Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

Science.gov (United States)

Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

2002-01-01

AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

DNA Differential Diagnosis of Taeniasis and Cysticercosis by Multiplex PCR

Science.gov (United States)

Yamasaki, Hiroshi; Allan, James C.; Sato, Marcello Otake; Nakao, Minoru; Sako, Yasuhito; Nakaya, Kazuhiro; Qiu, Dongchuan; Mamuti, Wulamu; Craig, Philip S.; Ito, Akira

2004-01-01

Multiplex PCR was established for differential diagnosis of taeniasis and cysticercosis, including their causative agents. For identification of the parasites, multiplex PCR with cytochrome c oxidase subunit 1 gene yielded evident differential products unique for Taenia saginata and Taenia asiatica and for American/African and Asian genotypes of Taenia solium with molecular sizes of 827, 269, 720, and 984 bp, respectively. In the PCR-based detection of tapeworm carriers using fecal samples, the diagnostic markers were detected from 7 of 14 and 4 of 9 T. solium carriers from Guatemala and Indonesia, respectively. Test sensitivity may have been reduced by the length of time (up to 12 years) that samples were stored and/or small sample volumes (ca. 30 to 50 mg). However, the diagnostic markers were detected by nested PCR in five worm carriers from Guatemalan cases that were found to be negative by multiplex PCR. It was noteworthy that a 720 bp-diagnostic marker was detected from a T. solium carrier who was egg-free, implying that it is possible to detect worm carriers and treat before mature gravid proglottids are discharged. In contrast to T. solium carriers, 827-bp markers were detected by multiplex PCR in all T. saginata carriers. The application of the multiplex PCR would be useful not only for surveillance of taeniasis and cysticercosis control but also for the molecular epidemiological survey of these cestode infections. PMID:14766815

Practical implementation of a multiplex PCR for acute respiratory tract infections in children

NARCIS (Netherlands)

Gruteke, Paul; Glas, Afina S.; Dierdorp, Mirjam; Vreede, Willem B.; Pilon, Jan-Willem; Bruisten, Sylvia M.

2004-01-01

Molecular testing for acute respiratory infections (ARIs) has documented value but limited implementation due to questions that typically slow the acceptance of new tests. This study sought to address these questions and achieve implementation. Rhinovirus was added to a nested multiplex PCR (M-PCR),

Molecular diagnosis of Salmonella typhi and its virulence in suspected typhoid blood samples through nested multiplex PCR.

Science.gov (United States)

Prabagaran, Solai Ramatchandirane; Kalaiselvi, Vellingiri; Chandramouleeswaran, Naganathan; Deepthi, Krishnan Nair Geetha; Brahmadathan, Kootallur Narayanan; Mani, Mariappa

2017-08-01

A nested multiplex polymerase chain reaction (PCR) based diagnosis was developed for the detection of virulent Salmonella typhi in the blood specimens from patients suspected for typhoid fever. After the Widal test, two pairs of primers were used for the detection of flagellin gene (fliC) of S. typhi. Among them, those positive for fliC alone were subjected to identification of genes in Via B operon of Salmonella Pathogenesity Island (SPI-7) where four primer pairs were used to detect tviA and tviB genes. Among 250 blood samples tested, 115 were positive by fliC PCR; 22 of these were negative for tviA and tviB. Hence, the method described here can be used to diagnose the incidence of Vi-negative serovar typhi especially in endemic regions where the Vi vaccine is administered. Copyright © 2017 Elsevier B.V. All rights reserved.

Detection and Typing of Human Papilloma Viruses by Nested Multiplex Polymerase Chain Reaction Assay in Cervical Cancer

Science.gov (United States)

Jalal Kiani, Seyed; Shatizadeh Malekshahi, Somayeh; Yousefi Ghalejoogh, Zohreh; Ghavvami, Nastaran; Shafiei Jandaghi, Nazanin Zahra; Shahsiah, Reza; Jahanzad, Isa; Yavarian, Jila

2015-01-01

Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have developed a multiplex PCR for simultaneous detection and typing of different HPVs. Objectives: The aim of the present study was to investigate the prevalence of HPV infection and its types in cervical Squamous Cell Carcinoma (SCC) using the Nested Multiplex PCR (NMPCR) assay. Patients and Methods: Sixty-six samples with histologically confirmed SCC were evaluated. Total DNA was isolated by phenol–chloroform extraction and ethanol precipitation. Nested multiplex PCR was performed with first-round PCR by GP-E6/E7 consensus primers for amplification of the genomic DNA of all known mucosal HPV genotypes and second-round PCR by type-specific multiplex PCR primer cocktails. Results: Human papilloma virus infection was detected in 78.8% of samples, with the highest prevalence of HPV 16 (60.6%) while concurrent infections with two types was detected in 10.6%. Conclusions: The NMPCR assay is more convenient and easy for analysis of results, which is important for fast diagnosis and patient management, in a type-specific manner. PMID:26865940

Multiplex enrichment quantitative PCR (ME-qPCR): a high-throughput, highly sensitive detection method for GMO identification.

Science.gov (United States)

Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang

2017-04-01

Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for

Interlaboratory study of DNA extraction from multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR for individual kernel detection system of genetically modified maize.

Science.gov (United States)

Akiyama, Hiroshi; Sakata, Kozue; Makiyma, Daiki; Nakamura, Kosuke; Teshima, Reiko; Nakashima, Akie; Ogawa, Asako; Yamagishi, Toru; Futo, Satoshi; Oguchi, Taichi; Mano, Junichi; Kitta, Kazumi

2011-01-01

In many countries, the labeling of grains, feed, and foodstuff is mandatory if the genetically modified (GM) organism content exceeds a certain level of approved GM varieties. We previously developed an individual kernel detection system consisting of grinding individual kernels, DNA extraction from the individually ground kernels, GM detection using multiplex real-time PCR, and GM event detection using multiplex qualitative PCR to analyze the precise commingling level and varieties of GM maize in real sample grains. We performed the interlaboratory study of the DNA extraction with multiple ground samples, multiplex real-time PCR detection, and multiplex qualitative PCR detection to evaluate its applicability, practicality, and ruggedness for the individual kernel detection system of GM maize. DNA extraction with multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR were evaluated by five laboratories in Japan, and all results from these laboratories were consistent with the expected results in terms of the commingling level and event analysis. Thus, the DNA extraction with multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR for the individual kernel detection system is applicable and practicable in a laboratory to regulate the commingling level of GM maize grain for GM samples, including stacked GM maize.

MPprimer: a program for reliable multiplex PCR primer design

Directory of Open Access Journals (Sweden)

Wang Xiaolei

2010-03-01

Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

Multiplex PCR identification of Taenia spp. in rodents and carnivores.

Science.gov (United States)

Al-Sabi, Mohammad N S; Kapel, Christian M O

2011-11-01

The genus Taenia includes several species of veterinary and public health importance, but diagnosis of the etiological agent in definitive and intermediate hosts often relies on labor intensive and few specific morphometric criteria, especially in immature worms and underdeveloped metacestodes. In the present study, a multiplex PCR, based on five primers targeting the 18S rDNA and ITS2 sequences, produced a species-specific banding patterns for a range of Taenia spp. Species typing by the multiplex PCR was compared to morphological identification and sequencing of cox1 and/or 12S rDNA genes. As compared to sequencing, the multiplex PCR identified 31 of 32 Taenia metacestodes from rodents, whereas only 14 cysts were specifically identified by morphology. Likewise, the multiplex PCR identified 108 of 130 adult worms, while only 57 were identified to species by morphology. The tested multiplex PCR system may potentially be used for studies of Taenia spp. transmitted between rodents and carnivores.

A multiplex PCR for detection of six viruses in ducks.

Science.gov (United States)

Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong

2017-10-01

In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.

Detection of adenoviruses in shellfish by means of conventional-PCR, nested-PCR, and integrated cell culture PCR (ICC/PCR).

Science.gov (United States)

Rigotto, C; Sincero, T C M; Simões, C M O; Barardi, C R M

2005-01-01

We tested three PCR based methodologies to detect adenoviruses associated with cultivated oysters. Conventional-PCR, nested-PCR, and integrated cell culture-PCR (ICC/PCR) were first optimized using oysters seeded with know amounts of Adenovirus serotype 5 (Ad5). The maximum sensitivity for Ad5 detection was determined for each method, and then used to detect natural adenovirus contamination in oysters from three aquiculture farms in Florianopolis, Santa Catarina State, Brazil, over a period of 6 months. The results showed that the nested-PCR was more sensitive (limit of detection: 1.2 PFU/g of tissue) than conventional-PCR and ICC-PCR (limit of detection for both: 1.2 x 10(2)PFU/g of tissue) for detection of Ad5 in oyster extracts. Nested-PCR was able to detect 90% of Ad5 contamination in harvested oyster samples, while conventional-PCR was unable to detect Ad5 in any of the samples. The present work suggests that detection of human adenoviruses can be used as a tool to monitor the presence of human viruses in marine environments where shellfish grow, and that nested-PCR is the method of choice.

Evaluation of the efficiency of nested q-PCR in the detection of Mycobacterium tuberculosis complex directly from tuberculosis-suspected lesions in post-mortem macroscopic inspections of bovine carcasses slaughtered in the state of Mato Grosso, Brazil.

Science.gov (United States)

Carvalho, Ricardo César Tavares; Furlanetto, Leone Vinícius; Maruyama, Fernanda Harumy; Araújo, Cristina Pires de; Barros, Sílvia Letícia Bomfim; Ramos, Carlos Alberto do Nascimento; Dutra, Valéria; Araújo, Flábio Ribeiro de; Paschoalin, Vânia Margaret Flosi; Nakazato, Luciano; Figueiredo, Eduardo Eustáquio de Souza

2015-08-01

Bovine tuberculosis (BTB) is a zoonotic disease caused by Mycobacterium bovis, a member of the Mycobacterium tuberculosis complex (MTC). The quick and specific detection of this species is of extreme importance, since BTB may cause economic impacts, in addition to presenting imminent risks to human health. In the present study a nested real-time PCR test (nested q-PCR) was used in post-mortem evaluations to assess cattle carcasses with BTB-suspected lesions. A total of 41,193 cattle slaughtered in slaughterhouses located in the state of Mato Grosso, were examined. Of the examined animals, 198 (0.48%) showed BTB-suspected lesions. M. bovis was isolated in 1.5% (3/198) of the samples. Multiplex-PCR detected MTC in 7% (14/198) of the samples. The nested q-PCR test detected MTC in 28% (56/198) of the BTB-suspected lesions, demonstrating higher efficiency when compared to the multiplex-PCR and conventional microbiology. Nested q-PCR can therefore be used as a complementary test in the national program for control and eradication of bovine tuberculosis. Copyright © 2015 Elsevier Ltd. All rights reserved.

Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.

Science.gov (United States)

Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing

2018-02-01

The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.

Human papillomavirus detection and typing using a nested-PCR-RFLP assay.

Science.gov (United States)

Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo

2011-01-01

It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.

Comparison of multiplex reverse transcription-PCR-enzyme ...

African Journals Online (AJOL)

Comparison of multiplex reverse transcription-PCR-enzyme hybridization assay with immunofluorescence techniques for the detection of four viral respiratory pathogens in pediatric community acquired pneumonia.

Comparison of nested PCR and qPCR for the detection and quantitation of BoHV6 DNA.

Science.gov (United States)

Kubiś, Piotr; Materniak, Magdalena; Kuźmak, Jacek

2013-12-01

Nested PCR and qPCR (quantitative PCR) tests based on glycoprotein B (gB) gene were designed for detecting Bovine herpesvirus 6 (BoHV6) in bovine whole blood samples and wild ruminant blood clots (deer and roe-deer). This virus, commonly known as BLHV (bovine lymphotropic herpesvirus) belongs to the Herpesviridae family, subfamily Gammaherpesvirinae and Macavirus genus. DNA isolated from 92 dairy cow blood samples and 69 wild ruminant clots were examined for the presence of BoHV6 using nested PCR and qPCR tests. Viral DNA was detected by using nested PCR in 59 out of 92 bovine blood samples (64.1%), and by qPCR in 68 out of 92 bovine blood samples (73.9%), but none out of 69 DNA samples isolated from wild ruminant blood clots, was positive in both assays. The specificity of nested PCR and qPCR was confirmed by using BoHV1, BoHV4, BoHV6, BFV, BIV, and BLV DNA. The sensitivity of nested PCR and qPCR was determined using a serially 10-fold diluted vector pCR2.1HgB (2 × 10(0)-2 × 10(6)copies/reaction). In this testing, qPCR was more sensitive than the nested PCR, detecting two copies of BoHV6 whilst the limit of detection for nested PCR was 20 copies. In all qPCR assays, the coefficients of determination (R(2)) ranged between 0.990 and 0.999, and the calculated amplification efficiencies (Eff%) within the range of 89.7-106.9. The intra- and inter-assay CV (coefficient of variation) values did not exceed 4%. Copyright © 2013 Elsevier B.V. All rights reserved.

An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection.

Science.gov (United States)

Pitz, Amanda de Faveri; Koishi, Andrea Cristine; Tavares, Eliandro Reis; Andrade, Fábio Goulart de; Loth, Eduardo Alexandre; Gandra, Rinaldo Ferreira; Venancio, Emerson José

2013-01-01

Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR) assay for the detection of Paracoccidioides brasiliensis. We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.

Typing of Y chromosome SNPs with multiplex PCR methods

DEFF Research Database (Denmark)

Sanchez Sanchez, Juan Jose; Børsting, Claus; Morling, Niels

2005-01-01

We describe a method for the simultaneous typing of Y-chromosome single nucleotide polymorphism (SNP) markers by means of multiplex polymerase chain reaction (PCR) strategies that allow the detection of 35 Y chromosome SNPs on 25 amplicons from 100 to 200 pg of chromosomal deoxyribonucleic acid...... factors for the creation of larger SNP typing PCR multiplexes include careful selection of primers for the primary amplification and the SBE reaction, use of DNA primers with homogenous composition, and balancing the primer concentrations for both the amplification and the SBE reactions....

Detection of hepatitis C virus RNA: comparison of one-stage polymerase chain reaction (PCR) with nested-set PCR.

OpenAIRE

Gretch, D R; Wilson, J J; Carithers, R L; dela Rosa, C; Han, J H; Corey, L

1993-01-01

We evaluated a new hepatitis C virus RNA assay based on one-stage PCR followed by liquid hybridization with an oligonucleotide probe and compared it with nested-set PCR. The one-stage and nested-set PCR assays had identical sensitivities in analytical experiments and showed 100% concordance when clinical specimens were used. One-stage PCR may be less prone to contamination than nested-set PCR.

An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection

Directory of Open Access Journals (Sweden)

Amanda de Faveri Pitz

2013-12-01

Full Text Available Introduction Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR assay for the detection of Paracoccidioides brasiliensis. Methods We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. Results The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. Conclusions The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.

Detection of Giardia intestinalis in water samples collected from natural water reservoirs and wells in northern and north-eastern Poland using LAMP, real-time PCR and nested PCR.

Science.gov (United States)

Lass, Anna; Szostakowska, Beata; Korzeniewski, Krzysztof; Karanis, Panagiotis

2017-10-01

Giardia intestinalis is a protozoan parasite, transmitted to humans and animals by the faecal-oral route, mainly through contaminated water and food. Knowledge about the distribution of this parasite in surface water in Poland is fragmentary and incomplete. Accordingly, 36 environmental water samples taken from surface water reservoirs and wells were collected in Pomerania and Warmia-Masuria provinces, Poland. The 50 L samples were filtered and subsequently analysed with three molecular detection methods: loop-mediated isothermal amplification (LAMP), real-time polymerase chain reaction (real-time PCR) and nested PCR. Of the samples examined, Giardia DNA was found in 15 (42%) samples with the use of LAMP; in 12 (33%) of these samples, Giardia DNA from this parasite was also detected using real-time PCR; and in 9 (25%) using nested PCR. Sequencing of selected positive samples confirmed that the PCR products were fragments of the Giardia intestinalis small subunit rRNA gene. Genotyping using multiplex real-time PCR indicated the presence of assemblages A and B, with the latter predominating. The results indicate that surface water in Poland, as well as water taken from surface wells, may be a source of Giardia strains which are potentially pathogenic for humans. It was also demonstrated that LAMP assay is more sensitive than the other two molecular assays.

Development of touch down-multiplex PCR for the diagnosis of toxoplasmosis

Directory of Open Access Journals (Sweden)

V Hallur

2015-01-01

Full Text Available Purpose: The diagnosis of toxoplasmosis is challenging since conventional methods like culture and immunofluorescence are not universally available. Serology, which is used regularly might be negative during early phase of infection and in immunosuppressed patients or may remain positive for a long time. Several molecular tests have been used for the diagnosis of toxoplasmosis, but none of them have an internal control which would inform us regarding the presence of polymerase chain reaction (PCR inhibitors thus, undermining the confidence of a laboratory physician. Materials and Methods: We designed a multiplex PCR containing primers targeting human beta globin gene which would act as internal control and two primers against the B1 gene and 5s gene which aid in sensitive detection of T. gondii. Results: Multiplex PCR had a sensitivity of 83.3% and specificity of 100%. Conclusion: Multiplex PCR may provide a sensitive and specific tool for diagnosis of human toxoplasmosis.

Multiplex PCR detection of waterborne intestinal protozoa: microsporidia, Cyclospora, and Cryptosporidium.

Science.gov (United States)

Lee, Seung-Hyun; Joung, Migyo; Yoon, Sejoung; Choi, Kyoungjin; Park, Woo-Yoon; Yu, Jae-Ran

2010-12-01

Recently, emerging waterborne protozoa, such as microsporidia, Cyclospora, and Cryptosporidium, have become a challenge to human health worldwide. Rapid, simple, and economical detection methods for these major waterborne protozoa in environmental and clinical samples are necessary to control infection and improve public health. In the present study, we developed a multiplex PCR test that is able to detect all these 3 major waterborne protozoa at the same time. Detection limits of the multiplex PCR method ranged from 10(1) to 10(2) oocysts or spores. The primers for microsporidia or Cryptosporidium used in this study can detect both Enterocytozoon bieneusi and Encephalitozoon intestinalis, or both Cryptosporidium hominis and Cryptosporidium parvum, respectively. Restriction enzyme digestion of PCR products with BsaBI or BsiEI makes it possible to distinguish the 2 species of microsporidia or Cryptosporidium, respectively. This simple, rapid, and cost-effective multiplex PCR method will be useful for detecting outbreaks or sporadic cases of waterborne protozoa infections.

A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

Directory of Open Access Journals (Sweden)

Cui Shang-jin

2010-05-01

Full Text Available Abstract A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV. A pair of primers (P1 and P4 specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV, canine parvovirus (CPV, canine coronavirus (CCV, rabies virus (RV, or canine adenovirus (CAV. The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance.

A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

Science.gov (United States)

2010-01-01

A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759

Authentication of Meat Species in Sucuk by Multiplex PCR

Directory of Open Access Journals (Sweden)

Osman İrfan İLHAK

2015-01-01

Full Text Available The identification of meat species used in meat products is important by reason of economic considerations, religious factors, verification of label, and prevention of unfair-market competition. In this paper, multiplex PCR method was experienced for routine detection of equine (horse and donkey, poultry (chicken and turkey, pig and cattle meat in sucuk (sausage. The primers used for these animals generated specific fragments, and they did not show cross reactions with the DNA from the other genus of animal. After multiplex PCR was successfully optimized, a field study was carried out to investigate the presence of horse, donkey, chicken, turkey and pig meat in 50 sucuks (30 beef and 20 beef + poultry collected from markets. The result of the field study indicated that 23.3% of 30 beef sucuk samples were containing poultry meat. None of the 50 sucuk samples was containing pig meat, but one (2% of the samples generated equine fragment. The present study showed that the multiplex PCR method can be used for routine analysis of meat species identification, verification and control of label information of meat products.

A new trilocus sequence-based multiplex-PCR to detect major Acinetobacter baumannii clones.

Science.gov (United States)

Martins, Natacha; Picão, Renata Cristina; Cerqueira-Alves, Morgana; Uehara, Aline; Barbosa, Lívia Carvalho; Riley, Lee W; Moreira, Beatriz Meurer

2016-08-01

A collection of 163 Acinetobacter baumannii isolates detected in a large Brazilian hospital, was potentially related with the dissemination of four clonal complexes (CC): 113/79, 103/15, 109/1 and 110/25, defined by University of Oxford/Institut Pasteur multilocus sequence typing (MLST) schemes. The urge of a simple multiplex-PCR scheme to specify these clones has motivated the present study. The established trilocus sequence-based typing (3LST, for ompA, csuE and blaOXA-51-like genes) multiplex-PCR rapidly identifies international clones I (CC109/1), II (CC118/2) and III (CC187/3). Thus, the system detects only one (CC109/1) out of four main CC in Brazil. We aimed to develop an alternative multiplex-PCR scheme to detect these clones, known to be present additionally in Africa, Asia, Europe, USA and South America. MLST, performed in the present study to complement typing our whole collection of isolates, confirmed that all isolates belonged to the same four CC detected previously. When typed by 3LST-based multiplex-PCR, only 12% of the 163 isolates were classified into groups. By comparative sequence analysis of ompA, csuE and blaOXA-51-like genes, a set of eight primers was designed for an alternative multiplex-PCR to distinguish the five CC 113/79, 103/15, 109/1, 110/25 and 118/2. Study isolates and one CC118/2 isolate were blind-tested with the new alternative PCR scheme; all were correctly clustered in groups of the corresponding CC. The new multiplex-PCR, with the advantage of fitting in a single reaction, detects five leading A. baumannii clones and could help preventing the spread in healthcare settings. Copyright © 2016 Elsevier B.V. All rights reserved.

Diagnostic value of nested-PCR for identification of Malassezia species in dandruff

Science.gov (United States)

Jusuf, N. K.; Nasution, T. A.; Ullyana, S.

2018-03-01

Dandruff or pityriasis simplex is a condition of abnormal occurrence of formation of yellowish white scales from the scalp. Many factors play a role in the pathogenesis of dandruff, i.e.colonization of Malassezia species. Examination of Malassezia species previously done by culture as the gold standard. However, there are various difficulties in doing the culture. Identification method with anested-polymerase chain reaction (nested-PCR) is expected to provide quickly and easily detected. This study aimedto determine the diagnostic value of nested-PCR in the identification of Malassezia species in dandruff. From 21 subjects, scales from the scalp were taken and sent to the laboratory for nested-PCR identification. Statistical analysis of diagnostic test carried out to determine sensitivity, specificity, positive predictive value, and negative predictive value. The results showed nested-PCR detected 10 sample (47.6%) positive for Malassezia species consist of M. sympodialis (23.8%); M. slooffiae (9.5%); M. furfur (4.8%); M. globosa and M. furfur (4.8%); and M. restricta and M. sympodialis (4.8%). Detection of Malassezia species by nested-PCR has 100% in sensitivity whereas the specificity was 55%. Nested-PCR test has high sensitivity. Therefore nested-PCR may be considered for a faster and simpler alternative examination in identification for Malassezia species in dandruff.

Development and evaluation of a nested-PCR assay for Senecavirus A diagnosis.

Science.gov (United States)

Feronato, Cesar; Leme, Raquel A; Diniz, Jaqueline A; Agnol, Alais Maria Dall; Alfieri, Alice F; Alfieri, Amauri A

2018-02-01

Senecavirus A (SVA) has been associated with vesicular disease in weaned and adult pigs and with high mortality of newborn piglets. This study aimed to establish a nested-PCR assay for the routine diagnosis of SVA infection. Tissue samples (n = 177) were collected from 37 piglets of 18 pig farms located in four different Brazilian states. For the nested-PCR, a primer set was defined to amplify an internal VP1 fragment of 316 bp of SVA genome. Of the 37 piglets, 15 (40.5%) and 23 (62.2%) were positive for the SVA in the RT-PCR and nested-PCR assays, respectively. The SVA RNA was detected in 61/177 (34.5%) samples with the RT-PCR, while the nested-PCR assay showed 84/177 (47.5%) samples with the virus (p PCR and nested-PCR assays, respectively. Nucleotide sequencing analysis revealed similarities of 98.7-100% among SVA Brazilian strains and of 86.6-98% with SVA strains from other countries. The nested-PCR assay in this study was suitable to recover the SVA RNA in biological specimens, piglets, and/or herds that were considered as negative in the RT-PCR assay, and is proposed for the routine investigation of the SVA infection in piglets, especially when other techniques are not available or when a great number of samples has to be examined.

Diagnosis of lymphoma in paraffin wax sections by nested PCR and immunohistochemistry.

OpenAIRE

Kitamura, Y; Nanba, E; Inui, S; Tanigawa, T; Ichihara, K

1996-01-01

AIMS: To investigate whether nested polymerase chain reaction (PCR) and immunohistochemistry can be used to diagnose malignant lymphoma. METHODS: Paraffin wax embedded tissue sections from 31 patients with malignant lymphoma were analysed by nested PCR and immunohistochemistry using standard protocols. RESULTS: Nested PCR amplification of 1 pg DNA confirmed monoclonality in B cell lymphoma; PCR amplification of 10 pg DNA confirmed monoclonality in T cell lymphoma. Twenty seven (87%) samples w...

A fully sealed plastic chip for multiplex PCR and its application in bacteria identification.

Science.gov (United States)

Xu, Youchun; Yan, He; Zhang, Yan; Jiang, Kewei; Lu, Ying; Ren, Yonghong; Wang, Hui; Wang, Shan; Xing, Wanli

2015-07-07

Multiplex PCR is an effective tool for simultaneous multiple target detection but is limited by the intrinsic interference and competition among primer pairs when it is performed in one reaction tube. Dividing a multiplex PCR into many single PCRs is a simple strategy to overcome this issue. Here, we constructed a plastic, easy-to-use, fully sealed multiplex PCR chip based on reversible centrifugation for the simultaneous detection of 63 target DNA sequences. The structure of the chip is quite simple, which contains sine-shaped infusing channels and a number of reaction chambers connecting to one side of these channels. Primer pairs for multiplex PCR were sequentially preloaded in the different reaction chambers, and the chip was enclosed with PCR-compatible adhesive tape. For usage, the PCR master mix containing a DNA template is pipetted into the infusing channels and centrifuged into the reaction chambers, leaving the infusing channels filled with air to avoid cross-contamination of the different chambers. Then, the chip is sealed and placed on a flat thermal cycler for PCR. Finally, amplification products can be detected in situ using a fluorescence scanner or recovered by reverse centrifugation for further analyses. Therefore, our chip possesses two functions: 1) it can be used for multi-target detection based on end-point in situ fluorescence detection; and 2) it can work as a sample preparation unit for analyses that need multiplex PCR such as hybridization and target sequencing. The performance of this chip was carefully examined and further illustrated in the identification of 8 pathogenic bacterial genomic DNA samples and 13 drug-resistance genes. Due to simplicity of its structure and operation, accuracy and generality, high-throughput capacity, and versatile functions (i.e., for in situ detection and sample preparation), our multiplex PCR chip has great potential in clinical diagnostics and nucleic acid-based point-of-care testing.

Simultaneous Detection of 13 Key Bacterial Respiratory Pathogens by Combination of Multiplex PCR and Capillary Electrophoresis.

Science.gov (United States)

Jiang, Lu Xi; Ren, Hong Yu; Zhou, Hai Jian; Zhao, Si Hong; Hou, Bo Yan; Yan, Jian Ping; Qin, Tian; Chen, Yu

2017-08-01

Lower respiratory tract infections continue to pose a significant threat to human health. It is important to accurately and rapidly detect respiratory bacteria. To compensate for the limits of current respiratory bacteria detection methods, we developed a combination of multiplex polymerase chain reaction (PCR) and capillary electrophoresis (MPCE) assay to detect thirteen bacterial pathogens responsible for lower respiratory tract infections, including Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Mycoplasma pneumoniae, Legionella spp., Bordetella pertussis, Mycobacterium tuberculosis complex, Corynebacterium diphtheriae, and Streptococcus pyogenes. Three multiplex PCR reactions were built, and the products were analyzed by capillary electrophoresis using the high-throughput DNA analyzer. The specificity of the MPCE assay was examined and the detection limit was evaluated using DNA samples from each bacterial strain and the simulative samples of each strain. This assay was further evaluated using 152 clinical specimens and compared with real-time PCR reactions. For this assay, three nested-multiplex-PCRs were used to detect these clinical specimens. The detection limits of the MPCE assay for the 13 pathogens were very low and ranged from 10-7 to 10-2 ng/μL. Furthermore, analysis of the 152 clinical specimens yielded a specificity ranging from 96.5%-100.0%, and a sensitivity of 100.0% for the 13 pathogens. This study revealed that the MPCE assay is a rapid, reliable, and high-throughput method with high specificity and sensitivity. This assay has great potential in the molecular epidemiological survey of respiratory pathogens. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

Designing multiplex PCR system of Campylobacter jejuni for efficient typing by improving monoplex PCR binary typing method.

Science.gov (United States)

Yamada, Kazuhiro; Ibata, Ami; Suzuki, Masahiro; Matsumoto, Masakado; Yamashita, Teruo; Minagawa, Hiroko; Kurane, Ryuichiro

2015-01-01

Campylobacter jejuni is responsible for the majority of Campylobacter infections. As the molecular epidemiological study of outbreaks, pulsed-field gel electrophoresis (PFGE) is performed in general. But PFGE has several problems. PCR binary typing (P-BIT) method is a typing method for Campylobacter spp. that was recently developed, and was reported to have a similar discriminatory power and stability to those of PFGE. We modified the P-BIT method from 18 monoplex PCRs to two multiplex PCR systems (mP-BIT). The same results were obtained from monoplex PCRs using original primers and multiplex PCR in the representative isolates. The mP-BIT can analyze 48 strains at a time by using 96-well PCR systems and can identify C. jejuni because mP-BIT includes C. jejuni marker. The typing of the isolates by the mP-BIT and PFGE demonstrated generally concordant results and the mP-BIT method (D = 0.980) has a similar discriminatory power to that of PFGE with SmaI digest (D = 0.975) or KpnI digest (D = 0.987) as with original article. The mP-BIT method is quick, simple and easy, and comes to be able to perform it at low cost by having become a multiplex PCR system. Therefore, the mP-BIT method with two multiplex PCR systems has high potential for a rapid first-line surveillance typing assay of C. jejuni and can be used for routine surveillance and outbreak investigations of C. jejuni in the future. Copyright © 2014 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Study comparing human papillomavirus (HPV) real-time multiplex PCR and Hybrid Capture II INNO-LiPA v2 HPV genotyping PCR assays

DEFF Research Database (Denmark)

Iftner, Thomas; Germ, Liesje; Swoyer, Ryan

2009-01-01

methods has not been well characterized. Clinically, cytology is used to establish possible HPV infection. We evaluated the sensitivity and specificity of HPV multiplex PCR assays compared to those of the testing scheme of the Hybrid Capture II (HCII) assay followed by an HPV PCR/line hybridization assay...... (HCII-LiPA v2). SurePath residual samples were split into two aliquots. One aliquot was subjected to HCII testing followed by DNA extraction and LiPA v2 genotyping. The second aliquot was shipped to a second laboratory, where DNA was extracted and HPV multiplex PCR testing was performed. Comparisons...... were evaluated for 15 HPV types common in both assays. A slightly higher proportion of samples tested positive by the HPV multiplex PCR than by the HCII-LiPA v2 assay. The sensitivities of the multiplex PCR assay relative to those of the HCII-LiPA v2 assay for HPV types 6, 11, 16, and 18, for example...

Utility of a Multiplex PCR Assay for Detecting Herpesvirus DNA in Clinical Samples

Science.gov (United States)

Druce, Julian; Catton, Mike; Chibo, Doris; Minerds, Kirsty; Tyssen, David; Kostecki, Renata; Maskill, Bill; Leong-Shaw, Wendy; Gerrard, Marie; Birch, Chris

2002-01-01

A multiplex PCR was designed to amplify herpes simplex virus types 1 and 2, cytomegalovirus, and varicella-zoster virus DNA present in a diverse range of clinical material. The susceptibility of these viruses to in vivo inhibition by at least one antiviral drug was an important consideration in their inclusion in the multiplex detection system. An aliquot of equine herpesvirus was introduced into each specimen prior to extraction and served as an indicator of potential inhibitors of the PCR and a detector of suboptimal PCR conditions. Compared to virus isolation and immunofluorescence-based antigen detection, the multiplex assay yielded higher detection rates for all viruses represented in the assay. The turnaround time for performance of the assay was markedly reduced compared to those for the other techniques used to identify these viruses. More than 21,000 tests have been performed using the assay. Overall, the multiplex PCR enabled the detection of substantially increased numbers of herpesviruses, in some cases in specimens or anatomical sites where previously they were rarely if ever identified using traditional detection methods. PMID:11980951

A semi-nested PCR assay for molecular detection of Paracoccidioides brasiliensis in tissue samples Semi-nested PCR para a detecção molecular de Paracoccidioides brasiliensis em amostras de tecido

Directory of Open Access Journals (Sweden)

Andrea Cristine Koishi

2010-12-01

Full Text Available INTRODUCTION: Paracoccidioidomycosis is a systemic infection caused by Paracoccidioides brasiliensis. METHODS: In this study, a semi-nested PCR for paracoccidioidomycosis diagnosis was developed. The primers ITS1 and ITS4 were used in the first reaction, while the primers MJ03 and ITS1 primer were used in the second reaction. The semi-nested PCR was used to investigate biopsies of five patients with oral lesions that resembled paracoccidioidomycosis. RESULTS: The semi-nested PCR was positive for four samples and negative for a sample from a patient later diagnosed with leishmaniasis. CONCLUSIONS: The new semi-nested PCR describe is useful for paracoccidioidomycosis diagnosis.INTRODUÇÃO: A paracoccidioidomicose é uma infecção sistêmica causada pelo Paracoccidioides brasiliensis. MÉTODOS: Neste estudo, uma semi-nested PCR foi desenvolvida para o diagnóstico da paracoccidioidomicose. Os oligonucleotídeos iniciadores ITS1 e ITS4 foram usados na primeira reação, enquanto os oligonucleotídeos iniciadores MJ03 e ITS1 foram usados na segunda reação. A semi-nested PCR foi usada para investigar biopsias de cinco pacientes com lesões orais que se assemelhavam a paracoccidioidomicose. RESULTADOS: A semi-nested PCR foi positiva para quatro amostras e negativa para a amostra de um paciente, posteriormente diagnosticado com leishmaniose. CONCLUSÕES: A semi-nested PCR descrita aqui é útil para o diagnóstico da paracoccidioidomicose.

[Optimized application of nested PCR method for detection of malaria].

Science.gov (United States)

Yao-Guang, Z; Li, J; Zhen-Yu, W; Li, C

2017-04-28

Objective To optimize the application of the nested PCR method for the detection of malaria according to the working practice, so as to improve the efficiency of malaria detection. Methods Premixing solution of PCR, internal primers for further amplification and new designed primers that aimed at two Plasmodium ovale subspecies were employed to optimize the reaction system, reaction condition and specific primers of P . ovale on basis of routine nested PCR. Then the specificity and the sensitivity of the optimized method were analyzed. The positive blood samples and examination samples of malaria were detected by the routine nested PCR and the optimized method simultaneously, and the detection results were compared and analyzed. Results The optimized method showed good specificity, and its sensitivity could reach the pg to fg level. The two methods were used to detect the same positive malarial blood samples simultaneously, the results indicated that the PCR products of the two methods had no significant difference, but the non-specific amplification reduced obviously and the detection rates of P . ovale subspecies improved, as well as the total specificity also increased through the use of the optimized method. The actual detection results of 111 cases of malarial blood samples showed that the sensitivity and specificity of the routine nested PCR were 94.57% and 86.96%, respectively, and those of the optimized method were both 93.48%, and there was no statistically significant difference between the two methods in the sensitivity ( P > 0.05), but there was a statistically significant difference between the two methods in the specificity ( P PCR can improve the specificity without reducing the sensitivity on the basis of the routine nested PCR, it also can save the cost and increase the efficiency of malaria detection as less experiment links.

Species-specific nested PCR as a diagnostic tool for Brucella ovis infection in rams

Directory of Open Access Journals (Sweden)

L.F. Costa

2013-02-01

Full Text Available The aim of the present study was to evaluate a species-specific nested PCR based on a previously described species-specific PCR for detection of B. ovis in semen and urine samples of experimentally infected rams. The performance of the species-specific nested PCR was compared with the results of a genus-specific PCR. Fourteen rams were experimentally infected with the Brucella ovis REO 198 strain and samples of semen and urine were collected every week up to 180 days post infection. Out of 83 semen samples collected, 42 (50.6% were positive for the species-specific nested PCR, and 23 (27.7% were positive for the genus-specific PCR. Out of 75 urine samples, 49 (65.3% were positive for the species-specific nested PCR, whereas 11 (14.6% were genus-specific PCR positive. Species-specific nested PCR was significantly more sensitive (P<0.001 than the genus-specific PCR in semen and urine from experimentally infected rams. In conclusion, the species-specific nested PCR developed in this study may be used as a diagnostic tool for the detection of B. ovis in semen and urine samples from suspected rams.

Designing of primers for detection of salmonella typhimirium and enteritidis by heminested PCR

International Nuclear Information System (INIS)

Ben salem, Issam

2007-01-01

Salmonella are the main responsible agent for the frequent food borne gastrointestinal diseases. In Tunisia, this pathogen is considered one of the most important causes of toxiinfections and its detection using classical methods is laborious and requires a large amount of time for revelation. To solve this problem, we developed a rapid molecular technique for the detection of the invA virulence gene sequence which is found in the majority of Salmonella spp. This technique is a hemi nested PCR amplification using specific primers designed and by bioinformatics tools. The detection method consisted of pre-enrichment of the sample in buffered peptone water (BPW), followed by a total DNA extraction step prior to single tube hemi nested PCR amplification. This method was found highly specific and sensitive to detect low levels of salmonella typhimurium and salmonella enteritidis (1cfu/ 25g) in naturally contaminated spicy sausage (merguez) samples. These results can benefit the public health agencies concerning microbiological and quality aspects of the commercial and traditional merguez meat production in Tunisia. (Author)

[Application of Nested PCR in the Diagnosis of Imported Plasmodium Ovale Infection].

Science.gov (United States)

Huang, Bing-cheng; Xu, Chao; Li, Jin; Xiao, Ting; Yin, Kun; Liu, Gong-zhen; Wang, Wei-yan; Zhao, Gui-hua; Wei, Yan-bin; Wang, Yong-bin; Zhao, Chang-lei; Wei, Qing-kuan

2015-02-01

To identity Plasmodium ovale infection by 18S rRNA gene nested PCR. Whole blood and filter paper blood samples of malaria patients in Shandong Province were collected during 2012-2013. The parasites were observed under a microscope with Giemsa staining. The genome DNA of blood samples were extracted as PCR templates. Genus- and species-specific primers were designed according to the Plasmodium 18S rRNA gene sequences. Plasmodium ovale-positive specimens were identified by nested PCR as well as verified by sequencing. There were 7 imported cases of P. ovale infection in the province during 2012-2013. Nested PCR results showed that the P. ovale specific band (800 bp) was amplified in all the 7 specimens. Blast results indicated that the PCR products were consistent with the Plasmodium ovale reference sequence in GenBank. Seven imported cases of ovale malaria in Shandong Province in 2012-2013 are confirmed by nested PCR.

Detection of sexually transmitted infection and human papillomavirus in negative cytology by multiplex-PCR

Directory of Open Access Journals (Sweden)

Chung Hyun-Jae

2010-09-01

Full Text Available Abstract Background The aim of this study was to determine the prevalence of human papillomavirus (HPV and 15 species that cause sexually transmitted infections (STIs in negative cytology. In addition, we compared the diagnostic performance of multiplex polymerase chain reaction (PCR with widely available techniques used to detect HPV. Methods We recruited 235 women of reproductive age who had negative cytology findings in a liquid-based cervical smear. STIs were identified by multiplex PCR, and HPV genotypes by multiplex PCR, hybrid capture 2, and DNA microaray; discordant results were analyzed by direct sequencing. Results Approximately 96.6% of patients with negative cytology results were positive for pathogens that cause STIs. The pathogens most frequently detected were Gardnerella vaginalis, Ureaplasma urealyticum. The incidence of HPV in negative cytology was 23.3%. Low-risk HPV infection was significantly correlated with Chalmaydia trachomatis, and high-risk HPV infection was significantly correlated with Group β streptococcus. The analytical sensitivities of the multiplex PCR and DNA microarray were higher than 80%, and the analytical specificity was nearly 100% for all tests. Conclusions Multiplex PCR yielded results that most of patients with negative cytology were positive for pathogens that cause STIs, and were more similar to that of DNA microarray, than that of hybrid capture 2 in terms of analytical sensitivity and prediction value of HPV infection.

[Sensitivity and specificity of nested PCR pyrosequencing in hepatitis B virus drug resistance gene testing].

Science.gov (United States)

Sun, Shumei; Zhou, Hao; Zhou, Bin; Hu, Ziyou; Hou, Jinlin; Sun, Jian

2012-05-01

To evaluate the sensitivity and specificity of nested PCR combined with pyrosequencing in the detection of HBV drug-resistance gene. RtM204I (ATT) mutant and rtM204 (ATG) nonmutant plasmids mixed at different ratios were detected for mutations using nested-PCR combined with pyrosequencing, and the results were compared with those by conventional PCR pyrosequencing to analyze the linearity and consistency of the two methods. Clinical specimens with different viral loads were examined for drug-resistant mutations using nested PCR pyrosequencing and nested PCR combined with dideoxy sequencing (Sanger) for comparison of the detection sensitivity and specificity. The fitting curves demonstrated good linearity of both conventional PCR pyrosequencing and nested PCR pyrosequencing (R(2)>0.99, PNested PCR showed a better consistency with the predicted value than conventional PCR, and was superior to conventional PCR for detection of samples containing 90% mutant plasmid. In the detection of clinical specimens, Sanger sequencing had a significantly lower sensitivity than nested PCR pyrosequencing (92% vs 100%, Pnested PCR and Sanger sequencing method, nested PCR pyrosequencing has a higher sensitivity especially in clinical specimens with low viral copies, which can be important for early detection of HBV mutant strains and hence more effective clinical management.

Multiplex real-time PCR assay for Legionella species.

Science.gov (United States)

Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja

2015-12-01

Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

Development of a highly sensitive one-tube nested real-time PCR for detecting Mycobacterium tuberculosis.

Science.gov (United States)

Choi, Yeonim; Jeon, Bo-Young; Shim, Tae Sun; Jin, Hyunwoo; Cho, Sang-Nae; Lee, Hyeyoung

2014-12-01

Rapid, accurate detection of Mycobacterium tuberculosis is crucial in the diagnosis of tuberculosis (TB), but conventional diagnostic methods have limited sensitivity and specificity or are time consuming. A new highly sensitive nucleic acid amplification test, combined nested and real-time polymerase chain reaction (PCR) in a single tube (one-tube nested real-time PCR), was developed for detecting M. tuberculosis, which takes advantage of two PCR techniques, i.e., nested PCR and real-time PCR. One-tube nested real-time PCR was designed to have two sequential reactions with two sets of primers and dual probes for the insertion sequence (IS) 6110 sequence of M. tuberculosis in a single closed tube. The minimum limits of detection of IS6110 real-time PCR and IS6110 one-tube nested real-time PCR were 100 fg/μL and 1 fg/μL of M. tuberculosis DNA, respectively. AdvanSure TB/non-tuberculous mycobacteria (NTM) real-time PCR, IS6110 real-time PCR, and two-tube nested real-time PCR showed 100% sensitivity and 100% specificity for clinical M. tuberculosis isolates and NTM isolates. In comparison, the sensitivities of AdvanSure TB/NTM real-time PCR, single IS6110 real-time PCR, and one-tube nested real-time PCR were 91% (152/167), 94.6% (158/167), and 100% (167/167) for sputum specimens, respectively. In conclusion, IS6110 one-tube nested real-time PCR is useful for detecting M. tuberculosis due to its high sensitivity and simple manipulation. Copyright © 2014 Elsevier Inc. All rights reserved.

Evaluation of a multiplex real-time PCR assay for the detection of respiratory viruses in clinical specimens.

Science.gov (United States)

Rheem, Insoo; Park, Joowon; Kim, Tae-Hyun; Kim, Jong Wan

2012-11-01

In this study, we evaluated the analytical performance and clinical potential of a one-step multiplex real-time PCR assay for the simultaneous detection of 14 types of respiratory viruses using the AdvanSure RV real-time PCR Kit (LG Life Sciences, Korea). Three hundred and twenty clinical specimens were tested with the AdvanSure RV real-time PCR Kit and conventional multiplex reverse transcription (RT)-PCR assay. The assay results were analyzed and the one-step AdvanSure RV real-time PCR Kit was compared with the conventional multiplex RT-PCR assay with respect to the sensitivity and specificity of the detection of respiratory viruses. The limit of detection (LOD) was 1.31 plaque-forming units (PFU)/mL for human rhinoviruses (hRVs), 4.93 PFU/mL for human coronavirus HCoV-229E/NL63, 2.67 PFU/mL for human coronavirus HCoV-OC43, 18.20 PFU/mL for parainfluenza virus 1 (PIV)-1, 24.57 PFU/mL for PIV-2, 1.73 PFU/mL for PIV-3, 1.79 PFU/mL for influenza virus group (Flu) A, 59.51 PFU/mL for FluB, 5.46 PFU/mL for human respiratory syncytial virus (hRSV)-A, 17.23 PFU/mL for hRSV-B, 9.99 PFU/mL for human adenovirus (ADVs). The cross-reactivity test for this assay against 23 types of non-respiratory viruses showed negative results for all viruses tested. The agreement between the one-step AdvanSure multiplex real-time PCR assay and the conventional multiplex RT-PCR assay was 98%. The one-step AdvanSure RV multiplex real-time PCR assay is a simple assay with high potential for specific, rapid and sensitive laboratory diagnosis of respiratory viruses compared to conventional multiplex RT-PCR.

Diagnosis of Neospora caninum in bovine fetuses by histology, immunohistochemistry, and nested-PCR Pesquisa de Neospora caninum em fetos bovinos por histologia, imunoistoquímica e nested-PCR

Directory of Open Access Journals (Sweden)

Aline Diniz Cabral

2009-12-01

Full Text Available Neospora caninum, a cause of abortion and stillbirth in cattle, was studied by histology, immunohistochemistry, and nested-PCR, using primers from the Nc5 region of the genomic DNA (PCR PLUS and primers from the ITS1 region of the ribosomal DNA (PCR JB. A total of 105 fetal samples sent to the Centro de Pesquisa e Desenvolvimento de Sanidade Animal do Instituto Biológico from January 2006 to May 2008 were examined for evidence of N. caninum. Histological examination revealed 71.4% with non-suppurative inflammation in the heart, lung, liver, kidney, placenta, and brain. Immunohistochemistry detected infections in 8.6% of the samples, mainly in the brain, placenta, and heart. Nested-PCR JB revealed 6.7% with infections, while nested-PCR PLUS returned 20.9% positive results, mainly in brain and placenta, and in the pooled liver and heart. Kappa statistics demonstrated little agreement among the three techniques. The three methods are complementary, since they have distinct diagnostic characteristics and were combined to give a positivity rate of 24.8%.Pesquisou-se Neospora caninum como causador de abortamento e natimortalidade em bovinos, por meio de exame histopatológico (hematoxilina-eosina, imunoistoquímica (IHQ e nested-PCR, utilizando primers da região Nc5 do DNA genômico (PCR PLUS e primers da região ITS1 do DNA ribossomal (PCR JB. Foram avaliadas 105 amostras de abortamento bovino entre janeiro de 2006 a maio de 2008, encaminhadas ao Centro de Pesquisa e Desenvolvimento de Sanidade Animal do Instituto Biológico para diagnóstico diferencial de causas infecciosas. Observou-se em 71,4% das amostras lesões histológicas (HE caracterizadas pela presença de células inflamatórias mononucleares no coração, pulmão, fígado, rim, placenta e cérebro. A IHQ detectou 8,57% de positividade, sendo maior no cérebro, placenta e coração. A nested-PCR JB revelou 6,66% de casos positivos, enquanto que a nested-PCR PLUS apresentou maior taxa

Establishment of a nested-ASP-PCR method to determine the clarithromycin resistance of Helicobacter pylori.

Science.gov (United States)

Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun

2016-07-07

To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and

Multiplex PCR-based assay for detection of Bordetella pertussis in nasopharyngeal swab specimens.

Science.gov (United States)

Wadowsky, R M; Michaels, R H; Libert, T; Kingsley, L A; Ehrlich, G D

1996-11-01

A multiplex PCR-based assay was developed for the detection of Bordetella pertussis in nasopharyngeal swab specimens. The assay simultaneously amplified two separate DNA targets (153 and 203 bp) within a B. pertussis repetitive element and a 438-bp target within the beta-actin gene of human DNA (PCR amplification control). PCR products were detected by a sensitive and specific liquid hybridization gel retardation assay. A total of 496 paired nasopharyngeal swab specimens were tested by both the PCR-based assay and culture. Although 30 (6%) of the specimens inhibited the amplification of the beta-actin target, in all 29 specimens studied, the inhibition disappeared on repeat testing or was easily overcome with a 1:8 dilution or less of specimen digest. Of the 495 specimen pairs yielding a final evaluable result by the PCR-based assay, 19.0% were positive by the PCR-based assay, whereas 13.9% were positive by culture (P < 0.0001). After resolving the PCR-positive, culture-negative results by testing an additional aliquot from these specimens by the multiplex PCR-based assay, the PCR-based assay had a sensitivity and specificity of 98.9 and 99.7%, respectively, compared with values of 73.4 and 100%, respectively, for culture. In comparison with patients with culture-confirmed pertussis, those with PCR-positive, culture-negative results were older and more likely to have had prolonged cough, immunization with pertussis vaccine, or treatment with erythromycin. This multiplex PCR-based assay is substantially more sensitive than culture and identifies specimens that contain inhibitors of PCR.

Development of a multiplex PCR for the genetic analysis of paddlefish (Polyodon spathula Walbaum,1792 populations

Directory of Open Access Journals (Sweden)

K. Kurta

2017-12-01

Full Text Available Purpose. Paddlefish is commercially important species owing to its biological features and consumer characteristics, namely it produces valuable and delicious fish products, such as high quality meat and black caviar. Consequently, its cultivation under Ukrainian fish farm conditions and further realization in domestic and foreign markets are economically efficient. However, the paddlefish broodstock in Ukraine requires the efficient solution of increasing its productivity, identification and assessment of its genetic variation. Thus, the aim of our study was to develop and implement a multiplex PCR-analysis of paddlefish (Polyodon spathula for population-genetic monitoring of its artificial broodstocks in Ukraine. Methodology. A multiplex PCR was used for the study. The multiplex PCR development was performed for four microsatellite DNA markers: Psp12, Psp21, Psp26 and Psp28. Each investigated DNA loci, for which the multiplex PCR was optimized, was selected in such a way that the colored PCR products labeled with fluorescent dye did not overlap the length of the amplified fragments. Evaluation of the multiplex PCR effectiveness and processing of the data were performed by fragment analysis of DNA on the genetic analyzer ABI Prism 3130 (Applied Biosystem, USA. The size of the identified alleles was determined using the "Gene Mapper 3.7" program (Applied Biosystems, USA and LIZ-500 size standard (Applied Biosystems, USA. Results. Based on the results of capillary electrophoresis of multiplex PCR products, it was found that the amplified fragments for each of the four studied loci: Psp12, Psp21, Psp26 and Psp28 in one PCR reaction were within the expected size range. Data analysis on the electrophoregram demonstrated that Psp21 had the highest peak intensity at 611 fluorescent units (FU and the lowest peak intensity at 105 FU was observed for Psp26 locus. In the multiplex PCR after proper interpretation of the data we identified heterozygous

Simultaneous Expression of GUS and Actin Genes by Using the Multiplex RT-PCR and Multiplex Gold Nanoparticle Probes.

Science.gov (United States)

Ghazi, Yaser; Vaseghi, Akbar; Ahmadi, Sepideh; Haddadi, Fatemeh

2018-04-23

Gene expression analysis is considered to be extremely important in many different biological researches. DNA-based diagnostic test, which contributes to DNA identification, has higher specificity, cost, and speed than some biochemical and molecular methods. In this study, we try to use the novel nano technology approach with Multiplex RT-PCR and Gold nano particular probes (GNPs-probes) in order to get gene expression in Curcumas melons. We used Agrobacterium tumefactions for gene transfer and GUS reporter gene as a reporter. After cDNA synthesis, Multiplex PCR and Multiplex RT-PCR techniques were used. Finally, probes were designed for RNA of GUS and Actin genes, and then the analysis of the gene expression using the probes attached to GNPs was carried out and the color changes in the GNPs were applied. In the following, probes hybridization was checked with DNA between 400 to 700 nm wavelengths and the highest rate was observed in the 550 to 650 nm. The results show that the simultaneous use of GNP-attached detectors and Multiplex RT-PCRcan reduce time and costmore considerably than somelaboratory methods for gene expiration investigation. Additionally, it can be seen thatthere is an increase in sensitivity and specificity of our investigation. Based on our findings, this can bea novel study doneusingMultiplex RT-PCRand unmodified AuNPs for gene transfer and expression detection to plants. We can claim that this assay has a remarkable advantage including rapid, cost-effectiveness, specificity and accuracy to detect transfer and expression genes in plants. Also,we can use this technique from other gene expressionsin many different biology samples.

Detection of Mycobacterium tuberculosis in extrapulmonary biopsy samples using PCR targeting IS6110, rpoB, and nested-rpoB PCR Cloning.

Science.gov (United States)

Meghdadi, Hossein; Khosravi, Azar D; Ghadiri, Ata A; Sina, Amir H; Alami, Ameneh

2015-01-01

Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39-31.27% for rpoB-PCR, 36.44-60.83% for IS6110- PCR, 75.29-92.93% for nested-rpoB PCR, and 87.98-99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100

Monitoring and improving the sensitivity of dengue nested RT-PCR used in longitudinal surveillance in Thailand.

Science.gov (United States)

Klungthong, Chonticha; Manasatienkij, Wudtichai; Phonpakobsin, Thipwipha; Chinnawirotpisan, Piyawan; Rodpradit, Prinyada; Hussem, Kittinun; Thaisomboonsuk, Butsaya; Ong-ajchaowlerd, Prapapun; Nisalak, Ananda; Kalayanarooj, Siripen; Buddhari, Darunee; Gibbons, Robert V; Jarman, Richard G; Yoon, In-Kyu; Fernandez, Stefan

2015-02-01

AFRIMS longitudinal dengue surveillance in Thailand depends on the nested RT-PCR and the dengue IgM/IgG ELISA. To examine and improve the sensitivity of the nested RT-PCR using a panel of archived samples collected during dengue surveillance. A retrospective analysis of 16,454 dengue IgM/IgG ELISA positive cases collected between 2000 and 2013 was done to investigate the sensitivity of the nested RT-PCR. From these cases, 318 acute serum specimens or extracted RNA, previously found to be negative by the nested RT-PCR, were tested using TaqMan real-time RT-PCR (TaqMan rRT-PCR). To improve the sensitivity of nested RT-PCR, we designed a new primer based on nucleotide sequences from contemporary strains found to be positive by the TaqMan rRT-PCR. Sensitivity of the new nested PCR was calculated using a panel of 87 samples collected during 2011-2013. The percentage of dengue IgM/IgG ELISA positive cases that were negative by the nested RT-PCR varied from 17% to 42% for all serotypes depending on the year. Using TaqMan rRT-PCR, dengue RNA was detected in 194 (61%) of the 318 acute sera or extracted RNA previously found to be negative by the nested RT-PCR. The newly designed DENV-1 specific primer increased the sensitivity of DENV-1 detection by the nested RT-PCR from 48% to 88%, and of all 4 serotypes from 73% to 87%. These findings demonstrate the impact of genetic diversity and signal erosion on the sensitivity of PCR-based methods. Published by Elsevier B.V.

Detection of tumor markers in prostate cancer and comparison of sensitivity between real time and nested PCR.

Science.gov (United States)

Matsuoka, Takayuki; Shigemura, Katsumi; Yamamichi, Fukashi; Fujisawa, Masato; Kawabata, Masato; Shirakawa, Toshiro

2012-06-27

The objective of this study is to investigate and compare the sensitivity in conventional PCR, quantitative real time PCR, nested PCR and western blots for detection of prostate cancer tumor markers using prostate cancer (PCa) cells. We performed conventional PCR, quantitative real time PCR, nested PCR, and western blots using 5 kinds of PCa cells. Prostate specific antigen (PSA), prostate specific membrane antigen (PSMA), and androgen receptor (AR) were compared for their detection sensitivity by real time PCR and nested PCR. In real time PCR, there was a significant correlation between cell number and the RNA concentration obtained (R(2)=0.9944) for PSA, PSMA, and AR. We found it possible to detect these markers from a single LNCaP cell in both real time and nested PCR. By comparison, nested PCR reached a linear curve in fewer PCR cycles than real time PCR, suggesting that nested PCR may offer PCR results more quickly than real time PCR. In conclusion, nested PCR may offer tumor maker detection in PCa cells more quickly (with fewer PCR cycles) with the same high sensitivity as real time PCR. Further study is necessary to establish and evaluate the best tool for PCa tumor marker detection.

Development of a One-Step Multiplex PCR Assay for Differential Detection of Major Mycobacterium Species.

Science.gov (United States)

Chae, Hansong; Han, Seung Jung; Kim, Su-Young; Ki, Chang-Seok; Huh, Hee Jae; Yong, Dongeun; Koh, Won-Jung; Shin, Sung Jae

2017-09-01

The prevalence of tuberculosis continues to be high, and nontuberculous mycobacterial (NTM) infection has also emerged worldwide. Moreover, differential and accurate identification of mycobacteria to the species or subspecies level is an unmet clinical need. Here, we developed a one-step multiplex PCR assay using whole-genome analysis and bioinformatics to identify novel molecular targets. The aims of this assay were to (i) discriminate between the Mycobacterium tuberculosis complex (MTBC) and NTM using rv0577 or RD750, (ii) differentiate M. tuberculosis ( M. tuberculosis ) from MTBC using RD9, (iii) selectively identify the widespread M. tuberculosis Beijing genotype by targeting mtbk_20680 , and (iv) simultaneously detect five clinically important NTM ( M. avium , M. intracellulare , M. abscessus , M. massiliense , and M. kansasii ) by targeting IS 1311 , DT1, mass_3210 , and mkan_rs12360 An initial evaluation of the multiplex PCR assay using reference strains demonstrated 100% specificity for the targeted Mycobacterium species. Analytical sensitivity ranged from 1 to 10 pg for extracted DNA and was 10 3 and 10 4 CFU for pure cultures and nonhomogenized artificial sputum cultures, respectively, of the targeted species. The accuracy of the multiplex PCR assay was further evaluated using 55 reference strains and 94 mycobacterial clinical isolates. Spoligotyping, multilocus sequence analysis, and a commercial real-time PCR assay were employed as standard assays to evaluate the multiplex PCR assay with clinical M. tuberculosis and NTM isolates. The PCR assay displayed 100% identification agreement with the standard assays. Our multiplex PCR assay is a simple, convenient, and reliable technique for differential identification of MTBC, M. tuberculosis , M. tuberculosis Beijing genotype, and major NTM species. Copyright © 2017 American Society for Microbiology.

A Newly Developed Nested PCR Assay for the Detection of Helicobacter pylori in the Oral Cavity.

Science.gov (United States)

Ismail, Hawazen; Morgan, Claire; Griffiths, Paul; Williams, John; Jenkins, Gareth

2016-01-01

To develop a new nested polymerase chain reaction (PCR) assay for identifying Helicobacter pylori DNA from dental plaque. H. pylori is one of the most common chronic bacterial pathogens in humans. The accurate detection of this organism is essential for proper patient management and for the eradication of the bacteria following treatment. Forty-nine patients (24 males and 25 females; mean age: 51; range, 19 to 94 y) were investigated for the presence of H. pylori in dental plaque by single-step PCR and nested PCR and in the stomach by single-step PCR, nested PCR, and histologic examination. The newly developed nested PCR assay identified H. pylori DNA in gastric biopsies of 18 patients who were histologically classified as H. pylori-positive and 2 additional biopsies of patients who were H. pylori-negative by histologic examination (20/49; 40.8%). Dental plaque samples collected before and after endoscopy from the 49 patients revealed that single-step PCR did not detect H. pylori but nested PCR was able to detect H. pylori DNA in 40.8% (20/49) patients. Nested PCR gave a higher detection rate (40.8%, 20/49) than that of histology (36.7%, 18/49) and single-step PCR. When nested PCR results were compared with histology results there was no significant difference between the 2 methods. Our newly developed nested PCR assay is at least as sensitive as histology and may be useful for H. pylori detection in patients unfit for endoscopic examination.

Development of multiplex real-time PCR assay for the detection of Brucella spp., Leptospira spp. and Campylobacter foetus

Directory of Open Access Journals (Sweden)

Abdelfattah M. Selim

2014-12-01

Full Text Available Abortion among dairy cattle is one of the major causes of economic losses in the livestock industry. This study describes a 1-step multiplex real-time polymerase chain reaction (PCR to detect Brucella spp., Leptospira spp. and Campylobacter foetus, these are significant bacteria commonly implicated in bovine abortion. ß-actin was added to the same PCR reaction as an internal control to detect any extraction failure or PCR inhibition. The detection limit of multiplex real-time PCR using purified DNA from cultured organisms was set to 5 fg for Leptospira spp. and C. foetus and to 50 fg for Brucella spp. The multiplex real-time PCR did not produce any non-specific amplification when tested with different strains of the 3 pathogens. This multiplex real-time PCR provides a valuable tool for diagnosis, simultaneous and rapid detection for the 3 pathogens causing abortion in bovine.

Nested PCR Biases in Interpreting Microbial Community Structure in 16S rRNA Gene Sequence Datasets.

Science.gov (United States)

Yu, Guoqin; Fadrosh, Doug; Goedert, James J; Ravel, Jacques; Goldstein, Alisa M

2015-01-01

Sequencing of the PCR-amplified 16S rRNA gene has become a common approach to microbial community investigations in the fields of human health and environmental sciences. This approach, however, is difficult when the amount of DNA is too low to be amplified by standard PCR. Nested PCR can be employed as it can amplify samples with DNA concentration several-fold lower than standard PCR. However, potential biases with nested PCRs that could affect measurement of community structure have received little attention. In this study, we used 17 DNAs extracted from vaginal swabs and 12 DNAs extracted from stool samples to study the influence of nested PCR amplification of the 16S rRNA gene on the estimation of microbial community structure using Illumina MiSeq sequencing. Nested and standard PCR methods were compared on alpha- and beta-diversity metrics and relative abundances of bacterial genera. The effects of number of cycles in the first round of PCR (10 vs. 20) and microbial diversity (relatively low in vagina vs. high in stool) were also investigated. Vaginal swab samples showed no significant difference in alpha diversity or community structure between nested PCR and standard PCR (one round of 40 cycles). Stool samples showed significant differences in alpha diversity (except Shannon's index) and relative abundance of 13 genera between nested PCR with 20 cycles in the first round and standard PCR (Pnested PCR with 10 cycles in the first round and standard PCR. Operational taxonomic units (OTUs) that had low relative abundance (sum of relative abundance 27% of total OTUs in stool). Nested PCR introduced bias in estimated diversity and community structure. The bias was more significant for communities with relatively higher diversity and when more cycles were applied in the first round of PCR. We conclude that nested PCR could be used when standard PCR does not work. However, rare taxa detected by nested PCR should be validated by other technologies.

A multiplex real-time PCR assay for routine diagnosis of bacterial vaginosis

NARCIS (Netherlands)

Kusters, J. G.; Reuland, E. A.; Bouter, S.; Koenig, P.; Dorigo-Zetsma, J. W.

2015-01-01

A semi-quantitative multiplex PCR assay for the diagnosis of bacterial vaginosis (BV) was evaluated in a prospective study in a population of Dutch women with complaints of abnormal vaginal discharge. The PCR targets Gardnerella vaginalis, Atopobium vaginae, Megasphaera phylotype 1, Lactobacillus

New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

Science.gov (United States)

Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

2015-01-01

We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

New multiplex PCR methods for rapid screening of genetically modified organisms in foods

Directory of Open Access Journals (Sweden)

Nelly eDatukishvili

2015-07-01

Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

Identification of Candida Species Associated with Vulvovaginal Candidiasis by Multiplex PCR

Directory of Open Access Journals (Sweden)

Mahnaz Mahmoudi Rad

2012-01-01

Full Text Available Background. Vulvovaginal candidiasis is a common infection. The aim of this study was to identify the species of vaginal Candida isolates by using multiplex PCR technique. Methods. 191 isolates from patients admitted to Mahdieh hospital were identified. The vaginal swab specimens were cultured on Sabouraud Dextrose Agar. The ITS1 region between the 18S and 5.8S rRNA genes and a specific DNA fragment within the ITS2 region were amplified. The multiplex PCR products were separated by electrophoresis in 2% agarose gel, visualized by staining with ethidium bromide, and photographed. Descriptive statistics, Chi-square test, and Spearman correlation were used to summarize the findings. Results. C. albicans and C. glabrata were the most common species isolated from the specimens. A mix of C. glabrata and C. albicans was the most common mixed infection isolated from the samples. The analysis revealed a significant positive association between older age and infection with C. glabrata isolates (Spearman’s rho = 0.89, P=0.015. Conclusion. Multiplex PCR is a fast, yet reliable method to identify Candida species. C. albicans and then C. glabrata are the two most common causes of vulvovaginal candidiasis. The number of mixed fungal infections is higher among Iranian population compared to international reports.

Detection of respiratory bacterial pathogens causing atypical pneumonia by multiplex Lightmix® RT-PCR.

Science.gov (United States)

Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M

2018-04-01

Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensitivity as in-house singleplex RT-PCRs for pathogen detection. The Lightmix ® multiplex RT-PCR assay represents a low-cost, time-saving and accurate diagnostic tool with high throughput potential. The time-to-result using an automated DNA extraction device for respiratory specimens followed by multiplex RT-PCR detection was

Whole blood Nested PCR and Real-time PCR amplification of Talaromyces marneffei specific DNA for diagnosis.

Science.gov (United States)

Lu, Sha; Li, Xiqing; Calderone, Richard; Zhang, Jing; Ma, Jianchi; Cai, Wenying; Xi, Liyan

2016-02-01

Talaromyces marneffei is a dimorphic pathogenic fungus, which is a life-threatening invasive mycosis in the immunocompromised host. Prompt diagnosis of T. marneffei infection remains difficult although there has been progress in attempts to expedite the diagnosis of this infection. We previously demonstrated the value of nested polymerase chain reaction (PCR) to detect T. marneffei in paraffin embedded tissue samples with high sensitivity and specificity. In this study, this assay was used to detect the DNA of T. marneffei in whole blood samples. Real-time PCR assay was also evaluated to identify T. marneffei in the same samples. Twenty out of 30 whole blood samples (67%) collected from 23 patients were found positive by using the nested PCR assay, while 23/30 (77%) samples were found positive by using the real-time PCR assay. In order to express accurately the fungal loads, we used a normalized linearized plasmid as an internal control for real-time PCR. The assay results were correlated as the initial quantity (copies/μl) with fungal burden. These data indicate that combination of nested PCR and real-time PCR assay provides an attractive alternative for identification of T. marneffei DNA in whole blood samples of HIV-infected patients. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

A multiplex PCR method for detection of Aspergillus spp. and Mycobacterium tuberculosis in BAL specimens.

Science.gov (United States)

Amini, F; Kachuei, R; Noorbakhsh, F; Imani Fooladi, A A

2015-06-01

The aim of this study was the detection of Aspergillus species and Mycobacterium tuberculosis together in bronchoalveolar lavage (BAL) using of multiplex PCR. In this study, from September 2012 until June 2013, 100 bronchoalveolar lavage (BAL) specimens were collected from patients suspected of tuberculosis (TB). After the direct and culture test, multiplex PCR were utilized in order to diagnose Aspergillus species and M. tuberculosis. Phenol-chloroform manual method was used in order to extract DNA from these microorganisms. Aspergillus specific primers, M. tuberculosis designed primers and beta actin primers were used for multiplex PCR. In this study, by multiplex PCR method, Aspergillus species were identified in 12 samples (12%), positive samples in direct and culture test were respectively 11% and 10%. Sensitivity and specificity of this method in comparison to direct test were respectively 100% and 98.8%, also sensitivity and specificity of this method in comparison to culture test were respectively 100% and 97.7%. In this assay, M. tuberculosis was identified in 8 samples (8%). Mycobacterium-positive samples in molecular method, direct and culture test were respectively 6%, 5% and 7%. Sensitivity and specificity of PCR method in comparison to direct test were 80% and 97.8% also sensitivity and specificity of this method in comparison to culture test was 71.4% and 98.9%. In the present study, multiplex PCR method had higher sensitivity than direct and culture test in order to identify and detect Aspergillus, also this method had lower sensitivity for identification of M. tuberculosis, suggesting that the method of DNA extraction was not suitable. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Single tube multiplex real-time PCR for the rapid detection of herpesvirus infections of the central nervous system.

Science.gov (United States)

Sankuntaw, Nipaporn; Sukprasert, Saovaluk; Engchanil, Chulapan; Kaewkes, Wanlop; Chantratita, Wasun; Pairoj, Vantanit; Lulitanond, Viraphong

2011-01-01

Human herpesvirus infection of immunocompromised hosts may lead to central nervous system (CNS) infection and diseases. In this study, a single tube multiplex real-time PCR was developed for the detection of five herpesviruses (HSV-1, HSV-2, VZV, EBV and CMV) in clinical cerebrospinal fluid (CSF) specimens. Two primer pairs specific for the herpesvirus polymerase gene and five hybridization probe pairs for the specific identification of the herpesvirus types were used in a LightCycler multiplex real-time PCR. A singleplex real-time PCR was first optimized and then applied to the multiplex real-time PCR. The singleplex and multiplex real-time PCRs showed no cross-reactivity. The sensitivity of the singleplex real-time PCR was 1 copy per reaction for each herpesvirus, while that of the multiplex real-time PCR was 1 copy per reaction for HSV-1 and VZV and 10 copies per reaction for HSV-2, EBV and CMV. Intra and inter-assay variations of the single tube multiplex assay were in the range of 0.02%-3.67% and 0.79%-4.35%, respectively. The assay was evaluated by testing 62 clinical CSF samples and was found to have equivalent sensitivity, specificity and agreement as the routine real-time PCR, but reducing time, cost and amount of used sample. Copyright © 2011 Elsevier Ltd. All rights reserved.

Comparative evaluation of the nested ITS PCR against the 18S PCR-RFLP in a survey of bovine trypanosomiasis in Kwale County, Kenya.

Science.gov (United States)

Odongo, Steven; Delespaux, Vincent; Ngotho, Maina; Bekkele, Serkalem Mindaye; Magez, Stefan

2016-09-01

We compared the nested internal transcribed spacer (ITS) PCR and the 18S PCR-RFLP (restriction-fragment length polymorphism) pan-trypanosome assays in a cross-sectional survey of bovine trypanosomiasis in 358 cattle in Kwale County, Kenya. The prevalence of trypanosomiasis as determined by the nested ITS PCR was 19.6% (70/358) and by 18S PCR-RFLP was 16.8% (60/358). Of the pathogenic trypanosomes detected, the prevalence of Trypanosoma congolense and Trypanosoma vivax was greater than that of Trypanosoma simiae The nested ITS PCR detected 83 parasite events, whereas the 18S PCR-RFLP detected 64; however, overall frequencies of infections and the parasite events detected did not differ between the assays (χ(2) = 0.8, df = 1, p > 0.05 and χ(2) = 2.5, df = 1, p > 0.05, respectively). The kappa statistic (0.8) showed good agreement between the tests. The nested ITS PCR and the 18S PCR-RFLP had comparable sensitivity, although the nested ITS PCR was better at detecting mixed infections (χ(2) = 5.4, df = 1, p < 0.05). © 2016 The Author(s).

Development of a GeXP-multiplex PCR assay for the simultaneous detection and differentiation of six cattle viruses.

Directory of Open Access Journals (Sweden)

Qing Fan

Full Text Available Foot-and-mouth disease virus (FMDV, Bluetongue virus (BTV, Vesicular stomatitis Virus (VSV, Bovine viral diarrheal (BVDV, Bovine rotavirus (BRV, and Bovine herpesvirus 1 (IBRV are common cattle infectious viruses that cause a great economic loss every year in many parts of the world. A rapid and high-throughput GenomeLab Gene Expression Profiler (GeXP analyzer-based multiplex PCR assay was developed for the simultaneous detection and differentiation of these six cattle viruses. Six pairs of chimeric primers consisting of both the gene-specific primer and a universal primer were designed and used for amplification. Then capillary electrophoresis was used to separate the fluorescent labeled PCR products according to the amplicons size. The specificity of GeXP-multiplex PCR assay was examined with samples of the single template and mixed template of six viruses. The sensitivity was evaluated using the GeXP-multiplex PCR assay on serial 10-fold dilutions of ssRNAs obtained via in vitro transcription. To further evaluate the reliability, 305 clinical samples were tested by the GeXP-multiplex PCR assay. The results showed that the corresponding virus specific fragments of genes were amplified. The detection limit of the GeXP-multiplex PCR assay was 100 copies/μL in a mixed sample of ssRNAs containing target genes of six different cattle viruses, whereas the detection limit for the Gexp-mono PCR assay for a single target gene was 10 copies/μL. In detection of viruses in 305 clinical samples, the results of GeXP were consistent with simplex real-time PCR. Analysis of positive samples by sequencing demonstrated that the GeXP-multiplex PCR assay had no false positive samples of nonspecific amplification. In conclusion, this GeXP-multiplex PCR assay is a high throughput, specific, sensitive, rapid and simple method for the detection and differentiation of six cattle viruses. It is an effective tool that can be applied for the rapid differential diagnosis

Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

Directory of Open Access Journals (Sweden)

U. Pagnini

2010-02-01

Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

Multiplex real-time PCR for identification of canine parvovirus antigenic types.

Science.gov (United States)

Kaur, Gurpreet; Chandra, Mudit; Dwivedi, P N; Narang, Deepti

2016-07-01

Canine parvovirus (CPV) is an important disease causing gastroenteritis and/or haemorrhagic gastroenteritis in dogs. There are four antigenic types of CPV reported worldwide viz. CPV 2, CPV 2a, CPV 2b and CPV 2c. The diagnosis of CPV with the identification of the antigen type responsible remains problematic. In the present study, identification as well as antigenic typing of CPV was done using a de novo multiplex real time PCR to combat the problem of antigenic type identification. From the study it could be concluded that the here developed multiplex real time PCR assay could be used for rapid detection of CPV as well as typing of its three antigenic types. Copyright © 2016 Elsevier B.V. All rights reserved.

A multiplex PCR assay for the detection and quantification of Sclerotinia sclerotiorum and Botrytis cinerea.

Science.gov (United States)

Reich, J D; Alexander, T W; Chatterton, S

2016-05-01

Traditional culture methods for identifying the plant fungal pathogens Sclerotinia sclerotiorum (Lib.) de Bary and Botrytis cinerea Pers.:Fr. are slow and laborious. The goal of this study was to develop a multiplex real-time PCR (qPCR) assay to detect and quantify DNA from S. sclerotiorum and B. cinerea. A primer set (SsIGS_5) for S. sclerotiorum was designed that targeted the intergenic spacer (IGS) regions of the ribosomal DNA. Addition of a probe to the assay increased its specificity: when the primer/probe set was tested against 21 fungal species (35 strains), amplification was detected from all S. sclerotiorum strains and no other species. For qPCR, the SsIGS_5 primer and probe set exhibited a linear range from 7·0 ng to 0·07 pg target DNA (R(2)  = 0·99). SsIGS_5 was then multiplexed with a previously published primer/probe set for B. cinerea to develop a high-throughput method for the detection and quantification of DNA from both pathogens. When multiplexed, the sensitivity and specificity of both assays were not different from individual qPCR reactions. The multiplex assay is currently being used to detect and quantify S. sclerotiorum and B. cinerea DNA from aerosol samples collected in commercial seed alfalfa fields. A primer and probe set for the quantification of Sclerotinia sclerotiorum DNA in a PCR assay was developed. The probe-based nature of this assay signifies an improvement over previous assays for this species by allowing multiplex reactions while maintaining high sensitivity. The primer/probe set was used in a multiplex real-time PCR assay for the quantification of S. sclerotiorum and Botrytis cinerea DNA, enabling rapid analysis of environmental samples. In crops susceptible to both pathogens, this multiplex assay can be used to quickly quantify the presence of each pathogen. © 2016 Her Majesty the Queen in Right of Canada © 2016 The Society for Applied Microbiology. Reproduced with the permission of the Office of the

Simultaneous Detection of Four Foodborne Viruses in Food Samples Using a One-Step Multiplex Reverse Transcription PCR.

Science.gov (United States)

Lee, Shin-Young; Kim, Mi-Ju; Kim, Hyun-Joong; Jeong, KwangCheol Casey; Kim, Hae-Yeong

2018-02-28

A one-step multiplex reverse transcription PCR (RT-PCR) method comprising six primer sets (for the detection of norovirus GI and GII, hepatitis A virus, rotavirus, and astrovirus) was developed to simultaneously detect four kinds of pathogenic viruses. The size of the PCR products for norovirus GI and GII, hepatitis A virus (VP3/VP1 and P2A regions), rotavirus, and astrovirus were 330, 164, 244, 198, 629, and 449 bp, respectively. The RT-PCR with the six primer sets showed specificity for the pathogenic viruses. The detection limit of the developed multiplex RT-PCR, as evaluated using serially diluted viral RNAs, was comparable to that of one-step single RT-PCR. Moreover, this multiplex RT-PCR was evaluated using food samples such as water, oysters, lettuce, and vegetable product. These food samples were artificially spiked with the four kinds of viruses in diverse combinations, and the spiked viruses in all food samples were detected successfully.

Detection by hemi-nested reverse transcription polymerase chain reaction and genetic characterization of wild type strains of Canine distemper virus in suspected infected dogs.

Science.gov (United States)

Di Francesco, Cristina E; Di Francesco, Daniela; Di Martino, Barbara; Speranza, Roberto; Santori, Domenico; Boari, Andrea; Marsilio, Fulvio

2012-01-01

A new highly sensitive and specific hemi-nested reverse transcription polymerase chain reaction (RT-PCR) assay was applied to detect nucleoprotein (NP) gene of Canine distemper virus (CDV) in samples collected from dogs showing respiratory, gastrointestinal, and neurological signs. Thirty-eight out of 86 samples were positive suggesting that despite the vaccination, canine distemper may still represent a high risk to the canine population. The 968 base pair (bp) fragments from the hemagglutinin (H) gene of 10 viral strains detected in positive samples were amplified and analyzed by restriction fragment length polymorphism (RFLP) using AluI and PsiI enzymes in order to differentiate among vaccine and wild-type CDV strains and to characterize the field viral strains. The products of the both enzymatic digestions allowed identification all viruses as wild strains of CDV. In addition, the RFLP analysis with AluI provided additional information about the identity level among the strains analyzed on the basis of the positions of the cleavage site in the nucleotide sequences of the H gene. The method could be a more useful and simpler method for molecular studies of CDV strains.

Simultaneous Detection of Genetically Modified Organisms in a Mixture by Multiplex PCR-Chip Capillary Electrophoresis.

Science.gov (United States)

Patwardhan, Supriya; Dasari, Srikanth; Bhagavatula, Krishna; Mueller, Steffen; Deepak, Saligrama Adavigowda; Ghosh, Sudip; Basak, Sanjay

2015-01-01

An efficient PCR-based method to trace genetically modified food and feed products is in demand due to regulatory requirements and contaminant issues in India. However, post-PCR detection with conventional methods has limited sensitivity in amplicon separation that is crucial in multiplexing. The study aimed to develop a sensitive post-PCR detection method by using PCR-chip capillary electrophoresis (PCR-CCE) to detect and identify specific genetically modified organisms in their genomic DNA mixture by targeting event-specific nucleotide sequences. Using the PCR-CCE approach, novel multiplex methods were developed to detect MON531 cotton, EH 92-527-1 potato, Bt176 maize, GT73 canola, or GA21 maize simultaneously when their genomic DNAs in mixtures were amplified using their primer mixture. The repeatability RSD (RSDr) of the peak migration time was 0.06 and 3.88% for the MON531 and Bt176, respectively. The RSD (RSDR) of the Cry1Ac peak ranged from 0.12 to 0.40% in multiplex methods. The method was sensitive in resolving amplicon of size difference up to 4 bp. The PCR-CCE method is suitable to detect multiple genetically modified events in a composite DNA sample by tagging their event specific sequences.

Development of Multiplex Microsatellite PCR Panels for the Seagrass Thalassia hemprichii (Hydrocharitaceae

Directory of Open Access Journals (Sweden)

Kor-jent van Dijk

2014-11-01

Full Text Available Premise of the study: New microsatellites were developed for the seagrass Thalassia hemprichii (Hydrocharitaceae, a long-lived seagrass species that is found throughout the shallow waters of tropical and subtropical Indo-West Pacific. Three multiplex PCR panels were designed utilizing new and previously developed markers, resulting in a toolkit for generating a 16-locus genotype. Methods and Results: Through the use of microsatellite enrichment and next-generation sequencing, 16 new, validated, polymorphic microsatellite markers were isolated. Diversity was between two and four alleles per locus totaling 36 alleles. These markers, plus previously developed microsatellite markers for T. hemprichii and T. testudinum, were tested for suitability in multiplex PCR panels. Conclusions: The generation of an easily replicated suite of multiplex panels of codominant molecular markers will allow for high-resolution and detailed genetic structure analysis and clonality assessment with minimal genotyping costs. We suggest the establishment of a T. hemprichii primer convention for the unification of future data sets.

Evaluation of nested PCR in diagnosis of fungal rhinosinusitis.

Science.gov (United States)

Badiee, Parisa; Gandomi, Behrooz; Sabz, Gholamabbass; Khodami, Bijan; Choopanizadeh, Maral; Jafarian, Hadis

2015-02-01

Given the importance of rapid diagnosis for fungal rhinosinusitis, this study aimed to evaluate the use of nested PCR to identify Aspergillus and Mucor species in clinical samples from patients with suspected fungal rhinosinusitis. Functional endoscopic sinus surgery specimens were collected from 98 patients with rhinosinusitis from 2012 to 2013. All samples were ground and cultured on sabouraud dextrose agar. The isolated fungi were identified based on their macroscopic and microscopic features. Fungal DNA was extracted from the tissue samples and nested PCR was performed with two sets of primers for Mucor and Aspergillus. Direct microscopic showed that 5.1% contained fungal components and 9.2% exhibited growth of fungi in culture. The most common agents isolated were Aspergillus fumigatus (n= 3), Aspergillus flavus (n=2), Penicillium sp (n=3) and Alternaria sp. (n=1). Mucor sp. was identified in the pathology smear from 1 patient. Positive results for fungal rhinosinusitis were obtained for a total of 10.2% by culture or pathology smear. Positive PCR results were obtained in 72 samples for Aspergillus and 31 samples for Mucor. Our results suggest that endoscopic sinus surgery specimens are not suitable for nested PCR, probably because of the accumulation of fungi that contaminate the environmental air. This drawback is a limiting factor for diagnosis with nasal cavity specimens. Therefore, molecular methods and conventional culture techniques are helpful complementary diagnostic methods to detect fungal rhinosinusitis and determine appropriate management for these patients.

Comparison of Nested-PCR technique and culture method in ...

African Journals Online (AJOL)

USER

2010-04-05

Apr 5, 2010 ... Full Length Research Paper. Comparison of ... The aim of the present study was to evaluate the diagnostic value of nested PCR in genitourinary ... method. Based on obtained results, the positivity rate of urine samples in this study was 5.0% by using culture and PCR methods and 2.5% for acid fast staining.

Evaluation of a nested-PCR for mycobacterium tuberculosis detection in blood and urine samples.

Science.gov (United States)

da Cruz, Heidi Lacerda Alves; de Albuquerque Montenegro, Rosana; de Araújo Lima, Juliana Falcão; da Rocha Poroca, Diogo; da Costa Lima, Juliana Figueirêdo; Maria Lapa Montenegro, Lílian; Crovella, Sergio; Charifker Schindler, Haiana

2011-01-01

The polymerase chain reaction (PCR) and its variations, such as the nested-PCR, have been described as promising techniques for rapid diagnosis of tuberculosis (TB). With the aim of evaluating the usefulness of a nested-PCR method on samples of blood and urine of patients suspected of tuberculosis we analyzed 192 clinical samples, using as a molecular target the insertion element IS6110 specific of M. tuberculosis genome. Nested-PCR method showed higher sensitivity in patients with extrapulmonary tuberculosis (47.8% and 52% in blood and urine) when compared to patients with the pulmonary form of the disease (sensitivity of 29% and 26.9% in blood and urine), regardless of the type of biological sample used. The nested-PCR is a rapid technique that, even if not showing a good sensitivity, should be considered as a helpful tool especially in the extrapulmonary cases or in cases where confirmatory diagnosis is quite difficult to be achieved by routine methods. The performance of PCR-based techniques should be considered and tested in future works on other types of biological specimens besides sputum, like blood and urine, readily obtainable in most cases. The improving of M. tuberculosis nested-PCR detection in TB affected patients will give the possibility of an earlier detection of bacilli thus interrupting the transmission chain of the disease.

Development of Nested-PCR Assay to Detect Acidovorax citrulli, a Causal Agent of Bacterial Fruit Blotch at Cucurbitaceae

Directory of Open Access Journals (Sweden)

Young-Tak Kim

2015-06-01

Full Text Available The specific and sensitive nested-PCR method to detect Acidovorax citrulli, a causal agent of bacterial fruit blotch on cucurbitaceae, was developed. PCR primers were designed from the draft genome sequence which was obtained with the Next Generation Sequencing of A. citrulli KACC10651, and the nested-PCR primer set (Ac-ORF 21F/Ac-ORF 21R were selected by checking of specificity to A. citrulli with PCR assays. The selected nested-PCR primer amplified the 140 bp DNA only from A. citrulli strains, and detection sensitivity of the nested PCR increased 10,000 times of 1st PCR detection limit (10 ng genomic DNA/PCR. The nested PCR detected A. citrulli from the all samples of seed surface wash (external seed detection of the artificially inoculated watermelon seeds with 101 cfu/ml and above population of A. citrulli while the nested PCR could not detected A. citrulli from the mashed seed suspension (internal seed detection of the all artificially inoculated watermelon seeds. When the naturally infested watermelon seeds (10% seed infested rate with grow-out test used, the nested PCR detected A. citrulli from 2 seed samples out of 10 replication samples externally and 5 seed samples out of 10 replication samples internally. We believe that the nested-PCR developed in this study will be useful method to detect A. citrulli from the Cucurbitaceae seeds.

Comparison of a conventional and nested PCR for diagnostic confirmation and genotyping of Orientia tsutsugamushi.

Science.gov (United States)

Janardhanan, Jeshina; Prakash, John Antony Jude; Abraham, Ooriapadickal C; Varghese, George M

2014-05-01

A nested polymerase chain reaction (PCR) targeting the 56-kDa antigen gene is currently the most commonly used molecular technique for confirmation of scrub typhus and genotyping of Orientia tsutsugamushi. In this study, we have compared the commonly used nested PCR (N-PCR) with a single-step conventional PCR (C-PCR) for amplification and genotyping. Eschar samples collected from 24 patients with scrub typhus confirmed by IgM enzyme-linked immunosorbent assay were used for DNA extraction following which amplifications were carried out using nested and C-PCR methods. The amplicons were sequenced and compared to other sequences in the database using BLAST. Conventional PCR showed a high positivity rate of 95.8% compared to the 75% observed using N-PCR. On sequence analysis, the N-PCR amplified region showed more variation among strains than the C-PCR amplified region. The C-PCR, which is more economical, provided faster and better results compared to N-PCR. Copyright © 2014 Elsevier Inc. All rights reserved.

Entamoeba spp. diagnosis in patients with inflmmatory diarrhea by staining, copro-antigen ELISA and multiplex PCR methods

Directory of Open Access Journals (Sweden)

Zahra Gharibi

2017-10-01

Full Text Available Objective: To evaluate Entamoeba spp. diagnosis in patients with inflammatory diarrhea by staining, copro-antigen ELISA and multiplex PCR methods. Methods: In this descriptive cross-sectional survey, 200 stool samples were randomly collected during 2015–2016. The stool samples were evaluated microscopically for the presence of the parasite using direct and formalin-ether concentration and trichrome staining methods. Then, the stool samples were examined by copro-antigen ELISA (Biomerica Company and multiplex PCR methods. Results: Of 200 samples, 17, 29 and 23 cases were positive for Entamoeba species by the staining, copro-antigen ELISA and multiplex PCR methods, respectively. Of 23 positive samples in multiplex PCR test, 13 and 10 samples were positive for Entamoeba dispar (E. dispar and Entamoeba histolytica (E. histolytica, respectively. Conclusions: Our finding indicated a relatively high prevalence of Entamoeba species in patients with inflammatory diarrhea in Ahvaz city. Due to the complications of E. histolytica/ dispar infection, the health authorities of the city must pay more attention to control and prevent the transmission of E. histolytica/dispar to individuals.

Species Identification of Fox-, Mink-, Dog-, and Rabbit-Derived Ingredients by Multiplex PCR and Real-Time PCR Assay.

Science.gov (United States)

Wu, Qingqing; Xiang, Shengnan; Wang, Wenjun; Zhao, Jinyan; Xia, Jinhua; Zhen, Yueran; Liu, Bang

2018-05-01

Various detection methods have been developed to date for identification of animal species. New techniques based on PCR approach have raised the hope of developing better identification methods, which can overcome the limitations of the existing methods. PCR-based methods used the mitochondrial DNA (mtDNA) as well as nuclear DNA sequences. In this study, by targeting nuclear DNA, multiplex PCR and real-time PCR methods were developed to assist with qualitative and quantitative analysis. The multiplex PCR was found to simultaneously and effectively distinguish four species (fox, dog, mink, and rabbit) ingredients by the different sizes of electrophoretic bands: 480, 317, 220, and 209 bp. Real-time fluorescent PCR's amplification profiles and standard curves showed good quantitative measurement responses and linearity, as indicated by good repeatability and coefficient of determination R 2  > 0.99. The quantitative results of quaternary DNA mixtures including mink, fox, dog, and rabbit DNA are in line with our expectations: R.D. (relative deviation) varied between 1.98 and 12.23% and R.S.D. (relative standard deviation) varied between 3.06 and 11.51%, both of which are well within the acceptance criterion of ≤ 25%. Combining the two methods is suitable for the rapid identification and accurate quantification of fox-, dog-, mink-, and rabbit-derived ingredients in the animal products.

Detection of Lymnaea columella infection by Fasciola hepatica through Multiplex-PCR

Directory of Open Access Journals (Sweden)

Kelly Grace Magalhães

2004-06-01

Full Text Available From complete mitochondrial DNA sequence of Fasciola hepatica available in Genbank, specific primers were designed for a conserved and repetitive region of this trematode. A pair of primers was used for diagnosis of infected Lymnaea columella by F. hepatica during the pre-patent period simultaneously with another pair of primers which amplified the internal transcribed spacer (ITS region of rDNA from L. columella in a single Multiplex-PCR. The amplification generated a ladder band profile specific for F. hepatica. This profile was observed in positive molluscs at different times of infection, including adult worms from the trematode. The Multiplex-PCR technique showed to be a fast and safe tool for fascioliasis diagnosis, enabling the detection of F. hepatica miracidia in L. columella during the pre-patent period and identification of transmission areas.

Simultaneous quantitative assessment of circulating cell-free mitochondrial and nuclear DNA by multiplex real-time PCR

Directory of Open Access Journals (Sweden)

Peng Xia

2009-01-01

Full Text Available Quantification of circulating nucleic acids in plasma and serum could be used as a non-invasive diagnostic tool for monitoring a wide variety of diseases and conditions. We describe here a rapid, simple and accurate multiplex real-time PCR method for direct synchronized analysis of circulating cell-free (ccf mitochondrial (mtDNA and nuclear (nDNA DNA in plasma and serum samples. The method is based on one-step multiplex real-time PCR using a FAM-labeled MGB probe and primers to amplify the mtDNA sequence of the ATP 8 gene, and a VIC-labeled MGB probe and primers to amplify the nDNA sequence of the glycerinaldehyde-3-phosphate-dehydrogenase (GAPDH gene, in plasma and serum samples simultaneously. The efficiencies of the multiplex assays were measured in serial dilutions. Based on the simulation of the PCR reaction kinetics, the relative quantities of ccf mtDNA were calculated using a very simple equation. Using our optimised real-time PCR conditions, close to 100% efficiency was obtained from the two assays. The two assays performed in the dilution series showed very good and reproducible correlation to each other. This optimised multiplex real-time PCR protocol can be widely used for synchronized quantification of mtDNA and nDNA in different samples, with a very high rate of efficiency.

Evaluation of a PCR multiplex for detection and differentiation of Mycoplasma synoviae, M. gallisepticum, and M. gallisepticum strain F-vaccine

Directory of Open Access Journals (Sweden)

Elena Mettifogo

2015-01-01

Full Text Available Mycoplasma gallisepticum (MG and Mycoplasma synoviae (MS are the mycoplasma infections of most concern for commercial poultry industry. MG infection is commonly designated as chronic respiratory disease (CRD of chickens and infections sinusitis of turkeys. MS causes sub clinical upper respiratory infection and tenosynovitis or bursitis in chickens and turkeys. The multiplex PCR was standardized to detect simultaneously the MS, MG field strains and MG F-vaccine strain specific. The generic PCR for detection of any species of Mollicutes Class was performed and compared to the multiplex PCR and to PCR using species-specific primers. A total of 129 avian tracheal swabs were collected from broiler-breeders, layer hens and broilers in seven different farms and were examined by multiplex PCR methods. The system (multiplex PCR demonstrated to be very rapid, sensitive, and specific. Therefore, the results showed a high prevalence of MS in the flocks examined (27.9%, and indicate that the MS is a recurrent pathogen in Brazilian commercial poultry flocks.

Detection of virulence genes in Uropathogenic E. coli (UPEC strains by Multiplex-PCR method

Directory of Open Access Journals (Sweden)

Javad Mohammadi

2017-06-01

Full Text Available Background & Objectives: Urinary tract infection caused by E. coli is one of the most common illnesses in all age groups worldwide. Presence of virulence genes is a key factor in bacterial pathogens in uroepithelial cells. The present study was performed to detect iha, iroN, ompT genes in the Uropathogenic E.coli isolates from clinical samples using multiplex-PCR method in Kerman. Materials & Methods: In this descriptive cross-sectional study, 200 samples of patients with urinary tract infections in Kerman hospitals were collected. After biochemical and microbiological tests, all strains were tested with regard to the presence of iha, iroN, and ompT genes using multiplex-PCR method. Results: The results of Multiplex-PCR showed that all specimens had one, two, or three virulence genes simultaneously. The highest and lowest frequency distribution of genes was related to iha (56.7% and iroN (20% respectively. Conclusion: According to the prevalence of urinary tract infection in the community and distribution of resistance and virulence factors, the fast and accurate detection of the strains and virulence genes is necessary

Nested PCR detection of malaria directly using blood filter paper samples from epidemiological surveys.

Science.gov (United States)

Li, Peipei; Zhao, Zhenjun; Wang, Ying; Xing, Hua; Parker, Daniel M; Yang, Zhaoqing; Baum, Elizabeth; Li, Wenli; Sattabongkot, Jetsumon; Sirichaisinthop, Jeeraphat; Li, Shuying; Yan, Guiyun; Cui, Liwang; Fan, Qi

2014-05-08

Nested PCR is considered a sensitive and specific method for detecting malaria parasites and is especially useful in epidemiological surveys. However, the preparation of DNA templates for PCR is often time-consuming and costly. A simplified PCR method was developed to directly use a small blood filter paper square (2 × 2 mm) as the DNA template after treatment with saponin. This filter paper-based nested PCR method (FP-PCR) was compared to microscopy and standard nested PCR with DNA extracted by using a Qiagen DNA mini kit from filter paper blood spots of 204 febrile cases. The FP-PCR technique was further applied to evaluate malaria infections in 1,708 participants from cross-sectional epidemiological surveys conducted in Myanmar and Thailand. The FP-PCR method had a detection limit of ~0.2 parasites/μL blood, estimated using cultured Plasmodium falciparum parasites. With 204 field samples, the sensitivity of the FP-PCR method was comparable to that of the standard nested PCR method, which was significantly higher than that of microscopy. Application of the FP-PCR method in large cross-sectional studies conducted in Myanmar and Thailand detected 1.9% (12/638) and 6.2% (66/1,070) asymptomatic Plasmodium infections, respectively, as compared to the detection rates of 1.3% (8/638) and 0.04% (4/1,070) by microscopy. This FP-PCR method was much more sensitive than microscopy in detecting Plasmodium infections. It drastically increased the detection sensitivity of asymptomatic infections in cross-sectional surveys conducted in Thailand and Myanmar, suggesting that this FP-PCR method has a potential for future applications in malaria epidemiology studies.

Synovial fluid multiplex PCR is superior to culture for detection of low-virulent pathogens causing periprosthetic joint infection.

Science.gov (United States)

Morgenstern, Christian; Cabric, Sabrina; Perka, Carsten; Trampuz, Andrej; Renz, Nora

2018-02-01

Analysis of joint aspirate is the standard preoperative investigation for diagnosis of periprosthetic joint infection (PJI). We compared the diagnostic performance of culture and multiplex polymerase chain reaction (PCR) of synovial fluid for diagnosis of PJI. Patients in whom aspiration of the prosthetic hip or knee joint was performed before revision arthroplasty were prospectively included. The performance of synovial fluid culture and multiplex PCR was compared by McNemar's chi-squared test. A total of 142 patients were included, 82 with knee and 60 with hip prosthesis. PJI was diagnosed in 77 patients (54%) and aseptic failure in 65 patients (46%). The sensitivity of synovial fluid culture and PCR was 52% and 60%, respectively, showing concordant results in 116 patients (82%). In patients with PJI, PCR missed 6 high-virulent pathogens (S. aureus, streptococci, E. faecalis, E. coli) which grew in synovial fluid culture, whereas synovial fluid culture missed 12 pathogens detected by multiplex PCR, predominantly low-virulent pathogens (Cutibacterium acnes and coagulase-negative staphylococci). In patients with aseptic failure, PCR detected 6 low-virulent organisms (predominantly C. acnes). While the overall performance of synovial fluid PCR was comparable to culture, PCR was superior for detection of low-virulent bacteria such as Cutibacterium spp. and coagulase-negative staphylococci. In addition, synovial fluid culture required several days for growth, whereas multiplex PCR provided results within 5hours in an automated manner. Copyright © 2017 Elsevier Inc. All rights reserved.

A Multiplex RT-PCR Assay for S. aureus, L. monocytogenes, and Salmonella spp. Detection in Raw Milk with Pre-enrichment

Directory of Open Access Journals (Sweden)

Tian Ding

2017-05-01

Full Text Available This study firstly developed a multiplex real-time PCR (RT-PCR technique combined with a pre-enrichment step to simultaneously detect Staphylococcus aureus (S. aureus, Listeria monocytogenes (L. monocytogenes and Salmonella spp. in raw milk and the dairy farm environment (feces, soil, feed, water in one reaction. Brain heart infusion (BHI broth was selected for the enrichment step to increase the density of the target bacteria by using an incubation of 4 h before multiplex RT-PCR. The results showed that the detection limit of the multiplex real-time assay was approximately 102 CFU/mL for pure cultures and artificially contaminated milk without enrichment, while 12, 14, and 10 CFU/25 mL, respectively, for S. aureus, L. monocytogenes, and Salmonella spp. after pre-enrichment. The newly developed multiplex RT-PCR assay was applied to 46 dairy farm environmental samples and raw milk samples covering a wide variety of sample types. The results demonstrated that the multiplex RT-PCR assay coupled with the BHI enrichment broth was suitable for the simultaneous screening of S. aureus, L. monocytogenes, and Salmonella spp. in the pasture environment and in raw milk. The multiplex RT-PCR assay clearly and successfully shortened the total detection time and reduced labor compared to conventional culture-based methods for testing natural samples.

Enhanced capillary electrophoretic screening of Alzheimer based on direct apolipoprotein E genotyping and one-step multiplex PCR.

Science.gov (United States)

Woo, Nain; Kim, Su-Kang; Sun, Yucheng; Kang, Seong Ho

2018-01-01

Human apolipoprotein E (ApoE) is associated with high cholesterol levels, coronary artery disease, and especially Alzheimer's disease. In this study, we developed an ApoE genotyping and one-step multiplex polymerase chain reaction (PCR) based-capillary electrophoresis (CE) method for the enhanced diagnosis of Alzheimer's. The primer mixture of ApoE genes enabled the performance of direct one-step multiplex PCR from whole blood without DNA purification. The combination of direct ApoE genotyping and one-step multiplex PCR minimized the risk of DNA loss or contamination due to the process of DNA purification. All amplified PCR products with different DNA lengths (112-, 253-, 308-, 444-, and 514-bp DNA) of the ApoE genes were analyzed within 2min by an extended voltage programming (VP)-based CE under the optimal conditions. The extended VP-based CE method was at least 120-180 times faster than conventional slab gel electrophoresis methods In particular, all amplified DNA fragments were detected in less than 10 PCR cycles using a laser-induced fluorescence detector. The detection limits of the ApoE genes were 6.4-62.0pM, which were approximately 100-100,000 times more sensitive than previous Alzheimer's diagnosis methods In addition, the combined one-step multiplex PCR and extended VP-based CE method was also successfully applied to the analysis of ApoE genotypes in Alzheimer's patients and normal samples and confirmed the distribution probability of allele frequencies. This combination of direct one-step multiplex PCR and an extended VP-based CE method should increase the diagnostic reliability of Alzheimer's with high sensitivity and short analysis time even with direct use of whole blood. Copyright © 2017 Elsevier B.V. All rights reserved.

Nested-PCR do gene que codifica o antígeno b aplicada ao diagnóstico da tuberculose pulmonar Nested-PCR for gene that encodes the antigen b applied to the diagnosis of pulmonary tuberculosis

Directory of Open Access Journals (Sweden)

Karla Valéria Batista Lima

2007-04-01

Full Text Available A reação em cadeia da polimerase usada para amplificação de uma seqüência interna de um fragmento previamente amplificado (nested-PCR foi investigada como uma alternativa complementar a pesquisa de bacilos álcool ácido resistentes e a cultura do Mycobacterium tuberculosis em meio de Lowenstein-Jensen. Foram investigadas 144 amostras de escarro de pacientes suspeitos de tuberculose encaminhados ao Laboratório de Tuberculose do Instituto Evandro Chagas em Belém, no período de junho de 2002 a dezembro de 2003. Das 144 amostras, 121 foram caracterizadas como tuberculose, 119 foram positivas na cultura, 95 na baciloscopia e 128 na nested-PCR. A sensibilidade da nested-PCR foi 96% (116/121, enquanto a especificidade foi 48% (11/23. A nested-PCR poderá ser uma ferramenta complementar para o diagnóstico da tuberculose, pois apresenta sensibilidade equivalente à cultura, no entanto, necessita de maiores avaliações visando minimizar o número de resultados falso-positivos.The polymerase chain reaction used for amplifying an internal sequence of a previously amplified fragment (nested-PCR was investigated as a complementary alternative for searching for alcohol-acid resistant bacilli and Mycobacterium tuberculosis cultures in Lowenstein-Jensen medium. 144 sputum samples were investigated from patients with suspected tuberculosis that were sent to the Tuberculosis Laboratory of the Evandro Chagas Institute in Belém, between June 2002 and December 2003. From the 144 samples, 121 were characterized as tuberculosis: 119 were positive in cultures, 95 under bacilloscopy and 128 using nested-PCR. The sensibility of the nested-PCR was 96% (116/121, while the specificity was 48% (11/23. Nested-PCR may be a complementary tool for diagnosing tuberculosis, since it presents sensitivity equivalent to that of cultures. However, further evaluations are needed with the aim of minimizing the number of false-positive results.

A novel multiplex PCR for the simultaneous detection of Salmonella enterica and Shigella species.

Science.gov (United States)

Radhika, M; Saugata, Majumder; Murali, H S; Batra, H V

2014-01-01

Salmonella enterica and Shigella species are commonly associated with food and water borne infections leading to gastrointestinal diseases. The present work was undertaken to develop a sensitive and reliable PCR based detection system for simultaneous detection of Salmonella enterica and Shigella at species level. For this the conserved regions of specific genes namely ipaH1, ipaH, wbgZ, wzy and invA were targeted for detection of Shigella genus, S. flexneri, S. sonnei, S. boydii and Salmonella enterica respectively along with an internal amplification control (IAC). The results showed that twenty Salmonella and eleven Shigella spp., were accurately identified by the assay without showing non-specificity against closely related other Enterobacteriaceae organisms and also against other pathogens. Further evaluation of multiplex PCR was undertaken on 50 natural samples of chicken, eggs and poultry litter and results compared with conventional culture isolation and identification procedure. The multiplex PCR identified the presence of Salmonella and Shigella strains with a short pre-enrichment step of 5 h in peptone water and the same samples were processed by conventional procedures for comparison. Therefore, this reported multiplex PCR can serve as an alternative to the tedious time-consuming procedure of culture and identification in food safety laboratories.

Nested PCR Assay for Detection of Leishmania donovani in Slit Aspirates from Post-Kala-Azar Dermal Leishmaniasis Lesions

Science.gov (United States)

Sreenivas, Gannavaram; Ansari, N. A.; Kataria, Joginder; Salotra, Poonam

2004-01-01

A nested PCR assay to detect parasite DNA in slit aspirates from skin lesions of patients with post-kala-azar dermal lesihmaniasis (PKDL) is described. PCR results were positive in 27 of 29 (93%) samples by nested PCR assay, while only 20 of 29 (69%) were positive in a primary PCR assay. The nested PCR assay allowed reliable diagnosis of PKDL in a noninvasive manner. PMID:15071047

Nested PCR Assay for Detection of Leishmania donovani in Slit Aspirates from Post-Kala-Azar Dermal Leishmaniasis Lesions

OpenAIRE

Sreenivas, Gannavaram; Ansari, N. A.; Kataria, Joginder; Salotra, Poonam

2004-01-01

A nested PCR assay to detect parasite DNA in slit aspirates from skin lesions of patients with post-kala-azar dermal lesihmaniasis (PKDL) is described. PCR results were positive in 27 of 29 (93%) samples by nested PCR assay, while only 20 of 29 (69%) were positive in a primary PCR assay. The nested PCR assay allowed reliable diagnosis of PKDL in a noninvasive manner.

Development of a multiplex PCR assay detecting 52 autosomal SNPs

DEFF Research Database (Denmark)

Sanchez Sanchez, Juan Jose; Phillips, C.; Børsting, Claus

2006-01-01

for amplifying 52 genomic DNA fragments, each containing one SNP, in a single tube, and accurately genotyping the PCR product mixture using two single base extension reactions. This multiplex approach reduces the cost of SNP genotyping and requires as little as 0.5 ng of genomic DNA to detect 52 SNPs. We used...

[Contribution of nested PCR in the diagnosis of imported malaria in southern Algeria].

Science.gov (United States)

Bouiba, L; Gassen, B; Gasmi, M; Hammadi, D; Harrat, Z

2016-12-01

The nested PCR was used to estimate its inputs in malaria diagnosis and in the performance of the microscope operators involved in the surveillance of malaria in remote areas of South Algeria. For the period 2010 to 2015, 112 patients (93 febrile and 19 asymptomatic) coming from sub-Saharan Africa were tested for malaria in the hospital of Tamanrasset. One part of the blood taken from fingertip was used for blood smears and the second part was absorbed in filter paper for molecular diagnosis. Overall, the infection was detected by nested PCR in 63 samples versus 53 by direct examination. In addition, 11 mixed infections and 6 positive asymptomatic cases not detected by microscopy were diagnosed by PCR. Moreover, two negative samples in nested PCR were tested positive by direct examination. The molecular tool is more sensitive than the direct examination in detecting infra-microscopic parasitaemia and mixed infections...

Performance of automated multiplex PCR using sonication fluid for diagnosis of periprosthetic joint infection: a prospective cohort.

Science.gov (United States)

Renz, Nora; Feihl, Susanne; Cabric, Sabrina; Trampuz, Andrej

2017-12-01

Sonication of explanted prostheses improved the microbiological diagnosis of periprosthetic joint infections (PJI). We evaluated the performance of automated multiplex polymerase chain reaction (PCR) using sonication fluid for the microbiological diagnosis of PJI. In a prospective cohort using uniform definition criteria for PJI, explanted joint prostheses were investigated by sonication and the resulting sonication fluid was analyzed by culture and multiplex PCR. McNemar's Chi-squared test was used to compare the performance of diagnostic tests. Among 111 patients, PJI was diagnosed in 78 (70%) and aseptic failure in 33 (30%). For the diagnosis of PJI, the sensitivity and specificity of periprosthetic tissue culture was 51 and 100%, of sonication fluid culture 58 and 100%, and of sonication fluid PCR 51 and 94%, respectively. Among 70 microorganisms, periprosthetic tissue culture grew 52 (74%), sonication fluid culture grew 50 (71%) and sonication fluid PCR detected 37 pathogens (53%). If only organisms are considered, for which primers are included in the test panel, PCR detected 37 of 58 pathogens (64%). The sonication fluid PCR missed 19 pathogens (predominantly oral streptococci and anaerobes), whereas 7 additional microorganisms were detected only by PCR (including Cutibacterium spp. and coagulase-negative staphylococci). The performance of multiplex PCR using sonication fluid is comparable to culture of periprosthetic tissue or sonication fluid. The advantages of PCR are short processing time (PCR, especially of low-virulent organisms.

Screening for circulating RAS/RAF mutations by multiplex digital PCR

DEFF Research Database (Denmark)

Andersen, Rikke Fredslund; Jakobsen, Anders

2016-01-01

by technical challenges primarily due to the low levels of ctDNA in patients with localized disease and in patients responding to therapy. The approach presented here is a multiplex digital PCR method of screening for 31 mutations in the KRAS, NRAS, BRAF, and PIK3CA genes in the plasma. The upper level...

Differentiating Botulinum Neurotoxin-Producing Clostridia with a Simple, Multiplex PCR Assay.

Science.gov (United States)

Williamson, Charles H D; Vazquez, Adam J; Hill, Karen; Smith, Theresa J; Nottingham, Roxanne; Stone, Nathan E; Sobek, Colin J; Cocking, Jill H; Fernández, Rafael A; Caballero, Patricia A; Leiser, Owen P; Keim, Paul; Sahl, Jason W

2017-09-15

Diverse members of the genus Clostridium produce botulinum neurotoxins (BoNTs), which cause a flaccid paralysis known as botulism. While multiple species of clostridia produce BoNTs, the majority of human botulism cases have been attributed to Clostridium botulinum groups I and II. Recent comparative genomic studies have demonstrated the genomic diversity within these BoNT-producing species. This report introduces a multiplex PCR assay for differentiating members of C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Coding region sequences unique to each of the four species/subgroups were identified by in silico analyses of thousands of genome assemblies, and PCR primers were designed to amplify each marker. The resulting multiplex PCR assay correctly assigned 41 tested isolates to the appropriate species or subgroup. A separate PCR assay to determine the presence of the ntnh gene (a gene associated with the botulinum neurotoxin gene cluster) was developed and validated. The ntnh gene PCR assay provides information about the presence or absence of the botulinum neurotoxin gene cluster and the type of gene cluster present ( ha positive [ ha + ] or orfX + ). The increased availability of whole-genome sequence data and comparative genomic tools enabled the design of these assays, which provide valuable information for characterizing BoNT-producing clostridia. The PCR assays are rapid, inexpensive tests that can be applied to a variety of sample types to assign isolates to species/subgroups and to detect clostridia with botulinum neurotoxin gene ( bont ) clusters. IMPORTANCE Diverse clostridia produce the botulinum neurotoxin, one of the most potent known neurotoxins. In this study, a multiplex PCR assay was developed to differentiate clostridia that are most commonly isolated in connection with human botulism cases: C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Since Bo

Direct detection of hemophilia B F9 gene mutation using multiplex PCR and conformation sensitive gel electrophoresis

Directory of Open Access Journals (Sweden)

Ki Young Yoo

2010-03-01

Full Text Available Purpose : The F9 gene is known to be the causative gene for hemophilia B, but unfortunately the detection rate for restriction fragment length polymorphism-based linkage analysis is only 55.6%. Direct DNA sequencing can detect 98% of mutations, but this alternative procedure is very costly. Here, we conducted multiplex polymerase chain reactions (PCRs and conformation sensitive gel electrophoresis (CSGE to perform a screened DNA sequencing for the F9 gene, and we compared the results with direct sequencing in terms of accuracy, cost, simplicity, and time consumption. Methods : A total of 27 unrelated hemophilia B patients were enrolled. Direct DNA sequencing was performed for 27 patients by a separate institute, and multiplex PCR-CSGE screened sequencing was done in our laboratory. Results of the direct DNA sequencing were used as a reference, to which the results of the multiplex PCR-CSGE screened sequencing were compared. For the patients whose mutation was not detected by the 2 methods, multiplex ligation-dependent probe amplification (MLPA was conducted. Results : With direct sequencing, the mutations could be identified from 26 patients (96.3%, whereas for multiplex PCR- CSGE screened sequencing, the mutations could be detected in 23 (85.2%. One patient’s mutation was identified by MLPA. A total of 21 different mutations were found among the 27 patients. Conclusion : Multiplex PCR-CSGE screened DNA sequencing detected 88.9% of mutations and reduced costs by 55.7% compared with direct DNA sequencing. However, it was more labor-intensive and time-consuming.

Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

Science.gov (United States)

Lee, Seong-Hun

2014-11-01

There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

Comparison of culture, single and multiplex real-time PCR for detection of Sabin poliovirus shedding in recently vaccinated Indian children.

Science.gov (United States)

Giri, Sidhartha; Rajan, Anand K; Kumar, Nirmal; Dhanapal, Pavithra; Venkatesan, Jayalakshmi; Iturriza-Gomara, Miren; Taniuchi, Mami; John, Jacob; Abraham, Asha Mary; Kang, Gagandeep

2017-08-01

Although, culture is considered the gold standard for poliovirus detection from stool samples, real-time PCR has emerged as a faster and more sensitive alternative. Detection of poliovirus from the stool of recently vaccinated children by culture, single and multiplex real-time PCR was compared. Of the 80 samples tested, 55 (68.75%) were positive by culture compared to 61 (76.25%) and 60 (75%) samples by the single and one step multiplex real-time PCR assays respectively. Real-time PCR (singleplex and multiplex) is more sensitive than culture for poliovirus detection in stool, although the difference was not statistically significant. © 2017 Wiley Periodicals, Inc.

Clostridium perfringens isolate typing by multiplex PCR

Directory of Open Access Journals (Sweden)

MR Ahsani

2010-01-01

Full Text Available Clostridium perfringens is an important pathogen that provokes numerous different diseases. This bacterium is classified into five different types, each of which capable of causing a different disease. There are various methods for the bacterial identification, many are labor-intensive, time-consuming, expensive and also present low sensitivity and specificity. The aim of this research was to identify the different types of C. perfringens using PCR molecular method. In this study, 130 sheep-dung samples were randomly collected from areas around the city of Kerman, southeastern Iran. After processing and culturing of samples, the produced colonies were morphologically studied, gram stain test was also carried out and the genera of these bacteria were identified through biochemical tests. DNA extracted from isolated bacteria for genotyping was tested by multiplex PCR with specific primers. Based on length of synthesized fragments by PCR, toxin types and bacterial strains were detected. C. perfringens isolated types were divided as follows: 17.39% type A, 21.74% type B, 34.78% type C and 26.09% type D. It should be emphasized that, up to the present moment, C. perfringens type A has not been reported in Iran.

Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.

Science.gov (United States)

Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S

2016-02-01

Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.

A multiplex PCR for detection of Listeria monocytogenes and its lineages.

Science.gov (United States)

Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B

2016-11-01

A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.

Multiplex quantification of four DNA targets in one reaction with Bio-Rad droplet digital PCR system for GMO detection

Science.gov (United States)

Dobnik, David; Štebih, Dejan; Blejec, Andrej; Morisset, Dany; Žel, Jana

2016-10-01

The advantages of the digital PCR technology are already well documented until now. One way to achieve better cost efficiency of the technique is to use it in a multiplexing strategy. Droplet digital PCR platforms, which include two fluorescence filters, support at least duplex reactions and with some developments and optimization higher multiplexing is possible. The present study not only shows a development of multiplex assays in droplet digital PCR, but also presents a first thorough evaluation of several parameters in such multiplex digital PCR. Two 4-plex assays were developed for quantification of 8 different DNA targets (7 genetically modified maize events and maize endogene). Per assay, two of the targets were labelled with one fluorophore and two with another. As current analysis software does not support analysis of more than duplex, a new R- and Shiny-based web application analysis tool (http://bit.ly/ddPCRmulti) was developed that automates the analysis of 4-plex results. In conclusion, the two developed multiplex assays are suitable for quantification of GMO maize events and the same approach can be used in any other field with a need for accurate and reliable quantification of multiple DNA targets.

Evaluation of hsp65 Nested PCR-Restriction Analysis (PRA) for Diagnosing Tuberculosis in a High Burden Country

Science.gov (United States)

Macente, Sara; Fujimura Leite, Clarice Queico; Santos, Adolfo Carlos Barreto; Siqueira, Vera Lúcia Dias; Machado, Luzia Neri Cosmo; Marcondes, Nadir Rodrigues; Hirata, Mario Hiroyuki; Hirata, Rosário Dominguez Crespo

2013-01-01

Current study evaluated the hsp65 Nested PCR Restriction Fragment Length Polymorphism Analysis (hsp65 Nested PCR-PRA) to detect and identify Mycobacterium tuberculosis complex directly in clinical samples for a rapid and specific diagnosis of tuberculosis (TB). hsp65 Nested PCR-PRA was applied directly to 218 clinical samples obtained from 127 patients suspected of TB or another mycobacterial infection from July 2009 to July 2010. The hsp65 Nested PCR-PRA showed 100% sensitivity and 95.0 and 93.1% specificity in comparison with culture and microscopy (acid fast bacillus smear), respectively. hsp65 Nested PCR-PRA was shown to be a fast and reliable assay for diagnosing TB, which may contribute towards a fast diagnosis that could help the selection of appropriate chemotherapeutic and early epidemiological management of the cases which are of paramount importance in a high TB burden country. PMID:24260739

SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

Directory of Open Access Journals (Sweden)

Mehmet AYBEKE

2015-12-01

Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

Detection of Mycobacterium bovis in bovine and bubaline tissues using nested-PCR for TbD1.

Science.gov (United States)

Araújo, Cristina P; Osório, Ana Luiza A R; Jorge, Kláudia S G; Ramos, Carlos Alberto N; Filho, Antonio Francisco S; Vidal, Carlos Eugênio S; Roxo, Eliana; Nishibe, Christiane; Almeida, Nalvo F; Júnior, Antônio A F; Silva, Marcio R; Neto, José Diomedes B; Cerqueira, Valíria D; Zumárraga, Martín J; Araújo, Flábio R

2014-01-01

In the present study, a nested-PCR system, targeting the TbD1 region, involving the performance of conventional PCR followed by real-time PCR, was developed to detect Mycobacterium bovis in bovine/bubaline tissue homogenates. The sensitivity and specificity of the reactions were assessed with DNA samples extracted from tuberculous and non-tuberculous mycobacteria, as well as other actinomycetales species and DNA samples extracted directly from bovine and bubaline tissue homogenates. In terms of analytical sensitivity, the DNA of M. bovis AN5 was detected up to 1.56 ng with conventional PCR, 97.6 pg with real-time PCR, and 1.53 pg with nested-PCR in the reaction mixture. The nested-PCR exhibited 100% analytical specificity for M. bovis when tested with the DNA of reference strains of environmental mycobacteria and closely-related Actinomycetales. A clinical sensitivity value of 76.0% was detected with tissue samples from animals that exhibited positive results in the comparative intradermal tuberculin test (CITT), as well as from those with lesions compatible with tuberculosis (LCT) that rendered positive cultures. A clinical specificity value of 100% was detected with tissue samples from animals with CITT- results, with no visible lesions (NVL) and negative cultures. No significant differences were found between the nested-PCR and culture in terms of detecting CITT+ animals with LCT or with NVL. No significant differences were recorded in the detection of CITT- animals with NVL. However, nested-PCR detected a significantly higher number of positive animals than the culture in the group of animals exhibiting LCT with no previous records of CITT. The use of the nested-PCR assay to detect M. bovis in tissue homogenates provided a rapid diagnosis of bovine and bubaline tuberculosis.

Discrimination between E. granulosus sensu stricto, E. multilocularis and E. shiquicus Using a Multiplex PCR Assay

Science.gov (United States)

Li, Li; Yan, Hong-Bin; Blair, David; Lei, Meng-Tong; Cai, Jin-Zhong; Fan, Yan-Lei; Li, Jian-Qiu; Fu, Bao-Quan; Yang, Yu-Rong; McManus, Donald P.; Jia, Wan-Zhong

2015-01-01

Background Infections of Echinococcus granulosus sensu stricto (s.s), E. multilocularis and E. shiquicus are commonly found co-endemic on the Qinghai-Tibet plateau, China, and an efficient tool is needed to facilitate the detection of infected hosts and for species identification. Methodology/Principal Findings A single-tube multiplex PCR assay was established to differentiate the Echinococcus species responsible for infections in intermediate and definitive hosts. Primers specific for E. granulosus, E. multilocularis and E. shiquicus were designed based on sequences of the mitochondrial NADH dehydrogenase subunit 1 (nad1), NADH dehydrogenase subunit 5 (nad5) and cytochrome c oxidase subunit 1 (cox1) genes, respectively. This multiplex PCR accurately detected Echinococcus DNA without generating nonspecific reaction products. PCR products were of the expected sizes of 219 (nad1), 584 (nad5) and 471 (cox1) bp. Furthermore, the multiplex PCR enabled diagnosis of multiple infections using DNA of protoscoleces and copro-DNA extracted from fecal samples of canine hosts. Specificity of the multiplex PCR was 100% when evaluated using DNA isolated from other cestodes. Sensitivity thresholds were determined for DNA from protoscoleces and from worm eggs, and were calculated as 20 pg of DNA for E. granulosus and E. shiquicus, 10 pg of DNA for E. multilocularis, 2 eggs for E. granulosus, and 1 egg for E. multilocularis. Positive results with copro-DNA could be obtained at day 17 and day 26 after experimental infection of dogs with larval E. multilocularis and E. granulosus, respectively. Conclusions/Significance The multiplex PCR developed in this study is an efficient tool for discriminating E. granulosus, E. multilocularis and E. shiquicus from each other and from other taeniid cestodes. It can be used for the detection of canids infected with E. granulosus s.s. and E. multilocularis using feces collected from these definitive hosts. It can also be used for the identification

Development of a real-time multiplex PCR assay for the detection of multiple Salmonella serotypes in chicken samples

Directory of Open Access Journals (Sweden)

Whyte Paul

2008-09-01

Full Text Available Abstract Background A real-time multiplex PCR assay was developed for the detection of multiple Salmonella serotypes in chicken samples. Poultry-associated serotypes detected in the assay include Enteritidis, Gallinarum, Typhimurium, Kentucky and Dublin. The traditional cultural method according to EN ISO 6579:2002 for the detection of Salmonella in food was performed in parallel. The real-time PCR based method comprised a pre-enrichment step in Buffered Peptone Water (BPW overnight, followed by a shortened selective enrichment in Rappaport Vasilliadis Soya Broth (RVS for 6 hours and subsequent DNA extraction. Results The real-time multiplex PCR assay and traditional cultural method showed 100% inclusivity and 100% exclusivity on all strains tested. The real-time multiplex PCR assay was as sensitive as the traditional cultural method in detecting Salmonella in artificially contaminated chicken samples and correctly identified the serotype. Artificially contaminated chicken samples resulted in a detection limit of between 1 and 10 CFU per 25 g sample for both methods. A total of sixty-three naturally contaminated chicken samples were investigated by both methods and relative accuracy, relative sensitivity and relative specificity of the real-time PCR method were determined to be 89, 94 and 87%, respectively. Thirty cultures blind tested were correctly identified by the real-time multiplex PCR method. Conclusion Real-time PCR methodology can contribute to meet the need for rapid identification and detection methods in food testing laboratories.

Diagnosis of Cutaneous Leishmaniasis by Multiplex PCR

Directory of Open Access Journals (Sweden)

M Heiat

2010-07-01

Full Text Available Introduction: Annually, more than 14 million people are reported to be infected with Leishmaniasis all over the world. In Iran, this disease is seen in the form of cutaneous and visceral leishmaniasis, of which the cutaneous form is more wide spread. In recent years, cutaneous leishmaniaisis is diagnosed by PCR utilizing specific primers in order to amplify different parasite genes including ribosomal RNA genes, kinetoplast DNA or tandem repeating sequences. The aim of this research was to detect early stage cutaneous leishmaniasis using Multiplex-PCR technique. Methods: In this study, 67 samples were prepared from patients with cutaneous leishmaniasis. DNA was extracted with phenolchloroform. Each specimen was analyzed using two different pairs of PCR primers. The sensitivity of each PCR was optimized on pure Leishmania DNA prior to use for diagnosis. Two standard parasites L. major and L. tropica were used as positive control. Results: DNA amplification fragments were two 115 bp and 683 bp for AB and UL primers, respectively. The sensitivity of two primers was not equal for detection of L. major and L. tropica. The sensivity of PCR with AB primer was 35 cells, while that for UL primer was 40 cells. Conclusion: The results of this study indicate that PCR is a sensitive diagnostic assay for cutaneous leishmaniasis and could be employed as the new standard for routine diagnosis when species identification is not required. However, the ability to identify species is especially important in prognosis of the disease and in deciding appropriate therapy, especially in regions where more than one type of species and disease are seen by clinicians.

The role of pleural fluid MAGE RT-nested PCR in the diagnosis of malignant pleural effusion.

Science.gov (United States)

Jeon, Eun Ju; Park, Hye Kyeong; Jeon, Kyeongman; Koh, Won-Jung; Suh, Gee Young; Chung, Man Pyo; Kim, Hojoong; Kwon, O Jung; Ki, Chang-Seok; Kim, Jong-Won; Shim, Young Mog; Um, Sang-Won

2012-11-01

  Melanoma antigen (MAGE) genes are expressed in tumor cells, the testis and the placenta. The purpose of this prospective study was to investigate the sensitivity, specificity, and accuracy of the carcinoembryonic antigen (CEA), MAGE reverse transcriptase-nested polymerase chain reaction (RT-nested PCR), and cytology of pleural fluid in the diagnosis of malignant pleural effusion.   Patients in whom unilateral pleural effusion was identified on chest radiography from January to December 2009 were included in the study. MAGE genes were analyzed by RT-nested PCR using MAGE A1-6 common primers.   Of 81 enrolled patients, 46 were diagnosed as malignant pleural effusion, and 24 were diagnosed as benign pleural effusion. The diagnoses of 11 patients were not confirmed in this study. The diagnostic sensitivity, specificity, and accuracy of MAGE RT-nested PCR were 61.4%, 95.7%, and 73.1%, respectively. The diagnostic sensitivities of cytology and CEA (>5 ng/mL) were 61.4% and 75.0%, respectively. Among 17 patients with negative cytology who had malignant pleural effusion, 12 and 10 patients were positive for CEA (>5.0 ng/mL) and MAGE RT-nested PCR, respectively. However, of five patients with malignant pleural effusion that was not recognized by cytology and CEA, MAGE RT-nested PCR correctly predicted a malignant etiology in only one additional patient (20%).   MAGE RT-nested PCR seems to add little on the combination of conventional methods in the diagnosis of malignant effusion. © 2012 Tianjin Lung Cancer Institute and Wiley Publishing Asia Pty. Ltd.

Detection of Pneumocystis jirovecii by nested PCR in HIV-negative patients with pulmonary disease.

Science.gov (United States)

Santos, Cristina Rodrigues; de Assis, Ângela M; Luz, Edson A; Lyra, Luzia; Toro, Ivan F; Seabra, José Claudio C; Daldin, Dira H; Marcalto, Tathiane U; Galasso, Marcos T; Macedo, Ronaldo F; Schreiber, Angélica Z; Aoki, Francisco H

Nested PCR can be used to determine the status of Pneumocystis jirovecii infection in other lung diseases. This study sought to detect a target DNA fragment (mitochondrial large subunit rRNA or mtL SUrRNA) of P. jirovecii in patients with lung disease who underwent bronchoscopy with collection of bronchoalveolar lavage (BAL). The results from toluidine blue staining were compared with those obtained using molecular methods that included an "in house" DNA extraction procedure, PCR and nested PCR. Fifty-five BAL samples from patients with atypical chest X-rays were screened for P. jirovecii. None of the samples was positive for P. jirovecii using toluidine blue staining. In contrast, P. jirovecii DNA was detected by nested PCR in BAL samples from 36 of 55 patients (65.5%). The lung diseases in the patients included cancer, pneumonia, tuberculosis, and chronic obstructive pulmonary disease (COPD). Other chronic problems in the patients included hypertension, diabetes, smoking, and alcoholism. Nested PCR showed high sensitivity for detecting P. jirovecii, especially when compared with toluidine blue staining. Using this method, P. jirovecii infection was detected in HIV-negative patients with lung disease. Copyright © 2016 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

Identification of methicillin-resistant Staphylococcus aureus (MRSA) strains isolated from burn patients by multiplex PCR.

Science.gov (United States)

Montazeri, Effat Abbasi; Khosravi, Azar Dokht; Jolodar, Abbas; Ghaderpanah, Mozhgan; Azarpira, Samireh

2015-05-01

Methicillin-resistant Staphylococcus aureus (MRSA) and methicillin-resistant coagulase-negative staphylococci (MRCoNS) as important human pathogens are causes of nosocomial infections worldwide. Burn patients are at a higher risk of local and systemic infections with these microorganisms. A screening method for MRSA by using a multiplex polymerase chain reaction (PCR) targeting the 16S ribosomal RNA (rRNA), mecA, and nuc genes was developed. The aim of the present study was to investigate the potential of this PCR assay for the detection of MRSA strains in samples from burn patients. During an 11-month period, 230 isolates (53.11%) of Staphylococcus spp. were collected from burn patients. The isolates were identified as S. aureus by using standard culture and biochemical tests. DNA was extracted from bacterial colonies and multiplex PCR was used to detect MRSA and MRCoNS strains. Of the staphylococci isolates, 149 (64.9%) were identified as S. aureus and 81 (35.21%) were described as CoNS. Among the latter, 51 (62.97%) were reported to be MRCoNS. From the total S. aureus isolates, 132 (88.6%) were detected as MRSA and 17 (11.4%) were methicillin-susceptible S. aureus (MSSA). The presence of the mecA gene in all isolates was confirmed by using multiplex PCR as a gold standard method. This study presented a high MRSA rate in the region under investigation. The 16S rRNA-mecA-nuc multiplex PCR is a good tool for the rapid characterization of MRSA strains. This paper emphasizes the need for preventive measures and choosing effective antimicrobials against MRSA and MRCoNS infections in the burn units. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

Diagnosis of common bacterial causes of urethritis in men by Gram stain, culture and multiplex PCR.

Science.gov (United States)

Jahan, F; Shamsuzzaman, S M; Akter, S

2014-12-01

Urethritis is one of the most important causes of morbidity and mortality in developing countries. The aim of this study was to detect common bacterial causes of urethritis in men by Gram stain, culture and multiplex PCR.185 male patients who presented at the Skin and venereal clinic of the Dhaka Medical College, Bangladesh with clinical symptoms suggestive of urethritis were enrolled in this study. Urethral discharges were tested for detection of Neisseria gonorrhoeae by Gram stain, culture and PCR. Multiplex PCR assay was done to detect DNA of Chlamydia trachomatis, Ureaplasma urealyticum and Mycoplasma genitalium. Out of 185 participants, 30.27% and 14.6% were infected by Neisseria gonorrhoeae and Chlamydia trachomatis respectively. None of the individuals was found positive for either Ureaplasma urealyticum or Mycoplasma genitalium. Among the Neisseria gonorrhoeae positive patients 27.57% were positive from Gram stain, 26.49% were culture positive, 30.27% were positive by PCR (p<0.001). 32.65% of the Neisseria gonorrhoeae isolates were penicillinase producers and 83.67% were susceptible to ceftriaxone. Considering culture as the gold standard, the sensitivity and specificity of PCR for the detection of Neisseria gonorrhoeae was 100%, and 94.85% respectively with an accuracy of 96.22%. 3.73% of the 134 smear negative and 5.15% of the 136 culture negative samples were positive by PCR. PCR was the most sensitive and rapid method for the diagnosis of urethritis. Multiplex PCR may be a useful approach to laboratory diagnosis of urethritis in men for its high sensitivity and specificity.

Detection of Tumor Markers in Prostate Cancer and Comparison of Sensitivity between Real Time and Nested PCR

OpenAIRE

Matsuoka, Takayuki; Shigemura, Katsumi; Yamamichi, Fukashi; Fujisawa, Masato; Kawabata, Masato; Shirakawa, Toshiro

2012-01-01

The objective of this study is to investigate and compare the sensitivity in conventional PCR, quantitative real time PCR, nested PCR and western blots for detection of prostate cancer tumor markers using prostate cancer (PCa) cells. We performed conventional PCR, quantitative real time PCR, nested PCR, and western blots using 5 kinds of PCa cells. Prostate specific antigen (PSA), prostate specific membrane antigen (PSMA), and androgen receptor (AR) were compared for their detection sensitivi...

In vitro culture, PCR , and nested PCR for the detection of Theileria equi in horses submitted to exercise Cultivo in vitro, PCR e nested PCR na detecção de Theileria equi em eqüinos submetidos a exercícios

Directory of Open Access Journals (Sweden)

C.D. Baldani

2008-06-01

Full Text Available This study compared the usefulness of in vitro culture, PCR, and nested PCR for the diagnosis of Theileria equi in horses submitted to stress during exercise. Blood samples from 15 apparently healthy horses, previously conditioned to a high-speed equine treadmill, were taken prior to and after exercise. The animals were divided into two experimental groups: 30-day training schedule (G1 and 90-day training schedule (G2. Statistical analysis was performed using a chi-square test and kappa statistic was used in order to assess agreement. No significant difference was observed between samples collected at resting or after exercise. In G1, merozoites of T. equi were detected in the blood smears of four horses before in vitro culture, whereas 14 samples were positive, confirmed by culture. In G2, five and 11 horses were positive before and after culture, respectively. No PCR amplified product was observed in any of the tested animals although the PCR system based on the 16S rRNA gene of T. equi detected DNA in blood with an equivalent 8x10-5% parasitaemia. The nested PCR based on the T. equi merozoite antigen gene (EMA-1 allowed the visualization of amplified products in all the horses. Therefore, nested PCR should be considered as a means of detection of sub-clinical T. equi infections and in vitro culture could be used as a complement to other methods of diagnosis.Comparou-se a utilização do cultivo in vitro, PCR e nested PCR no diagnóstico de Theileria equi em eqüinos submetidos ao estresse induzido por exercícios. Amostras de sangue foram obtidas de 15 eqüinos submetidos a treinamento em esteira rolante de alto desempenho, sendo as amostras colhidas antes e após os exercícios. Os animais foram divididos em dois grupos experimentais: 30 dias de treinamento (G1 e 90 dias de treinamento (G2. O teste do qui-quadrado foi empregado para as análises estatísticas e o índice kappa utilizado para avaliar a concordância. Não houve diferen

Multiplex real-time PCR assays for the identification of the potato cyst and tobacco cyst nematodes

Science.gov (United States)

TaqMan primer-probe sets were developed for the detection and identification of potato cyst nematodes (PCN) Globodera pallida and G. rostochiensis using two-tube, multiplex real-time PCR. One tube contained a primer-probe set specific for G. pallida (pale cyst nematode) multiplexed with another prim...

Clinical utility of an optimised multiplex real-time PCR assay for the identification of pathogens causing sepsis in Vietnamese patients.

Science.gov (United States)

Tat Trung, Ngo; Van Tong, Hoang; Lien, Tran Thi; Van Son, Trinh; Thanh Huyen, Tran Thi; Quyen, Dao Thanh; Hoan, Phan Quoc; Meyer, Christian G; Song, Le Huu

2018-02-01

For the identification of bacterial pathogens, blood culture is still the gold standard diagnostic method. However, several disadvantages apply to blood cultures, such as time and rather large volumes of blood sample required. We have previously established an optimised multiplex real-time PCR method in order to diagnose bloodstream infections. In the present study, we evaluated the diagnostic performance of this optimised multiplex RT-PCR in blood samples collected from 110 septicaemia patients enrolled at the 108 Military Central Hospital, Hanoi, Vietnam. Positive results were obtained by blood culture, the Light Cylcler-based SeptiFast ® assay and our multiplex RT-PCR in 35 (32%), 31 (28%), and 31 (28%) samples, respectively. Combined use of the three methods confirmed 50 (45.5%) positive cases of bloodstream infection, a rate significantly higher compared to the exclusive use of one of the three methods (P=0.052, 0.012 and 0.012, respectively). The sensitivity, specificity and area under the curve (AUC) of our assay were higher compared to that of the SeptiFast ® assay (77.4%, 86.1% and 0.8 vs. 67.7%, 82.3% and 0.73, respectively). Combined use of blood culture and multiplex RT-PCR assay showed a superior diagnostic performance, as the sensitivity, specificity, and AUC reached 83.3%, 100%, and 0.95, respectively. The concordance between blood culture and the multiplex RT-PCR assay was highest for Klebsiella pneumonia (100%), followed by Streptococcus spp. (77.8%), Escherichia coli (66.7%), Staphylococcus spp. (50%) and Salmonella spp. (50%). In addition, the use of the newly established multiplex RT-PCR assay increased the spectrum of identifiable agents (Acintobacter baumannii, 1/32; Proteus mirabilis, 1/32). The combination of culture and the multiplex RT-PCR assay provided an excellent diagnostic accomplishment and significantly supported the identification of causative pathogens in clinical samples obtained from septic patients. Copyright © 2017 The

Direct detection of Mycobacterium tuberculosis complex in bovine and bubaline tissues through nested-PCR.

Science.gov (United States)

Araújo, Cristina P; Osório, Ana Luiza A R; Jorge, Klaudia S G; Ramos, Carlos A N; Souza Filho, Antonio F; Vidal, Carlos E S; Vargas, Agueda P C; Roxo, Eliana; Rocha, Adalgiza S; Suffys, Philip N; Fonseca, Antônio A; Silva, Marcio R; Barbosa Neto, José D; Cerqueira, Valíria D; Araújo, Flábio R

2014-01-01

Post-mortem bacterial culture and specific biochemical tests are currently performed to characterize the etiologic agent of bovine tuberculosis. Cultures take up to 90 days to develop. A diagnosis by molecular tests such as PCR can provide fast and reliable results while significantly decreasing the time of confirmation. In the present study, a nested-PCR system, targeting rv2807, with conventional PCR followed by real-time PCR, was developed to detect Mycobacterium tuberculosis complex (MTC) organisms directly from bovine and bubaline tissue homogenates. The sensitivity and specificity of the reactions were assessed with DNA samples extracted from tuberculous and non-tuberculous mycobacteria, as well as other Actinomycetales species and DNA samples extracted directly from bovine and bubaline tissue homogenates. Regarding the analytical sensitivity, DNA of the M. bovis AN5 strain was detected up to 1.5 pg by nested-PCR, whereas DNA of M. tuberculosis H37Rv strain was detected up to 6.1 pg. The nested-PCR system showed 100% analytical specificity for MTC when tested with DNA of reference strains of non-tuberculous mycobacteria and closely-related Actinomycetales. A clinical sensitivity level of 76.7% was detected with tissues samples positive for MTC by means of the culture and conventional PCR. A clinical specificity of 100% was detected with DNA from tissue samples of cattle with negative results in the comparative intradermal tuberculin test. These cattle exhibited no visible lesions and were negative in the culture for MTC. The use of the nested-PCR assay to detect M. tuberculosis complex in tissue homogenates provided a rapid diagnosis of bovine and bubaline tuberculosis.

Molecular diagnosis of strongyloidiasis in a population of an endemic area through nested-PCR.

Science.gov (United States)

Sharifdini, Meysam; Keyhani, Amir; Eshraghian, Mohammad Reza; Beigom Kia, Eshrat

2018-01-01

This study is aimed to diagnose and analyze strongyloidiasis in a population of an endemic area of Iran using nested-PCR, coupled with parasitological methods. Screening of strongyloidiasis infected people using reliable diagnostic techniques are essential to decrease the mortality and morbidity associated with this infection. Molecular methods have been proved to be highly sensitive and specific for detection of Strongyloides stercoralis in stool samples. A total of 155 fresh single stool samples were randomly collected from residents of north and northwest of Khouzestan Province, Iran. All samples were examined by parasitological methods including formalin-ether concentration and nutrient agar plate culture, and molecular method of nested-PCR. Infections with S. stercoralis were analyzed according to demographic criteria. Based on the results of nested-PCR method 15 cases (9.7%) were strongyloidiasis positive. Nested-PCR was more sensitive than parasitological techniques on single stool sampling. Elderly was the most important population index for higher infectivity with S. stercoralis . In endemic areas of S. stercoralis , old age should be considered as one of the most important risk factors of infection, especially among the immunosuppressed individuals.

Rapid direct identification of Cryptococcus neoformans from pigeon droppings by nested PCR using CNLAC1 gene.

Science.gov (United States)

Chae, H S; Park, G N; Kim, S H; Jo, H J; Kim, J T; Jeoung, H Y; An, D J; Kim, N H; Shin, B W; Kang, Y I; Chang, K S

2012-08-01

Isolation and identification of Cryptococcus neoformans and pathogenic yeast-like fungi from pigeon droppings has been taken for a long time and requires various nutrients for its growth. In this study, we attempted to establish a rapid direct identification method of Cr. neoformans from pigeon dropping samples by nested-PCR using internal transcribed spacer (ITS) CAP64 and CNLAC1 genes, polysaccharide capsule gene and laccase-associated gene to produce melanin pigment, respectively, which are common genes of yeasts. The ITS and CAP64 genes were amplified in all pathogenic yeasts, but CNLAC1 was amplified only in Cr. neoformans. The ITS gene was useful for yeast genotyping depending on nucleotide sequence. Homology of CAP64 genes among the yeasts were very high. The specificity of PCR using CNLAC1 was demonstrated in Cr. neoformans environmental strains but not in other yeast-like fungi. The CNLAC1 gene was detected in 5 serotypes of Cr. neoformans. The nested-PCR amplified up to 10(-11) μg of the genomic DNA and showed high sensitivity. All pigeon droppings among 31 Cr. neoformans-positive samples were positive and all pigeon droppings among 348 Cr. neoformans-negative samples were negative by the direct nested-PCR. In addition, after primary enrichment of pigeon droppings in Sabouraud dextrose broth, all Cr. neoformans-negative samples were negative by the nested-PCR, which showed high specificity. The nested-PCR showed high sensitivity without culture of pigeon droppings. Nested-PCR using CNLAC1 provides a rapid and reliable molecular diagnostic method to overcome weak points such as long culture time of many conventional methods.

Differentiation of five enterohepatic Helicobacter species by nested PCR with high-resolution melting curve analysis.

Science.gov (United States)

Wu, Miaoli; Rao, Dan; Zhu, Yujun; Wang, Jing; Yuan, Wen; Zhang, Yu; Huang, Ren; Guo, Pengju

2017-04-01

Enterohepatic Helicobacter species (EHS) are widespread in rodent species around the world. Several studies have demonstrated that infection with EHS can interfere with the outcomes of animal experiments in cancer research and significantly influence the study results. Therefore, it is essential to establish a rapid detection and identification of EHS for biomedical research using laboratory rodents. Our study aimed to develop a rapid and sensitive method to detect and distinguish five enterohepatic Helicobacter species. Nested PCR followed by high-resolution melting curve analysis (HRM) was developed for identification of H. bilis, H. rodentium, H. muridarum, H. typhlonius, as well as H. hepaticus. To validate the accuracy of nested PCR-HRM analysis, quantitative real-time PCR methods for five different enterohepatic Helicobacter species were developed. A total of 50 cecal samples were tested using both nested PCR-HRM analysis and qPCR method. The nested PCR-HRM method could distinguish five enterohepatic Helicobacter species by different melting temperatures. The melting curve were characterized by peaks of 78.7 ± 0.12°C for H. rodentium, 80.51 ± 0.09°C for H. bilis, 81.6 ± 0.1°C for H. typhlonius, 82.11 ± 0.18°C for H. muridarum, and 82.95 ± 0.09°C for H. hepaticus. The nested PCR-HRM assay is a simple, rapid, and cost-effective assay. This assay could be a useful tool for molecular epidemiology study of enterohepatic Helicobacter infection and an attractive alternative for genotyping of enterohepatic Helicobacter species. © 2016 John Wiley & Sons Ltd.

Avaliação das técnicas de RT-PCR e heminested RT-PCR em cérebros de cães com sinais neurológicos compatíveis com cinomose

Directory of Open Access Journals (Sweden)

Adriana Cortez

2015-12-01

Full Text Available The diagnostic value of RT-PCR and hemi-nested RT-PCR (hnRT-PCR was compared in brain samples of dogs presenting neurological signs compatible with canine distemper. Samples of central nervous system (CNS were collected from 68 dogs and tested by direct immunofluorescence test (RFID and, independent of the results, they were stored at -20°C for at least three years. They were submitted to the RT-PCR and hnRT-PCR techniques aiming to determine the gene responsible for the viral nucleoprotein decoding. Fifty-nine samples were positive for RIFD, 40 for RT-PCR (Kappa = 0.358 and 54 for hnRT-PCR (Kappa = 0.740. All nine RIFD negative samples were also negative for RT-PCR and hnRT-PCR. In spite of the storage duration and proper sample conditions, the estimated accordance between hnRT-PCR and RIFD demonstrated that hnRT-PCR technique can be applied in retrospective studies.

Detection of Histoplasma capsulatum from clinical specimens by cycling probe-based real-time PCR and nested real-time PCR.

Science.gov (United States)

Muraosa, Yasunori; Toyotome, Takahito; Yahiro, Maki; Watanabe, Akira; Shikanai-Yasuda, Maria Aparecida; Kamei, Katsuhiko

2016-05-01

We developed new cycling probe-based real-time PCR and nested real-time PCR assays for the detection of Histoplasma capsulatum that were designed to detect the gene encoding N-acetylated α-linked acidic dipeptidase (NAALADase), which we previously identified as an H. capsulatum antigen reacting with sera from patients with histoplasmosis. Both assays specifically detected the DNAs of all H. capsulatum strains but not those of other fungi or human DNA. The limited of detection (LOD) of the real-time PCR assay was 10 DNA copies when using 10-fold serial dilutions of the standard plasmid DNA and 50 DNA copies when using human serum spiked with standard plasmid DNA. The nested real-time PCR improved the LOD to 5 DNA copies when using human serum spiked with standard plasmid DNA, which represents a 10-fold higher than that observed with the real-time PCR assay. To assess the ability of the two assays to diagnose histoplasmosis, we analyzed a small number of clinical specimens collected from five patients with histoplasmosis, such as sera (n = 4), formalin-fixed paraffin-embedded (FFPE) tissue (n = 4), and bronchoalveolar lavage fluid (BALF) (n = 1). Although clinical sensitivity of the real-time PCR assay was insufficiently sensitive (33%), the nested real-time PCR assay increased the clinical sensitivity (77%), suggesting it has a potential to be a useful method for detecting H. capsulatum DNA in clinical specimens. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Identification of Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid by multiplex real-time PCR.

Science.gov (United States)

Sanz, Juan Carlos; Ríos, Esther; Rodríguez-Avial, Iciar; Ramos, Belén; Marín, Mercedes; Cercenado, Emilia

2017-08-14

The aim was to evaluate the utility of a multiplex real-time PCR to detect Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid (PF). A collection of 81 PF samples was used. Sixty were considered positive for S. pneumoniae according to previous results (54 by an in-house lytA gene PCR and eight by universal rRNA PCR). The sensitivity for detection of the lytA, plyA and psaA genes by multiplex PCR was 100% (60/60), 98.3% (59/60) and 91.7% (55/60), respectively. The detection of all three genes was negative in 21 samples formerly confirmed as negative for S. pneumoniae (100% specificity) by the other procedures (9 by in-house lytA PCR and 12 by rRNA PCR). The use of this multiplex PCR may be a useful option to identify S. pneumoniae directly in PF samples. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.

Science.gov (United States)

Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh

2015-06-01

Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.

Rapid and reliable detection and identification of GM events using multiplex PCR coupled with oligonucleotide microarray.

Science.gov (United States)

Xu, Xiaodan; Li, Yingcong; Zhao, Heng; Wen, Si-yuan; Wang, Sheng-qi; Huang, Jian; Huang, Kun-lun; Luo, Yun-bo

2005-05-18

To devise a rapid and reliable method for the detection and identification of genetically modified (GM) events, we developed a multiplex polymerase chain reaction (PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a single reaction. The system included probes for screening gene, species reference gene, specific gene, construct-specific gene, event-specific gene, and internal and negative control genes. 18S rRNA was combined with species reference genes as internal controls to assess the efficiency of all reactions and to eliminate false negatives. Two sets of the multiplex PCR system were used to amplify four and five targets, respectively. Eight different structure genes could be detected and identified simultaneously for Roundup Ready soybean in a single microarray. The microarray specificity was validated by its ability to discriminate two GM maizes Bt176 and Bt11. The advantages of this method are its high specificity and greatly reduced false-positives and -negatives. The multiplex PCR coupled with microarray technology presented here is a rapid and reliable tool for the simultaneous detection of GM organism ingredients.

Molecular analysis of dolphin morbillivirus: A new sensitive detection method based on nested RT-PCR.

Science.gov (United States)

Centelleghe, Cinzia; Beffagna, Giorgia; Zanetti, Rossella; Zappulli, Valentina; Di Guardo, Giovanni; Mazzariol, Sandro

2016-09-01

Cetacean Morbillivirus (CeMV) has been identified as the most pathogenic virus for cetaceans. Over the past three decades, this RNA virus has caused several outbreaks of lethal disease in odontocetes and mysticetes worldwide. Isolation and identification of CeMV RNA is very challenging in whales because of the poor preservation status frequently shown by tissues from stranded animals. Nested reverse transcription polymerase chain reaction (nested RT-PCR) is used instead of conventional RT-PCR when it is necessary to increase the sensitivity and the specificity of the reaction. This study describes a new nested RT-PCR technique useful to amplify small amounts of the cDNA copy of Cetacean morbillivirus (CeMV) when it is present in scant quantity in whales' biological specimens. This technique was used to analyze different tissues (lung, brain, spleen and other lymphoid tissues) from one under human care seal and seven cetaceans stranded along the Italian coastline between October 2011 and September 2015. A well-characterized, 200 base pair (bp) fragment of the dolphin Morbillivirus (DMV) haemagglutinin (H) gene, obtained by nested RT-PCR, was sequenced and used to confirm DMV positivity in all the eight marine mammals under study. In conclusion, this nested RT-PCR protocol can represent a sensitive detection method to identify CeMV-positive, poorly preserved tissue samples. Furthermore, this is also a rather inexpensive molecular technique, relatively easy to apply. Copyright © 2016 Elsevier B.V. All rights reserved.

Multiplex PCR Assay for Identification of Human Diarrheagenic Escherichia coli

OpenAIRE

Toma, Claudia; Lu, Yan; Higa, Naomi; Nakasone, Noboru; Chinen, Isabel; Baschkier, Ariela; Rivas, Marta; Iwanaga, Masaaki

2003-01-01

A multiplex PCR assay for the identification of human diarrheagenic Escherichia coli was developed. The targets selected for each category were eae for enteropathogenic E. coli, stx for Shiga toxin-producing E. coli, elt and est for enterotoxigenic E. coli, ipaH for enteroinvasive E. coli, and aggR for enteroaggregative E. coli. This assay allowed the categorization of a diarrheagenic E. coli strain in a single reaction tube.

Giardia and Cryptosporidium spp. dissemination during wastewater treatment and comparative detection via immunofluorescence assay (IFA), nested polymerase chain reaction (nested PCR) and loop mediated isothermal amplification (LAMP).

Science.gov (United States)

Gallas-Lindemann, Carmen; Sotiriadou, Isaia; Plutzer, Judit; Noack, Michael J; Mahmoudi, Mohammad Reza; Karanis, Panagiotis

2016-06-01

Environmental water samples from the Lower Rhine area in Germany were investigated via immunofluorescence assays (IFAs), nested polymerase chain reaction (nested PCR) and loop-mediated isothermal amplification (LAMP) to detect the presence of Giardia spp. (n=185) and Cryptosporidium spp. (n=227). The samples were concentrated through filtration or flocculation, and oocysts were purified via centrifugation through a sucrose density gradient. For all samples, IFA was performed first, followed by DNA extraction for the nested PCR and LAMP assays. Giardia cysts were detected in 105 samples (56.8%) by IFA, 62 samples (33.5%) by nested PCR and 79 samples (42.7%) by LAMP. Cryptosporidium spp. were detected in 69 samples (30.4%) by IFA, 95 samples (41.9%) by nested PCR and 99 samples (43.6%) by LAMP. According to these results, the three detection methods are complementary for monitoring Giardia and Cryptosporidium in environmental waters. Copyright © 2016 Elsevier B.V. All rights reserved.

Comparison of ELISA, nested PCR and sequencing and a novel qPCR for detection of Giardia isolates from Jordan.

Science.gov (United States)

Hijjawi, Nawal; Yang, Rongchang; Hatmal, Ma'mon; Yassin, Yasmeen; Mharib, Taghrid; Mukbel, Rami; Mahmoud, Sameer Alhaj; Al-Shudifat, Abdel-Ellah; Ryan, Una

2018-02-01

Little is known about the prevalence of Giardia duodenalis in human patients in Jordan and all previous studies have used direct microscopy, which lacks sensitivity. The present study developed a novel quantitative PCR (qPCR) assay at the β-giardin (bg) locus and evaluated its use as a frontline test for the diagnosis of giardiasis in comparison with a commercially available ELISA using nested PCR and sequencing of the glutamate dehydrogenase (gdh) locus (gdh nPCR) as the gold standard. A total of 96 human faecal samples were collected from 96 patients suffering from diarrhoea from 5 regions of Jordan and were screened using the ELISA and qPCR. The analytical specificity of the bg qPCR assay revealed no cross-reactions with other genera and detected all the Giardia isolates tested. Analytical sensitivity was 1 Giardia cyst per μl of DNA extract. The overall prevalence of Giardia was 64.6%. The clinical sensitivity and specificity of the bg qPCR was 89.9% and 82.9% respectively compared to 76.5 and 68.0% for the ELISA. This study is the first to compare three different methods (ELISA, bg qPCR, nested PCR and sequencing at the gdh locus) to diagnose Jordanian patients suffering from giardiasis and to analyze their demographic data. Copyright © 2018 Elsevier Inc. All rights reserved.

[Application of multiplex PCR for the screening of genotyping system for the rare blood groups Fy(a-), s-,k-,Di(b-) and Js(b-)].

Science.gov (United States)

Jiao, Wei; Xie, Li; Li, Hailan; Lan, Jiao; Mo, Zhuning; Yang, Ziji; Liu, Fei; Xiao, Ruiping; He, Yunlei; Ye, Luyi; Zhu, Ziyan

2014-04-01

To screen rare blood groups Fy(a-), s-, k-, Di(b-) and Js(b-) in an ethnic Zhuang population. Sequence-specific primers were designed based on single nucleotide polymorphism (SNP) sites of blood group antigens Fy(b) and s. A specific multiplex PCR system I was established. Multiplex PCR system II was applied to detect alleles antigens Di(b), k, Js(b)1910 and Js(b) 2019 at the same time. The two systems was were used to screen for rare blood group antigens in 4490 randomly selected healthy donors of Guangxi Zhuang ethnic origin. We successfully made the multiplex PCR system I. We detected the rare blood group antigens using the two PCR system. There are five Fy(a-), three s(-), two Di(b-) in 4490 Guangxi zhuang random samples. The multiplex PCR system I has achieved good accuracy and stability. With multiplex PCR systems I and II, 4490 samples were screened. Five Fy(a-), three s(-) and two Di(b-) samples were discovered. Multiplex PCR is an effective methods, which can be used for high throughput screening of rare blood groups. The rare blood types of Guangxi Zhuang ethnic origin obtained through the screening can provide valuable information for compatible blood transfusion. Through screening we obtained precious rare blood type materials which can be used to improve the capability of compatible infusion and reduce the transfusion reactions.

ddPCRclust - An R package and Shiny app for automated analysis of multiplexed ddPCR data.

Science.gov (United States)

Brink, Benedikt G; Meskas, Justin; Brinkman, Ryan R

2018-03-09

Droplet digital PCR (ddPCR) is an emerging technology for quantifying DNA. By partitioning the target DNA into ∼20000 droplets, each serving as its own PCR reaction compartment, a very high sensitivity of DNA quantification can be achieved. However, manual analysis of the data is time consuming and algorithms for automated analysis of non-orthogonal, multiplexed ddPCR data are unavailable, presenting a major bottleneck for the advancement of ddPCR transitioning from low-throughput to high- throughput. ddPCRclust is an R package for automated analysis of data from Bio-Rad's droplet digital PCR systems (QX100 and QX200). It can automatically analyse and visualise multiplexed ddPCR experiments with up to four targets per reaction. Results are on par with manual analysis, but only take minutes to compute instead of hours. The accompanying Shiny app ddPCRvis provides easy access to the functionalities of ddPCRclust through a web-browser based GUI. R package: https://github.com/bgbrink/ddPCRclust; Interface: https://github.com/bgbrink/ddPCRvis/; Web: https://bibiserv.cebitec.uni-bielefeld.de/ddPCRvis/. bbrink@cebitec.uni-bielefeld.de.

Incidence of pulmonary aspergillosis and correlation of conventional diagnostic methods with nested PCR and real-time PCR assay using BAL fluid in intensive care unit patients.

Science.gov (United States)

Zarrinfar, Hossein; Makimura, Koichi; Satoh, Kazuo; Khodadadi, Hossein; Mirhendi, Hossein

2013-05-01

Although the incidence of invasive aspergillosis in the intensive care unit (ICU) is scarce, it has emerged as major problems in critically ill patients. In this study, the incidence of pulmonary aspergillosis (PA) in ICU patients has evaluated and direct microscopy and culture has compared with nested polymerase chain reaction (PCR) and real-time PCR for detection of Aspergillus fumigatus and A. flavus in bronchoalveolar lavage (BAL) samples of the patients. Thirty BAL samples obtained from ICU patients during a 16-month period were subjected to direct examinations on 20% potassium hydroxide (KOH) and culture on two culture media. Nested PCR targeting internal transcribed spacer ribosomal DNA and TaqMan real-time PCR assay targeting β-tubulin gene were used for the detection of A. fumigatus and A. flavus. Of 30 patients, 60% were men and 40% were women. The diagnosis of invasive PA was probable in 1 (3%), possible in 11 (37%), and not IPA in 18 (60%). Nine samples were positive in nested PCR including seven samples by A. flavus and two by A. fumigatus specific primers. The lowest amount of DNA that TaqMan real-time PCR could detect was ≥40 copy numbers. Only one of the samples had a positive result of A. flavus real-time PCR with Ct value of 37.5. Although a significant number of specimens were positive in nested PCR, results of this study showed that establishment of a correlation between the conventional methods with nested PCR and real-time PCR needs more data confirmed by a prospective study with a larger sample group. © 2013 Wiley Periodicals, Inc.

Clinical and epidemiological use of nested PCR targeting the repetitive element IS1111 associated with the transposase gene from Coxiella burnetii.

Science.gov (United States)

Mares-Guia, Maria Angélica M M; Guterres, Alexandro; Rozental, Tatiana; Ferreira, Michelle Dos Santos; Lemos, Elba R S

Q fever is a worldwide zoonosis caused by Coxiella burnetii-a small obligate intracellular Gram-negative bacterium found in a variety of animals. It is transmitted to humans by inhalation of contaminated aerosols from urine, feces, milk, amniotic fluid, placenta, abortion products, wool, and rarely by ingestion of raw milk from infected animals. Nested PCR can improve the sensitivity and specificity of testing while offering a suitable amplicon size for sequencing. Serial dilutions were performed tenfold to test the limit of detection, and the result was 10× detection of C. burnetti DNA with internal nested PCR primers relative to trans-PCR. Different biological samples were tested and identified only in nested PCR. This demonstrates the efficiency and effectiveness of the primers. Of the 19 samples, which amplify the partial sequence of C. burnetii, 12 were positive by conventional PCR and nested PCR. Seven samples-five spleen tissue samples from rodents and two tick samples-were only positive in nested PCR. With these new internal primers for trans-PCR, we demonstrate that our nested PCR assay for C. burnetii can achieve better results than conventional PCR. Published by Elsevier Editora Ltda.

The use of singleplex and nested PCR to detect Batrachochytrium dendrobatidis in free-living frogs.

Science.gov (United States)

Coutinho, Selene Dall'Acqua; Burke, Julieta Catarina; de Paula, Catia Dejuste; Rodrigues, Miguel Trefaut; Catão-Dias, José Luiz

2015-06-01

Many microorganisms are able to cause diseases in amphibians, and in the past few years one of the most reported has been Batrachochytrium dendrobatidis. This fungus was first reported in Brazil in 2005; following this, other reports were made in specimens deposited in museum collections, captive and free-living frogs. The aim of this study was to compare singleplex and nested-PCR techniques to detect B. dendrobatidis in free-living and apparently healthy adult frogs from the Brazilian Atlantic Forest. The sample collection area was a protected government park, with no general entrance permitted and no management of the animals there. Swabs were taken from the skin of 107 animals without macroscopic lesions and they were maintained in ethanol p.a. Fungal DNA was extracted and identification of B. dendrobatidis was performed using singleplex and nested-PCR techniques, employing specific primers sequences. B. dendrobatidis was detected in 61/107 (57%) and 18/107 (17%) animals, respectively by nested and singleplex-PCR. Nested-PCR was statistically more sensible than the conventional for the detection of B. dendrobatidis (Chi-square = 37.1; α = 1%) and the agreement between both techniques was considered just fair (Kappa = 0.27). The high prevalence obtained confirms that these fungi occur in free-living frogs from the Brazilian Atlantic Forest with no macroscopic lesions, characterizing the state of asymptomatic carrier. We concluded that the nested-PCR technique, due to its ease of execution and reproducibility, can be recommended as one of the alternatives in epidemiological surveys to detect B. dendrobatidis in healthy free-living frog populations.

A nested real-time PCR assay for the quantification of Plasmodium falciparum DNA extracted from dried blood spots.

Science.gov (United States)

Tran, Tuan M; Aghili, Amirali; Li, Shanping; Ongoiba, Aissata; Kayentao, Kassoum; Doumbo, Safiatou; Traore, Boubacar; Crompton, Peter D

2014-10-04

As public health efforts seek to eradicate malaria, there has been an emphasis on eliminating low-density parasite reservoirs in asymptomatic carriers. As such, diagnosing submicroscopic Plasmodium infections using PCR-based techniques has become important not only in clinical trials of malaria vaccines and therapeutics, but also in active malaria surveillance campaigns. However, PCR-based quantitative assays that rely on nucleic acid extracted from dried blood spots (DBS) have demonstrated lower sensitivity than assays that use cryopreserved whole blood as source material. The density of Plasmodium falciparum asexual parasites was quantified using genomic DNA extracted from dried blood spots (DBS) and the sensitivity of two approaches was compared: quantitative real-time PCR (qPCR) targeting the P. falciparum 18S ribosomal RNA gene, either with an initial conventional PCR amplification prior to qPCR (nested qPCR), or without an initial amplification (qPCR only). Parasite densities determined by nested qPCR, qPCR only, and light microscopy were compared. Nested qPCR results in 10-fold higher sensitivity (0.5 parasites/μl) when compared to qPCR only (five parasites/ul). Among microscopy-positive samples, parasite densities calculated by nested qPCR correlated strongly with microscopy for both asymptomatic (Pearson's r=0.58, PNested qPCR improves the sensitivity for the detection of P. falciparum blood-stage infection from clinical DBS samples. This approach may be useful for active malaria surveillance in areas where submicroscopic asymptomatic infections are prevalent.

Laboratory Tests of Multiplex Detection of PCR Amplicons Using the Luminex 100 Flow Analyzer

Energy Technology Data Exchange (ETDEWEB)

Venkateswaran, K.S.; Nasarabadi, S.; Langlois, R.G.

2000-05-05

Lawrence Livermore National Laboratory (LLNL) demonstrated the power of flow cytometry in detecting the biological agents simulants at JFT III. LLNL pioneered in the development of advanced nucleic acid analyzer (ANM) for portable real time identification. Recent advances in flow cytometry provide a means for multiplexed nucleic acid detection and immunoassay of pathogenic microorganisms. We are presently developing multiplexed immunoassays for the simultaneous detection of different simulants. Our goal is to build an integrated instrument for both nucleic acid analysis and immuno detection. In this study we evaluated the Luminex LX 100 for concurrent identification of more than one PCR amplified product. ANAA has real-time Taqman fluorescent detection capability for rapid identification of field samples. However, its multiplexing ability is limited by the combination of available fluorescent labels. Hence integration of ANAA with flow cytometry can give the rapidity of ANAA amplification and the multiplex capability of flow cytometry. Multiplexed flow cytometric analysis is made possible using a set of fluorescent latex microsphere that are individually identified by their red and infrared fluorescence. A green fluorochrome is used as the assay signal. Methods were developed for the identification of specific nucleic acid sequences from Bacillus globigii (Bg), Bacillus thuringensis (Bt) and Erwinia herbicola (Eh). Detection sensitivity using different reporter fluorochromes was tested with the LX 100, and also different assay formats were evaluated for their suitability for rapid testing. A blind laboratory trial was carried out December 22-27, 1999 to evaluate bead assays for multiplex identification of Bg and Bt PCR products. This report summarizes the assay development, fluorochrome comparisons, and the results of the blind trial conducted at LLNL for the laboratory evaluation of the LX 100 flow analyzer.

Ultrasensitive quantitation of human papillomavirus type 16 E6 oncogene sequences by nested real time PCR

Directory of Open Access Journals (Sweden)

López-Revilla Rubén

2010-05-01

Full Text Available Abstract Background We have developed an ultrasensitive method based on conventional PCR preamplification followed by nested amplification through real time PCR (qPCR in the presence of the DNA intercalating agent EvaGreen. Results Amplification mixtures calibrated with a known number of pHV101 copies carrying a 645 base pair (bp-long insert of the human papillomavirus type 16 (HPV16 E6 oncogene were used to generate the E6-1 amplicon of 645 bp by conventional PCR and then the E6-2 amplicon of 237 bp by nested qPCR. Direct and nested qPCR mixtures for E6-2 amplification corresponding to 2.5 × 102-2.5 × 106 initial pHV101 copies had threshold cycle (Ct values in the ranges of 18.7-29.0 and 10.0-25.0, respectively. The Ct of qPCR mixtures prepared with 1/50 volumes of preamplified mixtures containing 50 ng of DNA of the SiHa cell line (derived from an invasive cervical cancer with one HPV16 genome per cell was 19.9. Thermal fluorescence extinction profiles of E6-2 amplicons generated from pHV101 and SiHa DNA were identical, with a peak at 85.5°C. Conclusions Our method based on conventional preamplification for 15 cycles increased 10,750 times the sensitivity of nested qPCR for the quantitation of the E6 viral oncogene and confirmed that the SiHa cell line contains one E6-HPV16 copy per cell.

Multiplex PCR from Menstrual Blood: A Non-Invasive Cost-Effective Approach to Reduce Diagnostic Dilemma for Genital Tuberculosis.

Science.gov (United States)

Paine, Suman K; Basu, Analabha; Choudhury, Rajib Gon; Bhattacharya, Basudev; Chatterjee, Sidhartha; Bhattacharya, Chandra

2018-03-16

Genital tuberculosis (GTB) is a potent contributor to irreversible damage to the reproductive system and infertility in females. As no gold standard diagnostic tool is yet available, clinical suspicion and relatively insensitive approaches such as histopathology, laparoscopy and hysterosalpingogram are currently critical determinants in the diagnosis of GTB. Although a polymerase chain reaction (PCR)-based assay using endometrial tissue seems promising, sampling does require an invasive procedure. We hypothesized that menstrual blood may provide an alternate non-invasive source of samples for PCR-based GTB diagnosis. We enrolled 195 women with primary infertility in whom GTB was suspected. We obtained ethics committee approval from our institution and written informed consent from subjects. Endometrial tissue and menstrual blood was collected from the subjects and culture, histopathology, and multiplex PCR with both sample type was performed for each subject. The sensitivity and specificity of multiplex PCR was, respectively, 90.2 and 86.1% for menstrual blood, 95.8 and 84.3% for endometrial tissue, and 64.8 and 93.2% for histopathology staining. A strong clinical suspicion aided with multiplex PCR using menstrual blood may significantly reduce the diagnostic dilemma for GTB diagnosis in a non-invasive, sensitive, rapid, and cost-effective manner.

Molecular diagnostics of the honey bee parasites Lotmaria passim and Crithidia spp. (Trypanosomatidae) using multiplex PCR

Science.gov (United States)

Lotmaria passim Schwarz is a recently described trypanosome parasite of honey bees in continental United States, Europe, and Japan. We developed a multiplex PCR technique using a PCR primer specific for L. passim to distinguish this species from C. mellificae. We report the presence of L. passim in ...

Diagnóstico temprano en un brote epidémico del virus Dengue en Piura usando RT-PCR y nested-PCR

Directory of Open Access Journals (Sweden)

Oscar Nolasco

1997-07-01

Full Text Available Un test de diagnóstico temprano (RT-PCR y Nested-PCR fue evaluado y comparado con métodos convencionales (cultivo in vitro, IFI y MAC-ELISA. Treinta y cuatro sueros de pacientes correspondientes de un brote epidémico de la costa norte peruana (Mancora, Piura en mayo de 1997 fueron incluidos en este estudio. Todos los sueros fueron obtenidos de pacientes que presentaron en los primeros cinco días manifestaciones clínicas siendo diagnosticados luego como dengue serotipo 1. Asimismo, RT-PCR permitió diagnosticar 82% de los sueros (28/34, sin embargo Mac-ELISA y cultivo in vitro reconocieron unicamente 41% de los sueros (14/34 y 38% de los sueros (13/34 respectivamente. Por lo tanto, el uso de esta herramienta molecular (RT-PCR y Nested-PCR permitiró dar un diagnóstico temprano a estos pacientes y actuar inmediatamente ante la presencia de un brote epidémico.

Development of RT-PCR and Nested PCR for Detecting Four Quarantine Plant Viruses Belonging to Nepovirus

Directory of Open Access Journals (Sweden)

Siwon Lee

2013-09-01

Full Text Available For quarantine purpose, we developed the RT- and nested PCR module of Tomato black ring virus (TBRV, Arabis mosaic virus (ArMV, Cherry leafroll virus (CLRV and Grapevine fanleaf virus (GFLV. The PCR modules, developed in this study make diagnosis more convenient and speedy because of same PCR condition. And also, the methods are more accurate because it can check whether the result is contamination or not using the mutation-positive control. We discard or return the 27 cases of Nepovirus infection seed by employing the module past 3 years. This study provides a rapid and useful method for detection of four quarantine plant viruses.

Penerapan Metode Diagnosis Cepat Virus Avian Influenza H5N1 dengan Metode Single Step Multiplex RT-PCR

Directory of Open Access Journals (Sweden)

Aris Haryanto

2010-12-01

Full Text Available Avian influenza (AI virus is a segmented single stranded (ss RNA virus with negative polarity andbelong to the Orthomyxoviridae family. Diagnose of AI virus can be performed using conventional methodsbut it has low sensitivity and specificity. The objective of the research was to apply rapid, precise, andaccurate diagnostic method for AI virus and also to determine its type and subtype based on the SingleStep Multiplex Reverse Transcriptase-Polymerase Chain Reaction targeting M, H5, and N1 genes. In thismethod M, H5 and NI genes were simultaneously amplified in one PCR tube. The steps of this researchconsist of collecting viral RNAs from 10 different AI samples originated from Maros Disease InvestigationCenter during 2007. DNA Amplification was conducted by Simplex RT-PCR using M primer set. Then, bysingle step multiplex RT-PCR were conducted simultaneously using M, H5 and N1 primers set. The RTPCRproducts were then separated on 1.5% agarose gel, stained by ethidum bromide and visualized underUV transilluminator. Results showed that 8 of 10 RNA virus samples could be amplified by Simplex RTPCRfor M gene which generating a DNA fragment of 276 bp. Amplification using multiplex RT-PCRmethod showed two of 10 samples were AI positive using multiplex RT-PCR, three DNA fragments weregenerated consisting of 276 bp for M gene, 189 bp for H5 gene, and 131 bp for N1. In this study, rapid andeffective diagnosis method for AI virus can be conducted by using simultaneous Single Step Multiplex RTPCR.By this technique type and subtype of AI virus, can also be determined, especially H5N1.

Application of a Multiplex Quantitative PCR to Assess Prevalence and Intensity Of Intestinal Parasite Infections in a Controlled Clinical Trial

Science.gov (United States)

Llewellyn, Stacey; Inpankaew, Tawin; Nery, Susana Vaz; Gray, Darren J.; Verweij, Jaco J.; Clements, Archie C. A.; Gomes, Santina J.; Traub, Rebecca; McCarthy, James S.

2016-01-01

Background Accurate quantitative assessment of infection with soil transmitted helminths and protozoa is key to the interpretation of epidemiologic studies of these parasites, as well as for monitoring large scale treatment efficacy and effectiveness studies. As morbidity and transmission of helminth infections are directly related to both the prevalence and intensity of infection, there is particular need for improved techniques for assessment of infection intensity for both purposes. The current study aimed to evaluate two multiplex PCR assays to determine prevalence and intensity of intestinal parasite infections, and compare them to standard microscopy. Methodology/Principal Findings Faecal samples were collected from a total of 680 people, originating from rural communities in Timor-Leste (467 samples) and Cambodia (213 samples). DNA was extracted from stool samples and subject to two multiplex real-time PCR reactions the first targeting: Necator americanus, Ancylostoma spp., Ascaris spp., and Trichuris trichiura; and the second Entamoeba histolytica, Cryptosporidium spp., Giardia. duodenalis, and Strongyloides stercoralis. Samples were also subject to sodium nitrate flotation for identification and quantification of STH eggs, and zinc sulphate centrifugal flotation for detection of protozoan parasites. Higher parasite prevalence was detected by multiplex PCR (hookworms 2.9 times higher, Ascaris 1.2, Giardia 1.6, along with superior polyparasitism detection with this effect magnified as the number of parasites present increased (one: 40.2% vs. 38.1%, two: 30.9% vs. 12.9%, three: 7.6% vs. 0.4%, four: 0.4% vs. 0%). Although, all STH positive samples were low intensity infections by microscopy as defined by WHO guidelines the DNA-load detected by multiplex PCR suggested higher intensity infections. Conclusions/Significance Multiplex PCR, in addition to superior sensitivity, enabled more accurate determination of infection intensity for Ascaris, hookworms and

Detection of fungi by conventional methods and semi-nested PCR in patients with presumed fungal keratitis.

Science.gov (United States)

Haghani, I; Amirinia, F; Nowroozpoor-Dailami, K; Shokohi, T

2015-06-01

Fungal keratitis is a suppurative, ulcerative, and sight-threatening infection of the cornea that sometimes leads to blindness. The aims of this study were: recuperating facilities for laboratory diagnosis, determining the causative microorganisms, and comparing conventional laboratory diagnostic tools and semi-nested PCR. Sampling was conducted in patients with suspected fungal keratitis. Two corneal scrapings specimens, one for direct smear and culture and the other for semi- nested PCR were obtained. Of the 40 expected cases of mycotic keratitis, calcofluor white staining showed positivity in 25%, culture in 17.5%, KOH in 10%, and semi-nested PCR in 27.5%. The sensitivities of semi-nested PCR, KOH, and CFW were 57.1%, 28.5%, and 42% while the specificities were 78.7%, 94%, and 78.7%, respectively. The time taken for PCR assay was 4 to 8 hours, whereas positive fungal cultures took at least 5 to 7 days. Due to the increasing incidence of fungal infections in people with weakened immune systems, uninformed using of topical corticosteroids and improper use of contact lens, fast diagnosis and accurate treatment of keratomycosis seems to be essential . Therefore, according to the current study, molecular methods can detect mycotic keratitis early and correctly leading to appropriate treatment.

Multiplex real-time RT-PCR assay for bovine viral diarrhea virus type 1, type 2 and HoBi-like pestivirus.

Science.gov (United States)

Mari, Viviana; Losurdo, Michele; Lucente, Maria Stella; Lorusso, Eleonora; Elia, Gabriella; Martella, Vito; Patruno, Giovanni; Buonavoglia, Domenico; Decaro, Nicola

2016-03-01

HoBi-like pestiviruses are emerging pestiviruses that infect cattle causing clinical forms overlapping to those induced by bovine viral diarrhea virus (BVDV) 1 and 2. As a consequence of their widespread distribution reported in recent years, molecular tools for rapid discrimination among pestiviruses infecting cattle are needed. The aim of the present study was to develop a multiplex real-time RT-PCR assay, based on the TaqMan technology, for the rapid and unambiguous characterisation of all bovine pestiviruses, including the emerging HoBi-like strains. The assay was found to be sensitive, specific and repeatable, ensuring detection of as few as 10(0)-10(1) viral RNA copies. No cross-reactions between different pestiviral species were observed even in samples artificially contaminated with more than one pestivirus. Analysis of field samples tested positive for BVDV-1, BVDV-2 or HoBi-like virus by a nested PCR protocol revealed that the developed TaqMan assay had equal or higher sensitivity and was able to discriminate correctly the viral species in all tested samples, whereas a real-time RT-PCR assay previously developed for HoBi-like pestivirus detection showed cross-reactivity with few high-titre BVDV-2 samples. Copyright © 2015 Elsevier B.V. All rights reserved.

Design of a multiplex PCR assay for the simultaneous detection and confirmation of Neisseria gonorrhoeae.

LENUS (Irish Health Repository)

O'Callaghan, Isabelle

2010-05-01

To improve the detection of Neisseria gonorrhoeae by designing a multiplex PCR assay using two N gonorrhoeae-specific genes as targets, thereby providing detection and confirmation of a positive result simultaneously.

Multiplex PCR for Differential Identification of Broad Tapeworms (Cestoda: Diphyllobothrium) Infecting Humans

Czech Academy of Sciences Publication Activity Database

Wicht, B.; Yanagida, T.; Scholz, Tomáš; Ito, A.; Jiménez, J. A.; Brabec, Jan

2010-01-01

Roč. 48, č. 9 (2010), s. 3111-3116 ISSN 0095-1137 R&D Projects: GA MŠk LC522 Institutional research plan: CEZ:AV0Z60220518 Keywords : MOLECULAR EVIDENCE * PACIFIC SALMON * NIHONKAIENSE * Diphyllobothrium * multiplex PCR * the cytochrome c oxidase subunit 1 * mitochondrial DNA Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 4.220, year: 2010

A tissue biopsy-based epigenetic multiplex PCR assay for prostate cancer detection

Directory of Open Access Journals (Sweden)

Van Neste Leander

2012-06-01

Full Text Available Abstract Background PSA-directed prostate cancer screening leads to a high rate of false positive identifications and an unnecessary biopsy burden. Epigenetic biomarkers have proven useful, exhibiting frequent and abundant inactivation of tumor suppressor genes through such mechanisms. An epigenetic, multiplex PCR test for prostate cancer diagnosis could provide physicians with better tools to help their patients. Biomarkers like GSTP1, APC and RASSF1 have demonstrated involvement with prostate cancer, with the latter two genes playing prominent roles in the field effect. The epigenetic states of these genes can be used to assess the likelihood of cancer presence or absence. Results An initial test cohort of 30 prostate cancer-positive samples and 12 cancer-negative samples was used as basis for the development and optimization of an epigenetic multiplex assay based on the GSTP1, APC and RASSF1 genes, using methylation specific PCR (MSP. The effect of prostate needle core biopsy sample volume and age of formalin-fixed paraffin-embedded (FFPE samples was evaluated on an independent follow-up cohort of 51 cancer-positive patients. Multiplexing affects copy number calculations in a consistent way per assay. Methylation ratios are therefore altered compared to the respective singleplex assays, but the correlation with patient outcome remains equivalent. In addition, tissue-biopsy samples as small as 20 μm can be used to detect methylation in a reliable manner. The age of FFPE-samples does have a negative impact on DNA quality and quantity. Conclusions The developed multiplex assay appears functionally similar to individual singleplex assays, with the benefit of lower tissue requirements, lower cost and decreased signal variation. This assay can be applied to small biopsy specimens, down to 20 microns, widening clinical applicability. Increasing the sample volume can compensate the loss of DNA quality and quantity in older samples.

Improved assay to detect Plasmodium falciparum using an uninterrupted, semi-nested PCR and quantitative lateral flow analysis

Science.gov (United States)

2013-01-01

Background A rapid, non-invasive, and inexpensive point-of-care (POC) diagnostic for malaria followed by therapeutic intervention would improve the ability to control infection in endemic areas. Methods A semi-nested PCR amplification protocol is described for quantitative detection of Plasmodium falciparum and is compared to a traditional nested PCR. The approach uses primers that target the P. falciparum dihydrofolate reductase gene. Results This study demonstrates that it is possible to perform an uninterrupted, asymmetric, semi-nested PCR assay with reduced assay time to detect P. falciparum without compromising the sensitivity and specificity of the assay using saliva as a testing matrix. Conclusions The development of this PCR allows nucleic acid amplification without the need to transfer amplicon from the first PCR step to a second reaction tube with nested primers, thus reducing both the chance of contamination and the time for analysis to PCR amplicon yield was adapted to lateral flow detection using the quantitative up-converting phosphor (UCP) reporter technology. This approach provides a basis for migration of the assay to a POC microfluidic format. In addition the assay was successfully evaluated with oral samples. Oral fluid collection provides a simple non-invasive method to collect clinical samples. PMID:23433252

A simplified multiplex PCR assay for fast and easy discrimination of globally distributed staphylococcal cassette chromosome mec types in meticillin-resistant Staphylococcus aureus

NARCIS (Netherlands)

E. Ghaznavi Rad (Ehsanollah); N.S. Mariana (Nor Shamsudin); Z. Sekawi (Zamberi); A.F. van Belkum (Alex); V. Neela (Vasanthakumari)

2010-01-01

textabstractA multiplex PCR assay was developed for the identification of major types and subtypes of staphylococcal cassette chromosome mec (SCCmec) in meticillin-resistant Staphylococcus aureus (MRSA) strains. The method uses a novel 9 valent multiplex PCR plus two primer pairs for S. aureus

Detection and characterization of recombinant DNA expressing vip3A-type insecticidal gene in GMOs--standard single, multiplex and construct-specific PCR assays.

Science.gov (United States)

Singh, Chandra K; Ojha, Abhishek; Bhatanagar, Raj K; Kachru, Devendra N

2008-01-01

Vegetative insecticidal protein (Vip), a unique class of insecticidal protein, is now part of transgenic plants for conferring resistance against lepidopteron pests. In order to address the imminent regulatory need for detection and labeling of vip3A carrying genetically modified (GM) products, we have developed a standard single PCR and a multiplex PCR assay. As far as we are aware, this is the first report on PCR-based detection of a vip3A-type gene (vip-s) in transgenic cotton and tobacco. Our assay involves amplification of a 284-bp region of the vip-s gene. This assay can possibly detect as many as 20 natural wild-type isolates bearing a vip3A-like gene and two synthetic genes of vip3A in transgenic plants. The limit of detection as established by our assay for GM trait (vip-s) is 0.1%. Spiking with nontarget DNA originating from diverse plant sources had no inhibitory effect on vip-s detection. Since autoclaving of vip-s bearing GM leaf samples showed no deterioration/interference in detection efficacy, the assay seems to be suitable for processed food products as well. The vip-s amplicon identity was reconfirmed by restriction endonuclease assay. The primer set for vip-s was equally effective in a multiplex PCR assay format (duplex, triplex and quadruplex), used in conjunction with the primer sets for the npt-II selectable marker gene, Cauliflower mosaic virus 35S promoter and nopaline synthetase terminator, enabling concurrent detection of the transgene, regulatory sequences and marker gene. Further, the entire transgene construct was amplified using the forward primer of the promoter and the reverse primer of the terminator. The resultant amplicon served as a template for nested PCR to confirm the construct integrity. The method is suitable for screening any vip3A-carrying GM plant and food. The availability of a reliable PCR assay method prior to commercial release of vip3A-based transgenic crops and food would facilitate rapid and efficient regulatory

Molecular diagnosis of lyssaviruses and sequence comparison of Australian bat lyssavirus samples.

Science.gov (United States)

Foord, A J; Heine, H G; Pritchard, L I; Lunt, R A; Newberry, K M; Rootes, C L; Boyle, D B

2006-07-01

To evaluate and implement molecular diagnostic tests for the detection of lyssaviruses in Australia. A published hemi-nested reverse transcriptase polymerase chain reaction (RT-PCR) for the detection of all lyssavirus genotypes was modified to a fully nested RT-PCR format and compared with the original assay. TaqMan assays for the detection of Australian bat lyssavirus (ABLV) were compared with both the nested and hemi-nested RT-PCR assays. The sequences of RT-PCR products were determined to assess sequence variations of the target region (nucleocapsid gene) in samples of ABLV originating from different regions. The nested RT-PCR assay was highly analytically specific, and at least as analytically sensitive as the hemi-nested assay. The TaqMan assays were highly analytically specific and more analytically sensitive than either RT-PCR assay, with a detection level of approximately 10 genome equivalents per microl. Sequence of the first 544 nucleotides of the nucleocapsid protein coding sequence was obtained from all samples of ABLV received at Australian Animal Health Laboratory during the study period. The nested RT-PCR provided a means for molecular diagnosis of all tested genotypes of lyssavirus including classical rabies virus and Australian bat lyssavirus. The published TaqMan assay proved to be superior to the RT-PCR assays for the detection of ABLV in terms of analytical sensitivity. The TaqMan assay would also be faster and cross contamination is less likely. Nucleotide sequence analyses of samples of ABLV from a wide geographical range in Australia demonstrated the conserved nature of this region of the genome and therefore the suitability of this region for molecular diagnosis.

Real time quantitative amplification detection on a microarray: towards high multiplex quantitative PCR.

NARCIS (Netherlands)

Pierik, A.; Moamfa, M; van Zelst, M.; Clout, D.; Stapert, H.; Dijksman, Johan Frederik; Broer, D.; Wimberger-Friedl, R.

2012-01-01

Quantitative real-time polymerase chain reaction (qrtPCR) is widely used as a research and diagnostic tool. Notwithstanding its many powerful features, the method is limited in the degree of multiplexing to about 6 due to spectral overlap of the available fluorophores. A new method is presented that

Real time quantitative amplification detection on a microarray : towards high multiplex quantitative PCR

NARCIS (Netherlands)

Pierik, Anke; Boamfa, M.; Zelst, van M.; Clout, D.; Stapert, H.R.; Dijksman, J.F.; Broer, D.J.; Wimberger-Friedl, R.

2012-01-01

Quantitative real-time polymerase chain reaction (qrtPCR) is widely used as a research and diagnostic tool. Notwithstanding its many powerful features, the method is limited in the degree of multiplexing to about 6 due to spectral overlap of the available fluorophores. A new method is presented that

Nested PCR for specific diagnosis of Taenia solium taeniasis.

Science.gov (United States)

Mayta, Holger; Gilman, Robert H; Prendergast, Emily; Castillo, Janeth P; Tinoco, Yeny O; Garcia, Hector H; Gonzalez, Armando E; Sterling, Charles R

2008-01-01

Taeniasis due to Taenia solium is a disease with important public health consequences, since the larval stage is not exclusive to the animal intermediate, the pig, but also infects humans, causing neurocysticercosis. Early diagnosis and treatment of T. solium tapeworm carriers is important to prevent human cysticercosis. Current diagnosis based on microscopic observation of eggs lacks both sensitivity and specificity. In the present study, a nested-PCR assay targeting the Tso31 gene was developed for the specific diagnosis of taeniasis due to T. solium. Initial specificity and sensitivity testing was performed using stored known T. solium-positive and -negative samples. The assay was further analyzed under field conditions by conducting a case-control study of pretreatment stool samples collected from a population in an area of endemicity. Using the archived samples, the assay showed 97% (31/32) sensitivity and 100% (123/123) specificity. Under field conditions, the assay had 100% sensitivity and specificity using microscopy/enzyme-linked immunosorbent assay coproantigen testing as the gold standards. The Tso31 nested PCR described here might be a useful tool for the early diagnosis and prevention of taeniasis/cysticercosis.

Early diagnosis of typhoid fever by nested PCR for flagellin gene of Salmonella enterica serotype Typhi.

Science.gov (United States)

Khan, S; Harish, B N; Menezes, G A; Acharya, N S; Parija, S C

2012-11-01

Typhoid fever caused by Salmonella Typhi continues to be a major health problem in spite of the use of antibiotics and the development of newer antibacterial drugs. Inability to make an early laboratory diagnosis and resort to empirical therapy, often lead to increased morbidity and mortality in cases of typhoid fever. This study was aimed to optimize a nested PCR for early diagnosis of typhoid fever and using it as a diagnostic tool in culture negative cases of suspected typhoid fever. Eighty patients with clinical diagnosis of typhoid fever and 40 controls were included in the study. The blood samples collected were subjected to culture, Widal and nested PCR targeting the flagellin gene of S. Typhi. The sensitivity of PCR on blood was found to be 100 per cent whereas the specificity was 76.9 per cent. The positive predictive value (PPV) of PCR was calculated to be 76.9 per cent with an accuracy of 86 per cent. None of the 40 control samples gave a positive PCR. Due to its high sensitivity and specificity nested PCR can be used as a useful tool to diagnose clinically suspected, culture negative cases of typhoid fever.

Development of a multiplex PCR assay for rapid and simultaneous detection of four genera of fish pathogenic bacteria.

Science.gov (United States)

Zhang, D F; Zhang, Q Q; Li, A H

2014-11-01

Species of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus are the most common fish pathogenic bacteria that cause economically devastating losses in aquaculture. A multiplex polymerase chain reaction (mPCR) was developed for the simultaneous detection and differentiation of the four genera of fish pathogenic bacteria. Through the use of genus-specific primers instead of species-specific ones, the current mPCR covered much more target bacterial species compared with previously reported species-specific mPCR methods. The specificity of the four putative genus-specific primers was validated experimentally while used exclusively (uniplex PCR) or combined (mPCR) against bacterial genomic DNA templates of the target bacteria and nontarget bacteria. The PCR amplicons for the following genera were obtained as expected: Aeromonas (875 bp), Vibrio (524 bp), Edwardsiella (302 bp) and Streptococcus (197 bp), and the fragments could be separated clearly on the agarose gel electrophoresis. The mPCR did not produce nonspecific amplification products when used to amplify 21 nontarget species of bacteria. The mPCR detection limits for each target bacterial genera were 50 colony-forming units (CFU) in pure culture and 100 CFU in fish tissue samples. In conclusion, the mPCR assay was proven to be a powerful alternative to the conventional culture-based method, given its rapid, specific, sensitive and reliable detection of target pathogens. The fish pathogenic bacteria of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus frequently cause severe outbreaks of diseases in cultured fish, and the genus-specific multiplex PCR assay developed in this study can detect the bacteria of the four genera when present in the samples either alone or mixed. The mPCR assay is expected to identify the causative agents more efficiently than uniplex PCR or species-specific multiplex PCR for clinical diagnosis, resulting in the earlier implementation of control measures. This mPCR

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

Science.gov (United States)

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.

Science.gov (United States)

Kageyama, A; Benno, Y

2001-01-01

PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.

Detection of Shiga toxins genes by Multiplex PCR in clinical samples

Directory of Open Access Journals (Sweden)

2013-09-01

Full Text Available Background: Different methods have been used for detection of shiga toxins; such as,  cell culture, ELISA, and RFPLA. However, all of these methods suffer from high cost, time-consumption and relatively low sensitivity. In this study we used Multiplex PCR method for detection of genes encoding shiga toxins. Material and Methods: In this study, 63 clinical samples were obtained from positive cultures of Shigella and E. coli O157, from Bahman 1391 until Ordibehesht 1392 in Mazandaran province. Initial confirmation of shiga toxins producing bacteria was performed by biochemical and serological methods. After DNA extraction, detection of stx1 and stx2 genes was accomplished by multiplex PCR.  For confirmation of the PCR amplicon, DNA sequencing was used. Antibiotic sensitivity tests were performed by disk diffusion method. Results:  Among the positive strains, 13 strains contained stx2 genes, 4 strains contained Stx/Stx1 genes and 4 strains harbored both Stx/Stx1 and Stx2. The DNA extracted from other Gram-negative bacteria was not protected by the relevant parts of these toxins. Sequencing of the amplified fragments indicated the correct toxin sequences.  The sensitivity for identification of Stx/Stx1 gene was 1.56 pg/ µl and for Stx2 was 1.08 pg/µl. The toxin positive strains were all sensitive to Cefixime, Gentamicin, Amikacin, Ceftriaxone, and Nitrofurantoin. Conclusion: This method is fast and accurate for detection of bacteria producing shiga toxin and can be used to identify different types of shiga toxin.

Detection the human mitochondrial DNA 4977 bp deletion induced by 60Co γ-rays in vitro by nest-PCR

International Nuclear Information System (INIS)

Feng Jiangbing; Lu Xue; Chen Deqing; Liu Qingjie; Chen Xiaosui

2004-01-01

Objective: To establish a method for detecting the mitochondrial DNA 4977 bp deletion (mtDNA 4977) induced by different doses of ionizing radiation. Methods: A nest-PCR method was established with 3 primer pairs for detecting the human peripheral mtDNA 4977. The final PCR products were sequenced after purified and the sequence was BLASTed with the standard genome information of human mitochondrion. The mtDNA 4977 level induced by 0-5 Gy 60 Co γ-rays of 5 healthy individuals was analyzed with the established nest-PCR. Results: The mtDNA 4977 could be detected by the established nest-PCR method. The mtDNA 4977 was observed on samples after exposed to 1-5 Gy 60 Co γ-rays, but it was not observed before (0 Gy) exposure. Conclusion: The nest-PCR method established in this study could be used to detect the mtDNA 4977 induced by ionizing radiation. (authors)

Detection of Mycoplasma hyopneumoniae in lungs and nasal swabs of pigs by nested PCR Detecção de Mycoplasma hyopneumoniae em pulmões e suabes nasais de suínos por nested PCR

Directory of Open Access Journals (Sweden)

F.M.F. Silva

2009-02-01

Full Text Available Fifty-four samples were collected from growing and finishing pigs for the molecular diagnosis of enzootic porcine pneumonia. Nineteen lung fragments were obtained from pigs that showed signs of respiratory disease and 35 nasal swabs were obtained from clinically healthy pigs. For the detection of the bacterial genome in the samples, the nested PCR technique was used to amplify a fragment of 706bp. This fragment was subsequently cloned and sequenced. The sequence of obtained nucleotides was compared with six other sequences of Mycoplasma hyopneumoniae and 11 sequences of other bacteria available in the Genbank. To measure the sensitivity of the nested PCR, serial dilutions (10-1 to 10-15 of cloned fragments were conducted based on the concentration of 300ng. Ten lung fragments and eight nasal swabs showed positive for M. hyopneumoniae and the limit of detection was estimated to be 0.3fg DNA cloned. The sequence of nucleotides obtained showed 99.1% homology with the other sequences of M. hyopneumoniae, demonstrating that the nested PCR used in this study may provide an important diagnostic tool for the detection of this agent.Foram coletadas 54 amostras de animais em fase de crescimento e terminação para o diagnóstico molecular da pneumonia enzoótica suína. Dezenove fragmentos de pulmão foram obtidos de suínos que apresentavam sinais de doença respiratória e 35 suabes nasais foram obtidas de suínos clinicamente saudáveis. Para a detecção do genoma bacteriano nas amostras, foi utilizada a técnica de nested PCR que originou um fragmento de 706pb, o qual foi, posteriormente, clonado e sequenciado. A sequência de nucleotídeos obtida foi comparada com outras seis sequências de Mycoplasma hyopneumoniae e 11 sequências de outras bactérias disponíveis no Genbank. Para medir a sensibilidade da nested PCR, foram realizadas diluições seriadas (10-1 a 10-15 do fragmento clonado, partindo da concentração de 300ng. Dez fragmentos de pulm

The Diagnostic Utility of Bact/ALERT and Nested PCR in the Diagnosis of Tuberculous Meningitis.

Science.gov (United States)

Sastry, Apurba Sankar; Bhat K, Sandhya; Kumudavathi

2013-01-01

The early laboratory diagnosis of Tuberculous Meningitis (TBM) is crucial, to start the antitubercular chemotherapy and to prevent its complications. However, the conventional methods are either less sensitive or time consuming. Hence, the diagnostic potentials of BacT/ALERT and Polymerase Chain Reaction (PCR) was evaluated in this study. The study group comprised of 62 cases and 33 controls. The cases were divided according to Ahuja's criteria into the confirmed (two cases), highly probable (19 cases), probable (26 cases) and the possible (15 cases) subgroups. Ziehl Neelsen's (ZN) and Auramine Phenol (AP) staining, Lowenstein Jensen (LJ) medium culture, BacT/ALERT and nested Polymerase Chain Reaction (PCR) which targeted IS6110 were carried out on all the patients. The sensitivity of the LJ culture was 3.22%. BacT/ALERT showed a sensitivity and a specificity of 25.80% and 100% and those of nested PCR were found to be 40.32% and 96.97% respectively. The mean detection time of growth of the LJ culture was 31.28 days, whereas that of BacT/ALERT was 20.68 days. The contamination rate in the LJ culture and BacT/ALERT were 7.2% and 5.8% respectively. Nested PCR was found to be more sensitive, followed by BacT/ALERT as compared to the LJ culture and smear microscopy. As both false negative and false positive results have been reported for nested PCR, so it should not be used alone as a criterion for initiating or terminating the therapy, but it should be supported by clinical, radiological, cytological and other microbiological findings.

Comparison of Real-Time Multiplex Human Papillomavirus (HPV) PCR Assays with INNO-LiPA HPV Genotyping Extra Assay▿

OpenAIRE

Else, Elizabeth A.; Swoyer, Ryan; Zhang, Yuhua; Taddeo, Frank J.; Bryan, Janine T.; Lawson, John; Van Hyfte, Inez; Roberts, Christine C.

2011-01-01

Real-time type-specific multiplex human papillomavirus (HPV) PCR assays were developed to detect HPV DNA in samples collected for the efficacy determination of the quadrivalent HPV (type 6, 11, 16, and 18) L1 virus-like particle (VLP) vaccine (Gardasil). Additional multiplex (L1, E6, and E7 open reading frame [ORF]) or duplex (E6 and E7 ORF) HPV PCR assays were developed to detect high-risk HPV types, including HPV type 31 (HPV31), HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, and H...

Detection of intestinal protozoa in paediatric patients with gastrointestinal symptoms by multiplex real-time PCR.

Science.gov (United States)

Maas, L; Dorigo-Zetsma, J W; de Groot, C J; Bouter, S; Plötz, F B; van Ewijk, B E

2014-06-01

The performance of a multiplex real-time PCR for the detection of Blastocystis, Dientamoeba fragilis, Giardia lamblia, Cryptosporidium species and Entamoeba species in faecal samples was evaluated in an observational prospective study. Paediatric patients (0-18 years) presenting with gastrointestinal symptoms and suspected of having enteroparasitic disease were included. A questionnaire on gastrointestinal symptoms and the chosen treatment was completed at the start of the study and after 6 weeks. Of 163 paediatric patients (mean age, 7.8 years), 114 (70%) had a PCR-positive faecal sample. D. fragilis was detected most frequently, in 101 patients, followed by Blastocystis in 49. In faecal samples of 47 patients, more than one protozoan was detected, mainly the combination of D. fragilis and Blastocystis. Reported gastrointestinal symptoms were abdominal pain (78%), nausea (30%), and altered bowel habits (28%). Eighty-nine of the PCR-positive patients were treated with antibiotics. A significant reduction in abdominal pain was observed both in treated and in untreated patients. This study demonstrated that multiplex real-time PCR detects a high percentage of intestinal protozoa in paediatric patients with gastrointestinal symptoms. However, interpretation and determination of the clinical relevance of a positive PCR result in this population are still difficult. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

Construção de iniciadores e otimização de ensaios de PCR e de nested-PCR para a detecção específica de Tritrichomonas foetus Primers design and optimization of PCR and nested-PCR assays for the specific detection of Tritrichomonas foetus

Directory of Open Access Journals (Sweden)

Paula Rogério Fernandes

2008-09-01

Full Text Available Tritrichomonas foetus é um protozoário patogênico responsável por doença venérea em bovinos conhecida por tricomonose genital bovina. A tricomonose bovina é uma doença venérea causada pelo protozoário cujo habitat natural é o trato genital. Os protocolos já desenvolvidos para o diagnóstico deste parasito por PCR, apesar de serem eficazes na identificação do DNA genômico alvo, promovem algumas amplificações inespecíficas ou são incapazes de distinguir T. foetus das outras espécies do gênero. O presente trabalho foi desenvolvido com o objetivo de estabelecer e otimizar protocolos de ensaio de PCR e nested-PCR para o diagnóstico específico de T. foetus, empregando-se novos iniciadores, selecionados do alinhamento das seqüências dos genes 18S rRNA, 5,8S rRNA, 28S rRNA e dos espaços transcritos do rDNA (ITS1 e ITS2. Um par de iniciadores foi construído para amplificação gênero-específica de um fragmento de 648 pares de base e outros dois para a obtenção de produtos espécie- específicos de 343 e 429 pb. Nenhuma reação cruzada foi observada frente ao DNA genômico de Bos taurus ou de microrganismos responsáveis por infecções genitais. A sensibilidade dos ensaios de PCR e de nested-PCR apresentados neste estudo permitiu um limiar de detecção de até dois parasitos.Tritrichomonas foetus is a pathogenic protozoan that causes a venereal disease in cattle known as bovine genital tricomonosis. In spite of the efficacy to recognize the target genomic DNA, the protocols so far developed for the diagnosis of this organism by PCR promote some inespecific amplifications or they are unable to discriminate T. foetus against other species within the genus. The objective of this study was to assess and optimize PCR and nested-PCR assays for the specific diagnosis of T. foetus, using novel primers selected from the alignment of sequences of the genes 18S rRNA, 5.8S rRNA, 28S rRNA and of the internal transcribed spacers of the

Use of Multiplex Real-Time PCR To Diagnose Scrub Typhus.

Science.gov (United States)

Tantibhedhyangkul, Wiwit; Wongsawat, Ekkarat; Silpasakorn, Saowaluk; Waywa, Duangdao; Saenyasiri, Nuttawut; Suesuay, Jintapa; Thipmontree, Wilawan; Suputtamongkol, Yupin

2017-05-01

Scrub typhus, caused by Orientia tsutsugamushi , is a common cause of acute undifferentiated febrile illness in the Asia-Pacific region. However, its nonspecific clinical manifestation often prevents early diagnosis. We propose the use of PCR and serologic tests as diagnostic tools. Here, we developed a multiplex real-time PCR assay using hydrolysis (TaqMan) probes targeting O. tsutsugamushi 47-kDa, groEL , and human interferon beta (IFN-β gene) genes to improve early diagnosis of scrub typhus. The amplification efficiency was higher than 94%, and the lower detection limit was 10 copies per reaction. We used a human gene as an internal DNA quality and quantity control. To determine the sensitivity of this PCR assay, we selected patients with confirmed scrub typhus who exhibited a clear 4-fold increase in the level of IgG and/or IgM. The PCR assay result was positive in 45 of 52 patients, indicating a sensitivity of 86.5% (95% confidence interval [CI]: 74.2 to 94.4). The PCR assessment was negative for all 136 non-scrub typhus patients, indicating a specificity of 100% (95% CI: 97.3 to 100). In addition, this test helped diagnose patients with inconclusive immunofluorescence assay (IFA) results and using single blood samples. In conclusion, the real-time PCR assay proposed here is sensitive and specific in diagnosing scrub typhus. Combining PCR and serologic tests will improve the diagnosis of scrub typhus among patients presenting with acute febrile illness. Copyright © 2017 American Society for Microbiology.

Immunocapture reverse transcription-polymerase chain reaction combined with nested PCR greatly increases the detection of Prunus necrotic ring spot virus in the peach.

Science.gov (United States)

Helguera, P R; Taborda, R; Docampo, D M; Ducasse, D A

2001-06-01

A detection system based on nested PCR after IC-RT-PCR (IC-RT-PCR-Nested PCR) was developed to improve indexing of Prunus necrotic ringspot virus in peach trees. Inhibitory effects and inconsistencies of the standard IC-RT-PCR were overcome by this approach. IC-RT-PCR-Nested PCR improved detection by three orders of magnitude compared with DAS-ELISA for the detection of PNRSV in leaves. Several different tissues were evaluated and equally consistent results were observed. The main advantages of the method are its consistency, high sensitivity and easy application in quarantine programs.

Validation and clinical application of a nested PCR for paracoccidioidomycosis diagnosis in clinical samples from Colombian patients.

Science.gov (United States)

Gaviria, Marcela; Rivera, Vanessa; Muñoz-Cadavid, Cesar; Cano, Luz Elena; Naranjo, Tonny Williams

2015-01-01

Paracoccidioidomycosis is a systemic and endemic mycosis, restricted to tropical and subtropical areas of Latin America. The infection is caused by the thermal dimorphic fungus Paracoccidioides brasiliensis and Paracoccidioides lutzii. The diagnosis of paracoccidioidomycosis is usually performed by microscopic examination, culture and immunodiagnostic tests to respiratory specimens, body fluids and/or biopsies; however these methods require laboratory personnel with experience and several days to produce a result. In the present study, we have validated and evaluated a nested PCR assay targeting the gene encoding the Paracoccidioides gp43 membrane protein in 191 clinical samples: 115 samples from patients with proven infections other than paracoccidioidomycosis, 51 samples as negative controls, and 25 samples from patients diagnosed with paracoccidioidomycosis. Additionally, the specificity of the nested PCR assay was also evaluated using purified DNA isolated from cultures of different microorganisms (n=35) previously identified by culture and/or sequencing. The results showed that in our hands, this nested PCR assay for gp43 protein showed specificity and sensitivity rates of 100%. The optimized nested PCR conditions in our laboratory allowed detection down to 1fg of P. brasiliensis DNA. Copyright © 2015 Elsevier Editora Ltda. All rights reserved.

Molecular serotyping, virulence gene profiling and pathogenicity of Streptococcus agalactiae isolated from tilapia farms in Thailand by multiplex PCR.

Science.gov (United States)

Kannika, K; Pisuttharachai, D; Srisapoome, P; Wongtavatchai, J; Kondo, H; Hirono, I; Unajak, S; Areechon, N

2017-06-01

This study aimed to biotype Streptococcus agalactiae isolated from tilapia farms in Thailand based on molecular biotyping methods and to determine the correlation between the serotype and virulence of bacteria. In addition to a biotyping (serotyping) technique based on multiplex PCR of cps genes, in this study, we developed multiplex PCR typing of Group B streptococcus (GBS) virulence genes to examine three clusters of virulence genes and their correlation with the pathogenicity of S. agalactiae. The epidemiology of S. agalactiae in Thailand was analysed to provide bacterial genetic information towards a future rational vaccine strategy for tilapia culture systems. Streptococcus agalactiae were isolated from diseased tilapia from different areas of Thailand. A total of 124 S. agalactiae isolates were identified by phenotypic analysis and confirmed by 16S rRNA PCR. Bacterial genotyping was conducted based on (i) molecular serotyping of the capsular polysaccharide (cps) gene cluster and (ii) virulence gene profiling using multiplex PCR analysis of 14 virulence genes (lmb, scpB, pavA, cspA, spb1, cyl, bca, rib, fbsA, fbsB, cfb, hylB, bac and pbp1A/ponA). Only serotypes Ia and III were found in this study; serotype Ia lacks the lmb, scpB and spb1 genes, whereas serotype III lacks only the bac gene. Virulence tests in juvenile Nile tilapia demonstrated a correlation between the pathogenicity of the bacteria and their virulence gene profile, with serotype III showing higher virulence than serotype Ia. Epidemiological analysis showed an almost equal distribution in all regions of Thailand, except serotype III was found predominantly in the southern areas. Only two serotypes of S. agalactiae were isolated from diseased tilapia in Thailand. Serotype Ia showed fewer virulence genes and lower virulence than serotype III. Both serotypes showed a similar distribution throughout Thailand. We identified two major serotypes of S. agalactiae isolates associated with the outbreak in

Molecular analysis of single oocyst of Eimeria by whole genome amplification (WGA) based nested PCR.

Science.gov (United States)

Wang, Yunzhou; Tao, Geru; Cui, Yujuan; Lv, Qiyao; Xie, Li; Li, Yuan; Suo, Xun; Qin, Yinghe; Xiao, Lihua; Liu, Xianyong

2014-09-01

PCR-based molecular tools are widely used for the identification and characterization of protozoa. Here we report the molecular analysis of Eimeria species using combined methods of whole genome amplification (WGA) and nested PCR. Single oocyst of Eimeria stiedai or Eimeriamedia was directly used for random amplification of the genomic DNA with either primer extension preamplification (PEP) or multiple displacement amplification (MDA), and then the WGA product was used as template in nested PCR with species-specific primers for ITS-1, 18S rDNA and 23S rDNA of E. stiedai and E. media. WGA-based PCR was successful for the amplification of these genes from single oocyst. For the species identification of single oocyst isolated from mixed E. stiedai or E. media, the results from WGA-based PCR were exactly in accordance with those from morphological identification, suggesting the availability of this method in molecular analysis of eimerian parasites at the single oocyst level. WGA-based PCR method can also be applied for the identification and genetic characterization of other protists. Copyright © 2014 Elsevier Inc. All rights reserved.

Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

DEFF Research Database (Denmark)

Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

2017-01-01

, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...

Multiplex PCR detection of Cryptosporidium sp, Giardia lamblia and Entamoeba histolytica directly from dried stool samples from Guinea-Bissauan children with diarrhoea

DEFF Research Database (Denmark)

Mero, Sointu; Kirveskari, Juha; Antikainen, Jenni

2017-01-01

and specificity, while new molecular methods may provide more accurate diagnostics. In poor regions with sample storage hampered by uncertain electricity supply, research would benefit from a method capable of analysing dried stools. Methods: A real-time multiplex PCR method with internal inhibition control...... microscopy revealed a parasite in 15%, while PCR detected 62% positive for at least one parasite: 44% of the dried samples had Giardia, 23% Cryptosporidium and 0% E. histolytica. Conclusions: Our new multiplex real-time PCR for protozoa presents a sensitive method applicable to dried samples. As proof...

Simultaneous detection of peanut and hazelnut allergens in food matrices using multiplex PCR method

Directory of Open Access Journals (Sweden)

Eva Renčová

2014-01-01

Full Text Available Multiplex PCR analysis for the detection of two targeting segments of genes coding major food protein allergens as peanut (Arachis hypogaea Ara h 1 gene and hazelnut (Corylus avellana Cor a 1 gene was developed. Two sets of primers were designed and tested to their specificity on a broad range of ingredients. The identity of amplicons (Ara h 1- 180 bp, Cor a 1 – 258 bp by sequencing and alignment of sequences with sequences deposited in Genbank was confirmed. When testing the specificity of designed primer pairs on a spectrum of food ingredients, no cross reactions were detected. A potential inhibition of PCR reaction was eliminated using the universal plant primers of chloroplast gene 124 bp for the plant matrices confirmation. The intrinsic detection limit was 10 pg·ml-1 and the practical detection limit was 0.001% w/w (10 mg·kg-1 for both peanuts and hazelnuts. The method was applied to the investigation of 60 commercial food samples. The developed multiplex PCR method is cheap, specific and sensitive enough and can be used as a simple, one day procedure for the checking of undeclared peanut and hazelnut major allergens in food.

Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.

Science.gov (United States)

Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal

2014-05-01

Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

Detection of Toxoplasma gondii oocysts in soils in northwestern China using a new semi-nested PCR assay.

Science.gov (United States)

Wang, Meng; Meng, Peng; Ye, Qiang; Pu, Yuan-Hua; Yang, Xiao-Yu; Luo, Jian-Xun; Zhang, Nian-Zhang; Zhang, De-Lin

2014-09-28

Toxoplasma gondii is a zoonotic pathogen that can infect a range of animals and humans. Ingestion of T. gondii oocysts in soil is a significant transmission route for humans and animals acquiring toxoplasmosis. In the present study, we developed a new semi-nested PCR method to determine T. gondii oocysts distribution in soils in northwestern China. The one tube semi-nested PCR assay was developed to detect the oocysts of T. gondii in soil, targeting the repetitive 529 bp fragment of T. gondii genomic DNA. Then a total of 268 soil samples, including 148 samples from Gansu Province and 120 samples from Qinghai Province, northwestern China, were examined by the semi-nested PCR method. One third of the positive samples were sequenced. The sensitivity of the semi-nested PCR assay was 10(2)  T. gondii oocysts in 5 g soil sample. Investigation of soil samples from northwestern China showed that 34 out of 268 soil samples (12.69%) were T. gondii positive. Sequences of the partial 529 bp fragments varied from 0-1.2% among the sequenced samples. The prevalence of T. gondii oocysts in soil from cities (24/163) was slightly higher than that in soils from pasturing areas (10/105) (P = 0.21). Among the different regions in cities, the prevalence of T. gondii oocysts in soils from parks was 14.15%, whereas that in soils from schools was 19.05%. The present study firstly reported the prevalence of T. gondii oocysts in soils in northwest China using a novel semi-nested PCR assay, which provided baseline data for the effective prevention and control of toxoplasmosis in this region.

Real-time multiplex PCR assay for detection of Yersinia pestis and Yersinia pseudotuberculosis.

Science.gov (United States)

Matero, Pirjo; Pasanen, Tanja; Laukkanen, Riikka; Tissari, Päivi; Tarkka, Eveliina; Vaara, Martti; Skurnik, Mikael

2009-01-01

A multiplex real-time polymerase chain reaction (PCR) assay was developed for the detection of Yersinia pestis and Yersinia pseudotuberculosis. The assay includes four primer pairs, two of which are specific for Y. pestis, one for Y. pestis and Y. pseudotuberculosis and one for bacteriophage lambda; the latter was used as an internal amplification control. The Y. pestis-specific target genes in the assay were ypo2088, a gene coding for a putative methyltransferase, and the pla gene coding for the plasminogen activator. In addition, the wzz gene was used as a target to specifically identify both Y. pestis and the closely related Y. pseudotuberculosis group. The primer and probe sets described for the different genes can be used either in single or in multiplex PCR assays because the individual probes were designed with different fluorochromes. The assays were found to be both sensitive and specific; the lower limit of the detection was 10-100 fg of extracted Y. pestis or Y. pseudotuberculosis total DNA. The sensitivity of the tetraplex assay was determined to be 1 cfu for the ypo2088 and pla probe labelled with FAM and JOE fluorescent dyes, respectively.

Capsular typing of Streptococcus agalactiae (Lancefield group B streptococci) from fish using multiplex PCR and serotyping

Science.gov (United States)

Streptococcus spp. including Streptococcus agalactiae (Lancefield group B streptococci) are considered emerging pathogens responsible for approximately $1 billion USD in annual losses to the global tilapia (Oreochromis sp.) aquaculture industry. This study evaluated a published multiplex PCR capsul...

The Prevalence of Pneumocystis jiroveci in Bronchoalveolar Lavage Specimens of Lung Transplant Recipients Examined by the Nested PCR.

Science.gov (United States)

Izadi, Morteza; Jonaidi Jafari, Nematollah; Sadraei, Javid; Mahmoodzadeh Poornaki, Abbas; Rezavand, Babak; Zarrinfar, Hossein; Abdi, Jahangir; Mohammadi, Younes

2014-12-01

The use of immune suppressive drugs for organ transplant recipients predisposes them to opportunistic infections, especially by fungal agents. Pneumocystis jiroveci, as an opportunistic pathogen, endangers the patients' life in those with immune system disorders. Early detection of latent Pneumocystis infection in susceptible patients may help choose the optimal treatment for these patients. The aim of this study was to identify and determine the colonization of latent P. jiroveci infection among lung transplant recipients. This cross-sectional descriptive study was conducted on lung transplant recipients. Bronchoalveolar lavage (BAL) specimens were collected from 32 patients undergoing bronchoscopy. The samples were aseptically homogenized by 10 mM dithiothreitol, and their DNA was extracted. The mtLSUrRNA gene of P. jiroveci was amplified using nested PCR in two stages. Nested PCR was performed using external primers of pAZ-102-E and pAZ102-H followed by using the PCR product of the first stage and internal primers of pAZ-102-E and pAZ102-L2. The genome of P. jiroveci was revealed by a 346 bp PCR product in the initial amplification and a 120 bp product in the nested PCR. The results showed that seven BAL specimens (21.9%) from lung transplant recipients were positive for P. jiroveci. In molecular epidemiology studies, nested PCR has higher sensitivity than PCR. Results of this study support the colonization of P. jiroveci in patients receiving lung transplantation. Patients who are carriers of P. jiroveci are at a higher risk of P. jiroveci pneumonia.

A Multiplex PCR for Detection of Mycoplasma pneumoniae, Chlamydophila pneumoniae, Legionella pneumophila, and Bordetella pertussis in Clinical Specimens

National Research Council Canada - National Science Library

McDonough, E. A; Barrozo, C. P; Russell, K. L; Metzgar, D

2005-01-01

A multiplex PCR was developed that is capable of detecting four of the most important bacterial agents of atypical pneumophia, Mycaplasma pneumoniae, Chlamydophia pneumoniae, Legionella pneumophila...

A Multiplex PCR for Simultaneous Detection of Three Zoonotic Parasites Ancylostoma ceylanicum, A. caninum, and Giardia lamblia Assemblage A

Directory of Open Access Journals (Sweden)

Wei Hu

2015-01-01

Full Text Available Ancylostoma ceylanicum, A. caninum, and Giardia lamblia assemblage A are common intestinal parasites of dogs and cats; they can also infect humans, causing parasitic zoonoses. In this study, a multiplex PCR method was developed for simultaneous identification and detection of those three zoonotic parasites. Three pairs of specific primers were designed based on ITS sequence of A. ceylanicum and A. caninum and TPI gene of G. lamblia available in the GenBank. The multiplex PCR reaction system was established by optimizing the reaction condition, and a series of tests on the sensitivity, specificity, and clinical application were also conducted. Results showed that three target fragments were amplified specifically; the detection limit was 10 eggs for both A. ceylanicum and A. caninum, 72 pg DNA for G. lamblia. Of 112 clinical fecal samples, 34.8% and 17.8% samples were positive for A. caninum and A. ceylanicum, respectively, while only 2.7% samples were positive for G. lamblia assemblage A. It is concluded that the established multiplex PCR assay is a convenient, rapid, cost-effective, and high-efficiency method for molecular detection and epidemiological investigation of three zoonotic parasites.

Rapid Identification of Pathogenic Fungi Directly from Cultures by Using Multiplex PCR

OpenAIRE

Luo, Guizhen; Mitchell, Thomas G.

2002-01-01

A multiplex PCR method was developed to identify simultaneously multiple fungal pathogens in a single reaction. Five sets of species-specific primers were designed from the internal transcribed spacer (ITS) regions, ITS1 and ITS2, of the rRNA gene to identify Candida albicans, Candida glabrata, Candida parapsilosis, Candida tropicalis, and Aspergillus fumigatus. Another set of previously published ITS primers, CN4 and CN5, were used to identify Cryptococcus neoformans. Three sets of primers w...

Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice.

Science.gov (United States)

Cui, Z; Ojaghian, M R; Tao, Z; Kakar, K U; Zeng, J; Zhao, W; Duan, Y; Vera Cruz, C M; Li, B; Zhu, B; Xie, G

2016-05-01

The aim of this study was to develop a multiplex PCR (mPCR) assay for rapid, sensitive and simultaneous detection of six important rice pathogens: Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, Pseudomonas fuscovaginae, Burkholderia glumae, Burkholderia gladioli and Acidovorax avenae subsp. avenae. Specific primers were designed through a bioinformatics pipeline. Sensitivity of detection was established using both traditional PCR and quantitative real-time PCR on isolated DNA and on bacterial cells both in vitro and in simulated diseased seeds and the parameters were optimized for an mPCR assay. A total of 150 bacterial strains were tested for specificity. The mPCR assay accurately predicted the presence of pathogens among 44 symptomatic and asymptomatic rice seed, sheath and leaf samples. This study confirmed that this mPCR assay is a rapid, reliable and simple tool for the simultaneous detection of six important rice bacterial pathogens. This study is the first report of a method allowing simultaneous detection of six major rice pathogens. The ability to use crude extracts from plants without bacterial isolation or DNA extraction enhances the value of this mPCR technology for rapid detection and aetiological/epidemiological studies. © 2016 The Society for Applied Microbiology.

Whole-Blood Nested-PCR Amplification of M. leprae-Specific DNA for Early Diagnosis of Leprosy

Science.gov (United States)

Wen, Yan; Xing, Yan; Yuan, Lian-Chao; Liu, Jian; Zhang, Ying; Li, Huan-Ying

2013-01-01

We evaluated the sensitivity and specificity of a nested-polymerase chain reaction (PCR) method for detection of Mycobacterium leprae DNA from whole blood. Whole-blood specimens were subjected to nested-PCR amplification of M. leprae repeat DNA sequences in 49 multibacillary (MB) and 30 paucibacillary (PB) leprosy patients, 96 household contacts (HHCs), 18 tuberculosis (TB) patients, and 35 normal healthy individuals. M. leprae DNA was detected in 95.92% (47/49) of MB, 70% (21/30) of PB, and 6.25% (6/96) of HHC, but it was not detected in 18 TB or 35 normal controls. The sensitivities of the anti-bovine serum albumin (ND-O-BSA) immunoglobulin M (IgM) and antifusion protein of ML0405-ML2331 IgG for MB were 97.96% and 89.8%, and these values for PB were 70% and 53.33%. However, the ND-O-BSA enzyme-linked immunosorbent assay (ELISA) had lower specificity, with relatively high false-positive results for TB patients (16.67%) and normal healthy controls (10%). Based on these promising findings, we propose the use of nested PCR of whole-blood samples along with ELISA test for early detection of leprosy cases. PMID:23478578

Rapid and sensitive PCR-dipstick DNA chromatography for multiplex analysis of the oral microbiota.

Science.gov (United States)

Tian, Lingyang; Sato, Takuichi; Niwa, Kousuke; Kawase, Mitsuo; Tanner, Anne C R; Takahashi, Nobuhiro

2014-01-01

A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

Rapid and Sensitive PCR-Dipstick DNA Chromatography for Multiplex Analysis of the Oral Microbiota

Directory of Open Access Journals (Sweden)

Lingyang Tian

2014-01-01

Full Text Available A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

Nested PCR and RFLP analysis based on the 16S rRNA gene

Science.gov (United States)

Current phytoplasma detection and identification method is primarily based on nested PCR followed by restriction fragment length polymorphism analysis and gel electrophoresis. This method can potentially detect and differentiate all phytoplasmas including those previously not described. The present ...

Malaria diagnosis from pooled blood samples: comparative analysis of real-time PCR, nested PCR and immunoassay as a platform for the molecular and serological diagnosis of malaria on a large-scale

Directory of Open Access Journals (Sweden)

Giselle FMC Lima

2011-09-01

Full Text Available Malaria diagnoses has traditionally been made using thick blood smears, but more sensitive and faster techniques are required to process large numbers of samples in clinical and epidemiological studies and in blood donor screening. Here, we evaluated molecular and serological tools to build a screening platform for pooled samples aimed at reducing both the time and the cost of these diagnoses. Positive and negative samples were analysed in individual and pooled experiments using real-time polymerase chain reaction (PCR, nested PCR and an immunochromatographic test. For the individual tests, 46/49 samples were positive by real-time PCR, 46/49 were positive by nested PCR and 32/46 were positive by immunochromatographic test. For the assays performed using pooled samples, 13/15 samples were positive by real-time PCR and nested PCR and 11/15 were positive by immunochromatographic test. These molecular methods demonstrated sensitivity and specificity for both the individual and pooled samples. Due to the advantages of the real-time PCR, such as the fast processing and the closed system, this method should be indicated as the first choice for use in large-scale diagnosis and the nested PCR should be used for species differentiation. However, additional field isolates should be tested to confirm the results achieved using cultured parasites and the serological test should only be adopted as a complementary method for malaria diagnosis.

Sensitive detection of Treponema pallidum DNA from the whole blood of patients with syphilis by the nested PCR assay.

Science.gov (United States)

Wang, Cuini; Cheng, Yuanyuan; Liu, Biao; Wang, Yuanyuan; Gong, Weiming; Qian, Yihong; Guan, Zhifang; Lu, Haikong; Gu, Xin; Shi, Mei; Zhou, Pingyu

2018-05-09

The aim of this work was to investigate the application of the nested PCR assay for the detection of Treponema pallidum (TP) DNA from the blood of patients with different stages of syphilis. In this study, a nested PCR method targeting the Tpp47 and polA genes (Tpp47-Tp-PCR and polA-Tp-PCR) was developed to detect TP-DNA in whole blood samples collected from 262 patients with different stages of syphilis (84 primary syphilis, 97 secondary syphilis, and 81 latent syphilis patients). The PCR assay detected T. pallidum DNA in 53.6% and 62.9% of the patients with primary and secondary syphilis, respectively, which was much higher than the detection levels in patients with latent syphilis (7.4%) (both p PCR in the early phase of the latent infection. Thus, blood RPR titers were correlated with the blood T. pallidum burden, but the correlations varied with primary and secondary syphilis. The results indicate that nested PCR is a sensitive method for detecting blood TP-DNA and is especially useful for detecting early syphilis including primary syphilis and secondary syphilis. The findings also suggest that the PCR assay may be used to complement other methods to enhance the diagnosis of syphilis.

Novel approach based on one-tube nested PCR and a lateral flow strip for highly sensitive diagnosis of tuberculous meningitis.

Science.gov (United States)

Sun, Yajuan; Chen, Jiajun; Li, Jia; Xu, Yawei; Jin, Hui; Xu, Na; Yin, Rui; Hu, Guohua

2017-01-01

Rapid and sensitive detection of Mycobacterium tuberculosis (M. Tb) in cerebrospinal fluid is crucial in the diagnosis of tuberculous meningitis (TBM), but conventional diagnostic technologies have limited sensitivity and specificity or are time-consuming. In this work, a novel, highly sensitive molecular diagnostic method, one-tube nested PCR-lateral flow strip test (OTNPCR-LFST), was developed for detecting M. tuberculosis. This one-tube nested PCR maintains the sensitivity of conventional two-step nested PCR and reduces both the chance of cross-contamination and the time required for analysis. The PCR product was detected by a lateral flow strip assay, which provided a basis for migration of the test to a point-of-care (POC) microfluidic format. The developed assay had an improved sensitivity compared with traditional PCR, and the limit of detection was up to 1 fg DNA isolated from M. tuberculosis. The assay was also specific for M. tuberculosis, and no cross-reactions were found in other non-target bacteria. The application of this technique to clinical samples was successfully evaluated, and OTNPCR-LFST showed 89% overall sensitivity and 100% specificity for TBM patients. This one-tube nested PCR-lateral flow strip assay is useful for detecting M. tuberculosis in TBM due to its rapidity, high sensitivity and simple manipulation.

Clinical application of RT-nested PCR integrated with RFLP in Hantavirus detection and genotyping: a prospective study in Shandong Province, PR China.

Science.gov (United States)

Liu, Yun-Xi; Zhao, Zhong-Tang; Cao, Wu-Chun; Xu, Xiao-Qun; Suo, Ji-Jiang; Xing, Yu-Bin; Jia, Ning; Du, Ming-Mei; Liu, Bo-Wei; Yao, Yuan

2013-01-01

The aim of the present study was to evaluate the clinical usefulness of applying RT-nested PCR along with RFLP as a method for diagnosis and genotypic differentiation of Hantavirus in the acute-stage sera of HFRS patients as compared to the ELISA technique. A prospective study of patients with suspected HFRS patients was carried out. Sera were collected for serological evaluation by ELISA and RT-nested PCR testing. Primers were selected from the published sequence of the S segment of HTNV strain 76-118 and SEOV strain SR-11, which made it possible to obtain an amplicon of 403 bp by RT-nested PCR. The genotypic differentiations of the RT-nested PCR amplicons were carried out by RFLP. Sequence analyses of the amplicons were used to confirm the accuracy of the results obtained by RFLP. Of the 48 acute-stage sera from suspected HFRS patients, 35 were ELISA-positive while 41 were positive by RT-nested PCR. With Hind III and Hinf I, RFLP profiles of the RT-nested PCR amplicons of the 41 positive sera exhibited two patterns. 33 had RFLP profiles similar to the reference strain R22, and thus belonged to the SEOV type. The other 8 samples which were collected during October-December had RFLP profiles similar to the reference strain 76-118, and thus belonged to the HTNV type. Sequence phylogenetic analysis of RT-nested PCR amplicons revealed sdp1, sdp2 YXL-2008, and sdp3 as close relatives of HTNV strain 76-118, while sdp22 and sdp37 as close relatives of SEOV strain Z37 and strain R22 located in two separate clusters in the phylogenetic tree. These results were identical to those acquired by RFLP. RT-nested PCR integrated with RFLP was a rapid, simple, accurate method for detecting and differentiating the genotypes of Hantavirus in the acute-stage sera of suspected HFRS patients. In Shandong province, the main genotypes of Hantavirus belonged to the SEOV types, while the HTNV types were observed during the autumn-winter season.

Development of a multiplex real-time PCR assay for phylogenetic analysis of Uropathogenic Escherichia coli.

Science.gov (United States)

Hasanpour, Mojtaba; Najafi, Akram

2017-06-01

Uropathogenic Escherichia coli (UPEC) is among major pathogens causing 80-90% of all episodes of urinary tract infections (UTIs). Recently, E. coli strains are divided into eight main phylogenetic groups including A, B1, B2, C, D, E, F, and clade I. This study was aimed to develop a rapid, sensitive, and specific multiplex real time PCR method capable of detecting phylogenetic groups of E. coli strains. This study was carried out on E. coli strains (isolated from the patient with UTI) in which the presence of all seven target genes had been confirmed in our previous phylogenetic study. An EvaGreen-based singleplex and multiplex real-time PCR with melting curve analysis was designed for simultaneous detection and differentiation of these genes. The primers were selected mainly based on the production of amplicons with melting temperatures (T m ) ranging from 82°C to 93°C and temperature difference of more than 1.5°C between each peak.The multiplex real-time PCR assays that have been developed in the present study were successful in detecting the eight main phylogenetic groups. Seven distinct melting peaks were discriminated, with Tm value of 93±0.8 for arpA, 89.2±0.1for chuA, 86.5±0.1 for yjaA, 82.3±0.2 for TspE4C2, 87.8±0.1for trpAgpC, 85.4±0.6 for arpAgpE genes, and 91±0.5 for the internal control. To our knowledge, this study is the first melting curve-based real-time PCR assay developed for simultaneous and discrete detection of these seven target genes. Our findings showed that this assay has the potential to be a rapid, reliable and cost-effective alternative for routine phylotyping of E. coli strains. Copyright © 2017 Elsevier B.V. All rights reserved.

Development of Nested PCR-Based Specific Markers for Detection of Peach Rosette Mosaic Virus in Plant Quarantine.

Science.gov (United States)

Lee, S; Kim, C S; Shin, Y G; Kim, J H; Kim, Y S; Jheong, W H

2016-03-01

The Peach rosette mosaic virus (PRMV) is a plant pathogen of the genus Nepovirus, and has been designated as a controlled quarantine virus in Korea. In this study, a specific reverse transcription (RT)-PCR marker set, nested PCR marker set, and modified-plasmid positive control were developed to promptly and accurately diagnose PRMV at plant-quarantine sites. The final selected PRMV-specific RT-PCR marker was PRMV-N10/C70 (967 bp), and the nested PCR product of 419 bp was finally amplified. The modified-plasmid positive control, in which the SalI restriction-enzyme region (GTCGAC) was inserted, verified PRMV contamination in a comparison with the control, enabling a more accurate diagnosis. It is expected that the developed method will continuously contribute to the plant-quarantine process in Korea.

Development of a novel single tube nested PCR for enhanced detection of cytomegalovirus DNA from dried blood spots.

Science.gov (United States)

Atkinson, C; Emery, V C; Griffiths, P D

2014-02-01

Newborn screening for congenital cytomegalovirus (CCMV) using dried blood spots (DBS) has been proposed because many developed countries have DBS screening programmes in place for other diseases. The aim of this study was to develop a rapid, single tube nested polymerase chain reaction (PCR) method for enhanced detection of CMV from DBS compared to existing (single target) real time PCRs. The new method was compared with existing real time PCRs for sensitivity and specificity. Overall sensitivity of the single target PCR assays in both asymptomatic and symptomatic infants with laboratory confirmed congenital CMV was 69% (CMV PCR or culture positive before day 21 of life). In contrast, the single tube nested assay had an increased sensitivity of 81% with100% specificity. Overall the assay detected CMV from a DBS equivalent to an original blood sample which contained 500IU/ml. In conclusion this single tube nested methodology allows simultaneous amplification and detection of CMV DNA in 1.5h removing the associated contamination risk of a two step nested PCR. Owing to its increased sensitivity, it has the potential to be used as a screening assay and ultimately allow early identification and intervention for children with congenital CMV. Copyright © 2013 Elsevier B.V. All rights reserved.

Sensitive simultaneous detection of seven sexually transmitted agents in semen by multiplex-PCR and of HPV by single PCR.

Directory of Open Access Journals (Sweden)

Fabrícia Gimenes

Full Text Available Sexually transmitted diseases (STDs may impair sperm parameters and functions thereby promoting male infertility. To date limited molecular studies were conducted to evaluate the frequency and type of such infections in semen Thus, we aimed at conceiving and validating a multiplex PCR (M-PCR assay for the simultaneous detection of the following STD pathogens in semen: Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, Herpes virus simplex (HSV -1 and -2, and Treponema pallidum; We also investigated the potential usefulness of this M-PCR assay in screening programs for semen pathogens. In addition, we aimed: to detect human Papillomavirus (HPV and genotypes by single PCR (sPCR in the same semen samples; to determine the prevalence of the seven STDs, HPV and co-infections; to assess the possibility that these infections affect semen parameters and thus fertility. The overall validation parameters of M-PCR were extremely high including agreement (99.2%, sensitivity (100.00%, specificity (99.70%, positive (96.40% and negative predictive values (100.00% and accuracy (99.80%. The prevalence of STDs was very high (55.3%. Furthermore, associations were observed between STDs and changes in semen parameters, highlighting the importance of STD detection in semen. Thus, this M-PCR assay has great potential for application in semen screening programs for pathogens in infertility and STD clinics and in sperm banks.

Development and Validation of a Multiplex PCR-Based Assay for the Upper Respiratory Tract Bacterial Pathogens Haemophilus influenzae, Streptococcus pneumoniae, and Moraxella catarrhalis.

Science.gov (United States)

Post; White; Aul; Zavoral; Wadowsky; Zhang; Preston; Ehrlich

1996-06-01

indicate a detection limit of 10 femtograms (fg)(6-7 genomic equivalents) or less of genomic DNA for each of the three microorganisms regardless of the presence of irrelevant DNA. Conclusions: The reliance on individual, robust, species-specific primers and the avoidance of a nested PCR approach make this bacterial multiplex assay suitable for use in the clinical laboratory. This assay has proved useful in both research and patient care applications.

Detection of hepatitis A virus in shellfish by nested reverse transcription-PCR

NARCIS (Netherlands)

Croci, L.; Medici, de D.; Morace, G.; Fiore, A.; Scalfaro, C.; Beneduce, F.; Toti, L.

1999-01-01

A method for the detection of HAV in shellfish, based on the use of guanidinium isothiocyanate-contg. soln. for RNA extn. and purifn. steps, followed by nested PCR, is hereby proposed. Tests were carried out on mollusc samples spiked with HAV strain FG. Results showed that in samples subjected only

Rapid detection of bovine coronavirus by a semi-nested RT-PCR Detecção rápida do Coronavírus Bovino (BCoV por meio de uma semi-nested RT-PCR

Directory of Open Access Journals (Sweden)

Karen M. Asano

2009-11-01

Full Text Available Bovine coronavirus (BCoV is a member of the group 2 of the Coronavirus (Nidovirales: Coronaviridae and the causative agent of enteritis in both calves and adult bovine, as well as respiratory disease in calves. The present study aimed to develop a semi-nested RT-PCR for the detection of BCoV based on representative up-to-date sequences of the nucleocapsid gene, a conserved region of coronavirus genome. Three primers were designed, the first round with a 463bp and the second (semi-nested with a 306bp predicted fragment. The analytical sensitivity was determined by 10-fold serial dilutions of the BCoV Kakegawa strain (HA titre: 256 in DEPC treated ultra-pure water, in fetal bovine serum (FBS and in a BCoV-free fecal suspension, when positive results were found up to the 10-2, 10-3 and 10-7 dilutions, respectively, which suggests that the total amount of RNA in the sample influence the precipitation of pellets by the method of extraction used. When fecal samples was used, a large quantity of total RNA serves as carrier of BCoV RNA, demonstrating a high analytical sensitivity and lack of possible substances inhibiting the PCR. The final semi-nested RT-PCR protocol was applied to 25 fecal samples from adult cows, previously tested by a nested RT-PCR RdRp used as a reference test, resulting in 20 and 17 positives for the first and second tests, respectively, and a substantial agreement was found by kappa statistics (0.694. The high sensitivity and specificity of the new proposed method and the fact that primers were designed based on current BCoV sequences give basis to a more accurate diagnosis of BCoV-caused diseases, as well as to further insights on protocols for the detection of other Coronavirus representatives of both Animal and Public Health importance.O Coronavírus bovino (BCoV pertence ao grupo 2 do gênero Coronavirus (Nidovirales: Coronaviridae e é agente causador de enterites tanto em bezerros como em bovinos adultos, bem como de doen

Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

Directory of Open Access Journals (Sweden)

Wang Zhen

2011-11-01

Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

A multiplex PCR for detection of knockdown resistance mutations, V1016G and F1534C, in pyrethroid-resistant Aedes aegypti.

Science.gov (United States)

Saingamsook, Jassada; Saeung, Atiporn; Yanola, Jintana; Lumjuan, Nongkran; Walton, Catherine; Somboon, Pradya

2017-10-10

Mutation of the voltage-gated sodium channel (VGSC) gene, or knockdown resistance (kdr) gene, is an important resistance mechanism of the dengue vector Aedes aegypti mosquitoes against pyrethroids. In many countries in Asia, a valine to glycine substitution (V1016G) and a phenylalanine to cysteine substitution (F1534C) are common in Ae. aegypti populations. The G1016 and C1534 allele frequencies have been increasing in recent years, and hence there is a need to have a simple and inexpensive tool to monitor the alleles in large scale. A multiplex PCR to detect V1016G and F1534C mutations has been developed in the current study. This study utilized primers from previous studies for detecting the mutation at position 1016 and newly designed primers to detect variants at position 1534. The PCR conditions were validated and compared with DNA sequencing using known kdr mutant laboratory strains and field collected mosquitoes. The efficacy of this method was also compared with allele-specific PCR (AS-PCR). The results of our multiplex PCR were in complete agreement with sequencing data and better than the AS-PCR. In addition, the efficiency of two non-toxic DNA staining dyes, Ultrapower™ and RedSafe™, were evaluated by comparing with ethidium bromide (EtBr) and the results were satisfactory. Our multiplex PCR method is highly reliable and useful for implementing vector surveillance in locations where the two alleles co-occur.

Detection of four important Eimeria species by multiplex PCR in a single assay.

Science.gov (United States)

You, Myung-Jo

2014-06-01

The oocysts of some of the recognized species of chicken coccidiosis are difficult to distinguish morphologically. Diagnostic laboratories are increasingly utilizing DNA-based technologies for the specific identification of Eimeria species. This study reports a multiplex polymerase chain reaction (PCR) assay based on internal transcribed spacer-1 (ITS-1) for the simultaneous diagnosis of the Eimeria tenella, Eimeria acervulina, Eimeria maxima, and Eimeria necatrix species, which infect domestic fowl. Primer pairs specific to each species were designed in order to generate a ladder of amplification products ranging from 20 to 25 bp, and a common optimum annealing temperature for these species was determined to be 52.5 °C. Sensitivity tests were performed for each species, showing a detection threshold of 1-5 pg. All the species were amplified homogeneously, and a homogenous band ladder was observed, indicating that the assay permitted the simultaneous detection of all the species in a single-tube reaction. In the phylogenic study, there was a clear species clustering, which was irrespective of geographical location, for all the ITS-1 sequences used. This multiplex PCR assay represents a rapid and potential cost-effective diagnostic method for the detection of some key Eimeria species that infect domestic fowl. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Nested-PCR real time as alternative molecular tool for detection of Borrelia burgdorferi compared to the classical serological diagnosis of the blood.

Science.gov (United States)

Sroka-Oleksiak, Agnieszka; Ufir, Krzysztof; Salamon, Dominika; Bulanda, Malgorzata; Gosiewski, Tomasz

Lyme disease, caused by Borrelia burgdorferi, is a multisystem disease that often makes difficulties to recognize caused by their genetic heterogenity. Currently, the gold standard for the detection of Lyme disease (LD) is serologic diagnostics based mainly on tests: ELISA and Western blot (WB). These methods, however, are subject to consider- able defect, especially in the initial phase of infection due to the occurrence of so-called serological window period and low specificity. For this reason, they might be replaced by molecular methods, for example polymerase chain reaction (PCR), which should be more sensitivity and specificity. In the present study we attempt to optimize the PCR reaction conditions and enhance existing test sensitivity by applying the equivalent of real time PCR - nested PCR for detection B. burgdorferi DNA in the patient's blood. The study involved 94 blood samples of patients with suspected LD. From each sample, 1.5 ml of blood was used for the isolation of bacterial DNA and PCR real time am- plification and its equivalent, in nested version. The remaining part earmarked for serologi- cal testing. Optimization of the reaction conditions made experimentally, using gradient of the temperature and gradient of the magnesium ions concentration for reaction real time in nested-PCR and PCR version. The results show that the nested-PCR real time, has a much higher sensitivity 45 (47.8%) of positive results for the detection of B. burgdorferi compared to the single- variety, without a preceding pre-amplification 2 (2.1%). Serological methods allowed the detection of infection in 41 (43.6%) samples. These results support of the nested PCR method as a better molecular tool for the detection of B. burgdorferi infection than classical PCR real time reaction. The nested-PCR real time method may be considered as a complement to ELISA and WB mainly in the early stages of infection, when in the blood circulating B. burgdorferi cells. By contrast, the

Multiplex PCR for rapid diagnosis and differentiation of pox and pox-like diseases in dromedary Camels.

Science.gov (United States)

Khalafalla, Abdelmalik I; Al-Busada, Khalid A; El-Sabagh, Ibrahim M

2015-07-07

Pox and pox-like diseases of camels are a group of exanthematous skin conditions that have become increasingly important economically. Three distinct viruses may cause them: camelpox virus (CMLV), camel parapox virus (CPPV) and camelus dromedary papilloma virus (CdPV). These diseases are often difficult to differentiate based on clinical presentation in disease outbreaks. Molecular methods such as PCR targeting species-specific genes have been developed and used to identify these diseases, but not simultaneously in a single tube. Recently, multiplex PCR has gained reputation as a convenient diagnostic method with cost-and timesaving benefits. In the present communication, we describe the development, optimization and validation of a multiplex PCR assay able to detect simultaneously the genome of the three viruses in one single test allowing for rapid and efficient molecular diagnosis. The assay was developed based on the evaluation and combination of published and new primer sets and was validated with viral genomic DNA extracted from known virus strains (n = 14) and DNA extracted from homogenized clinical skin specimens (n = 86). The assay detects correctly the target pathogens by amplification of targeted genes, even in case of co-infection. The method showed high sensitivity, and the specificity was confirmed by PCR-product sequencing. This assay provide rapid, sensitive and specific method for identifying three important viruses in specimens collected from dromedary camels with varying clinical presentations.

A new multiplex PCR for easy screening of methicillin-resistant Staphylococcus aureus SCCmec types I-V

DEFF Research Database (Denmark)

Boye, Kit; Bartels, Mette Damkjær; Andersen, Ina S

2007-01-01

A multiplex PCR with four primer-pairs was designed to identify the five main known SCCmec types. A clear and easily discriminated band pattern was obtained for all five types. The SCCmec type was identified for 98% of 312 clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA...

Thermally multiplexed polymerase chain reaction.

Science.gov (United States)

Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

2015-07-01

Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

Hemi-Intravascular Stenting for Supermicrosurgical Anastomosis

OpenAIRE

Kensuke Tashiro, MD; Shuji Yamashita, MD; Mitsunaga Narushima, MD; Isao Koshima, MD; Shimpei Miyamoto, MD

2017-01-01

Background:. Although supermicrosurgical anastomosis is a widely known reconstructive microsurgical technique, it is difficult to perform. To expand the clinical use of supermicrosurgery, we used hemi-intravascular stenting (hemi-IVaS), which is performed by inserting an intravascular stent into one side of the vessel. We conducted lymphaticovenular anastomosis, free perforator flap transfer, and fingertip replantation with supermicrosurgical anastomosis using hemi-IVaS technique and examined...

Multiplex real-time PCR for detection, identification and quantification of 'Candidatus Liberibacter solanacearum' in potato plants with zebra chip.

Science.gov (United States)

Li, Wenbin; Abad, Jorge A; French-Monar, Ronald D; Rascoe, John; Wen, Aimin; Gudmestad, Neil C; Secor, Gary A; Lee, Ing-Ming; Duan, Yongping; Levy, Laurene

2009-07-01

The new Liberibacter species, 'Candidatus Liberibacter solanacearum' (Lso) recently associated with potato/tomato psyllid-transmitted diseases in tomato and capsicum in New Zealand, was found to be consistently associated with a newly emerging potato zebra chip (ZC) disease in Texas and other southwestern states in the USA. A species-specific primer LsoF was developed for both quantitative real-time PCR (qPCR) and conventional PCR (cPCR) to detect and quantify Lso in infected samples. In multiplex qPCR, a plant cytochrome oxidase (COX)-based probe-primer set was used as a positive internal control for host plants, which could be used to reliably access the DNA extraction quality and to normalize qPCR data for accurate quantification of the bacterial populations in environment samples. Neither the qPCR nor the cPCR using the primer and/or probe sets with LsoF reacted with other Liberibacter species infecting citrus or other potato pathogens. The low detection limit of the multiplex qPCR was about 20 copies of the target 16S rDNA templates per reaction for field samples. Lso was readily detected and quantified in various tissues of ZC-affected potato plants collected from fields in Texas. A thorough but uneven colonization of Lso was revealed in various tissues of potato plants. The highest Lso populations were about 3x10(8) genomes/g tissue in the root, which were 3-order higher than those in the above-ground tissues of potato plants. The Lso bacterial populations were normally distributed across the ZC-affected potato plants collected from fields in Texas, with 60% of ZC-affected potato plants harboring an average Lso population from 10(5) to 10(6) genomes/g tissue, 4% of plants hosting above 10(7) Lso genomes/g tissue, and 8% of plants holding below 10(3) Lso genomes/g tissue. The rapid, sensitive, specific and reliable multiplex qPCR showed its potential to become a powerful tool for early detection and quantification of the new Liberibacter species associated

A novel RT-multiplex PCR for enteroviruses, hepatitis A and E viruses and influenza A virus among infants and children with diarrhea in Vietnam.

Science.gov (United States)

Phan, T G; Nguyen, T A; Yan, H; Okitsu, S; Ushijima, H

2005-06-01

A novel reverse transcription-multiplex polymerase chain reaction (RT-multiplex PCR) assay that can detect enteroviruses, hepatitis A and E viruses and influenza A virus from various hosts (avian species, human, swine and horse) was developed. The identification of that group of viruses was performed with the mixture of four pairs of published specific primers (F1 and R1, P3 and P4, 2s and 2as, MMU42 and MMU43) for amplifying viral genomes and specifically generated four different amplicon sizes of 440, 267, 146 and 219 bp for enteroviruses, hepatitis A and E viruses and influenza A virus, respectively. A total of 276 fecal specimens (previously screened for rotavirus, adenovirus, norovirus, sapovirus and astrovirus-negative) from infants and children admitted into hospital with acute gastroenteritis in Ho Chi Minh city, Vietnam during October 2002 and September 2003 were collected and further tested for the presence of those viruses by RT-multiplex PCR. Enteroviruses were identified in 27 specimens and this represented 9.8%. No hepatitis A and E viruses and influenza A virus was found among these subjects. The sensitivity and specificity of RT-multiplex PCR were also assessed and demonstrated the strong validation against RT-monoplex PCR. Taken together, the findings clearly indicated that this novel RT-multiplex PCR is a simple and potential assay for rapid, sensitive, specific and cost-effective laboratory diagnosis to investigate molecular epidemiology of acute gastroenteritis caused by enteroviruses, hepatitis A and E viruses and influenza A virus. This report is the first, to our knowledge, detecting these kinds of viruses in diarrheal feces from infants and children in Vietnam.

Detection of Cryptococcus neoformans DNA in Tissue Samples by Nested and Real-Time PCR Assays

OpenAIRE

Bialek, Ralf; Weiss, Michael; Bekure-Nemariam, Kubrom; Najvar, Laura K.; Alberdi, Maria B.; Graybill, John R.; Reischl, Udo

2002-01-01

Two PCR protocols targeting the 18S rRNA gene of Cryptococcus neoformans were established, compared, and evaluated in murine cryptococcal meningitis. One protocol was designed as a nested PCR to be performed in conventional block thermal cyclers. The other protocol was designed as a quantitative single-round PCR adapted to LightCycler technology. One hundred brain homogenates and dilutions originating from 20 ICR mice treated with different azoles were examined. A fungal burden of 3 × 101 to ...

Validation of the multiplex PCR for identification of Brucella spp.

Directory of Open Access Journals (Sweden)

Lívia de Lima Orzil

2016-05-01

Full Text Available ABSTRACT: A multiplex PCR technique for detection of Brucella spp. in samples of bacterial suspension was validated as a complementary tool in the diagnosis of the disease. This technique allows the characterization of the agent without performing biochemical tests, which greatly reduces the time for a final diagnosis, and provides more security for the analyst by reducing the time of exposure to microorganisms. The validation was performed in accordance with the Manual of Diagnostic Tests from OIE (2008 and following the requirements present in the ABNT NBR ISO/IEC 17025:2005. The mPCR validated in this study identified the different species of Brucella ( Brucella abortus , B. suis , B. ovis e B. melitensis of bacterial suspension obtained from the slaughterhouse samples, as well as distinguished the biovars (1, 2 e 4; 3b, 5, 6 e 9 of B. abortus in grouped form and differentiated the field strains from vaccine strains, as a quick, useful and less expensive technique in diagnosis of brucellosis in Brazil.

Differentiation of five strains of infectious bursal disease virus: Development of a strain-specific multiplex PCR

DEFF Research Database (Denmark)

Kusk, M.; Kabell, Susanne; Jørgensen, Poul Henrik

2005-01-01

and histopathology. Since these methods are laborious and have low specificity alternatives are needed. In the present study, we report the development of a strain-specific multiplex RT-PCR technique, which can detect and differentiate between field strains of IBDV and vaccine virus strains including a so-called hot...

Development of a multiplex methylation-specific PCR as candidate triage test for women with an HPV-positive cervical scrape

International Nuclear Information System (INIS)

Snellenberg, Suzanne; Strooper, Lise MA De; Hesselink, Albertus T; Meijer, Chris JLM; Snijders, Peter JF; Heideman, Daniëlle AM; Steenbergen, Renske DM

2012-01-01

Quantitative methylation-specific PCR (qMSP) analysis for determining the methylation status of (candidate) tumor suppressor genes has potential as objective and valuable test to triage high-risk human papillomavirus (hrHPV) positive women in cervical screening. Particularly combined methylation analysis of a panel of genes shows most promising clinical performance, with sensitivity levels that equal or exceed that of cytology. However, the wide application of such methylation marker panels is hampered by the lack of effective multiplex assays allowing simultaneous methylation detection of various targets in a single reaction. Here, we designed and analyzed a multiplex qMSP assay for three genes whose methylation was previously found to be informative for cervical (pre)cancer (i.e. CADM1, MAL and hsa-miR-124-2) as well as a reference gene β-actin. Based on our experience, we discuss the optimization of the parameters that provide a practical approach towards multiplex qMSP design. Primers and PCR reagents were optimized for multiplex qMSP purposes and the resulting assay was analytically validated on serial dilutions of methylated DNA in unmethylated DNA, and compared with singleplex counterparts on hrHPV-positive cervical scrapings. Upon optimization, including primer redesign and primer limiting assays, the multiplex qMSP showed the same analytical performance as the singleplex qMSPs. A strong correlation between the obtained normalized ratios of the singleplex and multiplex qMSPs on cervical scrapes was found for all three markers: CADM1 (R 2 =0.985), MAL (R 2 =0.986) and hsa-miR-124-2 (R 2 =0.944). Multiplex qMSP offers a promising approach for high-throughput diagnostic analysis of the methylation status of multiple genes, which after proper design and validation can be equally specific, sensitive and reproducible as its singleplex versions

A simplified multiplex PCR assay for fast and easy discrimination of globally distributed staphylococcal cassette chromosome mec types in meticillin-resistant Staphylococcus aureus.

Science.gov (United States)

Ghaznavi-Rad, Ehsanollah; Nor Shamsudin, Mariana; Sekawi, Zamberi; van Belkum, Alex; Neela, Vasanthakumari

2010-10-01

A multiplex PCR assay was developed for the identification of major types and subtypes of staphylococcal cassette chromosome mec (SCCmec) in meticillin-resistant Staphylococcus aureus (MRSA) strains. The method uses a novel 9 valent multiplex PCR plus two primer pairs for S. aureus identification and detection of meticillin resistance. All 389 clinical MRSA isolates from Malaysia and 18 European isolates from the Harmony collection harbouring different SCCmec types that we tested were correctly characterized by our PCR assay. SCCmec type III and V were by far the most common types among both hospital- and community-acquired Malaysian MRSA isolates, with an apparent emergence of MRSA harbouring the IVh type.

Urine-Based Nested PCR for the Diagnosis of Mycobacterium tuberculosis: A Comparative Study Between HIV-Positive and HIV-Negative Patients.

Science.gov (United States)

Jamshidi Makiani, Mahin; Davoodian, Parivash; Baghershiroodi, Mahnaz; Nejatizadeh, Abdol Azim; Fakkhar, Farideh; Zangeneh, Mehrangiz; Jahangiri, Nadia

2016-08-01

While tuberculosis (TB) can be diagnosed by microscopy and culture, the sensitivity of Ziehl-Neelsen staining is variable and culture results require 4 - 8 weeks to be determined. Polymerase chain reaction (PCR) and its modifications, including nested PCR, might be promising methods for the rapid diagnosis of TB. This study aimed to evaluate the performance of nested PCR on urine samples of human immunodeficiency virus (HIV)-positive and -negative patients with different manifestations of clinical TB. In a prospective study, three early-morning urine samples from 100 patients with pulmonary TB (PTB) or extrapulmonary TB (EPTB) were evaluated using a molecular target with insertion element IS6110, specific to the Mycobacterium tuberculosis genome, and nested PCR was performed. The results were analyzed with SPSS version 22. A total of 100 patients, including 74 (74%) with PTB and 26 (26%) with EPTB, were enrolled. Positive smears were seen in 38 patients (38%). Lymph nodes were the most commonly involved organ in 14 of the 26 (53.8%) EPTB patients (13.5%). Seven (23.1%) of the EPTB patients were HIV-positive. Urine PCR was positive in only 28 patients (28%). Seven HIV-positive patients with PTB showed positive urine PCR results. Moreover, PCR results were positive in only one of the seven HIV-positive subjects with EPTB. Positive PCR results were found in 20 of the 73 HIV-negative patients (27.4%) and in 8 of the 27 HIV-positive patients (29.6%). Therefore, there was no significant difference between the HIV-negative and HIV-positive patients for urine PCR (sensitivity 29.6%, specificity 72.6%; positive and negative predictive values 28% and 72%, respectively; P = 0.138). Nested PCR showed the same sensitivity in HIV-positive and HIV-negative patients. It can be applied as a rapid technique for the diagnosis of TB.

A novel enterovirus and parechovirus multiplex one-step real-time PCR-validation and clinical experience.

Science.gov (United States)

Nielsen, Alex Christian Yde; Böttiger, Blenda; Midgley, Sofie Elisabeth; Nielsen, Lars Peter

2013-11-01

As the number of new enteroviruses and human parechoviruses seems ever growing, the necessity for updated diagnostics is relevant. We have updated an enterovirus assay and combined it with a previously published assay for human parechovirus resulting in a multiplex one-step RT-PCR assay. The multiplex assay was validated by analysing the sensitivity and specificity of the assay compared to the respective monoplex assays, and a good concordance was found. Furthermore, the enterovirus assay was able to detect 42 reference strains from all 4 species, and an additional 9 genotypes during panel testing and routine usage. During 15 months of routine use, from October 2008 to December 2009, we received and analysed 2187 samples (stool samples, cerebrospinal fluids, blood samples, respiratory samples and autopsy samples) were tested, from 1546 patients and detected enteroviruses and parechoviruses in 171 (8%) and 66 (3%) of the samples, respectively. 180 of the positive samples could be genotyped by PCR and sequencing and the most common genotypes found were human parechovirus type 3, echovirus 9, enterovirus 71, Coxsackievirus A16, and echovirus 25. During 2009 in Denmark, both enterovirus and human parechovirus type 3 had a similar seasonal pattern with a peak during the summer and autumn. Human parechovirus type 3 was almost invariably found in children less than 4 months of age. In conclusion, a multiplex assay was developed allowing simultaneous detection of 2 viruses, which can cause similar clinical symptoms. Copyright © 2013 Elsevier B.V. All rights reserved.

FIRST MOLECULAR DETECTION AND VP7 (G GENOTYPING OF GROUP A ROTAVIRUS BY SEMI-NESTED RT-PCR FROM SEWAGE IN NIGERIA

Directory of Open Access Journals (Sweden)

Babatunde Olanrewaju MOTAYO

Full Text Available SUMMARY Rotavirus is the leading cause of viral gastroenteritis worldwide, and sewage is a major source of the virus dissemination in the environment. Our aim was to detect and genotype rotaviruses from sewages in Nigeria. One hundred and ninety sewage samples were collected between June 2014 and January 2015. The two phase concentration method using PEG 6000 and dextran was used to concentrate sewage samples following WHO protocols. Molecular detection was performed by RT-PCR, and VP7 genotyping by semi-nested multiplex PCR. A total of 14.2% (n = 27 samples tested positive. Monthly distribution showed that June to September had a lower rate (3.7% to 7.4%, while October to January recorded 11% to 26%. Genotype G1 predominated followed by G8, G9, G4 and lastly G2, 7.4% (n = 2 of isolates were nontypeable. This is the first report of rotavirus detection in sewages from Nigeria. Genotype G1 remains the most prevalent genotype. This observation calls for an effort by the governmental authorities to implement a molecular surveillance, both clinical and environmental, in order to provide vital information for the control and the vaccine efficacy not only in Nigeria, but globally.

Detection of Salmonella in Shellfish Using SYBR Green™ I-Based Real-Time Multiplexed PCR Assay Targeting invA and spvB

KAUST Repository

Gangwar, Maulshree

2012-09-23

A SYBR Green™ I-based real-time multiplexed PCR assay was developed targeting invA and spvB for the detection of Salmonella strains in shellfish after both hns and invA genes were identified in all Salmonella strains. Simultaneously, the 16S rRNA gene was used as a PCR internal amplification control (IAC). All 89 Salmonella strains tested in this study exhibited amplification of invA, whereas only 21 (23. 6 %) were PCR positive for spvB. The sensitivity of detection of all three targeted genes was 1 ng, which is equivalent to approximately 105 colony-forming unit (CFU) of Salmonella enterica. The analysis showed specific PCR products that were identified by reproducible melt temperature profiles (invA, 84. 27 ± 1. 7 °C; spvB, 88. 76 ± 1. 0 °C; and 16S rRNA gene, 87. 16 ± 0. 8 °C). The sensitivity of detection was 10 pg purified DNA (invA) or 105 CFU in 1 mL pure culture of S. enterica ATCC 14028. The above molecular detection method for Salmonella strains was successfully applied to the oyster homogenates (food matrix). An initial inoculum of 106 and 102 CFU Salmonella in 1 ml seeded oyster tissue homogenate was detected by multiplexed PCR for all three genes after 5 and 24 h of enrichment, respectively. Natural oysters isolated from Gulf of Mexico during the winter months exhibited negative PCR amplification results suggesting the absence of Salmonella. In contrast to conventional PCR, real-time multiplex PCR assay developed in this study is rapid and sensitive and will help Interstate Shellfish Sanitation Conference undertake appropriate measures to monitor Salmonella in oysters, thereby preventing disease outbreaks and consequently protecting consumer health. © 2012 Springer Science+Business Media, LLC.

Detection of Salmonella in Shellfish Using SYBR Green™ I-Based Real-Time Multiplexed PCR Assay Targeting invA and spvB

KAUST Repository

Gangwar, Maulshree; Waters, Alicia M.; Bej, Gautam A.; Bej, Asim K.; Mojib, Nazia

2012-01-01

A SYBR Green™ I-based real-time multiplexed PCR assay was developed targeting invA and spvB for the detection of Salmonella strains in shellfish after both hns and invA genes were identified in all Salmonella strains. Simultaneously, the 16S rRNA gene was used as a PCR internal amplification control (IAC). All 89 Salmonella strains tested in this study exhibited amplification of invA, whereas only 21 (23. 6 %) were PCR positive for spvB. The sensitivity of detection of all three targeted genes was 1 ng, which is equivalent to approximately 105 colony-forming unit (CFU) of Salmonella enterica. The analysis showed specific PCR products that were identified by reproducible melt temperature profiles (invA, 84. 27 ± 1. 7 °C; spvB, 88. 76 ± 1. 0 °C; and 16S rRNA gene, 87. 16 ± 0. 8 °C). The sensitivity of detection was 10 pg purified DNA (invA) or 105 CFU in 1 mL pure culture of S. enterica ATCC 14028. The above molecular detection method for Salmonella strains was successfully applied to the oyster homogenates (food matrix). An initial inoculum of 106 and 102 CFU Salmonella in 1 ml seeded oyster tissue homogenate was detected by multiplexed PCR for all three genes after 5 and 24 h of enrichment, respectively. Natural oysters isolated from Gulf of Mexico during the winter months exhibited negative PCR amplification results suggesting the absence of Salmonella. In contrast to conventional PCR, real-time multiplex PCR assay developed in this study is rapid and sensitive and will help Interstate Shellfish Sanitation Conference undertake appropriate measures to monitor Salmonella in oysters, thereby preventing disease outbreaks and consequently protecting consumer health. © 2012 Springer Science+Business Media, LLC.

Multiplex real-time PCR (TaqMan) assay for the simultaneous detection and discrimination of potato powdery and common scab diseases and pathogens.

Science.gov (United States)

Qu, X S; Wanner, L A; Christ, B J

2011-03-01

To develop a multiplex real-time PCR assay using TaqMan probes for the simultaneous detection and discrimination of potato powdery scab and common scab, two potato tuber diseases with similar symptoms, and the causal pathogens Spongospora subterranea and plant pathogenic Streptomyces spp. Real-time PCR primers and a probe for S. subterranea were designed based on the DNA sequence of the ribosomal RNA ITS2 region. Primers and a probe for pathogenic Streptomyces were designed based on the DNA sequence of the txtAB genes. The two sets of primer pairs and probes were used in a single real-time PCR assay. The multiplex real-time PCR assay was confirmed to be specific for S. subterranea and pathogenic Streptomyces. The assay detected DNA quantities of 100 fg for each of the two pathogens and linear responses and high correlation coefficients between the amount of DNA and C(t) values for each pathogen were achieved. The presence of two sets of primer pairs and probes and of plant extracts did not alter the sensitivity and efficiency of multiplex PCR amplification. Using the PCR assay, we could discriminate between powdery scab and common scab tubers with similar symptoms. Common scab and powdery scab were detected in some tubers with no visible symptoms. Mixed infections of common scab and powdery scab on single tubers were also revealed. This multiplex real-time PCR assay is a rapid, cost efficient, specific and sensitive tool for the simultaneous detection and discrimination of the two pathogens on infected potato tubers when visual symptoms are inconclusive or not present. Accurate and quick identification and discrimination of the cause of scab diseases on potatoes will provide critical information to potato growers and researchers for disease management. This is important because management strategies for common and powdery scab diseases are very different. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

Multiplex, Quantitative, Reverse Transcription PCR Detection of Influenza Viruses Using Droplet Microfluidic Technology

Directory of Open Access Journals (Sweden)

Ravi Prakash

2014-12-01

Full Text Available Quantitative, reverse transcription, polymerase chain reaction (qRT-PCR is facilitated by leveraging droplet microfluidic (DMF system, which due to its precision dispensing and sample handling capabilities at microliter and lower volumes has emerged as a popular method for miniaturization of the PCR platform. This work substantially improves and extends the functional capabilities of our previously demonstrated single qRT-PCR micro-chip, which utilized a combination of electrostatic and electrowetting droplet actuation. In the reported work we illustrate a spatially multiplexed micro-device that is capable of conducting up to eight parallel, real-time PCR reactions per usage, with adjustable control on the PCR thermal cycling parameters (both process time and temperature set-points. This micro-device has been utilized to detect and quantify the presence of two clinically relevant respiratory viruses, Influenza A and Influenza B, in human samples (nasopharyngeal swabs, throat swabs. The device performed accurate detection and quantification of the two respiratory viruses, over several orders of RNA copy counts, in unknown (blind panels of extracted patient samples with acceptably high PCR efficiency (>94%. The multi-stage qRT-PCR assays on eight panel patient samples were accomplished within 35–40 min, with a detection limit for the target Influenza virus RNAs estimated to be less than 10 RNA copies per reaction.

Human herpesvirus infections of the central nervous system: laboratory diagnosis based on DNA detection by nested PCR in plasma and cerebrospinal fluid samples.

Science.gov (United States)

Rimério, Carla Aparecida Tavares; De Oliveira, Renato Souza; de Almeida Bonatelli, Murilo Queiroz; Nucci, Anamarli; Costa, Sandra Cecília Botelho; Bonon, Sandra Helena Alves

2015-04-01

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the "gold standard," and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture. © 2015 Wiley Periodicals, Inc.

Efficiency of Nested-PCR in Detecting Asymptomatic Cases toward Malaria Elimination Program in an Endemic Area of Iran.

Directory of Open Access Journals (Sweden)

Habibollah Turki

2015-03-01

Full Text Available The aim of this study was to detect low parasite and asymptomatic malaria infections by means of three malaria diagnostic tests, in a low transmission region of Minab district, Hormozgan Province, southern Iran.Blood samples of 200 healthy volunteers from Bagh-e-Malek area were evaluated using microscopic, rapid diagnostic tests (RDT and nested-PCR to inspect malaria parasite.The results showed no Plasmodium parasite in subjects by means of microscopy and RDT. However, 3 P. vivax positive samples (1.5% were discovered by Nested-PCR while microscopy and RDT missed the cases.Microscopy as the gold standard method and RDT correctly identified 98.5% of cases, and molecular analysis is sensitive and reliable, especially in the detection of "asymptomatic" infections for active case surveillance. Regarding the existence of asymptomatic malaria in endemic area of Hormozgan, Iran, nested-PCR could be considered as a sensitive tool to interrupt malaria transmission in the country, beside the microscopic and RDT methods.

Efficiency of Nested-PCR in Detecting Asymptomatic Cases toward Malaria Elimination Program in an Endemic Area of Iran.

Science.gov (United States)

Turki, Habibollah; Raeisi, Ahmad; Malekzadeh, Kianoosh; Ghanbarnejad, Amin; Zoghi, Samaneh; Yeryan, Masoud; Abedi Nejad, Masoumeh; Mohseni, Fatemeh; Shekari, Mohammad

2015-01-01

The aim of this study was to detect low parasite and asymptomatic malaria infections by means of three malaria diagnostic tests, in a low transmission region of Minab district, Hormozgan Province, southern Iran. Blood samples of 200 healthy volunteers from Bagh-e-Malek area were evaluated using microscopic, rapid diagnostic tests (RDT) and nested-PCR to inspect malaria parasite. The results showed no Plasmodium parasite in subjects by means of microscopy and RDT. However, 3 P. vivax positive samples (1.5%) were discovered by Nested-PCR while microscopy and RDT missed the cases. Microscopy as the gold standard method and RDT correctly identified 98.5% of cases, and molecular analysis is sensitive and reliable, especially in the detection of "asymptomatic" infections for active case surveillance. Regarding the existence of asymptomatic malaria in endemic area of Hormozgan, Iran, nested-PCR could be considered as a sensitive tool to interrupt malaria transmission in the country, beside the microscopic and RDT methods.

Group-specific multiplex PCR detection systems for the identification of flying insect prey.

Directory of Open Access Journals (Sweden)

Daniela Sint

Full Text Available The applicability of species-specific primers to study feeding interactions is restricted to those ecosystems where the targeted prey species occur. Therefore, group-specific primer pairs, targeting higher taxonomic levels, are often desired to investigate interactions in a range of habitats that do not share the same species but the same groups of prey. Such primers are also valuable to study the diet of generalist predators when next generation sequencing approaches cannot be applied beneficially. Moreover, due to the large range of prey consumed by generalists, it is impossible to investigate the breadth of their diet with species-specific primers, even if multiplexing them. However, only few group-specific primers are available to date and important groups of prey such as flying insects have rarely been targeted. Our aim was to fill this gap and develop group-specific primers suitable to detect and identify the DNA of common taxa of flying insects. The primers were combined in two multiplex PCR systems, which allow a time- and cost-effective screening of samples for DNA of the dipteran subsection Calyptratae (including Anthomyiidae, Calliphoridae, Muscidae, other common dipteran families (Phoridae, Syrphidae, Bibionidae, Chironomidae, Sciaridae, Tipulidae, three orders of flying insects (Hymenoptera, Lepidoptera, Plecoptera and coniferous aphids within the genus Cinara. The two PCR assays were highly specific and sensitive and their suitability to detect prey was confirmed by testing field-collected dietary samples from arthropods and vertebrates. The PCR assays presented here allow targeting prey at higher taxonomic levels such as family or order and therefore improve our ability to assess (trophic interactions with flying insects in terrestrial and aquatic habitats.

Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth disease virus and look-alike disease viruses

Energy Technology Data Exchange (ETDEWEB)

Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P

2007-07-26

A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

A multiplex PCR-based method for the detection and early identification of wood rotting fungi in standing trees.

Science.gov (United States)

Guglielmo, F; Bergemann, S E; Gonthier, P; Nicolotti, G; Garbelotto, M

2007-11-01

The goal of this research was the development of a PCR-based assay to identify important decay fungi from wood of hardwood tree species in northern temperate regions. Eleven taxon-specific primers were designed for PCR amplification of either nuclear or mitochondrial ribosomal DNA regions of Armillaria spp., Ganoderma spp., Hericium spp., Hypoxylon thouarsianum var. thouarsianum, Inonotus/Phellinus-group, Laetiporus spp., Perenniporia fraxinea, Pleurotus spp., Schizophyllum spp., Stereum spp. and Trametes spp. Multiplex PCR reactions were developed and optimized to detect fungal DNA and identify each taxon with a sensitivity of at least 1 pg of target DNA in the template. This assay correctly identified the agents of decay in 82% of tested wood samples. The development and optimization of multiplex PCRs allowed for reliable identification of wood rotting fungi directly from wood. Early detection of wood decay fungi is crucial for assessment of tree stability in urban landscapes. Furthermore, this method may prove useful for prediction of the severity and the evolution of decay in standing trees.

Quantitation of Marek's disease and chicken anemia viruses in organs of experimentally infected chickens and commercial chickens by multiplex real-time PCR.

Science.gov (United States)

Davidson, Irit; Raibshtein, I; Al-Touri, A

2013-06-01

The worldwide distribution of chicken anemia virus (CAV) and Marek's disease virus (MDV) is well documented. In addition to their economic significance in single- or dual-virus infections, the two viruses can often accompany various other pathogens and affect poultry health either directly, by causing tumors, anemia, and delayed growth, or indirectly, by aggravating other diseases, as a result of their immunosuppressive effects. After a decade of employing the molecular diagnosis of those viruses, which replaced conventional virus isolation, we present the development of a real-time multiplex PCR for the simultaneous detection of both viruses. The real-time PCRs for MDV and for CAV alone are more sensitive than the respective end-point PCRs. In addition, the multiplex real-time shows a similar sensitivity when compared to the single real-time PCR for each virus. The newly developed real-time multiplex PCR is of importance in terms of the diagnosis and detection of low copies of each virus, MDV and CAV in single- and in multiple-virus infections, and its applicability will be further evaluated.

A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR

Energy Technology Data Exchange (ETDEWEB)

Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others

1996-07-01

Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.

Approach to determine the diversity of Legionella species by nested PCR-DGGE in aquatic environments

Science.gov (United States)

Huang, Wen-Chien; Tsai, Hsin-Chi; Tao, Chi-Wei; Chen, Jung-Sheng; Shih, Yi-Jia; Kao, Po-Min; Huang, Tung-Yi; Hsu, Bing-Mu

2017-01-01

In this study, we describe a nested PCR-DGGE strategy to detect Legionella communities from river water samples. The nearly full-length 16S rRNA gene was amplified using bacterial primer in the first step. After, the amplicons were employed as DNA templates in the second PCR using Legionella specific primer. The third round of gene amplification was conducted to gain PCR fragments apposite for DGGE analysis. Then the total numbers of amplified genes were observed in DGGE bands of products gained with primers specific for the diversity of Legionella species. The DGGE patterns are thus potential for a high-throughput preliminary determination of aquatic environmental Legionella species before sequencing. Comparative DNA sequence analysis of excised DGGE unique band patterns showed the identity of the Legionella community members, including a reference profile with two pathogenic species of Legionella strains. In addition, only members of Legionella pneumophila and uncultured Legionella sp. were detected. Development of three step nested PCR-DGGE tactic is seen as a useful method for studying the diversity of Legionella community. The method is rapid and provided sequence information for phylogenetic analysis. PMID:28166249

Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

Science.gov (United States)

Kim, S A; Park, S H; Lee, S I; Ricke, S C

2017-12-01

The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

A multiplex PCR method for the identification of commercially important salmon and trout species (Oncorhynchus and Salmo) in North America.

Science.gov (United States)

Rasmussen Hellberg, Rosalee S; Morrissey, Michael T; Hanner, Robert H

2010-09-01

The purpose of this study was to develop a species-specific multiplex polymerase chain reaction (PCR) method that allows for the detection of salmon species substitution on the commercial market. Species-specific primers and TaqMan® probes were developed based on a comprehensive collection of mitochondrial 5' cytochrome c oxidase subunit I (COI) deoxyribonucleic acid (DNA) "barcode" sequences. Primers and probes were combined into multiplex assays and tested for specificity against 112 reference samples representing 25 species. Sensitivity and linearity tests were conducted using 10-fold serial dilutions of target DNA (single-species samples) and DNA admixtures containing the target species at levels of 10%, 1.0%, and 0.1% mixed with a secondary species. The specificity tests showed positive signals for the target DNA in both real-time and conventional PCR systems. Nonspecific amplification in both systems was minimal; however, false positives were detected at low levels (1.2% to 8.3%) in conventional PCR. Detection levels were similar for admixtures and single-species samples based on a 30 PCR cycle cut-off, with limits of 0.25 to 2.5 ng (1% to 10%) in conventional PCR and 0.05 to 5.0 ng (0.1% to 10%) in real-time PCR. A small-scale test with food samples showed promising results, with species identification possible even in heavily processed food items. Overall, this study presents a rapid, specific, and sensitive method for salmon species identification that can be applied to mixed-species and heavily processed samples in either conventional or real-time PCR formats. This study provides a newly developed method for salmon and trout species identification that will assist both industry and regulatory agencies in the detection and prevention of species substitution. This multiplex PCR method allows for rapid, high-throughput species identification even in heavily processed and mixed-species samples. An inter-laboratory study is currently being carried out to

Multiplex PCR analysis of fumonisin biosynthetic genes in fumonisin-nonproducing Aspergillus niger and A. awamori strains

Science.gov (United States)

In order to determine the genetic basis for loss of fumonisin B¬2 (FB2) biosynthesis in FB2 non-producing A. niger strains, we developed multiplex PCR primer sets to amplify fragments of eight fumonisin biosynthetic pathway (fum) genes. Fragments of all eight fum genes were amplified in FB2-produci...

A new methodology for rapid detection of Lactobacillus delbrueckii subsp. bulgaricus based on multiplex PCR.

Science.gov (United States)

Nikolaou, Anastasios; Saxami, Georgia; Kourkoutas, Yiannis; Galanis, Alex

2011-02-01

In this study we present a novel multiplex PCR assay for rapid and efficient detection of Lactobacillus delbrueckii subsp. bulgaricus. The accuracy of our method was confirmed by the successful identification of L. delbrueckii subsp. bulgaricus in commercial yoghurts and food supplements and it may be readily applied to the food industry. Copyright © 2010 Elsevier B.V. All rights reserved.

Development and inter-laboratory assessment of droplet digital PCR assays for multiplex quantification of 15 genetically modified soybean lines.

Science.gov (United States)

Košir, Alexandra Bogožalec; Spilsberg, Bjørn; Holst-Jensen, Arne; Žel, Jana; Dobnik, David

2017-08-17

Quantification of genetically modified organisms (GMOs) in food and feed products is often required for their labelling or for tolerance thresholds. Standard-curve-based simplex quantitative polymerase chain reaction (qPCR) is the prevailing technology, which is often combined with screening analysis. With the rapidly growing number of GMOs on the world market, qPCR analysis becomes laborious and expensive. Innovative cost-effective approaches are therefore urgently needed. Here, we report the development and inter-laboratory assessment of multiplex assays to quantify GMO soybean using droplet digital PCR (ddPCR). The assays were developed to facilitate testing of foods and feed for compliance with current GMO regulations in the European Union (EU). Within the EU, the threshold for labelling is 0.9% for authorised GMOs per ingredient. Furthermore, the EU has set a technical zero tolerance limit of 0.1% for certain unauthorised GMOs. The novel multiplex ddPCR assays developed target 11 GMO soybean lines that are currently authorised, and four that are tolerated, pending authorisation in the EU. Potential significant improvements in cost efficiency are demonstrated. Performance was assessed for the critical parameters, including limits of detection and quantification, and trueness, repeatability, and robustness. Inter-laboratory performance was also determined on a number of proficiency programme and real-life samples.

High-throughput multiplex real-time PCR assay for the simultaneous quantification of DNA and RNA viruses infecting cassava plants.

Science.gov (United States)

Otti, G; Bouvaine, S; Kimata, B; Mkamillo, G; Kumar, P L; Tomlins, K; Maruthi, M N

2016-05-01

To develop a multiplex TaqMan-based real-time PCR assay (qPCR) for the simultaneous detection and quantification of both RNA and DNA viruses affecting cassava (Manihot esculenta) in eastern Africa. The diagnostic assay was developed for two RNA viruses; Cassava brown streak virus (CBSV) and Uganda cassava brown streak virus (UCBSV) and two predominant DNA viruses; African cassava mosaic virus (ACMV) and East African cassava mosaic virus (EACMV), which cause the economically important cassava brown streak disease (CBSD) and cassava mosaic disease (CMD) respectively. Our method, developed by analysing PCR products of viruses, was highly sensitive to detect target viruses from very low quantities of 4-10 femtograms. Multiplexing did not diminish sensitivity or accuracy compared to uniplex alternatives. The assay reliably detected and quantified four cassava viruses in field samples where CBSV and UCBSV synergy was observed in majority of mixed-infected varieties. We have developed a high-throughput qPCR diagnostic assay capable of specific and sensitive quantification of predominant DNA and RNA viruses of cassava in eastern Africa. The qPCR methods are a great improvement on the existing methods and can be used for monitoring virus spread as well as for accurate evaluation of the cassava varieties for virus resistance. © 2016 The Society for Applied Microbiology.

Multiplex real-time PCR for the detection and quantification of latent and persistent viral genomes in cellular or plasma blood fractions.

Science.gov (United States)

Compston, Lara Isobel; Sarkobie, Francis; Li, Chengyao; Candotti, Daniel; Opare-Sem, Ohene; Allain, Jean-Pierre

2008-07-01

In common with latent viruses such as herpesviruses, parvovirus B19, HBV and GBV-C are contained successfully by the immune response and persist in the host. When immune control breaks down, reactivation of both latent and persistent viruses occurs. Two multiplex assays were developed (B19, HBV, HHV-8), (EBV, CMV, VZV) for blood screening, and tested on blood donor samples from Ghana to determine baseline prevalence of viraemia in immunocompetent persons. Single-virus real-time quantitative PCR (qPCR) assays were optimised for viral load determination of positive initial screening. The qPCR method utilised was absolute quantification with external standards. Multiplex and single-virus qPCR assays had similar sensitivity, except for the B19 assay in which sensitivity was 100-fold lower. Assays were optimised for reproducibility and repeatability, with R(2) of 0.9 being obtained for most assays. With the exception of B19 and CMV, assays had 100% detection limit ranging between 10(1) and 10(2) copies, IU or arbitrary units under single-virus and multiplex assay conditions. The prevalence of viraemia was 1.6% HBV (0.8% DNA+/HBsAg-, 0.8% DNA+/HBsAg+), 0.8% parvovirus B19, and 3.3% GBV-C viraemia in the plasma fraction. The prevalence of four herpesviruses was 1.0% HHV-8, 0.85% CMV, and 8.3% EBV, and no detectable VZV viraemia.

Molecular typing of Salmonella enterica serovar typhi isolates from various countries in Asia by a multiplex PCR assay on variable-number tandem repeats.

Science.gov (United States)

Liu, Yichun; Lee, May-Ann; Ooi, Eng-Eong; Mavis, Yeo; Tan, Ai-Ling; Quek, Hung-Hiang

2003-09-01

A multiplex PCR method incorporating primers flanking three variable-number tandem repeat (VNTR) loci (arbitrarily labeled TR1, TR2, and TR3) in the CT18 strain of Salmonella enterica serovar Typhi has been developed for molecular typing of S. enterica serovar Typhi clinical isolates from several Asian countries, including Singapore, Indonesia, India, Bangladesh, Malaysia, and Nepal. We have demonstrated that the multiplex PCR could be performed on crude cell lysates and that the VNTR banding profiles produced could be easily analyzed by visual inspection after conventional agarose gel electrophoresis. The assay was highly discriminative in identifying 49 distinct VNTR profiles among 59 individual isolates. A high level of VNTR profile heterogeneity was observed in isolates from within the same country and among countries. These VNTR profiles remained stable after the strains were passaged extensively under routine laboratory culture conditions. In contrast to the S. enterica serovar Typhi isolates, an absence of TR3 amplicons and a lack of length polymorphisms in TR1 and TR2 amplicons were observed for other S. enterica serovars, such as Salmonella enterica serovar Typhimurium, Salmonella enterica serovar Enteritidis, and Salmonella enterica serovar Paratyphi A, B, and C. DNA sequencing of the amplified VNTR regions substantiated these results, suggesting the high stability of the multiplex PCR assay. The multiplex-PCR-based VNTR profiling developed in this study provides a simple, rapid, reproducible, and high-resolution molecular tool for the epidemiological analysis of S. enterica serovar Typhi strains.

COMPARISON OF A GENUS-SPECIFIC CONVENTIONAL PCR AND A SPECIES-SPECIFIC NESTED-PCR FOR MALARIA DIAGNOSIS USING FTA COLLECTED SAMPLES FROM KINGDOM OF SAUDI ARABIA.

Science.gov (United States)

Al-Harthi, Saeed A

2015-12-01

Molecular tools are increasingly accepted as the most sensitive and reliable techniques for malaria diagnosis and epidemiological surveys. Also, collection of finger prick blood spots onto filter papers is the most simple and affordable method for samples preservation and posterior molecular analysis, especially in rural endemic regions where malaria remains a major health problem. Two malaria molecular diagnostic tests, a Plasmodium genus-specific conventional PCR and a Plasmodium species-specific Nested PCR, were evaluated using DNA templates prepared from Whatman-FTA cards' dry blood spots using both, Methanol-fixation/Heat-extraction and FTA commercial purification kit. A total of 121 blood samples were collected from six Saudi south-western endemic districts both, as thick and thin films for routine microscopic screening and onto FTA cards for molecular studies. Out of the 121 samples, 75 were P. falciparum positive by at least one technique. No other species of Plasmodium were detected. P. falciparum parasites were identified in 69/75 (92%) samples by microscopic screening in health care centers. P. genus-specific PCR was able to amplify P. falciparum DNA in 41/75 (55%) and 59/75 (79%) samples using Methanol-fixation/Heat-extraction and FTA purification kit, respectively. P. species-specific Nested PCR revealed 68/75 (91%) and 75/75 (100%) positive samples using DNA templates were isolated by Methanol-fixation/Heat- extraction and FTA purification methods, respectively. The species-specific Nested PCR applied to Whatman-FTA preserved and processed blood samples represents the best alternative to classical microscopy for malaria diagnosis, particularly in epidemiological screening.

Rapid screening of pyogenic Staphylococcus aureus for confirmation of genus and species, methicillin resistance and virulence factors by using two novel multiplex PCR.

Science.gov (United States)

Haque, Abdul; Haque, Asma; Saeed, Muhammad; Azhar, Aysha; Rasool, Samreen; Shan, Sidra; Ehsan, Beenish; Nisar, Zohaib

2017-01-01

Emergence of methicillin resistant Staphylococcus aureus (MRSA) is a major medical problem of current era. These bacteria are resistant to most drugs and rapid diagnosis can provide a clear guideline to clinicians. They possess specific virulence factors and relevant information can be very useful. We designed this study to develop multiplex PCRs to provide rapid information. We studied 60 Staphylococcus aureus isolates and detected methicillin resistance by cefoxitin sensitivity and targeting of mecA gene. After initial studies with uniplex PCRs we optimized two multiplex PCRs with highly reproducible results. The first multiplex PCR was developed to confirm genus, species and methicillin resistance simultaneously, and the second multiplex PCR was for screening of virulence factors. We found 38.33% isolates as methicillin resistant. α -toxin, the major cytotoxic factor, was detected in 40% whereas β-hemolysin was found in 25% cases. Panton Valentine leucocidin was detected in 8.33% and toxic shock syndrome toxin in5% cases. The results of uniplex and multiplex PCRs were highly compatible. These two multiplex PCRs when run simultaneously can provide vital information about methicillin resistance and virulence status of the isolate within a few hours as compared to several days needed by routine procedures.

Survival in soil and detection of co-transformed Trichoderma harzianum by nested PCR Sobrevivência em solo e detecção de co-transformantes de Trichoderma harzianum por PCR "nested"

Directory of Open Access Journals (Sweden)

Paulo Roberto Queiroz

2004-04-01

Full Text Available The objective of this work was to evaluate the survival of two Trichoderma harzianum co-transformants, TE 10 and TE 41, carrying genes for green fluorescent protein (egfp and for resistance to benomyl, during four weeks in a contained soil microcosm. Selective culture media were used to detect viable fungal material, whose identity was confirmed by the observation of the fluorescent phenotype by direct epifluorence microscopy. PCR using two nested primer pairs specific to the egfp gene was also used to detect the transformed fungi. Although it was not possible to reliably detect the egfp gene directly from soil extracts, an enrichment step involving selective culture of soil samples in liquid medium prior to DNA extraction enabled the consistent detection of the T. harzianum co-transformants by nested PCR for the duration of the incubation period.O objetivo deste trabalho foi avaliar a sobrevivência de dois co-transformantes de Trichoderma harzianum, TE 10 e TE 41, expressando o gene da proteína de fluorescência verde (egfp e resistência a benomil, por um período de quatro semanas em microcosmo de solo, sob condições controladas. Foi utilizado um meio seletivo para detecção de material fúngico viável, o qual foi confirmado por observação quanto ao fenótipo de fluorescência em microscópio de epifluorescência direta. O fungo transformado foi detectado por PCR "nested", utilizando-se dois pares de primers específicos para o gene egfp. Foram utilizados meios líquidos enriquecidos no cultivo de amostras de solo, permitindo uma detecção consistente de co-transformantes de T. harzianum, uma vez que não foi possível a detecção do gene egfp por PCR de amostras de DNA extraídas diretamente de solo.

Comparison of two methods for the detection of hepatitis A virus in clam samples (Tapes spp.) by reverse transcription-nested PCR.

Science.gov (United States)

Suñén, Ester; Casas, Nerea; Moreno, Belén; Zigorraga, Carmen

2004-03-01

The detection of hepatitis A virus in shellfish by reverse transcription-nested polymerase chain reaction (RT-nested PCR) is hampered mainly by low levels of virus contamination and PCR inhibitors in shellfish. In this study, we focused on getting a rapid and sensitive processing procedure for the detection of HAV by RT-nested PCR in clam samples (Tapes spp.). Two previously developed processing methods for virus concentration in shellfish have been improved upon and compared. The first method involves acid adsorption, elution, polyethylene glycol (PEG) precipitation, chloroform extraction and PEG precipitation. The second method is based on elution with a glycine buffer at pH 10, chloroform extraction and concentration by ultracentrifugation. Final clam concentrates were processed by RNA extraction or immunomagnetic capture of viruses (IMC) before the RT-nested PCR reaction. Both methods of sample processing combined with the RNA extraction from the concentrates were very efficient when they were assayed in seeded and naturally contaminated samples. The results show that the first method was more effective in removal inhibitors and the second was simpler and faster. The IMC of HAV from clam concentrates processed by method 1 was revealed to be a very effective method of simultaneously removing residual PCR inhibitors and of concentrating the virus.

Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers.

Science.gov (United States)

Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos

2015-10-22

Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers

Directory of Open Access Journals (Sweden)

Alex Galanis

2015-10-01

Full Text Available Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD Sequenced Characterized Amplified Region (SCAR analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

Simultaneous Detection of Key Bacterial Pathogens Related to Pneumonia and Meningitis Using Multiplex PCR Coupled With Mass Spectrometry

Directory of Open Access Journals (Sweden)

Chi Zhang

2018-04-01

Full Text Available Pneumonia and meningitis continue to present an enormous public health burden and pose a major threat to young children. Among the causative organisms of pneumonia and meningitis, bacteria are the most common causes of serious disease and deaths. It is challenging to accurately and rapidly identify these agents. To solve this problem, we developed and validated a 12-plex PCR coupled with matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS method (bacterial pathogen-mass spectrometry, BP-MS that can be used to simultaneously screen for 11 key bacterial pathogens related to pneumonia and meningitis. Forty-six nasopharyngeal swabs and 12 isolates were used to determine the specificity of the method. The results showed that, using the BP-MS method, we could accurately identify the expected bacteria without cross-reactivity with other pathogens. For the 11 target bacterial pathogens, the analytical sensitivity of the BP-MS method was as low as 10 copies/reaction. To further evaluate the clinical effectiveness of this method, 204 nasopharyngeal swabs from hospitalized children with suspected pneumonia were tested using this method. In total, 81.9% (167/204 of the samples were positive for at least one of the 11 target pathogens. Among the 167 bacteria-positive samples, the rate of multiple infections was 55.7% (93/167, and the most frequent combination was Streptococcus pneumoniae with Haemophilus influenzae, representing 46.2% (43/93 two-pathogen mixed infections. We used real-time PCR and nested PCR to confirm positive results, with identical results obtained for 81.4% (136/167 of the samples. The BP-MS method is a sensitive and specific molecular detection technique in a multiplex format and with high sample throughput. Therefore, it will be a powerful tool for pathogen screening and antibiotic selection at an early stage of disease.

Detection and Resolution of Cryptosporidium Species and Species Mixtures by Genus-Specific Nested PCR-Restriction Fragment Length Polymorphism Analysis, Direct Sequencing, and Cloning ▿

Science.gov (United States)

Ruecker, Norma J.; Hoffman, Rebecca M.; Chalmers, Rachel M.; Neumann, Norman F.

2011-01-01

Molecular methods incorporating nested PCR-restriction fragment length polymorphism (RFLP) analysis of the 18S rRNA gene of Cryptosporidium species were validated to assess performance based on limit of detection (LoD) and for detecting and resolving mixtures of species and genotypes within a single sample. The 95% LoD was determined for seven species (Cryptosporidium hominis, C. parvum, C. felis, C. meleagridis, C. ubiquitum, C. muris, and C. andersoni) and ranged from 7 to 11 plasmid template copies with overlapping 95% confidence limits. The LoD values for genomic DNA from oocysts on microscope slides were 7 and 10 template copies for C. andersoni and C. parvum, respectively. The repetitive nested PCR-RFLP slide protocol had an LoD of 4 oocysts per slide. When templates of two species were mixed in equal ratios in the nested PCR-RFLP reaction mixture, there was no amplification bias toward one species over another. At high ratios of template mixtures (>1:10), there was a reduction or loss of detection of the less abundant species by RFLP analysis, most likely due to heteroduplex formation in the later cycles of the PCR. Replicate nested PCR was successful at resolving many mixtures of Cryptosporidium at template concentrations near or below the LoD. The cloning of nested PCR products resulted in 17% of the cloned sequences being recombinants of the two original templates. Limiting-dilution nested PCR followed by the sequencing of PCR products resulted in no sequence anomalies, suggesting that this method is an effective and accurate way to study the species diversity of Cryptosporidium, particularly for environmental water samples, in which mixtures of parasites are common. PMID:21498746

Identification of and Screening for Human Helicobacter cinaedi Infections and Carriers via Nested PCR

Science.gov (United States)

Oyama, Kohta; Khan, Shahzada; Okamoto, Tatsuya; Fujii, Shigemoto; Ono, Katsuhiko; Matsunaga, Tetsuro; Yoshitake, Jun; Sawa, Tomohiro; Tomida, Junko; Kawamura, Yoshiaki

2012-01-01

Helicobacter cinaedi is the most frequently reported enterohepatic Helicobacter species isolated from humans. Earlier research suggested that certain patients with H. cinaedi infection may remain undiagnosed or incorrectly diagnosed because of difficulties in detecting the bacteria by conventional culture methods. Here, we report a nested PCR assay that rapidly detects the cytolethal distending toxin gene (cdt) of H. cinaedi with high specificity and sensitivity. Specificity of the assay was validated by using different species of Helicobacter and Campylobacter, as well as known H. cinaedi-positive and -negative samples. The sensitivity of detection for the cdt gene in the assay was 102 CFU/ml urine or 102 CFU/105 infected RAW 264.7 cells. In an H. cinaedi-infected mouse model, the cdt gene of H. cinaedi was effectively detected via the assay with urine (6/7), stool (2/3), and blood (2/6) samples. Importantly, it detected H. cinaedi in blood, urine, and stool samples from one patient with a suspected H. cinaedi infection and three patients with known infections. The assay was further used clinically to follow up two H. cinaedi-infected patients after antibiotic treatment. Stool samples from these two patients evaluated by nested PCR after antibiotic therapy showed clearance of bacterial DNA. Finally, analysis of stool specimens from healthy volunteers showed occasional positive reactions (4/30) to H. cinaedi DNA, which suggests intestinal colonization by H. cinaedi in healthy subjects. In conclusion, this nested PCR assay may be useful for the rapid diagnosis, antimicrobial treatment evaluation, and epidemiological study of H. cinaedi infection. PMID:23015666

Laparoscopic hemi-hysterectomy in treatment of a didelphic uterus with a hypoplastic cervix and obstructed hemi-vagina.

Science.gov (United States)

Boudhraa, K; Barbarino, A; Gara, Mohamed Faouzi

2008-11-01

Maldevelopment of the Müllerian duct system may result in various urogenital anomalies including didelphic uterus with a hypoplastic cervix and obstructed hemi-vagina. We report a patient with this anomaly who was treated by laparoscopic hemi-hysterectomy and hysteroscopic resection of hemi-vagina. A 16-year-old patient who had complained of vaginal pus-like discharge on and off for 1 year was diagnosed by MRI to have a double uterus with obstructed right hemi-vagina and ipsilateral renal agenesis. After hysteroscopic identification of hypoplasia of the right uterine cervix, laparoscopic resection of the right uterus and right fallopian tube and hysteroscopic assisted resection of the vaginal septa were performed successfully. We think that combined laparoscopy and hysteroscopy may be an effective alternative in the management and diagnosis of Mullerian anomalies.

A novel multiplex PCR discriminates Bacillus anthracis and its genetically related strains from other Bacillus cereus group species.

Directory of Open Access Journals (Sweden)

Hirohito Ogawa

Full Text Available Anthrax is an important zoonotic disease worldwide that is caused by Bacillus anthracis, a spore-forming pathogenic bacterium. A rapid and sensitive method to detect B. anthracis is important for anthrax risk management and control in animal cases to address public health issues. However, it has recently become difficult to identify B. anthracis by using previously reported molecular-based methods because of the emergence of B. cereus, which causes severe extra-intestinal infection, as well as the human pathogenic B. thuringiensis, both of which are genetically related to B. anthracis. The close genetic relation of chromosomal backgrounds has led to complexity of molecular-based diagnosis. In this study, we established a B. anthracis multiplex PCR that can screen for the presence of B. anthracis virulent plasmids and differentiate B. anthracis and its genetically related strains from other B. cereus group species. Six sets of primers targeting a chromosome of B. anthracis and B. anthracis-like strains, two virulent plasmids, pXO1 and pXO2, a bacterial gene, 16S rRNA gene, and a mammalian gene, actin-beta gene, were designed. The multiplex PCR detected approximately 3.0 CFU of B. anthracis DNA per PCR reaction and was sensitive to B. anthracis. The internal control primers also detected all bacterial and mammalian DNAs examined, indicating the practical applicability of this assay as it enables monitoring of appropriate amplification. The assay was also applied for detection of clinical strains genetically related to B. anthracis, which were B. cereus strains isolated from outbreaks of hospital infections in Japan, and field strains isolated in Zambia, and the assay differentiated B. anthracis and its genetically related strains from other B. cereus group strains. Taken together, the results indicate that the newly developed multiplex PCR is a sensitive and practical method for detecting B. anthracis.

Testing the sensitivity of Nested PCR method to detect Aspergillus fumigates in experimentally infected Sputum samples

International Nuclear Information System (INIS)

Ramadan, A.; Soukkaria, S.

2013-01-01

Fungal infections caused by Aspergillus species generally are occupying a second place among invasive fungal infections in the world, especially A. fumigatus, which is considered the main cause of invasive Aspergillosis (IA). Although IA rarely infects immunocompetent individuals, however, it can lead to death in immunocompromised patients. Therefore, it is necessary to diagnose the infection early in order to treat the disease efficiently. However, the conventional diagnostic tools, currently used to detect infections, has low sensitivity and reliability. Polymerase chain reaction (PCR) technology distribution as a molecular and high sensitive technology has allowed us to make comparative study between sensitivity of traditional currently used diagnostic method and Nested-PCR, the result of the study of sputum samples that experimentally infected with different concentrations of A.fumigatus spores ramping from 10 to10 6 spore/ml, have high sensitivity and specificity of Nested-PCR in detecting the lower concentrations, comparing with traditional diagnostic method (culture on Sabouraud media) that were negative in all concetrations. (author)

Hemi-nested PCR and RFLP methodologies for identifying blood meals of the Chagas disease vector, Triatoma infestans.

Science.gov (United States)

Roellig, Dawn M; Gomez-Puerta, Luis A; Mead, Daniel G; Pinto, Jesus; Ancca-Juarez, Jenny; Calderon, Maritza; Bern, Caryn; Gilman, Robert H; Cama, Vitaliano A

2013-01-01

Trypanosoma cruzi, the etiologic agent of Chagas disease, is transmitted by hematophagous reduviid bugs within the subfamily Triatominae. These vectors take blood meals from a wide range of hosts, and their feeding behaviors have been used to investigate the ecology and epidemiology of T. cruzi. In this study we describe two PCR-based methodologies that amplify a fragment of the 16S mitochondrial rDNA, aimed to improve the identification of blood meal sources for Triatoma infestans: a.--Sequence analyses of two heminested PCRs that allow the identification of mammalian and avian species, and b.--restriction fragment length polymorphism (RFLP) analysis from the mammalian PCR to identify and differentiate multi-host blood meals. Findings from both methodologies indicate that host DNA could be detected and the host species identified in samples from laboratory reared and field collected triatomines. The implications of this study are two-fold. First, these methods can be used in areas where the fauna diversity and feeding behavior of the triatomines are unknown. Secondly, the RFLP method led to the identification of multi-host DNA from T. infestans gut contents, enhancing the information provided by this assay. These tools are important contributions for ecological and epidemiological studies of vector-borne diseases.

Clinical utility of an optimised multiplex real-time PCR assay for the identification of pathogens causing sepsis in Vietnamese patients

Directory of Open Access Journals (Sweden)

Ngo Tat Trung

2018-02-01

Conclusion: The combination of culture and the multiplex RT-PCR assay provided an excellent diagnostic accomplishment and significantly supported the identification of causative pathogens in clinical samples obtained from septic patients.

Detection of diarrheagenic Escherichia coli by use of melting-curve analysis and real-time multiplex PCR.

Science.gov (United States)

Guion, Chase E; Ochoa, Theresa J; Walker, Christopher M; Barletta, Francesca; Cleary, Thomas G

2008-05-01

Diarrheagenic Escherichia coli strains are important causes of diarrhea in children from the developing world and are now being recognized as emerging enteropathogens in the developed world. Current methods of detection are too expensive and labor-intensive for routine detection of these organisms to be practical. We developed a real-time fluorescence-based multiplex PCR for the detection of all six of the currently recognized classes of diarrheagenic E. coli. The primers were designed to specifically amplify eight different virulence genes in the same reaction: aggR for enteroaggregative E. coli, stIa/stIb and lt for enterotoxigenic E. coli, eaeA for enteropathogenic E. coli and Shiga toxin-producing E. coli (STEC), stx(1) and stx(2) for STEC, ipaH for enteroinvasive E. coli, and daaD for diffusely adherent E. coli (DAEC). Eighty-nine of ninety diarrheagenic E. coli and 36/36 nonpathogenic E. coli strains were correctly identified using this approach (specificity, 1.00; sensitivity, 0.99). The single false negative was a DAEC strain. The total time between preparation of DNA from E. coli colonies on agar plates and completion of PCR and melting-curve analysis was less than 90 min. The cost of materials was low. Melting-point analysis of real-time multiplex PCR is a rapid, sensitive, specific, and inexpensive method for detection of diarrheagenic E. coli.

Rapid detection and typing of pathogenic nonpneumophila Legionella spp. isolates using a multiplex real-time PCR assay.

Science.gov (United States)

Benitez, Alvaro J; Winchell, Jonas M

2016-04-01

We developed a single tube multiplex real-time PCR assay that allows for the rapid detection and typing of 9 nonpneumophila Legionella spp. isolates that are clinically relevant. The multiplex assay is capable of simultaneously detecting and discriminating L. micdadei, L. bozemanii, L. dumoffii, L. longbeachae, L. feeleii, L. anisa, L. parisiensis, L. tucsonensis serogroup (sg) 1 and 3, and L. sainthelensis sg 1 and 2 isolates. Evaluation of the assay with nucleic acid from each of these species derived from both clinical and environmental isolates and typing strains demonstrated 100% sensitivity and 100% specificity when tested against 43 other Legionella spp. Typing of L. anisa, L. parisiensis, and L. tucsonensis sg 1 and 3 isolates was accomplished by developing a real-time PCR assay followed by high-resolution melt (HRM) analysis targeting the ssrA gene. Further typing of L. bozemanii, L. longbeachae, and L. feeleii isolates to the serogroup level was accomplished by developing a real-time PCR assay followed by HRM analysis targeting the mip gene. When used in conjunction with other currently available diagnostic tests, these assays may aid in rapidly identifying specific etiologies associated with Legionella outbreaks, clusters, sporadic cases, and potential environmental sources. Published by Elsevier Inc.

The Development of Three Long Universal Nuclear Protein-Coding Locus Markers and Their Application to Osteichthyan Phylogenetics with Nested PCR

Science.gov (United States)

Zhang, Peng

2012-01-01

Background Universal nuclear protein-coding locus (NPCL) markers that are applicable across diverse taxa and show good phylogenetic discrimination have broad applications in molecular phylogenetic studies. For example, RAG1, a representative NPCL marker, has been successfully used to make phylogenetic inferences within all major osteichthyan groups. However, such markers with broad working range and high phylogenetic performance are still scarce. It is necessary to develop more universal NPCL markers comparable to RAG1 for osteichthyan phylogenetics. Methodology/Principal Findings We developed three long universal NPCL markers (>1.6 kb each) based on single-copy nuclear genes (KIAA1239, SACS and TTN) that possess large exons and exhibit the appropriate evolutionary rates. We then compared their phylogenetic utilities with that of the reference marker RAG1 in 47 jawed vertebrate species. In comparison with RAG1, each of the three long universal markers yielded similar topologies and branch supports, all in congruence with the currently accepted osteichthyan phylogeny. To compare their phylogenetic performance visually, we also estimated the phylogenetic informativeness (PI) profile for each of the four long universal NPCL markers. The PI curves indicated that SACS performed best over the whole timescale, while RAG1, KIAA1239 and TTN exhibited similar phylogenetic performances. In addition, we compared the success of nested PCR and standard PCR when amplifying NPCL marker fragments. The amplification success rate and efficiency of the nested PCR were overwhelmingly higher than those of standard PCR. Conclusions/Significance Our work clearly demonstrates the superiority of nested PCR over the conventional PCR in phylogenetic studies and develops three long universal NPCL markers (KIAA1239, SACS and TTN) with the nested PCR strategy. The three markers exhibit high phylogenetic utilities in osteichthyan phylogenetics and can be widely used as pilot genes for

Detection of Mycobacterium chelonae, Mycobacterium abscessus Group, and Mycobacterium fortuitum Complex by a Multiplex Real-Time PCR Directly from Clinical Samples Using the BD MAX System.

Science.gov (United States)

Rocchetti, Talita T; Silbert, Suzane; Gostnell, Alicia; Kubasek, Carly; Campos Pignatari, Antonio C; Widen, Raymond

2017-03-01

A new multiplex PCR test was designed to detect Mycobacterium chelonae, Mycobacterium abscessus group, and Mycobacterium fortuitum complex on the BD MAX System. A total of 197 clinical samples previously submitted for mycobacterial culture were tested using the new protocol. Samples were first treated with proteinase K, and then each sample was inoculated into the BD MAX Sample Buffer Tube. Extraction and multiplex PCR were performed by the BD MAX System, using the BD MAX ExK TNA-3 extraction kit and BD TNA Master Mix, along with specific in-house designed primers and probes for each target. The limit of detection of each target, as well as specificity, was evaluated. Of 197 clinical samples included in this study, 133 were positive and 60 were negative for mycobacteria by culture, and another 4 negative samples were spiked with M. chelonae ATCC 35752. The new multiplex PCR on the BD MAX had 97% concordant results with culture for M. abscessus group detection, 99% for M. chelonae, and 100% for M. fortuitum complex. The new multiplex PCR test performed on the BD MAX System proved to be a sensitive and specific test to detect M. chelonae, M. abscessus group, and M. fortuitum complex by real-time PCR on an automated sample-in results-out platform. Copyright © 2017 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Hemi-Intravascular Stenting for Supermicrosurgical Anastomosis

Science.gov (United States)

Yamashita, Shuji; Narushima, Mitsunaga; Koshima, Isao; Miyamoto, Shimpei

2017-01-01

Background: Although supermicrosurgical anastomosis is a widely known reconstructive microsurgical technique, it is difficult to perform. To expand the clinical use of supermicrosurgery, we used hemi-intravascular stenting (hemi-IVaS), which is performed by inserting an intravascular stent into one side of the vessel. We conducted lymphaticovenular anastomosis, free perforator flap transfer, and fingertip replantation with supermicrosurgical anastomosis using hemi-IVaS technique and examined its usefulness. Methods: Between January 2013 and February 2015, 11 anastomoses in 11 cases of lymphaticovenular anastomosis for lymphedema patients, 14 anastomoses in 7 cases of free perforator flap transfer with supermicrosurgical perforator-to-perforator anastomosis, and 9 anastomoses in 5 cases of fingertip replantation were performed using hemi-IVaS. Time required for anastomosis and complications were examined. Flap survival rate was also examined in free perforator flap transfer cases and fingertip replantation cases. Results: In all cases, anastomoses were performed without complications such as inadvertent catching of the back wall of the vessel during the procedure or the need for reanastomoses. The average time required to complete the anastomosis was 16.4 ± 3.20 minutes using the hemi IVaS technique. All flaps survived in the supermicrosurgical perforator-to-perforator anastomosis as well as fingertip replantation cases. Conclusions: Hemi-IVaS could be a useful alternative to conventional intravascular stenting techniques and is also effective for supermicrosurgical perforator-to-perforator anastomosis. Further studies are needed to improve the success rate and to explore its other possible utilizations in supermicrosurgery. PMID:29263952

Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR.

Directory of Open Access Journals (Sweden)

Kerstin Wernike

Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.

Diagnostic potential of nested PCR, galactomannan EIA, and beta-D-glucan for invasive aspergillosis in pediatric patients.

Science.gov (United States)

Badiee, Parisa; Alborzi, Abdolvahab; Karimi, Mahammad; Pourabbas, Bahman; Haddadi, Pedram; Mardaneh, Jalal; Moieni, Mahsa

2012-04-13

Limited specific data and investigations are available for invasive aspergillosis (IA) in pediatric patients. We evaluated the diagnostic potential of three noninvasive tests including the Platelia Aspergillus EIA kit for using galactomannan antigen, (1,3)-β-D-glucan Detection Reagent Kit, and nested-PCR for Aspergillus DNA in sera. We evaluated the diagnostic potential of three noninvasive tests including EIA for galactomannan antigen  (Platelia Aspergillus), nested  PCR assay for Aspergillus DNA and test for (1→3)-β-D-glucan (Glucatell assay Kit). All pediatric patients treated at the hematology/oncology unit who were at increased risk of developing invasive aspergillosis were enrolled. Clinical samples were examined for Aspergillus infections by mycological methods. Serial blood samples were collected twice weekly and evaluated by noninvasive tests. We analyzed 230 consecutive blood samples from 62 pediatric patients. The incidence rate of invasive aspergillosis in the patients was found to be 27.4%, and the etiologic agents were Aspergillus flavus, Aspergillus fumigatus, and Aspergillus spp.  The sensitivity, specificity, positive and negative predictive values, and likelihood ratios for positive and negative results of galactomannan in patients with proven and probable IA were 90%, 92%, 81.8%, 96%, 11.25, and 0.1; for beta-D-glucan they were 50%, 46%, 26%, 70.6%, 0.9, 0.9; and for nested-PCR they were 80%, 96.2%, 88.9%, 92.6%, 21, and 0.2, respectively. The conventional methods are not able to detect IA, due to the lack of valid and proper sampling. Galactomannan and nested-PCR tests in serum, with enough accuracy and reliability, can serve as noninvasive methods for the detection of IA in pediatric patients. However, the beta-D-glucan test cannot serve as an efficient diagnostic tool in those with hematologic disorders. 

A novel multiplex PCR assay for simultaneous detection of nine clinically significant bacterial pathogens associated with bovine mastitis.

Science.gov (United States)

Ashraf, Aqeela; Imran, Muhammad; Yaqub, Tahir; Tayyab, Muhammad; Shehzad, Wasim; Thomson, Peter C

2017-06-01

For rapid and simultaneous detection of nine bovine mastitic pathogens, a sensitive and specific multiplex PCR assay was developed. The assay was standardized using reference strains and validated on mastitic milk cultures which were identified to species level based on 16S rRNA sequencing. Multiplex PCR assay also efficiently detected the target bacterial strains directly from milk. The detection limit of the assay was up to 50 pg for DNA isolated from pure cultures and 10 4  CFU/ml for spiked milk samples. As estimated by latent class analysis, the assay was sensitive up to 88% and specific up to 98% for targeted mastitic pathogens, compared with the bacterial culture method and the 16S rRNA sequence analysis. This novel molecular assay could be useful for monitoring and maintaining the bovine udder health, ensuring the bacteriological safety of milk, and conducting epidemiological studies. Copyright © 2017 Elsevier Ltd. All rights reserved.

Evaluation of multiplex ligation-dependent probe amplification analysis versus multiplex polymerase chain reaction assays in the detection of dystrophin gene rearrangements in an Iranian population subset

Directory of Open Access Journals (Sweden)

Nayereh Nouri

2014-01-01

Full Text Available Background: The Duchenne muscular dystrophy (DMD gene is located in the short arm of the X chromosome (Xp21. It spans 2.4 Mb of the human genomic DNA and is composed of 79 exons. Mutations in the Dystrophin gene result in DMD and Becker muscular dystrophy. In this study, the efficiency of multiplex ligation-dependent probe amplification (MLPA over multiplex polymerase chain reaction (PCR assays in an Iranian population was investigated. Materials and Methods: Multiplex PCR assays and MLPA analysis were carried out in 74 patients affected with DMD. Results: Multiplex PCR detected deletions in 51% of the patients with DMD. MLPA analysis could determine all the deletions detected by the multiplex PCR. Additionally, MLPA was able to identify one more deletion and duplication in patients without detectable mutations by multiplex PCR. Moreover, MLPA precisely determined the exact size of the deletions. Conclusion: Although MLPA analysis is more sensitive for detection of deletions and duplications in the dystrophin gene, multiplex PCR might be used for the initial analysis of the boys affected with DMD in the Iranian population as it was able to detect 95% of the rearrangements in patients with DMD.

Multiplex PCR with minisequencing as an effective high-throughput SNP typing method for formalin-fixed tissue

DEFF Research Database (Denmark)

Gilbert, Marcus T P; Sanchez, Juan J; Haselkorn, Tamara

2007-01-01

, multiplex PCR with minisequencing (MPMS), on 92 DNA extractions performed on six archival FFPE samples of variable DNA quality, which date between 9 and 25 years old. On the three extracts with highest quality, we found the assay efficiency to be near 100%. However, the efficiency of the lowest quality...... extracts varied significantly. In this study, we demonstrate that although direct measures of DNA concentration in the extracts provide no useful information with regard to subsequent MPMS success, the success of the assay can be determined to some degree a priori, through initial screening of the DNA...... quality using a simple quantitative real-time PCR (qPCR) assay for nuclear DNA, and/or an assay of the maximum PCR amplifiable size of nuclear DNA. MPMS promises to be of significant use in future genetic studies on FFPE material. It provides a streamlined approach for retrieving a large amount of genetic...

Multiplex-PCR As a Rapid and Sensitive Method for Identification of Meat Species in Halal-Meat Products.

Science.gov (United States)

Alikord, Mahsa; Keramat, Javad; Kadivar, Mahdi; Momtaz, Hassan; Eshtiaghi, Mohammad N; Homayouni-Rad, Aziz

2017-01-01

Species identification and authentication in meat products are important subjects for ensuring the health of consumers. The multiplex-PCR amplification and species- specific primer set were used for the identification of horse, donkey, pig and other ruminants in raw and processed meat products. Oligonucleotid primers were designed and patented for amplification of species-specific mitochondrial DNA sequences of each species and samples were prepared from binary meat mixtures. The results showed that meat species were accurately determined in all combinations by multiplex-PCR, and the sensitivity of this method was 0.001 ng, rendering this technique open to and suitable for use in industrial meat products. It is concluded that more fraud is seen in lower percentage industrial meat products than in higher percentage ones. There was also more fraud found in processed products than in raw ones. This rapid and useful test is recommended for quality control firms for applying more rigorous controls over industrial meat products, for the benefit of target consumers. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Detection of Hepatocyte Clones Containing Integrated Hepatitis B Virus DNA Using Inverse Nested PCR.

Science.gov (United States)

Tu, Thomas; Jilbert, Allison R

2017-01-01

Chronic hepatitis B virus (HBV) infection is a major cause of liver cirrhosis and hepatocellular carcinoma (HCC), leading to ~600,000 deaths per year worldwide. Many of the steps that occur during progression from the normal liver to cirrhosis and/or HCC are unknown. Integration of HBV DNA into random sites in the host cell genome occurs as a by-product of the HBV replication cycle and forms a unique junction between virus and cellular DNA. Analyses of integrated HBV DNA have revealed that HCCs are clonal and imply that they develop from the transformation of hepatocytes, the only liver cell known to be infected by HBV. Integrated HBV DNA has also been shown, at least in some tumors, to cause insertional mutagenesis in cancer driver genes, which may facilitate the development of HCC. Studies of HBV DNA integration in the histologically normal liver have provided additional insight into HBV-associated liver disease, suggesting that hepatocytes with a survival or growth advantage undergo high levels of clonal expansion even in the absence of oncogenic transformation. Here we describe inverse nested PCR (invPCR), a highly sensitive method that allows detection, sequencing, and enumeration of virus-cell DNA junctions formed by the integration of HBV DNA. The invPCR protocol is composed of two major steps: inversion of the virus-cell DNA junction and single-molecule nested PCR. The invPCR method is highly specific and inexpensive and can be tailored to DNA extracted from large or small amounts of liver. This procedure also allows detection of genome-wide random integration of any known DNA sequence and is therefore a useful technique for molecular biology, virology, and genetic research.

A nested PCR approach for improved recovery of archaeal 16S rRNA gene fragments from freshwater samples

NARCIS (Netherlands)

Vissers, E.W.; Bodelier, P.L.E.; Muyzer, G.; Laanbroek, R.

2009-01-01

In a survey on the presence of archaea in a number of European lakes, it was found that known archaeal primer sets for PCR were not suited for use in freshwater environment, as some lack selectivity, while others were too selective. A nested PCR was developed for denaturing gradient gel

Real-time RT-PCR high-resolution melting curve analysis and multiplex RT-PCR to detect and differentiate grapevine leafroll-associated associated virus 3 variant groups I, II, III and VI

Directory of Open Access Journals (Sweden)

Bester Rachelle

2012-09-01

Full Text Available Abstract Background Grapevine leafroll-associated virus 3 (GLRaV-3 is the main contributing agent of leafroll disease worldwide. Four of the six GLRaV-3 variant groups known have been found in South Africa, but their individual contribution to leafroll disease is unknown. In order to study the pathogenesis of leafroll disease, a sensitive and accurate diagnostic assay is required that can detect different variant groups of GLRaV-3. Methods In this study, a one-step real-time RT-PCR, followed by high-resolution melting (HRM curve analysis for the simultaneous detection and identification of GLRaV-3 variants of groups I, II, III and VI, was developed. A melting point confidence interval for each variant group was calculated to include at least 90% of all melting points observed. A multiplex RT-PCR protocol was developed to these four variant groups in order to assess the efficacy of the real-time RT-PCR HRM assay. Results A universal primer set for GLRaV-3 targeting the heat shock protein 70 homologue (Hsp70h gene of GLRaV-3 was designed that is able to detect GLRaV-3 variant groups I, II, III and VI and differentiate between them with high-resolution melting curve analysis. The real-time RT-PCR HRM and the multiplex RT-PCR were optimized using 121 GLRaV-3 positive samples. Due to a considerable variation in melting profile observed within each GLRaV-3 group, a confidence interval of above 90% was calculated for each variant group, based on the range and distribution of melting points. The intervals of groups I and II could not be distinguished and a 95% joint confidence interval was calculated for simultaneous detection of group I and II variants. An additional primer pair targeting GLRaV-3 ORF1a was developed that can be used in a subsequent real-time RT-PCR HRM to differentiate between variants of groups I and II. Additionally, the multiplex RT-PCR successfully validated 94.64% of the infections detected with the real-time RT-PCR HRM

A novel and highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus.

Science.gov (United States)

Shen, Xin-Xin; Qiu, Fang-Zhou; Zhao, Huai-Long; Yang, Meng-Jie; Hong, Liu; Xu, Song-Tao; Zhou, Shuai-Feng; Li, Gui-Xia; Feng, Zhi-Shan; Ma, Xue-Jun

2018-03-01

The sensitivity of qRT-PCR assay is not adequate for the detection of the samples with lower viral load, particularly in the cerebrospinal fluid (CSF) of patients. Here, we present the development of a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of human enterovirus (HEV). The clinical performance of both RTN RT-PCR and qRT-PCR was also tested and compared using 140 CSF and fecal specimens. The sensitivities of RTN RT-PCR assay for EV71, Coxsackievirus A (CVA)16, CVA6 and CVA10 achieved 10 -8 dilution with a corresponding Ct value of 38.20, 36.45, 36.75, and 36.45, respectively, which is equal to traditional two-step nested RT-PCR assay and approximately 2-10-fold lower than that of qRT-PCR assay. The specificity of RTN RT-PCR assay was extensively analyzed insilico and subsequently verified using the reference isolates and clinical samples. Sixteen qRT-PCR-negative samples were detected by RTN RT-PCR and a variety of enterovirus serotypes was identified by sequencing of inner PCR products. We conclude RTN RT-PCR is more sensitive than qRT-PCR for the detection of HEV in clinical samples. Copyright © 2017 Elsevier Inc. All rights reserved.

A novel enterovirus and parechovirus multiplex one-step real-time PCR-validation and clinical experience

DEFF Research Database (Denmark)

Nielsen, A. C. Y.; Bottiger, B.; Midgley, S. E.

2013-01-01

As the number of new enteroviruses and human parechoviruses seems ever growing, the necessity for updated diagnostics is relevant. We have updated an enterovirus assay and combined it with a previously published assay for human parechovirus resulting in a multiplex one-step RT-PCR assay....... The multiplex assay was validated by analysing the sensitivity and specificity of the assay compared to the respective monoplex assays, and a good concordance was found. Furthermore, the enterovirus assay was able to detect 42 reference strains from all 4 species, and an additional 9 genotypes during panel...... testing and routine usage. During 15 months of routine use, from October 2008 to December 2009, we received and analysed 2187 samples (stool samples, cerebrospinal fluids, blood samples, respiratory samples and autopsy samples) were tested, from 1546 patients and detected enteroviruses and parechoviruses...

Use of Multiplex PCR for Diagnosis of Bacterial Infection Respiratory Mixed

Directory of Open Access Journals (Sweden)

Al-ssum, R. M.

2010-01-01

Full Text Available Atypical bacteria grow very slowly in culture or they do not grow at all leading to delays in detection and diagnosis. PCR multiplex was performed on template DNAs extracted from seventy three collected specimens. Thirty seven showed positive indication for the presence of bacterial infection. The incidence of Mycoplasma pneumoniae, Chlamydia pneumonia and Legionella pneumophila as a single infecting agent was 31.5%, 27.5% and 20 % respectively. Dual agent infection caused by Mycoplasma + Chlamydia, Mycoplasma + Legionella and Legionella + Chlamydia was 24%, 20% and 15% respectively. Triple agent infection caused by Legionella + Mycoplasma + Chlamydia was 17.5%. The etiology of the infection was M. pneumoniae, L. pneumophila or C. pneumoniae as a single etiology or in combination of two or three organisms.

Genomic Characterization of Flavobacterium psychrophilum Serotypes and Development of a Multiplex PCR-Based Serotyping Scheme

Directory of Open Access Journals (Sweden)

Tatiana Rochat

2017-09-01

Full Text Available Flavobacterium psychrophilum is a devastating bacterial pathogen of salmonids reared in freshwater worldwide. So far, serological diversity between isolates has been described but the underlying molecular factors remain unknown. By combining complete genome sequence analysis and the serotyping method proposed by Lorenzen and Olesen (1997 for a set of 34 strains, we identified key molecular determinants of the serotypes. This knowledge allowed us to develop a robust multiplex PCR-based serotyping scheme, which was applied to 244 bacterial isolates. The results revealed a striking association between PCR-serotype and fish host species and illustrate the use of this approach as a simple and cost-effective method for the determination of F. psychrophilum serogroups. PCR-based serotyping could be a useful tool in a range of applications such as disease surveillance, selection of salmonids for bacterial coldwater disease resistance and future vaccine formulation.

Nested-PCR and a new ELISA-based NovaLisa test kit for malaria diagnosis in an endemic area of Thailand.

Science.gov (United States)

Thongdee, Pimwan; Chaijaroenkul, Wanna; Kuesap, Jiraporn; Na-Bangchang, Kesara

2014-08-01

Microscopy is considered as the gold standard for malaria diagnosis although its wide application is limited by the requirement of highly experienced microscopists. PCR and serological tests provide efficient diagnostic performance and have been applied for malaria diagnosis and research. The aim of this study was to investigate the diagnostic performance of nested PCR and a recently developed an ELISA-based new rapid diagnosis test (RDT), NovaLisa test kit, for diagnosis of malaria infection, using microscopic method as the gold standard. The performance of nested-PCR as a malaria diagnostic tool is excellent with respect to its high accuracy, sensitivity, specificity, and ability to discriminate Plasmodium species. The sensitivity and specificity of nested-PCR compared with the microscopic method for detection of Plasmodium falciparum, Plasmodium vivax, and P. falciparum/P. vivax mixed infection were 71.4 vs 100%, 100 vs 98.7%, and 100 vs 95.0%, respectively. The sensitivity and specificity of the ELISA-based NovaLisa test kit compared with the microscopic method for detection of Plasmodium genus were 89.0 vs 91.6%, respectively. NovaLisa test kit provided comparable diagnostic performance. Its relatively low cost, simplicity, and rapidity enables large scale field application.

High throughput multiplex real time PCR assay for the simultaneous quantification of DNA and RNA viruses infecting cassava plants

OpenAIRE

Otti, Gerald; Bouvaine, Sophie; Kimata, Bernadetha; Mkamillo, Geoffrey; Kumar, Lava; Tomlins, Keith; Maruthi, M.N.

2016-01-01

Aims: To develop a multiplex TaqMan-based real-time PCR assay (qPCR) for the simultaneous detection and quantification of both RNA and DNA viruses affecting cassava (Manihot esculenta) in eastern Africa.\\ud \\ud Methods and Results: The diagnostic assay was developed for two RNA viruses; Cassava brown streak virus (CBSV) and Uganda cassava brown streak virus (UCBSV) and two predominant DNA viruses; African cassava mosaic virus (ACMV) and East African cassava mosaic virus (EACMV), which cause t...

Detection and serotyping of dengue virus in serum samples by multiplex reverse transcriptase PCR-ligase detection reaction assay.

Science.gov (United States)

Das, S; Pingle, M R; Muñoz-Jordán, J; Rundell, M S; Rondini, S; Granger, K; Chang, G-J J; Kelly, E; Spier, E G; Larone, D; Spitzer, E; Barany, F; Golightly, L M

2008-10-01

The detection and successful typing of dengue virus (DENV) from patients with suspected dengue fever is important both for the diagnosis of the disease and for the implementation of epidemiologic control measures. A technique for the multiplex detection and typing of DENV serotypes 1 to 4 (DENV-1 to DENV-4) from clinical samples by PCR-ligase detection reaction (LDR) has been developed. A serotype-specific PCR amplifies the regions of genes C and E simultaneously. The two amplicons are targeted in a multiplex LDR, and the resultant fluorescently labeled ligation products are detected on a universal array. The assay was optimized using 38 DENV strains and was evaluated with 350 archived acute-phase serum samples. The sensitivity of the assay was 98.7%, and its specificity was 98.4%, relative to the results of real-time PCR. The detection threshold was 0.017 PFU for DENV-1, 0.004 PFU for DENV-2, 0.8 PFU for DENV-3, and 0.7 PFU for DENV-4. The assay is specific; it does not cross-react with the other flaviviruses tested (West Nile virus, St. Louis encephalitis virus, Japanese encephalitis virus, Kunjin virus, Murray Valley virus, Powassan virus, and yellow fever virus). All but 1 of 26 genotypic variants of DENV serotypes in a global DENV panel from different geographic regions were successfully identified. The PCR-LDR assay is a rapid, sensitive, specific, and high-throughput technique for the simultaneous detection of all four serotypes of DENV.

Development of genomic microsatellite multiplex PCR using dye-labeled universal primer and its validation in pedigree analysis of Pacific oyster ( Crassostrea gigas)

Science.gov (United States)

Liu, Ting; Li, Qi; Song, Junlin; Yu, Hong

2017-02-01

There is an increasing requirement for traceability of aquaculture products, both for consumer protection and for food safety. There are high error rates in the conventional traceability systems depending on physical labels. Genetic traceability technique depending on DNA-based tracking system can overcome this problem. Genealogy information is essential for genetic traceability, and microsatellite DNA marker is a good choice for pedigree analysis. As increasing genotyping throughput of microsatellites, microsatellite multiplex PCR has become a fast and cost-effective technique. As a commercially important cultured aquatic species, Pacific oyster Crassostrea gigas has the highest global production. The objective of this study was to develop microsatellite multiplex PCR panels with dye-labeled universal primer for pedigree analysis in C. gigas, and these multiplex PCRs were validated using 12 full-sib families with known pedigrees. Here we developed six informative multiplex PCRs using 18 genomic microsatellites in C. gigas. Each multiplex panel contained a single universal primer M13(-21) used as a tail on each locus-specific forward primer and a single universal primer M13(-21) labeled with fluorophores. The polymorphisms of the markers were moderate, with an average of 10.3 alleles per locus and average polymorphic information content of 0.740. The observed heterozygosity per locus ranged from 0.492 to 0.822. Cervus simulations revealed that the six panels would still be of great value when massive families were analysed. Pedigree analysis of real offspring demonstrated that 100% of the offspring were unambiguously allocated to their parents when two multiplex PCRs were used. The six sets of multiplex PCRs can be an important tool for tracing cultured individuals, population genetic analysis, and selective breeding program in C. gigas.

Combined use of real-time PCR and nested sequence-based typing in survey of human Legionella infection.

Science.gov (United States)

Qin, T; Zhou, H; Ren, H; Shi, W; Jin, H; Jiang, X; Xu, Y; Zhou, M; Li, J; Wang, J; Shao, Z; Xu, X

2016-07-01

Legionnaires' disease (LD) is a globally distributed systemic infectious disease. The burden of LD in many regions is still unclear, especially in Asian countries including China. A survey of Legionella infection using real-time PCR and nested sequence-based typing (SBT) was performed in two hospitals in Shanghai, China. A total of 265 bronchoalveolar lavage fluid (BALF) specimens were collected from hospital A between January 2012 and December 2013, and 359 sputum specimens were collected from hospital B throughout 2012. A total of 71 specimens were positive for Legionella according to real-time PCR focusing on the 5S rRNA gene. Seventy of these specimens were identified as Legionella pneumophila as a result of real-time PCR amplification of the dotA gene. Results of nested SBT revealed high genetic polymorphism in these L. pneumophila and ST1 was the predominant sequence type. These data revealed that the burden of LD in China is much greater than that recognized previously, and real-time PCR may be a suitable monitoring technology for LD in large sample surveys in regions lacking the economic and technical resources to perform other methods, such as urinary antigen tests and culture methods.

Nested-PCR assay for detection of Schistosoma japonicum infection in domestic animals.

Science.gov (United States)

Zhang, Xin; He, Chuan-Chuan; Liu, Jin-Ming; Li, Hao; Lu, Ke; Fu, Zhi-Qiang; Zhu, Chuan-Gang; Liu, Yi-Ping; Tong, Lai-Bao; Zhou, De-Bao; Zha, Li; Hong, Yang; Jin, Ya-Mei; Lin, Jiao-Jiao

2017-04-13

Schistosomiasis japonica is a common zoonosis. Domestic animals are the primary source of infection and play an important role in disease transmission. The prevalence and infectivity of this disease in domestic animals in China have significantly decreased and, for this reason, diagnostics with a higher sensitivity have become increasingly necessary. It was reported that polymerase chain reaction (PCR)-based methods could be used to detect schistosome infection in humans and animals and presented a high sensitivity and specificity. The present study aimed to develop a PCR-based method for detection of Schistosoma japonicum infection in domestic animals. A specific nested-PCR assay was developed to detect S. japonicum infection in domestic animals via amplification of a 231-bp DNA fragment of retrotransposon SjR2. The developed assay was first used in sera and dry blood filter paper (DBFP) from goats and buffaloes at different time points of infection. Then, 78 DBFPs from 39 artificially-infected bovines at 14 and 28 days post-infection and 42 DBFPs from schistosome-negative bovines from the city of Huangshan in the Anhui province were used to evaluate the diagnostic validity. Furthermore, this assay was used to detect S. japonicum infection in domestic animals in Dongzhi and Wangjiang counties. The expected PCR product was detected in eggs and adult worms of S. japonicum and blood samples from S. japonicum-infected goats and water buffaloes, but not from Fasciola and Haemonchus contortus worms. The nested-PCR assay could detect the target S. japonicum DNA in DBFPs from goats and buffaloes after day 3 post-infection. The sensitivity in buffaloes at 14 and 28 days post-infection was 92.30% (36/39) and 100% (39/39), respectively. The specificity was 97.60% (41/42). The positivity rates in Dongzhi and Wangjiang counties were 6.00% and 8.00% in bovines and 22.00% and 16.67% in goats, respectively. The positivity rates in goats in both counties were higher than those

A new multiplex PCR for easy screening of methicillin-resistant Staphylococcus aureus SCCmec types I-V

DEFF Research Database (Denmark)

Boye, Kit; Bartels, Mette Damkjær; Andersen, Ina S

2007-01-01

A multiplex PCR with four primer-pairs was designed to identify the five main known SCCmec types. A clear and easily discriminated band pattern was obtained for all five types. The SCCmec type was identified for 98% of 312 clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA......). SCCmec type IV was by far the most common SCCmec type among both hospital- and community-acquired MRSA isolates in Denmark....

Comparative study of Gram stain, potassium hydroxide smear, culture and nested PCR in the diagnosis of fungal keratitis.

Science.gov (United States)

Badiee, Parisa; Nejabat, Mahmood; Alborzi, Abdolvahab; Keshavarz, Fatemeh; Shakiba, Elaheh

2010-01-01

This study seeks to evaluate the efficacy and practicality of the molecular method, compared to the standard microbiological techniques for diagnosing fungal keratitis (FK). Patients with eye findings suspected of FK were enrolled for cornea sampling. Scrapings from the affected areas of the infected corneas were obtained and were divided into two parts: one for smears and cultures, and the other for nested PCR analysis. Of the 38 eyes, 28 were judged to have fungal infections based on clinical and positive findings in the culture, smear and responses to antifungal treatment. Potassium hydroxide, Gram staining, culture and nested PCR results (either positive or negative) matched in 76.3, 42.1, 68.4 and 81.6%, respectively. PCR is a sensitive method but due to the lack of sophisticated facilities in routine laboratory procedures, it can serve only complementarily and cannot replace conventional methods. Copyright © 2010 S. Karger AG, Basel.

Application of multiplex PCR for the simultaneous detection of Taenia spp. from domestic dogs in the north of Iran

Directory of Open Access Journals (Sweden)

Rahimi M.T.

2016-09-01

Full Text Available The family Taeniidae is of great importance in the medical and veterinary fields, particularly in the tropics and subtropics. Identification of eggs of different Taenia spp. in the final host by morphological examination is difficult owing to their similarity. Therefore, a multiplex polymerase chain reaction (PCR targeting a mitochondrial gene was applied to identify morphologically indistinguishable eggs. Fecal samples from 100 domestic dogs, from the Mazandaran province in Iran, were examined using the flotation/sieving method followed by multiplex PCR. Taeniid eggs were observed in 24 % samples, of which 12 %, 10 %, and 2 % were infected with Echinococcus granulosus, Taenia spp., and both E. granulosus and Taenia spp., respectively. E. multilocularis was absent in these samples. The prevalence of E. granulosus in the examined domestic dogs as definitive hosts in north of Iran was high (14 %. Therefore, people living in this region of Iran are in danger of acquiring hydatid cyst, which is a serious public health problem.

Identification of Mycobacterium tuberculosis in Clinical Specimens of Patients Suspected of Having Extrapulmonary Tuberculosis by Application of Nested PCR on Five Different Genes.

Science.gov (United States)

Khosravi, Azar D; Alami, Ameneh; Meghdadi, Hossein; Hosseini, Atta A

2017-01-01

Definitive and rapid diagnosis of extrapulmonary tuberculosis (EPTB) is challenging since conventional techniques have limitations due to the paucibacillary nature of the disease. To increase the sensitivity of detection of Mycobacterium tuberculosis (MTB) in EPTB specimens, we performed a nested PCR assay targeting several genes of MTB on EPTB specimens. A total of 100 clinical specimens from suspected cases of EPTB were processed. Standard staining for acid fast bacilli (AFB) was performed as the preliminary screening test. Extracted DNAs from specimens were subjected to Nested PCR technique for the detection of five different MTB target genes of IS6110, IS1081, hsp65kd, mbp64 , and mtp40 . On performing AFB staining, only 13% of specimens were positive, of which ascites fluid (33.3%), followed by pleural effusion (30.8%) showed the greatest AFB positivity rate. We demonstrated slight improvement in yields in lymph node which comprised the majority of specimens in this study, by employing PCR targeted to IS6110 - and hsp65-genes in comparison to AFB staining. However, the yields in ascites fluid and pleural effusion were not substantially improved by PCR, but those from bone and wound were, as in nested PCR employing either gene, the same positivity rate were obtained for ascites fluid (33.3%), while for pleural effusion specimens only IS1081 based PCR showed identical positivity rate with AFB stain (30.8%). The results for bone and wound specimens, however, demonstrated an improved yield mainly by employing IS1081 gene. Here, we report higher detection rate of EPTB in clinical specimens using five different targeted MTB genes. This nested PCR approach facilitates the comparison and the selection of the most frequently detected genes. Of course this study demonstrated the priority of IS1081 followed by mtp40 and IS6110 , among the five tested genes and indicates the effectiveness of any of the three genes in the design of an efficient nested-PCR test that

Emulsion preparation for novel micro-porous polymeric hemi-shells

CSIR Research Space (South Africa)

Naidoo, Kersch

2008-01-01

Full Text Available -dichloromethane (DCM) oil phase , micro-porous hemi-shells formed as solvent evaporated. CO2 gas ) 252–254 www.elsevier.com/locate/matlet Polycaprolactone hemi-shells were prepared by using an O/W technique. PCL (15% w/v) was fully dissolved in 10ml DCM (oil 253K...-averaged particle size and hemi-shell yield with solvent evaporation time. (ImageJ, NIH), the number-average particle size and yield of hemi-shells were obtained with increasing time intervals (n=200). Scanning electron microscopy (LEO 1525 field emis- sion SEM...

Comparison of ELISA and RT-PCR for the detection of Prunus necrotic ring spot virus and prune dwarf virus in almond (Prunus dulcis).

Science.gov (United States)

Mekuria, Genet; Ramesh, Sunita A; Alberts, Evita; Bertozzi, Terry; Wirthensohn, Michelle; Collins, Graham; Sedgley, Margaret

2003-12-01

A technique based on the reverse transcriptase-polymerase chain reaction (RT-PCR) has been developed to detect the presence of Prunus necrotic ringspot virus (PNRSV) and prune dwarf virus (PDV) simultaneously in almond. This paper presents the results of a 3-year study comparing both enzyme-linked immunosorbent assay (ELISA) and RT-PCR for the detection of PNRSV and PDV using 175 almond leaf samples. Multiplex RT-PCR was found to be more sensitive than ELISA, especially when followed by nested PCR for the detection of PDV. The RT-PCR technique has the added advantage that plant material can be tested at any time throughout the growing season.

Multiplex real-time PCR SYBR Green for detection and typing of group III Clostridium botulinum.

Science.gov (United States)

Anniballi, Fabrizio; Auricchio, Bruna; Delibato, Elisabetta; Antonacci, Monia; De Medici, Dario; Fenicia, Lucia

2012-01-27

Clostridium botulinum type C and type D belonging to the group III organisms, are mainly responsible for animal botulism outbreaks. Clinical signs alone are often insufficient to make a diagnosis of botulism and a laboratory confirmation is required. Laboratory confirmation can be performed by demonstrating the presence of botulinum neurotoxins in serum, gastrointestinal contents, liver, wound of sick or dead animals, or by demonstrating the presence of C. botulinum in gastrointestinal contents, liver, and wound. Demonstration of spores in gastrointestinal contents or tissue of animals with clinical signs indicative of botulism reinforces the clinical diagnosis. With the aim of detecting and typing C. botulinum group III organisms, a multiplex real-time PCR SYBR Green was developed and in-house validated. Selectivity, limit of detection, relative accuracy, relative specificity, relative sensitivity, and repeatability of the method were investigated. The multiplex real-time PCR SYBR green used showed a 100% selectivity, 100% relative accuracy, 100% relative specificity, 100% relative sensitivity and a limit of detection of 277 and 580 DNA copies for C. botulinum type C and C. botulinum type D, respectively. The method reported here represents a suitable tool for laboratory diagnosis of type C and D botulism and for testing a large number of samples collected during the animal botulism surveillance and prevention activities. Copyright © 2011 Elsevier B.V. All rights reserved.

Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products.

Science.gov (United States)

Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

2009-01-01

PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.

Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specific primers derived from the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA.

Science.gov (United States)

Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K

2000-06-15

Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.

Mutation spectrum of 122 hemophilia A families from Taiwanese population by LD-PCR, DHPLC, multiplex PCR and evaluating the clinical application of HRM

Directory of Open Access Journals (Sweden)

Chang Chieh-Ting

2008-06-01

Full Text Available Abstract Background Hemophilia A represents the most common and severe inherited hemorrhagic disorder. It is caused by mutations in the F8 gene, which leads to a deficiency or dysfunctional factor VIII protein, an essential cofactor in the factor X activation complex. Methods We used long-distance polymerase chain reaction and denaturing high performance liquid chromatography for mutation scanning of the F8 gene. We designed the competitive multiplex PCR to identify the carrier with exonal deletions. In order to facilitate throughput and minimize the cost of mutation scanning, we also evaluated a new mutation scanning technique, high resolution melting analysis (HRM, as an alternative screening method. Results We presented the results of detailed screening of 122 Taiwanese families with hemophilia A and reported twenty-nine novel mutations. There was one family identified with whole exons deletion, and the carriers were successfully recognized by multiplex PCR. By HRM, the different melting curve patterns were easily identified in 25 out of 28 cases (89% and 15 out of 15 (100% carriers. The sensitivity was 93 % (40/43. The overall mutation detection rate of hemophilia A was 100% in this study. Conclusion We proposed a diagnostic strategy for hemophilia A genetic diagnosis. We consider HRM as a powerful screening tool that would provide us with a more cost-effective protocol for hemophilia A mutation identification.

Detecting the presence of infectious hepatitis A virus in molluscs positive to RT-nested-PCR

NARCIS (Netherlands)

Medici, de D.; Croci, L.; Pasquale, di S.; Fiore, A.; Toti, L.

2001-01-01

Aims: The objective of this study was to det. the presence of infectious hepatitis A virus (HAV) in molluscs naturally contaminated with viral HAV-RNA. Methods and Results: One hundred and forty-two mollusc samples were analyzed for the presence of viral HAV-RNA using RT-nested-PCR; pos. samples

Detection of Talaromyces marneffei from Fresh Tissue of an Inhalational Murine Pulmonary Model Using Nested PCR.

Directory of Open Access Journals (Sweden)

Yinghui Liu

Full Text Available Penicilliosis marneffei, often consecutive to the aspiration of Talaromyces marneffei (Penicillium marneffei, continues to be one of the significant causes of morbidity and mortality in immunocompromised patients in endemic regions such as Southeast Asia. Improving the accuracy of diagnosing this disease would aid in reducing the mortality of associated infections. In this study, we developed a stable and reproducible murine pulmonary model that mimics human penicilliosis marneffei using a nebulizer to deliver Talaromyces marneffei (SUMS0152 conidia to the lungs of BALB/c nude mice housed in exposure chamber. Using this model, we further revealed that nested PCR was sensitive and specific for detecting Talaromyces marneffei in bronchoalveolar lavage fluid and fresh tissues. This inhalation model may provide a more representative analysis tool for studying the development of penicilliosis marneffei, in addition to revealing that nested PCR has a predictive value in reflecting pulmonary infection.

Detection of Talaromyces marneffei from Fresh Tissue of an Inhalational Murine Pulmonary Model Using Nested PCR

Science.gov (United States)

Liu, Yinghui; Huang, Xiaowen; Yi, Xiuwen; He, Ya; Mylonakis, Eleftherios; Xi, Liyan

2016-01-01

Penicilliosis marneffei, often consecutive to the aspiration of Talaromyces marneffei (Penicillium marneffei), continues to be one of the significant causes of morbidity and mortality in immunocompromised patients in endemic regions such as Southeast Asia. Improving the accuracy of diagnosing this disease would aid in reducing the mortality of associated infections. In this study, we developed a stable and reproducible murine pulmonary model that mimics human penicilliosis marneffei using a nebulizer to deliver Talaromyces marneffei (SUMS0152) conidia to the lungs of BALB/c nude mice housed in exposure chamber. Using this model, we further revealed that nested PCR was sensitive and specific for detecting Talaromyces marneffei in bronchoalveolar lavage fluid and fresh tissues. This inhalation model may provide a more representative analysis tool for studying the development of penicilliosis marneffei, in addition to revealing that nested PCR has a predictive value in reflecting pulmonary infection. PMID:26886887

Simultaneous Detection of CDC Category "A" DNA and RNA Bioterrorism Agents by Use of Multiplex PCR & RT-PCR Enzyme Hybridization Assays

Directory of Open Access Journals (Sweden)

Kelly J. Henrickson

2009-10-01

Full Text Available Assays to simultaneously detect multiple potential agents of bioterrorism are limited. Two multiplex PCR and RT-PCR enzyme hybridization assays (mPCR-EHA, mRT-PCR-EHA were developed to simultaneously detect many of the CDC category “A” bioterrorism agents. The “Bio T” DNA assay was developed to detect: Variola major (VM, Bacillus anthracis (BA, Yersinia pestis (YP, Francisella tularensis (FT and Varicella zoster virus (VZV. The “Bio T” RNA assay (mRT-PCR-EHA was developed to detect: Ebola virus (Ebola, Lassa fever virus (Lassa, Rift Valley fever (RVF, Hantavirus Sin Nombre species (HSN and dengue virus (serotypes 1-4. Sensitivity and specificity of the 2 assays were tested by using genomic DNA, recombinant plasmid positive controls, RNA transcripts controls, surrogate (spiked clinical samples and common respiratory pathogens. The analytical sensitivity (limit of detection (LOD of the DNA asssay for genomic DNA was 1×100~1×102 copies/mL for BA, FT and YP. The LOD for VZV whole organism was 1×10-2 TCID50/mL. The LOD for recombinant controls ranged from 1×102~1×103copies/mL for BA, FT, YP and VM. The RNA assay demonstrated LOD for RNA transcript controls of 1×104~1×106 copies/mL without extraction and 1×105~1×106 copies/mL with extraction for Ebola, RVF, Lassa and HSN. The LOD for dengue whole organisms was ~1×10-4 dilution for dengue 1 and 2, 1×104 LD50/mL and 1×102 LD50/mL for dengue 3 and 4. The LOD without extraction for recombinant plasmid DNA controls was ~1×103 copies/mL (1.5 input copies/reaction for Ebola, RVF, Lassa and HSN. No cross-reactivity of primers and probes used in both assays was detected with common respiratory pathogens or between targeted analytes. Clinical sensitivity was estimated using 264 surrogate clinical samples tested with the BioT DNA assay and 549 samples tested with the BioT RNA assay. The clinical specificity is 99.6% and 99.8% for BioT DNA assay and BioT RNA assay, respectively. The

Simultaneous Detection of Brown Rot- and Soft Rot-Causing Bacterial Pathogens from Potato Tubers Through Multiplex PCR.

Science.gov (United States)

Ranjan, R K; Singh, Dinesh; Baranwal, V K

2016-11-01

Ralstonia solanacearum (Smith) Yabuuchi et al. and Erwinia carotovora subsp. carotovora (Jones) Bergey et al. (Pectobacterium carotovorum subsp. carotovorum) are the two major bacterial pathogens of potato causing brown rot (wilt) and soft rot diseases, respectively, in the field and during storage. Reliable and early detection of these pathogens are keys to avoid occurrence of these diseases in potato crops and reduce yield loss. In the present study, multiplex polymerase chain reaction (PCR) protocol was developed for simultaneous detection of R. solanacearum and E. carotovora subsp. carotovora from potato tubers. A set of oligos targeting the pectatelyase (pel) gene of E. carotovora subsp. carotovora and the universal primers based on 16S r RNA gene of R. solanacearum were used. The standardized multiplex PCR protocol could detect R. solanacearum and E. carotovora subsp. carotovora up to 0.01 and 1.0 ng of genomic DNA, respectively. The protocol was further validated on 96 stored potato tuber samples, collected from different potato-growing states of India, viz. Uttarakhand, Odisha, Meghalaya and Delhi. 53.1 % tuber samples were positive for R. solanacearum, and 15.1 % of samples were positive for E. carotovora subsp. carotovora, and both the pathogens were positive in 26.0 % samples when BIO-PCR was used. This method offers sensitive, specific, reliable and fast detection of two major bacterial pathogens from potato tubers simultaneously, particularly pathogen-free seed certification in large scale.

A comparison between the efficiency of the Xpert MTB/RIF assay and nested PCR in identifying Mycobacterium tuberculosis during routine clinical practice.

Science.gov (United States)

Kim, Cheol-Hong; Woo, Heungjeong; Hyun, In Gyu; Kim, Changhwan; Choi, Jeong-Hee; Jang, Seung-Hun; Park, Sang Myeon; Kim, Dong-Gyu; Lee, Myung Goo; Jung, Ki-Suck; Hyun, Jeongwon; Kim, Hyun Soo

2014-06-01

Polymerase chain reaction (PCR) for the detection of Mycobacterium tuberculosis (MTB) is more sensitive, specific, and rapid than the conventional methods of acid-fast bacilli (AFB) smear and culture. The aim of this study was to determine if the Xpert MTB/rifampicin (RIF) assay had additional advantages over nested PCR for the detection of MTB in a geographical area with intermediate tuberculosis (TB) incidence. Between February and December 2013, the Xpert MTB/RIF assay and MTB nested PCR, as well as AFB smear and culture, were simultaneously performed on 198 clinical samples (160 pulmonary and 38 non-pulmonary specimens) collected from 171 patients hospitalized at Hallym University Medical Center for possible TB. The accuracy of the diagnosis of MTB culture-positive TB and the turnaround time of reporting laboratory results were calculated and compared. Rifampin resistance by the Xpert MTB/RIF assay was reviewed with that of conventional drug susceptibility testing (DST). The sensitivity, specificity, and positive and negative predictive values of the Xpert MTB/RIF assay and MTB nested PCR for diagnosis of MTB culture-positive pulmonary TB were 86.1% vs. 69.4% (P=0.1563), 97.8% vs. 94.1% (P=0.2173), 91.2% vs. 75.8% (P=0.1695), and 96.4% vs. 92.0% (P=0.2032), respectively. The median turnaround times of the Xpert MTB/RIF assay and MTB nested PCR were 0 [0-4] days and 4 [1-11] days, respectively (Pnested PCR for identifying MTB among clinically suspected TB patients, and the assay can be valuable in giving a timely identification of resistance to rifampin.

Determination of foodborne pathogenic bacteria by multiplex PCR-microchip capillary electrophoresis with genetic algorithm-support vector regression optimization.

Science.gov (United States)

Li, Yongxin; Li, Yuanqian; Zheng, Bo; Qu, Lingli; Li, Can

2009-06-08

A rapid and sensitive method based on microchip capillary electrophoresis with condition optimization of genetic algorithm-support vector regression (GA-SVR) was developed and applied to simultaneous analysis of multiplex PCR products of four foodborne pathogenic bacteria. Four pairs of oligonucleotide primers were designed to exclusively amplify the targeted gene of Vibrio parahemolyticus, Salmonella, Escherichia coli (E. coli) O157:H7, Shigella and the quadruplex PCR parameters were optimized. At the same time, GA-SVR was employed to optimize the separation conditions of DNA fragments in microchip capillary electrophoresis. The proposed method was applied to simultaneously detect the multiplex PCR products of four foodborne pathogenic bacteria under the optimal conditions within 8 min. The levels of detection were as low as 1.2 x 10(2) CFU mL(-1) of Vibrio parahemolyticus, 2.9 x 10(2) CFU mL(-1) of Salmonella, 8.7 x 10(1) CFU mL(-1) of E. coli O157:H7 and 5.2 x 10(1) CFU mL(-1) of Shigella, respectively. The relative standard deviation of migration time was in the range of 0.74-2.09%. The results demonstrated that the good resolution and less analytical time were achieved due to the application of the multivariate strategy. This study offers an efficient alternative to routine foodborne pathogenic bacteria detection in a fast, reliable, and sensitive way.

A multiplex PCR assay for simultaneous detection of Escherichia coli O157:H7, Bacillus cereus, Vibrio parahaemolyticus, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus in Korean ready-to-eat food.

Science.gov (United States)

Lee, Nari; Kwon, Kyung Yoon; Oh, Su Kyung; Chang, Hyun-Joo; Chun, Hyang Sook; Choi, Sung-Wook

2014-07-01

A multiplex polymerase chain reaction (PCR) assay was developed for simultaneous detection of Escherichia coli O157:H7, Bacillus cereus, Vibrio parahaemolyticus, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus in various Korean ready-to-eat foods. The six specific primer pairs for multiplex PCR were selected based on the O157 antigen (rfbE) gene of E. coli O157:H7, the DNA gyrase subunit B (gyrB) gene of B. cereus, the toxin regulatory protein (toxR) gene of V. parahaemolyticus, the invasion protein A (invA) gene of Salmonella spp., the hemolysin (hly) gene of L. monocytogenes, and the thermonuclease (nuc) gene of S. aureus. The 16S rRNA gene was targeted as an internal control gene in the presence of bacterial DNA. The specificity and sensitivity assays for multiplex primer pairs were investigated by testing different strains. When this multiplex PCR assay was applied to evaluate the validity of detecting six foodborne pathogens in artificially inoculated several ready-to-eat food samples, the assay was able to specifically simultaneously detect as few as 1 colony-forming unit/mL of each pathogen after enrichment for 12 h. Their presence in naturally contaminated samples also indicates that the developed multiplex PCR assay is an effective and informative supplement for practical use.

Ultra-fast DNA-based multiplex convection PCR method for meat species identification with possible on-site applications.

Science.gov (United States)

Song, Kyung-Young; Hwang, Hyun Jin; Kim, Jeong Hee

2017-08-15

The aim of this study was to develop an ultra-fast molecular detection method for meat identification using convection Palm polymerase chain reaction (PCR). The mitochondrial cytochrome b (Cyt b) gene was used as a target gene. Amplicon size was designed to be different for beef, lamb, and pork. When these primer sets were used, each species-specific set specifically detected the target meat species in singleplex and multiplex modes in a 24min PCR run. The detection limit was 1pg of DNA for each meat species. The convection PCR method could detect as low as 1% of meat adulteration. The stability of the assay was confirmed using thermal processed meats. We also showed that direct PCR can be successfully performed with mixed meats and food samples. These results suggest that the developed assay may be useful in the authentication of meats and meat products in laboratory and rapid on-site applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

Detection of Salmonella enterica Serovar Typhimurium from Avians Using Multiplex-PCR

Directory of Open Access Journals (Sweden)

Alireza Talebi

2011-09-01

Full Text Available Abstract Salmonella enterica serovar Typhimurium and S.enterica serovar Enteritidis are the most frequently isolated serovars from food-borne diseases throughout the world. According to their antigenic profiles, salmonella shows different disease syndromes and host specificities. It is necessary and important to discriminate salmonella serovars from each other in order to ensure that each pathogen and its epidemiology are correctly recognized. Many PCR-based methods have been developed to identify salmonella serovars. The objective of present study was to identify S. Typhimurium in avians from different regions including: North, Northwest and capital city (Tehran of Iran. Also in this research, the quality of CHROMagar™ Salmonella medium (CAS medium in veterinary medicine was evaluated. The results of present study showed that out of 1870 intestine samples, fifty two S. Typhimurium including broiler (n=13, layer (n=12, duck (n=5, goose (n=5, sparrow (n=8, canary (n=3, pigeon (n=5 and African grey parrot (n=1 were identified using serotyping as well as multiplex-PCR. In conclusion, important measures must be taken on prevention and propagation of S. Typhimurium among avians. CHROMagar™ Salmonella medium has high levels of sensitivity and specificity and reduced the time to final identification of salmonella spp. in comparison with biochemical tests.

Multiplex PCR for specific and robust detection of Xanthomonas campestris pv. musacearum in pure culture and infected plant material

DEFF Research Database (Denmark)

Adriko, John; Aritua, V.; Mortensen, Carmen Nieves

2012-01-01

The present study developed a pathovar-specific PCR for the detection of Xanthomonas campestris pv. musacearum (Xcm), the cause of banana xanthomonas wilt, by amplification of a 265-bp region of the gene encoding the general secretion pathway protein D (GspD). A distinct DNA fragment......-specific PCR was successfully multiplexed with internal control primers targeting 16S rDNA for application on DNA from bacterial cultures and with primers targeting plant mitochondrial 26S rDNA for application on DNA extracted from plant material. Diagnostic discrimination of healthy and infected plants...

Multiplex hydrolysis probe real-time PCR for simultaneous detection of hepatitis A virus and hepatitis E virus.

Science.gov (United States)

Qiu, Feng; Cao, Jingyuan; Su, Qiudong; Yi, Yao; Bi, Shengli

2014-05-30

Detection of hepatitis viral infections has traditionally relied on the circulating antibody test using the enzyme-linked immunosorbent assay. However, multiplex real-time PCR has been increasingly used for a variety of viral nucleic acid detections and has proven to be superior to traditional methods. Hepatitis A virus (HAV) and hepatitis E virus (HEV) are the major causes of acute hepatitis worldwide; both HAV and HEV infection are a main public health problem. In the present study, a one-step multiplex reverse transcriptase quantitative polymerase chain reaction assay using hydrolysis probes was developed for simultaneously detecting HAV and HEV. This novel detection system proved specific to the target viruses, to be highly sensitive and to be applicable to clinical sera samples, making it useful for rapid, accurate and feasible identification of HAV and HEV.

Comparison of loop-mediated isothermal amplification (LAMP) and nested-PCR assay targeting the RE and B1 gene for detection of Toxoplasma gondii in blood samples of children with leukaemia.

Science.gov (United States)

Fallahi, Shirzad; Seyyed Tabaei, Seyyed Javad; Pournia, Yadollah; Zebardast, Nozhat; Kazemi, Bahram

2014-07-01

Toxoplasmosis diagnosis constitutes an important measure for disease prevention and control. In this paper, a newly described DNA amplification technique, loop-mediated isothermal amplification (LAMP), and nested-PCR targeting the repeated element (RE) and B1 gene, were compared to each other for the detection of Toxoplasma gondii DNA in blood samples of children with leukaemia. One hundred ten blood samples from these patients were analyzed by LAMP and nested-PCR. Out of 50 seropositive samples (IgM+, IgG+), positive results were obtained with 92% and 86% on RE, B1-LAMP and 82% and 68% on RE, B1-nested PCR analyses, respectively. Of the 50 seronegative samples, three, two and one samples were detected positive by RE-LAMP, B1-LAMP and RE-nested PCR assays, respectively, while none were detected positive by B1-nested PCR. None of the 10 IgM-, IgG+ samples was detected positive after testing LAMP and nested-PCR assays in duplicate. This is the first report of a study in which the LAMP method was applied with high sensitivity and efficacy for the diagnosis of T. gonii in blood samples of children with leukaemia. Copyright © 2014 Elsevier Inc. All rights reserved.

The Prevalence of Human Papilloma Virus(HPV in Malignant Cervical Lesion, Using Multiplex PCR

Directory of Open Access Journals (Sweden)

M. R. Keyhkhaee

2006-07-01

Full Text Available Background: Cervical cancer is the second leading cause of cancer death among women. In this cancer, the effects of prevention, early diagnosis and treatment more than other cancers decrease the mortality rate. In 1970 human papilloma virus (HPV was introduction as major etiologic factor of cervical cancer. Different studies throughout the world revealed strong correlation between HPV and cancerous & precancerous changes in epithelial cells. Since cell culture and serological methods can not recognize the virus and its subtypes, the importance of the molecular methods including polymerase chain reaction (PCR in early and definite diagnosis of virus is obvious. Methods: In this study, after patient selection using the related protocol and completion of the questionnaires, 100 samples from cancer lesions of cervix selected. Then DNA extraction from paraffin blocks performed using standard method. Multiplex PCR with two pairs of primer (one as internal control performed and the PCR product run on 8% polyacrylamid gel. Results: The results showed that 73% of the tissues were infected by HPV. Conclusion: This finding confirm the previous results based of correlation between HPV,and cervical cancer.

The efficacy of a nested PCR in detecting cytochrome c oxidase subunit 1 gene of Sarcoptes scabiei var. Hominis for diagnosing scabies.

Science.gov (United States)

Hahm, J E; Kim, C W; Kim, S S

2018-04-06

A widespread scabies infestation, associated to long-term residence in nursing homes, is becoming a serious issue in developed countries. Mineral oil examination is regarded as the gold standard in diagnosing scabies, but the sensitivity of this method is generally low-approximately 50%. Molecular tests may contribute to enhance the sensitivity of current tests for laboratory diagnosis of human scabies. In this study, we developed new primers for a nested PCR for the cytochrome c oxidase subunit 1 (cox1) gene of Sarcoptes scabiei var. hominis to increase the sensitivity of a previously developed conventional PCR. Clinically suspected scabies patients underwent dermoscopy-guided skin scraping with microscopic examination. The diagnosis was positive for scabies when mites or eggs were found under the microscope, and patients were then designated as 'microscopy-positive'. Patients in the 'microscopy-negative' group presented with negative microscopic results. Skin scrapings were collected from both groups for PCR. Of the total 63 samples, 28 were microscopy-positive and 35 were negative with no differences in sex and age between the two groups. All microscopically proven scabies cases were positive with the cox1 nested PCR. Among microscopy-negative ones, S. scabiei DNA was detected in 9 samples. If sensitivity of the cox1 nested PCR is considered 100% (95% CI, 90.51-100), then sensitivity of microscopy is 75.68% (95% CI, 58.80-88.23; P = 0.004). Nested PCR can be successfully used as an alternative method for diagnosing suspected scabies patient. Therefore, infection control measures and treatments can be initiated before significant transmission occurs, minimizing the risk of outbreaks. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Diagnosis of theileria equi infections in horses in the Azores using cELISA and nested PCR

Science.gov (United States)

Equine piroplasmosis is a tick-borne disease of equids that is often caused by the parasite Theileria equi. We applied competitive ELISA (cELISA) and nested PCR diagnostic methods to detect this parasite in horses by screening 162 samples from mainland Portugal where the parasite is endemic, and 143...

Rapid PCR using nested primers of the 16S rRNA and the hippuricase (hipO) genes to detect Campylobacter jejuni and Campylobacter coli in environmental samples

DEFF Research Database (Denmark)

Bang, Dang Duong; Wedderkopp, A.; Pedersen, Karl

2002-01-01

sensitivity due to the use of selective media, the low number of bacteria in the samples and possibly also due to the presence of non-culturable or sub-lethally injured stages of the bacteria. The present paper describes a rapid PCR assay using nested primers of the 16S rRNA or the hippuricase (hipO) genes...... to detect Campylobacter jejuni and Campylobacter coli in environmental samples. The sensitivity of the nested PCR was determined to be 0.01 pg/PCR, corresponding to 2-3 colony forming units (cfu) per ml. The nested PCR assays were applied to detect C. jejuni and C. coli in 269 environmental samples...... collected from ten broiler farms. The sensitivity, specificity and the usefulness of the PCR assay for detection of C. jejuni and C coli in environmental samples are presented and discussed....

A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach.

Science.gov (United States)

Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S

2013-10-01

A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.

Detection and Quantification of the Entomopathogenic Fungal Endophyte Beauveria bassiana in Plants by Nested and Quantitative PCR.

Science.gov (United States)

Garrido-Jurado, Inmaculada; Landa, Blanca B; Quesada-Moraga, Enrique

2016-01-01

The described protocol allows detecting as low as 10 fg the entomopathogenic fungal endophyte Beauveria bassiana in host plants by using a two-step nested PCR with the ITS1F/ITS4 and BB.fw and BB.rv primer pairs. On the other hand, a qPCR protocol using BB.fw and BB.rv primers is also available allowing the quantification of up to 26 fg of B. bassiana DNA per 20 ng of leaf DNA.

Evaluation of the Roche LightMix Gastro parasites multiplex PCR assay detecting Giardia duodenalis, Entamoeba histolytica, cryptosporidia, Dientamoeba fragilis, and Blastocystis hominis.

Science.gov (United States)

Friesen, J; Fuhrmann, J; Kietzmann, H; Tannich, E; Müller, M; Ignatius, R

2018-03-23

Multiplex PCR assays offer highly sensitive and specific tools for the detection of enteric pathogens. This prospective study aimed at comparing the novel Roche LightMix Modular Assay Gastro Parasites (LMAGP) detecting Giardia duodenalis, Entamoeba histolytica, Cryptosporidium spp., Blastocystishominis, and Dientamoebafragilis with routine laboratory procedures. Stool specimens (n = 1062 from 1009 patients) were consecutively examined by LMAGP, R-Biopharm Ridascreen enzyme immunoassays (EIAs) detecting G. duodenalis or E. histolytica/dispar, and microscopy of wet mounts. Discrepant results were analysed by in-house PCR. D. fragilis or B. hominis were detected by LMAGP in 131 (14.4%) and 179 (19.9%; 16 samples positive by microscopy; p PCR). G. duodenalis was detected by LMAGP, EIA, or microscopy in 20, 16, or 9 of 1039 stool samples, respectively; all four samples missed by EIA were confirmed by in-house PCR. In total, 938 stool samples were analysed for E. histolytica/dispar. Nine of ten EIA-positive samples were negative by LMAGP but positive by in-house PCR for E. dispar. One E. histolytica infection (positive by both LMAGP and in-house PCR) was missed by EIA and microscopy. Parasites only detected by microscopy included Enterobius vermicularis eggs (n = 3) and apathogenic amoebae (n = 27). The data call for routine use of multiplex PCR assays for the detection of enteric protozoan parasites in laboratory diagnostics. Copyright © 2018 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Simultaneous detection of four garlic viruses by multiplex reverse transcription PCR and their distribution in Indian garlic accessions.

Science.gov (United States)

Majumder, S; Baranwal, V K

2014-06-01

Indian garlic is infected with Onion yellow dwarf virus (OYDV), Shallot latent virus (SLV), Garlic common latent virus (GarCLV) and allexiviruses. Identity and distribution of garlic viruses in various garlic accessions from different geographical regions of India were investigated. OYDV and allexiviruses were observed in all the garlic accessions, while SLV and GarCLV were observed only in a few accessions. A multiplex reverse transcription (RT)-PCR method was developed for the simultaneous detection and identification of OYDV, SLV, GarCLV and Allexivirus infecting garlic accessions in India. This multiplex protocol standardized in this study will be useful in indexing of garlic viruses and production of virus free seed material. Copyright © 2014 Elsevier B.V. All rights reserved.

Comparison of multiplex RT-PCR and real-time HybProbe assay for serotyping of dengue virus using reference strains and clinical samples from India

Directory of Open Access Journals (Sweden)

Anita Chakravarti

2016-01-01

Full Text Available Background: Dengue virus serotyping is crucial from clinical management and epidemiological point of view. Aims: To compare efficacy of two molecular detection and typing methods, namely, multiplex reverse transcription polymerase chain reaction (RT-PCR and real-time Hybprobe assay using a panel of known dilution of four reference Dengue virus strains and a panel of sera collected from clinically suspected dengue patients. Settings: This study was conducted at a tertiary-care teaching hospital in Delhi, India. Materials and Methods: Dengue serotype specific virus strains were used as prototypes for serotyping assays. Viral load was quantified by quantitative real time reverse transcription polymerase chain reaction (qRT-PCR. Acute phase serum samples were collected from 79 patients with clinically suspected Dengue fever on their first day of presentation during September-October 2012. Viral RNA from serum and cell culture supernatant was extracted. Reverse transcription was carried out. Quantitative detection of DENV RNA from reference strain culture supernatants and each of the 79 patient samples by real-time PCR was performed using light cycler Taqman master mix kit. Serotyping was done by multiplex RT-PCR assay and Hybprobe assay. Results: The multiplex RT-PCR assay, though found to be 100% specific, couldn't serotype either patient or reference strains with viral load less than 1000 RNA copies/ml. The Hybprobe assay was found to have 100% specificity and had a lower limit of serotype detection of merely 3.54 RNA copies/ml. Conclusions: HybProbe assay has an important role especially in situations where serotyping is to be performed in clinical samples with low viral load.

Production of bovine hand-made cloned embryos by zygote-oocyte cytoplasmic hemi-complementation.

Science.gov (United States)

Mezzalira, Joana Claudia; Ohlweiler, Lain Uriel; da Costa Gerger, Renato Pereira; Casali, Renata; Vieira, Fabiano Koerich; Ambrósio, Carlos Eduardo; Miglino, Maria Angélica; Rodrigues, José Luiz; Mezzalira, Alceu; Bertolini, Marcelo

2011-02-01

The aim of this study was to evaluate the effect of the cytoplast type and activation process on development of cloned embryos. Bovine oocytes (MII) or zygotes at the one-cell stage (IVF) were manually bisected and segregated in MII or IVF hemi-cytoplasts or hemi-karyoplasts. Adult skin cells from a bovine female were used as nucleus donors (SC). Experimental groups were composed of IVF embryos; parthenogenetic embryos; hand-made cloned (HMC) embryos; and reconstructed HMC embryos using IVF hemi-cytoplast + MII hemi-cytoplast + SC (G-I); IVF hemi-cytoplast + IVF hemi-cytoplast + SC (G-II); MII hemi-cytoplast + IVF hemi-karyoplast (G-III); and IVF hemi-cytoplast + IVF hemi-karyoplast (G-IV). Embryos from G-I to G-IV were allocated to subgroups as sperm-activated (SA) or were further chemically activated (SA + CA). Embryos from all groups and subgroups were in vitro cultured in the WOW system. Blastocyst development in subgroup G-I SA (28.2%) was similar to IVF (27.0%) and HMC (31.4%) controls, perhaps due to a to a more suitable activation process and/or better complementation of cytoplasmic reprogramming factors, with the other groups and subgroups having lower levels of development. No blastocyst development was observed when using IVF hemi-karyoplasts (G-III and G-IV), possibly due to the manipulation process during a sensitive biological period. In summary, the presence of cytoplasmic factors from MII hemi-oocytes and the sperm activation process from hemi-zygotes appear to be necessary for adequate in vitro development, as only the zygote-oocyte hemi-complementation was as efficient as controls for the generation of bovine cloned blastocysts.

A Nested PCR Assay to Avoid False Positive Detection of the Microsporidian Enterocytozoon hepatopenaei (EHP) in Environmental Samples in Shrimp Farms

Science.gov (United States)

Jaroenlak, Pattana; Sanguanrut, Piyachat; Williams, Bryony A. P.; Stentiford, Grant D.; Flegel, Timothy W.; Sritunyalucksana, Kallaya

2016-01-01

Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP) is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth and unprofitable harvests. Existing PCR detection methods target the EHP small subunit ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give false positive test results due to cross reactivity of the SSU-PCR primers with DNA from closely related microsporidia that infect other aquatic organisms. This is problematic for investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive and specific nested PCR method was developed for detection of the spore wall protein (SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive results from closely related microsporidia. The first PCR step of the SWP-PCR method was 100 times (104 plasmid copies per reaction vial) more sensitive than that of the existing SSU-PCR method (106 copies) but sensitivity was equal for both in the nested step (10 copies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepatopancreatic samples despite the lower sensitivity than the SWP-PCR method. However, due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be used to screen for EHP in feces, feed and environmental samples for potential EHP carriers. PMID:27832178

A Nested PCR Assay to Avoid False Positive Detection of the Microsporidian Enterocytozoon hepatopenaei (EHP) in Environmental Samples in Shrimp Farms.

Science.gov (United States)

Jaroenlak, Pattana; Sanguanrut, Piyachat; Williams, Bryony A P; Stentiford, Grant D; Flegel, Timothy W; Sritunyalucksana, Kallaya; Itsathitphaisarn, Ornchuma

2016-01-01

Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP) is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth and unprofitable harvests. Existing PCR detection methods target the EHP small subunit ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give false positive test results due to cross reactivity of the SSU-PCR primers with DNA from closely related microsporidia that infect other aquatic organisms. This is problematic for investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive and specific nested PCR method was developed for detection of the spore wall protein (SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive results from closely related microsporidia. The first PCR step of the SWP-PCR method was 100 times (104 plasmid copies per reaction vial) more sensitive than that of the existing SSU-PCR method (106 copies) but sensitivity was equal for both in the nested step (10 copies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepatopancreatic samples despite the lower sensitivity than the SWP-PCR method. However, due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be used to screen for EHP in feces, feed and environmental samples for potential EHP carriers.

Hemi-fused structure mediates and controls fusion and fission in live cells.

Science.gov (United States)

Zhao, Wei-Dong; Hamid, Edaeni; Shin, Wonchul; Wen, Peter J; Krystofiak, Evan S; Villarreal, Seth A; Chiang, Hsueh-Cheng; Kachar, Bechara; Wu, Ling-Gang

2016-06-23

Membrane fusion and fission are vital for eukaryotic life. For three decades, it has been proposed that fusion is mediated by fusion between the proximal leaflets of two bilayers (hemi-fusion) to produce a hemi-fused structure, followed by fusion between the distal leaflets, whereas fission is via hemi-fission, which also produces a hemi-fused structure, followed by full fission. This hypothesis remained unsupported owing to the lack of observation of hemi-fusion or hemi-fission in live cells. A competing fusion hypothesis involving protein-lined pore formation has also been proposed. Here we report the observation of a hemi-fused Ω-shaped structure in live neuroendocrine chromaffin cells and pancreatic β-cells, visualized using confocal and super-resolution stimulated emission depletion microscopy. This structure is generated from fusion pore opening or closure (fission) at the plasma membrane. Unexpectedly, the transition to full fusion or fission is determined by competition between fusion and calcium/dynamin-dependent fission mechanisms, and is notably slow (seconds to tens of seconds) in a substantial fraction of the events. These results provide key missing evidence in support of the hemi-fusion and hemi-fission hypothesis in live cells, and reveal the hemi-fused intermediate as a key structure controlling fusion and fission, as fusion and fission mechanisms compete to determine the transition to fusion or fission.

Development of a highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus 71 in hand, foot, and mouth disease.

Science.gov (United States)

Niu, Peihua; Qi, Shunxiang; Yu, Benzhang; Zhang, Chen; Wang, Ji; Li, Qi; Ma, Xuejun

2016-11-01

Enterovirus 71 (EV71) is one of the major causative agents of outbreaks of hand, foot, and mouth disease (HFMD). A commercial TaqMan probe-based real-time PCR assay has been widely used for the differential detection of EV71 despite its relatively high cost and failure to detect samples with a low viral load (Ct value > 35). In this study, a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of EV71 in HFMD was developed. The sensitivity and specificity of this assay were evaluated using a reference EV71 stock and a panel of controls consisting of coxsackievirus A16 (CVA16) and common respiratory viruses, respectively. The clinical performance of this assay was evaluated and compared with those of a commercial TaqMan probe-based real-time PCR (qRT-PCR) assay and a traditional two-step nested RT-PCR assay. The limit of detection for the RTN RT-PCR assay was 0.01 TCID50/ml, with a Ct value of 38.3, which was the same as that of the traditional two-step nested RT-PCR assay and approximately tenfold lower than that of the qRT-PCR assay. When testing the reference strain EV71, this assay showed favorable detection reproducibility and no obvious cross-reactivity. The testing results of 100 clinical throat swabs from HFMD-suspected patients revealed that 41 samples were positive for EV71 by both RTN RT-PCR and traditional two-step nested RT-PCR assays, whereas only 29 were EV71 positive by qRT-PCR assay.

Simultaneous differential detection of Chlamydophila abortus, Chlamydophila pecorum and Coxiella burnetii from aborted ruminant's clinical samples using multiplex PCR

Directory of Open Access Journals (Sweden)

Rodolakis Annie

2009-07-01

Full Text Available Abstract Background Chlamydiosis and Q fever, two zoonosis, are important causes of ruminants' abortion around the world. They are caused respectively by strictly intracellular and Gram negative bacterium Chlamydophila abortus (Cp. abortus and Coxiella burnetii (C. burnetii. Chlamydophila pecorum (Cp. pecorum is commonly isolated from the digestive tract of clinically inconspicuous ruminants but the abortive and zoonotic impact of this bacterium is still unknown because Cp. pecorum is rarely suspected in abortion cases of small ruminants. We have developed a multiplex PCR (m-PCR for rapid simultaneous differential detection of Cp. abortus, Cp. pecorum and C. burnetii in clinical samples taken from infected animals. Results Specific PCR primers were designed and a sensitive and specific m-PCR was developed to detect simultaneously, in one tube reaction, three specific fragments of 821, 526 and 687-bp long for Cp. abortus, Cp. pecorum and C. burnetii respectively. This m-PCR assay was performed on 253 clinical samples taken from infected ruminant's flocks that have showed problems of abortion diseases. Thus, 67 samples were infected by either one of the three pathogens: 16 (13 vaginal swabs and 3 placentas were positive for Cp. abortus, 2 were positive for Cp. pecorum (1 vaginal swab and 1 placenta and 49 samples (33 vaginal swabs, 11 raw milks, 4 faeces and 1 placenta were positive for C. burnetii. Two vaginal swabs were m-PCR positive of both Cp. abortus and C. burnetii and none of the tested samples was shown to be infected simultaneously with the three pathogens. Conclusion We have successfully developed a rapid multiplex PCR that can detect and differentiate Cp. abortus, Cp. pecorum and C. burnetii; with a good sensitivity and specificity. The diagnosis of chlamydiosis and Q fever may be greatly simplified and performed at low cost. In addition, the improvement in diagnostic techniques will enhance our knowledge regarding the prevalence and

Sensitivity of nested-PCR for plasmodium detection in pooled whole blood samples and its usefulness to blood donor screening in endemic areas.

Science.gov (United States)

de Freitas, Daniel Roberto Coradi; Gomes, Luciano Teixeira; Fontes, Cor Jesus F; Tauil, Pedro Luiz; Pang, Lorrin W; Duarte, Elisabeth Carmen

2014-04-01

Transfusion-transmitted malaria is a severe disease with high fatality rate. Most Brazilian blood banks in the Amazon region perform malaria screening using microscopic examination (thick smears). Since low parasite concentrations are expected in asymptomatic blood donors a high sensitivity test should be used for donor screening. This study determined the sensitivity of a nested-PCR for plasmodium detection in pooled samples. We performed a one-stage criterion validation study with 21 positive samples pooled with samples from ten negative volunteer until three different concentrations were reached (0.33; 0.25; 0.20 parasites/μL - p/μL). Nested PCR was performed as described by Snounou et al. (1993). Sensitivities (and confidence intervals) were determined by stratum of final parasite concentration on the pooled samples. All samples with parasitemia values of 0.33 and 0.25 p/μL had 100% sensitivity (95%CI=86.3-100). One negative result was obtained from a sample with 0.20 p/μL sensitivity=95.2% (95%CI=76.2-99.9). Compared to parasitemia detectable under ideal conditions of thick smear, this nested-PCR in pooled sample was able to detect 40 times more parasites per microliter. Nested-PCR in pooled samples should be considered as a high sensitive alternative to thick smear for donor screening in blood banks at endemic regions. Local authorities need to assess cost:benefit advantages of this method compared to alternatives. Copyright © 2014 Elsevier Ltd. All rights reserved.

Multiplexing Short Primers for Viral Family PCR

Energy Technology Data Exchange (ETDEWEB)

Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

2008-06-26

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

Polymerase chain reaction and nested-PCR approaches for detecting Cryptosporidium in water catchments of water treatment plants in Curitiba, State of Paraná, Brazil

Directory of Open Access Journals (Sweden)

Silvia Cristina Osaki

2013-06-01

Full Text Available Introduction Cryptosporidium is an important protozoan cause of waterborne disease worldwide of concern to public health authorities. To prevent outbreaks of cryptosporidiosis, the monitoring of this parasite in drinking water is necessary. In the present work, the polymerase chain reaction (PCR and nested-PCR techniques were used to detect Cryptosporidium in raw water from catchment points of four water treatment plants (WTP in Curitiba, Paraná, Brazil. Methods First, DNA extraction techniques were tested in samples containing decreasing amount of oocysts in reagent water, and PCR and nested-PCR with specific primers for 18SSU rDNA of Cryptosporidium were conducted to determine their sensitivity. In reagent water, a commercial extraction kit provided the best analytical sensitivity, and PCR and nested-PCR allowed the detection of five and two oocysts, respectively, with the primers XIAOR/XIAOF and XIAO1F/XIAO2R. Results In the spiking experiments, only the PCR with the primers AWA995F/AWA1206R was successful at detecting concentrations of 0.1 oocysts/mL. Two catchments samples of raw water and/or water sludge from four WTPs were contaminated with Cryptosporidium. Conclusions The application of the techniques to monitor Cryptosporidium in water and detect contamination in water catchments of WTPs in Curitiba are discussed in the present work.

Hemi-transseptal Approach for Pituitary Surgery: A Follow-Up Study

Science.gov (United States)

Fnais, Naif; Maio, Salvatore Di; Edionwe, Susan; Zeitouni, Anthony; Sirhan, Denis; Valdes, Constanza J.; Tewfik, Marc A.

2016-01-01

Objectives The hemi-transseptal (Hemi-T) approach was developed to overcome the potential drawbacks of the nasoseptal flap (NSF) in endoscopic endonasal transsphenoidal skull base surgery. In this study, we describe further refinements on the Hemi-T approach, and report long-term outcomes as compared with traditional methods of skull base reconstruction. Design A retrospective case-control study. Setting Montreal Neurological Institute and Jewish General Hospital, Montreal, Canada. Participants Patients who underwent endoscopic endonasal transsphenoidal approach to skull base pathology. Main Outcome Measures Operative time, CSF rhinorrhea, and postoperative nasal morbidity. Results A total of 105 patients underwent the Hemi-T approach versus 40 controls. Operative time was shorter using the Hemi-T technique (180.51 ± 56.9 vs. 202.9 ± 62 minutes; p = 0.048). The rates of nasal morbidity (septal perforation [5/102 vs. 6/37; p = 0.029] and mucosal adhesion [11/102 vs. 10/39 p = 0.027]), fascia lata harvest (21/100 vs. 18/39; p = 0.0028), and postoperative CSF leak rates (7/100 vs. 9/38; p = 0.006) were lower in the Hemi-T group. Conclusion Advantages of the Hemi-T approach over traditional exposure techniques include preservation of the nasal vascular pedicle, shorter operative time, reduced fascia lata harvest rates, and decreased nasal morbidity. PMID:28321378

Detection of environmental sources of Histoplasma capsulatum in Chiang Mai, Thailand, by nested PCR.

Science.gov (United States)

Norkaew, Treepradab; Ohno, Hideaki; Sriburee, Pojana; Tanabe, Koichi; Tharavichitkul, Prasit; Takarn, Piyawan; Puengchan, Tanpalang; Bumrungsri, Sara; Miyazaki, Yoshitsugu

2013-12-01

Histoplasmosis is a systemic mycosis caused by inhaling spores of Histoplasma capsulatum, a dimorphic fungus. This fungus grows in soil contaminated with bat and avian excreta. Each year, patients with disseminated histoplasmosis have been diagnosed in Chiang Mai, northern Thailand. No published information is currently available on the environmental sources of this fungus in Chiang Mai or anywhere else in Thailand. The aim of this study was to detect H. capsulatum in soil samples contaminated with bat guano and avian droppings by nested PCR. Two hundred and sixty-five samples were collected from the following three sources: soil contaminated with bat guano, 88 samples; soil contaminated with bird droppings, 86 samples; and soil contaminated with chicken droppings, 91 samples. Genomic DNA was directly extracted from each sample, and H. capsulatum was detected by nested PCR using a primer set specific to a gene encoding 100-kDa-like protein (HcI, HcII and HcIII, HcIV). Histoplasma capsulatum was detected in seven of 88 soil samples contaminated with bat guano, one of 21 soil samples contaminated with pigeon droppings and 10 of 91 soil samples contaminated with chicken droppings. The results indicate the possibility of the association of bat guano and chicken droppings with H. capsulatum in this area of Thailand.

Hemi-central retinal artery occlusion in young adults

Directory of Open Access Journals (Sweden)

Rishi Pukhraj

2010-01-01

Full Text Available Amongst the clinical presentations of retinal artery occlusion, hemi-central retinal artery occlusion (Hemi-CRAO is rarely described. This case series of four adults aged between 22 and 36 years attempts to describe the clinical profile, etiology and management of Hemi-CRAO. Case 1 had an artificial mitral valve implant. Polycythemia and malignant hypertension were noted in Case 2. The third patient had Leiden mutation while the fourth patient had Eisenmenger′s syndrome. Clinical examination and fundus fluorescein angiography revealed a bifurcated central retinal artery at emergence from the optic nerve head, in all cases. Color Doppler examination of the central retinal artery confirmed branching of the artery behind the lamina cribrosa. It is hypothesized that bifurcation of central retinal artery behind the lamina cribrosa may predispose these hemi-trunks to develop an acute occlusion if associated with underlying risk factors. The prognosis depends upon arterial recanalisation and etiology of the thromboembolic event.

Isolation and identification of Enterococcus faecalis from necrotic root canals using multiplex PCR.

Science.gov (United States)

Mahmoudpour, Ali; Rahimi, Saeed; Sina, Mahmood; Soroush, Mohammad H; Shahi, Shahriar; Shahisa, Shahriar; Asl-Aminabadi, Naser

2007-09-01

This study was designed to survey the incidence of Enterococcus faecalis infection in symptomatic and asymptomatic root canals of necrotic teeth using PCR and to isolate the bacterium for further screening. Sixty patients categorized according to their clinical symptoms were used for sampling by insertion of paper points into the root canals and absorbing all the fluids present within them. The samples were incubated in 1.0 ml 2xYT (containing 16 g bacto tryptone, 10 g yeast extract and 5.0 g NaCl per liter) for 24 h at 37 degrees C without aeration prior to multiplex PCR analysis. To assist the isolation of E. faecalis, sub-samples were further grown in the same medium supplemented with 6.5% NaCl and back-inoculated into bile esculin. Using multiple cultivation-dependent and PCR analyses, 6 cases (10%) of E. faecalis were identified. Four isolates were obtained from asymptomatic cases of chronic apical periodontitis, and the other two were associated with phoenix abscess and acute apical abscess, respectively. No E. faecalis infection was found in 5 patients with acute apical periodontitis or in 9 with chronic suppurative periodontitis. Our results indicate that there is no significant difference in the incidence of E. faecalis between symptomatic and asymptomatic necrotic dental root canals (P > 0.05).

Detection of Malassezia Species Isolated From Patients With Pityriasis Versicolor and Seborrheic Dermatitis Using Nested-PCR

Directory of Open Access Journals (Sweden)

Zarei Mahmoudabadi

2014-12-01

Full Text Available Background The species of the genus Malassezia are lipophilic and dimorphic yeasts that are regarded as part of the normal flora of the skin of humans and warm-blooded animals. These organisms are the cause of superficial mycosis in humans and other animals, and are common in pityriasis versicolor and seborrheic dermatitis. Objectives The purpose of this study was to determine the frequency of common Malassezia species in patients affected by pityriasis versicolor and seborrheic dermatitis using of the nested PCR method, in the city of Ahvaz. Patients and Methods In the present study, 85 samples from patients with pityriasis versicolor and seborrheic dermatitis were analyzed by the nested-PCR method. During the first stage, the internal transcribed spacer (ITS region from the ribosomal DNA was reproduced using primers ITS4-R and ITS1F-N. During the second stage, the product of the first step was used as DNA and using three special primer pairs, including Mf-F, 5.8SR and M.gl-F, 5.8SR and M.rt-F and M.rt-R, the inner part of the first phase was detected. Results The most common isolate was Malassezia furfur (51.3% followed by M. globosa (35.2% and M. restricta (13.5%. Amongst the 30 patients with seborrheic dermatitis, in 15 cases (65.2% M. restricta, in six cases (26.1% M. globosa and in two cases (8.7% M. furfur was detected and in seven patients no isolate was detected. Conclusions The nested-PCR is a rapid and repeatable method for identification of important Malassezia species and this method is recommended for use on more patients. In addition the most common agents of pityriasis versicolor and seborrheic dermatitis were M. furfur and M. restricta, respectively.

Multiplex real-time PCR assay for detection of Escherichia coli O157:H7 and screening for non-O157 Shiga toxin-producing E. coli.

Science.gov (United States)

Li, Baoguang; Liu, Huanli; Wang, Weimin

2017-11-09

Shiga toxin-producing Escherichia coli (STEC), including E. coli O157:H7, are responsible for numerous foodborne outbreaks annually worldwide. E. coli O157:H7, as well as pathogenic non-O157:H7 STECs, can cause life-threating complications, such as bloody diarrhea (hemolytic colitis) and hemolytic-uremic syndrome (HUS). Previously, we developed a real-time PCR assay to detect E. coli O157:H7 in foods by targeting a unique putative fimbriae protein Z3276. To extend the detection spectrum of the assay, we report a multiplex real-time PCR assay to specifically detect E. coli O157:H7 and screen for non-O157 STEC by targeting Z3276 and Shiga toxin genes (stx1 and stx2). Also, an internal amplification control (IAC) was incorporated into the assay to monitor the amplification efficiency. The multiplex real-time PCR assay was developed using the Life Technology ABI 7500 System platform and the standard chemistry. The optimal amplification mixture of the assay contains 12.5 μl of 2 × Universal Master Mix (Life Technology), 200 nM forward and reverse primers, appropriate concentrations of four probes [(Z3276 (80 nM), stx1 (80 nM), stx2 (20 nM), and IAC (40 nM)], 2 μl of template DNA, and water (to make up to 25 μl in total volume). The amplification conditions of the assay were set as follows: activation of TaqMan at 95 °C for 10 min, then 40 cycles of denaturation at 95 °C for 10 s and annealing/extension at 60 °C for 60 s. The multiplex assay was optimized for amplification conditions. The limit of detection (LOD) for the multiplex assay was determined to be 200 fg of bacterial DNA, which is equivalent to 40 CFU per reaction which is similar to the LOD generated in single targeted PCRs. Inclusivity and exclusivity determinants were performed with 196 bacterial strains. All E. coli O157:H7 (n = 135) were detected as positive and all STEC strains (n = 33) were positive for stx1, or stx2, or stx1 and stx2 (Table 1). No cross reactivity was detected with Salmonella

Novel exon-exon breakpoint in CIC-DUX4 fusion sarcoma identified by anchored multiplex PCR (Archer FusionPlex Sarcoma Panel).

Science.gov (United States)

Loke, Benjamin Nathanael; Lee, Victor Kwan Min; Sudhanshi, Jain; Wong, Meng Kang; Kuick, Chik Hong; Puhaindran, Mark; Chang, Kenneth Tou En

2017-08-01

We describe the clinical and pathological features and novel genetic findings of a case of CIC-DUX4 sarcoma occurring in the thigh of a 35-year-old man. Fusion gene detection using a next-generation sequencing-based anchored multiplex PCR technique (Archer FusionPlex Sarcoma Panel) was used to identify the novel fusion breakpoints of this CIC-DUX4 sarcoma using formalin-fixed and paraffin-embedded tumour material. This CIC-DUX4 sarcoma has a novel fusion breakpoint between exon 20 of the CIC gene and exon 1 of the DUX4 gene. This case report describes an additional case of CIC-DUX4 sarcoma with a novel fusion breakpoint, and demonstrates the value of this next-generation sequencing-based anchored multiplex PCR technique (Archer FusionPlex Sarcoma Panel) in both diagnosis for patient care and in identification of a novel fusion breakpoint in this tumour type. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Development of a multiplex qPCR in real time for quantification and differential diagnosis of Salmonella Gallinarum and Salmonella Pullorum.

Science.gov (United States)

Rubio, Marcela da Silva; Penha Filho, Rafael Antonio Casarin; Almeida, Adriana Maria de; Berchieri, Angelo

2017-12-01

Currently there are 2659 Salmonella serovars. The host-specific biovars Salmonella Pullorum and Salmonella Gallinarum cause systemic infections in food-producing and wild birds. Fast diagnosis is crucial to control the dissemination in avian environments. The present work describes the development of a multiplex qPCR in real time using a low-cost DNA dye (SYBr Green) to identify and quantify these biovars. Primers were chosen based on genomic regions of difference (RoD) and optimized to control dimers. Primers pSGP detect both host-specific biovars but not other serovars and pSG and pSP differentiate biovars. Three amplicons showed different melting temperatures (Tm), allowing differentiation. The pSGP amplicon (97 bp) showed Tm of 78°C for both biovars. The pSG amplicon (273 bp) showed a Tm of 86.2°C for S. Gallinarum and pSP amplicon (260 bp) dissociated at 84.8°C for S. Pullorum identification. The multiplex qPCR in real time showed high sensitivity and was capable of quantifying 10 8 -10 1 CFU of these biovars.

21 CFR 888.3170 - Elbow joint radial (hemi-elbow) polymer prosthesis.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Elbow joint radial (hemi-elbow) polymer prosthesis. 888.3170 Section 888.3170 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... (hemi-elbow) polymer prosthesis. (a) Identification. An elbow joint radial (hemi-elbow) polymer...

One-step multiplex real-time RT-PCR assay for detecting and genotyping wild-type group A rotavirus strains and vaccine strains (Rotarix® and RotaTeq®) in stool samples

Science.gov (United States)

Mijatovic-Rustempasic, Slavica; Esona, Mathew D.; Tam, Ka Ian; Quaye, Osbourne; Bowen, Michael D.

2016-01-01

Background. Group A rotavirus (RVA) infection is the major cause of acute gastroenteritis (AGE) in young children worldwide. Introduction of two live-attenuated rotavirus vaccines, RotaTeq® and Rotarix®, has dramatically reduced RVA associated AGE and mortality in developed as well as in many developing countries. High-throughput methods are needed to genotype rotavirus wild-type strains and to identify vaccine strains in stool samples. Quantitative RT-PCR assays (qRT-PCR) offer several advantages including increased sensitivity, higher throughput, and faster turnaround time. Methods. In this study, a one-step multiplex qRT-PCR assay was developed to detect and genotype wild-type strains and vaccine (Rotarix® and RotaTeq®) rotavirus strains along with an internal processing control (Xeno or MS2 RNA). Real-time RT-PCR assays were designed for VP7 (G1, G2, G3, G4, G9, G12) and VP4 (P[4], P[6] and P[8]) genotypes. The multiplex qRT-PCR assay also included previously published NSP3 qRT-PCR for rotavirus detection and Rotarix® NSP2 and RotaTeq® VP6 qRT-PCRs for detection of Rotarix® and RotaTeq® vaccine strains respectively. The multiplex qRT-PCR assay was validated using 853 sequence confirmed stool samples and 24 lab cultured strains of different rotavirus genotypes. By using thermostable rTth polymerase enzyme, dsRNA denaturation, reverse transcription (RT) and amplification (PCR) steps were performed in single tube by uninterrupted thermocycling profile to reduce chances of sample cross contamination and for rapid generation of results. For quantification, standard curves were generated using dsRNA transcripts derived from RVA gene segments. Results. The VP7 qRT-PCRs exhibited 98.8–100% sensitivity, 99.7–100% specificity, 85–95% efficiency and a limit of detection of 4–60 copies per singleplex reaction. The VP7 qRT-PCRs exhibited 81–92% efficiency and limit of detection of 150–600 copies in multiplex reactions. The VP4 qRT-PCRs exhibited 98.8�

Genotyping canine distemper virus (CDV) by a hemi-nested multiplex PCR provides a rapid approach for investigation of CDV outbreaks

DEFF Research Database (Denmark)

Blixenkrone-Møller, Merete; Martella, Vito

2007-01-01

CDV is a highly contagious viral pathogen causing a lethal systemic disease in dogs and other carnivores. Several lineages or genotypes of CDV exist that are variously distributed throughout several continents. Legal or uncontrolled trading of animals may modify the epidemiology of CDV, introduci...

Comparison of Microscopy, Nested-PCR, and Real-Time-PCR Assays Using High-Throughput Screening of Pooled Samples for Diagnosis of Malaria in Asymptomatic Carriers from Areas of Endemicity in Myanmar

Science.gov (United States)

Wang, Bo; Han, Soe-Soe; Cho, Cho; Han, Jin-Hee; Cheng, Yang; Lee, Seong-Kyun; Galappaththy, Gawrie N. L; Thimasarn, Krongthong; Soe, Myat Thu; Oo, Htet Wai; Kyaw, Myat Phone

2014-01-01

Asymptomatic infection is an important obstacle for controlling disease in countries where malaria is endemic. Because asymptomatic carriers do not seek treatment for their infections, they can have high levels of gametocytes and constitute a reservoir available for new infection. We employed a sample pooling/PCR-based molecular detection strategy for screening malaria infection in residents from areas of Myanmar where malaria is endemic. Blood samples (n = 1,552) were collected from residents in three areas of malaria endemicity (Kayin State, Bago, and Tanintharyi regions) of Myanmar. Two nested PCR and real-time PCR assays showed that asymptomatic infection was detected in about 1.0% to 9.4% of residents from the surveyed areas. The sensitivities of the two nested PCR and real-time PCR techniques were higher than that of microscopy examination (sensitivity, 100% versus 26.4%; kappa values, 0.2 to 0.5). Among the three regions, parasite-positive samples were highly detected in subjects from the Bago and Tanintharyi regions. Active surveillance of residents from regions of intense malaria transmission would reduce the risk of morbidity and mitigate transmission to the population in these areas of endemicity. Our data demonstrate that PCR-based molecular techniques are more efficient than microscopy for nationwide surveillance of malaria in countries where malaria is endemic. PMID:24648557

21 CFR 888.3810 - Wrist joint ulnar (hemi-wrist) polymer prosthesis.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Wrist joint ulnar (hemi-wrist) polymer prosthesis. 888.3810 Section 888.3810 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... (hemi-wrist) polymer prosthesis. (a) Identification. A wrist joint ulnar (hemi-wrist) polymer prosthesis...

21 CFR 888.3730 - Toe joint phalangeal (hemi-toe) polymer prosthesis.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Toe joint phalangeal (hemi-toe) polymer prosthesis. 888.3730 Section 888.3730 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... (hemi-toe) polymer prosthesis. (a) Identification. A toe joint phalangeal (hemi-toe) polymer prosthesis...

Development and validation of a multiplex real-time PCR method to simultaneously detect 47 targets for the identification of genetically modified organisms.

Science.gov (United States)

Cottenet, Geoffrey; Blancpain, Carine; Sonnard, Véronique; Chuah, Poh Fong

2013-08-01

Considering the increase of the total cultivated land area dedicated to genetically modified organisms (GMO), the consumers' perception toward GMO and the need to comply with various local GMO legislations, efficient and accurate analytical methods are needed for their detection and identification. Considered as the gold standard for GMO analysis, the real-time polymerase chain reaction (RTi-PCR) technology was optimised to produce a high-throughput GMO screening method. Based on simultaneous 24 multiplex RTi-PCR running on a ready-to-use 384-well plate, this new procedure allows the detection and identification of 47 targets on seven samples in duplicate. To comply with GMO analytical quality requirements, a negative and a positive control were analysed in parallel. In addition, an internal positive control was also included in each reaction well for the detection of potential PCR inhibition. Tested on non-GM materials, on different GM events and on proficiency test samples, the method offered high specificity and sensitivity with an absolute limit of detection between 1 and 16 copies depending on the target. Easy to use, fast and cost efficient, this multiplex approach fits the purpose of GMO testing laboratories.

A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

Science.gov (United States)

Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

2009-11-01

Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

Multiplex polymerase chain reaction on FTA cards vs. flow cytometry for B-lymphocyte clonality.

Science.gov (United States)

Dictor, Michael; Skogvall, Ingela; Warenholt, Janina; Rambech, Eva

2007-01-01

Two-colour flow cytometry was compared with multiplex PCR with capillary electrophoresis for clonality determination in specific categories of B-cell lymphoma. FTA cards were evaluated for preserving DNA from node imprints and expediting molecular analysis. A single-tube multiplex PCR targeted IGH and lymphoma-specific translocations in DNA extracted from 180 frozen lymphoid tissues and DNA bound to FTA cards from 192 fresh tissues and 137 aspirates. PCR results were compared with flow cytometry in the extracted and aspirated samples. Overall, single-tube multiplex PCR sensitivity was equivalent in the sample groups (intergroup range 79%-91%). False negatives were associated with tumour origin in the follicle centre. Multiplex PCR and flow cytometry were equally sensitive and together detected 98% of B-cell lymphomas. Additional two-tube targeting of IGK suggested an overall molecular sensitivity >90%. False positive (pseudoclonal) single-tube multiplex PCR was associated with necrosis and sparse lymphocytes. Multiplex PCR using template DNA bound to an FTA card effectively detects B-lymphocyte clonality, obviates DNA extraction and refrigeration, and can be used without diminished sensitivity in fine needle aspirates or node imprints as a replacement for or complement to flow cytometry at any point in the diagnostic work-up.

Comparison of real-time SYBR green dengue assay with real-time taqman RT-PCR dengue assay and the conventional nested PCR for diagnosis of primary and secondary dengue infection

Science.gov (United States)

Paudel, Damodar; Jarman, Richard; Limkittikul, Kriengsak; Klungthong, Chonticha; Chamnanchanunt, Supat; Nisalak, Ananda; Gibbons, Robert; Chokejindachai, Watcharee

2011-01-01

Background: Dengue fever and dengue hemorrhagic fever are caused by dengue virus. Dengue infection remains a burning problem of many countries. To diagnose acute dengue in the early phase we improve the low cost, rapid SYBR green real time assay and compared the sensitivity and specificity with real time Taqman® assay and conventional nested PCR assay. Aims: To develop low cost, rapid and reliable real time SYBR green diagnostic dengue assay and compare with Taqman real-time assay and conventional nested PCR (modified Lanciotti). Materials and Methods: Eight cultured virus strains were diluted in tenth dilution down to undetectable level by the PCR to optimize the primer, temperature (annealing, and extension and to detect the limit of detection of the assay. Hundred and ninety three ELISA and PCR proved dengue clinical samples were tested with real time SYBR® Green assay, real time Taqman® assay to compare the sensitivity and specificity. Results: Sensitivity and specificity of real time SYBR® green dengue assay (84% and 66%, respectively) was almost comparable to those (81% and 74%) of Taqman real time PCR dengue assay. Real time SYBR® green RT-PCR was equally sensitive in primary and secondary infection while real time Taqman was less sensitive in the secondary infection. Sensitivity of real time Taqman on DENV3 (87%) was equal to SYBR green real time PCR dengue assay. Conclusion: We developed low cost rapid diagnostic SYBR green dengue assay. Further study is needed to make duplex primer assay for the serotyping of dengue virus. PMID:22363089

Association of carcinoma of the gallbladder with typhoid carriage in a typhoid endemic area using nested PCR.

Science.gov (United States)

Nath, Gopal; Singh, Yogesh Kumar; Kumar, Kailash; Gulati, Anil Kumar; Shukla, Vijay Kumar; Khanna, Ajay Kumar; Tripathi, Sunil Kumar; Jain, Ashok Kumar; Kumar, Mohan; Singh, Tej Bali

2008-08-30

Although well studied the association between chronic typhoid carrier state and carcinoma of the gallbladder (CaGB) remains unproven. The study was performed at a tertiary care medical center in North India and involved 52 patients with CaGB, 223 patients with benign gallbladder diseases, 508 healthy individuals and, 424 corpses. For the detection of Salmonella enterica serovar Typhi, hepatobiliary specimens were subjected to DNA extraction for specific nested- PCR amplification of the S. Typhi flagellin gene. Anti-Vi S. Typhi antibodies were detected in serum samples from patients by indirect haemagglutination. Thirty five of the 52 (67.3%) CaGB patients were PCR-positive for the S. Typhi flagellin gene; significantly higher than for patients with benign gallbladder diseases (95/223, 42.6%; p or = 160) in their serum were 20/52 (38.5%) for CaGB patients, 31/223 (13.9%) for patients with benign gallbladder diseases, and 47/508 (9.2%) for healthy individuals. Specific nested-PCR amplification of the S. Typhi flagellin gene in hepato-biliary specimens was more sensitive for detection of S. Typhi carriage than anti-Vi antibody titres in serum. The results demonstrate an association between typhoid carriage and gallbladder diseases, both CaGB and benign. S. Typhi specific immunosuppression is also suggested in patients with gallbladder diseases.

A multiplex PCR for the simultaneous detection and genotyping of the Echinococcus granulosus complex.

Directory of Open Access Journals (Sweden)

Ghalia Boubaker

Full Text Available Echinococcus granulosus is characterized by high intra-specific variability (genotypes G1-G10 and according to the new molecular phylogeny of the genus Echinococcus, the E. granulosus complex has been divided into E. granulosus sensu stricto (G1-G3, E. equinus (G4, E. ortleppi (G5, and E. canadensis (G6-G10. The molecular characterization of E. granulosus isolates is fundamental to understand the spatio-temporal epidemiology of this complex in many endemic areas with the simultaneous occurrence of different Echinococcus species and genotypes. To simplify the genotyping of the E. granulosus complex we developed a single-tube multiplex PCR (mPCR allowing three levels of discrimination: (i Echinococcus genus, (ii E. granulosus complex in common, and (iii the specific genotype within the E. granulosus complex. The methodology was established with known DNA samples of the different strains/genotypes, confirmed on 42 already genotyped samples (Spain: 22 and Bulgaria: 20 and then successfully applied on 153 unknown samples (Tunisia: 114, Algeria: 26 and Argentina: 13. The sensitivity threshold of the mPCR was found to be 5 ng Echinoccoccus DNA in a mixture of up to 1 µg of foreign DNA and the specificity was 100% when template DNA from closely related members of the genus Taenia was used. Additionally to DNA samples, the mPCR can be carried out directly on boiled hydatid fluid or on alkaline-lysed frozen or fixed protoscoleces, thus avoiding classical DNA extractions. However, when using Echinococcus eggs obtained from fecal samples of infected dogs, the sensitivity of the mPCR was low (<40%. Thus, except for copro analysis, the mPCR described here has a high potential for a worldwide application in large-scale molecular epidemiological studies on the Echinococcus genus.

A nested PCR approach for unambiguous typing of pestiviruses infecting cattle.

Science.gov (United States)

Decaro, Nicola; Sciarretta, Rossana; Lucente, Maria Stella; Mari, Viviana; Amorisco, Francesca; Colaianni, Maria Loredana; Cordioli, Paolo; Parisi, Antonio; Lelli, Rossella; Buonavoglia, Canio

2012-02-01

An atypical pestivirus ('Hobi'-like pestivirus, putative bovine viral diarrhoea 3, BVDV-3) was identified firstly in contaminated foetal calf serum batches and isolated subsequently from an outbreak of respiratory disease in a cattle herd in Italy. The isolation of the novel pestivirus from animals affected clinically posed concerns about the validity of BVDV eradication programs, considering that 'Hobi'-like pestivirus (BVDV-3) is undetected or mistyped by the molecular diagnostic tools currently employed. In this paper, the development of a nested PCR (nPCR) assay for unambiguous typing of all bovine pestiviruses is reported. The assay consisted of a first-round amplification using an oligonucleotide pair which binds to conserved sequences located in the 5' untranslated region and capsid gene, followed by a heminested PCR using virus-specific forward primers. The assay performances were evaluated analytically, showing good sensitivity and specificity. By analysis of 100 BVDV-positive samples typed using a nPCR assay discriminating ruminant pestiviruses, five samples recognised previously as BVDV-2 were not typed when submitted to the new assay (n=2) or reacted as 'Hobi'-like pestivirus BVDV-3 (n=3). Sequence analysis of the first-round amplification products showed that the untyped strains were border disease viruses, whereas the other three strains were true 'Hobi'-like viruses. The development of a molecular assay able to identify simultaneously all bovine pestiviruses known currently will help warrant biosafety of live vaccines and other biological products and assess the molecular epidemiology of 'Hobi'-like pestivirus, thus leading to the improvement of the eradication programs through unambiguous typing of pestiviruses infecting cattle. Copyright © 2011 Elsevier Ltd. All rights reserved.

A new multiplex real-time TaqMan® PCR for quantification of Mycoplasma hyopneumoniae, M. hyorhinis and M. flocculare: Exploratory epidemiological investigations to research mycoplasmal association in enzootic pneumonia-like lesions in slaughtered pigs.

Science.gov (United States)

Fourour, Sarah; Fablet, Christelle; Tocqueville, Véronique; Dorenlor, Virginie; Eono, Florent; Eveno, Eric; Kempf, Isabelle; Marois-Créhan, Corinne

2018-03-30

A new multiplex qPCR targeting Mycoplasma (M.) hyopneumoniae, M. hyorhinis and M. flocculare was developed and the relationship between the detection of those mycoplasma species and the extent of gross pneumonia like lesions in slaughtered pigs lungs were investigated. The multiplex qPCR method targets the p102, p37 and fruA genes and has detection limits of 14, 146, and 16 genome equivalents μl -1 for M. hyopneumoniae, M. hyorhinis and M. flocculare, respectively. In all, 671 lungs were collected and analysed, among them 666 were scored for macroscopic pneumonia and categorized according to the extent of the lesions (no or minor lesions, moderate lesions, and extensive lesions). According to results of multiplex qPCR, 59.5% were positive for M. hyopneumoniae, 3.4% for M. hyorhinis and 34.7% for M. flocculare, with on average, 3.1x10 7 , 9.7x10 6 and 5.7x10 6 genome equivalents of mycoplasma ml -1 , respectively. More results showed that no or minor lesions were associated with multiplex qPCR-negative results or qPCR-positive results for M. flocculare. Moderate to extensive lesions were positively correlated with qPCR-positive results for M. hyopneumoniae. Extensive lesions were associated with qPCR-positive results for at least two mycoplasma species (M. hyopneumoniae and M. hyorhinis). The findings also indicated that M. hyopneumoniae and M. hyorhinis significantly increased the odds for a lung to have macroscopic pneumonia. No relationship was found between the extent of lesions and the mycoplasma genome load. This new multiplex qPCR appears to be specific, sufficiently sensitive and repeatable. The validation of this method with field samples guarantees its use for field epidemiological investigations, particularly to gain more insight into the etiology of the porcine respiratory disease complex. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Combination of microbiological culture and multiplex PCR increases the range of vaginal microorganisms identified in cervical cancer patients at high risk for bacterial vaginosis and vaginitis.

Science.gov (United States)

Schmidt, Katarzyna; Cybulski, Zefiryn; Roszak, Andrzej; Grabiec, Alicja; Talaga, Zofia; Urbański, Bartosz; Odważna, Joanna; Wojciechowicz, Jacek

2015-05-01

Bacterial vaginosis (BV) and vaginitis in cervical cancer patients might becaused by mixed aerobic, anaerobic, and atypical bacteria. Since genital tract infections can be complicated, early and accurate identification of causal pathogens is vital. The purpose of this study was i) to determinate if currently used aerobic culture methods are sufficiently sensitive to identify pathogens that can appear in the cervix of women after cancer treatment; ii) to investigate if molecular methods can improve the diagnostic process of BV and vaginitis, as well as broaden the range of detectable pathogens that would otherwise be difficult to cultivate. A one-year hospital-based study was conducted in 2011/2012. Cervical swabs from 130 patients were examined by microbiological culture and multiplex PCR. Swab samples were positive for 107 and 93 women by microbiological culture and multiplex PCR, respectively The most common bacteria isolated from culture were: Escherichia coli, Enterococcus faecalis, Streptococcus agalactiae, and Staphylococcus aureus, and using the molecular technique were: Gardnerella vaginalis, Bacteroides fragilis, Ureoplasma ureoliticum/parvum, Mobiluncus curtisii and Atopobium vaginae. Multiplex PCR might contribute to the diagnosis of genital tract infections and it broadens the number of detectable microorganisms responsible for BV. Combination of these two methods may become the basis for standardized diagnosis of BV and vaginitis.

Multiplex Real-Time qPCR Assay for Simultaneous and Sensitive Detection of Phytoplasmas in Sesame Plants and Insect Vectors.

Science.gov (United States)

Ikten, Cengiz; Ustun, Rustem; Catal, Mursel; Yol, Engin; Uzun, Bulent

2016-01-01

Phyllody, a destructive and economically important disease worldwide caused by phytoplasma infections, is characterized by the abnormal development of floral structures into stunted leafy parts and contributes to serious losses in crop plants, including sesame (Sesamum indicum L.). Accurate identification, differentiation, and quantification of phyllody-causing phytoplasmas are essential for effective management of this plant disease and for selection of resistant sesame varieties. In this study, a diagnostic multiplex qPCR assay was developed using TaqMan® chemistry based on detection of the 16S ribosomal RNA gene of phytoplasmas and the 18S ribosomal gene of sesame. Phytoplasma and sesame specific primers and probes labeled with different fluorescent dyes were used for simultaneous amplification of 16SrII and 16SrIX phytoplasmas in a single tube. The multiplex real-time qPCR assay allowed accurate detection, differentiation, and quantification of 16SrII and 16SrIX groups in 109 sesame plant and 92 insect vector samples tested. The assay was found to have a detection sensitivity of 1.8 x 102 and 1.6 x 102 DNA copies for absolute quantification of 16SrII and 16SrIX group phytoplasmas, respectively. Relative quantification was effective and reliable for determination of phyllody phytoplasma DNA amounts normalized to sesame DNA in infected plant tissues. The development of this qPCR assay provides a method for the rapid measurement of infection loads to identify resistance levels of sesame genotypes against phyllody phytoplasma disease.

A Multiplex PCR for the Simultaneous Detection and Genotyping of the Echinococcus granulosus Complex

Science.gov (United States)

Boubaker, Ghalia; Macchiaroli, Natalia; Prada, Laura; Cucher, Marcela A.; Rosenzvit, Mara C.; Ziadinov, Iskender; Deplazes, Peter; Saarma, Urmas; Babba, Hamouda; Gottstein, Bruno; Spiliotis, Markus

2013-01-01

Echinococcus granulosus is characterized by high intra-specific variability (genotypes G1–G10) and according to the new molecular phylogeny of the genus Echinococcus, the E. granulosus complex has been divided into E. granulosus sensu stricto (G1–G3), E. equinus (G4), E. ortleppi (G5), and E. canadensis (G6–G10). The molecular characterization of E. granulosus isolates is fundamental to understand the spatio-temporal epidemiology of this complex in many endemic areas with the simultaneous occurrence of different Echinococcus species and genotypes. To simplify the genotyping of the E. granulosus complex we developed a single-tube multiplex PCR (mPCR) allowing three levels of discrimination: (i) Echinococcus genus, (ii) E. granulosus complex in common, and (iii) the specific genotype within the E. granulosus complex. The methodology was established with known DNA samples of the different strains/genotypes, confirmed on 42 already genotyped samples (Spain: 22 and Bulgaria: 20) and then successfully applied on 153 unknown samples (Tunisia: 114, Algeria: 26 and Argentina: 13). The sensitivity threshold of the mPCR was found to be 5 ng Echinoccoccus DNA in a mixture of up to 1 µg of foreign DNA and the specificity was 100% when template DNA from closely related members of the genus Taenia was used. Additionally to DNA samples, the mPCR can be carried out directly on boiled hydatid fluid or on alkaline-lysed frozen or fixed protoscoleces, thus avoiding classical DNA extractions. However, when using Echinococcus eggs obtained from fecal samples of infected dogs, the sensitivity of the mPCR was low (Echinococcus genus. PMID:23350011

A multiplex PCR for the simultaneous detection and genotyping of the Echinococcus granulosus complex.

Science.gov (United States)

Boubaker, Ghalia; Macchiaroli, Natalia; Prada, Laura; Cucher, Marcela A; Rosenzvit, Mara C; Ziadinov, Iskender; Deplazes, Peter; Saarma, Urmas; Babba, Hamouda; Gottstein, Bruno; Spiliotis, Markus

2013-01-01

Echinococcus granulosus is characterized by high intra-specific variability (genotypes G1-G10) and according to the new molecular phylogeny of the genus Echinococcus, the E. granulosus complex has been divided into E. granulosus sensu stricto (G1-G3), E. equinus (G4), E. ortleppi (G5), and E. canadensis (G6-G10). The molecular characterization of E. granulosus isolates is fundamental to understand the spatio-temporal epidemiology of this complex in many endemic areas with the simultaneous occurrence of different Echinococcus species and genotypes. To simplify the genotyping of the E. granulosus complex we developed a single-tube multiplex PCR (mPCR) allowing three levels of discrimination: (i) Echinococcus genus, (ii) E. granulosus complex in common, and (iii) the specific genotype within the E. granulosus complex. The methodology was established with known DNA samples of the different strains/genotypes, confirmed on 42 already genotyped samples (Spain: 22 and Bulgaria: 20) and then successfully applied on 153 unknown samples (Tunisia: 114, Algeria: 26 and Argentina: 13). The sensitivity threshold of the mPCR was found to be 5 ng Echinoccoccus DNA in a mixture of up to 1 µg of foreign DNA and the specificity was 100% when template DNA from closely related members of the genus Taenia was used. Additionally to DNA samples, the mPCR can be carried out directly on boiled hydatid fluid or on alkaline-lysed frozen or fixed protoscoleces, thus avoiding classical DNA extractions. However, when using Echinococcus eggs obtained from fecal samples of infected dogs, the sensitivity of the mPCR was low (Echinococcus genus.

A multiplex PCR method for rapid identification of Brachionus rotifers.

Science.gov (United States)

Vasileiadou, Kalliopi; Papakostas, Spiros; Triantafyllidis, Alexander; Kappas, Ilias; Abatzopoulos, Theodore J

2009-01-01

Cryptic species are increasingly being recognized in many organisms. In Brachionus rotifers, many morphologically similar yet genetically distinct species/biotypes have been described. A number of Brachionus cryptic species have been recognized among hatchery strains. In this study, we present a simple, one-step genetic method to detect the presence of those Brachionus sp. rotifers that have been found in hatcheries. With the proposed technique, each of the B. plicatilis sensu stricto, B. ibericus, Brachionus sp. Nevada, Brachionus sp. Austria, Brachionus sp. Manjavacas, and Brachionus sp. Cayman species and/or biotypes can be identified with polymerase chain reaction (PCR) analysis. Based on 233 cytochrome c oxidase subunit I sequences, we reviewed all the available cryptic Brachionus sp. genetic polymorphisms, and we designed six nested primers. With these primers, a specific amplicon of distinct size is produced for every one of the involved species/biotypes. Two highly sensitive protocols were developed for using the primers. Many of the primers can be combined in the same PCR. The proposed method has been found to be an effective and practical tool to investigate the presence of the above six cryptic species/biotypes in both individual and communal (bulk) rotifer deoxyribonucleic acid extractions from hatcheries. With this technique, hatchery managers could easily determine their rotifer composition at the level of cryptic species and monitor their cultures more efficiently.

One-Step Multiplex RT-qPCR Assay for the detection of Peste des petits ruminants virus, Capripoxvirus, Pasteurella multocida and Mycoplasma capricolum subspecies (ssp.) capripneumoniae

International Nuclear Information System (INIS)

Settypalli, T.B.K.; Lamien, C.; Spergser, J.; Lelenta, M.; Wade, A.; Gelaye, E.; Loitsch, A.; Minoungou, G.; Thiaucourt, F.; Diallo, A.

2016-01-01

Full text: Respiratory infections, although showing common clinical symptoms like pneumonia, are caused by bacterial, viral or parasitic agents. These are often reported in sheep and goats populations and cause huge economic losses to the animal owners in developing countries. Detection of these diseases is routinely done using ELISA or microbiological methods which are being reinforced or replaced by molecular based detection methods including multiplex assays, where detection of different pathogens is carried out in a single reaction. In the present study, a one-step multiplex RT-qPCR assay was developed for simultaneous detection of Capripoxvirus (CaPV), Peste de petits ruminants virus (PPRV), Pasteurella multocida (PM) and Mycoplasma capricolum ssp. capripneumonia (Mccp) in pathological samples collected from small ruminants with respiratory disease symptoms. The test performed efficiently without any cross-amplification. The multiplex PCR efficiency was 98.31%, 95.48%, 102.77% and 91.46% whereas the singleplex efficiency was 93.43%, 98.82%, 102.55% and 92.0% for CaPV, PPRV, PM and Mccp, respectively. The correlation coefficient was greater than 0.99 for all the targets in both multiplex and singleplex. Based on cycle threshold values, intra and inter assay variability, ranged between the limits of 2%–4%, except for lower concentrations of Mccp. The detection limits at 95% confidence interval (CI) were 12, 163, 13 and 23 copies/reaction for CaPV, PPRV, PM and Mccp, respectively. The multiplex assay was able to detect CaPVs from all genotypes, PPRV from the four lineages, PM and Mccp without amplifying the other subspecies of mycoplasmas. The discriminating power of the assay was proven by accurate detection of the targeted pathogen (s) by screening 58 viral and bacterial isolates representing all four targeted pathogens. Furthermore, by screening 81 pathological samples collected from small ruminants showing respiratory disease symptoms, CaPV was detected in

One-Step Multiplex RT-qPCR Assay for the Detection of Peste des petits ruminants virus, Capripoxvirus, Pasteurella multocida and Mycoplasma capricolum subspecies (ssp. capripneumoniae.

Directory of Open Access Journals (Sweden)

Tirumala Bharani Kumar Settypalli

Full Text Available Respiratory infections, although showing common clinical symptoms like pneumonia, are caused by bacterial, viral or parasitic agents. These are often reported in sheep and goats populations and cause huge economic losses to the animal owners in developing countries. Detection of these diseases is routinely done using ELISA or microbiological methods which are being reinforced or replaced by molecular based detection methods including multiplex assays, where detection of different pathogens is carried out in a single reaction. In the present study, a one-step multiplex RT-qPCR assay was developed for simultaneous detection of Capripoxvirus (CaPV, Peste de petits ruminants virus (PPRV, Pasteurella multocida (PM and Mycoplasma capricolum ssp. capripneumonia (Mccp in pathological samples collected from small ruminants with respiratory disease symptoms. The test performed efficiently without any cross-amplification. The multiplex PCR efficiency was 98.31%, 95.48%, 102.77% and 91.46% whereas the singleplex efficiency was 93.43%, 98.82%, 102.55% and 92.0% for CaPV, PPRV, PM and Mccp, respectively. The correlation coefficient was greater than 0.99 for all the targets in both multiplex and singleplex. Based on cycle threshold values, intra and inter assay variability, ranged between the limits of 2%-4%, except for lower concentrations of Mccp. The detection limits at 95% confidence interval (CI were 12, 163, 13 and 23 copies/reaction for CaPV, PPRV, PM and Mccp, respectively. The multiplex assay was able to detect CaPVs from all genotypes, PPRV from the four lineages, PM and Mccp without amplifying the other subspecies of mycoplasmas. The discriminating power of the assay was proven by accurate detection of the targeted pathogen (s by screening 58 viral and bacterial isolates representing all four targeted pathogens. Furthermore, by screening 81 pathological samples collected from small ruminants showing respiratory disease symptoms, CaPV was detected in

Performance of nested RT-PCR on CSF for tuberculous meningitis diagnosis in HIV-infected patients.

Science.gov (United States)

Gualberto, F A S; Gonçalves, M G; Fukasawa, L O; Santos, A M Ramos Dos; Sacchi, C T; Harrison, L H; Boulware, D R; Vidal, J E

2017-10-01

Timely diagnosis of tuberculous meningitis (TBM) in patients with human immunodeficiency virus (HIV) infection remains a challenge. Despite the current scale-up of the Xpert® MTB/RIF assay, other molecular diagnostic tools are necessary, particularly in referral centres in low- and middle-income countries without Xpert testing. To determine the diagnostic performance of nested real-time polymerase chain reaction (nRT-PCR) in HIV-infected TBM patients categorised according to standardised clinical case definitions. Based on clinical, laboratory and imaging data, HIV-infected patients with suspected TBM were prospectively categorised as 'definite TBM', 'probable TBM', 'possible TBM' or 'not TBM'. We evaluated nRT-PCR sensitivity and specificity in diagnosing TBM among definite TBM cases, and among definite + probable TBM cases. Ninety-two participants were enrolled in the study. nRT-PCR sensitivity for definite TBM (n = 8) was 100% (95%CI 67-100) and 86% (95%CI 60-96) for both definite and probable TBM (n = 6). Assuming that 'not TBM' patients (n = 74) were true-negatives, nRT-PCR specificity was 100% (95%CI 95-100). The possible TBM group (n = 4) had no nRT-PCR positives. The nRT-PCR is a useful rule-in test for HIV-infected patients with TBM according to international consensus case definitions. As nRT-PCR cannot exclude TBM, studies comparing and combining nRT-PCR with other assays are necessary for a rule-out test.

Detection of Mycoplasma hyopneumoniae by ELISA and nested PCR from blood samples and nasal swabs from pigs in Slovakia

Directory of Open Access Journals (Sweden)

Marián Prokeš

2012-01-01

Full Text Available The aim of our study was to map the situation of swine mycoplasmoses on four farms in the region of Eastern Slovakia. The primary agent of Enzootic pneumonia of swine is Mycoplasma hyopneumoniae. After reviewing the health status of conventional herds and evaluation of clinical symptoms, paired samples of nasal swabs and venous blood samples were collected from 38 pigs with clinical signs of respiratory disease. Nasal swab samples were tested by nested PCR, while blood samples were used to detect antibodies against M. hyopneumoniae by blocking ELISA. The presence of M. hyopneumoniae was confirmed by nested PCR in four pigs (10.5% and by blocking ELISA in 16 pigs (42.1% of all four farms. This work presents for the first time comparison of different methods to diagnose M. hyopneumoniae infection on pig farms in Eastern Slovakia.

Comparison of Antigen Detection and Nested PCR in CSF Samples of HIV Positive and Negative Patients with Suspected Cryptococcal Meningitis in a Tertiary Care Hospital.

Science.gov (United States)

Kumari, Sunita; Verma, Rajesh Kumar; Singh, Dharmendra Prasad; Yadav, Ramakant

2016-04-01

The cases of cryptococcal meningitis and other forms of cryptococcosis have increased in recent time and the present scenario of the condition with significant morbidity and mortality is actually posing a serious threat to the community, so an early and prompt diagnosis is necessary to prevent serious complications and thus improving the overall disease outcome. Comparison of diagnostic efficacy of nested Polymerase Chain Reaction (PCR) with Latex Agglutination Test (LAT) in the Cerebro Spinal Fluid (CSF) samples of the cases of meningitis in HIV positive and negative cases. We have compared the diagnostic efficacy of Latex Agglutination Test (LAT) with nested Polymerase Chain Reaction (PCR) in 200 Cerebrospinal Fluid (CSF) samples, including 14 HIV positive also, in the cases of suspected cryptococcal meningitis. Nested PCR was done in all cases reporting positive by LAT and results were then compared with that of India ink and culture on Sabouraud Dextrose Agar (SDA), and the isolates were further identified by urease, nitrate and sugar assimilation tests. Of the 200 cases, including 14 HIV positive, LAT was positive in 46 cases while 154 were negative. Out of these 46 LAT positive cases, nested PCR was positive in 40 cases only, while culture and India ink was positive in 38 and 33 cases respectively. Majority of the cases, 30 (65.2%) were between age group 21-50 years, while 2 (4.3%) in 0-20, and 14 (30.4%) in 51-80 years age group. Although negative staining like India ink and nigrosin are most widely used techniques, but these suffer with subjective error. Rapid method like LAT is available but it always has the scope of false positive and negative results. In such cases nested PCR can help in establishing final diagnosis.

Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

Science.gov (United States)

Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

2004-10-15

This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

21 CFR 888.3400 - Hip joint femoral (hemi-hip) metallic resurfacing prosthesis.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Hip joint femoral (hemi-hip) metallic resurfacing... HUMAN SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3400 Hip joint femoral (hemi-hip) metallic resurfacing prosthesis. (a) Identification. A hip joint femoral (hemi-hip...

21 CFR 888.3370 - Hip joint (hemi-hip) acetabular metal cemented prosthesis.