 25% of samples, S. Enteritidis was present in 12% of the Salmonella-positive samples and S. Typhimurium in 3% of the samples. The m-PCR assay developed in this study is a specific and rapid alternative method for the identification of Salmonella spp. and allowed the observation of specific serovar contamination in the field conditions within the locations where these chickens are typically raised.

  18. Clinical Relevance of Pathogens Detected by Multiplex PCR in Blood of Very-Low-Birth Weight Infants with Suspected Sepsis - Multicentre Study of the German Neonatal Network.

    Science.gov (United States)

    Tröger, Birte; Härtel, Christoph; Buer, Jan; Dördelmann, Michael; Felderhoff-Müser, Ursula; Höhn, Thomas; Hepping, Nico; Hillebrand, Georg; Kribs, Angela; Marissen, Janina; Olbertz, Dirk; Rath, Peter-Michael; Schmidtke, Susanne; Siegel, Jens; Herting, Egbert; Göpel, Wolfgang; Steinmann, Joerg; Stein, Anja

    2016-01-01

    In the German Neonatal Network (GNN) 10% of very-low-birth weight infants (VLBWI) suffer from blood-culture confirmed sepsis, while 30% of VLBWI develop clinical sepsis. Diagnosis of sepsis is a difficult task leading to potential over-treatment with antibiotics. This study aims to investigate whether the results of blood multiplex-PCR (SeptiFast®) for common sepsis pathogens are relevant for clinical decision making when sepsis is suspected in VLBWI. We performed a prospective, multi-centre study within the GNN including 133 VLBWI with 214 episodes of suspected late onset sepsis (LOS). In patients with suspected sepsis a multiplex-PCR (LightCycler SeptiFast MGRADE-test®) was performed from 100 μl EDTA blood in addition to center-specific laboratory biomarkers. The attending neonatologist documented whether the PCR-result, which was available after 24 to 48 hrs, had an impact on the choice of antibiotic drugs and duration of therapy. PCR was positive in 110/214 episodes (51%) and blood culture (BC) was positive in 55 episodes (26%). Both methods yielded predominantly coagulase-negative staphylococci (CoNS) followed by Escherichia coli and Staphylococcus aureus. In 214 BC-PCR paired samples concordant results were documented in 126 episodes (59%; n = 32 were concordant pathogen positive results, n = 94 were negative in both methods). In 65 episodes (30%) we found positive PCR results but negative BCs, with CoNS being identified in 43 (66%) of these samples. Multiplex-PCR results influenced clinical decision making in 30% of episodes, specifically in 18% for the choice of antimicrobial therapy and in 22% for the duration of antimicrobial therapy. Multiplex-PCR results had a moderate impact on clinical management in about one third of LOS-episodes. The main advantage of multiplex-PCR was the rapid detection of pathogens from micro-volume blood samples. In VLBWI limitations include risk of contamination, lack of resistance testing and high costs. The high rate of

  19. Simple and highly discriminatory VNTR-based multiplex PCR for tracing sources of Aspergillus flavus isolates.

    Directory of Open Access Journals (Sweden)

    Dong Ying Wang

    Full Text Available Aspergillus flavus is second only to A. fumigatus in causing invasive aspergillosis and it is the major agent responsible for fungal sinusitis, keratitis and endophthalmitis in many countries in the Middle East, Africa and Southeast Asia. Despite the growing challenge due to A. flavus, data on the molecular epidemiology of this fungus remain scarce. The objective of the present study was to develop a new typing method based on the detection of VNTR (Variable number tandem repeat markers. Eight VNTR markers located on 6 different chromosomes (1, 2, 3, 5, 7 and 8 of A. flavus were selected, combined by pairs for multiplex amplifications and tested on 30 unrelated isolates and six reference strains. The Simpson index for individual markers ranged from 0.398 to 0.818. A combined loci index calculated with all the markers yielded an index of 0.998. The MLVA (Multiple Locus VNTR Analysis technique proved to be specific and reproducible. In a second time, a total of 55 isolates from Chinese avian farms and from a Tunisian hospital have been evaluated. One major cluster of genotypes could be defined by using the graphing algorithm termed Minimum Spanning Tree. This cluster comprised most of the isolates collected in an avian farm in southern China. The MLVA technique should be considered as an excellent and cost-effective typing method that could be used in many laboratories without the need for sophisticated equipment.

  20. Multiplex qPCR for reliable detection and differentiation of Burkholderia mallei and Burkholderia pseudomallei

    Directory of Open Access Journals (Sweden)

    Janse Ingmar

    2013-02-01

    Full Text Available Abstract Background Burkholderia mallei and B. pseudomallei are two closely related species of highly virulent bacteria that can be difficult to detect. Pathogenic Burkholderia are endemic in many regions worldwide and cases of infection, sometimes brought by travelers from unsuspected regions, also occur elsewhere. Rapid, sensitive methods for identification of B. mallei and B. pseudomallei are urgently needed in the interests of patient treatment and epidemiological surveillance. Methods Signature sequences for sensitive, specific detection of pathogenic Burkholderia based on published genomes were identified and a qPCR assay was designed and validated. Results A single-reaction quadruplex qPCR assay for the detection of pathogenic Burkholderia, which includes a marker for internal control of DNA extraction and amplification, was developed. The assay permits differentiation of B. mallei and B. pseudomallei strains, and probit analysis showed a very low detection limit. Use of a multicopy signature sequence permits detection of less than 1 genome equivalent per reaction. Conclusions The new assay permits rapid detection of pathogenic Burkholderia and combines enhanced sensitivity, species differentiation, and inclusion of an internal control for both DNA extraction and PCR amplification.

  1. Multiplex qPCR for reliable detection and differentiation of Burkholderia mallei and Burkholderia pseudomallei.

    Science.gov (United States)

    Janse, Ingmar; Hamidjaja, Raditijo A; Hendriks, Amber C A; van Rotterdam, Bart J

    2013-02-14

    Burkholderia mallei and B. pseudomallei are two closely related species of highly virulent bacteria that can be difficult to detect. Pathogenic Burkholderia are endemic in many regions worldwide and cases of infection, sometimes brought by travelers from unsuspected regions, also occur elsewhere. Rapid, sensitive methods for identification of B. mallei and B. pseudomallei are urgently needed in the interests of patient treatment and epidemiological surveillance. Signature sequences for sensitive, specific detection of pathogenic Burkholderia based on published genomes were identified and a qPCR assay was designed and validated. A single-reaction quadruplex qPCR assay for the detection of pathogenic Burkholderia, which includes a marker for internal control of DNA extraction and amplification, was developed. The assay permits differentiation of B. mallei and B. pseudomallei strains, and probit analysis showed a very low detection limit. Use of a multicopy signature sequence permits detection of less than 1 genome equivalent per reaction. The new assay permits rapid detection of pathogenic Burkholderia and combines enhanced sensitivity, species differentiation, and inclusion of an internal control for both DNA extraction and PCR amplification.

  2. Epidemiological survey on Mycoplasma gallisepticum and M. synoviae by multiplex PCR in commercial poultry Investigação epidemiológica de Mycoplasma gallisepticum e M. synoviae por PCR Multiplex em estabelecimentos comerciais de aves

    Directory of Open Access Journals (Sweden)

    Marcos Roberto Buim

    2009-07-01

    Full Text Available Mycoplasmas are important avian pathogens, which cause respiratory and joint diseases that result in large economic losses in Brazilian and world-wide poultry industry. This investigation regarding the main species of mycoplasmas, Mycoplasma gallisepticum (MG and M. synoviae (MS, responsible for the above mentioned conditions, was carried out through PCR Multiplex analysis. One thousand and forty-six (1,046 samples of tracheal swabs and piped embryos were collected from 33 farms with laying hens, breeders, broilers or hatchery, located in the Brazilian states of São Paulo, Paraná and Pernambuco, where respiratory problems or drops in egg production had occurred. The MG and MS prevalence on the farms was 72.7%. These results indicated (1 high dissemination of mycoplasmas in the evaluated farms, with predominance of MS, either as single infectious agent or associated with other mycoplasmas in 20 farms (60.6%, and (2 an increase of MS and decrease of MG infection in Brazilian commercial poultry.Os Micoplasmas são importantes patógenos aviários que causam doenças respiratórias e de articulações que resultam em grandes perdas econômicas para a indústria avícola brasileira e mundial. O estudo das principais espécies de Mycoplasma, Mycoplasma gallisepticum (MG e M. synoviae (MS, responsáveis pelas doenças mencionadas acima, foram analisadas pela técnica de PCR Multiplex. Foram colhidas 1046 amostras de suabe traqueal e embriões bicados de 33 estabelecimentos de aves de postura, matrizes, frangos de corte e um incubatório, localizados nos Estados brasileiros de São Paulo, Paraná e Pernambuco, as quais apresentavam problemas respiratórios ou queda na produção de ovos. A prevalência de MS e MG nas granjas foi de 72,7%. Os resultados indicaram uma alta disseminação de Mycoplasma nas granjas avaliadas, com predominância de MS, como um único agente infeccioso ou associado com outros micoplasmas em 20 granjas (60,6%. Assim, este

  3. Development of genomic microsatellite multiplex PCR using dye-labeled universal primer and its validation in pedigree analysis of Pacific oyster ( Crassostrea gigas)

    Science.gov (United States)

    Liu, Ting; Li, Qi; Song, Junlin; Yu, Hong

    2017-02-01

    There is an increasing requirement for traceability of aquaculture products, both for consumer protection and for food safety. There are high error rates in the conventional traceability systems depending on physical labels. Genetic traceability technique depending on DNA-based tracking system can overcome this problem. Genealogy information is essential for genetic traceability, and microsatellite DNA marker is a good choice for pedigree analysis. As increasing genotyping throughput of microsatellites, microsatellite multiplex PCR has become a fast and cost-effective technique. As a commercially important cultured aquatic species, Pacific oyster Crassostrea gigas has the highest global production. The objective of this study was to develop microsatellite multiplex PCR panels with dye-labeled universal primer for pedigree analysis in C. gigas, and these multiplex PCRs were validated using 12 full-sib families with known pedigrees. Here we developed six informative multiplex PCRs using 18 genomic microsatellites in C. gigas. Each multiplex panel contained a single universal primer M13(-21) used as a tail on each locus-specific forward primer and a single universal primer M13(-21) labeled with fluorophores. The polymorphisms of the markers were moderate, with an average of 10.3 alleles per locus and average polymorphic information content of 0.740. The observed heterozygosity per locus ranged from 0.492 to 0.822. Cervus simulations revealed that the six panels would still be of great value when massive families were analysed. Pedigree analysis of real offspring demonstrated that 100% of the offspring were unambiguously allocated to their parents when two multiplex PCRs were used. The six sets of multiplex PCRs can be an important tool for tracing cultured individuals, population genetic analysis, and selective breeding program in C. gigas.

  4. Simultaneous Screening of 24 Target Genes of Foodborne Pathogens in 35 Foodborne Outbreaks Using Multiplex Real-Time SYBR Green PCR Analysis

    Directory of Open Access Journals (Sweden)

    Hiroshi Fukushima

    2010-01-01

    Full Text Available A set of 8 multiplex real-time SYBR Green PCR (SG-PCR assays including 3 target primers and an internal amplification control (IAC primer was simultaneously evaluated in 3 h or less with regard to detection of 24 target genes of 23 foodborne pathogens in 7 stool specimens of foodborne outbreak using a 96-well reaction plate. This assay, combined with DNA extraction (QIAamp DNA Stool Mini kit, offered detection of greater than 103-104 foodborne pathogens per g in stool specimens. The products formed were identified using melting point temperature (Tm curve analysis. This assay was evaluated for the detection of foodborne pathogens in 33 out of 35 cases of foodborne outbreak, using 4 different PCR instruments in 5 different laboratories. No interference from the multiplex real-time SG-PCR assay, including IAC, was observed in stool specimens in any analysis. We found multiplex real-time SG-PCR assay for simultaneous detection of 24 target genes of foodborne pathogens to be comprehensive, rapid, inexpensive, accurate, of high selectivity, and good for screening probability.

  5. Comparison of the BAX System with a multiplex PCR method for simultaneous detection and identification of Campylobacter jejuni and Campylobacter coli in environmental samples.

    Science.gov (United States)

    Manfreda, Gerardo; De Cesare, Alessandra; Bondioli, Valentina; Franchini, Achille

    2003-11-01

    The Campylobacter detection is performed by conventional culture methods and the identification of Campylobacter jejuni and Campylobacter coli is principally based on the hippurate hydrolysis test. The two major drawbacks of this biochemical test for species identification include the inconsistency of the results and the presence of atypical strains, which can lead to the misidentification of an isolate. As an alternative, multiplex polymerase chain reaction (mPCR) protocols for the simultaneous detection and identification of different Campylobacter species have been developed. This study examined the performances of an experimental BAX System assay for the C. jejuni and C. coli identification in comparison to a multiplex PCR protocol recently published. The samples tested were represented by 106 environmental swabs collected on Teflon strips and tables, stainless steel saws, hooks and trays, ceramic floors and walls, as well as equipment surfaces, located in a swine (N=50) and a poultry (N=56) slaughterhouse. The highest Campylobacter detection rate was obtained after 48 h of enrichment by using both the PCR procedures. After 24 h, the BAX System provides a more rapid and accurate Campylobacter detection and identification assay than the multiplex PCR. Except for two samples, all the broths where Campylobacter cells were detected after 24 or 48 h of enrichment, with at least one of the PCR protocols, gave Campylobacter colonies using the culture method.

  6. Comparison of the EntericBio multiplex PCR system with routine culture for detection of bacterial enteric pathogens.

    LENUS (Irish Health Repository)

    O'Leary, James

    2009-11-01

    The EntericBio system uses a multiplex PCR assay for the simultaneous detection of Campylobacter spp., Salmonella enterica, Shigella spp., and Escherichia coli O157 from feces. It combines overnight broth enrichment with PCR amplification and detection by hybridization. An evaluation of this system was conducted by comparing the results obtained with the system with those obtained by routine culture, supplemented with alternative PCR detection methods. In a study of 773 samples, routine culture and the EntericBio system yielded 94.6 and 92.4% negative results, respectively. Forty-two samples had positive results by culture, and all of these were positive with the EntericBio system. This system detected an additional 17 positive samples (Campylobacter spp., n = 12; Shigella spp., n = 1; E. coli O157, n = 4), but the results for 5 samples (Campylobacter spp., n = 2; Shigella spp., n = 1; E. coli O157, n = 2) could not be confirmed. The target for Shigella spp. detected by the EntericBio system is the ipaH gene, and the molecular indication of the presence of Shigella spp. was investigated by sequence analysis, which confirmed that the ipaH gene was present in a Klebsiella pneumoniae isolate from the patient. The sensitivity, specificity, positive predictive value, and negative predictive value were 100%, 99.3%, 91.5%, and 100%, respectively. Turnaround times were significantly reduced with the EntericBio system, and a result was available between 24 and 32 h after receipt of the sample in the laboratory. In addition, the amount of laboratory waste was significantly reduced by use of this system. In summary, the EntericBio system proved convenient to use, more sensitive than the conventional culture used in this study, and highly specific; and it generated results significantly faster than routine culture for the pathogens tested.

  7. Multiplex PCR system for the rapid diagnosis of respiratory virus infection: systematic review and meta-analysis.

    Science.gov (United States)

    Huang, H-S; Tsai, C-L; Chang, J; Hsu, T-C; Lin, S; Lee, C-C

    2017-12-05

    To provide a summary of evidence for the diagnostic accuracies of three multiplex PCR systems (mPCRs)-BioFire FilmArray RP (FilmArray), Nanosphere Verigene RV+ test (Verigene RV+) and Hologic Gen-Probe Prodesse assays-on the detection of viral respiratory infections. A comprehensive search up to 1 July 2017 was conducted on Medline and Embase for studies that utilized FilmArray, Verigene RV+ and Prodesse for diagnosis of viral respiratory infections. A summary of diagnostic accuracies for the following five viruses were calculated: influenza A virus (FluA), influenza B virus, respiratory syncytial virus, human metapneumovirus and adenovirus. Hierarchical summary receiver operating curves were used for estimating the viral detection performance per assay. Twenty studies of 5510 patient samples were eligible for analysis. Multiplex PCRs demonstrated high diagnostic accuracy, with area under the receiver operating characteristic curve (AUROC) equal to or more than 0.98 for all the above viruses except for adenovirus (AUROC 0.89). FilmArray, Verigene RV+ and ProFlu+ (the only Prodesse assay with enough data) demonstrated a summary sensitivity for FluA of 0.911 (95% confidence interval, 0.848-0.949), 0.949 (95% confidence interval, 0.882-0.979) and 0.954 (95% confidence interval, 0.871-0.985), respectively. The three mPCRs were comparable in terms of detection of FluA. Point estimates calculated from eligible studies showed that the three mPCRs (FilmArray, Verigene RV+ and ProFlu+) are highly accurate and may provide important diagnostic information for early identification of respiratory virus infections. In patients with low pretest probability for FluA, these three mPCRs can predict a low possibility of infection and may justify withholding empirical antiviral treatments. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  8. Empirical evaluation of humpback whale telomere length estimates; quality control and factors causing variability in the singleplex and multiplex qPCR methods

    DEFF Research Database (Denmark)

    Olsen, Morten Tange; Bérubé, Martine; Robbins, Jooke

    2012-01-01

    steps of qPCR. In order to evaluate the utility of the qPCR method for telomere length estimation in non-model species, we carried out four different qPCR assays directed at humpback whale telomeres, and subsequently performed a rigorous quality control to evaluate the performance of each assay. RESULTS......:Performance differed substantially among assays and only one assay was found useful for telomere length estimation in humpback whales. The most notable factors causing these inter-assay differences were primer design and choice of using singleplex or multiplex assays. Inferred amplification efficiencies differed by up...

  9. Development of Multiplex PCR for Simultaneous Detection of Citrus Viruses and the Incidence of Citrus Viral Diseases in Late-Maturity Citrus Trees in Jeju Island

    Science.gov (United States)

    Hyun, Jae Wook; Hwang, Rok Yeon; Jung, Kyung Eun

    2017-01-01

    Satsuma dwarf virus (SDV) or Citrus mosaic sadwavirus (CiMV) were not consistently detected in RT-PCR assay with the primer sets based on gene of Japan isolates. SDV and CiMV isolates were distinctively divided into two groups based on phylogenetic analysis of PP2 gene cloned from 22 Korean isolates, and the Korean CiMV and SDV isolates shared 95.5–96.2% and 97.1–97.7% sequence identity with Japanese isolate, respectively. We developed PP2-1 primer set based on the PP2 gene sequence of Korean isolates to simultaneously and effectively detect SDV and CiMV. And CTLV-2013 and CTV-po primer sets were newly designed for detection of Citrus tatter leaf virus (CTLV) and Citrus tristeza virus (CTV), respectively. Using these primer sets, a new multiplex PCR assay was developed as a means to simultaneously detect 4 citrus viruses, CTV, CTLV, SDV, and CiMV. The degree of detection by the multiplex PCR were consistent with those of uniplex RT-PCR for detection of each of the viruses. Therefore, the new multiplex PCR provides an efficient method for detecting 4 citrus viruses, which will help diagnose many citrus plants at the same time. We verified that 35.2% and 72.1% of 775 trees in 155 orchards were infected with SDV or CiMV (SDV/CiMV) and CTV by the multiplex-PCR assay, respectively, and CTLV was not detected in any of the trees tested. PMID:28592949

  10. Is Follow-Up Testing with the FilmArray Gastrointestinal Multiplex PCR Panel Necessary?

    Science.gov (United States)

    Park, Sholhui; Hitchcock, Matthew M; Gomez, Carlos A; Banaei, Niaz

    2017-04-01

    The FilmArray gastrointestinal (GI) panel (BioFire Diagnostics, Salt Lake City, UT) is a simple, sample-to-answer, on-demand, multiplex, nucleic acid amplification test for syndromic diagnosis of infectious gastroenteritis. The aim of this study was to measure the yield of follow-up testing with FilmArray GI panel within 4 weeks of an initial test. Consecutive adult and pediatric patients tested at an academic institution between August 2015 and June 2016 were included in this study. Of 145 follow-up tests in 106 unique patients with an initial negative result, 134 (92.4%) tests and 98 (92.5%) patients remained negative upon follow-up testing. Excluding targets that are not reported at this institution ( Clostridium difficile , enteroaggregative Escherichia coli , enteropathogenic E. coli , and enterotoxigenic E. coli ), 137 (94.5%) follow-up tests and 101 (95.3%) patients remained negative. Weekly conversion rates were not significantly different across the 4-week follow-up interval. No epidemiological or clinical factors were significantly associated with a negative to positive conversion. Of 80 follow-up tests in patients with an initial positive result, 43 (53.8%) remained positive for the same target, 34 (42.5%) were negative, and 3 were positive for a different target (3.8%). Follow-up testing with FilmArray GI panel within 4 weeks of a negative result rarely changed the initial result, and the follow-up test reverted to negative less than half the time after an initial positive result. In the absence of clinical or epidemiological evidence for a new infection, follow-up testing should be limited and FilmArray GI panel should not be used as a test of cure. Copyright © 2017 American Society for Microbiology.

  11. Detection of Salmonella in Shellfish Using SYBR Green™ I-Based Real-Time Multiplexed PCR Assay Targeting invA and spvB

    KAUST Repository

    Gangwar, Maulshree

    2012-09-23

    A SYBR Green™ I-based real-time multiplexed PCR assay was developed targeting invA and spvB for the detection of Salmonella strains in shellfish after both hns and invA genes were identified in all Salmonella strains. Simultaneously, the 16S rRNA gene was used as a PCR internal amplification control (IAC). All 89 Salmonella strains tested in this study exhibited amplification of invA, whereas only 21 (23. 6 %) were PCR positive for spvB. The sensitivity of detection of all three targeted genes was 1 ng, which is equivalent to approximately 105 colony-forming unit (CFU) of Salmonella enterica. The analysis showed specific PCR products that were identified by reproducible melt temperature profiles (invA, 84. 27 ± 1. 7 °C; spvB, 88. 76 ± 1. 0 °C; and 16S rRNA gene, 87. 16 ± 0. 8 °C). The sensitivity of detection was 10 pg purified DNA (invA) or 105 CFU in 1 mL pure culture of S. enterica ATCC 14028. The above molecular detection method for Salmonella strains was successfully applied to the oyster homogenates (food matrix). An initial inoculum of 106 and 102 CFU Salmonella in 1 ml seeded oyster tissue homogenate was detected by multiplexed PCR for all three genes after 5 and 24 h of enrichment, respectively. Natural oysters isolated from Gulf of Mexico during the winter months exhibited negative PCR amplification results suggesting the absence of Salmonella. In contrast to conventional PCR, real-time multiplex PCR assay developed in this study is rapid and sensitive and will help Interstate Shellfish Sanitation Conference undertake appropriate measures to monitor Salmonella in oysters, thereby preventing disease outbreaks and consequently protecting consumer health. © 2012 Springer Science+Business Media, LLC.

  12. A novel lab-on-chip platform with integrated solid phase PCR and Supercritical Angle Fluorescence (SAF) microlens array for highly sensitive and multiplexed pathogen detection.

    Science.gov (United States)

    Hung, Tran Quang; Chin, Wai Hoe; Sun, Yi; Wolff, Anders; Bang, Dang Duong

    2017-04-15

    Solid-phase PCR (SP-PCR) has become increasingly popular for molecular diagnosis and there have been a few attempts to incorporate SP-PCR into lab-on-a-chip (LOC) devices. However, their applicability for on-line diagnosis is hindered by the lack of sensitive and portable on-chip optical detection technology. In this paper, we addressed this challenge by combining the SP-PCR with super critical angle fluorescence (SAF) microlens array embedded in a microchip. We fabricated miniaturized SAF microlens array as part of a microfluidic chamber in thermoplastic material and performed multiplexed SP-PCR directly on top of the SAF microlens array. Attribute to the high fluorescence collection efficiency of the SAF microlens array, the SP-PCR assay on the LOC platform demonstrated a high sensitivity of 1.6 copies/µL, comparable to off-chip detection using conventional laser scanner. The combination of SP-PCR and SAF microlens array allows for on-chip highly sensitive and multiplexed pathogen detection with low-cost and compact optical components. The LOC platform would be widely used as a high-throughput biosensor to analyze food, clinical and environmental samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Rapid Detection of Campylobacter jejuni, Campylobacter coli, and Campylobacter lari in Fresh Chicken Meat and By-Products in Bangkok, Thailand, Using Modified Multiplex PCR.

    Science.gov (United States)

    Saiyudthong, S; Phusri, K; Buates, S

    2015-07-01

    A multiplex PCR assay for simultaneous detection and differentiation of Campylobacter jejuni, Campylobacter coli, and Campylobacter lari was developed and validated to assess the occurrence of these bacteria in fresh chicken meat and by-products in Bangkok, Thailand, by using a new combination of four previously published PCR primers for C. jejuni, C. coli, C. lari, and a universal 16S rDNA gene as an internal control. The specificity was determined by using 13 strains of other bacteria. With pure culture DNA, the detection limit was 0.017 ng/PCR for C. jejuni and C. coli and was 0.016 ng/PCR for C. lari. It can detect 10 CFU of C. jejuni, C. coli, and C. lari in 2 g of chicken meat within a 16-h enrichment time. Our multiplex PCR assay was applied for identification of Campylobacter spp. in 122 supermarket samples and 108 fresh market samples. Of the 230 samples evaluated by multiplex PCR, 54.0, 3.3, and 10.7% of supermarket samples were positive for C. jejuni, C. coli, and mixed C. jejuni and C. coli, respectively, and 56.5 and 33.3% of fresh market samples were positive for C. jejuni and mixed C. jejuni and C. coli, respectively. No sample was positive for C. lari. Fresh market samples had significantly higher C. jejuni and C. coli contamination than those from supermarkets (relative risk: 1.3; P = 0.0001). Compared with the culture method (a gold standard), the sensitivity, specificity, positive predictive value, negative predictive value, and diagnostic accuracy of multiplex PCR were 97.7, 86.8, 96.1, 92.0, and 95.2%, respectively. No significant difference was observed between results from two methods (P = 0.55). Therefore, the established multiplex PCR was not only rapid and easy to perform but had a high sensitivity and specificity to distinguish between C. jejuni, C. coli, and C. lari, even in samples containing mixed contamination. Our study indicated that fresh chicken meat and by-products from fresh markets were significantly less hygienic than those

  14. Monitoring the Various Types of Clostridium botulinumin in Four Kinds of Food Stuffs Using Multiplex PCR

    Directory of Open Access Journals (Sweden)

    Mohammad Vahid Sadeghi Sarvestani

    2014-03-01

    Full Text Available Background &Objective: Food poisoning (FP caused by C. botulinum is the most serious feature of FP inpeople consuming the contaminated foodstuffs (Canned meat, vegetarian foods, dairy products and seafood products. Botulism is basically detected by the identification of live bacteria and/or its toxins. Among various types of microorganisms (i.e. A, B, C1, C2, D, E, F, serotypes A, B, E and F are considered as the main human pathogens. The present study was aimed at investigating the possible roles of various foodstuffs to induce the food intoxication and also to compare the culture and molecular assays for identifying the microorganism.Materials &Methods: Three Lab techniques including biochemical, culture (enriched in TPGY and cooked meat medium and MPCR were used to detect C. botulinum in the samples. As the molecular based techniques have recently employed for the rapid and reliable identification of the bacteria and its toxins, the PCR assay, using three pairs of primers were designed and optimized to identify A, B and E strains in the contaminated specimens. The PCR was able to amplify 782, 205 and 389 bp genes specified for A, B and E types of the bacteria, respectively. Results: Total number of 290 specimens including fish, honey,"kashk"and"Dough" were tested, in which 5%, 4%, 2.5% and 1.25%, were found positive, respectively. Using selective culture of the specimens on the enriched samples, it was shown that just four samples were found positive.Conclusion: As a final conclusion, the molecular based techniques are recommended as a reliable tool to detect C. botulinum and, its toxins and spores in foodstuffs. Moreover, it is strongly advised to use it in food microbial Lab and also the epidemiological surveys.

  15. Multiplex PCR and Next Generation Sequencing for the Non-Invasive Detection of Bladder Cancer.

    Directory of Open Access Journals (Sweden)

    Douglas G Ward

    Full Text Available Highly sensitive and specific urine-based tests to detect either primary or recurrent bladder cancer have proved elusive to date. Our ever increasing knowledge of the genomic aberrations in bladder cancer should enable the development of such tests based on urinary DNA.DNA was extracted from urine cell pellets and PCR used to amplify the regions of the TERT promoter and coding regions of FGFR3, PIK3CA, TP53, HRAS, KDM6A and RXRA which are frequently mutated in bladder cancer. The PCR products were barcoded, pooled and paired-end 2 x 250 bp sequencing performed on an Illumina MiSeq. Urinary DNA was analysed from 20 non-cancer controls, 120 primary bladder cancer patients (41 pTa, 40 pT1, 39 pT2+ and 91 bladder cancer patients post-TURBT (89 cancer-free.Despite the small quantities of DNA extracted from some urine cell pellets, 96% of the samples yielded mean read depths >500. Analysing only previously reported point mutations, TERT mutations were found in 55% of patients with bladder cancer (independent of stage, FGFR3 mutations in 30% of patients with bladder cancer, PIK3CA in 14% and TP53 mutations in 12% of patients with bladder cancer. Overall, these previously reported bladder cancer mutations were detected in 86 out of 122 bladder cancer patients (70% sensitivity and in only 3 out of 109 patients with no detectable bladder cancer (97% specificity.This simple, cost-effective approach could be used for the non-invasive surveillance of patients with non-muscle-invasive bladder cancers harbouring these mutations. The method has a low DNA input requirement and can detect low levels of mutant DNA in a large excess of normal DNA. These genes represent a minimal biomarker panel to which extra markers could be added to develop a highly sensitive diagnostic test for bladder cancer.

  16. Multiplex PCR and Next Generation Sequencing for the Non-Invasive Detection of Bladder Cancer.

    Science.gov (United States)

    Ward, Douglas G; Baxter, Laura; Gordon, Naheema S; Ott, Sascha; Savage, Richard S; Beggs, Andrew D; James, Jonathan D; Lickiss, Jennifer; Green, Shaun; Wallis, Yvonne; Wei, Wenbin; James, Nicholas D; Zeegers, Maurice P; Cheng, K K; Mathews, Glenn M; Patel, Prashant; Griffiths, Michael; Bryan, Richard T

    2016-01-01

    Highly sensitive and specific urine-based tests to detect either primary or recurrent bladder cancer have proved elusive to date. Our ever increasing knowledge of the genomic aberrations in bladder cancer should enable the development of such tests based on urinary DNA. DNA was extracted from urine cell pellets and PCR used to amplify the regions of the TERT promoter and coding regions of FGFR3, PIK3CA, TP53, HRAS, KDM6A and RXRA which are frequently mutated in bladder cancer. The PCR products were barcoded, pooled and paired-end 2 x 250 bp sequencing performed on an Illumina MiSeq. Urinary DNA was analysed from 20 non-cancer controls, 120 primary bladder cancer patients (41 pTa, 40 pT1, 39 pT2+) and 91 bladder cancer patients post-TURBT (89 cancer-free). Despite the small quantities of DNA extracted from some urine cell pellets, 96% of the samples yielded mean read depths >500. Analysing only previously reported point mutations, TERT mutations were found in 55% of patients with bladder cancer (independent of stage), FGFR3 mutations in 30% of patients with bladder cancer, PIK3CA in 14% and TP53 mutations in 12% of patients with bladder cancer. Overall, these previously reported bladder cancer mutations were detected in 86 out of 122 bladder cancer patients (70% sensitivity) and in only 3 out of 109 patients with no detectable bladder cancer (97% specificity). This simple, cost-effective approach could be used for the non-invasive surveillance of patients with non-muscle-invasive bladder cancers harbouring these mutations. The method has a low DNA input requirement and can detect low levels of mutant DNA in a large excess of normal DNA. These genes represent a minimal biomarker panel to which extra markers could be added to develop a highly sensitive diagnostic test for bladder cancer.

  17. Charging YOYO-1 on capillary wall for online DNA intercalation and integrating this approach with multiplex PCR and bare narrow capillary-hydrodynamic chromatography for online DNA analysis.

    Science.gov (United States)

    Chen, Huang; Zhu, Zaifang; Lu, Joann Juan; Liu, Shaorong

    2015-02-03

    Multiplex polymerase chain reaction (PCR) has been widely utilized for high-throughput pathogen identification. Often, a dye is used to intercalate the amplified DNA fragments, and identifications of the pathogens are carried out by DNA melting curve analysis or gel electrophoresis. Integrating DNA amplification and identification is a logic path toward maximizing the benefit of multiplex PCR. Although PCR and gel electrophoresis have been integrated, replenishing the gels after each run is tedious and time-consuming. In this technical note, we develop an approach to address this issue. We perform multiplex PCR inside a capillary, transfer the amplified fragments to a bare narrow capillary, and measure their lengths online using bare narrow capillary-hydrodynamic chromatography (BaNC-HDC), a new technique recently developed in our laboratory for free-solution DNA separation. To intercalate the DNA with YOYO-1 (a fluorescent dye) for BaNC-HDC, we flush the capillary column with a YOYO-1 solution; positively charged YOYO-1 is adsorbed (or charged) onto the negatively charged capillary wall. As DNA molecules are driven down the column for separation, they react with the YOYO-1 stored on the capillary wall and are online-intercalated with the dye. With a single YOYO-1 charging, the column can be used for more than 40 runs, although the fluorescence signal intensities of the DNA peaks decrease gradually. Although the dye-DNA intercalation occurs during the separation, it does not affect the retention times, separation efficiencies, or resolutions.

  18. Charging YOYO-1 on Capillary Wall for Online DNA Intercalation and Integrating This Approach with Multiplex PCR and Bare Narrow Capillary–Hydrodynamic Chromatography for Online DNA Analysis

    Science.gov (United States)

    2016-01-01

    Multiplex polymerase chain reaction (PCR) has been widely utilized for high-throughput pathogen identification. Often, a dye is used to intercalate the amplified DNA fragments, and identifications of the pathogens are carried out by DNA melting curve analysis or gel electrophoresis. Integrating DNA amplification and identification is a logic path toward maximizing the benefit of multiplex PCR. Although PCR and gel electrophoresis have been integrated, replenishing the gels after each run is tedious and time-consuming. In this technical note, we develop an approach to address this issue. We perform multiplex PCR inside a capillary, transfer the amplified fragments to a bare narrow capillary, and measure their lengths online using bare narrow capillary–hydrodynamic chromatography (BaNC-HDC), a new technique recently developed in our laboratory for free-solution DNA separation. To intercalate the DNA with YOYO-1 (a fluorescent dye) for BaNC-HDC, we flush the capillary column with a YOYO-1 solution; positively charged YOYO-1 is adsorbed (or charged) onto the negatively charged capillary wall. As DNA molecules are driven down the column for separation, they react with the YOYO-1 stored on the capillary wall and are online-intercalated with the dye. With a single YOYO-1 charging, the column can be used for more than 40 runs, although the fluorescence signal intensities of the DNA peaks decrease gradually. Although the dye-DNA intercalation occurs during the separation, it does not affect the retention times, separation efficiencies, or resolutions. PMID:25555111

  19. Rapid detection method for Bacillus anthracis using a combination of multiplexed real-time PCR and pyrosequencing and its application for food biodefense.

    Science.gov (United States)

    Janzen, Timothy W; Thomas, Matthew C; Goji, Noriko; Shields, Michael J; Hahn, Kristen R; Amoako, Kingsley K

    2015-02-01

    Bacillus anthracis, the causative agent of anthrax, has the capacity to form highly resilient spores as part of its life cycle. The potential for the dissemination of these spores using food as a vehicle is a huge public health concern and, hence, requires the development of a foodborne bioterrorism response approach. In this work, we address a critical gap in food biodefense by presenting a novel, combined, sequential method involving the use of real-time PCR and pyrosequencing for the rapid, specific detection of B. anthracis spores in three food matrices: milk, apple juice, and bottled water. The food samples were experimentally inoculated with 40 CFU ml(-1), and DNA was extracted from the spores and analyzed after immunomagnetic separation. Applying the combination of multiplex real-time PCR and pyrosequencing, we successfully detected the presence of targets on both of the virulence plasmids and the chromosome. The results showed that DNA amplicons generated from a five-target multiplexed real-time PCR detection using biotin-labeled primers can be used for single-plex pyrosequencing detection. The combined use of multiplexed real-time PCR and pyrosequencing is a novel, rapid detection method for B. anthracis from food and provides a tool for accurate, quantitative identification with potential biodefense applications.

  20. Agronomically important thrips: development of species-specific primers in multiplex PCR and microarray assay using internal transcribed spacer 1 (ITS1) sequences for identification.

    Science.gov (United States)

    Yeh, W B; Tseng, M J; Chang, N T; Wu, S Y; Tsai, Y S

    2015-02-01

    Thrips, the sole vector of plant Tospovirus, are major pests of many agricultural crops throughout the world. Molecular approaches have been applied in recent decades to identify these minute and morphologically difficult to distinguish insects. In this study, sequences of internal transcribed spacer 1 (ITS1) region of 15 agronomically important thrips, including several virus transmission species, have been analyzed in order to design species-specific primers for multiplex PCR and probes for microarray assay. That the ITS1 sequence distances within species were smaller than those among species suggests that the ITS1 fragment can be used for thrips species identification. The specificity and stability of these primers, combined with universal paired primers, were tested and verified in multiplex PCR. Using these specific primers as probes, microarray assay showed that PCR products of all thrips species hybridized consistently to their corresponding probes, though some signals were weak. We have demonstrated that multiplex PCR using specific primers based on ITS1 sequences is a simple, reliable, and cost-effective diagnostic tool for thrips species identification. Moreover, the DNA microarray assay is expected to extend into a reliable high-throughput screening tool for the vast numbers of thrips.

  1. Comparison of Seeplex PneumoBacter aCE detection assay and in-house multiplex PCR for the identification of Streptococcus pneumoniae.

    Science.gov (United States)

    Luznik, Dane; Kosnik, Mitja; Tomic, Viktorija

    2015-01-01

    Rapid and accurate identification of Streptococcus pneumoniae is important for appropriate and prudent antimicrobial use in the treatment of lower respiratory tract infection. It is difficult to separate S. pneumoniae from commensal viridans group streptococci either by classical techniques or molecular methods. Aim of this study was to compare a commercially available multiplex PCR assay Seeplex PneumoBacter ACE Detection assay (Seegene, Seoul, South Korea), and in-house multiplex PCR using primer sets for lytA and cpsA for ability to differentiate S. pneumoniae in a known set of bacteria (S. pneumoniae and viridans group streptococci) and clinical samples. Of 20 viridans streptococcal isolates, 8 were misidentified as S. pneumoniae by commercial PCR test. Of 209 throat swabs tested with Seeplex PneumoBacter ACE Detection assay, 122 (58,4%) were positive for S. pneumoniae while only 11 (5.3%) samples were positive with lytA and cpsA primers. Therefore, the commercial multiplex PCR test appears to have low specificity in diagnosing S. pneumoniae.

  2. [Genotypic survey of Plasmodium falciparum based on the msp1, msp2 and glurp genes by multiplex PCR].

    Science.gov (United States)

    Barrera, Sandra Milena; Pérez, Manuel Alberto; Knudson, Angélica; Nicholls, Rubén Santiago; Guerra, Angela Patricia

    2010-01-01

    The genetic diversity of Plasmodium falciparum has been one of the major obstacles for the success of anti-malaria drug therapy. It provides the parasite an ability to evade the host's immune response by generating changes in its antigenic composition and resistance to antimalarial drugs. The genetic diversity of P.falciparum was characterized in 4 Colombian localities through the analysis of polymorphic genes. Eighty-one samples were obtained from patients with uncomplicated P. falciparum malaria and screened for polymorphic variants of msp1, msp2 (merozoite surface proteins) and glurp (glutamate-rich protein) with a multiplex PCR assay. The geographic regions sampled were Tierralta (Córdoba), in northwestern Colombia and in the Orinoco river watershed of eastern Colombia--Inírida (Guainía), La Carpa (Guaviare), and Casuarito (Vichada). The MAD20 variant was detected in all samples analyzed for the msp1 gene. For the msp2 gene, the IC allelic family was found in 96.3% of the samples as compared to 4.9% of the samples with the FC family. Both families showed size polymorphism with bands between 467 and 513 basepairs (bp) for IC and 286 and 300 bp for FC. PCR products of differing sizes were detected for the glurp gene and grouped into 5 size classes: I (600-699 bp) 2.5%, II (700-799 bp) 19.8%, III (800-899 bp) 72.8%, IV (900-999 bp) 1.2% and V (1000-1099 bp) 3.7%. The msp1 molecular marker did not provide information for differentiating P. falciparum parasite populations. The msp2 gene was more suitable for studying the genetic diversity, however, further studies are required to identify polymorphisms within the two allelic families. The glurp gene showed a great genetic diversity of circulating P. falciparum populations, and suggested that this gene may be useful for distinguishing between recrudescence and reinfection.

  3. Molecular diagnosis of bloodstream infections with a new dual-priming oligonucleotide-based multiplex PCR assay.

    Science.gov (United States)

    Carrara, Lucrecia; Navarro, Ferran; Turbau, Miquel; Seres, Montse; Morán, Indalecio; Quintana, Isabel; Martino, Rodrigo; González, Yesica; Brell, Albert; Cordon, Oscar; Diestra, Karol; Mata, Caterina; Mirelis, Beatriz; Coll, Pere

    2013-11-01

    Mortality from bloodstream infections (BSIs) correlates with diagnostic delay and the use of inappropriate empirical treatment. Early PCR-based diagnosis could decrease inappropriate treatment, improving patient outcome. The aim of the present study was to assess the clinical utility of this molecular technology to diagnose BSIs. We assessed a new dual-priming oligonucleotide-based multiplex PCR assay, the Magicplex Sepsis Test (MST) (Seegene), along with blood culture (BC). A total of 267 patients from the intensive care unit and haematology and emergency departments were enrolled. Clinical data were also used by physicians to determine the likelihood of infection. Ninety-eight (37 %) specimens were positive: 29 (11 %) by both the MST and BC, 29 (11 %) by the MST only, and 40 (15 %) by BC only. The proportion of agreement between the two methods was 73 % (Cohen's κ: 0.45; 0.28-0.6; indicating fair to moderate agreement). According to clinical assessment, 63 (64 %) positive specimens were considered BSIs: 23 (36 %) were positive by both the MST and BC, 22 (35 %) were positive only by BC, and 18 (29 %) were positive only by the MST. Thirty-eight (14 %) positive specimens by the MST and/or BC were considered as contaminants. Of 101 specimens collected from patients receiving antibiotics, 20 (20 %) were positive by the MST and 32 (32 %) by BC. Sensitivity and specificity were 65 % and 92 %, respectively, for the MST and 71 % and 88 %, respectively for BC. We concluded that the MST shows a high specificity but changes in design are needed to increase bacteraemia detection. For viability in clinical laboratories, technical improvements are also required to further automate the process.

  4. One-step multiplex real time RT-PCR for the detection of bovine respiratory syncytial virus, bovine herpesvirus 1 and bovine parainfluenza virus 3.

    Science.gov (United States)

    Thonur, Leenadevi; Maley, Madeleine; Gilray, Janice; Crook, Tara; Laming, Ellie; Turnbull, Dylan; Nath, Mintu; Willoughby, Kim

    2012-03-28

    Detection of respiratory viruses in veterinary species has traditionally relied on virus detection by isolation or immunofluorescence and/or detection of circulating antibody using ELISA or serum neutralising antibody tests. Multiplex real time PCR is increasingly used to diagnose respiratory viruses in humans and has proved to be superior to traditional methods. Bovine respiratory disease (BRD) is one of the most common causes of morbidity and mortality in housed cattle and virus infections can play a major role. We describe here a one step multiplex reverse transcriptase quantitative polymerase chain reaction (mRT-qPCR) to detect the viruses commonly implicated in BRD. A mRT-qPCR assay was developed and optimised for the simultaneous detection of bovine respiratory syncytial virus (BRSV), bovine herpes virus type 1 (BoHV-1) and bovine parainfluenza virus type 3 (BPI3 i & ii) nucleic acids in clinical samples from cattle. The assay targets the highly conserved glycoprotein B gene of BoHV-1, nucleocapsid gene of BRSV and nucleoprotein gene of BPI3. This mRT-qPCR assay was assessed for sensitivity, specificity and repeatability using in vitro transcribed RNA and recent field isolates. For clinical validation, 541 samples from clinically affected animals were tested and mRT-qPCR result compared to those obtained by conventional testing using virus isolation (VI) and/or indirect fluorescent antibody test (IFAT). The mRT-qPCR assay was rapid, highly repeatable, specific and had a sensitivity of 97% in detecting 102 copies of BRSV, BoHV-1 and BPI3 i & ii. This is the first mRT-qPCR developed to detect the three primary viral agents of BRD and the first multiplex designed using locked nucleic acid (LNA), minor groove binding (MGB) and TaqMan probes in one reaction mix. This test was more sensitive than both VI and IFAT and can replace the aforesaid methods for virus detection during outbreaks of BRD.

  5. Diagnostic performance of a multiplex PCR assay for meningitis in an HIV-infected population in Uganda.

    Science.gov (United States)

    Rhein, Joshua; Bahr, Nathan C; Hemmert, Andrew C; Cloud, Joann L; Bellamkonda, Satya; Oswald, Cody; Lo, Eric; Nabeta, Henry; Kiggundu, Reuben; Akampurira, Andrew; Musubire, Abdu; Williams, Darlisha A; Meya, David B; Boulware, David R

    2016-03-01

    Meningitis remains a worldwide problem, and rapid diagnosis is essential to optimize survival. We evaluated the utility of a multiplex PCR test in differentiating possible etiologies of meningitis. Cerebrospinal fluid (CSF) from 69 HIV-infected Ugandan adults with meningitis was collected at diagnosis (n=51) and among persons with cryptococcal meningitis during therapeutic lumbar punctures (n=68). Cryopreserved CSF specimens were analyzed with BioFire FilmArray® Meningitis/Encephalitis panel, which targets 17 pathogens. The panel detected Cryptococcus in the CSF of patients diagnosed with a first episode of cryptococcal meningitis by fungal culture with 100% sensitivity and specificity and differentiated between fungal relapse and paradoxical immune reconstitution inflammatory syndrome in recurrent episodes. A negative FilmArray result was predictive of CSF sterility on follow-up lumbar punctures for cryptococcal meningitis. EBV was frequently detected in this immunosuppressed population (n=45). Other pathogens detected included: cytomegalovirus (n=2), varicella zoster virus (n=2), human herpes virus 6 (n=1), and Streptococcus pneumoniae (n=1). The FilmArray Meningitis/Encephalitis panel offers a promising platform for rapid meningitis diagnosis. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. A Two-Tube Multiplex Reverse Transcription PCR Assay for Simultaneous Detection of Viral and Bacterial Pathogens of Infectious Diarrhea

    Directory of Open Access Journals (Sweden)

    Ji Wang

    2014-01-01

    Full Text Available Diarrhea caused by viral and bacterial infections is a major health problem in developing countries. The purpose of this study is to develop a two-tube multiplex PCR assay using automatic electrophoresis for simultaneous detection of 13 diarrhea-causative viruses or bacteria, with an intended application in provincial Centers for Diseases Control and Prevention, China. The assay was designed to detect rotavirus A, norovirus genogroups GI and GII, human astrovirus, enteric adenoviruses, and human bocavirus (tube 1, and Salmonella, Vibrio parahaemolyticus, diarrheagenic Escherichia coli, Campylobacter jejuni, Shigella, Yersinia, and Vibrio cholera (tube 2. The analytical specificity was examined with positive controls for each pathogen. The analytical sensitivity was evaluated by performing the assay on serial tenfold dilutions of in vitro transcribed RNA, recombinant plasmids, or bacterial culture. A total of 122 stool samples were tested by this two-tube assay and the results were compared with those obtained from reference methods. The two-tube assay achieved a sensitivity of 20–200 copies for a single virus and 102-103 CFU/mL for bacteria. The clinical performance demonstrated that the two-tube assay had comparable sensitivity and specificity to those of reference methods. In conclusion, the two-tube assay is a rapid, cost-effective, sensitive, specific, and high throughput method for the simultaneous detection of enteric bacteria and virus.

  7. Diagnostic Performance of a Multiplex PCR assay for meningitis in an HIV-infected population in Uganda

    Science.gov (United States)

    Rhein, Joshua; Bahr, Nathan C; Hemmert, Andrew C; Cloud, Joann L; Bellamkonda, Satya; Oswald, Cody; Lo, Eric; Nabeta, Henry; Kiggundu, Reuben; Akampurira, Andrew; Musubire, Abdu; Williams, Darlisha; Meya, David B; Boulware, David R

    2015-01-01

    Meningitis remains a worldwide problem, and rapid diagnosis is essential to optimize survival. We evaluated the utility of a multiplex PCR test in differentiating possible etiologies of meningitis. Cerebrospinal fluid (CSF) from 69 HIV-infected Ugandan adults with meningitis was collected at diagnosis (n=51) and among persons with cryptococcal meningitis during therapeutic lumbar punctures (n=68). Cryopreserved CSF specimens were analyzed with BioFire FilmArray® Meningitis/Encephalitis panel, which targets 17 pathogens. The panel detected Cryptococcus in the CSF of patients diagnosed with a first-episode of cryptococcal meningitis by fungal culture with 100% sensitivity and specificity, and differentiated between fungal relapse and paradoxical immune reconstitution inflammatory syndrome in recurrent episodes. A negative FilmArray result was predictive of CSF sterility on follow-up lumbar punctures for cryptococcal meningitis. EBV was frequently detected in this immunosuppressed population (n=45). Other pathogens detected included: CMV (n=2), VZV (n=2), HHV-6 (n=1), and Streptococcus pneumoniae (n=1). The FilmArray Meningitis/Encephalitis panel offers a promising platform for rapid meningitis diagnosis. PMID:26711635

  8. A Multiplex PCR assay to differentiate between dog and red fox.

    Science.gov (United States)

    Weissenberger, M; Reichert, W; Mattern, R

    2011-11-01

    Foxes are frequently the cause of car accidents in Baden-Württemberg (BW, Germany). The domestic dog (Canis familiaris) is in close relation to the red fox (Vulpes vulpes) and the silver fox which is a coat colour variant of the red fox. As insurance claims that involve accidents with animals require authentication, we analyzed frequency distribution and allele sizes in two canine microsatellite loci in 26 dogs (different breeds) and 19 red foxes of the region of BW, Germany. Moreover, sequencing analysis was performed. Red foxes exhibited only 1 allele at each microsatellite locus, whereas in dog 7 alleles at the CPH4 locus and 6 alleles at the CPH12 locus were detected. Sequences of PCR products from the two species revealed several differences between dogs and foxes. We established a sequenced allelic ladder and give population data from dogs and red foxes from the region of BW, Germany. Using microsatellite polymorphisms is efficient in differentiating between dogs and foxes in forensic casework. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  9. A multiplex PCR for non-invasive fetal RHD genotyping using cell-free fetal DNA.

    Science.gov (United States)

    Tounta, Georgia; Vrettou, Christina; Kolialexi, Aggeliki; Papantoniou, Nikolas; Destouni, Aspasia; Tsangaris, George T; Antsaklis, Aris; Kanavakis, Emmanuel; Mavrou, Ariadni

    2011-01-01

    To design a protocol for non-invasive prenatal diagnosis of fetal Rhesus D (RhD) status. A total of 112 single lymphocytes were used to test the efficiency of the assay. The protocol was validated using blood samples from 84 RhD-negative pregnant women at 7-24 weeks of gestation. Cell-free DNA (cfDNA) was enzymatically digested using AciI and analyzed by a polymerase chain reaction (PCR) that allowed simultaneous amplification of RHD exons 7 and 10, SRY, RASFF1A and ACTB. On the one genome-equivalent level, the efficiency of the protocol was ≥ 94.6% for each locus amplified. Conclusive results from the first set of PCRs were obtained for 79 cases with one false-positive. In five cases the analysis was repeated and, subsequently, all cases were accurately diagnosed. The proposed protocol is rapid, applicable in most molecular diagnostic laboratories and provides the basis for non-invasive examination of fetal RhD with 96.7% specificity and 100% sensitivity.

  10. Comparison of multiplex real-time PCR and PCR-reverse blot hybridization assay for the direct and rapid detection of bacteria and antibiotic resistance determinants in positive culture bottles.

    Science.gov (United States)

    Wang, Hye-Young; Kim, Seoyong; Kim, Jungho; Park, Soon Deok; Kim, Hyo Youl; Uh, Young; Lee, Hyeyoung

    2016-09-01

    The aim of this study was to evaluate the performance of a commercially available multiplex real-time PCR assay and a PCR-reverse blot hybridization assay (PCR-REBA) for the rapid detection of bacteria and identification of antibiotic resistance genes directly from blood culture bottles and to compare the results of these molecular assays with conventional culture methods. The molecular diagnostic methods were used to evaluate 593 blood culture bottles from patients with bloodstream infections. The detection positivity of multiplex real-time PCR assay for Gram-positive bacteria, Gram-negative bacteria and Candida spp. was equivalent to PCR-REBA as 99.6 %, 99.1 % and 100 %, respectively. Using conventional bacterial cultures as the gold standard, the sensitivity, specificity, positive predictive value and negative predictive value of these two molecular methods were 99.5 % [95 % confidence interval (CI), 0.980-1.000; PReal-methicillin-resistant Staphylococcusaureus multiplex real-time PCR assay targeting the mecA gene to detect methicillin resistance was lower than that of the PCR-REBA method, detecting an overall positivity of 98.4 % (n=182; 95 % CI, 0.964-1.000; P<0.009) and 99.5 % (n=184; 95 % CI, 0.985-1.000; P<0.0001), respectively. The entire two methods take about 3 h, while results from culture can take up to 48-72 h. Therefore, the use of these two molecular methods was rapid and reliable for the characterization of causative pathogens in bloodstream infections.

  11. [Respiratory viral diagnosis by using an automated system of multiplex PCR (FilmArray) compared to conventional methods].

    Science.gov (United States)

    Marcone, Débora N; Carballal, Guadalupe; Ricarte, Carmen; Echavarria, Marcela

    2015-01-01

    Acute respiratory infections, which are commonly caused by viruses, are an important cause of morbidity and mortality in children. In Argentina, national surveillance programs for the detection of respiratory viruses are usually performed by using immunofluorescence (IF) assays, although it is well known that molecular methods are more sensitive. An automated multiplex PCR device, the FilmArray-Respiratory Panel (FilmArray-RP), can detect 17 viral and 3 bacterial pathogens in a closed system that requires only 5 min of hands-on time and 1h of instrumentation time. A total of 315 respiratory samples from children under 6 years of age suffering from acute respiratory infections, were studied by IF for 8 respiratory viruses and by RT-PCR for rhinoviruses. Later, these samples were tested by the FilmArray-RP. The positivity frequency obtained for the 9 viruses tested was 75% by IF/RT-PCR and 92% by the FilmArray-RP. The positive and negative percent agreement between both methods was 70.5% whereas the negative percent agreement was 99.6% (95% confidence interval:65.5-75.1 and 99.2-99.8 respectively). The FilmArray-RP allowed a higher positive diagnosis (97%) and detected other viruses such as coronavirus NL63, 229E, OC43, HKU1 (10%) and bocavirus (18%). In addition, this method identified multiple coinfections (39%) with 2, 3, 4 and up to 5 different viruses. At present, IF is still the most frequently used method in most Latin American countries for respiratory viruses diagnosis due to its low cost, its capability to process a high number of samples simultaneously and the fast determination of results for the most frequent viruses, which are available within 5h. However, the coming incorporation of molecular methods in routine procedures will significantly increase the diagnostic yield of these infections. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  12. An experimental study for rapid detection and quantification of endodontic microbiota following photo-activated disinfection via new multiplex real-time PCR assay.

    Science.gov (United States)

    Pourhajibagher, Maryam; Raoofian, Reza; Ghorbanzadeh, Roghayeh; Bahador, Abbas

    2018-01-11

    The infected root canal system harbors one of the highest accumulations of polymicrobial infections. Since the eradication of endopathogenic microbiota is a major goal in endodontic infection therapy, photo-activated disinfection (PAD) can be used as an alternative therapeutic method in endodontic treatment. Compared to cultivation-based approaches, molecular techniques are more reliable for identifying microbial agents associated with endodontic infections. The purpose of this study was to evaluate the ability of designed multiplex real-time PCR protocol for the rapid detection and quantification of six common microorganisms involved in endodontic infection before and after the PAD. Samples were taken from the root canals of 50 patients with primary and secondary/persistent endodontic infections using sterile paper points. PAD with toluidine blue O (TBO) plus diode laser was performed on root canals. Resampling was then performed, and the samples were transferred to transport medium. Then, six target microorganisms were detected using multiplex real-time PCR before and after the PAD. Veillonella parvula was found using multiplex real-time PCR to have the highest frequency among samples collected before the PAD (29.4%), followed by Porphyromonas. gingivalis (23.1%), Aggregatibacter actinomycetemcomitans (13.6%), Actinomyces naeslundii (13.0%), Enterococcus faecalis (11.5%), and Lactobacillus rhamnosus (9.4%). After TBO-mediated PAD, P. gingivalis strains, the most resistance microorganisms, were recovered in 41.7% of the samples using molecular approach (P > 0.05). As the results shown, multiplex real-time PCR as an accurate detection approach with high-throughput and TBO-mediated PAD as an efficient antimicrobial strategy due to the significant reduction of the endopathogenic count can be used for detection and treatment of microbiota involved in infected root canals, respectively. Copyright © 2018. Published by Elsevier B.V.

  13. Identification of Campylobacter jejuni and determination of point mutations associated with macrolide resistance using a multiplex TaqMan MGB real-time PCR.

    Science.gov (United States)

    Hao, H; Liu, J; Kuang, X; Dai, M; Cheng, G; Wang, X; Peng, D; Huang, L; Ahmad, I; Ren, N; Liu, Z; Wang, Y; Yuan, Z

    2015-06-01

    The aim of the study was to develop a multiplex real-time PCR method to identify Campylobacter jejuni containing mutations commonly associated with macrolide resistance. A multiplex fluorescence real-time PCR assay was developed based on TaqMan minor groove binder (MGB) probes. The VS1-MGB probe was designed based on the VS1 gene and was used to identify Camp. jejuni. The 23S rDNA-MGB probe was designed to distinguish macrolide resistance mutations in 23S rDNA, while 57D-MGB and 74D-MGB were designed to detect resistance mutations in ribosomal protein L4. The specificity and accuracy of our method were identical to the conventional biochemical tests, mapA PCR, minimum inhibitory concentration (MIC) determination and DNA sequencing. The linear detection limit of the method was 0·03 ng genomic DNA and three colony formation unit (CFU) per reaction. In 6 of 18 cases, the nature of Erythromycin resistance could be correctly determined from natural isolates; absence of the tested mutations was demonstrated in the remaining four resistant isolates. A multiplex TaqMan MGB real-time PCR assay with high specificity and accuracy was developed to simultaneously identify Camp. jejuni and detect the gene mutations associated with macrolide resistance. This multiplex method can potentially simplify the identification of Camp. jejuni and determine macrolide resistance due to mutations in 23S rDNA or ribosomal protein L4. This method has a potential for application in different research areas and molecular surveillance. © 2015 The Society for Applied Microbiology.

  14. Point-of-care multiplex PCR promises short turnaround times for microbial testing in hospital-acquired pneumonia--an observational pilot study in critical ill patients.

    OpenAIRE

    Kunze, Nils; Moerer, Onnen; Steinmetz, Nicolas; Schulze, Marco H.; Quintel, Michael; Perl, Thorsten

    2015-01-01

    BACKGROUND: The early beginning of an adequate antibiotic therapy is crucial in hospital-acquired pneumonia (HAP), but depends on the results of conventional microbiological diagnostics (cMD). It was the aim of this study to evaluate the performance and turnaround times of a new point-of-care multiplex polymerase chain reaction (mPCR) system for rapid identification of pathogens and antibiotic resistance markers. We assessed the applicability of the system under real-life conditions in critic...

  15. A multiplex PCR assay for the rapid and sensitive detection of methicillin-resistant Staphylococcus aureus and simultaneous discrimination of Staphylococcus aureus from coagulase-negative staphylococci.

    Science.gov (United States)

    Xu, Benjin; Liu, Ling; Liu, Li; Li, Xinping; Li, Xiaofang; Wang, Xin

    2012-11-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is a global health concern, which had been detected in food and food production animals. Conventional testing for detection of MRSA takes 3 to 5 d to yield complete information of the organism and its antibiotic sensitivity pattern. So, a rapid method is needed to diagnose and treat the MRSA infections. The present study focused on the development of a multiplex PCR assay for the rapid and sensitive detection of MRSA. The assay simultaneously detected 4 genes, namely, 16S rRNA of the Staphylococcus genus, femA of S. aureus, mecA that encodes methicillin resistance, and one internal control. It was rapid and yielded results within 4 h. The analytical sensitivity and specificity of the multiplex PCR assay was evaluated by comparing it with the conventional method. The analytical sensitivity of the multiplex PCR assay at the DNA level was 10 ng DNA. The analytical specificity was evaluated with 10 reference staphylococci strains and was 100%. The diagnostic evaluation of MRSA was carried out using 360 foodborne staphylococci isolates, and showed 99.1% of specificity, 96.4% of sensitivity, 97.5% of positive predictive value, and 97.3% of negative predictive value compared to the conventional method. The inclusion of an internal control in the multiplex PCR assay is important to exclude false-negative cases. This test can be used as an effective diagnostic and surveillance tool to investigate the spread and emergence of MRSA. © 2012 Institute of Food Technologists®

  16. [Multiplex PCR strategy for the simultaneous identification of Staphylococcus aureus and detection of staphylococcal enterotoxins in isolates from food poisoning outbreaks].

    Science.gov (United States)

    Brizzio, Aníbal A; Tedeschi, Fabián A; Zalazar, Fabián E

    2013-01-01

    Staphylococcal food poisoning is the most frequent type of food poisoning around the world. Staphylococcus aureus enterotoxins cause significant loss of water in the intestinal lumen, followed by vomiting and diarrhea. To report a fast, reliable and inexpensive strategy based on multiplex PCR for the simultaneous identification of S. aureus and detection of five classical S. aureus enterotoxin genes ( sea, seb, sec, sed, see ) in Staphylococcus spp. strains isolated from food poisoning outbreaks. We analyzed isolates from 12 food poisoning outbreaks occurred in Santa Fe province (Argentina). Isolation and phenotypic characterization were carried out by standard procedures. Genotypic analysis was performed by multiplex PCR, using primers for nuc , sea-see and 16S rRNA genes simultaneously. Of all the strains tested, 58% were found to carry toxigenic genes. Sea and seb toxins were found at the same percentage (29%) while sec, sed and see genes were found in a lower and identical proportion (14%). We did not find more than one different type of S. aureus enterotoxin in the isolates analyzed. The multiplex PCR strategy designed in this work has enabled us to identify strains of S. aureus and detect -at the same time- their enterotoxigenic ability. At present, our efforts are devoted to the detection of genes encoding enterotoxins other than the classical ones, in order to know their impact on staphylococcal food poisoning, as well as to investigate their relevance to our country's public health.

  17. A low-cost efficient multiplex PCR for prenatal sex determination in bovine fetus using free fetal DNA in maternal plasma.

    Science.gov (United States)

    Davoudi, Arash; Seighalani, Ramin; Aleyasin, Seyed Ahmad; Tarang, Alireza; Salehi, Abdolreza Salehi; Tahmoressi, Farideh

    2012-04-01

    In order to establish a reliable non-invasive method for sex determination in a bovine fetus in a routine setting, the possibility of identifying specific sequence in the fetal X and Y-chromosomes has been evaluated in maternal plasma using conventional multiplex polymerase chain reaction (PCR) analysis. The aim of this study was to provide a rapid and reliable method for sexing bovine fetuses. In this experimental study, peripheral blood samples were taken from 38 pregnant heifers with 8 to 38 weeks of gestation. DNA template was extracted by phenol-chloroform method from 350 µl maternal plasma. Two primer pairs for bovine amelogenin gene (bAML) and BC1.2 were used to amplify fragments from X and Y chromosomes. A multiplex PCR reaction has been optimized for amplification of 467 bp and 341 bp fragments from X and Y bAML gene and a 190 bp fragment from BC1.2 related to Y chromosome. The 467 bp fragment was observed in all 38 samples. Both 341 and 190 bp fragments were detected only in 24 plasma samples from male calves. The sensitivity and specificity of test were 100% with no false negative or false positive results. The results showed that phenol-chloroform method is a simple and suitable method for isolation of fetal DNA in maternal plasma. The multiplex PCR method is an available non-invasive approach which is cost efficient and reliable for sexing bovine fetuses.

  18. A novel lab-on-chip platform with integrated solid phase PCR and Supercritical Angle Fluorescence (SAF) microlens array for highly sensitive and multiplexed pathogen detection

    DEFF Research Database (Denmark)

    Hung, Tran Quang; Chin, Wai Hoe; Sun, Yi

    2016-01-01

    Solid-phase PCR (SP-PCR) has become increasingly popular for molecular diagnosis and there have been a few attempts to incorporate SP-PCR into lab-on-a-chip (LOC) devices. However, their applicability for on-line diagnosis is hindered by the lack of sensitive and portable on-chip optical detectio......-PCR and SAF microlens array allows for on-chip highly sensitive and multiplexed pathogen detection with low-cost and compact optical components. The LOC platform would be widely used as a high-throughput biosensor to analyze food, clinical and environmental samples.......Solid-phase PCR (SP-PCR) has become increasingly popular for molecular diagnosis and there have been a few attempts to incorporate SP-PCR into lab-on-a-chip (LOC) devices. However, their applicability for on-line diagnosis is hindered by the lack of sensitive and portable on-chip optical detection......-PCR directly on top of the SAF microlens array. Attribute to the high fluorescence collection efficiency of the SAF microlens array, the SP-PCR assay on the LOC platform demonstrated a high sensitivity of 1.6 copies/µL, comparable to off-chip detection using conventional laser scanner. The combination of SP...

  19. Detection of Giardia lamblia, Cryptosporidium spp. and Entamoeba histolytica in clinical stool samples by using multiplex real-time PCR after automated DNA isolation.

    Science.gov (United States)

    Van Lint, P; Rossen, J W; Vermeiren, S; Ver Elst, K; Weekx, S; Van Schaeren, J; Jeurissen, A

    2013-01-01

    Diagnosis of intestinal parasites in stool samples is generally still carried out by microscopy; however, this technique is known to suffer from a low sensitivity and is unable to discriminate between certain protozoa. In order to overcome these limitations, a real-time multiplex PCR was evaluated as an alternative approach for diagnosing Giardia lamblia, Cryptosporidium spp. and Entamoeba histolytica in stool samples.Therefore, a total of 631 faecal samples were analysed both by microscopy as well as by real-time PCR following automated DNA extraction. Results showed that real-time PCR exhibited sensitivity and specificity of both 100%, whereas traditional microscopy exhibited sensitivity and specificity of 37.5% and 99.8% respectively. As real-time PCR provides simple, sensitive and specific detection of these three important pathogenic protozoan parasites, this technique, rather than microscopy, has become our diagnostic method of choice for the detection of enteric protozoan parasites for the majority of patients.

  20. Isolation, characterization and PCR multiplexing of microsatellite loci for a mite crop pest, Tetranychus urticae (Acari: Tetranychidae).

    Science.gov (United States)

    Sauné, Laure; Auger, Philippe; Migeon, Alain; Longueville, Jean-Emmanuel; Fellous, Simon; Navajas, Maria

    2015-06-17

    Tetranychus urticae is a highly polyphagous species with a cosmopolitan distribution that has the status of pest in more than 100 economically significant crops all over the world. Despite a number of previous efforts to isolate genetic markers, only a reduced set of microsatellite loci has been published. Taking advantage of the whole genome sequence of T. urticae that recently became available; we isolated and characterized a new set of microsatellite loci and tested the level of polymorphism across populations originating from a wide geographical area. A total of 42 microsatellite sequences widespread in the T. urticae genome were identified, the exact position in the genome recorded, and PCR amplification of microsatellite loci tested with primers defined here. Fourteen loci showed unambiguous genotype patterns and were further characterized. Three multiplex polymerase chain reaction sets were optimized in order to genotype a total of 24 polymorphic loci, including 10 previously published Tetranychus-specific loci. The microsatellite kits successfully amplified 686 individuals from 60 field populations for which we assessed the level of genetic diversity. The number of alleles per locus ranged from 3 to 16 and the expected heterozygosity values ranged from 0.12 to 0.81. Most of the loci displayed a significant excess of homozygous and did not model the Hardy-Weinberg equilibrium. This can be explained by the arrhenotokous mode of reproduction of T. urticae. These primers represent a valuable resource for robust studies on the genetic structure, dispersal and population biology of T. urticae, that can be used in managing this destructive agricultural pest.

  1. Multiplex PCR Analysis of 17 (11 Novels) STR Markers Linked to Six Autosomal Recessive Intellectual Disability Genes in Iranian Population.

    Science.gov (United States)

    Shirin, Ghadami; Maryam, Abiri; Farideh, Zonozi Rishsefid; Javad, Tavakkoly-Bazzaz; Sirous, Zeinali

    2016-01-01

    Non-syndromic autosomal recessive intellectual disability (NS-ARID) is a heterogeneous neurodevelopmental disease. More research is needed to study the NS-ARID genes. Using STR markers linked to a specific gene, we can perform homozygosity mapping and prenatal diagnosis. One approach to investigate the NS-ARID genes in large families is homozygosity mapping. In this study, we surveyed allele frequency and allele heterozygosity of 17 NS-ARID STR markers linked to the six NS-ARID genes in Iranian population. The test group consisted of 120 unrelated healthy individuals. STR markers were designed using SERV software. Also, genotyping was done using multiplex PCR. Data was analyzed by Gene Mapper software. Allele frequency and observed heterozygosity rates were estimated using PowerStatV12. Deviation from the Hardy-Weinberg equilibrium (HWE) was performed based on the Exact test. Out of 17 STR loci, 11 were novel. In total, 166 alleles were detected for the 17 markers. According to our study, the D9MAN1B1SD7.4, D19S872, D6GRIK2SI1.7, D19TECRSDI.8, D1ST3GAL3SIO.5, and D14ZC3H14SD5.3 STR loci were found to be the most informative and polymorphic STR markers for MAN1B1, ZNF526, GRIK2, TECR, ST3GAL3, and ZC3H14 genes, respectively. We also performed other statistical analyses on these STR markers and found that all of the 17 STRs were polymorphic and met the Hardy-Weinberg equilibrium. Finding novel STRs, with high allele heterozygosity, is one of the most significant outcomes of the present study. These findings can be useful for homozygosity mapping, PGD, and PND practices for the NS-ARID.

  2. Epidemiology and Clinical Presentations of Respiratory Syncytial Virus Subgroups A and B Detected with Multiplex Real-Time PCR.

    Directory of Open Access Journals (Sweden)

    Wenkuan Liu

    Full Text Available Respiratory syncytial virus (RSV is one of the most important pathogenic infections of children and requires in-depth research worldwide, and especially in developing countries. We used a novel multiplex real-time PCR to test 5483 patients (≤ 14 years old hospitalized with respiratory illness in Guangzhou, China, over a 3-year period. Of these patients, 729 were positive for RSV-A (51.2%, 373/729 or RSV-B (48.8%, 356/729, but none was infected with both viruses. Two seasonal peaks in total RSV were detected at the changes from winter to spring and from summer to autumn. RSV-B was dominant in 2013 and RSV-A in 2015, whereas RSV-A and RSV-B cocirculated in 2014. The clinical presentations of 645 RSV-positive patients were analyzed. Bronchiolitis, dyspnea, coryza, vomiting, poor appetite, and diarrhea occurred more frequently in RSV-A-positive than RSV-B-positive patients, whereas chill, headache, myalgia, debility, and rash etc. were more frequent in RSV-B-positive than RSV-A-positive patients, suggesting specific clinical characteristics for RSV-A and RSV-B. Coinfectons with other pathogens were common and diverse. Bronchiolitis, fever (≥ 38°C, and poor appetite were more frequent in patients with single RSV infections than in coinfected patients, suggesting the key pathogenic activity of RSV. Analysis of the relationships between the comparative viral load and clinical presentations showed significant differences in bronchiolitis, fever (≥ 38°C, and rash etc. among patients with different viral loads. This study provides a novel rapid method for detecting RSV subgroups, and provides new insights into the epidemiology and clinical implications of RSV.

  3. Prevalence of sexually transmitted infections among healthy Korean women: implications of multiplex PCR pathogen detection on antibiotic therapy.

    Science.gov (United States)

    Kim, Yoonjung; Kim, Juwon; Lee, Kyung-A

    2014-01-01

    In this study, we investigated the prevalence of sexually transmitted infections (STIs) using multiplex real-time PCR assay in healthy Korean women. We also evaluated the risk factors of STIs, and compared the various factors between the STI-positive and the STI-negative groups. A total of 799 endocervical swab samples from healthy Korean women who visited our hospital for general medical check-ups during January 2012 to October 2012 were included. Eight STIs including Human papillomavirus (HPV), Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Mycoplasma genitalium (MG), Mycoplasma hominis (MH), Ureaplasma urealyticum (UU), Ureaplasma parvum (UP), and Trichomonas vaginalis (TV) were detected using Anyplex II STI-7 Detection assay Detection (Seegene, Seoul, Korea) and Hybrid Capture 2 High-Risk HPV DNA test (Digene Corporation, Gaithersburg, MD, USA) according manufacture's protocols. Ninety-seven (12.1%) subjects were positive for HPV. Of 393 (49.2%) subjects were infected with at least one microorganism and a total of 499 STIs were identified. Among the 393 STI-positive subjects, the proportion of single, double and triple infection was 76.3%, 20.4% and 3.3%, respectively. The median age of the STI-positive group (47 years, range 42-52) was younger than the STI-negative group (49 years, range 43-56; P < 0.001). The infection rate of HPV was significantly higher in the STI-positive group (15.8%, 62/393) than the STI-negative group (8.6%, 35/406) (P = 0.002). Copyright © 2013 Japanese Society of Chemotherapy and the Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  4. Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides.

    Directory of Open Access Journals (Sweden)

    Takao Ito

    Full Text Available Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.

  5. Evaluation of multiplex tandem real-time PCR for detection of Cryptosporidium spp., Dientamoeba fragilis, Entamoeba histolytica, and Giardia intestinalis in clinical stool samples.

    Science.gov (United States)

    Stark, D; Al-Qassab, S E; Barratt, J L N; Stanley, K; Roberts, T; Marriott, D; Harkness, J; Ellis, J T

    2011-01-01

    The aim of this study was to describe the first development and evaluation of a multiplex tandem PCR (MT-PCR) assay for the detection and identification of 4 common pathogenic protozoan parasites, Cryptosporidium spp., Dientamoeba fragilis, Entamoeba histolytica, and Giardia intestinalis, from human clinical samples. A total of 472 fecal samples submitted to the Department of Microbiology at St. Vincent's Hospital were included in the study. The MT-PCR assay was compared to four real-time PCR (RT-PCR) assays and microscopy by a traditional modified iron hematoxylin stain. The MT-PCR detected 28 G. intestinalis, 26 D. fragilis, 11 E. histolytica, and 9 Cryptosporidium sp. isolates. Detection and identification of the fecal protozoa by MT-PCR demonstrated 100% correlation with the RT-PCR results, and compared to RT-PCR, MT-PCR exhibited 100% sensitivity and specificity, while traditional microscopy of stained fixed fecal smears exhibited sensitivities and specificities of 56% and 100% for Cryptosporidium spp., 38% and 99% for D. fragilis, 47% and 97% for E. histolytica, and 50% and 100% for G. intestinalis. No cross-reactivity was detected in 100 stool samples containing various other bacterial, viral, and protozoan species. The MT-PCR assay was able to provide rapid, sensitive, and specific simultaneous detection and identification of the four most important diarrhea-causing protozoan parasites that infect humans. This study also highlights the lack of sensitivity demonstrated by microscopy, and thus, molecular methods such as MT-PCR must be considered the diagnostic methods of choice for enteric protozoan parasites.

  6. Evaluation of Multiplex Tandem Real-Time PCR for Detection of Cryptosporidium spp., Dientamoeba fragilis, Entamoeba histolytica, and Giardia intestinalis in Clinical Stool Samples ▿

    Science.gov (United States)

    Stark, D.; Al-Qassab, S. E.; Barratt, J. L. N.; Stanley, K.; Roberts, T.; Marriott, D.; Harkness, J.; Ellis, J. T.

    2011-01-01

    The aim of this study was to describe the first development and evaluation of a multiplex tandem PCR (MT-PCR) assay for the detection and identification of 4 common pathogenic protozoan parasites, Cryptosporidium spp., Dientamoeba fragilis, Entamoeba histolytica, and Giardia intestinalis, from human clinical samples. A total of 472 fecal samples submitted to the Department of Microbiology at St. Vincent's Hospital were included in the study. The MT-PCR assay was compared to four real-time PCR (RT-PCR) assays and microscopy by a traditional modified iron hematoxylin stain. The MT-PCR detected 28 G. intestinalis, 26 D. fragilis, 11 E. histolytica, and 9 Cryptosporidium sp. isolates. Detection and identification of the fecal protozoa by MT-PCR demonstrated 100% correlation with the RT-PCR results, and compared to RT-PCR, MT-PCR exhibited 100% sensitivity and specificity, while traditional microscopy of stained fixed fecal smears exhibited sensitivities and specificities of 56% and 100% for Cryptosporidium spp., 38% and 99% for D. fragilis, 47% and 97% for E. histolytica, and 50% and 100% for G. intestinalis. No cross-reactivity was detected in 100 stool samples containing various other bacterial, viral, and protozoan species. The MT-PCR assay was able to provide rapid, sensitive, and specific simultaneous detection and identification of the four most important diarrhea-causing protozoan parasites that infect humans. This study also highlights the lack of sensitivity demonstrated by microscopy, and thus, molecular methods such as MT-PCR must be considered the diagnostic methods of choice for enteric protozoan parasites. PMID:21048004

  7. Multiplex Real-Time PCR for Detection of Staphylococcus aureus, mecA and Panton-Valentine Leukocidin (PVL) Genes from Selective Enrichments from Animals and Retail Meat

    Science.gov (United States)

    Velasco, Valeria; Sherwood, Julie S.; Rojas-García, Pedro P.; Logue, Catherine M.

    2014-01-01

    The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL) genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat). The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus), mecA (associated with methicillin resistance) and PVL (virulence factor), and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68–0.88 (from substantial to almost perfect agreement) and 0.29–0.77 (from fair to substantial agreement) for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0–0.49 (from no agreement beyond that expected by chance to moderate agreement) for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA) using

  8. One-Step Multiplex RT-qPCR Assay for the Detection of Peste des petits ruminants virus, Capripoxvirus, Pasteurella multocida and Mycoplasma capricolum subspecies (ssp.) capripneumoniae.

    Science.gov (United States)

    Settypalli, Tirumala Bharani Kumar; Lamien, Charles Euloge; Spergser, Joachim; Lelenta, Mamadou; Wade, Abel; Gelaye, Esayas; Loitsch, Angelika; Minoungou, Germaine; Thiaucourt, Francois; Diallo, Adama

    2016-01-01

    Respiratory infections, although showing common clinical symptoms like pneumonia, are caused by bacterial, viral or parasitic agents. These are often reported in sheep and goats populations and cause huge economic losses to the animal owners in developing countries. Detection of these diseases is routinely done using ELISA or microbiological methods which are being reinforced or replaced by molecular based detection methods including multiplex assays, where detection of different pathogens is carried out in a single reaction. In the present study, a one-step multiplex RT-qPCR assay was developed for simultaneous detection of Capripoxvirus (CaPV), Peste de petits ruminants virus (PPRV), Pasteurella multocida (PM) and Mycoplasma capricolum ssp. capripneumonia (Mccp) in pathological samples collected from small ruminants with respiratory disease symptoms. The test performed efficiently without any cross-amplification. The multiplex PCR efficiency was 98.31%, 95.48%, 102.77% and 91.46% whereas the singleplex efficiency was 93.43%, 98.82%, 102.55% and 92.0% for CaPV, PPRV, PM and Mccp, respectively. The correlation coefficient was greater than 0.99 for all the targets in both multiplex and singleplex. Based on cycle threshold values, intra and inter assay variability, ranged between the limits of 2%-4%, except for lower concentrations of Mccp. The detection limits at 95% confidence interval (CI) were 12, 163, 13 and 23 copies/reaction for CaPV, PPRV, PM and Mccp, respectively. The multiplex assay was able to detect CaPVs from all genotypes, PPRV from the four lineages, PM and Mccp without amplifying the other subspecies of mycoplasmas. The discriminating power of the assay was proven by accurate detection of the targeted pathogen (s) by screening 58 viral and bacterial isolates representing all four targeted pathogens. Furthermore, by screening 81 pathological samples collected from small ruminants showing respiratory disease symptoms, CaPV was detected in 17 samples

  9. One-Step Multiplex RT-qPCR Assay for the Detection of Peste des petits ruminants virus, Capripoxvirus, Pasteurella multocida and Mycoplasma capricolum subspecies (ssp. capripneumoniae.

    Directory of Open Access Journals (Sweden)

    Tirumala Bharani Kumar Settypalli

    Full Text Available Respiratory infections, although showing common clinical symptoms like pneumonia, are caused by bacterial, viral or parasitic agents. These are often reported in sheep and goats populations and cause huge economic losses to the animal owners in developing countries. Detection of these diseases is routinely done using ELISA or microbiological methods which are being reinforced or replaced by molecular based detection methods including multiplex assays, where detection of different pathogens is carried out in a single reaction. In the present study, a one-step multiplex RT-qPCR assay was developed for simultaneous detection of Capripoxvirus (CaPV, Peste de petits ruminants virus (PPRV, Pasteurella multocida (PM and Mycoplasma capricolum ssp. capripneumonia (Mccp in pathological samples collected from small ruminants with respiratory disease symptoms. The test performed efficiently without any cross-amplification. The multiplex PCR efficiency was 98.31%, 95.48%, 102.77% and 91.46% whereas the singleplex efficiency was 93.43%, 98.82%, 102.55% and 92.0% for CaPV, PPRV, PM and Mccp, respectively. The correlation coefficient was greater than 0.99 for all the targets in both multiplex and singleplex. Based on cycle threshold values, intra and inter assay variability, ranged between the limits of 2%-4%, except for lower concentrations of Mccp. The detection limits at 95% confidence interval (CI were 12, 163, 13 and 23 copies/reaction for CaPV, PPRV, PM and Mccp, respectively. The multiplex assay was able to detect CaPVs from all genotypes, PPRV from the four lineages, PM and Mccp without amplifying the other subspecies of mycoplasmas. The discriminating power of the assay was proven by accurate detection of the targeted pathogen (s by screening 58 viral and bacterial isolates representing all four targeted pathogens. Furthermore, by screening 81 pathological samples collected from small ruminants showing respiratory disease symptoms, CaPV was detected in

  10. A Multiplex Real-Time PCR Assay for Identification of Pneumocystis jirovecii, Histoplasma capsulatum, and Cryptococcus neoformans/Cryptococcus gattii in Samples from AIDS Patients with Opportunistic Pneumonia

    Science.gov (United States)

    Gago, Sara; Esteban, Cristina; Valero, Clara; Zaragoza, Óscar; Puig de la Bellacasa, Jorge

    2014-01-01

    A molecular diagnostic technique based on real-time PCR was developed for the simultaneous detection of three of the most frequent causative agents of fungal opportunistic pneumonia in AIDS patients: Pneumocystis jirovecii, Histoplasma capsulatum, and Cryptococcus neoformans/Cryptococcus gattii. This technique was tested in cultured strains and in clinical samples from HIV-positive patients. The methodology used involved species-specific molecular beacon probes targeted to the internal transcribed spacer regions of the rDNA. An internal control was also included in each assay. The multiplex real-time PCR assay was tested in 24 clinical strains and 43 clinical samples from AIDS patients with proven fungal infection. The technique developed showed high reproducibility (r2 of >0.98) and specificity (100%). For H. capsulatum and Cryptococcus spp., the detection limits of the method were 20 and 2 fg of genomic DNA/20 μl reaction mixture, respectively, while for P. jirovecii the detection limit was 2.92 log10 copies/20 μl reaction mixture. The sensitivity in vitro was 100% for clinical strains and 90.7% for clinical samples. The assay was positive for 92.5% of the patients. For one of the patients with proven histoplasmosis, P. jirovecii was also detected in a bronchoalveolar lavage sample. No PCR inhibition was detected. This multiplex real-time PCR technique is fast, sensitive, and specific and may have clinical applications. PMID:24478409

  11. Molecular identification of Pseudoplatystoma sp. fish fillets by Multiplex PCR / Identificação molecular de filés de peixe Pseudoplatystoma sp. por PCR-Multiplex

    Directory of Open Access Journals (Sweden)

    Cátia Maria de Oliveira Lobo

    2014-08-01

    Full Text Available Nuclear and mitochondrial genes were used as molecular markers for verifying the iden-tity of fish fillets marketed as pintado (Pseudoplatystoma corruscans. Based on THE polymorphisms of nuclear DNA (RAG2, globin, and EF1 genes and mitochondrial regions (16S, we examined whether the fillets originated from inbred species of pintado or from hybrids derived from crosses between cachara (P. reticulatum and pintado. Nuclear genes from both species were detected in the analyzed fillets (n = 29. This clearly iden-tified these fish as interspecific hybrids (or F1/first filial generation of the type “cacha-pinta,” resulting from a cross between female cachara and male pintado. These results demonstrate that monitoring fish fillet trading is crucial for detecting discrepancies between the marketed species and related information declared on the label. Species that are frequently hybridized, such as pintado and cachara, require special attention. -------------------------------------------------------------------- Marcadores moleculares (PCR-Multiplex de genes nucleares e mitocondriais foram uti-lizados para verificar a identidade molecular de filés de peixe comercializados como pintado (Pseudoplatystoma corruscans com base em polimorfismos de regiões do DNA nuclear (genes RAG2, globina e EF1 e mitocondriais (16S para verificar se os filés per-tenciam a espécie pura de pintado ou se eram híbridos derivados do cruzamento entre cachara (Pseudoplatystoma reticulatum e pintado (Pseudoplatystoma corruscans. Os filés analisados (n = 29 apresentaram genes nucleares de ambas espécies P. corruscans e P. reticulatum, e desta forma, foram identificados como híbridos interespecíficos ou F1 (primeira geração filial do tipo “cachapinta” resultante do cruzamento entre uma fêmea de cachara e um macho de pintado. Estes resultados mostram que o monitora-mento da comercialização de filés de peixe é fundamental para identificar situações onde

  12. Multiplex, construct-specific, and real-time PCR-based analytical methods for Bt rice with cry1Ac gene.

    Science.gov (United States)

    Randhawa, Gurinder Jit; Singh, Monika

    2012-01-01

    Qualitative and quantitative analytical methods based on PCR for Bacillus thuringiensis (Bt) rice hybrid, namely, MRP 5401 Bt expressing a modified version of the Bt cry1Ac gene, are reported here. Multiplex PCR assays were developed to target the cry1Ac transgene, Cauliflower mosaic virus (CaMV) 35S promoter, Agrobacterium tumefaciens nopaline synthase (nos) terminator, the neomycin phosphotransferase II (nptLL) marker gene, and an endogenous a-tubulin (TubA) gene in Bt rice. The 3.178 kb region of inserted gene construct comprising the region of the CaMV 35S promoter and cry1Ac gene was amplified, and the construct integrity was confirmed by the nested PCR. The LOD for cry1Ac gene-specific simplex PCR was 0.01%, as established using Bt rice DNA dilutions with 100, 10, 1.0, 0.1, 0.05, 0.01, and 0.001% genetically modified trait. A real-time PCR assay was also developed to quantify the cry1Ac gene. The method performance of the reported real-time PCR assay was in line with the acceptance criteria of Codex Alimentarius Commission ALINORM 10/33/23, with LOD and LOQ values of 0.05%. The reliable PCR assays prior to commercial release of Bt rice would facilitate efficient regulatory compliance for identification of genetic trait, labeling requirements, and effective risk assessment and management. They could also address consumers' concerns and legal disputes that may arise.

  13. Multiplex PCR for the simultaneous identification and detection of Meloidogyne incognita, M. enterolobii, and M. javanica using DNA extracted directly from individual galls.

    Science.gov (United States)

    Hu, M X; Zhuo, K; Liao, J L

    2011-11-01

    Meloidogyne incognita, M. enterolobii, and M. javanica are the most widespread species of root-knot nematodes in South China, affecting many economically important crops, ornamental plants, and fruit trees. In this study, one pair of Meloidogyne universal primers was designed and three pairs of species-specific primers were employed successfully to rapidly detect and identify M. incognita, M. enterolobii, and M. javanica by multiplex polymerase chain reaction (PCR) using DNA extracted from individual galls. Multiplex PCR from all M. incognita, M. enterolobii, and M. javanica isolates generated two fragments of ≈500 and 1,000, 500 and 200, and 500 and 700 bp, respectively. The 500-bp fragment is the internal positive control fragment of rDNA 28S D2/D3 resulting from the use of the universal primers. Other Meloidogyne spp. included in this study generated only one fragment of ≈500 bp in size. Using this approach, M. incognita, M. enterolobii, and M. javanica were identified and detected using DNA extracted directly from individual galls containing the Meloidogyne spp. at various stages of their life cycle. Moreover, the percentage of positive PCR amplification increased with nematode development and detection was usually easy after the late stage of the second-stage juvenile. The protocol was applied to galls from naturally infested roots and the results were found to be fast, sensitive, robust, and accurate. This present study is the first to provide a definitive diagnostic tool for M. incognita, M. enterolobii, and M. javanica using DNA extracted directly from individual galls using a one-step multiplex PCR technique.

  14. Detection of viable enterotoxin-producing Bacillus cereus and analysis of toxigenicity from ready-to-eat foods and infant formula milk powder by multiplex PCR.

    Science.gov (United States)

    Zhang, Zhihong; Feng, Lixia; Xu, Hengyi; Liu, Chengwei; Shah, Nagendra P; Wei, Hua

    2016-02-01

    Bacillus cereus is responsible for several outbreaks of foodborne diseases due to its emetic toxin and enterotoxin. Enterotoxins, cytotoxin K (CytK), nonhemolytic enterotoxin (Nhe), and hemolysin BL (Hbl), have been recorded in several diarrheal cases due to food poisoning from B. cereus. The objective of this study was to develop a rapid and accurate method that combines multiplex PCR with propidium monoazide to selectively detect viable cells of enterotoxin-producing B. cereus in milk powder, noodles, and rice, and investigate the distribution of enterotoxins in 62 strains of B. cereus in Jiangxi province, China. The specificity of primers of 3 enterotoxins (i.e., cytK, nheA, and hblD) of B. cereus was verified by inclusivity and exclusivity tests using single PCR. Upon optimization of multiplex PCR conditions, it was found that the detection limit of viable cells was 10(2) cfu/mL of B. cereus in pure culture. By enrichment for 3 or 4 h and propidium monoazide pretreatment, a protocol for detection of viable cells as low as 2.2×10(1) cfu/g in spiked food (e.g., milk powder, noodles, and rice) was established and proved valid even under the interference of non-Bacillus cereus at as high as 10(5) cfu/g. Moreover, the protocol based on multiplex PCR for detection was applied for the analysis of distribution of toxin gene of B. cereus, and the results showed a regional feature for toxin gene distribution, indicating that potential toxigenicity of B. cereus should be evaluated further. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  15. A Multiplex SYBR Green Real-Time PCR Assay for the Detection of Three Colistin Resistance Genes from Cultured Bacteria, Feces, and Environment Samples

    Directory of Open Access Journals (Sweden)

    Jiyun Li

    2017-10-01

    Full Text Available The aim of the study was to develop a multiplex assay for rapid detection of mcr-1, mcr-2, and mcr-3, a group of genes of conferring resistance to colistin mediated by plasmid in Enterobacteriaceae. A SYBR Green based real-time PCR assay has been designed to detect the mcr genes, and applied to cultured bacteria, feces and soil samples. All three mcr genes could be detected with a lower limit of 102 cultured bacteria. This test was highly specific and sensitive, and generated no false-positive results. The assay was also conclusive when applied to feces and soil samples containing mcr-1-positive Escherichia coli, which could facilitate the screening of mcr genes not only in the bacteria, but also directly from the environment. This simple, rapid, sensitive, and specific multiplex assay will be useful for rapid screening of the colistin resistance in both clinical medicine and animal husbandry.

  16. Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

    Science.gov (United States)

    Kim, S A; Park, S H; Lee, S I; Ricke, S C

    2017-12-01

    The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

  17. Multiplex PCR as a tool for the diagnosis of Leishmania spp. kDNA and the gapdh housekeeping gene of mammal hosts.

    Science.gov (United States)

    de Cássia-Pires, Renata; de Melo, Myllena de Fátima Alheiros Dias; Barbosa, Raquel da Hora; Roque, André Luiz Rodrigues

    2017-01-01

    The PCR assays usually employed for Leishmania diagnosis does not simultaneously detect a constitutive gene that would certify the viability of the DNA sample. We present a multiplex PCR approach for the simultaneous diagnosis of the Leishmania sp. kDNA fragment and a catalytic domain segment of a conserved region of the mammalian gapdh gene. The proposed multiplex protocol was designed through in silico PCR. The annealing temperature, concentration of primer pairs, number of cycles, distinct polymerase enzymes and premix kit were defined to achieve an optimal reaction. The DNA detection sensitivity was tested with different concentrations of known L. tropica DNA, and the reproducibility of the assay was confirmed using samples from 106 wild mammals that were previously subject to Leishmania sp. kDNA analysis through singleplex reactions. The following optimal conditions were established: 95°C for 1 min followed by 30 cycles of 95°C for 30 s, 61°C for 30 s, and 72°C for 30 s and a final extension at 72°C for 1 min. The multiplex PCR system was capable of detecting 0.1 ng of L. tropica diluted in 100 ng of mammalian DNA. Of 51 kDNA samples that were previously found to be positive, 45 (88.2%) were positive for both targets, two were positive only for kDNA and four were negative for both. Of 55 kDNA samples that were previously identified as negative, 38 (69.1%) were positive for gapdh whereas the other 17 were negative for both targets. The proposed multiplex PCR system allows the simultaneous detection of the gapdh gene and Leishmania sp. kDNA in tissue samples derived from distinct wild mammal species. The amplification of the gapdh mammalian gene in the same reaction ensures the quality and viability of the DNA in the sample, eliminating the possibility of false-negative results that would impair an accurate description of the infection rates in a given population.

  18. A lab-on-a-chip system integrating tissue sample preparation and multiplex RT-qPCR for gene expression analysis in point-of-care hepatotoxicity assessment.

    Science.gov (United States)

    Lim, Geok Soon; Chang, Joseph S; Lei, Zhang; Wu, Ruige; Wang, Zhiping; Cui, Kemi; Wong, Stephen

    2015-10-21

    A truly practical lab-on-a-chip (LOC) system for point-of-care testing (POCT) hepatotoxicity assessment necessitates the embodiment of full-automation, ease-of-use and "sample-in-answer-out" diagnostic capabilities. To date, the reported microfluidic devices for POCT hepatotoxicity assessment remain rudimentary as they largely embody only semi-quantitative or single sample/gene detection capabilities. In this paper, we describe, for the first time, an integrated LOC system that is somewhat close to a practical POCT hepatotoxicity assessment device - it embodies both tissue sample preparation and multiplex real-time RT-PCR. It features semi-automation, is relatively easy to use, and has "sample-in-answer-out" capabilities for multiplex gene expression analysis. Our tissue sample preparation module incorporating both a microhomogenizer and surface-treated paramagnetic microbeads yielded high purity mRNA extracts, considerably better than manual means of extraction. A primer preloading surface treatment procedure and the single-loading inlet on our multiplex real-time RT-PCR module simplify off-chip handling procedures for ease-of-use. To demonstrate the efficacy of our LOC system for POCT hepatotoxicity assessment, we perform a preclinical animal study with the administration of cyclophosphamide, followed by gene expression analysis of two critical protein biomarkers for liver function tests, aspartate transaminase (AST) and alanine transaminase (ALT). Our experimental results depict normalized fold changes of 1.62 and 1.31 for AST and ALT, respectively, illustrating up-regulations in their expression levels and hence validating their selection as critical genes of interest. In short, we illustrate the feasibility of multiplex gene expression analysis in an integrated LOC system as a viable POCT means for hepatotoxicity assessment.

  19. Multiplex real-time PCR assay for detection of Escherichia coli O157:H7 and screening for non-O157 Shiga toxin-producing E. coli.

    Science.gov (United States)

    Li, Baoguang; Liu, Huanli; Wang, Weimin

    2017-11-09

    Shiga toxin-producing Escherichia coli (STEC), including E. coli O157:H7, are responsible for numerous foodborne outbreaks annually worldwide. E. coli O157:H7, as well as pathogenic non-O157:H7 STECs, can cause life-threating complications, such as bloody diarrhea (hemolytic colitis) and hemolytic-uremic syndrome (HUS). Previously, we developed a real-time PCR assay to detect E. coli O157:H7 in foods by targeting a unique putative fimbriae protein Z3276. To extend the detection spectrum of the assay, we report a multiplex real-time PCR assay to specifically detect E. coli O157:H7 and screen for non-O157 STEC by targeting Z3276 and Shiga toxin genes (stx1 and stx2). Also, an internal amplification control (IAC) was incorporated into the assay to monitor the amplification efficiency. The multiplex real-time PCR assay was developed using the Life Technology ABI 7500 System platform and the standard chemistry. The optimal amplification mixture of the assay contains 12.5 μl of 2 × Universal Master Mix (Life Technology), 200 nM forward and reverse primers, appropriate concentrations of four probes [(Z3276 (80 nM), stx1 (80 nM), stx2 (20 nM), and IAC (40 nM)], 2 μl of template DNA, and water (to make up to 25 μl in total volume). The amplification conditions of the assay were set as follows: activation of TaqMan at 95 °C for 10 min, then 40 cycles of denaturation at 95 °C for 10 s and annealing/extension at 60 °C for 60 s. The multiplex assay was optimized for amplification conditions. The limit of detection (LOD) for the multiplex assay was determined to be 200 fg of bacterial DNA, which is equivalent to 40 CFU per reaction which is similar to the LOD generated in single targeted PCRs. Inclusivity and exclusivity determinants were performed with 196 bacterial strains. All E. coli O157:H7 (n = 135) were detected as positive and all STEC strains (n = 33) were positive for stx1, or stx2, or stx1 and stx2 (Table 1). No cross reactivity was detected with Salmonella

  20. Evaluation of a Commercial Multiplex PCR Assay for Detection of Pathogen DNA in Blood from Patients with Suspected Sepsis.

    Science.gov (United States)

    Ziegler, Ingrid; Fagerström, Anna; Strålin, Kristoffer; Mölling, Paula

    2016-01-01

    The Magicplex Sepsis Real-time Test (MST) is a commercial multiplex PCR that can detect more than 90 different pathogens in blood, with an analysis time of six hours. The aim of the present study was to evaluate this method for the detection of bloodstream infection (BSI). An EDTA whole blood sample for MST was collected together with blood cultures (BC) from patients with suspected sepsis at the Emergency Department of a university hospital. Among 696 study patients, 322 (46%) patients were positive with at least one method; 128 (18%) were BC positive and 268 (38%) were MST positive. Considering BC to be the gold standard, MST had an overall sensitivity of 47%, specificity of 66%, positive predictive value (PPV) of 23%, and a negative predictive value of 87%. Among the MST positive samples with a negative BC, coagulase-negative staphylococci (CoNS) and species that rarely cause community-acquired BSI were frequently noted. However, the quantification cycle (Cq) values of the MST+/BC- results were often high. We thus hypothesized that the performance of the MST test could be improved if the Cq cut-off level was adjusted downwards. With a lower Cq cut-off value, i.e. 6.0 for Staphylococcus species and 9.0 for all other species, the number of MST positive cases decreased to 83 (12%) and the overall sensitivity decreased to 38%. However, the PPV increased to 59% and the specificity increased to 96%, as many MST positive results for CoNS and bacteria that rarely cause community-acquired BSI turned MST negative. In conclusion, our study shows that with a lower Cq cut-off value, the MST will detect less contaminants and findings with unclear relevance, but to the cost of a lower sensitivity. Consequently, we consider that a positive MST results with a Cq value above the adjusted cut-off should be interpreted with caution, as the result might be clinically irrelevant. In a correspondent way, quantitative results could probably be useful in the interpretation of positive

  1. One-step multiplex real time RT-PCR for the detection of bovine respiratory syncytial virus, bovine herpesvirus 1 and bovine parainfluenza virus 3

    Directory of Open Access Journals (Sweden)

    Thonur Leenadevi

    2012-03-01

    Full Text Available Abstract Background Detection of respiratory viruses in veterinary species has traditionally relied on virus detection by isolation or immunofluorescence and/or detection of circulating antibody using ELISA or serum neutralising antibody tests. Multiplex real time PCR is increasingly used to diagnose respiratory viruses in humans and has proved to be superior to traditional methods. Bovine respiratory disease (BRD is one of the most common causes of morbidity and mortality in housed cattle and virus infections can play a major role. We describe here a one step multiplex reverse transcriptase quantitative polymerase chain reaction (mRT-qPCR to detect the viruses commonly implicated in BRD. Results A mRT-qPCR assay was developed and optimised for the simultaneous detection of bovine respiratory syncytial virus (BRSV, bovine herpes virus type 1 (BoHV-1 and bovine parainfluenza virus type 3 (BPI3 i & ii nucleic acids in clinical samples from cattle. The assay targets the highly conserved glycoprotein B gene of BoHV-1, nucleocapsid gene of BRSV and nucleoprotein gene of BPI3. This mRT-qPCR assay was assessed for sensitivity, specificity and repeatability using in vitro transcribed RNA and recent field isolates. For clinical validation, 541 samples from clinically affected animals were tested and mRT-qPCR result compared to those obtained by conventional testing using virus isolation (VI and/or indirect fluorescent antibody test (IFAT. Conclusions The mRT-qPCR assay was rapid, highly repeatable, specific and had a sensitivity of 97% in detecting 102 copies of BRSV, BoHV-1 and BPI3 i & ii. This is the first mRT-qPCR developed to detect the three primary viral agents of BRD and the first multiplex designed using locked nucleic acid (LNA, minor groove binding (MGB and TaqMan probes in one reaction mix. This test was more sensitive than both VI and IFAT and can replace the aforesaid methods for virus detection during outbreaks of BRD.

  2. Solid-phase PCR for rapid multiplex detection of Salmonella spp. at the subspecies level, with amplification efficiency comparable to conventional PCR

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    Solid-phase PCR (SP-PCR) has attracted considerable interest in different research fields since it allows parallel DNA amplification on the surface of a solid substrate. However, the applications of SP-PCR have been hampered by the low efficiency of the solid-phase amplification. In order...

  3. Response surface methodology to design a selective co-enrichment broth of Escherichia coli, Salmonella spp. and Staphylococcus aureus for simultaneous detection by multiplex PCR.

    Science.gov (United States)

    Zhang, Qiao Yan; Zhou, Wen Wu; Zhou, Yu; Wang, Xiao Fu; Xu, Jun Feng

    2012-07-25

    Escherichia coli, Salmonella spp. and Staphylococcus aureus are frequent co-visitors of contaminated foods to cause food-borne diseases. To achieve rapid detection of three organisms by multiplex PCR, a selective co-enrichment broth was considered to design using response surface methodology (RSM) in this work. NaCl, LiCl and KSCN as selective bacterial inhibitors were selected to optimize their concentrations for a matched composition of bacterial biomass with uniform amplification of three targets. Central composite design was employed to collect the data and fit the responses. Three quadratic polynomial models were derived by computer simulation. A statistical analysis was carried out to explore the effects of the variables on the composition of bacterial biomass and PCR amplification yields. In the end, a novel broth (ESS-3 broth) of NaCl 1.60%, LiCl 0.70%, KSCN 0.10% was formulated to allow co-enrichment of the target pathogens and suppress growth of some non-target pathogens. The simultaneous detection of E. coli, Salmonella spp. and S. aureus was developed on a rapid, convenient and sensitive method consisting of selective co-enrichment in ESS-3 broth, DNA extraction with the boiling method and robust test by multiplex PCR. Our work provided broader application of RSM for the simultaneous detection of other combinations of multiple pathogens. Copyright © 2012 Elsevier GmbH. All rights reserved.

  4. The Current Incidence of Viral Disease in Korean Sweet Potatoes and Development of Multiplex RT-PCR Assays for Simultaneous Detection of Eight Sweet Potato Viruses

    Directory of Open Access Journals (Sweden)

    Hae-Ryun Kwak

    2014-12-01

    Full Text Available Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV and sweet potato virus C (SPVC were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1, Sweet potato virus G (SPVG, Sweet potato leaf curl virus (SPLCV, Sweet potato virus 2 ( SPV2, Sweet potato chlorotic fleck virus (SPCFV, and Sweet potato latent virus (SPLV were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1 in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

  5. Simultaneous detection and differentiation of three Potyviridae viruses in sweet potato by a multiplex TaqMan real time RT-PCR assay.

    Science.gov (United States)

    Lan, Pingxiu; Li, Fan; Abad, Jorge; Pu, Lingling; Li, Ruhui

    2018-02-01

    A multiplex TaqMan real time RT-PCR was developed for detection and differentiation of Sweet potato virus G, Sweet potato latent virus and Sweet potato mild mottle virus in one tube. Amplification and detection of a fluorogenic cytochrome oxidase gene was included as an internal control. The assay was compared with a multiplex RT-PCR developed in the initial study for the detection and differentiation of the three viruses and host 18S rRNA. Primers and/or probes of the two assays were designed from conserved regions of each virus. The two assays were optimized for primers/probes and primer concentrations and thermal cycling conditions. Sensitivity and specificity of the assays were compared each other and with other assay. Both assays were evaluated by 74 field samples original from five different provinces of China. showed that the TaqMan real time RT-PCR offered rapid, sensitive, effective and reliable for the simultaneous detection and differentiation of the three viruses in sweet potato plants. The assay will be useful to quarantine and certification programs and virus surveys when large numbers of samples are tested. Copyright © 2017. Published by Elsevier B.V.

  6. The current incidence of viral disease in korean sweet potatoes and development of multiplex rt-PCR assays for simultaneous detection of eight sweet potato viruses.

    Science.gov (United States)

    Kwak, Hae-Ryun; Kim, Mi-Kyeong; Shin, Jun-Chul; Lee, Ye-Ji; Seo, Jang-Kyun; Lee, Hyeong-Un; Jung, Mi-Nam; Kim, Sun-Hyung; Choi, Hong-Soo

    2014-12-01

    Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV) and sweet potato virus C (SPVC) were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1), Sweet potato virus G (SPVG), Sweet potato leaf curl virus (SPLCV), Sweet potato virus 2 ( SPV2), Sweet potato chlorotic fleck virus (SPCFV), and Sweet potato latent virus (SPLV) were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1) in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

  7. Development of Multiplex-Mismatch Amplification Mutation-PCR Assay for Simultaneous Detection of Campylobacter jejuni and Mutation in gyrA Gene Related to Fluoroquinolone Resistance.

    Science.gov (United States)

    Cui, Mingquan; Wu, Chenbin; Zhang, Peng; Wu, Congming

    2016-11-01

    Campylobacter jejuni, a foodborne pathogen, is the major cause of enteritis in humans worldwide, however, its increasing resistance to fluoroquinolones reported recently is of a major concern. In the present study, multiplex-mismatch amplification mutation assay-polymerase chain reaction (MMAMA-PCR) was developed for the first time with the aim to quickly identify C. jejuni and to detect the single nucleotide mutation (C-257 to T) frequently observed in gyrA gene, associated with the acquisition of resistance to fluoroquinolones. In this assay, mismatch amplification mutation primers for the detection of gyrA mutation in C. jejuni were coupled with primers for the hip gene encoding for hippuricase and 16S rRNA gene of C. jejuni, respectively, in the multiplex PCR assay. The specificity and accuracy of this method were analyzed by the use of 78 C. jejuni strains with previously confirmed resistance phenotypes and the mutation (C-257 to T) in gyrA gene, as well as 107 clinical isolates of various bacterial species, including 29 C. jejuni isolates. This study indicates that MMAMA-PCR is a promising assay for the rapid identification of C. jejuni with a specific mutation in gyrA gene, responsible for the resistance to fluoroquinolones.

  8. PCR

    African Journals Online (AJOL)

    sunny

    (5'-. MGATAAGRTGTAATCCW-3') and. (5'-. TGGAAGCCATCATCGACGAAGCCAT-3') were designed to amplify a new partial rbcS gene by PCR. About 400 bp DNA fragment was obtained by PCR. This DNA fragment was cloned into the pMD18-T vector. (TakaRa) for sequencing. Sequence analysis of this DNA fragment.

  9. One-step Multiplex RT-PCR Method for Simultaneous Detection of Seed Transmissible Bacterium and Virus Occurring on Brassicaceae Crop Seeds

    Directory of Open Access Journals (Sweden)

    Kyusik Jeong

    2011-04-01

    Full Text Available The aim of this research was to develop specific and sensitive PCR-based procedures for simultaneous detection of economically important plant pathogenic bacteria and seed borne virus in commercial Brassicaceae crop seeds, Xanthomonns campestris pv. campestris (Xcc and Lettuce Mosaic Virus (LMV. Bacterial and virus diseases of Brassicaceae leaves are responsible for heavy losses. PCR with arbitral primers: selection of specific primers, performance of PCR with specific primers and determination of the threshold level for pathogens detection. To detect simultaneously the Xcc and LMV in commercial Brassicaceae crop seeds (lettuce, kohlrabi, radish, chinese cabbage and cabbage, two pairs of specific primer (LMV-F/R, Xcc-F/R were synthesized by using primer-blast program (http://www.ncbi.nlm.nih.gov/tools/ primer-blast/. The multiplex PCR for the two pathogens in Brassicaceae crop seeds could detect specifically without interference among primers and/or cDNA of other plant pathogens. The pathogen detection limit was determined at 1 ng of RNA extracted from pathogens. In the total PCR results for pathogen detection using commercial kohlrabi (10 varieties, lettuce (50 varieties, radish (20 varieties, chinese cabbage (20 varieties and cabbage (20 varieties, LMV and Xcc were detected from 39 and 2 varieties, respectively. In the PCR result of lettuce, LMV and Xcc were simultaneously detected in 8 varieties.

  10. [Multiplex PCR for the detection of sea, seb, sec, sed and see genes of Staphylococcus aureus. Characterization of isolates from food].

    Science.gov (United States)

    Manfredi, E A; Leotta, G A; Rivas, M

    2010-01-01

    Multiplex PCR for the detection of sea, seb, sec, sed and see genes of Staphylococcus aureus. Characterization of isolates from food. The presence of Staphylococcus aureus in food represents a potential risk to public health, being its enterotoxins the major virulence factor. Enterotoxin detection can be determined by ELISA, but only for the pool of enterotoxins SEA, SEB, SEC, SED and SEE. The main aims of this study were to optimize two PCR techniques for detection of S. aureus sea, seb, sec, sed and see, and to characterize Staphylococcus spp. isolates associated with food intoxication. Two PCR techniques were optimized and 115 Staphylococcus spp. isolates from Ciudad Aut6noma de Buenos Aires, and Buenos Aires, Córdoba, and Neuquén provinces were characterized. The characterization was performed by biochemical tests, ELISA and PCR. Sixty-eight isolates (59.1%) were positive by ELISA, while 61 (53%) were positive by PCR. Out of the positive PCR isolates, 34 (55.7%) carried the sea gene, 9 (14.8%) the seb gene, 5 (8.1%) the see gene, 4 (6.5%) the sec gene, 6 (9.9%) were positive for sea and seb genes, 2 (3.3%) for sea and sec genes, and 1 (1.7%) for sea and sedgenes. This is the first study of genotypic characterization of S. aureus isolates associated with food intoxication from different provinces of Argentina.

  11. Identification of the capsule type of Pasteurella multocida isolates from cases of fowl cholera by multiplex PCR and comparison with phenotypic methods

    Directory of Open Access Journals (Sweden)

    TQ Furian

    2014-06-01

    Full Text Available The ability of Pasteurella multocida to invade and multiply in its host is enhanced by the presence of the capsule, one of the most important virulence factors for this bacterium. Capsular typing methods are often used in epidemiological and pathogenesis studies of this agent. Five different serogroups have been identified based on serological typing. However, such tests are laborious, and agglutination of homologous antiserum may fail. The aim of this study was to develop a multiplex PCR protocol for the identification of the hyaD-hyaC and dcbF genes specific to serogroups A and D, respectively, and to compare these results with those of phenotypic tests for 54 strains isolated from fowl cholera cases in southern Brazil. The kappa coefficient and chisquare statistics were calculated to assess the agreement between the diagnostic methods and to determine the significance of the results, respectively. The multiplex PCR was able to detect the evaluated genes. Forty-nine strains (90.74% were classified into serogroup A, and only two isolates (3.7% were not identified as belonging to any of the serogroups analyzed. In contrast, with the phenotypic tests, only 41 strains (75.93% were classified into serogroup A and 11 samples (20.37% were unidentifiable. Of the strains analyzed, 70.37% were classified into the same serogroup (A by both methods, and the kappa coefficient (k = 0.017 indicated poor agreement between the tests. Thus, multiplex PCR is an alternative for P. multocida capsular typing, as it allows the simultaneous and rapid detection of genes and also provides a greater strain-typing capacity.

  12. Comparison of three multiplex PCR assays for detection of respiratory viruses: Anyplex II RV16, AdvanSure RV, and Real-Q RV.

    Science.gov (United States)

    Yun, Seung Gyu; Kim, Min Young; Choi, Jong Moon; Lee, Chang Kyu; Lim, Chae Seung; Cho, Yunjung; Suh, In Bum

    2017-04-11

    Due to its great sensitivity, the nucleic acid amplification test (NAAT) is widely used for detection of respiratory viruses (RV). However, few reports have described a direct comparison between multiplex RT-PCR assays for RV. The objective of this study was to perform a direct comparison of three multiplex RT-PCR assays for the detection of respiratory viruses. A total of 201 respiratory samples (161 nasopharyngeal swab samples and 40 sputum samples) were tested with three commercial RV assays: Seegene Anyplex II RV16 (AP), LG AdvanSure RV (AD), and Biosewoom Real-Q RV (RQ). The additional tests for the discrepant results were conducted by repeat RV assay or monoplex PCR coupled direct sequencing. Data analysis using percent agreement, kappa, and prevalence-adjusted and bias-adjusted kappa (PABAK) values was performed for comparisons among the three RV assays. Of the 201 samples, AP, AD, and RQ detected 105 (52.2%), 99 (49.3%), and 95 (47.3%) positive cases respectively. The overall agreement, kappa, and PABAK values for the three assays ranged between 97%-98%, 0.76-0.86, and 0.93-0.96 respectively. The performance of the three assays was very similar, with 94%-100% agreement for all comparisons, each virus types. The additional testing of samples showed discrepant results demonstrating that AD assay had the highest rate of concordance with original results. We suggest that all multiplex assay would be suitable for the detection of for respiratory viruses in clinical setting. © 2017 The Authors Journal of Clinical Laboratory Analysis Published by Wiley Periodicals, Inc.

  13. Multiplex PCR technique could be an alternative approach for early detection of leprosy among close contacts - a pilot study from India

    Directory of Open Access Journals (Sweden)

    Banerjee Surajita

    2010-08-01

    Full Text Available Abstract Background Implementation of Multi drug Therapy (MDT regimen has resulted in the decline of the total number of leprosy cases in the world. Though the prevalence rate has been declining, the incidence rate remains more or less constant and high in South East Asian countries particularly in India, Nepal, Bangladesh, Pakistan and Srilanka. Leprosy, particularly that of multibacillary type spreads silently before it is clinically detected. An early detection and treatment would help to prevent transmission in the community. Multiplex PCR (M-PCR technique appears to be promising towards early detection among contacts of leprosy cases. Methods A total of 234 paucibacillary (PB and 205 multibacillary (MB leprosy cases were studied in a community of an endemic area of Bankura district of West Bengal (Eastern India. They were assessed by smear examination for acid-fast bacilli (AFB and M-PCR technique. These patients were treated with Multidrug Therapy (MDT as prescribed by WHO following detection. A total of 110 MB and 72 PB contacts were studied by performing M-PCR in their nasal swab samples. Results 83.4% of MB patients were observed to be positive by smear examination for AFB and 89.2% by M-PCR. While 22.2% of PB patients were found to be positive by smear examination for AFB, 80.3% of these patients were positive by M-PCR. Among leprosy contacts (using M-PCR, 10.9% were found to be positive among MB contacts and 1.3% among PB contacts. Interestingly, two contacts of M-PCR positive MB cases developed leprosy during the period of two years follow up. Conclusion The M-PCR technique appears to be an efficient tool for early detection of leprosy cases in community based contact tracing amongst close associates of PB and MB cases. Early contact tracing using a molecular biology tool can be of great help in curbing the incidence of leprosy further.

  14. Empirical evaluation of humpback whale telomere length estimates; quality control and factors causing variability in the singleplex and multiplex qPCR methods.

    Science.gov (United States)

    Olsen, Morten Tange; Bérubé, Martine; Robbins, Jooke; Palsbøll, Per J

    2012-09-06

    Telomeres, the protective cap of chromosomes, have emerged as powerful markers of biological age and life history in model and non-model species. The qPCR method for telomere length estimation is one of the most common methods for telomere length estimation, but has received recent critique for being too error-prone and yielding unreliable results. This critique coincides with an increasing awareness of the potentials and limitations of the qPCR technique in general and the proposal of a general set of guidelines (MIQE) for standardization of experimental, analytical, and reporting steps of qPCR. In order to evaluate the utility of the qPCR method for telomere length estimation in non-model species, we carried out four different qPCR assays directed at humpback whale telomeres, and subsequently performed a rigorous quality control to evaluate the performance of each assay. Performance differed substantially among assays and only one assay was found useful for telomere length estimation in humpback whales. The most notable factors causing these inter-assay differences were primer design and choice of using singleplex or multiplex assays. Inferred amplification efficiencies differed by up to 40% depending on assay and quantification method, however this variation only affected telomere length estimates in the worst performing assays. Our results suggest that seemingly well performing qPCR assays may contain biases that will only be detected by extensive quality control. Moreover, we show that the qPCR method for telomere length estimation can be highly precise and accurate, and thus suitable for telomere measurement in non-model species, if effort is devoted to optimization at all experimental and analytical steps. We conclude by highlighting a set of quality controls which may serve for further standardization of the qPCR method for telomere length estimation, and discuss some of the factors that may cause variation in qPCR experiments.

  15. Empirical evaluation of humpback whale telomere length estimates; quality control and factors causing variability in the singleplex and multiplex qPCR methods

    Directory of Open Access Journals (Sweden)

    Olsen Morten

    2012-09-01

    Full Text Available Abstract Background Telomeres, the protective cap of chromosomes, have emerged as powerful markers of biological age and life history in model and non-model species. The qPCR method for telomere length estimation is one of the most common methods for telomere length estimation, but has received recent critique for being too error-prone and yielding unreliable results. This critique coincides with an increasing awareness of the potentials and limitations of the qPCR technique in general and the proposal of a general set of guidelines (MIQE for standardization of experimental, analytical, and reporting steps of qPCR. In order to evaluate the utility of the qPCR method for telomere length estimation in non-model species, we carried out four different qPCR assays directed at humpback whale telomeres, and subsequently performed a rigorous quality control to evaluate the performance of each assay. Results Performance differed substantially among assays and only one assay was found useful for telomere length estimation in humpback whales. The most notable factors causing these inter-assay differences were primer design and choice of using singleplex or multiplex assays. Inferred amplification efficiencies differed by up to 40% depending on assay and quantification method, however this variation only affected telomere length estimates in the worst performing assays. Conclusion Our results suggest that seemingly well performing qPCR assays may contain biases that will only be detected by extensive quality control. Moreover, we show that the qPCR method for telomere length estimation can be highly precise and accurate, and thus suitable for telomere measurement in non-model species, if effort is devoted to optimization at all experimental and analytical steps. We conclude by highlighting a set of quality controls which may serve for further standardization of the qPCR method for telomere length estimation, and discuss some of the factors that may cause

  16. A novel, multiplex, real-time PCR-based approach for the detection of the commonly occurring pathogenic fungi and bacteria.

    Science.gov (United States)

    Horváth, Ádám; Pető, Zoltán; Urbán, Edit; Vágvölgyi, Csaba; Somogyvári, Ferenc

    2013-12-23

    Polymerase chain reaction (PCR)-based techniques are widely used to identify fungal and bacterial infections. There have been numerous reports of different, new, real-time PCR-based pathogen identification methods although the clinical practicability of such techniques is not yet fully clarified.The present study focuses on a novel, multiplex, real-time PCR-based pathogen identification system developed for rapid differentiation of the commonly occurring bacterial and fungal causative pathogens of bloodstream infections. A multiplex, real-time PCR approach is introduced for the detection and differentiation of fungi, Gram-positive (G+) and Gram-negative (G-) bacteria. The Gram classification is performed with the specific fluorescence resonance energy transfer (FRET) probes recommended for LightCycler capillary real-time PCR. The novelty of our system is the use of a non-specific SYBR Green dye instead of labelled anchor probes or primers, to excite the acceptor dyes on the FRET probes. In conjunction with this, the use of an intercalating dye allows the detection of fungal amplicons.With the novel pathogen detection system, fungi, G + and G- bacteria in the same reaction tube can be differentiated within an hour after the DNA preparation via the melting temperatures of the amplicons and probes in the same tube. This modified FRET technique is specific and more rapid than the gold-standard culture-based methods. The fact that fungi, G + and G- bacteria were successfully identified in the same tube within an hour after the DNA preparation permits rapid and early evidence-based management of bloodstream infections in clinical practice.

  17. Rapid and not culture-dependent assay based on multiplex PCR-SSR analysis for monitoring inoculated yeast strains in industrial wine fermentations.

    Science.gov (United States)

    Cordero-Bueso, Gustavo; Rodríguez, María Esther; Garrido, Carlos; Cantoral, Jesús Manuel

    2017-01-01

    Wine industry needs a simple method for rapid diagnosis of the dominance of inoculated strains that could be performed routinely during the fermentation process. We present a suitable, high-throughput, and low-cost method to monitor rapidly the dominance of inoculated yeast strains in industrial fermentations of red and white wines using an activated carbon cleaning pretreatment, and a rapid DNA extraction method plus multiplex PCR-SSR analysis. We apply this technique directly to samples of fermenting wines without previously isolating yeast colonies. Results are obtained in a maximum time of 4.5 h.

  18. Multiplex quantitative PCR for detection of lower respiratory tract infection and meningitis caused by Streptococcus pneumoniae, Haemophilus influenzae and Neisseria meningitidis

    Directory of Open Access Journals (Sweden)

    Welinder-Olsson Christina

    2010-12-01

    Full Text Available Abstract Background Streptococcus pneumoniae and Haemophilus influenzae cause pneumonia and as Neisseria meningitidis they are important agents of meningitis. Although several PCR methods have been described for these bacteria the specificity is an underestimated problem. Here we present a quantitative multiplex real-time PCR (qmPCR for detection of S. pneumoniae (9802 gene fragment, H. influenzae (omp P6 gene and N. meningitidis (ctrA gene. The method was evaluated on bronchoalveolar lavage (BAL samples from 156 adults with lower respiratory tract infection (LRTI and 31 controls, and on 87 cerebrospinal fluid (CSF samples from meningitis patients. Results The analytical sensitivity was not affected by using a combined mixture of reagents and a combined DNA standard (S. pneumoniae/H. influenzae/N. meningitidis in single tubes. By blood- and BAL-culture and S. pneumoniae urinary antigen test, S. pneumoniae and H. influenzae were aetiological agents in 21 and 31 of the LTRI patients, respectively. These pathogens were identified by qmPCR in 52 and 72 of the cases, respectively, yielding sensitivities and specificities of 95% and 75% for S. pneumoniae, and 90% and 65% for H. influenzae, respectively. When using a cut-off of 105 genome copies/mL for clinical positivity the sensitivities and specificities were 90% and 80% for S. pneumoniae, and 81% and 85% for H. influenzae, respectively. Of 44 culture negative but qmPCR positive for H. influenzae, 41 were confirmed by fucK PCR as H. influenzae. Of the 103 patients who had taken antibiotics prior to sampling, S. pneumoniae and H. influenzae were identified by culture in 6% and 20% of the cases, respectively, and by the qmPCR in 36% and 53% of the cases, respectively. In 87 CSF samples S. pneumoniae and N. meningitidis were identified by culture and/or 16 S rRNA in 14 and 10 samples and by qmPCR in 14 and 10 samples, respectively, giving a sensitivity of 100% and a specificity of 100% for both